Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Amrita [Department of Chemistry, University of Calcutta, 92, A. P. C. Road, Kolkata 700009 (India); Kar, Samiran [Department of Organic Chemistry, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700 032 (India); Guchhait, Nikhil [Department of Chemistry, University of Calcutta, 92, A. P. C. Road, Kolkata 700009 (India)], E-mail: nikhilg@postmark.net
2006-01-05
The photophysical behaviour of trans-methyl p-(dimethylamino) cinnamate (t-MDMAC) donor-acceptor system has been investigated by steady-state absorption and emission spectroscopy and quantum chemical calculations. The molecule t-MDMAC shows an emission from the locally excited state in non-polar solvents. In addition to weak local emission, a strong solvent dependent red shifted fluorescence in polar aprotic solvents is attributed to highly polar intramolecular charge transfer state. However, the formation of hydrogen-bonded clusters with polar protic solvents has been suggested from a linear correlation between the observed red shifted fluorescence band maxima with hydrogen bonding parameters ({alpha}). Calculations by ab initio and density functional theory show that the lone pair electron at nitrogen center is out of plane of the benzene ring in the global minimum ground state structure. In the gas phase, a potential energy surface along the twist coordinate at the donor (-NMe{sub 2}) and acceptor (-CH = CHCOOMe) sites shows stabilization of S{sub 1} state and destabilization S{sub 2} and S{sub 0} states. A similar potential energy calculation along the twist coordinate in acetonitrile solvent using non-equilibrium polarized continuum model also shows more stabilization of S{sub 1} state relative to other states and supports solvent dependent red shifted emission properties. In all types of calculations it is found that the nitrogen lone pair is delocalized over the benzene ring in the global minimum ground state and is localized on the nitrogen centre at the 90 deg. twisted configuration. The S{sub 1} energy state stabilization along the twist coordinate at the donor site and localized nitrogen lone pair at the perpendicular configuration support well the observed dual fluorescence in terms of proposed twisted intramolecular charge transfer (TICT) model.
Structural modification of trans-cinnamic acid using Colletotrichum acutatum
Velasco B., Rodrigo; Gil G., Jesús H.; García P., Carlos M.; Durango R., Diego L.
2012-01-01
The biotransformation of trans-cinnamic acid by whole cells of the Colombian native phytopathogenic fungus Colletotrichum acutatum was studied. Initially, fungitoxicity of this compound against C. acutatum was evaluated; trans-cinnamic acid exhibited a moderate to weak toxicity against the microorganism and apparently a detoxification mechanism was present. Then, in order to study such mechanism and explore the capacity of this fungus to biotransform trans-cinnamic acid into value-added produ...
Gottardi, Manuela; Grün, Peter; Bode, Helge B; Hoffmann, Thomas; Schwab, Wilfried; Oreb, Mislav; Boles, Eckhard
2017-12-01
Trans-cinnamic acid (tCA) and hydrocinnamyl alcohol (HcinOH) are valuable aromatic compounds with applications in the flavour, fragrance and cosmetic industry. They can be produced with recombinant yeasts from sugars via phenylalanine after expression of a phenylalanine ammonia lyase (PAL) and an aryl carboxylic acid reductase. Here, we show that in Saccharomyces cerevisiae a PAL enzyme from the bacterium Photorhabdus luminescens was superior to a previously used plant PAL enzyme for the production of tCA. Moreover, after expression of a UDP-glucose:cinnamate glucosyltransferase (FaGT2) from Fragaria x ananassa, tCA could be converted to cinnamoyl-D-glucose which is expected to be less toxic to the yeast cells. Production of tCA and HcinOH from glucose could be increased by eliminating feedback-regulated steps of aromatic amino acid biosynthesis and diminishing the decarboxylation step of the competing Ehrlich pathway. Finally, an unknown by-product resulting from further metabolisation of a carboligation product of cinnamaldehyde (cinALD) with activated acetaldehyde, mediated by pyruvate decarboxylases, could be identified as cinnamyl methyl ketone providing a new route for the biosynthesis of precursors, such as (2S,3R) 5-phenylpent-4-ene-2,3-diol, necessary for the chemical synthesis of specific biologically active drugs such as daunomycin. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Kumar, Ritesh; Vashisth, Divya; Misra, Amita; Akhtar, Md Qussen; Jalil, Syed Uzma; Shanker, Karuna; Gupta, Madan Mohan; Rout, Prashant Kumar; Gupta, Anil Kumar; Shasany, Ajit Kumar
2016-05-25
Cinnamate-4-hydroxylase (C4H) converts trans-cinnamic acid (CA) to p-coumaric acid (COA) in the phenylpropanoid/lignin biosynthesis pathway. Earlier we reported increased expression of AaCYP71AV1 (an important gene of artemisinin biosynthesis pathway) caused by CA treatment in Artemisia annua. Hence, AaC4H gene was identified, cloned, characterized and silenced in A. annua with the assumption that the elevated internal CA due to knock down may increase the artemisinin yield. Accumulation of trans-cinnamic acid in the plant due to AaC4H knockdown was accompanied with the reduction of p-coumaric acid, total phenolics, anthocyanin, cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia lyase (PAL) activities but increase in salicylic acid (SA) and artemisinin. Interestingly, feeding trans-cinnamic acid to the RNAi line increased the level of artemisinin along with benzoic (BA) and SA with no effect on the downstream metabolites p-coumaric acid, coniferylaldehyde and sinapaldehyde, whereas p-coumaric acid feeding increased the content of downstream coniferylaldehyde and sinapaldehyde with no effect on BA, SA, trans-cinnamic acid or artemisinin. SA is reported earlier to be inducing the artemisinin yield. This report demonstrates the link between the phenylpropanoid/lignin pathway with artemisinin pathway through SA, triggered by accumulation of trans-cinnamic acid because of the blockage at C4H.
2013-05-29
... study showed no treatment- related effects on mating or fertility. There were no treatment-related... a petition to EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), requesting establishment... received and the nature of the adverse effects caused by methyl 5-(dimethylamino)-2-methyl-5- oxopentanoate...
Directory of Open Access Journals (Sweden)
Rajendra Chandra Padalia
2017-03-01
Full Text Available The essential oils obtained from hydrodistillation of Ocimum basilicum L. harvested at four different growth stages during spring-summer and rain-autumn cropping seasons , were characterized using GC and GC-MS. The e ssential oil yield was found to vary from 0.28–0.32% and 0.40–0.52% during spring-summer and rain-autumn cropping season, respectively with its maximal at full bloom stage. Altogether , forty constituents, comprising 94.9–98.3% were identified represented by ( E -methyl cinnamate (36.6 – 66.4%, linalool (11.2 – 43.8%, and (Z -methyl cinnamate (5.4-7.6% as main constituents. Results showed that growth stages strongly influenced the chemical composition of the essential oil in two cropping seasons, particularly concerning to the content of ( E -methyl cinnamate and linalool. Seed setting stage was optimized for harvesting ( E -methyl cinnamate rich oil (66.4% in rain-winter cropping season. The antimicrobial potential of the essential oil was tested againist eight pathogenic bacteria and three fungal strains. Antimicrobial assay showed that the essential oil possessed good antibacterial activity against Streptococcus mutans, Staphylococcus epidermidis, Escherichia coli , and antifungal activity against Candida kefyr and Candida albicans. Ocimum basilicum , essential oil, ( E - methyl cinnamate, linalool, antibacterial activity, antifungal activity
Chan, Jeannine; Oshiro, Tyler; Thomas, Sarah; Higa, Allyson; Black, Stephen; Todorovic, Aleksandar; Elbarbry, Fawzy; Harrelson, John P.
2016-01-01
Human exposure to trans-cinnamic aldehyde [t-CA; cinnamaldehyde; cinnamal; (E)-3-phenylprop-2-enal] is common through diet and through the use of cinnamon powder for diabetes and to provide flavor and scent in commercial products. We evaluated the likelihood of t-CA to influence metabolism by inhibition of P450 enzymes. IC50 values from recombinant enzymes indicated that an interaction is most probable for CYP2A6 (IC50 = 6.1 ?M). t-CA was 10.5-fold more selective for human CYP2A6 than for CYP...
Trans-methylation reactions in plants: focus on the activated methyl cycle.
Rahikainen, Moona; Alegre, Sara; Trotta, Andrea; Pascual, Jesús; Kangasjärvi, Saijaliisa
2018-02-01
Trans-methylation reactions are vital in basic metabolism, epigenetic regulation, RNA metabolism, and posttranslational control of protein function and therefore fundamental in determining the physiological processes in all living organisms. The plant kingdom is additionally characterized by the production of secondary metabolites that undergo specific hydroxylation, oxidation and methylation reactions to obtain a wide array of different chemical structures. Increasing research efforts have started to reveal the enzymatic pathways underlying the biosynthesis of complex metabolites in plants. Further engineering of these enzymatic machineries offers significant possibilities in the development of bio-based technologies, but necessitates deep understanding of their potential metabolic and regulatory interactions. Trans-methylation reactions are tightly coupled with the so-called activated methyl cycle (AMC), an essential metabolic circuit that maintains the trans-methylation capacity in all living cells. Tight regulation of the AMC is crucial in ensuring accurate trans-methylation reactions in different subcellular compartments, cell types, developmental stages and environmental conditions. This review addresses the organization and posttranslational regulation of the AMC and elaborates its critical role in determining metabolic regulation through modulation of methyl utilization in stress-exposed plants. © 2017 Scandinavian Plant Physiology Society.
Ebata, Takayuki
2017-06-01
The nonraddiative dececy route involving trans → cis photo-isomerization from the S_1 (ππ*) state has been investigated for several trans-cinnamate derivatives, which are known as sunscreen reagents. We examined two types of substitution effects. One is structural isomer such as ortho-, meta-, and para-hydroxy-methylcinnmate (o-, m-, p-HMC). The S_1 lifetime of p-HMC is less than 8 ps at zero-point level, and it undergoes rapid S_1 → ^1nπ* → T_1 decay via multiple conical intersections. Finally, the trans → cis isomerization proceeds in the T_1 state. On the other hand, both o- and m-HMC show very slow decay. Their S_1 lifetimes are in the order of 100 ps even at the excess energy of 2000-3000 \\wn. The other is the effect of the complexity of ester group in para-subsitituted species, such as para-methoxy-methyl, -ethyl and -2ethylhexyl cinnamate (p-MMC, p-MEC, p-M2EHC). p-MMC and p-MEC show sharp S_0 → S_1 (ππ*) vibronic bands, while p-M2EHC shows only broad structureless feature even under the jet-cooled condition. In addition, we found that the S_0 → ^1nπ* absorption appears at 1000 \\wn below the S_0 → S_1 (ππ*) transition in p-MEC and p-M2EHC, but not in p-MMC. Thus, the complexity of the ester group is very important for the appearance of the ^1nπ* state.
Kumar, Ritesh; Vashisth, Divya; Misra, Amita; Akhtar, Md Qussen; Jalil, Syed Uzma; Shanker, Karuna; Gupta, Madan Mohan; Rout, Prashant Kumar; Gupta, Anil Kumar; Shasany, Ajit Kumar
2016-01-01
Cinnamate-4-hydroxylase (C4H) converts trans-cinnamic acid (CA) to p-coumaric acid (COA) in the phenylpropanoid/lignin biosynthesis pathway. Earlier we reported increased expression of AaCYP71AV1 (an important gene of artemisinin biosynthesis pathway) caused by CA treatment in Artemisia annua. Hence, AaC4H gene was identified, cloned, characterized and silenced in A. annua with the assumption that the elevated internal CA due to knock down may increase the artemisinin yield. Accumulation of t...
Energy Technology Data Exchange (ETDEWEB)
Meyer, M.; Mialocq, J.C.; Perly, B. (CNRS, Gif-sur-Yvette (France))
1990-01-11
The photoexcitation of 4-(dicyanomethylene)-2-methyl-6-(p-(dimethylamino)styryl)-4H-pyran (DCM) induces a large intramolecular charge transfer (ICT) from the dimethylamino electron-donor group to the dicyanomethylene acceptor group. The dramatic effect of the solvent polarity on the absorption and fluorescence spectra on the one hand and the competition between the nonradiative S{sub 1} {yields} S{sub 0} deactivation and trans {yields} cis isomerization processes on the other hand has been examined. Our results clearly show that DCM isomerization efficiency is very low in the more polar solvents. The S{sub 1} {yields} S{sub 0} internal conversion may intervene at a torsional angle smaller than 90{degree} before reaching the perpendicular configuration.
Synthesis of racemic [methyl-d3]-labeled cis- and trans-3'-hydroxycotinine
International Nuclear Information System (INIS)
Ravard, A.; Crooks, P.A.
1994-01-01
A method is described for the synthesis of the racemic [methyl-d 3 ] forms of the nicotine metabolites cis-3'-hydroxycotinine and trans-3'-hydroxycotinine. The key intermediate was [methyl-d 3 ]-N-methylhydroxylamine, obtained from a selective hydrogenation of d 3 -nitro-methane. This intermediate was converted to [methyl-d 3 ]-α-3-pyridyl-N-methylnitrone, which was condensed with methyl acrylate to give a mixture of isomeric isoxazolidines. The hydrogenolysis of this mixture afforded a 70:30 mixture of [methyl-d 3 ] cis- and trans-3'-hydroxycotinine, from which the pure cis-isomer could be isolated by recrystallization from acetone. [Methyl-d 3 ]-trans-3'-hydroxycotinine could be prepared in high yield from the cis-isomer via chiral inversion utilizing a Mitsunobu reaction, or by chromatographic separation from a mixture of the cis- and trans-3'-benzoyloxycotinine, followed by O-debenzoylation in methanolic NaOH. (author)
Preparation and Characterization of InP/Poly(methyl methacrylate) Nanocomposite Films.
Kwon, Younghoon; Kim, Jongsung
2017-04-01
Quantum dots (QDs) are nanocrystalline semiconductors with many unusual optical properties. They exhibit very high fluorescence intensities and possess exceptional stability against photo-bleaching. In this study, we report the preparation of InP QDs-poly(methyl methacrylate) (PMMA) hybrids by fabricating QDs via a thermal decomposition reaction, followed by radical polymerization. The InP QDs were synthesized using indium(III) chloride and tris(dimethylamino)phosphine. Flexible composite films were obtained by radical polymerization using methyl methacrylate (MMA) as the monomer and 2,2′-azobis(2-methylpropionitrile) (AIBN) as a radical initiator. The PL intensity of the QDs was lowered upon composite formation with PMMA. However, the composites exhibited higher thermal stability than pure PMMA.
International Nuclear Information System (INIS)
Alves, C.N.; Camilo, F.F.; Gruber, J.; Silva, A.B.F. da
2004-01-01
The molecular mechanism of the Diels-Alder reaction between (E)-methyl cinnamate and cyclopentadiene has been characterized by means of density functional theory method at the B3LYP/6-31G* theory level. Stationary points for two reactive channels, endo-cis and exo-cis, on potential energy surfaces, have been characterized. Three Lewis acids, boron trifluoride (BF 3 ), aluminum trichloride (AlCl 3 ) and catechol boron bromide (CBB), have been used as catalysts taking into account the formation of a complex between the boron or aluminum atom and the carbonyl oxygen of (E)-methyl cinnamate. The molecular mechanism of the uncatalyzed reaction corresponds to a concerted process. In the presence of BF 3 and AlCl 3 , enhancement of both the asynchronicity and charge transfer between diene and the dienophile, with small decreased energy barriers, were obtained. With CBB, the molecular mechanism changes and the reaction takes place along a stepwise mechanism. The inclusion of the CBB catalyst drastically decreases the energy barrier associated with the carbon-carbon bond formation of the first step relative to the concerted process. The results obtained in this work are compared with experimental data and AM1 semiempirical calculation
Salmahaminati; Azis, Muhlas Abdul; Purwiandono, Gani; Arsyik Kurniawan, Muhammad; Rubiyanto, Dwiarso; Darmawan, Arif
2017-11-01
In this research, modeling several alkyl p-methoxy cinnamate (APMC) based on electronic transition by using semiempirical mechanical quantum ZINDO/s calculation is performed. Alkyl cinnamates of C1 (methyl) up to C7 (heptyl) homolog with 1-5 example structures of each homolog are used as materials. Quantum chemistry-package software Hyperchem 8.0 is used to simulate the drawing of the structure, geometry optimization by a semiempirical Austin Model 1 algorithm and single point calculation employing a semiempirical ZINDO/s technique. ZINDO/s calculations use a defined criteria that singly excited -Configuration Interaction (CI) where a gap of HOMO-LUMO energy transition and maximum degeneracy level are 7 and 2, respectively. Moreover, analysis of the theoretical spectra is focused on the UV-B (290-320 nm) and UV-C (200-290 nm) area. The results show that modeling of the compound can be used to predict the type of UV protection activity depends on the electronic transition in the UV area. Modification of the alkyl homolog relatively does not change the value of wavelength absorption to indicate the UV protection activity. Alkyl cinnamate compounds are predicted as UV-B and UV-C sunscreen.
International Nuclear Information System (INIS)
Lee, Jong Woo; Kim, Hak Won; Kim, Hong Doo
2001-01-01
Photocyclizable poly(cinnam-4'-yl methyl methacrylate) derivatives bearing methoxy benzene (PMCMMA), anthracene (PACMMA), and coumarin (PCCMMMA) have been synthesized via Heck type reaction. Three different types of polymers are photoreactable using linearly polarized UV light and applicable as liquid crystal alignment layer. Anthracene and coumarin containing polymers (PACMMA, PCCMMA) have better thermal stability than PMCMMA. This observation may be attributed to the glass transition temperature elevation due to the bulky size and another photocrosslinking site provided by anthracene or coumarin group
Jastrzebski, J.T.B.H.; Arink, A.M.; Kleijn, H.; Braam, T.W.; Lutz, M.; Spek, A.L.; van Koten, G.
2013-01-01
Regioselectivity is an important aspect in the design of organic protocols involving Directed ortho-Lithiation (DoL) of arenes, in particular with those arenes containing heteroatom substituents as directing groups. The DoL of 2-[(dimethylamino)methyl]naphthalene (dman) that proceeds with low
Production of cinnamic and p-hydroxycinnamic acids in engineered microbes
Directory of Open Access Journals (Sweden)
Alejandra eVargas-Tah
2015-08-01
Full Text Available The aromatic compounds cinnamic and p-hydroxycinnamic acids are phenylpropanoids having applications as precursors for the synthesis of thermoplastics, flavoring, cosmetic and health products. These two aromatic acids can be obtained by chemical synthesis or extraction from plant tissues. However, both manufacturing processes have shortcomings such as the generation of toxic subproducts or a low concentration in plant material. Alternative production methods are being developed to enable the biotechnological production of cinnamic and p-hydroxycinnamic acids by genetically engineering various microbial hosts, including Escherichia coli, Saccharomyces cerevisiae, Pseudomonas putida and Streptomyces lividans. The natural capacity to synthesize these aromatic acids is not existent in these microbial species. Therefore, genetic modification have been performed that include the heterologous expression of genes encoding phenylalanine ammonia-lyase and tyrosine ammonia-lyase activities, which catalyze the conversion of L-phenylalanine and L-tyrosine to cinnamic acid and p-hydroxycinnamic acid, respectively. Additional host modifications include the metabolic engineering to increase carbon flow from central metabolism to the L-phenylalanine or L-tyrosine biosynthetic pathways. These strategies include the expression of feedback insensitive mutant versions of enzymes from the aromatic pathways, as well as genetic modifications to central carbon metabolism to increase biosynthetic availability of precursors phosphoenolpyruvate and erythrose-4-phosphate. These efforts have been complemented with strain optimization for the utilization of raw material, including various simple carbon sources, as well as sugar polymers and sugar mixtures derived from plant biomass. A systems biology approach to production strains characterization has been limited so far and should yield important data for future strain improvement.
International Nuclear Information System (INIS)
Oya, Shunichi; Choi, Seok-Rye; Kung, Mei-Ping; Kung, Hank F.
2007-01-01
Two novel ligands with 4' substitution on the Phenyl Ring B of biphenylthiol, 5-chloro-2-(2'-((dimethylamino)methyl)-4'-iodophenylthio)benzenamine (7) and 2-(2'-((dimethylamino)methyl)-4'-methoxyphenylthio)-5-iodobenzenamine (8), were prepared and tested as potential serotonin transporter (SERT) imaging agents. The new ligands displayed extremely high binding affinities to SERT (K i =0.22±0.09 and 0.11±0.04 nM, respectively), with very low binding affinities to dopamine and norepinephrine transporters (K i >1000 nM). The corresponding [ 125 I]7 and [ 125 I]8 were successfully prepared from tri-n-butyltin derivatives. They showed good brain uptakes and prolonged retention after intravenous injection in rats (brain uptake was 1.77% and 0.98% dose/g for [ 125 I]7, and 0.92% and 0.29% dose/g for [ 125 I]8, at 2 and 120 min, respectively). Significantly, [ 125 I]7 showed excellent uptake and prolonged retention in the hypothalamus, where SERT concentration was highest. The hypothalamus/cerebellum (HY/CB) ratios (target/background ratios) were 4.24, 7.10, 8.24 and 12.6 at 2, 4, 6 and 12 h, respectively. The HY/CB ratios for [ 125 I]8 were 3.97, 5.57 and 5.06 at 1, 2 and 4 h, respectively. Adding the 4'-iodo group to the Phenyl Ring B of Compound (7) appeared to reduce the rate of clearance from the brain, and kinetics favored uptake and retention in the hypothalamus. The localization of [ 125 I]7 in the hypothalamus region in the rat brain could be blocked by pretreatment with (+)McN5652, escitalopram and ADAM (2), which are all selective SERT ligands (at 2 mg/kg iv, 5 min pretreatment). Ex vivo autoradiograms of rat brain sections (at 4 h after intravenous injection of [ 125 I]7) showed intense labeling in regions of the brain known to have high SERT density. The excellent selective uptake and retention in the hypothalamus region suggest that [ 123 I]7 is a potential lead compound for developing new imaging agents targeting SERT-binding sites with single
Li, Wen; Ji, Yuan Yuan; Wang, Jian Wen; Zhu, Yong Ming
2012-01-01
The interaction of calf thymus DNA (ct-DNA) with a novel synthesized pyrazolo[1,5-a]indole compound 1-methyl-7H-indeno[1,2-b]quinolinium-7-(4-dimethylamino) benzylidene triflate (MIDBT) was extensively studied by various spectroscopic techniques, viscosity measurements, and gel electrophoresis. The UV-visible observation implied that the compound interacted with ct-DNA by two binding modes, intercalating into the DNA base pairs and attaching to the helix exterior of DNA. The results of the fl...
Chemical Diversity in Basil (Ocimum sp.) Germplasm
da Costa, Andréa Santos; Arrigoni-Blank, Maria de Fátima; de Carvalho Filho, José Luiz Sandes; de Santana, Aléa Dayane Dantas; Santos, Darlisson de Alexandria; Alves, Péricles Barreto; Blank, Arie Fitzgerald
2015-01-01
The present study aimed to chemically characterize 31 accessions and seven cultivars of basil. The percentage composition of the essential oils of the accessions and cultivars was based on the 14 most abundant constituents: 1,8-cineole, linalool, methyl chavicol, neral, nerol, geraniol, geranial, methyl cinnamate, β-bourbonene, methyl eugenol, α-trans-bergamotene, germacrene-D, epi-α-cadinol, and δ-cadinene. The genetic materials were classified into eight clusters according to the chemical composition of the essential oils: Cluster 1—mostly linalool and 1,8-cineole; Cluster 2—mostly linalool, geraniol, and α-trans-bergamotene; Cluster 3—mostly linalool, methyl chavicol, methyl cinnamate, and β-bourbonene; Cluster 4—mostly linalool, methyl chavicol, epi-α-cadinol, and α-trans-bergamotene; Cluster 5—mainly linalool, methyl eugenol, α-trans-bergamotene, and epi-α-cadinol; Cluster 6—mainly linalool, geraniol, and epi-α-cadinol; Cluster 7—mostly linalool and methyl chavicol; Cluster 8—mainly geranial and neral. PMID:25629084
Chemical Diversity in Basil (Ocimum sp. Germplasm
Directory of Open Access Journals (Sweden)
Andréa Santos da Costa
2015-01-01
Full Text Available The present study aimed to chemically characterize 31 accessions and seven cultivars of basil. The percentage composition of the essential oils of the accessions and cultivars was based on the 14 most abundant constituents: 1,8-cineole, linalool, methyl chavicol, neral, nerol, geraniol, geranial, methyl cinnamate, β-bourbonene, methyl eugenol, α-trans-bergamotene, germacrene-D, epi-α-cadinol, and δ-cadinene. The genetic materials were classified into eight clusters according to the chemical composition of the essential oils: Cluster 1—mostly linalool and 1,8-cineole; Cluster 2—mostly linalool, geraniol, and α-trans-bergamotene; Cluster 3—mostly linalool, methyl chavicol, methyl cinnamate, and β-bourbonene; Cluster 4—mostly linalool, methyl chavicol, epi-α-cadinol, and α-trans-bergamotene; Cluster 5—mainly linalool, methyl eugenol, α-trans-bergamotene, and epi-α-cadinol; Cluster 6—mainly linalool, geraniol, and epi-α-cadinol; Cluster 7—mostly linalool and methyl chavicol; Cluster 8—mainly geranial and neral.
Synthesis and ring openings of cinnamate-derived N-unfunctionalised aziridines
Directory of Open Access Journals (Sweden)
Alan Armstrong
2012-10-01
Full Text Available tert-Butyl cinnamates are aziridinated with high trans-selectivity by an N–N ylide generated in situ from N-methylmorpholine and O-diphenylphosphinyl hydroxylamine. The resulting N-unfunctionalised aziridines are shown to be versatile synthetic building blocks that undergo highly selective ring-opening reactions with a wide range of nucleophiles.
Directory of Open Access Journals (Sweden)
Özlem Gürsoy Kol
2016-08-01
Full Text Available In this paper, eight novel 1-(morpholine-4-yl-methyl-3-alkyl(aryl-4-[4-(dimethylamino-benzylidenamino]-4,5-dihydro-1H-1,2,4-triazol-5-ones (2 were obtained by the reactions of 3-alkyl(aryl-4-[4-(dimethylamino-benzylidenamino]-4,5-dihydro-1H-1,2,4-triazol-5-ones (1 with formaldehyde and morpholine. The novel synthesized compounds were identified by IR, 1H NMR and 13C NMR spectral data. Besides, the newly synthesized compounds were analysed for their in vitro potential antioxidant capacities in three different assays. All of the compounds demonstrated significant activity for metal chelating effect.
Deodorants: An experimental provocation study with cinnamic aldehyde
DEFF Research Database (Denmark)
Bruze, M.; Johansen, J. D.; Andersen, K. E.
2003-01-01
BACKGROUND: Axillary dermatitis is common and overrepresented in individuals with contact allergy to fragrances. Many individuals suspect their deodorants to be the incriminating products. OBJECTIVE: Our aim was to investigate the significance of cinnamic aldehyde in deodorants for the development...... of axillary dermatitis when used by individuals with and without contact allergy to cinnamic aldehyde. METHODS: Patch tests with deodorants and ethanol solutions with cinnamic aldehyde, and repeated open application tests with roll-on deodorants without and with cinnamic aldehyde at different concentrations......, were performed in 37 patients with dermatitis, 20 without and 17 with contact allergy to cinnamic aldehyde. RESULTS: A repeated open application test with positive findings was noted only in patients hypersensitive to cinnamic aldehyde (P deodorants containing...
Salum, María L; Itovich, Lucia M; Erra-Balsells, Rosa
2013-11-01
Successful application of matrix-assisted laser desorption/ionization (MALDI) MS started with the introduction of efficient matrices such as cinnamic acid derivatives (i.e. 3,5-dimethoxy-4-hydroxycinnamic acid, SA; α-cyano-4-hydroxycinnamic acid). Since the empirical founding of these matrices, other commercial available cinnamic acids with different nature and location of substituents at benzene ring were attempted. Rational design and synthesis of new cinnamic acids have been recently described too. Because the presence of a rigid double bond in its molecule structure, cinnamic acids can exist as two different geometric isomers, the E-form and Z-form. Commercial available cinnamic acids currently used as matrices are the geometric isomers trans or E (E-cinnamic and trans-cinnamic acids). As a new rational design of MALDI matrices, Z-cinnamic acids were synthesized, and their properties as matrices were studied. Their performance was compared with that of the corresponding E-isomer and classical crystalline matrices (3,5-dihydroxybenzoic acid; norharmane) in the analysis of neutral/sulfated carbohydrates. Herein, we demonstrate the outstanding performance for Z-SA. Sulfated oligosaccharides were detected in negative ion mode, and the dissociation of sulfate groups was almost suppressed. Additionally, to better understand the quite different performance of each geometric isomer as matrix, the physical and morphological properties as well as the photochemical stability in solid state were studied. The influence of the E/Z photoisomerization of the matrix during MALDI was evaluated. Finally, molecular modeling (density functional theory study) of the optimized geometry and stereochemistry of E-cinnamic and Z-cinnamic acids revealed some factors governing the analyte-matrix interaction. Copyright © 2013 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Oya, Shunichi [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Choi, Seok-Rye [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Kung, Mei-Ping [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Kung, Hank F. [Department of Radiology, University of Pennsylvania, Philadelphia, PA 19104 (United States); Department of Pharmacology, University of Pennsylvania, Philadelphia, PA 19104 (United States)
2007-02-15
Two novel ligands with 4' substitution on the Phenyl Ring B of biphenylthiol, 5-chloro-2-(2'-((dimethylamino)methyl)-4'-iodophenylthio)benzenamine (7) and 2-(2'-((dimethylamino)methyl)-4'-methoxyphenylthio)-5-iodobenzenamine (8), were prepared and tested as potential serotonin transporter (SERT) imaging agents. The new ligands displayed extremely high binding affinities to SERT (K {sub i}=0.22{+-}0.09 and 0.11{+-}0.04 nM, respectively), with very low binding affinities to dopamine and norepinephrine transporters (K {sub i}>1000 nM). The corresponding [{sup 125}I]7 and [{sup 125}I]8 were successfully prepared from tri-n-butyltin derivatives. They showed good brain uptakes and prolonged retention after intravenous injection in rats (brain uptake was 1.77% and 0.98% dose/g for [{sup 125}I]7, and 0.92% and 0.29% dose/g for [{sup 125}I]8, at 2 and 120 min, respectively). Significantly, [{sup 125}I]7 showed excellent uptake and prolonged retention in the hypothalamus, where SERT concentration was highest. The hypothalamus/cerebellum (HY/CB) ratios (target/background ratios) were 4.24, 7.10, 8.24 and 12.6 at 2, 4, 6 and 12 h, respectively. The HY/CB ratios for [{sup 125}I]8 were 3.97, 5.57 and 5.06 at 1, 2 and 4 h, respectively. Adding the 4'-iodo group to the Phenyl Ring B of Compound (7) appeared to reduce the rate of clearance from the brain, and kinetics favored uptake and retention in the hypothalamus. The localization of [{sup 125}I]7 in the hypothalamus region in the rat brain could be blocked by pretreatment with (+)McN5652, escitalopram and ADAM (2), which are all selective SERT ligands (at 2 mg/kg iv, 5 min pretreatment). Ex vivo autoradiograms of rat brain sections (at 4 h after intravenous injection of [{sup 125}I]7) showed intense labeling in regions of the brain known to have high SERT density. The excellent selective uptake and retention in the hypothalamus region suggest that [{sup 123}I]7 is a potential lead compound for
Ma, Wei-Bin; Feng, Jun-Tao; Jiang, Zhi-Li; Zhang, Xing
2014-09-01
We studied the knockdown activity and lethal toxicity of 6 essential oil compounds-methyl salicylate, linalool, 2-phenethyl alcohol, eugenol, β-citronellol, and trans-cinnamaldehyde-as fumigants against adult female Culex pipiens pallens in the laboratory. Of the 6 products tested, trans-cinnamaldehyde was the most toxic (LC50 = 0.26 µl/l air, 24 h) with a slow knockdown time (KT95 = 176.5 min at 0.5 µl/l air). Methyl salicylate displayed a lower toxicity (LC50 = 1.17 µl/l air, 24 h) but the fastest knockdown activity (KT95 = 16.8 min) at the sublethal concentration 0.5 µl/l air. Furthermore, the binary mixture of methyl salicylate and trans-cinnamaldehyde exhibited a combined effect of fast knockdown activity and high toxicity against Cx. p. pallens adults, showing potential for development as natural fumigants for mosquito control.
Lavysh, A. V.; Maskevich, A. A.; Lugovskii, A. A.; Voropai, E. S.; Sulatskaya, A. I.; Kuznetsova, I. M.; Turoverov, K. K.
2017-01-01
The spectral properties of a novel thioflavin T derivative, trans-2-[4-(dimethylamino)styryl]-3-ethyl-1,3-benzothiazolium perchlorate (DMASEBT), were studied in aqueous solutions in the presence of sodium polystyrene sulfonate (SPS). It was shown that SPS either could interact with dye monomers or initiate the formation of non-fluorescent dye dimers depending on the concentration ratio of dye and polyelectrolyte. DMASEBT dimer formation in the presence of SPS produced a hypsochromic shift by 40 nm in the absorption spectrum and quenched fluorescence. A bathochromic shift of the absorption spectrum and an increase of the fluorescence intensity by an order of magnitude were observed if DMASEBT monomers interacted with SPS. Quantum-chemical analysis found that sandwich dimers (H-aggregates) were most stable. A comparison of DMASEBT spectra in the presence of SPS and amyloid fibrils showed that DMASEBT molecules were incorporated into amyloid fibrils as monomers. The spectral changes associated with this incorporation could not be explained by the formation of dye aggregates.
Structural modification of trans-cinnamic acid using Colletotrichum acutatum
Rodrigo Velasco B.; Jesús H. Gil G.; Carlos M. García P.; Diego L. Durango R.
2012-01-01
Se estudió la biotransformación de ácido trans-cinámico mediante células completas del hongo fitopatógeno nativo colombiano Colletotrichum acutatum. Inicialmente, se evaluó la fungitoxicidad de este compuesto contraC. acutatum; el ácido trans-cinámico exhibió una toxicidad moderada a débil contra el microorganismo y aparentemente se presentó un mecanismo de detoxificación. Luego, para estudiar tal mecanismo y explorar la capacidad de este hongo para biotransformar el ácido trans-cinámico en ...
Solvent-dependent regioselective oxidation of trans-chalcones using aqueous hydrogen peroxide
Energy Technology Data Exchange (ETDEWEB)
Peng, Wang; Jiabin, Yang; Lushen, Li, E-mail: jimin@seu.edu.cn [Southeast University, Nanjing (China). School of Biological Science and Medical Engineering; Jin, Cai; Chunlong, Sun; Min, Ji [Southeast University, Nanjing (China). School of Chemistry and Chemical Engineering
2013-03-15
A novel method for regioselective oxidation of trans-chalcones with hydrogen peroxide in acetonitrile to afford cinnamic acids is reported. Only trans-b-arylacrylic acids were observed. A wide range of functionalized products can be effectively produced from various chalcones in good to excellent yields. (author)
International Nuclear Information System (INIS)
Carbonezi, Carlos Alberto; Lopes, Marcia Nasser; Silva, Dulce Helena Siqueira; Araujo, Angela Regina; Bolzani, Vanderlan da Silva; Young, Maria Claudia Marx; Silva, Marcelo Rogerio da
2004-01-01
The bioactive compound trans-3'-methylsulphonylallyl trans-cinnamate (1) along with the inactive iryelliptin (2) and (7R,8S,1'S)-Δ 8' -3',5'-dimethoxy-1',4'-dihydro-4'-oxo-7.0.2',8.1'-neolignan (3) were isolated from the leaves of Cinnamomum australe. The structures of these compounds were assigned by analysis of 1D and 2D NMR data and comparison with data registered in the literature for these compounds. The DNA-damaging activity of 1 is being described for the first time. (author)
Directory of Open Access Journals (Sweden)
M. Onciu
2005-02-01
Full Text Available Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP and pyridine (Py as bases and N-methyl-2-pyrolidinone (NMP as solvent, at reflux (180-190°C for 8-12 hours.
[Study on chemical constituents from ethyl acetate extract of Myricaria bracteata].
Zhang, Ying; Yuan, Yi; Cui, Baosong; Li, Shuai
2011-04-01
To study the chemical constituents from the ethyl acetate extract of Myricaria bracteata. The chemical constituents were isolated and purified by chromatographic techniques, and their structures were identified by physical characters and spectroscopic analysis. Sixteen compounds were isolated from the ethyl acetate portion of the 95% ethanolic extract of Myricaria bracteata, and identified as myricarin (1), myricarin B (2), 3alpha-hydroxytaraxer-14-en-28-oic acid (3), myricadiol (4), trans-ferulic acid 22-hydroxydocosanoic acid ester (5), docosyl-3, 4-dihydroxy-trans-cinnamate (6), dillenetin (7), 3, 5, 4'-trihydroxy-7-methoxyflavone (8), 3, 5, 4'-trihydroxy-7, 3'-dimethoxyflavone (9), methyl 3, 5-dihydroxy-4-methoxybenzoate (10), 3-hydroxy-4-methoxy cinnamic acid (11), sinapaldehyde (12), vanillin (13), syringaldehyde (14), 3, 3', 4'-trimethoxyellagic acid (15), methyl p-hyroxybenzoate (16). Compounds 5, 6, 12-16 were isolated from the genus Myricaria for the fist time, all of the compounds were isolated from this plant for the fist time, except for 8 and 9.
Structural modification of trans-cinnamic acid using Colletotrichum acutatum
Directory of Open Access Journals (Sweden)
Rodrigo Velasco B.
2012-01-01
Full Text Available Se estudió la biotransformación de ácido trans-cinámico mediante células completas del hongo fitopatógeno nativo colombiano Colletotrichum acutatum. Inicialmente, se evaluó la fungitoxicidad de este compuesto contraC. acutatum; el ácido trans-cinámico exhibió una toxicidad moderada a débil contra el microorganismo y aparentemente se presentó un mecanismo de detoxificación. Luego, para estudiar tal mecanismo y explorar la capacidad de este hongo para biotransformar el ácido trans-cinámico en productos con valor agregado, el microorganismo se incubó con el sustrato usando tres medios de cultivo diferentes (Czapeck-Dox, Sabouraud y PDB a condiciones ambientales. Usando el medio Czapeck-Dox, los cultivos completos de C.acutatum redujeron el ácido trans-cinámico, primero a aldehídos (transcinamaldehido y 3-fenilpropanal, luego a alcoholes (alcohol cinamílico y 3-fenil-1-propanol. Posteriormente, estos alcoholes fueron transformados a los correspondientes ésteres de acetilo. Sin embargo, algunos de estos productos estuvieron ausentes o presentes a una concentración diferente cuando se cambió el medio de cultivo. Los resultados sugieren un mecanismo de detoxificación en el cual el sistema carbonílico α,β-insaturado es afectado.Por otra parte, los productos metabólicos formados son compuestos útiles usados como fragancias y sabores. Por consiguiente, el metabolismo del ácido trans-cinámico usando C. acutatum puede proporcionar nuevos blancos metabólicos para controlar C. acutatum así como también una forma simple y eficiente para obtener sabores y perfumes, tales como el alcohol cinamílico y el 3-fenil-1-propanol, y sus ésteres de acetilo.
Energy Technology Data Exchange (ETDEWEB)
Vijayakumar, T.; Hubert Joe, I. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India); Reghunadhan Nair, C.P. [Polymers and Special Chemicals Division, Vikram Sarabhai Space Centre, Thiruvananthapuram 695 022, Kerala (India); Jayakumar, V.S. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India)], E-mail: vsjk@vsnl.net
2008-01-22
A comprehensive investigation on the intramolecular charge transfer (ICT) of an efficient {pi}-conjugated potential push-pull NLO chromophore, 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS), from a strong electron-donor group (dimethylamino-N(CH{sub 3}){sub 2}) to a strong electron-acceptor group (nitro-NO{sub 2}) through the {pi}-conjugated bridge (trans-stilbene) has been carried out from their vibrational spectra. The NIR FT-Raman and FT-IR spectra supported by the density functional theory (DFT) quantum chemical computations have been employed to analyze the effects of intramolecular charge transfer on the geometries and the vibrational modes contributing to the linear electro-optic effect of the organic NLO material. It has been observed that the changes in the endocyclic and exocyclic angles result from the charge-transfer interaction of the phenyl ring and the amino group in the electron-donor side of the NLO chromophore. The strongest vibrational modes contributing to the electro-optic effect have been identified and examined from the concurrent IR and Raman activation of {nu}(C=C/C-C) mode, ring C=C stretching modes, in-plane deformation modes, nitro modes and the umbrella mode of methyl groups. Furthermore, the splitting of the vinyl stretching modes and the electronic effects such as hyperconjugation and backdonation on the methyl hydrogen atoms causing the decrease of stretching frequencies and infrared intensities have also been analyzed in detail. The effect of frontier orbitals transition of electron density transfer and the influence of planarity between the phenyl rings of the stilbene moiety on the first hyperpolarizability have also been discussed.
Katagiri, Yukiko; Miyazaki, Yasunori; Uchino, Tomonobu; Kagawa, Yoshiyuki
2014-01-01
Goreisan suppository is prepared as a hospital preparation, and successfully used for the treatment of diarrhea and vomiting in young children with common cold. While clinical efficacy of the suppository has been reported, few studies have been carried out to clarify the preparation procedure and pharmacokinetics of the suppository. In this study, trans-cinnamic acid (CA) was used as a representative substance of goreisan constituents, and assayed by HPLC-UV. We investigated the properties of goreisan suppositories prepared using various sizes of pulverized goreisan extract granules, in vitro dissolution profiles using the reciprocating dialysis tube method, and pharmacokinetics in rabbits compared with those for goreisan enema. Mass and content uniformity tests on the suppositories of three size fractions, 0-75, 75-150, and 150-300 µm, showed good acceptance for all kinds of suppository. Storage stability at 4°C was maintained until 4 months. In vitro dissolution of CA from the suppository was proportional to time until 45 min, and slower than that from the enema. Finally, 80% of CA had dissolved at 60 min. Pharmacokinetic study in rabbits revealed that the area under the plasma concentration-time curve from 0 to 120 min (AUC0-120 min) of the suppository was twice that of the enema. Moreover, from a study in rabbits using CA injection and CA suppository, we revealed that CA was rapidly and well absorbed from the rectum, showing 84% absolute bioavailability. Thus, we illustrated the defined preparation procedure of the suppository and the superiority of the suppository over the enema. This study will support evidence that the suppository is fast-acting and efficacious in clinical use.
El-Shabaan, M. M.
2018-02-01
Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.
Koten, G. van; Donkervoort, J.G.; Vicario, J.L.; Rijnberg, E.; Jastrzebski, J.T.B.H.; Kooijman, H.; Spek, A.L.
1998-01-01
The heteroatom assisted lithiation of 1, 3-bis[1-(dimethylamino)ethyl]benzene with n-BuLi afforded 2,6-bis[1-(dimethylamino)ethyl]phenyllithium. An X-ray crystal structure determination revealed a dimeric aggregate in which the four benzylic chiral centers are identical, pointing to stereoselective
Searching for trans ethyl methyl ether in Orion KL.
Tercero, B; Cernicharo, J; López, A; Brouillet, N; Kolesniková, L; Motiyenko, R A; Margulès, L; Alonso, J L; Guillemin, J-C
2015-10-01
We report on the tentative detection of trans ethyl methyl ether (tEME), t-CH 3 CH 2 OCH 3 , through the identification of a large number of rotational lines from each one of the spin states of the molecule towards Orion KL. We also search for gauche-trans-n-propanol, Gt-n-CH 3 CH 2 CH 2 OH, an isomer of tEME in the same source. We have identified lines of both species in the IRAM 30 m line survey and in the ALMA Science Verification data. We have obtained ALMA maps to establish the spatial distribution of these species. Whereas tEME mainly arises from the compact ridge component of Orion, Gt-n-propanol appears at the emission peak of ethanol (south hot core). The derived column densities of these species at the location of their emission peaks are ≤(4.0 ± 0.8) × 10 15 cm -2 and ≤(1.0 ± 0.2)× 10 15 cm -2 for tEME and Gt-n-propanol, respectively. The rotational temperature is ~100 K for both molecules. We also provide maps of CH 3 OCOH, CH 3 CH 2 OCOH, CH 3 OCH 3 , CH 3 OH, and CH 3 CH 2 OH to compare the distribution of these organic saturated O-bearing species containing methyl and ethyl groups in this region. Abundance ratios of related species and upper limits to the abundances of non-detected ethers are provided. We derive an abundance ratio N (CH 3 OCH 3 )/ N (tEME) ≥ 150 in the compact ridge of Orion.
Cinnamic Acid Derivatives as Antidiabetics Agents
Directory of Open Access Journals (Sweden)
Teni Ernawati
2017-04-01
Full Text Available Diabetes mellitus is a metabolic disorder of carbohydrate metabolism. Treatment of type II diabetes is usually done by prescribing diet and exercise for the patient however it can also be treated with antidiabetic drugs. The purpose of this paper is to illustrate some cinnamic acid derivative compounds which are either isolated from natural materials or the results of the chemical synthesis. In addition, their biological activities as an agent of α-glucosidase inhibitors have also been evaluated. Chemically, cinnamic acid has three main functional groups: first is the substitution on the phenyl group, second is the additive reaction into the α-β unsaturated, and third is the chemical reaction with carboxylic acid functional groups. Chemical aspects of cinnamic acid derivative compounds have received much attention in the research and development of drugs, especially modifications within three functional groups are very influential. In the last 10 years, a lot of research and development of cinnamic acid derivatives as inhibitors of the α-glucosidase enzyme has been done. One example of the research done in this field is the modification of para position in the structure of cinnamic acid and addition of alkyl groups in the carboxylic group which would increase the activity of the α-glucosidase enzyme therefore the level of inhibition is 100 times higher than that of cinnamic acid compound itself. The novelty of this review article is to focus on the antidiabetic activity of cinnamic acid derivatives.
Energy Technology Data Exchange (ETDEWEB)
Mahanta, Subrata; Balia Singh, Rupashree; Bagchi, Arnab [Department of Chemistry University of Calcutta 92, A.P.C. Road, Kolkata 700009 (India); Nath, Debnarayan [Department of Physical Chemistry, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700 032 (India); Guchhait, Nikhil, E-mail: nguchhait@yahoo.co [Department of Chemistry University of Calcutta 92, A.P.C. Road, Kolkata 700009 (India)
2010-06-15
In this paper, we demonstrate the interaction between intramolecular charge transfer (ICT) probe-Methyl ester of N,N-dimethylamino naphthyl acrylic acid (MDMANA) with bovine serum albumin (BSA) using absorption and fluorescence emission spectroscopy. The nature of probe protein binding interaction, fluorescence resonance energy transfer from protein to probe and time resolved fluorescence decay measurement predict that the probe molecule binds strongly to the hydrophobic cavity of the protein. Furthermore, the interaction of the anionic surfactant sodium dodecyl sulphate (SDS) with water soluble protein BSA has been investigated using MDMANA as fluorescenece probe. The changes in the spectral characteristics of charge transfer fluorescence probe MDMANA in BSA-SDS environment reflects well the nature of the protein-surfactant binding interaction such as specific binding, non-cooperative binding, cooperative binding and saturation binding.
Isolation of Cinnamic Acid Derivatives from the Bulbs of Allium tripedale
Directory of Open Access Journals (Sweden)
Zahra Chehri
2018-01-01
Full Text Available Background: Allium genus with 750 species is the most diverse genus in the Amaryllidaceae family. Historically, Allium species have been used as medicinal plants, especially for prevention and treatment of cardiovascular diseases and considered as valuable sources of phytonutrients. Phytochemical investigation of Allium tripedale, locally called “Anashq,” which is an edible plant of the “Zagros” region (west of Iran was conducted in the present study. Materials and Methods: Air-dried bulbs of the plant were extracted in a four-step extraction method with increasing polarity using hexane, chloroform, chloroform–methanol (9:1, and methanol. Chloroform-methanol (9:1 extract was fractionated by medium-pressure liquid chromatography on a RP-18 column using a linear gradient solvent system of H2O to MeOH. Phenolic-rich fractions were subjected to the final isolation and purification of the constituents by reversed-phase high-performance liquid chromatography method. Structure elucidation of the compounds was performed through comprehensive methods including 1D-and 2D-NMR and mass spectroscopy. Results: Two cinnamic acid derivatives were isolated from the bulbs of A. tripedale; using spectroscopic methods, their chemical structures were determined as 6,7-dimethoxy N-trans-caffeoyltyramine (1 and N-trans-feruloyltyramine (2. Conclusion: Cinnamic acid derivatives are pharmacologically active phenolic compounds, which have been isolated from different Allium species. Isolation of these compounds from A. tripedale is reported for the first time in this study and could be used as a chemical basis for explanation of the plant biological and pharmacological activities.
International Nuclear Information System (INIS)
Oya, Shunichi; Choi, S.-R.; Hou, Catherine; Mu Mu; Kung, M.-P.; Acton, Paul D.; Siciliano, Michael; Kung, Hank F.
2000-01-01
Serotonin transporters (SERT) are target-sites for commonly used antidepressants, such as fluoxetine, paroxetine, sertraline, and so on. Imaging of these sites in the living human brain may provide an important tool to evaluate the mechanisms of action as well as to monitor the treatment of depressed patients. Synthesis and characterization of an improved SERT imaging agent, ADAM (2-((2-((dimethylamino)methyl)phenyl)thio)-5-iodophenylamine)(7) was achieved. The new compound, ADAM(7), displayed an extremely potent binding affinity toward SERT (K i =0.013 nM, in membrane preparations of LLC-PK 1 -cloned cell lines expressing the specific monoamine transporter). ADAM(7) also showed more than 1,000-fold selectivity for SERT over norepinephrine transporter (NET) and dopamine transporter (DAT) (K i =699 and 840 nM, for NET and DAT, respectively). The radiolabeled compound [ 125 I]ADAM(7) showed an excellent brain uptake in rats (1.41% dose at 2 min post intravenous [IV] injection), and consistently displayed the highest uptake (between 60-240 min post IV injection) in hypothalamus, a region with the highest density of SERT. The specific uptake of [ 125 I]ADAM(7) in the hypothalamus exhibited the highest target-to-nontarget ratio ([hypothalamus - cerebellum]/cerebellum was 3.97 at 120 min post IV injection). The preliminary imaging study of [ 123 I]ADAM in the brain of a baboon by single photon emission computed tomography (SPECT) at 180-240 min post IV injection indicated a specific uptake in midbrain region rich in SERT. These data suggest that the new ligand [ 123 I]ADAM(7) may be useful for SPECT imaging of SERT binding sites in the human brain
Manivannan, M.; Martin Britto Dhas, S. A.; Jose, M.
2016-12-01
Bulk terahertz emitting single crystal of 4-dimethylamino-N-methyl-4-stilbazolium tosylate (DAST) was synthesized by condensation method and grown by slow solvent evaporation technique from methanol. The structure and cell parameters of the grown crystals were derived from single crystal and powder X-ray diffraction analyses and the optical properties of the crystal were analyzed by UV-Vis Spectrophotometer. The presence of functional groups was identified by FTIR and FT-Raman spectroscopic studies. We demonstrated that in DAST crystal, the thermal transport properties such as thermal conductivity, thermal diffusivity and thermal effusivity are better than several well recognized standard materials using photoacoustic spectrophotometer. The dielectric measurement was made as a function of frequency (1 Hz-35 MHz) at different temperatures (30-200 °C). The dielectric constant and dielectric loss were found to be strongly dependent on temperature and frequency of the applied electric field. The semicircle in the cole-cole plot showed the presence of dielectric relaxation in the crystal with its diameter representing the resistance of the crystal. The resistivity and ac conductivity were calculated from the measured dielectric data.
Cinnamic acid amides from Tribulus terrestris displaying uncompetitive α-glucosidase inhibition.
Song, Yeong Hun; Kim, Dae Wook; Curtis-Long, Marcus J; Park, Chanin; Son, Minky; Kim, Jeong Yoon; Yuk, Heung Joo; Lee, Keun Woo; Park, Ki Hun
2016-05-23
The α-glucosidase inhibitory potential of Tribulus terrestris extracts has been reported but as yet the active ingredients are unknown. This study attempted to isolate the responsible metabolites and elucidate their inhibition mechanism of α-glucosidase. By fractionating T. terristris extracts, three cinnamic acid amide derivatives (1-3) were ascertained to be active components against α-glucosidase. The lead structure, N-trans-coumaroyltyramine 1, showed significant inhibition of α-glucosidase (IC50 = 0.42 μM). Moreover, all active compounds displayed uncompetitive inhibition mechanisms that have rarely been reported for α-glucosidase inhibitors. This kinetic behavior was fully demonstrated by showing a decrease of both Km and Vmax, and Kik/Kiv ratio ranging between 1.029 and 1.053. We progressed to study how chemical modifications to the lead structure 1 may impact inhibition. An α, β-unsaturation carbonyl group and hydroxyl group in A-ring of cinnamic acid amide emerged to be critical functionalities for α-glucosidase inhibition. The molecular modeling study revealed that the inhibitory activities are tightly related to π-π interaction as well as hydrogen bond interaction between enzyme and inhibitors. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Domenech, Antonio [Departament de Quimica Analitica, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot, Valencia (Spain); Costero, Ana Maria; Banuls, Maria Jose; Aurell, Maria Jose [Departament de Quimica Organica, Universitat de Valencia, Dr. Moliner 50, 46100 Burjassot, Valencia (Spain)
2005-07-25
The voltammetric behaviour at carbon fibre microelectrodes under the application of static magnetic fields of two series of macrolactams containing in their structure 4,4'-bis(dimethylamino)biphenyl or 4,4'-dinitrobiphenyl groups in MeCN solution is described. The response of 4,4'-dinitrobiphenyl receptors is dominated by two successive one-electron reduction processes at -0.9 and -1.6 V versus AgCl/Ag. 4,4'-bis(dimethylamino)biphenyl-containing receptors display two one-electron oxidations above +0.8 and +1.0 V. In both cases, a dihedral/planar interconversion precedes the second electron transfer step. Upon application of moderate (0.05-0.2 T) static magnetic fields to the electrochemical cell, the rate of such dihedral/planar interconversion is lowered for both the reduction of 4,4'-dinitrobiphenyl receptors and the oxidation of 4,4'-bis(dimethylamino)biphenyl lactams. The electrochemical response of N-methylated receptors, for which different cisoid-cisoid, cisoid-transoid, and transoid-transoid forms exist, exhibits a significant peak splitting that can be associated to the presence of such conformational isomers. Application of magnetic fields produces a relative enhancement of some peaks that can be interpreted in terms of differential magnetoconvection involving such conformational isomers. (author)
Photocure Reactions of Photoreactive Prepolymers with Cinnamate Groups
International Nuclear Information System (INIS)
Kim, Whan Gun
2011-01-01
The photoreactive prepolymers with multifunctional cinnamate and bisphenol A type cinnamate groups that could perform photodimerization without photoinitiators were synthesized by the reaction of t-cinnamic acids (CAs) and epoxy resins. Their photocure reaction rates and the extent of reaction conversion were measured with Fourier transform infrared spectroscopy, and these increased with the intensity of UV irradiation. The experimental data of these reaction rates showed the characteristics of nth-order kinetics reaction, and all kinetic constants of each photoreactive polymer with this equation were summarized. Although the GTR-1800-HCA and KWG1-EP-HCA with hydroxyl group substituted cinnamate showed lower reaction conversion rates and rate constant than GTR-1800-CA and KWG1-EP-CA with an unsubstituted cinnamate group, GTR-1800-MCAand KWG1-EP-MCA with methoxy group substituted cinnamate showed similar and higher reaction conversion rates than the former, respectively. These results were explained in terms of segmental mobility for photopolymerization by molecular interactions
Directory of Open Access Journals (Sweden)
Rogério Barbosa Lima
Full Text Available Cinnamic acid and its hydroxylated derivatives (p-coumaric, caffeic, ferulic and sinapic acids are known allelochemicals that affect the seed germination and root growth of many plant species. Recent studies have indicated that the reduction of root growth by these allelochemicals is associated with premature cell wall lignification. We hypothesized that an influx of these compounds into the phenylpropanoid pathway increases the lignin monomer content and reduces the root growth. To confirm this hypothesis, we evaluated the effects of cinnamic, p-coumaric, caffeic, ferulic and sinapic acids on soybean root growth, lignin and the composition of p-hydroxyphenyl (H, guaiacyl (G and syringyl (S monomers. To this end, three-day-old seedlings were cultivated in nutrient solution with or without allelochemical (or selective enzymatic inhibitors of the phenylpropanoid pathway in a growth chamber for 24 h. In general, the results showed that 1 cinnamic, p-coumaric, caffeic and ferulic acids reduced root growth and increased lignin content; 2 cinnamic and p-coumaric acids increased p-hydroxyphenyl (H monomer content, whereas p-coumaric, caffeic and ferulic acids increased guaiacyl (G content, and sinapic acid increased sinapyl (S content; 3 when applied in conjunction with piperonylic acid (PIP, an inhibitor of the cinnamate 4-hydroxylase, C4H, cinnamic acid reduced H, G and S contents; and 4 when applied in conjunction with 3,4-(methylenedioxycinnamic acid (MDCA, an inhibitor of the 4-coumarate:CoA ligase, 4CL, p-coumaric acid reduced H, G and S contents, whereas caffeic, ferulic and sinapic acids reduced G and S contents. These results confirm our hypothesis that exogenously applied allelochemicals are channeled into the phenylpropanoid pathway causing excessive production of lignin and its main monomers. By consequence, an enhanced stiffening of the cell wall restricts soybean root growth.
Energy Technology Data Exchange (ETDEWEB)
Oya, Shunichi; Choi, S.-R.; Hou, Catherine; Mu Mu; Kung, M.-P.; Acton, Paul D.; Siciliano, Michael; Kung, Hank F. E-mail: kunghf@sunmac.spect.upenn.edu
2000-04-01
Serotonin transporters (SERT) are target-sites for commonly used antidepressants, such as fluoxetine, paroxetine, sertraline, and so on. Imaging of these sites in the living human brain may provide an important tool to evaluate the mechanisms of action as well as to monitor the treatment of depressed patients. Synthesis and characterization of an improved SERT imaging agent, ADAM (2-((2-((dimethylamino)methyl)phenyl)thio)-5-iodophenylamine)(7) was achieved. The new compound, ADAM(7), displayed an extremely potent binding affinity toward SERT (K{sub i}=0.013 nM, in membrane preparations of LLC-PK{sub 1}-cloned cell lines expressing the specific monoamine transporter). ADAM(7) also showed more than 1,000-fold selectivity for SERT over norepinephrine transporter (NET) and dopamine transporter (DAT) (K{sub i}=699 and 840 nM, for NET and DAT, respectively). The radiolabeled compound [{sup 125}I]ADAM(7) showed an excellent brain uptake in rats (1.41% dose at 2 min post intravenous [IV] injection), and consistently displayed the highest uptake (between 60-240 min post IV injection) in hypothalamus, a region with the highest density of SERT. The specific uptake of [{sup 125}I]ADAM(7) in the hypothalamus exhibited the highest target-to-nontarget ratio ([hypothalamus - cerebellum]/cerebellum was 3.97 at 120 min post IV injection). The preliminary imaging study of [{sup 123}I]ADAM in the brain of a baboon by single photon emission computed tomography (SPECT) at 180-240 min post IV injection indicated a specific uptake in midbrain region rich in SERT. These data suggest that the new ligand [{sup 123}I]ADAM(7) may be useful for SPECT imaging of SERT binding sites in the human brain.
Multifunctional Cinnamic Acid Derivatives
Directory of Open Access Journals (Sweden)
Aikaterini Peperidou
2017-07-01
Full Text Available Our research to discover potential new multitarget agents led to the synthesis of 10 novel derivatives of cinnamic acids and propranolol, atenolol, 1-adamantanol, naphth-1-ol, and (benzylamino ethan-1-ol. The synthesized molecules were evaluated as trypsin, lipoxygenase and lipid peroxidation inhibitors and for their cytotoxicity. Compound 2b derived from phenoxyphenyl cinnamic acid and propranolol showed the highest lipoxygenase (LOX inhibition (IC50 = 6 μΜ and antiproteolytic activity (IC50 = 0.425 μΜ. The conjugate 1a of simple cinnamic acid with propranolol showed the higher antiproteolytic activity (IC50 = 0.315 μΜ and good LOX inhibitory activity (IC50 = 66 μΜ. Compounds 3a and 3b, derived from methoxylated caffeic acid present a promising combination of in vitro inhibitory and antioxidative activities. The S isomer of 2b also presented an interesting multitarget biological profile in vitro. Molecular docking studies point to the fact that the theoretical results for LOX-inhibitor binding are identical to those from preliminary in vitro study.
Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James
2016-01-01
We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10−11 to 5.0 × 10−21). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10−6). Our results provide new evidence for the role of DNA methylation in blood pressure regulation. PMID:26390057
Han, Dongfei; Kurusarttra, Somwang; Ryu, Ji-Young; Kanaly, Robert A; Hur, Hor-Gil
2012-12-05
A gene encoding p-anisaldehyde dehydrogenase (PAADH), which catalyzes the oxidation of p-anisaldehyde to p-anisic acid, was identified to be clustered with the trans-anethole oxygenase (tao) gene in Pseudomonas putida JYR-1. Heterologously expressed PAADH in Escherichia coli catalyzed the oxidation of vanillin, veratraldehyde, and piperonal to the corresponding aromatic acids vanillic acid, veratric acid, and piperonylic acid, respectively. Coexpression of trans-anethole oxygenase (TAO) and PAADH in E. coli also resulted in the successful transformation of trans-anethole, isoeugenol, O-methyl isoeugenol, and isosafrole to p-anisic acid, vanillic acid, veratric acid, and piperonylic acid, respectively, which are compounds found in plants as secondary metabolites. Because of the relaxed substrate specificity and high transformation rates by coexpressed TAO and PAADH in E. coli , the engineered strain has potential to be applied in the fragrance industry.
Searching for trans ethyl methyl ether in Orion KL★,★★
Tercero, B.; Cernicharo, J.; López, A.; Brouillet, N.; Kolesniková, L.; Motiyenko, R. A.; Margulès, L.; Alonso, J. L.; Guillemin, J.-C.
2015-01-01
We report on the tentative detection of trans ethyl methyl ether (tEME), t-CH3CH2OCH3, through the identification of a large number of rotational lines from each one of the spin states of the molecule towards Orion KL. We also search for gauche-trans-n-propanol, Gt-n-CH3CH2CH2OH, an isomer of tEME in the same source. We have identified lines of both species in the IRAM 30 m line survey and in the ALMA Science Verification data. We have obtained ALMA maps to establish the spatial distribution of these species. Whereas tEME mainly arises from the compact ridge component of Orion, Gt-n-propanol appears at the emission peak of ethanol (south hot core). The derived column densities of these species at the location of their emission peaks are ≤(4.0 ± 0.8) × 1015 cm−2 and ≤(1.0 ± 0.2)× 1015 cm−2 for tEME and Gt-n-propanol, respectively. The rotational temperature is ~100 K for both molecules. We also provide maps of CH3OCOH, CH3CH2OCOH, CH3OCH3, CH3OH, and CH3CH2OH to compare the distribution of these organic saturated O-bearing species containing methyl and ethyl groups in this region. Abundance ratios of related species and upper limits to the abundances of non-detected ethers are provided. We derive an abundance ratio N(CH3OCH3)/N(tEME) ≥ 150 in the compact ridge of Orion. PMID:26869726
Threshold responses in cinnamic-aldehyde-sensitive subjects
DEFF Research Database (Denmark)
Johansen, J D; Andersen, K E; Rastogi, Suresh Chandra
1996-01-01
Cinnamic aldehyde is an important fragrance material and contact allergen. The present study was performed to provide quantitative data on the eliciting capacity of cinnamic aldehyde, to be considered in assessment of clinical relevance and health hazard. The skin response to serial dilution patch...
Directory of Open Access Journals (Sweden)
Mihaela Florina Axente
2006-08-01
dimethylamino-3-chromanone. The 1/10000 dilution induces the increase of frequency of mitotic dividing cells. The cells with chromosome aberrations are in greater number in treated variants, comparatively with control. The aberration spectrum is enough large and comprises: ana-telophases with bridges, lagging chromosomes, expelled chromosomes, multipolar ana-telophases, as well as binucleate cells and interphases with micronucleuses.
Natural Cinnamic Acids, Synthetic Derivatives and Hybrids with Antimicrobial Activity
Directory of Open Access Journals (Sweden)
Juan David Guzman
2014-11-01
Full Text Available Antimicrobial natural preparations involving cinnamon, storax and propolis have been long used topically for treating infections. Cinnamic acids and related molecules are partly responsible for the therapeutic effects observed in these preparations. Most of the cinnamic acids, their esters, amides, aldehydes and alcohols, show significant growth inhibition against one or several bacterial and fungal species. Of particular interest is the potent antitubercular activity observed for some of these cinnamic derivatives, which may be amenable as future drugs for treating tuberculosis. This review intends to summarize the literature data on the antimicrobial activity of the natural cinnamic acids and related derivatives. In addition, selected hybrids between cinnamic acids and biologically active scaffolds with antimicrobial activity were also included. A comprehensive literature search was performed collating the minimum inhibitory concentration (MIC of each cinnamic acid or derivative against the reported microorganisms. The MIC data allows the relative comparison between series of molecules and the derivation of structure-activity relationships.
Furukawa, Kazuki; Hino, Kazuyuki; Yamamoto, Norifumi; Awasthi, Kamlesh; Nakabayashi, Takakazu; Ohta, Nobuhiro; Sekiya, Hiroshi
2015-09-17
The external electric field effects on the steady-state electronic spectra and excited-state dynamics were investigated for 4'-N,N-(dimethylamino)-3-hydroxyflavone (DMHF) in a poly(methyl methacrylate) (PMMA) film. In the steady-state spectrum, dual emission was observed from the excited states of the normal (N*) and tautomer (T*) forms. Application of an external electric field of 1.0 MV·cm(-1) enhanced the N* emission and reduced the T* emission, indicating that the external electric field suppressed the excited-state intramolecular proton transfer (ESIPT). The fluorescence decay profiles were measured for the N* and T* forms. The change in the emission intensity ratio N*/T* induced by the external electric field is dominated by ESIPT from the Franck-Condon excited state of the N* form and vibrational cooling in potential wells of the N* and T* forms occurring within tens of picoseconds. Three manifolds of fluorescent states were identified for both the N* and T* forms. The excited-state dynamics of DMHF in PMMA films has been found to be very different from that in solution due to intermolecular interactions in a rigid environment.
Cinnamic acid derivatives in cosmetics - current use and future prospects.
Gunia-Krzyżak, Agnieszka; Słoczyńska, Karolina; Popiół, Justyna; Koczurkiewicz, Paulina; Marona, Henryk; Pękala, Elżbieta
2018-06-05
Cinnamic acid derivatives are widely used in cosmetics and possess various functions. This group of compounds includes both naturally occurring as well as synthetic substances. On the basis of the Cosmetic Ingredient Database (CosIng) and available literature, this review summarizes their functions in cosmetics, including their physicochemical and biological properties as well as reported adverse effects. A perfuming function is typical of many derivatives of cinnamaldehyde, cinnamyl alcohol, dihydrocinnamyl alcohol, and cinnamic acid itself; these substances are commonly used in cosmetics all over the world. Some of them show allergic and photoallergic potential, resulting in restrictions in maximum concentrations and/or a requirement to indicate the presence of some substances in the list of ingredients when their concentrations exceed certain fixed values in a cosmetic product. Another important function of cinnamic acid derivatives in cosmetics is UV protection. Ester derivatives such as ethylhexyl methoxycinnamate (octinoxate), isoamyl p-methoxycinnamte (amiloxiate), octocrylene, and cinoxate are used in cosmetics all over the world as UV filters. However, their maximum concentrations in cosmetic products are restricted due to their adverse effects, which include contact and a photocontact allergies, phototoxic contact dermatitis, contact dermatitis, estrogenic modulation, and generation of reactive oxygen species. Other rarely utilized functions of cinnamic acid derivatives are as an antioxidant, in skin conditioning, hair conditioning, as a tonic, and in antimicrobial activities. Moreover, some currently investigated natural and synthetic derivatives of cinnamic acid have shown skin lightening and anti-aging properties. Some of them may become new cosmetic ingredients in the future. In particular, 4-hydroxycinnamic acid, which is currently indexed as a skin-conditioning cosmetics ingredient, has been widely tested in vitro and in vivo as a new drug candidate
DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue
Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul
2013-03-01
We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.
DEFF Research Database (Denmark)
Majdi, Mohammad; Malekzadeh-Mashhady, Atefe; Maroufi, Asad
2017-01-01
of the regulation of monoterpene biosynthesis in thyme, the expression of genes related to thymol and carvacrol biosynthesis in different tissues and in response to abiotic elicitors was analyzed. Methyl jasmonate (MeJA), salicylic acid (SA), trans-cinnamic acid (tCA) and UV-C irradiation were applied to T. vulgare...
New Photochrome Probe Allows Simultaneous pH and Microviscosity Sensing.
Wu, Yuanyuan; Papper, Vladislav; Pokholenko, Oleksandr; Kharlanov, Vladimir; Zhou, Yubin; Steele, Terry W J; Marks, Robert S
2015-07-01
4-N,N'-dimethylamino-4'-N'-stilbenemaleamic acid (DASMA), a unique molecular photochrome probe that exhibits solubility and retains trans-cis photoisomerisation in a wide range of organic solvents and aqueous pH environments, was prepared, purified and chemically characterised. Absorption, fluorescence excitation and emission spectra and constant-illumination fluorescence decay were measured in acetonitrile, dimethyl sulfoxide, ethanol, propylene carbonate, and aqueous glycerol mixtures. The pseudo-first-order fluorescence decay rates were found to be strongly dependent on the medium viscosity. In addition, the molecule exhibited the pH-dependent fluorescence and photoisomerisation kinetics.
International Nuclear Information System (INIS)
Sanga, Madhu; Younis, Islam R.; Tirumalai, Padma S.; Bland, Tina M.; Banaszewska, Monica; Konat, Gregory W.; Tracy, Timothy S.; Gannett, Peter M.; Callery, Patrick S.
2006-01-01
Pyrolytic products of smoked methamphetamine hydrochloride are well established. Among the various degradation products formed, trans-phenylpropene (trans-β-methylstyrene) is structurally similar to styrene analogues known to be bioactivated by CYP enzymes. In human liver microsomes, trans-phenylpropene was converted to the epoxide trans-phenylpropylene oxide (trans-2-methyl-3-phenyloxirane) and cinnamyl alcohol. Incubation of trans-phenylpropene with microsomes in the presence of enzyme-specific P450 enzyme inhibitors indicated the involvement of CYP2E1, CYP1A2, and CYP3A4 enzymes. Both (R,R)-phenylpropylene oxide and (S,S)-phenylpropylene oxide were formed in human liver microsomal preparations. Enantiomers of trans-phenylpropylene oxide were stereoselectively and regioselectively conjugated in a Phase II drug metabolism reaction catalyzed by human liver cytosolic enzymes consisting of conjugation with glutathione. The structure of the phenylpropylene oxide-glutathione adduct is consistent with nucleophilic ring-opening by attack at the benzylic carbon. Exposure of cultured C6 glial cells to (S,S)-phenylpropylene oxide produced a cytotoxic response in a concentration-dependent manner based on cell degeneration and death
2014-01-01
The binding-induced fluorescence of 4-(4-(dimethylamino)-phenyl)-1-methylpyridinium (APP+) and two new serotonin transporter (SERT)-binding fluorescent analogues, 1-butyl-4-[4-(1-dimethylamino)phenyl]-pyridinium bromide (BPP+) and 1-methyl-4-[4-(1-piperidinyl)phenyl]-pyridinium (PPP+), has been investigated. Optical spectroscopy reveals that these probes are highly sensitive to their chemical microenvironment, responding to variations in polarity with changes in transition energies and responding to changes in viscosity or rotational freedom with emission enhancements. Molecular docking calculations reveal that the probes are able to access the nonpolar and conformationally restrictive binding pocket of SERT. As a result, the probes exhibit previously not identified binding-induced turn-on emission that is spectroscopically distinct from dyes that have accumulated intracellularly. Thus, binding and transport dynamics of SERT ligands can be resolved both spatially and spectroscopically. PMID:24460204
Directory of Open Access Journals (Sweden)
Ioannis Tiritiris
2015-12-01
Full Text Available The reaction of the orthoamide 1,1,1-tris(dimethylamino-4-methyl-4-(trimethylsilyloxypent-2-yne with bromine in benzene, yields the title salt, C15H33BrN3OSi+·Br−. The C—N bond lengths in the amidinium unit are 1.319 (6 and 1.333 (6 Å, indicating double-bond character, pointing towards charge delocalization within the NCN plane. The C—Br bond length of 1.926 (5 Å is characteristic for a C—Br single bond. Additionally, there is a bromine–bromine interaction [3.229 (3 Å] present involving the anion and cation. In the crystal, weak C—H...Br interactions between the methyl H atoms of the cation and the bromide ions are present.
Thermodynamic Solubility Profile of Carbamazepine-Cinnamic Acid Cocrystal at Different pH.
Keramatnia, Fatemeh; Shayanfar, Ali; Jouyban, Abolghasem
2015-08-01
Pharmaceutical cocrystal formation is a direct way to dramatically influence physicochemical properties of drug substances, especially their solubility and dissolution rate. Because of their instability in the solution, thermodynamic solubility of cocrystals could not be determined in the common way like other compounds; therefore, the thermodynamic solubility is calculated through concentration of their components in the eutectic point. The objective of this study is to investigate the effect of an ionizable coformer in cocrystal with a nonionizable drug at different pH. Carbamazepine (CBZ), a nonionizable drug with cinnamic acid (CIN), which is an acidic coformer, was selected to prepare CBZ-CIN cocrystal and its thermodynamic solubility was studied in pH range 2-7. Instead of HPLC that is a costly and time-consuming method, a chemometric-based approach, net analyte signal standard addition method, was selected for simultaneous determination of CBZ and CIN in solution. The result showed that, as pH increases, CIN ionization leads to change in CBZ-CIN cocrystal solubility and stability in solution. In addition, the results of this study indicated that there is no significant difference between intrinsic solubility of CBZ and cocrystal despite the higher ideal solubility of cocrystal. This verifies that ideal solubility is not good parameter to predict cocrystal solubility. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.
Koten, G. van; Lagunas, M.C.; Gossage, R.A.; Spek, A.L.
1998-01-01
The potentially bis-cyclometalating ligand 3,3',5,5'-tetrakis[(dimethylamino)methyl]biphenyl, was prepared from 3,5-(Me2NCH2)2C6H3Br in a one-pot synthesis involving lithium-halogen exchange, transmetalation, and reductive-elimination reactions. This ligand undergoes selective dilithiation in the 4
Georgiev, Anton; Kostadinov, Anton; Ivanov, Deyan; Dimov, Deyan; Stoyanov, Simeon; Nedelchev, Lian; Nazarova, Dimana; Yancheva, Denitsa
2018-03-05
This paper describes the synthesis, spectroscopic characterization and quantum mechanical calculations of three azo-azomethine dyes. The dyes were synthesized via condensation reaction between 4-(dimethylamino)benzaldehyde and three different 4-aminobenzene azo dyes. Quantum chemical calculations on the optimized molecular geometry and electron densities of the trans (E) and cis (Z) isomers and their vibrational frequencies have been computed by using DFT/B3LYP density-functional theory with 6-311++G(d,p) basis set in vacuo. The thermodynamic parameters such as total electronic energy E (RB3LYP), enthalpy H 298 (sum of electronic and thermal enthalpies), free Gibbs energy G 298 (sum of electronic and thermal free Gibbs energies) and dipole moment μ were computed for trans (E) and cis (Z) isomers in order to estimate the ΔE trans→cis , Δμ trans→cis, ΔH trans→cis , ΔG trans→cis and ΔS trans→cis values. After molecular geometry optimization the electronic spectra have been obtained by TD-DFT calculations at same basis set and correlated with the spectra of vapour deposited nanosized films of the dyes. The NBO analysis was performed in order to understand the intramolecular charge transfer and energy of resonance stabilization. Solvatochromism was investigated by UV-VIS spectroscopy in five different organic solvents with increasing polarity. The dynamic photoisomerization experiments have been performed in DMF by pump lasers λ=355nm (mostly E→Z) and λ=491nm (mostly Z→E) in spectral region 300nm - 800nm at equal concentrations and times of illumination in order to investigate the photodynamical trans-cis-trans properties of the CHN and NN chromophore groups of the dyes. Copyright © 2017 Elsevier B.V. All rights reserved.
Lipase-Catalyzed Production of 6-O-cinnamoyl-sorbitol from D-sorbitol and Cinnamic Acid Esters.
Kim, Jung-Ho; Bhatia, Shashi Kant; Yoo, Dongwon; Seo, Hyung Min; Yi, Da-Hye; Kim, Hyun Joong; Lee, Ju Hee; Choi, Kwon-Young; Kim, Kwang Jin; Lee, Yoo Kyung; Yang, Yung-Hun
2015-05-01
To overcome the poor properties of solubility and stability of cinnamic acid, cinnamate derivatives with sugar alcohols were produced using the immobilized Candida antarctica lipase with vinyl cinnamate and D-sorbitol as substrate at 45 °C. Immobilized C. antarctica lipase was found to synthesize 6-O-cinnamoyl-sorbitol and confirmed by HPLC and (1)H-NMR and had a preference for vinyl cinnamate over other esters such as allyl-, ethyl-, and isobutyl cinnamate as co-substrate with D-sorbitol. Contrary to D-sorbitol, vinyl cinnamate, and cinnamic acid, the final product 6-O-cinnamoyl-sorbitol was found to have radical scavenging activity. This would be the first report on the biosynthesis of 6-O-cinnamoyl-sorbitol with immobilized enzyme from C. antarctica.
Accumulation of cinnamic acid and vanillin in eggplant root ...
African Journals Online (AJOL)
The contents of cinnamic acid and vanillin in eggplant root exudates and soil were determined by HPLC. The results showed that cinnamic acid and vanillin might remain in soil after the root of eggplant is released. With the extending growth stage and planting year of eggplant, the contents in root exudates, rhizosphere and ...
The Clinical Implications of Methylated p15 and p73 Genes in Adult Acute Lymphoblastic Leukemia
International Nuclear Information System (INIS)
ABD EL-HAMID, Th.M.; SHERISHER, M.A.; MOSSALLAM, Gh.I.
2010-01-01
Aberrant methylation of promoter associated CpG islands is an epigenetic modification of DNA which is associated with gene silencing. It plays an important role in the leukemia pathogenesis. This phenomenon is frequently observed in acute lymphoblastic leukemia (ALL) and results in the functional inactivation of its associated genes. The aim of this study is to investigate the frequency and the prognostic impact of p15 and p73 genes methylation in adult acute lymphoblastic leukemia patients. Patients and Methods: Methylation-specific polymerase chain reaction (PCR) was used to analyze methylation of the p15 and p73 genes in 51 newly diagnosed adult ALL patients. Results: The methylation frequencies of p15 and p73 genes at diagnosis were 41.2% and 27.5% respectively, while concomitant methylation was detected in 14% of the patients. Concomitant methylation of p15 and p73 genes was associated with significant lower rate of CR compared to patients without methylation (57% versus 90%), p=0.008. Overall survival (OS) was not affected by p15 methylation, but was poorer with p73 methylation and the difference was near significant (p=0.059). For patients without meyhylation, the survival benefit was significant when compared to patients with p15, p73 or both genes methylation (p=0.047). The leukemia free survival was not affected by the methylation status of single gene p15 or p73, but tended to be worse in patients with methylated p15, p73 or both genes when compared to patients without methylation (p= 0.08). Conclusion: Aberrant p73 promoter methylation is a potential prognostic factor in adult ALL patients. P15 methylation is frequent in Egyptian adult ALL patients, its concomitant methylation with p73 is of poor prognostic significance. Identification of these molecular targets improve risk assessment and selection of appropriate therapy.
Naturally Occurring Cinnamic Acid Sugar Ester Derivatives
Directory of Open Access Journals (Sweden)
Yuxin Tian
2016-10-01
Full Text Available Cinnamic acid sugar ester derivatives (CASEDs are a class of natural product with one or several phenylacrylic moieties linked with the non-anomeric carbon of a glycosyl skeleton part through ester bonds. Their notable anti-depressant and brains protective activities have made them a topic of great interest over the past several decades. In particular the compound 3′,6-disinapoylsucrose, the index component of Yuanzhi (a well-known Traditional Chinese Medicine or TCM, presents antidepressant effects at a molecular level, and has become a hotspot of research on new lead drug compounds. Several other similar cinnamic acid sugar ester derivatives are reported in traditional medicine as compounds to calm the nerves and display anti-depression and neuroprotective activity. Interestingly, more than one third of CASEDs are distributed in the family Polygalaceae. This overview discusses the isolation of cinnamic acid sugar ester derivatives from plants, together with a systematic discussion of their distribution, chemical structures and properties and pharmacological activities, with the hope of providing references for natural product researchers and draw attention to these interesting compounds.
Benchmark studies of UV-vis spectra simulation for cinnamates with UV filter profile.
Garcia, Ricardo D'A; Maltarollo, Vinícius G; Honório, Káthia M; Trossini, Gustavo H G
2015-06-01
Skin cancer is a serious public health problem worldwide, being incident over all five continents and affecting an increasing number of people. As sunscreens are considered an important preventive measure, studies to develop better and safer sunscreens are crucial. Cinnamates are UVB filters with good efficiency and cost-benefit, therefore, their study could lead to the development of new UV filters. A benchmark to define the most suitable density functional theory (DFT) functional to predict UV-vis spectra for ethylhexyl methoxycinnamate was performed. Time-dependent DFT (TD-DFT) calculations were then carried out [B3LYP/6-311 + G(d,p) and B3P86/6-311 + G(d,p) in methanol environment] for seven cinammete derivatives implemented in the Gaussian 03 package. All DFT/TD-DFT simulations were performed after a conformational search with the Monte-Carlo method and MMFF94 force field. B3LYP and B3P86 functionals were better at reproducing closely the experimental spectra of ethylhexyl methoxycinnamate. Calculations of seven cinnamates showed a λmax of around 310 nm, corroborating literature reports. It was observed that the energy for the main electronic transition was around 3.95 eV and could be explained by electron delocalization on the aromatic ring and ester group, which is important to UV absorption. The methodology employed proved to be suitable for determination of the UV spectra of cinnamates and could be used as a tool for the development of novel UV filters.
Multitarget Molecular Hybrids of Cinnamic Acids
Directory of Open Access Journals (Sweden)
Aikaterini Peperidou
2014-12-01
Full Text Available In an attempt to synthesize potential new multitarget agents, 11 novel hybrids incorporating cinnamic acids and paracetamol, 4-/7-hydroxycoumarin, benzocaine, p-aminophenol and m-aminophenol were synthesized. Three hybrids—2e, 2a, 2g—and 3b were found to be multifunctional agents. The hybrid 2e derived from the phenoxyphenyl cinnamic acid and m-acetamidophenol showed the highest lipoxygenase (LOX inhibition and analgesic activity (IC50 = 0.34 μΜ and 98.1%, whereas the hybrid 3b of bromobenzyloxycinnamic acid and hymechromone exhibited simultaneously good LOX inhibitory activity (IC50 = 50 μΜ and the highest anti-proteolytic activity (IC50= 5 μΜ. The hybrid 2a of phenyloxyphenyl acid with paracetamol showed a high analgesic activity (91% and appears to be a promising agent for treating peripheral nerve injuries. Hybrid 2g which has an ester and an amide bond presents an interesting combination of anti-LOX and anti-proteolytic activity. The esters were found very potent and especially those derived from paracetamol and m-acetamidophenol. The amides follow. Based on 2D-structure–activity relationships it was observed that both steric and electronic parameters play major roles in the activity of these compounds. Molecular docking studies point to the fact that allosteric interactions might govern the LOX-inhibitor binding.
DNA Photolithography with Cinnamate Crosslinkers
Feng, Lang (Inventor); Chaikin, Paul Michael (Inventor)
2016-01-01
The present invention relates generally to cinnamate crosslinkers. Specifically, the present invention relates to gels, biochips, and functionalized surfaces useful as probes, in assays, in gels, and for drug delivery, and methods of making the same using a newly-discovered crosslinking configuration.
Energy Technology Data Exchange (ETDEWEB)
Costa, B.R. de; Thurkauf, A.; Rothman, R.R. (National Inst. of Mental Health, Bethesda, MD (USA)); Jacobson, A.E.; Rice, K.C. (National Inst. of Digestive Diabetes, and Kidney Diseases, Bethesda, MD (USA))
1990-11-01
Optically pure tritium labeled 1S,2S-(-)-trans-2-isothiocyanato-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl )benzeneacetamide, an affinity ligand specific for the kappa opioid receptor was synthesized from optically pure 1S,2S-(-)-trans-2-amino-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl)benzeneacetamide via the sequence of dibromination (57%) followed by catalytic tritiation of the dibromide. The resulting tritium labelled aniline (14% yield, specific activity 31.2 Ci/mmol) was transformed to the title compound in 13.3% yield and 99+% radiochemical purity by treatment with thiophosgene. (author).
trans-Carbonylchloridobis[diphenyl(4-vinylphenylphosphane-κP]rhodium(I
Directory of Open Access Journals (Sweden)
Reinout Meijboom
2012-05-01
Full Text Available In the title compound, trans-[RhCl(C20H17P2(CO], the RhI atom is situated on a center of symmetry, resulting in a statistical 1:1 disorder of the chloride [Rh—Cl = 2.383 (2 Å] and carbonyl [Rh—C = 1.752 (7 Å] ligands. The distorted trans square-planar environment is completed by two P atoms [Rh—P = 2.3251 (4 Å] from two diphenyl(4-vinylphenylphosphane ligands. The vinyl group is disordered over two sets of sites in a 0.668 (10:0.332 (10 ratio. The crystal packing exhibits weak C—H...Cl and C—H...O hydrogen bonds and π–π interactions between the phenyl rings of neighbouring molecules, with a centroid–centroid distance of 3.682 (2 Å.
Threshold responses in cinnamic-aldehyde-sensitive subjects: results and methodological aspects
DEFF Research Database (Denmark)
Johansen, J D; Andersen, Klaus Ejner; Rastogi, S C
1996-01-01
Cinnamic aldehyde is an important fragrance material and contact allergen. The present study was performed to provide quantitative data on the eliciting capacity of cinnamic aldehyde, to be considered in assessment of clinical relevance and health hazard. The skin response to serial dilution patch...
International Nuclear Information System (INIS)
Senent, M. L.; Puzzarini, C.; Hochlaf, M.; Domínguez-Gómez, R.; Carvajal, M.
2014-01-01
Highly correlated ab initio methods are employed to determine spectroscopic properties at low temperatures of two S-analogs of methyl formate: S-methyl thioformate CH 3 -S-CHO (MSCHO) and O-methyl thioformate CH 3 -O-CHS (MOCHS). Both species are detectable and they are expected to play an important role in Astrochemistry. Molecular properties are compared with those of the O-analog, methyl formate. Both isomers present two conformers cis and trans. cis-CH 3 -S-CHO represents the most stable structure lying 4372.2 cm −1 below cis-CH 3 -O-CHS. The energy difference between the cis and trans forms is drastically lower for MSCHO (1134 cm −1 ) than for MOCHS (1963.6 cm −1 ). Harmonic and anharmonic fundamentals and the corresponding intensities, as well as the rotational constants for the ground vibrational and first excited torsional states and the centrifugal distortions constants, are provided. Low torsional energy levels have been obtained by solving variationally a two dimensional Hamiltonian expressed in terms of the two torsional degrees of freedom. The corresponding 2D potential energy surfaces have been computed at the CCSD(T)/aug-cc-pVTZ level of theory. The methyl torsional barriers V 3 (cis) are determined to be 139.7 cm −1 (CH 3 -S-CHO) and 670.4 cm −1 (CH 3 -O-CHS). The A/E splitting of ground torsional state has been estimated to be 0.438 cm −1 for CH 3 -S-CHO and negligible for CH 3 -O-CHS
Directory of Open Access Journals (Sweden)
Adewale O. Adeloye
2011-09-01
Full Text Available In this work, two ligands: 4-(trans-2-Methyl-2-butenoic acid-2,2'-bipyridine (L1 and 5-(trans-2-methyl-2-butenoic acid-1,10-phenanthroline (L2, with the corresponding mixed-ligand heteroleptic Ru(II complex were synthesized and characterized by FT-IR, 1H-, 13C-NMR spectroscopy and elemental analysis. The influence of the mixed functionalized polypyridyl ruthenium(II complex on the photophysical and electrochemical properties were investigated and compared to individual single-ligand homoleptic complexes. Interestingly, the mixed-ligand complex formulated as [RuL1L2(NCS2] exhibits broad and intense metal-to-ligand charge transfer (MLCT absorption with a high molar extinction coefficient (λmax = 514 nm, ε = 69,700 M−1 cm−1, better than those of individual single-ligand complexes, [Ru(L12(NCS2] and [Ru(L22(NCS2], and a strong photoluminescence intensity ratio in the red region at λem = 686 nm. The electrochemical properties of the complex indicated that the redox processes are ligand-based.
Directory of Open Access Journals (Sweden)
Takako Kawasaki
2007-12-01
Full Text Available Insulin-like growth factor binding protein 3 (IGFBP3, which is induced by wild-type p53, regulates IGF and interacts with the TGF-β pathway. IGFBP3 promoter methylation may occur in colorectal cancer with or without the CpG island methylator phenotype (CIMP, which is associated with microsatellite instability (MSI and TGFBR2 mutation. We examined the relationship between IGFBP3 methylation, p53 expression, CIMP and MSI in 902 population-based colorectal cancers. Utilizing real-time PCR (MethyLight, we quantified promoter methylation in IGFBP3 and eight other CIMP-high-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1. IGFBP3 methylation was far more frequent in non-MSI-high CIMP-high tumors (85% = 35/41 than in MSI-high CIMPhigh (49% = 44/90, P < .0001, MSI-high non-CIMP-high (17% = 6/36, P < .0001, non-MSI-high non-CIMP-high tumors (22% = 152/680, P < .0001. Among CIMPhigh tumors, the inverse relationship between MSI and IGFBP3 methylation persisted in p53-negative tumors (P < .0001, but not in p53-positive tumors. IGFBP3 methylation was associated inversely with TGFBR2 mutation in MSI-high non-CIMP-high tumors (P = .02. In conclusion, IGFBP3 methylation is inversely associated with MSI in CIMP-high colorectal cancers, this relationship is limited to p53-negative tumors. Our data suggest complex relationship between global genomic/epigenomic phenomena (such as MSI/ CIMP, single molecular events (e.g., IGFBP3 methylation, TP53 mutation, TGFBR2 mutation, the related pathways.
Energy Technology Data Exchange (ETDEWEB)
Senent, M. L., E-mail: senent@iem.cfmac.csic.es [Departamento de Química y Física Teóricas, Instituto de Estructura de la Materia, IEM-C.S.I.C., Serrano 121, Madrid 28006 (Spain); Puzzarini, C., E-mail: cristina.puzzarini@unibo.it [Dipartimento di Chimica G. Ciamician, Università di Bologna, Via F. Selmi 2, I-40126 Bologna (Italy); Hochlaf, M., E-mail: hochlaf@univ-mlv.fr [Laboratoire de Modélisation et Simulation Multi Echelle, Université Paris-Est, MSME UMR 8208 CNRS, 5 boulevard Descartes, 77454 Marne-la-Vallée (France); Domínguez-Gómez, R., E-mail: rosa.dominguez@upm.es [Departamento de Ingeniería Civil, Cátedra de Química, E.U.I.T. Obras Públicas, Universidad Politécnica de Madrid, Madrid (Spain); Carvajal, M., E-mail: miguel.carvajal@dfa.uhu.es [Departamento de Física Aplicada, Facultad de Ciencias Experimentales, Unidad Asociada IEM-CSIC-U.Huelva, Universidad de Huelva, 21071 Huelva (Spain)
2014-09-14
Highly correlated ab initio methods are employed to determine spectroscopic properties at low temperatures of two S-analogs of methyl formate: S-methyl thioformate CH{sub 3}-S-CHO (MSCHO) and O-methyl thioformate CH{sub 3}-O-CHS (MOCHS). Both species are detectable and they are expected to play an important role in Astrochemistry. Molecular properties are compared with those of the O-analog, methyl formate. Both isomers present two conformers cis and trans. cis-CH{sub 3}-S-CHO represents the most stable structure lying 4372.2 cm{sup −1} below cis-CH{sub 3}-O-CHS. The energy difference between the cis and trans forms is drastically lower for MSCHO (1134 cm{sup −1}) than for MOCHS (1963.6 cm{sup −1}). Harmonic and anharmonic fundamentals and the corresponding intensities, as well as the rotational constants for the ground vibrational and first excited torsional states and the centrifugal distortions constants, are provided. Low torsional energy levels have been obtained by solving variationally a two dimensional Hamiltonian expressed in terms of the two torsional degrees of freedom. The corresponding 2D potential energy surfaces have been computed at the CCSD(T)/aug-cc-pVTZ level of theory. The methyl torsional barriers V{sub 3}(cis) are determined to be 139.7 cm{sup −1} (CH{sub 3}-S-CHO) and 670.4 cm{sup −1} (CH{sub 3}-O-CHS). The A/E splitting of ground torsional state has been estimated to be 0.438 cm{sup −1} for CH{sub 3}-S-CHO and negligible for CH{sub 3}-O-CHS.
Shibamoto, Shigeaki; Gooley, Andrew; Yamamoto, Kouhei
2015-01-01
Using a strongly polar cyanopropyl capillary column we have investigated the gas chromatography (GC) separation behaviors of 24 octadecadienoic acid methyl ester (18:2ME) isomers compared against saturated methyl stearate (18:0ME) and arachidic acid methyl ester (20:0ME), and the dependency on the GC column temperature. The 24 isomers were obtained by performing cis-to trans-isomerization of six regioisomers: five of the 18:2ME isomers were prepared by the partial reduction of methyl α-linolenate and methyl γ-linolenate C18 trienoic acids with different double bond positions, whereas the sixth isomer, 18:2ME (c5, c9), was obtained from a raw constituent fatty acid methyl ester (FAME) sample extracted from Japanese yew seeds. There are no reference standards commercially available for 18:2ME isomers, and in elucidating the elution order of these isomers this study should help the future identification of cis- and trans-type of 18:2ME. We also report the identification method of cis- and trans-type of FAME using equivalent chain lengths and attempt the identification of cis- and trans-type of 18:2ME isomers from partially hydrogenated canola oil.
Enantioselective kappa opioid binding sites on the macrophage cell line, P388d sub 1
Energy Technology Data Exchange (ETDEWEB)
Carr, D.J.J.; Blalock, J.E. (Univ. of Alabama, Birmingham (USA)); DeCosta, B.R.; Jacobson, A.E.; Rice, K.C. (NIDDK, NIH, Bethesda, MD (USA))
1991-01-01
A kappa opioid binding site has been characterized on the macrophage cell line, P388d{sub 1}, using the kappa selective affinity ligand, ({sup 3H}(1S,2S)-(-)-trans-2-isothiocyanato-N-methyl-N-(2-(1-phrrolidinyl) cyclohexyl) benzeneacetamide ((-)BD166). The kappa site has a relative molecular mass (Mr) of 38,000 under nonreducing conditions and 42,000 under reducing conditions. Moreover, it exhibits enantioselectivity in that 1S,2S-(-)-trans-3,4-dichloro-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl) benzeneacetamide ((-)-U-50,488) blocks ({sup 3}H)95{alpha},7{alpha},8{beta})-(-)-N-methyl-N-(7-(1- pyrrolidinyl)-1-oxaspiro-(4,5)-dec-8-yl)benzeneacetamide (U-69,593) binding to P388d{sub 1} cells with an IC{sub 50} = 7.0 nM whereas 1R,2R-(+)-trans-3,4-dichloro-N-methyl-N-(2-(1-pyrrolidinyl)cyclohexyl) benzeneacetamide ((+)U-50,488) blocks ({sup 3}H)U-69,593 binding to P388d{sub 1} cells with an IC{sub 50} = 700 nM.
Institute of Scientific and Technical Information of China (English)
QIU Kunyuan; SHUI Li; FENG Xinde
1984-01-01
Radical polymerization of methyl methacrylate (MMA) initiated with various diacyl peroxideamine systems was studied. Benzoyl peroxide (BPO) and lauroyl peroxide (LPO) were used as diacyl peroxide component, N,N-dimethyl aniline (DMA) and its para substituted derivatives, i.e., N,N-dimethyl-p-toluidine (DMT), p-hydroxymethyl-N,N-dimethyl aniline (HDMA), p-nitro-N,N-dimethyl aniline (NDMA) and p-dimethylamino benzaldehyde (DMAB) were used as amine components. It was found that the peroxide-DMT systems give higher rates of bulk polymerization Rp of MMA than the organic hydroperoxide-DMT systems with the following descending order BPO-DMT>LPO-DMT>CHP (cumene hydroperoxide)-DMT>TBH (tert-butyl hydroperoxide)-DMT.The aromatic tertiary amines possess obvious structural effect on the Rp values in the diacyl peroxideamine system. The overall activation energy of MMA polymerization was determined and the kinetics of polymerization of MMA initiated with BPO-DMT system was investigated.
Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)
International Nuclear Information System (INIS)
Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant'Anna, Carlos M.R.; Benassi Neto, Mario; Eberlin, Marcos N.; Braz-Filho, Raimundo
2010-01-01
The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1->5)-β-D-apiofuranosyl-(1->6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete 1 H and 13 C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)
High CpG island methylation of p16 gene and loss of p16 protein
Indian Academy of Sciences (India)
Methylation-specific polymerase chain reaction (MSP) was employed to detect CpG island methylation in p16 promoter region andWestern blotting was used to detect p16 expression of all subjects. Real-time fluorescence quantitative polymerase chain reaction (FQ-PCR) was performed to test p16 mRNA expression.
Vapor pressures of dimethylcadmium, trimethylbismuth, and tris(dimethylamino)antimony
Czech Academy of Sciences Publication Activity Database
Morávek, Pavel; Fulem, Michal; Pangrác, Jiří; Hulicius, Eduard; Růžička, K.
2013-01-01
Roč. 360, Dec (2013), s. 106-110 ISSN 0378-3812 R&D Projects: GA ČR GA13-15286S; GA MŠk(CZ) LM2011026 Institutional support: RVO:68378271 Keywords : vapor pressure * dimethylcadmium * trimethylbismuth * tris(dimethylamino)antimony * sublimation and vaporization enthalpy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.241, year: 2013
Effect of Trans, Trans-Farnesol on Pseudogymnoascus destructans and Several Closely Related Species.
Raudabaugh, Daniel B; Miller, Andrew N
2015-12-01
Bat white-nose syndrome, caused by the psychrophilic fungus Pseudogymnoascus destructans, has dramatically reduced the populations of many hibernating North American bat species. The search for effective biological control agents targeting P. destructans is of great importance. We report that the sesquiterpene trans, trans-farnesol, which is also a Candida albicans quorum sensing compound, prevented in vitro conidial germination for at least 14 days and inhibited growth of preexisting hyphae of five P. destructans isolates in filtered potato dextrose broth at 10 °C. Depending on the inoculation concentrations, both spore and hyphal inhibition occurred upon exposure to concentrations as low as 15-20 µM trans, trans-farnesol. In contrast, most North American Pseudogymnoascus isolates were more tolerant to the exposure of trans, trans-farnesol. Our results suggest that some Candida isolates may have the potential to inhibit the growth of P. destructans and that the sesquiterpene trans, trans-farnesol has the potential to be utilized as a biological control agent.
Hu, Shuang; Yang, Xiao; Xue, Jiao; Chen, Xuan; Bai, Xiao-Hong; Yu, Zhi-Hui
2017-07-01
A novel graphene/dodecanol floating solidification microextraction followed by HPLC with diode-array detection has been developed to extract trace levels of four cinnamic acid derivatives in traditional Chinese medicines. Several parameters affecting the performance were investigated and optimized. Also, possible microextraction mechanism was analyzed and discussed. Under the optimum conditions (amount of graphene in dodecanol: 0.25 mg/mL; volume of extraction phase: 70 μL; pH of sample phase: 3; extraction time: 30 min; stirring rate: 1000 rpm; salt amount: 26.5% NaCl; volume of sample phase: 10 mL, and without dispersant addition), the enrichment factors of four cinnamic acid derivatives ranged from 26 to 112, the linear ranges were 1.0 × 10 -2 -10.0 μg/mL for caffeic acid, 1.3 × 10 -3 -1.9 μg/mL for p-hydroxycinnamic acid, 2.8 × 10 -3 -4.1 μg/mL for ferulic acid, and 2.7 × 10 -3 -4.1 μg/mL for cinnamic acid, with r 2 ≥ 0.9993. The detection limits were found to be in the range of 0.1-1.0 ng/mL, and satisfactory recoveries (92.5-111.2%) and precisions (RSDs 1.1-9.5%) were also achieved. The results showed that the approach is simple, effective and sensitive for the preconcentration and determination of trace levels of cinnamic acid derivatives in Chinese medicines. The proposed method was compared with conventional dodecanol floating solidification microextraction and other extraction methods. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Putschögl, M.; Zirak, P.; Penzkofer, A.
2008-01-01
The absorption and fluorescence behaviour of trans- p-coumaric acid ( trans-4-hydroxycinnamic acid) is investigated in buffered aqueous solution over a wide range from pH 1 to pH 12, in un-buffered water, and in some organic solvents. Absorption cross-section spectra, fluorescence quantum distributions, fluorescence quantum yields, and degrees of fluorescence polarisation are measured. p-Coumaric acid exists in different ionic forms in aqueous solution depending on the pH. There is an equilibrium between the neutral form ( p-CAH 2) and the single anionic form ( p-CAH -) at low pH (p Kna ≈ 4.9), and between the single anionic and the double anionic form ( p-CA 2-) at high pH (p Kaa ≈ 9.35). In the organic solvents studied trans- p-coumaric acid is dissolved in its neutral form. The fluorescence quantum yield of trans- p-coumaric acid in aqueous solution is ϕF ≈ 1.4 × 10 -4 for the neutral and the single anionic form, while it is ϕF ≈ 1.3 × 10 -3 for the double anionic form. For trans- p-coumaric acid in organic solvents fluorescence quantum yields in the range from 4.8 × 10 -5 (acetonitrile) to 1.5 × 10 -4 (glycerol) were measured. The fluorescence spectra are 7700-10,000 cm -1 Stokes shifted in aqueous solution, and 5400-8200 cm -1 Stokes shifted in the studied organic solvents. Decay paths responsible for the low fluorescence quantum yields are discussed (photo-isomerisation and internal conversion for p-CA 2-, solvent-assisted intra-molecular charge-transfer or ππ ∗ to nπ ∗ transfer and internal conversion for p-CAH 2 and p-CAH -). The solvent dependence of the first ππ ∗ electronic transition frequency and of the fluorescence Stokes shift of p-CAH 2 is discussed in terms of polar solute-solvent interaction effects. Thereby the ground-state and excite-state molecular dipole moments are extracted.
International Nuclear Information System (INIS)
Putschoegl, M.; Zirak, P.; Penzkofer, A.
2008-01-01
The absorption and fluorescence behaviour of trans-p-coumaric acid (trans-4-hydroxycinnamic acid) is investigated in buffered aqueous solution over a wide range from pH 1 to pH 12, in un-buffered water, and in some organic solvents. Absorption cross-section spectra, fluorescence quantum distributions, fluorescence quantum yields, and degrees of fluorescence polarisation are measured. p-Coumaric acid exists in different ionic forms in aqueous solution depending on the pH. There is an equilibrium between the neutral form (p-CAH 2 ) and the single anionic form (p-CAH - ) at low pH (pK na ∼ 4.9), and between the single anionic and the double anionic form (p-CA 2- ) at high pH (pK aa ∼ 9.35). In the organic solvents studied trans-p-coumaric acid is dissolved in its neutral form. The fluorescence quantum yield of trans-p-coumaric acid in aqueous solution is φ F ∼ 1.4 x 10 -4 for the neutral and the single anionic form, while it is φ F ∼ 1.3 x 10 -3 for the double anionic form. For trans-p-coumaric acid in organic solvents fluorescence quantum yields in the range from 4.8 x 10 -5 (acetonitrile) to 1.5 x 10 -4 (glycerol) were measured. The fluorescence spectra are 7700-10,000 cm -1 Stokes shifted in aqueous solution, and 5400-8200 cm -1 Stokes shifted in the studied organic solvents. Decay paths responsible for the low fluorescence quantum yields are discussed (photo-isomerisation and internal conversion for p-CA 2- , solvent-assisted intra-molecular charge-transfer or ππ* to nπ* transfer and internal conversion for p-CAH 2 and p-CAH - ). The solvent dependence of the first ππ* electronic transition frequency and of the fluorescence Stokes shift of p-CAH 2 is discussed in terms of polar solute-solvent interaction effects. Thereby the ground-state and excite-state molecular dipole moments are extracted
Rho, Ho Sik; Hong, Soo Hyun; Park, Jongho; Jung, Hyo-Il; Park, Young-Ho; Lee, John Hwan; Shin, Song Seok; Noh, Minsoo
2014-05-01
The subcutaneous fat tissue mass gradually decreases with age, and its regulation is a strategy to develop anti-aging compounds to ameliorate the photo-aging of human skin. The adipogenesis of human adipose tissue-mesenchymal stem cells (hAT-MSCs) can be used as a model to discover novel anti-aging compounds. Cinnamomum cassia methanol extracts were identified as adipogenesis-promoting agents by natural product library screening. Cinnamates, the major chemical components of Cinnamomum cassia extracts, promoted adipogenesis in hAT-MSCs. We synthesized kojyl cinnamate ester derivatives to improve the pharmacological activity of cinnamates. Structure-activity studies of kojyl cinnamate derivatives showed that both the α,β-unsaturated carbonyl ester group and the kojic acid moiety play core roles in promoting adiponectin production during adipogenesis in hAT-MSCs. We conclude that kojyl cinnamate ester derivatives provide novel pharmacophores that can regulate adipogenesis in hAT-MSCs. Copyright © 2014 Elsevier Ltd. All rights reserved.
Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...
Fridlyand, Aleksandr; Goldsborough, S Scott; Brezinsky, Kenneth
2015-07-16
The high pressure and temperature oxidation of methyl trans-2-nonenoate, methyl trans-3-nonenoate, 1-octene, and trans-2-octene are investigated experimentally to probe the influence of the double bond position on the chemical kinetics of long esters and alkenes. Single pulse shock tube experiments are performed in the ranges p = 3.8-6.2 MPa and T = 850-1500 K, with an average reaction time of 2 ms. Gas chromatographic measurements indicate increased reactivity for trans-2-octene compared to 1-octene, whereas both methyl nonenoate isomers have reactivities similar to that of 1-octene. A difference in the yield of stable intermediates is observed for the octenes when compared to the methyl nonenoates. Chemical kinetic models are developed with the aid of the Reaction Mechanism Generator to interpret the experimental results. The models are created using two different base chemistry submodels to investigate the influence of the foundational chemistry (i.e., C0-C4), whereas Monte Carlo simulations are performed to examine the quality of agreement with the experimental results. Significant uncertainties are found in the chemistry of unsaturated esters with the double bonds located close to the ester groups. This work highlights the importance of the foundational chemistry in predictive chemical kinetics of biodiesel combustion at engine relevant conditions.
International Nuclear Information System (INIS)
Marzoni, G.; Wheeler, W.J.; Garbrecht, W.L.
1988-01-01
The 5HT 2 -receptor antagonist, [ 14 C]-labeled brace[trans-(8β)]-6-methyl-1-(1-methylethyl)ergoline-8-carboxylic acid, 4-methoxycyclohexyl ester (Z)-2-butenedioate (1:1)brace (LY281067) was synthesized from unlabeled 6-methyl-1-(1-methylethyl)ergoline-8-carboxylic acid. The [ 14 C] label was introduced into the carboxyl group attached to the 8 position of the ergoline nucleus. This site is stable to metabolism. The synthesis involves removal of an unlabeled carboxyl group and subsequent reinsertion of a [ 14 C]-labeled carboxyl group into the same position. The radiolabel is not introduced until near the end of the synthesis which allows for ease of handling and scale-up of intermediates. (author)
Effect of methylation on the side-chain pKa value of arginine.
Evich, Marina; Stroeva, Ekaterina; Zheng, Yujun George; Germann, Markus W
2016-02-01
Arginine methylation is important in biological systems. Recent studies link the deregulation of protein arginine methyltransferases with certain cancers. To assess the impact of methylation on interaction with other biomolecules, the pKa values of methylated arginine variants were determined using NMR data. The pKa values of monomethylated, symmetrically dimethylated, and asymmetrically dimethylated arginine are similar to the unmodified arginine (14.2 ± 0.4). Although the pKa value has not been significantly affected by methylation, consequences of methylation include changes in charge distribution and steric effects, suggesting alternative mechanisms for recognition. © 2015 The Protein Society.
Energy Technology Data Exchange (ETDEWEB)
Putschoegl, M.; Zirak, P. [Institut II - Experimentelle und Angewandte Physik, Universitaet Regensburg, Universitaetsstrasse 31, D-93053 Regensburg (Germany); Penzkofer, A. [Institut II - Experimentelle und Angewandte Physik, Universitaet Regensburg, Universitaetsstrasse 31, D-93053 Regensburg (Germany)], E-mail: alfons.penzkofer@physik.uni-regensburg.de
2008-01-22
The absorption and fluorescence behaviour of trans-p-coumaric acid (trans-4-hydroxycinnamic acid) is investigated in buffered aqueous solution over a wide range from pH 1 to pH 12, in un-buffered water, and in some organic solvents. Absorption cross-section spectra, fluorescence quantum distributions, fluorescence quantum yields, and degrees of fluorescence polarisation are measured. p-Coumaric acid exists in different ionic forms in aqueous solution depending on the pH. There is an equilibrium between the neutral form (p-CAH{sub 2}) and the single anionic form (p-CAH{sup -}) at low pH (pK{sub na} {approx} 4.9), and between the single anionic and the double anionic form (p-CA{sup 2-}) at high pH (pK{sub aa} {approx} 9.35). In the organic solvents studied trans-p-coumaric acid is dissolved in its neutral form. The fluorescence quantum yield of trans-p-coumaric acid in aqueous solution is {phi}{sub F} {approx} 1.4 x 10{sup -4} for the neutral and the single anionic form, while it is {phi}{sub F} {approx} 1.3 x 10{sup -3} for the double anionic form. For trans-p-coumaric acid in organic solvents fluorescence quantum yields in the range from 4.8 x 10{sup -5} (acetonitrile) to 1.5 x 10{sup -4} (glycerol) were measured. The fluorescence spectra are 7700-10,000 cm{sup -1} Stokes shifted in aqueous solution, and 5400-8200 cm{sup -1} Stokes shifted in the studied organic solvents. Decay paths responsible for the low fluorescence quantum yields are discussed (photo-isomerisation and internal conversion for p-CA{sup 2-}, solvent-assisted intra-molecular charge-transfer or {pi}{pi}* to n{pi}* transfer and internal conversion for p-CAH{sub 2} and p-CAH{sup -}). The solvent dependence of the first {pi}{pi}* electronic transition frequency and of the fluorescence Stokes shift of p-CAH{sub 2} is discussed in terms of polar solute-solvent interaction effects. Thereby the ground-state and excite-state molecular dipole moments are extracted.
Koten, G. van; Hoedt, R.W.M. ten; Noltes, J.G.
1979-01-01
Dimethylamino- and dimethylaminomethyl-substituted diarylacetylenes were prepared by the Pd(PPh{3}){4}-catalyzed coupling reaction of dimethylamino- and dimethylaminomethyl-substituted aryl halides with arylacetylenes.Reaction of the asymmetric diarylacetylenes with methylmagnesium bromide in the
Chunli Xu; Lidong Cao; Pengyue Zhao; Zhaolu Zhou; Chong Cao; Feng Zhu; Fengmin Li; Qiliang Huang
2018-01-01
Controllable pesticide release in response to environmental stimuli is highly desirable for better efficacy and fewer adverse effects. Combining the merits of natural and synthetic polymers, pH and temperature dual-responsive chitosan copolymer (CS-g-PDMAEMA) was facilely prepared through free radical graft copolymerization with 2-(dimethylamino) ethyl 2-methacrylate (DMAEMA) as the vinyl monomer. An emulsion chemical cross-linking method was used to expediently fabricate pyraclostrobin micro...
Impedance and Interface Properties of Al/Methyl-Red/p-In P Solar Cell
International Nuclear Information System (INIS)
Gullu, O
2009-01-01
An Al/methyl-red/p-In P solar cell was fabricated via solution-processing method and was characterized by using current-voltage (I-V) and capacitance-voltage-frequency (C-V-f) measurements at room temperature. From dark I-V characteristics, the values of ideality factor and barrier height of the device were calculated as 1.11 eV and 2.02, respectively. It has been seen that the device exhibited a good photovoltaic behavior with a maximum open circuit voltage Voc of 0.38 V and short-circuit current Isc of 2.8 nA under only 200 lx light intensity. The barrier height and acceptor carrier concentration values for the Al/methyl-red/p-InP devices were extracted as 1.27 eV and 3.46 x1017cm -3 from linear region of its C-2-V characteristics, respectively. The difference between Fb (I-V) and Fb (C-V) for Al/methyl-red/p-InP device was attributed the different nature of the I-V and C-V measurements. Also, the energy distribution curves of the interface states and their time constants were obtained from the experimental conductance properties of the Al/methyl-red/p-InP structure at room temperature. The interface state densities and their relaxation times of the device have ranged from 2.96x1012 cm -2 eV-1 and 4.96x10-6 s at (1.11-Ev) eV to 5.19x1012 cm -2 eV-1 and 9.39x10-6 s at (0.79-Ev) eV, respectively. It was seen that both the interface state density and the relaxation time of the interface states have decreased with bias voltage from experimental results
High CpG island methylation of p16 gene and loss of p16 protein ...
Indian Academy of Sciences (India)
SI-JU GAO
The study subjects consisted of 75 healthy controls and 63 ToF ... Additionally, our analysis suggested that CpG island methylation in p16 promoters in ToF ..... reduced p16 protein expression in lung cancer (Kondo et al. 2006). In this context ..... promoter methylation in gastric carcinogenesis: a meta-analysis. Mol. Biol. Rep.
International Nuclear Information System (INIS)
Kovalchukova, O. V.; Stash, A. I.; Strashnova, S. B.; Romashkina, E. P.; Zaitsev, B. E.
2010-01-01
The complex compounds (H 3 L . Cl)[CoCl 4 ] (I) and H 2 L[CuBr 4 ] (II), where L is 2,4,6-tri(N,N-dimethylamino)methylphenol, were isolated in the crystalline state and studied by X-ray diffraction. The organic cations were found to be outer-sphere ligands. All three nitrogen atoms of the tertiary amino groups are protonated. In compound I, the H 3 L 3+ cation exists as the cis tautomer. In compound II, the H 2 L 2+ dication exists as the trans isomer. In the crystal structure, the dications are arranged in layers via hydrogen bonds.
Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)
Energy Technology Data Exchange (ETDEWEB)
Cornelius, Marli T.F.; Carvalho, Mario G. de; Silva, Tania M.S. da; Alves, Cassia C.F.; Siston, Ana P.N.; Alves, Kelly Z.; Sant' Anna, Carlos M.R., E-mail: mgeraldo@ufrrj.b [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil). Dept. de Quimica; Benassi Neto, Mario; Eberlin, Marcos N. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacases, RJ (Brazil). Setor de Quimica de Produtos Naturais. Lab. de Ciencias Quimicas
2010-07-01
The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-{beta}-D-apiofuranosyl-(1->5)-{beta}-D-apiofuranosyl-(1->6)-{beta}-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans-coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solamargine (13), 20-epi-solamargine (14) and solasonine (16) were isolated from the methanolic extract of the green fruits. The derivatives 3,5,7,4'-tretra-O-methyl-kaempferol (4), 3,7,4'-tri-O-methyl-kaempferol (5), 3,7,4'-tri-O-methyl-5-O-acetyl-kaempferol (6), the peracetyl-episolamargine (15) and peracetyl-solasonine (17) were prepared. The structures were established through the analysis of their spectral data. The complete {sup 1}H and {sup 13}C NMR data assignments of the new peracetyl derivatives of the alkaloids were made. (author)
Etika, S. B.; Nasra, E.; Rilaztika, I.
2018-04-01
Synthesis and characterization of compound C-Cinnamal Calix [4] Resorsinarena (CCCR) of cinnamon oil waste have been done. This study was aimed to synthesis and characterize C-Cinnamal Calix [4] Resorsinarena from cinnamaldehyde violated cinnamon oil waste. C-Cinnamal Calix [4] Resorsinarena was synthesized by electrophilic substitution reaction of cinnamaldehyde isolated by the acid and resorcinol at 77oC temperature for 2 hour. The data analysis spectrum UV-VIS and FT-IR showed that the compound isolated cinnamaldehyde same as pure cinnamaldehyde compound. The characterization of C-Cinnamal Calix [4] Resorsinarena in the form of reddish-colored solids with melting point 3580C by using UV-VIS showed the presence of double bond, FT-IR showed the absorption at the wave number 3323,94 cm-1 indicating the ‑OH group, the wave number 1610,94 cm-1 showed the vibration C=C, the strong region absorption of 1500,86 cm-1 indicating the presence of an aromatic ring, the at 1442,88 cm-1 wave number indicating the presence of CH3.
Directory of Open Access Journals (Sweden)
I. JURANIC
2000-11-01
Full Text Available The pKa values for a series of eight p-substituted trans-2,3-epoxy-4-phenyl butanoic acids (p-substituted trans-b-aroylepoxyacrylic acids have been determined potentiometrically in aqueous media at 25°C at an ionic strength of 0.1 mol/dm3 (NaCl. The transmission of polar effects from the substituents on the phenyl nucleus to the carboxylic group through the side chain involving a carbonyl group and an epoxide ring was investigated. The pKa values were correlated with structure using the Hammett, Taft and Yukawa-Tsuno approaches. The Hammett r constant (0.34 was compared with analogue values for structurally similar acids.
Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...
40 CFR 721.10176 - Amides, peanut-oil, N-[3-(dimethylamino)propyl].
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Amides, peanut-oil, N-[3... Specific Chemical Substances § 721.10176 Amides, peanut-oil, N-[3-(dimethylamino)propyl]. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as amides...
Energy Technology Data Exchange (ETDEWEB)
Pannipara, Mehboobali [Department of Chemistry, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Asiri, Abdullah M. [Department of Chemistry, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Center of Excellence for Advanced Materials Research, King Abdulaziz University, Jeddah 21589, P.O. Box 80203 (Saudi Arabia); Alamry, Khalid A. [Department of Chemistry, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Salem, Ibrahim A. [Department of Chemistry, Faculty of Science, Tanta University, 31527 Tanta (Egypt); El-Daly, Samy A., E-mail: samyeldaly@yahoo.com [Department of Chemistry, Faculty of Science, King Abdulaziz University, P.O. Box 80203, Jeddah 21589 (Saudi Arabia); Department of Chemistry, Faculty of Science, Tanta University, 31527 Tanta (Egypt)
2015-01-15
A new fluorophore, (2Z)-3-[4-(dimethylamino) phenyl]-2-(4-fluorophenyl) prop-2-ene-nitrile (DPF), was synthesized by knoevenagel condensation of 4-(dimethylamino) benzaldehyde and 4-fluorobenzyl cyanide in ethanol using NaOH as base. The electronic absorption and emission characteristic of DPF were studied in different solvents. The X-ray crystallographic structure of DPF was also investigated. DPF exhibits a red-shift in its emission spectrum as solvent polarity increases, indicating a large change in the dipole moment of dye molecule upon excitation due to intramolecular charge transfer in excited DPF{sup ⁎}. The fluorescence quantum yield depends strongly on the properties of the solvents, which was attributed to positive and negative solvatokinetic effects. A crystalline solid of DPF gives a strong yellow emission at about 532 nm; these phenomena are important for the application of DPF dye in organic photoemitting diode. The photochemical quantum yield of cis–trans isomerization of DPF was also determined in different solvents. The DPF dye displays solubilization in both cationic (CTAB) and anionic (SDS) micelle and may be used as a probe to determine the critical micelle concentration (CMC) of SDS and CTAB. - Highlights: • Organic pi conjugated molecule with a donor acceptor group was studied. • Crystalline solid of the molecule shows strong and intense yellow emission. • The dye displays solubilization in cationic micelle with abrupt change in emission intensity at CMC. • This work gives an insight into the application of organic luminescent material in various fields.
International Nuclear Information System (INIS)
Kumar Paul, Bijan; Samanta, Anuva; Kar, Samiran; Guchhait, Nikhil
2010-01-01
Intramolecular charge transfer (ICT) reaction has been investigated in 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester (DPDAME) using spectroscopic techniques. The molecule DPDAME shows local emission in non-polar solvent and dual emission in polar solvents. Solvatochromic effects on the Stokes shifted emission band clearly demonstrate the charge transfer character of the excited state. Quantum chemical calculations have been performed at Hartree-Fock (HF) and density functional theoretical (DFT) levels to correlate the experimental findings. Potential energy curves (PECs) for the ICT reaction have been evaluated along the donor twist angle at DFT and time dependent density functional theory (TDDFT) levels for the ground and excited states, respectively, using B3LYP hybrid functional and 6-31G** basis set. The solvent effects on the spectral properties have been explored theoretically at the same level with time dependent density functional theory-polarized continuum model (TDDFT-PCM) and the theoretical results are found to well substantiate the solvent polarity dependent Stokes shifted emission of DPDAME. Huge enhancement of dipole moment (Δμ=16.42 D) of the molecule following photoexcitation dictates the highly polar character of the excited state. Although elucidation of PECs does not exactly predict the operation of ICT according to twisted intramolecular charge transfer (TICT) model in DPDAME, lowering of vertical transition energy as a function of the donor twist coordinate scripts the occurrence of red shifted emission as observed experimentally.
A green Hunsdiecker reaction of cinnamic acids
Energy Technology Data Exchange (ETDEWEB)
Sodre, Leonardo R.; Esteves, Pierre M.; Mattos, Marcio C. S. de, E-mail: pesteves@iq.ufrj.br, E-mail: mmattos@iq.ufrj.br [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil). Instituto de Quimica. Departamento de Quimica
2013-02-15
Tribromo- and trichloroisocyanuric acids react with cinnamic acids in NaOH/H{sub 2}O/Et{sub 2}O at room temperature to produce (E)-2-halostyrenes regioselectively in 25-95% yield. Mechanism studies using Hammett correlations and DFT (density functional theory) calculations have shown that this reaction has as rate determining step the electrophilic addition of chlorine atom to the double bond. (author)
trans-Carbonylchloridobis[tris(naphthalen-1-ylphosphane-κP]rhodium(I acetone trisolvate
Directory of Open Access Journals (Sweden)
Reinout Meijboom
2011-10-01
Full Text Available In the title compound, trans-[RhCl{P(C10H73}2(CO]·3C3H6O, where P(C10H73 is trinaphthylphosphine, the Rh—P bond lengths are 2.3360 (10 and 2.3258 (10 Å, while the Rh—Cl bond length is 2.3525 (11 Å. The coordination around the Rh atom shows a slightly distorted square-planar arrangement.
International Nuclear Information System (INIS)
Santos, Fernanda G.; Bonkovoski, Leticia C.; Witt, Maria A.; Rubira, Adley F.; Muniz, Edvani C.
2015-01-01
The present work comprises the fabrication of nanofiber meshes of polycaprolactone (PCL)/poly [(2-dimethylamino) ethyl methacrylate] (PDMAEMA) and the subsequent immobilization of silver nanoparticles, in order to obtain materials with potential application in tissue engineering. The nanofibers composed of different ratios of PDMAEMA / PCL (m/m) were obtained by electrospinning. These nanofiber meshes were then immersed in colloidal suspensions containing the AgNPs under different pH values to immobilize the nanoparticles onto the fiber's surface. A greater amount of AgNPs was deposited when the fibers were immersed in a solution of pH 5, as one can observe from the scanning electron microscopy (SEM) images and the X-ray spectroscopy (EDS) spectra. It was observed that the meshes of the blends suffered morphological changes after immersion in acid solution (pH 5), and, the deposition of AgNPs onto the meshes in general was more effective in acid environment (pH 5). (author)
Li, Xin; Wang, Jun; Zhang, Xiaojian; Chen, Chao
2015-06-01
Powdered activated carbon (PAC) adsorption of two fishy odorants, trans,trans-2,4-heptadienal (HDE) and trans,trans-2,4-decadienal (DDE), was investigated. Both the pseudo first-order and the pseudo second-order kinetic models well described the kinetics curves, and DDE was more readily removed by PAC. In isotherm tests, both Freundlich and Modified Freundlich isotherms fitted the experimental data well. PAC exhibited a higher adsorption capacity for DDE than for HDE, which could be ascribed to the difference in their hydrophobicity. The calculated thermodynamic parameters (ΔG0, ΔH0, and ΔS0) indicated an exothermic and spontaneous adsorption process. PAC dosage, pH, and natural organic matter (NOM) presence were found to influence the adsorption process. With increasing PAC dosage, the pseudo first-order and pseudo second-order rate constants both increased. The value of pH had little influence on HDE or DDE molecules but altered the surface charge of PAC, and the maximum adsorption capacity occurred at pH9. The presence of NOM, especially the fraction with molecular weight less than 1k Dalton, hindered the adsorption. The study showed that preloaded NOM impaired the adsorption capacity of HDE or DDE more severely than simultaneously fed NOM did. Copyright © 2015. Published by Elsevier B.V.
How polyamine synthesis inhibitors and cinnamic acid affect tropane alkaloid production.
Marconi, Patricia L; Alvarez, María A; Pitta-Alvarez, Sandra I
2007-01-01
Hairy roots of Brugmansia candida produce the tropane alkaloids scopolamine and hyoscyamine. In an attempt to divert the carbon flux from competing pathways and thus enhance productivity, the polyamine biosynthesis inhibitors cyclohexylamine (CHA) and methylglyoxal-bis-guanylhydrazone (MGBG) and the phenylalanine-ammonia-lyase inhibitor cinnamic acid were used. CHA decreased the specific productivity of both alkaloids but increased significantly the release of scopolamine (approx 500%) when it was added in the mid-exponential phase. However, when CHA was added for only 48 h during the exponential phase, the specific productivity of both alkaloids increased (approx 200%), favoring scopolamine. Treatment with MGBG was detrimental to growth but promoted release into the medium of both alkaloids. However, when it was added for 48 h during the exponential phase, MGBG increased the specific productivity (approx 200%) and release (250- 1800%) of both alkaloids. Cinnamic acid alone also favored release but not specific productivity. When a combination of CHA or MGBG with cinnamic acid was used, the results obtained were approximately the same as with each polyamine biosynthesis inhibitor alone, although to a lesser extent. Regarding root morphology, CHA inhibited growth of primary roots and ramification. However, it had a positive effect on elongation of lateral roots.
Trans-generational responses to low pH depend on parental gender in a calcifying tubeworm
Lane, Ackley; Campanati, Camilla; Dupont, Sam; Thiyagarajan, Vengatesen
2015-01-01
The uptake of anthropogenic CO2 emissions by oceans has started decreasing pH and carbonate ion concentrations of seawater, a process called ocean acidification (OA). Occurring over centuries and many generations, evolutionary adaptation and epigenetic transfer will change species responses to OA over time. Trans-generational responses, via genetic selection or trans-generational phenotypic plasticity, differ depending on species and exposure time as well as differences between individuals su...
International Nuclear Information System (INIS)
Wilcox, B.E.; Ho, D.M.; Deutsch, E.
1989-01-01
Technetium(III) complexes of the general formula cis(Cl),trans(P)-[TcCl 2 (P) 2 L] + , where (P) is dimethylphenylphosphine (PMe 2 Ph) or ethyldiphenylphosphine (PEtPh 2 ) and L is 2,2'-bipyridine (bpy), 4,4'-dimethyl-2,2'-bipyridine (Me 2 bpy), or 1,10-phenanthroline (phen), have been synthesized and characterized. They are prepared by L substitution onto, with concomitant displacement of one chloride and one phosphine ligand from, the mer-TcCl 3 (P) 3 starting material in refluxing ethanol. Analysis of these complexes by fast atom bombardment mass spectrometry (in the positive ion mode) provides fingerprint mass spectra that exhibit peaks assigned to the molecular ion M + as well as peaks assigned to M + minus one or more monodentate ligands. Results of single-crystal x-ray structure determinations of cis(Cl),trans(P)-[TcCl 2 (PMe 2 Ph) 2 (bpy)]BPh 4 (A), cis(Cl),trans(P)-[TcCl 2- (PMe 2 Ph) 2 (phen)]BPh 4 (B), and cis(Cl),trans(P)-[TcCl 2 (PEtPh 2 ) 2 (bpy)]SO 3 CF 3 (C), with formula weights of 921.62, 945.64, and 903.65, respectively are reported. 26 refs., 5 figs., 5 tabs
Photophysical and photochemical study of styrene dyes related to their laser efficiency
International Nuclear Information System (INIS)
Meyer, Martine
1989-01-01
The photophysical and photochemical properties of two styrene dyes: 4-dicyanomethylene-2-methyl-6-p-dimethylamino-styryl-4H-pyran (DCM) and 7-dimethylamino-3-(-p-formyl-styryl)-1,4-benzoxazine-2-one (DFSBO) have been studied. These molecules have electron donor and electron acceptor groups which give to their fluorescent excited state a charge transfer state character. The red shifts of the absorption and fluorescence spectra in polar solvents and the large Stokes shift related to the increase of the dipole moment from the ground state to the singlet excited state have been fully characterised. The absorption spectra of the first excited singlet and triplet states and the quantum yields of the intersystem crossing to the triplet state have been determined. The existence of conformers of the two dyes has been evidenced. The synthesis of DCM leads to the trans isomer which, under light exposure undergoes photo-isomerization to the cis-compound. Their fluorescence lifetimes and the photo-isomerization efficiency are solvent dependent. The DFSBO emission spectra depend greatly on the excitation wavelength. This effect can be explained by the occurrence of two rotational conformers one being stabilised by an intramolecular hydrogen bond. The spectral properties of these two molecules enable us to explain why DCM is a very good laser dye whereas DFSBO has a poor laser efficiency. (author) [fr
Regulation and Functional Expression of Cinnamate 4-Hydroxylase from Parsley
Koopmann, Edda; Logemann, Elke; Hahlbrock, Klaus
1999-01-01
A previously isolated parsley (Petroselinum crispum) cDNA with high sequence similarity to cinnamate 4-hydroxylase (C4H) cDNAs from several plant sources was expressed in yeast (Saccharomyces cerevisiae) containing a plant NADPH:cytochrome P450 oxidoreductase and verified as encoding a functional C4H (CYP73A10). Low genomic complexity and the occurrence of a single type of cDNA suggest the existence of only one C4H gene in parsley. The encoded mRNA and protein, in contrast to those of a functionally related NADPH:cytochrome P450 oxidoreductase, were strictly coregulated with phenylalanine ammonia-lyase mRNA and protein, respectively, as demonstrated by coinduction under various conditions and colocalization in situ in cross-sections from several different parsley tissues. These results support the hypothesis that the genes encoding the core reactions of phenylpropanoid metabolism form a tight regulatory unit. PMID:9880345
Schreiber, D; Martin, J; Mendel, J
1986-01-01
The carcinogenic activity of 1-methyl-3(p-chlorophenyl)-1-nitrosourea (Cl-MPNU) and its 1-methyl trideuterated analog (Cl-MPNU-d3) was compared by intragastric administration to hooded rats of equimolar doses of both compounds. A 100% frequency of forestomach tumors was observed in both groups. However, the mean latency period of the animals treated with Cl-MPNU-d3 was significantly longer (P less than 0.01). The results suggest the occurrence of a deuterium isotope effect in nitrosoureas but not as distinct as in nitrosamines.
Takao, Koichi; Toda, Kazuhiro; Saito, Takayuki; Sugita, Yoshiaki
2017-01-01
A series of cinnamic acid derivatives, amides (1-12) and esters (13-22), were synthesized, and structure-activity relationships for antioxidant activity, and monoamine oxidases (MAO) A and B, acetylcholinesterase, and butyrylcholinesterase (BChE) inhibitory activities were analyzed. Among the synthesized compounds, compounds 1-10, 12-18, and rosmarinic acid (23), which contained catechol, o-methoxyphenol or 5-hydroxyindole moieties, showed potent 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity. Compounds 9-11, 15, 17-22 showed potent and selective MAO-B inhibitory activity. Compound 20 was the most potent inhibitor of MAO-B. Compounds 18 and 21 showed moderate BChE inhibitory activity. In addition, compound 18 showed potent antioxidant activity and MAO-B inhibitory activity. In a comparison of the cinnamic acid amides and esters, the amides exhibited more potent DPPH free radical scavenging activity, while the esters showed stronger inhibitory activities against MAO-B and BChE. These results suggested that cinnamic acid derivatives such as compound 18, p-coumaric acid 3,4-dihydroxyphenethyl ester, and compound 20, p-coumaric acid phenethyl ester, may serve as lead compounds for the development of novel MAO-B inhibitors and candidate lead compounds for the prevention or treatment of Alzheimer's disease.
Methylation of miR-145a-5p promoter mediates adipocytes differentiation
Energy Technology Data Exchange (ETDEWEB)
Du, Jingjing; Cheng, Xiao; Shen, Linyuan; Tan, Zhendong; Luo, Jia; Wu, Xiaoqian; Liu, Chendong [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Yang, Qiong [Department of Animal Husbandry and Veterinary Medicine, Chengdu Agricultural College, Chengdu 611100, Sichuan (China); Jiang, Yanzhi [College of Life and Science, Sichuan Agricultural University, Chengdu 611130 (China); Tang, Guoqing; Li, Xuewei [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhang, Shunhua, E-mail: zhangsh1919@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhu, Li, E-mail: zhuli7508@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China)
2016-06-17
MicroRNAs (miRNAs, miR) play important roles in adipocyte development. Recent studies showed that the expression of several miRNAs is closely related with promoter methylation. However, it is not known whether miRNA mediates adipocytes differentiation by means of DNA methylation. Here, we showed that miR-145a-5p was poorly expressed in adipose tissue from mice fed a high fat diet (HFD). Overexpression or inhibition of miR-145a-5p was unfavorable or beneficial, respectively, for adipogenesis, and these effects were achieved by regulating adipocyte-specific genes involved in lipogenic transcription, fatty acid synthesis, and fatty acid transportation. Particularly, we first suggested that miR-145a-5p mimics or inhibitors promoted or repressed adipocytes proliferation by regulating p53 and p21, which act as cell cycle regulating factors. Surprisingly, the miR-145a-5p-repressed adipocyte differentiation was enhanced or rescued when cells treated with 5-Aza-dC were transfected with miR-145a-5p mimics or inhibitors, respectively. These data indicated that, as a new mean to positively regulate adipocyte proliferation, the process of miR-145a-5p-inhibited adipogenesis may be regulated by DNA methylation. -- Highlights: •MiR-145a-5p promotes adipocytes proliferation. •MiR-145a-5p is negatively correlated with obesity. •MiR-145a-5p mediates adipocytes differentiation via regulating pathway related adipocytes differentiation. MiR-145a-5p mediating adipocytes differentiation was regulated by DNA methylation.
High frequency of p 16 promoter methylation in non-small cell lung carcinomas from Chile
Directory of Open Access Journals (Sweden)
LEDA M GUZMAN
2007-01-01
Full Text Available The inactivation of tumour suppressor genes by aberrant methylation of promoter regions has been described as a frequent event in neoplasia development, including lung cancer. The p16 gene is a tumour suppressor gene involved in the regulation of cell cycle progression that has been reported to be inactivated by promoter methylation in lung carcinomas at variable frequencies around the world in a smoking habit dependent manner. The purpose of this study was to investigate the methylation status of the promoter region of the p16 gene in 74 non-small cell lung carcinomas from Chile. The frequency of p16 gene inactivation by promoter methylation was determined as 79.7% (59/74. When we considered histological type, we observed that p16 promoter methylation was significantly higher in squamous cell carcinomas (30/33, 91% compared with adenocarcinomas (21/30, 70% (p=0.029. In addition, no association between p16 promoter methylation and gender, age or smoking habit was found (p=0.202, 0.202 and 0.147 respectively. Our results suggest that p16 promoter hypermethylation is a very frequent event in non-small cell lung carcinomas from Chile and could be smoking habit-independent
DELETION AND 5'CPG ISLAND METHYLATION OF p15 GENE IN BRAIN GLIOMA
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
Objective: To investigate the abnormality of p15 gene in brain glioma and the correlation of it with occurrence or malignant progression of brain glioma. Methods: Deletion and 5'CPG island methylation of p15 gene were detected by the methods of PCR and PCR-based methylation in 56 cases of brain glioma. Results: Out of 43 cases of high grade glioma, 14 cases were found to have homozygous deletion of p15E1, while none of the 13 cases of low grade glioma was found to have deletion of p15E1 (P<0.05). Methylation of 5'CPG Island of p15 gene was found only in four cases of glioma. Conclusion: Abnormality of p15 gene may involved in the occurrence and malignant progression of brain glioma. Homozygous deletion of gene is the major mechanism of inactivation for p15 gene in brain glioma.
Boba, Aleksandra; Kostyn, Kamil; Kostyn, Anna; Wojtasik, Wioleta; Dziadas, Mariusz; Preisner, Marta; Szopa, Jan; Kulma, Anna
2016-01-01
Flax ( Linum usitatissimum ) is a crop plant valued for its oil and fiber. Unfortunately, large losses in cultivation of this plant are caused by fungal infections, with Fusarium oxysporum being one of its most dangerous pathogens. Among the plant's defense strategies, changes in the expression of genes of the shikimate/phenylpropanoid/benzoate pathway and thus in phenolic contents occur. Among the benzoates, salicylic acid, and its methylated form methyl salicylate play an important role in regulating plants' response to stress conditions. Upon treatment of flax plants with the fungus we found that methyl salicylate content increased (4.8-fold of the control) and the expression profiles of the analyzed genes suggest that it is produced most likely from cinnamic acid, through the β-oxidative route. At the same time activation of some genes involved in lignin and flavonoid biosynthesis was observed. We suggest that increased methyl salicylate biosynthesis during flax response to F. oxysporum infection may be associated with phenylpropanoid pathway activation.
Synthesis of two S-(methyl-3H)-labelled enkephalins and S-(methyl-14C) substance P
International Nuclear Information System (INIS)
Naegren, K.; Laangstroem, B.; Franzen, H.M.; Ragnarsson, U.
1988-01-01
The synthesis of 3 H-labelled Met-enkephalin and Tyr-D-Ala-Gly-Phe-Met-NH 2 (DALA) and 14 C-labelled Substance P (SP) from previously described, fully protected intermediates is reported. The labelled peptides were prepared by methylation with ( 3 H)- or ( 14 C)methyl iodide of the sulphide anions formed on deprotection of the corresponding S-benzyl-homocysteine precursors with sodium in liquid ammonia. After purification by LC, the labelled peptides were obtained in radiochemical yields in the range of 9 to 24% with a radiochemical purity higher than 97%. The specific radioactivities of the 3 H- and 14 C- labelled products, corresponding to the labelled methyl iodides used, were 80 mCi/μmol and 60 μCi/μmol, respectively. (author)
Jiao, Yang; Ouyang, Hui-Ling; Jiang, Yu-Jiao; Kong, Xiang-Zhen; He, Wei; Liu, Wen-Xiu; Yang, Bin; Xu, Fu-Liu
2015-01-01
The toxic effects of ethyl cinnamate on the photosynthetic and physiological characteristics of Chlorella vulgaris were studied based on chlorophyll fluorescence and flow cytometry analysis. Parameters, including biomass, F v/F m (maximal photochemical efficiency of PSII), ФPSII (actual photochemical efficiency of PSII in the light), FDA, and PI staining fluorescence, were measured. The results showed the following: (1) The inhibition on biomass increased as the exposure concentration increased. 1 mg/L ethyl cinnamate was sufficient to reduce the total biomass of C. vulgaris. The 48-h and 72-h EC50 values were 2.07 mg/L (1.94–2.20) and 1.89 mg/L (1.82–1.97). (2) After 24 h of exposure to 2–4 mg/L ethyl cinnamate, the photosynthesis of C. vulgaris almost ceased, manifesting in ФPSII being close to zero. After 72 h of exposure to 4 mg/L ethyl cinnamate, the F v/F m of C. vulgaris dropped to zero. (3) Ethyl cinnamate also affected the cellular physiology of C. vulgaris, but these effects resulted in the inhibition of cell yield rather than cell death. Exposure to ethyl cinnamate resulted in decreased esterase activities in C. vulgaris, increased average cell size, and altered intensities of chlorophyll a fluorescence. Overall, esterase activity was the most sensitive variable. PMID:26101784
High CpG island methylation ofp16 gene and loss of p16 protein ...
Indian Academy of Sciences (India)
Navya
employed to detect CpG island methylation in p16 promoter region and ... of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ..... Our findings that p16 has a role in heart development is ... Asian Pac J Cancer Prev 15, 75-84. .... phenotype in colorectal cancer using a large population-based sample.
van Delden, Richard A.; Huck, N.P.M.; Piet, J.J.; Warman, J.M.; Meskers, S.C.J.; Dekkers, H.P J M; Feringa, B.L.
2003-01-01
The photochemical control of ground- and excited-state chirality of (M)-cis-(1) and (P)-trans(2)-2-nitro-7-(dimethylamino)-9-(2',3'-dihydro-1'H-naphtho[2,1-b]-thiopyran-1'-ylidene)-9H-thioxanthene is described. It is shown that while ground state chirality can be controlled photochemically by
Delden, van R.A.; Huck, H.P.M.; Piet, J.J.; Warman, J.M.; Meskers, S.C.J.; Dekkers, H.P.J.M.; Feringa, B.L.
2003-01-01
The photochemical control of ground- and excited-state chirality of (M)-cis-(1) and (P)-trans-(2)-2-nitro-7-(dimethylamino)-9-(2',3' -dihydro-1'H-naphtho[2,1-b]-thiopyran-1'-ylidene)-9H-thioxanthene is described. It is shown that while ground state chirality can be controlled photochemically by
Production of Methyl Ester (Biodiesel from Used Cooking Oils via Trans-esterification process
Directory of Open Access Journals (Sweden)
Sameer Mohammed Salman
2016-06-01
Full Text Available Used cooking oil was undergoing trans-esterification reaction to produce biodiesel fuel. Method of production consisted of pretreatment steps, trans-esterification, separation, washing and drying. Trans-esterification of treated oils was studied at different operation conditions, the methanol to oil mole ratio were 6:1, 8:1, 10:1, and 12:1, at different temperature 30, 40, 50, and 60 º C, reaction time 40, 60, 80, and 120 minutes, amount of catalyst 0.5, 1, 1.5, and 2 wt.% based on oil and mixing speed 400 rpm. The maximum yield of biodiesel was 91.68 wt.% for treated oils obtained by trans-esterification reaction with 10:1 methanol to oil mole ratio, 60 º C reaction temperature, 80 minute reaction time and 0.5 wt.% of NaOH catalyst. The physical properties such as specific gravity, kinematic viscosity, acid number, flash point, pour point, and water content, were measured and compared them with American Standard Test Methods (ASTM D6751. The results of these properties for biodiesel product at (6:1, 8:1, 10:1, and 12:1 of methanol to oil mole ratio were within the range of American Standard Test Methods (ASTM D6751.
DEFF Research Database (Denmark)
Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter
2008-01-01
ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (dMS-HRM) t......ABSTRACT: BACKGROUND: Methylation-sensitive high resolution melting (MS-HRM) methodology is able to recognise heterogeneously methylated sequences by their characteristic melting profiles. To further analyse heterogeneously methylated sequences, we adopted a digital approach to MS-HRM (d......MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... the methylated alleles and assess the degree of methylation. Direct sequencing of selected dMS-HRM products was used to determine the exact DNA methylation pattern and confirmed the degree of methylation estimated by dMS-HRM. CONCLUSION: dMS-HRM is a powerful technique for the analysis of methylation in CDKN2B...
International Nuclear Information System (INIS)
Mariano, P.S.; Glover, G.I.; Wilkinson, T.J.
1976-01-01
Results of a quantitative photochemical study of poly-p-benzoyl-phenylacetimido-bovine serum albumin in the presence of small-molecule triplet quenchers are reported. The efficiency of quenching by organic salts containing low triplet energy chromophores has been shown to be qualitatively dependent on their predicted association constants to the modified protein. In addition, quenching was inhibited by salts of organic acids which possess high binding affinities for the protein but do not contain chromophores of low triplet energy. Quantitative treatment of the quenching and inhibition data yielded results which strongly support the operation of an 'affinity controlled' mechanism for triplet energy transfer from the benzophenone moieties of the modified-bovine serum albumin to quenchers such as α-naphthylacetate and trans-cinnamate. (author)
International Nuclear Information System (INIS)
Sahraoui, Lakhdar; Khimeche, Kamel; Dahmani, Abdallah; Mokbel, Ilham; Jose, Jacques
2016-01-01
Highlight: • Vapor-liquid equilibria, Enthalpy of Vaporization, saturated Fatty Acid Methyl Ester. - Abstract: Vapor pressures of six saturated Fatty Acid Methyl Esters (FAMEs), methyl hexanoate (or methyl caproate), methyl octanoate (or methyl caprylate), Methyl decanoate (or methyl caprate), methyl dodecanoate (or methyl laurate), methyl tetradecanoate (or methyl myristate), and methyl hexadecanoate (or methyl palmitate) were measured from 1 Pa to 100 kPa and at temperature range between 262 and 453 K using a static apparatus. The experimental data (P-T) were compared with the available literature data.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
Kalinovskaya, I. V.; Zadorozhnaya, A. N.
2018-04-01
Influence of cinnamic acid on the luminescent properties of the europium(III) nitrate with 1,10-phenantroline in a polymer materials was studied. It was shown that combined use of these rare earth complexes leads to intense luminescence in the 400-700 nm region. Samples containing polymer europium nitrate with 1,10-phenantroline and cinnamic acid at a molar ratio of 1:2,0 had the maximum luminescence intensity and photostability.
21 CFR 177.1635 - Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene).
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Poly(p-methylstyrene) and rubber-modified poly(p-methyl-styrene). 177.1635 Section 177.1635 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use as Basic Components...
Synthesis of (+-)-[1,1'-15N2, 2'-13C]-trans-3'-methylnicotine
International Nuclear Information System (INIS)
Sirimanne, S.R.; Maggio, V.L.; Patterson, D.G. Jr.
1992-01-01
The synthesis of (±)- [1,1'- 15 N 2 , 2'- 13 C]-trans-3'-methylnicotine is reported. 15 N-3-Bromopyridine obtained from bromination of pyridine was formylated with nBuLi/[carbonyl- 13 C]-methyl formate. The resulting 15 n-Pyridine-3-[ 13 C-carbonyl]-carboxaldehyde was reacted with 15 N-methylamine and then the resulting Schiff's base was condensed with succinic anhydride to give (±)- [1,1'- 15 N 2 , 5'- 13 C]-trans-4'-carboxycotinine. Reduction with lithium aluminum hydride and mesylation followed by reduction with Zn/NaI gave (±)-[1,1'- 15 N 2 , 2'- 13 C]-trans-3'-methylnicotine. (Author)
Trans-generational responses to low pH depend on parental gender in a calcifying tubeworm.
Lane, Ackley; Campanati, Camilla; Dupont, Sam; Thiyagarajan, Vengatesen
2015-06-03
The uptake of anthropogenic CO2 emissions by oceans has started decreasing pH and carbonate ion concentrations of seawater, a process called ocean acidification (OA). Occurring over centuries and many generations, evolutionary adaptation and epigenetic transfer will change species responses to OA over time. Trans-generational responses, via genetic selection or trans-generational phenotypic plasticity, differ depending on species and exposure time as well as differences between individuals such as gender. Males and females differ in reproductive investment and egg producing females may have less energy available for OA stress responses. By crossing eggs and sperm from the calcareous tubeworm Hydroides elegans (Haswell, 1883) raised in ambient (8.1) and low (7.8) pH environments, we observed that paternal and maternal low pH experience had opposite and additive effects on offspring. For example, when compared to offspring with both parents from ambient pH, growth rates of offspring of fathers or mothers raised in low pH were higher or lower respectively, but there was no difference when both parents were from low pH. Gender differences may result in different selection pressures for each gender. This may result in overestimates of species tolerance and missed opportunities of potentially insightful comparisons between individuals of the same species.
DEFF Research Database (Denmark)
Hansen, Camilla Petrycer; Jensen, Anders Asbjørn; Balle, Thomas
2009-01-01
Compounds based on the 3-(dimethylamino)butyl dimethylcarbamate (DMABC) scaffold were synthesized and pharmacologically characterized at the alpha(4)beta(2), alpha(3)beta(4,) alpha(4)beta(4) and alpha(7) neuronal nicotinic acetylcholine receptors (nAChRs). The carbamate functionality and a small...
The formation of space network in structure of polyallyl cinnamates under UV- and γ-irradiation
International Nuclear Information System (INIS)
Yagudeev, T.
2003-01-01
Influence of UV- and γ-irradiation on polyallyl cinnamates (PAC) structure are investigated. UV-irradiation of polymers samples carried out by lamp PRK-2 at 25-30 deg. C.; 60 Co was used for γ-irradiation: mean value of dose power - 50 μR/s; average energy of γ-quantum E γ =1.25 MeV. It was shown that under various kinds of irradiation polyallyl cinnamates forms space networks and samples of PAC kept itself physico-mechanical properties (light transparent - 90 %), or increase its (microhardness reach 150 %). It can be concluded that such polymers may find application for creation of elements of laser optics
Henkel, Bernd; Westner, Benedikt; Dömling, Alexander
2003-01-01
The synthesis of resin-bound 3-N,N-(dimethylamino)-2-isocyanoacrylate is described. This bifunctional reagent can be used for the synthesis of thiazoles via a multicomponent reaction. Several examples are reported.
Daniel, Louis; Rasrendra, Carolus B.; Kloekhorst, Arjan; Broekhuis, Antonius A.; Manurung, Robert; Heeres, Hero J.
This paper describes an experimental study on the application of metal triflate salts for the (trans-) esterification of fatty esters (triolein, methyl oleate, methyl linoleate), fatty acid (oleic acid), as well as Jatropha curcas L. oil with methanol and higher alcohols (ethanol, n-propanol,
Study of the biogenesis of flavones and cinnamic acids by using molecules labelled with carbon 14
International Nuclear Information System (INIS)
Chabannes, Bernard
1970-01-01
This research thesis reports the study of flavones, flavonoid compounds and cinnamic acids which are very common as natural pigments in plant species. The author first reports the study of the synthesis of shikimic acid labelled with carbon 14 (biological methods of preparation, synthesis), and then the synthesis of prunin labelled with carbon 14. The next part reports the study of the transformation of prunin labelled with carbon 14 into cosmosiine in flowers with white cosmos. The author finally compares the introduction of cinnamic acid and of shikimic acid (both labelled with carbon 14) into the sinapic acid of red cabbage leaves
Salimon, Jumat; Omar, Talal A; Salih, Nadia
2014-01-01
Two different procedures for the methylation of fatty acids (FAs) and trans fatty acids (TFAs) in food fats were compared using gas chromatography (GC-FID). The base-catalyzed followed by an acid-catalyzed method (KOCH3/HCl) and the base-catalyzed followed by (trimethylsilyl)diazomethane (TMS-DM) method were used to prepare FA methyl esters (FAMEs) from lipids extracted from food products. In general, both methods were suitable for the determination of cis/trans FAs. The correlation coefficients (r) between the methods were relatively small (ranging from 0.86 to 0.99) and had a high level of agreement for the most abundant FAs. The significant differences (P = 0.05) can be observed for unsaturated FAs (UFAs), specifically for TFAs. The results from the KOCH3/HCl method showed the lowest recovery values (%R) and higher variation (from 84% to 112%), especially for UFAs. The TMS-DM method had higher R values, less variation (from 90% to 106%), and more balance between variation and %RSD values in intraday and interday measurements (less than 4% and 6%, resp.) than the KOCH3/HCl method, except for C12:0, C14:0, and C18:0. Nevertheless, the KOCH3/HCl method required shorter time and was less expensive than the TMS-DM method which is more convenient for an accurate and thorough analysis of rich cis/trans UFA samples.
Salimon, Jumat; Omar, Talal A.; Salih, Nadia
2014-01-01
Two different procedures for the methylation of fatty acids (FAs) and trans fatty acids (TFAs) in food fats were compared using gas chromatography (GC-FID). The base-catalyzed followed by an acid-catalyzed method (KOCH3/HCl) and the base-catalyzed followed by (trimethylsilyl)diazomethane (TMS–DM) method were used to prepare FA methyl esters (FAMEs) from lipids extracted from food products. In general, both methods were suitable for the determination of cis/trans FAs. The correlation coefficients (r) between the methods were relatively small (ranging from 0.86 to 0.99) and had a high level of agreement for the most abundant FAs. The significant differences (P = 0.05) can be observed for unsaturated FAs (UFAs), specifically for TFAs. The results from the KOCH3/HCl method showed the lowest recovery values (%R) and higher variation (from 84% to 112%), especially for UFAs. The TMS-DM method had higher R values, less variation (from 90% to 106%), and more balance between variation and %RSD values in intraday and interday measurements (less than 4% and 6%, resp.) than the KOCH3/HCl method, except for C12:0, C14:0, and C18:0. Nevertheless, the KOCH3/HCl method required shorter time and was less expensive than the TMS-DM method which is more convenient for an accurate and thorough analysis of rich cis/trans UFA samples. PMID:24719581
Directory of Open Access Journals (Sweden)
Jumat Salimon
2014-01-01
Full Text Available Two different procedures for the methylation of fatty acids (FAs and trans fatty acids (TFAs in food fats were compared using gas chromatography (GC-FID. The base-catalyzed followed by an acid-catalyzed method (KOCH3/HCl and the base-catalyzed followed by (trimethylsilyldiazomethane (TMS–DM method were used to prepare FA methyl esters (FAMEs from lipids extracted from food products. In general, both methods were suitable for the determination of cis/trans FAs. The correlation coefficients (r between the methods were relatively small (ranging from 0.86 to 0.99 and had a high level of agreement for the most abundant FAs. The significant differences (P=0.05 can be observed for unsaturated FAs (UFAs, specifically for TFAs. The results from the KOCH3/HCl method showed the lowest recovery values (%R and higher variation (from 84% to 112%, especially for UFAs. The TMS-DM method had higher R values, less variation (from 90% to 106%, and more balance between variation and %RSD values in intraday and interday measurements (less than 4% and 6%, resp. than the KOCH3/HCl method, except for C12:0, C14:0, and C18:0. Nevertheless, the KOCH3/HCl method required shorter time and was less expensive than the TMS-DM method which is more convenient for an accurate and thorough analysis of rich cis/trans UFA samples.
DEFF Research Database (Denmark)
Weibel, H; Hansen, J; Andersen, Klaus Ejner
1989-01-01
Guinea pig maximization tests (GPMT) were performed with cinnamon substances. There was a certain degree of cross-reactivity between cinnamaldehyde, cinnamyl alcohol and cinnamic acid as animals sensitized to cinnamaldehyde reacted to the challenge with the three substances. Animals sensitized to...
Sun, Hokeun; Wang, Ya; Chen, Yong; Li, Yun; Wang, Shuang
2017-06-15
DNA methylation plays an important role in many biological processes and cancer progression. Recent studies have found that there are also differences in methylation variations in different groups other than differences in methylation means. Several methods have been developed that consider both mean and variance signals in order to improve statistical power of detecting differentially methylated loci. Moreover, as methylation levels of neighboring CpG sites are known to be strongly correlated, methods that incorporate correlations have also been developed. We previously developed a network-based penalized logistic regression for correlated methylation data, but only focusing on mean signals. We have also developed a generalized exponential tilt model that captures both mean and variance signals but only examining one CpG site at a time. In this article, we proposed a penalized Exponential Tilt Model (pETM) using network-based regularization that captures both mean and variance signals in DNA methylation data and takes into account the correlations among nearby CpG sites. By combining the strength of the two models we previously developed, we demonstrated the superior power and better performance of the pETM method through simulations and the applications to the 450K DNA methylation array data of the four breast invasive carcinoma cancer subtypes from The Cancer Genome Atlas (TCGA) project. The developed pETM method identifies many cancer-related methylation loci that were missed by our previously developed method that considers correlations among nearby methylation loci but not variance signals. The R package 'pETM' is publicly available through CRAN: http://cran.r-project.org . sw2206@columbia.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
SYNTHESIS OF 3,4-DIMETHOXY ISOAMYL CINNAMIC AS THE SUNSCREEN COMPOUND FROM CLOVE OIL AND FUSEL OIL
Directory of Open Access Journals (Sweden)
Tutik Dwi Wahyuningsih
2010-06-01
Full Text Available Synthesis of sunscreen compound 3,4-dimethoxy isoamyl cinnamic from clove oil and fusel oil has been done. The majoring component of clove oil that is eugenol has been isolated, followed with several chemical processes i.e. isomerization into isoeugenol, oxidation of the product to change into vanillin, then modification vanillin into veratraldehyde. From the fusel oil, we isolate isoamyl alcohol and modified by acetylation into isoamyl acetic. The final product could be produce by Claissen's condensation of isoamyl acetic and veratraldehyde to give 3,4-dimethoxy isoamyl cinnamic. All of the processes are followed with structure characterization using GC, IR, GC-MS and 1H-NMR spectroscopy. The result shown that compound has 46.98% purity and potent as the UV-B sunscreen's type (lmax = 313 nm. In-vitro sunscreen's activity of the compound was tested by UV-Vis spectrophotometry and resulting a maximum Sun Protection Factor value (SPFin-vitro at low concentration, 10.25 mg/mL. Keywords: UV absorber, sunscreen, clove oil, cinnamic esther.
Jantzi, Kevin L.; Wiltrakis, Susan; Wolf, Lauren; Weber, Anna; Cardinal, Josh; Krieter, Katie
2011-01-01
A critical factor for the increased nucleophilicity of the pyridine nitrogen in 4-(dimethylamino)pyridine (DMAP) is electron donation via resonance from the amino group into the aromatic ring that increases electron density on the pyridine nitrogen. To explore how important this resonance effect is, 4-(dimethylaminomethyl)pyridine (DMAMP) was…
Cis-trans photoisomerization of abscisic acid
International Nuclear Information System (INIS)
Brabham, D.E.; Biggs, R.H.
1981-01-01
An important regulator of numerous physiological processes in higher plants is abscisic acid (ABA), which is photoisomerized from the more biologically active cis isomer to the nearly inactive trans isomer by natural sunlight. It is possible that this photoisomerization is a UV control mechanism in functions regulated by ABA. The quantum yields of both the cis to trans and trans to cis photoisomerizations were measured under various conditions of pH and oxygen concentration at room temperature. The yield for photoisomerization of cis-ABA ranged from 0.25 at pH 3.0 to 0.11 at pH 7.0. Oxygen partially quenched the process. The quantum yield varied only slightly with wavelength. The quantum yield of photolysis of cis-ABA was reported for pH 3.0 as 0.06. This yield also varied slightly with wavelength and was relatively insensitive to oxygen. This relatively high yield explains the loss of potency of ABA during UV irradiation. Phosphorescence of cis- and trans-ABA was observed in methanol at 77 K. Onset of the emission was at 350 nm. The emission spectra were the same for both isomers. From these results a mechanism of UV action on plants based on the photoisomerization of the inactive trans-ABA to the biologically active cis isomer is proposed. (author)
HDO of Methyl Palmitate over Silica-Supported Ni Phosphides: Insight into Ni/P Effect
Directory of Open Access Journals (Sweden)
Irina V. Deliy
2017-10-01
Full Text Available Two sets of silica-supported nickel phosphide catalysts with a nickel content of about 2.5 and 10 wt % and Ni/P molar ratio 2/1, 1/1 and 1/2 in each set, were prepared by way of a temperature-programmed reduction method using (Ni(CH3COO2 and ((NH42HPO4 as a precursor. The NixPy/SiO2 catalysts were characterized using chemical analysis N2 physisorption, XRD, TEM, 31P MAS NMR. Methyl palmitate hydrodeoxygenation (HDO was performed in a trickle-bed reactor at 3 MPa and 290 °C with LHSV ranging from 0.3 to 16 h−1. The Ni/P ratio was found to affect the nickel phosphide phase composition, POx groups content and catalytic properties in methyl palmitate HDO with the TOF increased along with a decline of Ni/P ratio and a growth of POx groups’ content. Taking into account the possible routes of methyl palmitate conversion (metal-catalyzed hydrogenolysis or acid-catalyzed hydrolysis, we proposed that the enhancement of acid POx groups’ content with the Ni/P ratio decrease provides an enhancement of the rate of methyl palmitate conversion through the acceleration of acid-catalyzed hydrolysis.
Directory of Open Access Journals (Sweden)
Said F. Figueredo
2014-01-01
Full Text Available Potential energy surface (PES of cis-trans and trans-trans formic acid dimers were sampled using a stochastic method, and the geometries, energies, and vibrational frequencies were computed at B3LYP/6-311++G(3df,2p level of theory. The results show that molar free energy of dimerization deviated up to 108.4% when basis set superposition error (BSSE and zero-point energy (ZPE were not considered. For cis-trans dimers, C=O and O - H bond weakened, whereas C - O bonds strengthened due to dimerization. Also, trans-trans FA dimers did not show a trend regarding strengthening or weakening of the C=O, O - H and C - O bonds.
The carcinogenicity of 1-methyl-3(p-bromophenyl)-1-nitrosourea (Br-MPNU).
Warzok, R; Martin, J; Mendel, J; Thust, R; Schwarz, H
1983-01-01
In long-term experiments with Hooded rats the carcinogenic potential of 1-methyl-3(p-bromophenyl)-1-nitrosourea (Br-MPNU) could be demonstrated for the first time. Br-MPNU is formed also endogenously after combined administration of 1-methyl-3(p-bromophenyl)-urea (Br-MPU) and sodium nitrite. After repeated intragastric administration of 0.33 mmol Br-MPU and 0.73 mmol NaNO2 per kg b.w. papillomas and carcinomas of the forestomach developed in 83%. After repeated administration of 0.28 mmol Br-MPNU per kg b.w. these neoplasms were observed in 88%. The comparison of results obtained in similar experiments with 1-methyl-3-phenyl-1-nitrosourea shows that bromine substitution led to a reduction of the carcinogenic activity. The present paper is part of a complex program studying the interrelationships between structure, physico-chemical properties, mutagenicity and carcinogenicity of nitrosoureas.
Directory of Open Access Journals (Sweden)
Jeelani Basha Shaik
2013-04-01
Full Text Available trans-Bis(1,4-dimesityl-3-methyl-1,2,3-triazol-5-ylidenepalladium(II dichloride has been shown to be an excellent catalyst for the multiple Suzuki–Miyaura coupling reactions of polybromoarenes to the corresponding fully substituted polyarylarenes. The reactions proceeded in excellent yields and with high turnover numbers. With 1,4-dibromobenzene the catalyst was found to be active for up to 13 consecutive cycles with a turnover number of 1260. The polyarylarenes were obtained in pure form after crystallization once without recourse to chromatographic purification. The single-crystal X-ray structures of the chloro (1 as well as the corresponding acetato (2 complexes are also reported and compared with the corresponding complexes of 1,4-diphenyl-3-methyl-1,2,3-triazol-5-ylidene as the ligand.
International Nuclear Information System (INIS)
Rai, Chitharanjan; Sreenivas, K.; Dharmaprakash, S.M.
2009-01-01
Single crystals of triglycine sulphate (TGS) doped with 1 mol% of 4-(dimethylamino) benzaldehyde (DB) have been grown from aqueous solution at ambient temperature by slow evaporation technique. The effect of dopant on the crystal growth and dielectric, pyroelectric and mechanical properties of TGS crystal have been investigated. X-ray powder diffraction pattern for pure and doped TGS was collected to determine the lattice parameters. FTIR spectra were employed to confirm the presence of 4-(dimethylamino) benzaldehyde in TGS crystal, qualitatively. The dielectric permittivity has been studied as a function of temperature by cooling the sample at a rate of 1 deg. C/min. An increase in the Curie temperature T c =51 deg. C (for pure TGS, T c =48.5 deg. C) and decrease in maximum permittivity has been observed for doped TGS when compared to pure TGS crystal. Pyroelectric studies on doped TGS were carried out to determine pyroelectric coefficient. The Vickers's hardness of the doped TGS crystals along (0 1 0) face is higher than that of pure TGS crystal for the same face. Domain patterns on b-cut plates were observed using scanning electron microscope. The low dielectric constant, higher pyroelectric coefficient and higher value of hardness suggest that doped TGS crystals could be a potential material for IR detectors.
Rai, Chitharanjan; Sreenivas, K.; Dharmaprakash, S. M.
2009-11-01
Single crystals of triglycine sulphate (TGS) doped with 1 mol% of 4-(dimethylamino) benzaldehyde (DB) have been grown from aqueous solution at ambient temperature by slow evaporation technique. The effect of dopant on the crystal growth and dielectric, pyroelectric and mechanical properties of TGS crystal have been investigated. X-ray powder diffraction pattern for pure and doped TGS was collected to determine the lattice parameters. FTIR spectra were employed to confirm the presence of 4-(dimethylamino) benzaldehyde in TGS crystal, qualitatively. The dielectric permittivity has been studied as a function of temperature by cooling the sample at a rate of 1 °C/min. An increase in the Curie temperature Tc=51 °C (for pure TGS, Tc=48.5 °C) and decrease in maximum permittivity has been observed for doped TGS when compared to pure TGS crystal. Pyroelectric studies on doped TGS were carried out to determine pyroelectric coefficient. The Vickers's hardness of the doped TGS crystals along (0 1 0) face is higher than that of pure TGS crystal for the same face. Domain patterns on b-cut plates were observed using scanning electron microscope. The low dielectric constant, higher pyroelectric coefficient and higher value of hardness suggest that doped TGS crystals could be a potential material for IR detectors.
27 CFR 21.65 - Formula No. 38-B.
2010-04-01
.... Cinnamic aldehyde, N.F. IX. Cinnamon oil, N.F. Citronella oil, natural. Clove oil, N.F. Coal tar, U.S.P....P. Methyl salicylate, N.F. Mustard oil, volatile (allyl isothiocyanate), U.S.P. XII. Peppermint oil... pounds of any one, or a total of 10 pounds of two or more, of the oils and substances listed below: Alpha...
N. Kato (Norihiro); M. Loh (Marie); F. Takeuchi (Fumihiko); N. Verweij (Niek); X. Wang (Xu); W. Zhang (Weihua); T. NKelly (Tanika); D. Saleheen; B. Lehne (Benjamin); I.M. Leach (Irene Mateo); A. Drong (Alexander); J. Abbott (James); S. Wahl (Simone); S.-T. Tan (Sian-Tsung); W.R. Scott (William R.); G. Campanella (Gianluca); M. Chadeau-Hyam (Marc); U. Afzal (Uzma); T.S. Ahluwalia (Tarunveer Singh); M.J. Bonder (Marc); P. Chen (Ping); A. Dehghan (Abbas); T.L. Edwards (Todd L.); T. Esko (Tõnu); M.J. Go (Min Jin); S.E. Harris (Sarah); J. Hartiala (Jaana); S. Kasela (Silva); A. Kasturiratne (Anuradhani); C.C. Khor; M.E. Kleber (Marcus); H. Li (Huaixing); Z.Y. Mok (Zuan Yu); M. Nakatochi (Masahiro); N.S. Sapari (Nur Sabrina); R. Saxena (Richa); A.F. Stewart (Alexandre F.); L. Stolk (Lisette); Y. Tabara (Yasuharu); A.L. Teh (Ai Ling); Y. Wu (Ying); J.-Y. Wu (Jer-Yuarn); Y. Zhang (Yi); I. Aits (Imke); A. Da Silva Couto Alves (Alexessander); S. Das (Shikta); R. Dorajoo (Rajkumar); J. CHopewell (Jemma); Y.K. Kim (Yun Kyoung); R. WKoivula (Robert); J. Luan (Jian'An); L.-P. Lyytikäinen (Leo-Pekka); Q. NNguyen (Quang); M.A. Pereira (Mark A); D. Postmus (Douwe); O. TRaitakari (Olli); M. Scannell Bryan (Molly); R.A. Scott (Robert); R. Sorice; V. Tragante (Vinicius); M. Traglia (Michela); J. White (Jon); K. Yamamoto (Ken); Y. Zhang (Yonghong); L.S. Adair (Linda); A. Ahmed (Alauddin); K. Akiyama (Koichi); R. Asif (Rasheed); T. Aung (Tin); I.E. Barroso (Inês); A. Bjonnes (Andrew); T.R. Braun (Timothy R.); H. Cai (Hui); L.-C. Chang (Li-Ching); C.-H. Chen; C-Y. Cheng (Ching-Yu); Y.-S. Chong (Yap-Seng); F.S. Collins (Francis); R. Courtney (Regina); G. Davies (Gail); G. Delgado; L.D. Do (Loi D.); P.A. Doevendans (Pieter); R.T. Gansevoort (Ron); Y. Gao; T.B. Grammer (Tanja B); N. Grarup (Niels); J. Grewal (Jagvir); D. Gu (D.); G. SWander (Gurpreet); A.L. Hartikainen; S.L. Hazen (Stanley); J. He (Jing); C.K. Heng (Chew-Kiat); E.J.A. Hixso (E. James Ames); A. Hofman (Albert); C. Hsu (Chris); W. Huang (Wei); L.L.N. Husemoen (Lise Lotte); J.-Y. Hwang (Joo-Yeon); S. Ichihara (Sahoko); M. Igase (Michiya); M. Isono (Masato); J.M. Justesen (Johanne M.); T. Katsuya (Tomohiro); M. GKibriya (Muhammad); Y.J. Kim; M. Kishimoto (Miyako); W.-P. Koh (Woon-Puay); K. Kohara (Katsuhiko); M. Kumari (Meena); K. Kwek (Kenneth); N.R. Lee (Nanette); J. Lee (Jeannette); J. Liao (Jie); W. Lieb (Wolfgang); D.C. Liewald (David C.); T. Matsubara (Tatsuaki); Y. Matsushita (Yumi); T. Meitinger (Thomas); E. Mihailov (Evelin); L. Milani (Lili); R. Mills (Rebecca); K. Mononen (Kari); M. Müller-Nurasyid (Martina); T. Nabika (Toru); E. Nakashima (Eitaro); H.K. Ng (Hong Kiat); K. Nikus (Kjell); T. Nutile; T. Ohkubo (Takayoshi); K. Ohnaka (Keizo); S. Parish (Sarah); L. Paternoster (Lavinia); H. Peng (Hao); A. Peters (Annette); S. TPham (Son); M.J. Pinidiyapathirage (Mohitha J.); M. Rahman (Mahfuzar); H. Rakugi (Hiromi); O. Rolandsson (Olov); M.A. Rozario (Michelle Ann); D. Ruggiero; C. Sala (Cinzia); R. Sarju (Ralhan); K. Shimokawa (Kazuro); H. Snieder (Harold); T. Sparsø (Thomas); W. Spiering (Wilko); J.M. Starr (John); D.J. Stott (David J.); D. OStram (Daniel); T. Sugiyama (Takao); S. Szymczak (Silke); W.H.W. Tang (W.H. Wilson); L. Tong (Lin); S. Trompet (Stella); V. Turjanmaa (Väinö); H. Ueshima (Hirotsugu); A.G. Uitterlinden (André); S. Umemura (Satoshi); M. Vaarasmaki (Marja); R.M. Dam (Rob Mvan); W.H. van Gilst (Wiek); D.J. van Veldhuisen (Dirk); J. Viikari (Jorma); M. Waldenberger (Melanie); Y. Wang (Yiqin); A. Wang (Aili); R. Wilson (Rory); T.Y. Wong (Tien Yin); Y.-B. Xiang (Yong-Bing); S. Yamaguchi (Shuhei); X. Ye (Xingwang); R. Young (Robin); T.L. Young (Terri); J.-M. Yuan (Jian-Min); X. Zhou (Xueya); F.W. Asselbergs (Folkert); M. Ciullo; R. Clarke (Robert); P. Deloukas (Panagiotis); A. Franke (Andre); W.F. Paul (W. Frank); S. Franks (Steve); Y. Friedlander (Yechiel); M.D. Gross (Myron D.); Z. Guo (Zhirong); T. Hansen (T.); M.-R. Jarvelin (Marjo-Riitta); T. Jørgensen (Torben); J.W. Jukema (Jan Wouter); M. Kähönen (Mika); H. Kajio (Hiroshi); M. Kivimaki (Mika); J.-Y. Lee (Jong-Young); T. Lehtimäki (Terho); A. Linneberg (Allan); T. Miki (Tetsuro); O. Pedersen (Oluf); N.J. Samani (Nilesh); T.I.A. Sørensen (Thorkild); R. Takayanagi (Ryoichi); D. Toniolo (Daniela); H. Ahsan (Habibul); H. Allayee (Hooman); Y.-T. Chen (Yuan-Tsong); J. Danesh (John); I.J. Deary (Ian J.); O.H. Franco (Oscar); L. Franke (Lude); B. THeijman (Bastiaan); J.D. Holbrook (Joanna D.); A.J. Isaacs (Aaron); B.-J. Kim (Bong-Jo); X. Lin (Xu); J. Liu (Jianjun); W. März (Winfried); A. Metspalu (Andres); K.L. Mohlke (Karen); K. Sangher; D. Harambir (Dharambir); X.-O. Shu (Xiao-Ou); J.B.J. van Meurs (Joyce); E.N. Vithana (Eranga); A.R. Wickremasinghe (Ananda); C. Wijmenga (Cisca); B.H.W. Wolffenbuttel (Bruce H.W.); M. Yokota (Mitsuhiro); W. Zheng (Wei); D. Zhu (Dingliang); P. Vineis (Paolo); S.A. Kyrtopoulos (Soterios A.); J.C.S. Kleinjans (Jos C.S.); M.I. McCarthy (Mark); R. Soong (Richie); C. Gieger (Christian); J. Scott (James); Y.Y. Teo (Yik Ying); J. He (Jiang); P. Elliott (Paul); E.S. Tai (Shyong); P. van der Harst (Pim); J.S. Kooner (Jaspal S.); J.C. Chambers (John)
2015-01-01
textabstractWe carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10 -11 to
Coordination compounds of thorium(4) containing tris(dimethylamino)-phosphinoxide
International Nuclear Information System (INIS)
Skopenko, V.V.; Klunnik, L.A.
1983-01-01
Compounds including tris(dimethylamino)-phosphinoxide of the following composition: [ThX 4 (HMPA) 4 ] and [ThX 2 (HMPA) 4 ](BPh 4 ) 2 , where X=NCSe, N(CN) 2 =, C(CN) 3 , ONC(CN) 2 -, [C(CN) 2 C(O)NH 2 ], BPh 4 =[B(C 6 H 5 ) 4 ] - , and HMPA=OP[N(CN 3 ) 2 ] 3 are prepared by interactions of thoriUm chloride with different pseudohalogenides and sodium tetraphenylborate. Some properties of the above compoUnds are studied. Using the IR spectroscopy, the way of coordinating these compounds is determined; the X-ray crystal analysis has determined isostrUcture of compounds: [Th(NCX) 4 (HMPA) 4 ] and [ThX 2 (HMPA) 4 ](BPh 4 ) 2 , where X is Se, S
Pakala, Suresh B; Gorla, Purushotham; Pinjari, Aleem Basha; Krovidi, Ravi Kumar; Baru, Rajasekhar; Yanamandra, Mahesh; Merrick, Mike; Siddavattam, Dayananda
2007-01-01
A soil bacterium capable of utilizing methyl parathion as sole carbon and energy source was isolated by selective enrichment on minimal medium containing methyl parathion. The strain was identified as belonging to the genus Serratia based on a phylogram constructed using the complete sequence of the 16S rRNA. Serratia sp. strain DS001 utilized methyl parathion, p-nitrophenol, 4-nitrocatechol, and 1,2,4-benzenetriol as sole carbon and energy sources but could not grow using hydroquinone as a source of carbon. p-Nitrophenol and dimethylthiophosphoric acid were found to be the major degradation products of methyl parathion. Growth on p-nitrophenol led to release of stoichiometric amounts of nitrite and to the formation of 4-nitrocatechol and benzenetriol. When these catabolic intermediates of p-nitrophenol were added to resting cells of Serratia sp. strain DS001 oxygen consumption was detected whereas no oxygen consumption was apparent when hydroquinone was added to the resting cells suggesting that it is not part of the p-nitrophenol degradation pathway. Key enzymes involved in degradation of methyl parathion and in conversion of p-nitrophenol to 4-nitrocatechol, namely parathion hydrolase and p-nitrophenol hydroxylase component "A" were detected in the proteomes of the methyl parathion and p-nitrophenol grown cultures, respectively. These studies report for the first time the existence of a p-nitrophenol hydroxylase component "A", typically found in Gram-positive bacteria, in a Gram-negative strain of the genus Serratia.
DEFF Research Database (Denmark)
Kato, Norihiro; Loh, Marie; Takeuchi, Fumihiko
2015-01-01
We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10(-11) to 5.0 × 10...
Kato, Norihiro; Loh, Marie; Takeuchi, Fumihiko; Verweij, Niek; Wang, Xu; Zhang, Weihua; Kelly, Tanika N.; Saleheen, Danish; Lehne, Benjamin; Leach, Irene Mateo; Drong, Alexander W.; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R.; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S.; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L.; Esko, Tonu; Go, Min Jin; Harris, Sarah E.; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E.; Li, Huaixing; Mok, Zuan Yu; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F. R.; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Alves, Alexessander Da Silva Couto; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C.; Kim, Yun Kyoung; Koivula, Robert W.; Luan, Jian'an; Lyytikainen, Leo-Pekka; Nguyen, Quang N.; Pereira, Mark A.; Postmus, Iris; Raitakari, Olli T.; Bryan, Molly Scannell; Scott, Robert A.; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S.; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Ines; Bjonnes, Andrew; Braun, Timothy R.; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D.; Doevendans, Pieter A.; Gansevoort, Ron T.; Gao, Yu-Tang; Grammer, Tanja B.; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S.; Hartikainen, Anna-Liisa; Hazen, Stanley L.; He, Jing; Heng, Chew-Kiat; Hixson, James E.; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L. N.; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M.; Katsuy, Tomohiro; Kibriya, Muhammad G.; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R.; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C. M.; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Mueller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T.; Pinidiyapathirage, Mohitha J.; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Rozario, Michelle Ann; Ruggiero, Daniela; Sala, Cinzia F.; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparso, Thomas; Spiering, Wilko; Starr, John M.; Stott, David J.; Stram, Daniel O.; Sugiyama, Takao; Szymczak, Silke; Tang, W. H. Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Vaino; Ueshima, Hirotsugu; Uitterlinden, Andre G.; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M.; van Gilst, Wiek H.; van Veldhuisen, Dirk J.; Viikari, Jorma S.; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D.; Young, Terri L.; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W.; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W.; Franks, Steve; Friedlander, Yechiel; Gross, Myron D.; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jorgensen, Torben; Jukema, J. Wouter; Kahonen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimaki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J.; Sorensen, Thorkild I. A.; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J.; Franco, Oscar H.; Franke, Lude; Heijman, Bastiaan T.; Holbrook, Joanna D.; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; Maerz, Winfried; Metspalu, Andres; Mohlke, Karen L.; Sanghera, Dharambir K.; Shu, Xiao-Ou; van Meurs, Joyce B. J.; Vithana, Eranga; Wickremasinghe, Ananda R.; Wijmenga, Cisca; Wolffenbuttel, Bruce H. W.; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A.; Kleinjans, Jos C. S.; McCarthy, Mark I.; Soong, Richie; Gieger, Christian; Scott, James; Teo, Yik-Ying; He, Jiang; Elliott, Paul; Tai, E. Shyong; van der Harst, Pim; Kooner, Jaspal S.; Chambers, John C.
2015-01-01
We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 x 10(-11) to 5.0 x
Control of box C/D snoRNP assembly by N6-methylation of adenine.
Huang, Lin; Ashraf, Saira; Wang, Jia; Lilley, David Mj
2017-09-01
N 6 -methyladenine is the most widespread mRNA modification. A subset of human box C/D snoRNA species have target GAC sequences that lead to formation of N 6 -methyladenine at a key trans Hoogsteen-sugar A·G base pair, of which half are methylated in vivo The GAC target is conserved only in those that are methylated. Methylation prevents binding of the 15.5-kDa protein and the induced folding of the RNA Thus, the assembly of the box C/D snoRNP could in principle be regulated by RNA methylation at its critical first stage. Crystallography reveals that N 6 -methylation of adenine prevents the formation of trans Hoogsteen-sugar A·G base pairs, explaining why the box C/D RNA cannot adopt its kinked conformation. More generally, our data indicate that sheared A·G base pairs (but not Watson-Crick base pairs) are more susceptible to disruption by N 6 mA methylation and are therefore possible regulatory sites. The human signal recognition particle RNA and many related Alu retrotransposon RNA species are also methylated at N6 of an adenine that forms a sheared base pair with guanine and mediates a key tertiary interaction. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Binding-Induced Fluorescence of Serotonin Transporter Ligands
DEFF Research Database (Denmark)
Wilson, James; Ladefoged, Lucy Kate; Babinchak, Michael
2014-01-01
The binding-induced fluorescence of 4-(4-(dimethylamino)-phenyl)-1-methylpyridinium (APP(+)) and two new serotonin transporter (SERT)-binding fluorescent analogues, 1-butyl-4-[4-(1-dimethylamino)phenyl]-pyridinium bromide (BPP(+)) and 1-methyl-4-[4-(1-piperidinyl)phenyl]-pyridinium (PPP(+)), has...
Directory of Open Access Journals (Sweden)
Zhe-Ming Lu
Full Text Available BACKGROUND: The exact relationship between nucleosome positioning and methylation of CpG islands in human pathogenesis is unknown. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we characterized the nucleosome position within the p16 CpG island and established a seeding methylation-specific PCR (sMSP assay based on bisulfite modification to enrich the p16 alleles containing methylated-CpG at the methylation "seeding" sites within its intron-1 in gastric carcinogenesis. The sMSP-positive rate in primary gastric carcinoma (GC samples (36/40 was significantly higher than that observed in gastritis (19/45 or normal samples (7/13 (P<0.01. Extensive clone sequencing of these sMSP products showed that the density of methylated-CpGs in p16 CpG islands increased gradually along with the severity of pathological changes in gastric tissues. In gastritis lesions the methylation was frequently observed in the region corresponding to the exon-1 coding-nucleosome and the 5'UTR-nucleosome; the methylation was further extended to the region corresponding to the promoter-nucleosome in GC samples. Only few methylated-CpG sites were randomly detected within p16 CpG islands in normal tissues. The significantly inversed relationship between the p16 exon-1 methylation and its transcription was observed in GC samples. An exact p16 promoter-specific 83 bp-MSP assay confirms the result of sMSP (33/55 vs. 1/6, P<0.01. In addition, p16 methylation in chronic gastritis lesions significantly correlated with H. pylori infection; however, such correlation was not observed in GC specimens. CONCLUSIONS/SIGNIFICANCE: It was determined that de novo methylation was initiated in the coding region of p16 exon-1 in gastritis, then progressed to its 5'UTR, and ultimately to the proximal promoter in GCs. Nucleosomes may function as the basic extension/progression unit of de novo methylation of p16 CpG islands in vivo.
Alsdurf, Jacob; Anderson, Cynthia; Siemens, David H.
2016-01-01
Genetic variation gives plants the potential to adapt to stressful environments that often exist beyond their geographic range limits. However, various genetic, physiological or developmental constraints might prevent the process of adaptation. Alternatively, environmentally induced epigenetic changes might sustain populations for several generations in stressful areas across range boundaries, but previous work on Boechera stricta, an upland mustard closely related to Arabidopsis, documented a drought-induced trans-generational plastic trade-off that could contribute to range limit development. Offspring of parents who were drought treated had higher drought tolerance, but lower levels of glucosinolate toxins. Both drought tolerance and defence are thought to be needed to expand the range to lower elevations. Here, we used methylation-sensitive amplified fragment length polymorphisms to determine whether environmentally induced DNA methylation and thus epigenetics could be a mechanism involved in the observed trans-generational plastic trade-off. We compared 110 offspring from the same self-fertilizing lineages whose parents were exposed to experimental drought stress treatments in the laboratory. Using three primer combinations, 643 polymorphic epi-loci were detected. Discriminant function analysis (DFA) on the amount of methylation detected resulted in significant combinations of epi-loci that distinguished the parent drought treatments in the offspring. Principal component (PC) and univariate association analyses also detected the significant differences, even after controlling for lineage, planting flat, developmental differences and multiple testing. Univariate tests also indicated significant associations between the amount of methylation and drought tolerance or glucosinolate toxin concentration. One epi-locus that was implicated in DFA, PC and univariate association analysis may be directly involved in the trade-off because increased methylation at this
Alsdurf, Jacob; Anderson, Cynthia; Siemens, David H
2015-12-18
Genetic variation gives plants the potential to adapt to stressful environments that often exist beyond their geographic range limits. However, various genetic, physiological or developmental constraints might prevent the process of adaptation. Alternatively, environmentally induced epigenetic changes might sustain populations for several generations in stressful areas across range boundaries, but previous work on Boechera stricta, an upland mustard closely related to Arabidopsis, documented a drought-induced trans-generational plastic trade-off that could contribute to range limit development. Offspring of parents who were drought treated had higher drought tolerance, but lower levels of glucosinolate toxins. Both drought tolerance and defence are thought to be needed to expand the range to lower elevations. Here, we used methylation-sensitive amplified fragment length polymorphisms to determine whether environmentally induced DNA methylation and thus epigenetics could be a mechanism involved in the observed trans-generational plastic trade-off. We compared 110 offspring from the same self-fertilizing lineages whose parents were exposed to experimental drought stress treatments in the laboratory. Using three primer combinations, 643 polymorphic epi-loci were detected. Discriminant function analysis (DFA) on the amount of methylation detected resulted in significant combinations of epi-loci that distinguished the parent drought treatments in the offspring. Principal component (PC) and univariate association analyses also detected the significant differences, even after controlling for lineage, planting flat, developmental differences and multiple testing. Univariate tests also indicated significant associations between the amount of methylation and drought tolerance or glucosinolate toxin concentration. One epi-locus that was implicated in DFA, PC and univariate association analysis may be directly involved in the trade-off because increased methylation at this
Rathore, Mangal S; Jha, Bhavanath
2016-03-01
The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.
Energy Technology Data Exchange (ETDEWEB)
Rai, Chitharanjan, E-mail: raichitharanjan@gmail.co [Department of Physics, Mangalore University, Mangalagangotri 574 199 (India); Kalpataru First Grade Science College, Tiptur 572 202 (India); Sreenivas, K. [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Dharmaprakash, S.M., E-mail: smdharma@yahoo.co [Department of Physics, Mangalore University, Mangalagangotri 574 199 (India)
2009-11-15
Single crystals of triglycine sulphate (TGS) doped with 1 mol% of 4-(dimethylamino) benzaldehyde (DB) have been grown from aqueous solution at ambient temperature by slow evaporation technique. The effect of dopant on the crystal growth and dielectric, pyroelectric and mechanical properties of TGS crystal have been investigated. X-ray powder diffraction pattern for pure and doped TGS was collected to determine the lattice parameters. FTIR spectra were employed to confirm the presence of 4-(dimethylamino) benzaldehyde in TGS crystal, qualitatively. The dielectric permittivity has been studied as a function of temperature by cooling the sample at a rate of 1 deg. C/min. An increase in the Curie temperature T{sub c}=51 deg. C (for pure TGS, T{sub c}=48.5 deg. C) and decrease in maximum permittivity has been observed for doped TGS when compared to pure TGS crystal. Pyroelectric studies on doped TGS were carried out to determine pyroelectric coefficient. The Vickers's hardness of the doped TGS crystals along (0 1 0) face is higher than that of pure TGS crystal for the same face. Domain patterns on b-cut plates were observed using scanning electron microscope. The low dielectric constant, higher pyroelectric coefficient and higher value of hardness suggest that doped TGS crystals could be a potential material for IR detectors.
Yield and oil composition of 38 basil (Ocimum basilicum L.) accessions grown in Mississippi.
Zheljazkov, Valtcho D; Callahan, Amber; Cantrell, Charles L
2008-01-09
A field experiment was conducted to assess yield, oil content, and composition of 38 genotypes of sweet basil ( Ocimum basilicum L.). Overall, biomass yields were high and comparable to those reported in the literature. However, basil genotypes differed significantly with respect to oil content and composition. Oil content of the tested accessions varied from 0.07% to 1.92% in dry herbage. On the basis of the oil composition, basil accessions were divided into seven groups: (1) high-linalool chemotype [19-73% (-)-linalool], (2) linalool-eugenol chemotype [six chemotypes with 28-66% (-)-linalool and 5-29% eugenol], (3) methyl chavicol chemotype [six accessions with 20-72% methyl chavicol and no (-)-linalool], (4) methyl chavicol-linalool chemotype [six accessions with 8-29% methyl chavicol and 8-53% (-)-linalool], (5) methyl eugenol-linalool chemotype [two accessions with 37% and 91% methyl eugenol and 60% and 15% (-)-linalool], (6) methyl cinnamate-linalool chemotype [one accession with 9.7% methyl cinnamate and 31% (-)-linalool], and (7) bergamotene chemotype [one accession with bergamotene as major constituent, 5% eucalyptol, and basil could be a viable essential oil crop in Mississippi. The availability of various chemotypes offers the opportunity for production of basil to meet the market requirements of specific basil oils or individual compounds such as (-)-linalool, eugenol, methyl chavicol, methyl cinnamate, or methyl eugenol.
Zened, A; Enjalbert, F; Nicot, M C; Troegeler-Meynadier, A
2013-01-01
Trans fatty acids (FA), exhibit different biological properties. Among them, cis-9,trans-11 conjugated linoleic acid has some interesting putative health properties, whereas trans-10,cis-12 conjugated linoleic acid has negative effects on cow milk fat production and would negatively affect human health. In high-yielding dairy cows, a shift from trans-11 to trans-10 pathway of biohydrogenation (BH) can occur in the rumen of cows receiving high-concentrate diets, especially when the diet is supplemented with unsaturated fat sources. To study this shift, 4 rumen-fistulated nonlactating Holstein cows were assigned to a 4×4 Latin square design with 4 different diets during 4 periods. Cows received 12 kg of dry matter per day of 4 diets based on corn silage during 4 successive periods: a control diet (22% starch, diet supplemented with wheat plus barley (35% starch, diet supplemented with 5% of sunflower oil (20% starch, 7.6% crude fat), and a high-starch plus sunflower oil diet (33% starch, 7.3% crude fat). Five hours after feeding, proportions of trans-11 BH isomers greatly increased in the rumen content with the addition of sunflower oil, without change in ruminal pH compared with the control diet. Addition of starch to the control diet had no effect on BH pathways but decreased ruminal pH. The addition of a large amount of starch in association with sunflower oil increased trans-10 FA at the expense of trans-11 FA in the rumen content, revealing a trans-11 to trans-10 shift. Interestingly, with this latter diet, ruminal pH did not change compared with a single addition of starch. This trans-11 to trans-10 shift occurred progressively, after a decrease in the proportion of trans-11 FA in the rumen, suggesting that this shift could result from a dysbiosis in the rumen in favor of trans-10-producing bacteria at the expense of those producing trans-11 or a modification of bacterial activities. Copyright © 2013 American Dairy Science Association. Published by Elsevier
Blee, K.; Choi, J. W.; O'Connell, A. P.; Jupe, S. C.; Schuch, W.; Lewis, N. G.; Bolwell, G. P.
2001-01-01
A number of plant species contain the class II of genes encoding the cytochrome P450, CYP73, the cognate protein of which cinnamic acid 4-hydroxylase, is the second enzyme of the phenylpropanoid pathway. In order to begin to determine possible functionality, tobacco has been transformed with a truncated French bean class II cinnamate hydroxylase (CYP73A15) in the sense and antisense orientations. Signals for C4H protein could be detected in vascular tissue from wild-type plants using heterologous probes. The transformed plants showed a normal phenotype, even though detectable C4H protein was much reduced in tissue prints. Young propagated transformants displayed a range of reduced C4H activities, as well as either reduced or no phloroglucinol-stainable lignin. However, all mature tobacco plants showed the accumulation of lignin, even though its deposition was apparently delayed. This was not due to induction of tyrosine ammonia-lyase activity, which was not detected, but instead it is presumed due to sufficient C4H residual activity. Analysis of the lignin content of the plants showed reductions of up to 30% with a slightly reduced syringyl to guaiacyl ratio as compared to wild type. This reduction level was favourable in comparison with some other targets in the lignification pathway that have been manipulated including that of class I cinnamate 4-hydroxylase. It is proposed that the class II cinnamate 4-hydroxylase might also function in lignification in a number of species including French bean and tobacco, based on these data.
Biotransformation of trans-1-chloro-3,3,3-trifluoropropene (trans-HCFO-1233zd)
Energy Technology Data Exchange (ETDEWEB)
Schmidt, Tobias [Institut für Toxikologie, Universität Würzburg, Versbacher Str. 9, 97078 Würzburg (Germany); Bertermann, Rüdiger [Institut für Anorganische Chemie, Universität Würzburg, Am Hubland, 97074 Würzburg (Germany); Rusch, George M.; Tveit, Ann [Honeywell, P.O. Box 1057, Morristown, NJ 07962-1057 (United States); Dekant, Wolfgang, E-mail: dekant@toxi.uni-wuerzburg.de [Institut für Toxikologie, Universität Würzburg, Versbacher Str. 9, 97078 Würzburg (Germany)
2013-05-01
trans-1-Chloro-3,3,3-trifluoropropene (trans-HCFO-1233zd) is a novel foam blowing and precision cleaning agent with a very low impact for global warming and ozone depletion. trans-HCFO-1233zd also has a low potential for toxicity in rodents and is negative in genotoxicity testing. The biotransformation of trans-HCFO-1233zd and kinetics of metabolite excretion with urine were assessed in vitro and in animals after inhalation exposures. For in vitro characterization, liver microsomes from rats, rabbits and humans were incubated with trans-HCFO-1233zd. Male Sprague Dawley rats and female New Zealand White rabbits were exposed to 2,000, 5,000 and 10,000 ppm for 6 h and urine was collected for 48 h after the end of the exposure. Study specimens were analyzed for metabolites using {sup 19}F NMR, LC-MS/MS and GC/MS. S-(3,3,3-trifluoro-trans-propenyl)-glutathione was identified as predominant metabolite of trans-HCFO-1233zd in all microsomal incubation experiments in the presence of glutathione. Products of the oxidative biotransformation of trans-HCFO-1233zd were only minor metabolites when glutathione was present. In rats, both 3,3,3-trifluorolactic acid and N-acetyl-(3,3,3-trifluoro-trans-propenyl)-L-cysteine were observed as major urinary metabolites. 3,3,3-Trifluorolactic acid was not detected in the urine of rabbits. Quantitation showed rapid excretion of both metabolites in both species (t{sub 1/2} < 6 h) and the extent of biotransformation of trans-HCFO-1233zd was determined as approximately 0.01% of received dose in rabbits and approximately 0.002% in rats. trans-HCFO-1233zd undergoes both oxidative biotransformation and glutathione conjugation at very low rates. The low extent of biotransformation and the rapid excretion of metabolites formed are consistent with the very low potential for toxicity of trans-HCFO-1233zd in mammals. - Highlights: ► No lethality and clinical signs were observed. ► Glutathione S-transferase and cytochrome P-450 dependent
Fibrillarin methylates H2A in RNA polymerase I trans-active promoters in Brassica oleracea
Directory of Open Access Journals (Sweden)
lloyd eLoza-Muller
2015-11-01
Full Text Available Fibrillarin is a well conserved methyltransferase involved in several if not all of the more than 100 methylations sites in rRNA which are essential for proper ribosome function. It is mainly localized in the nucleoli and Cajal bodies inside the cell nucleus where it exerts most of its functions. In plants, fibrillarin binds directly the guide RNA together with Nop56, Nop58 and 15.5ka proteins to form a snoRNP complex that selects the sites to be methylated in pre-processing of ribosomal RNA. Recently, the yeast counterpart NOP1 was found to methylate histone H2A in the nucleolar regions. Here we show that plant fibrillarin can also methylate histone H2A. In Brassica floral meristem cells the methylated histone H2A is mainly localized in the nucleolus but unlike yeast or human cells it also localize in the periphery of the nucleus. In specialized transport cells the pattern is altered and it exhibits a more diffuse staining in the nucleus for methylated histone H2A as well as for fibrillarin. Here we also show that plant fibrillarin is capable of interacting with H2A and carry out its methylation in the rDNA promoter.
Thermodynamic properties of the methyl esters of p-hydroxy and p-methoxy benzoic acids
International Nuclear Information System (INIS)
Almeida, Ana R.R.P.; Cunha, André F.G.; Matos, M. Agostinha R.; Morais, Victor M.F.
2014-01-01
Highlights: • Vapor pressures and energies of combustion of two methyl benzoates were measured. • Standard molar ΔH, ΔS and ΔG of sublimation and vaporization were derived. • Standard molar ΔH, ΔS and ΔG of formation in crystal and gas phases were calculated. • Gas phase ΔH of formation was also estimated by quantum chemical calculations. • ΔH of the intermolecular hydrogen bond O–H⋯O was estimated. - Abstract: The vapor pressures of crystalline and liquid phases of methyl p-hydroxybenzoate and of methyl p-methoxybenzoate were measured over the temperature ranges (338.9 to 423.7) K and (292.0 to 355.7) K respectively, using a static method based on diaphragm capacitance gauges. The vapor pressures of the crystalline phase of the former compound were also measured in the temperature range (323.1 to 345.2) K using a Knudsen mass-loss effusion technique. The results enabled the determination of the standard molar enthalpies, entropies and Gibbs free energies of sublimation and of vaporization, at T = 298.15 K, as well as phase diagram representations of the (p, T) experimental data, including the triple point. The temperatures and molar enthalpies of fusion of both compounds were determined using differential scanning calorimetry and were compared with the results indirectly derived from the vapor pressure measurements. The standard (p° = 10 5 Pa) molar enthalpies of formation, in the crystalline phase, at T = 298.15 K, of the compounds studied were derived from their standard massic energies of combustion measured by static-bomb combustion calorimetry. From the experimental results, the standard molar enthalpies of formation, in the gaseous phase at T = 298.15 K, were calculated and compared with the values estimated by employing quantum chemical computational calculations. A good agreement between experimental and theoretical results is observed. To analyze the thermodynamic stability of the two compounds studied, the standard Gibbs free
International Nuclear Information System (INIS)
Dai, Wei; Cheung, Arthur Kwok Leung; Ko, Josephine Mun Yee; Cheng, Yue; Zheng, Hong; Ngan, Roger Kai Cheong; Ng, Wai Tong; Lee, Anne Wing Mui; Yau, Chun Chung; Lee, Victor Ho Fu; Lung, Maria Li
2015-01-01
Altered patterns of DNA methylation are key features of cancer. Nasopharyngeal carcinoma (NPC) has the highest incidence in Southern China. Aberrant methylation at the promoter region of tumor suppressors is frequently reported in NPC; however, genome-wide methylation changes have not been comprehensively investigated. Therefore, we systematically analyzed methylome data in 25 primary NPC tumors and nontumor counterparts using a high-throughput approach with the Illumina HumanMethylation450 BeadChip. Comparatively, we examined the methylome data of 11 types of solid tumors collected by The Cancer Genome Atlas (TCGA). In NPC, the hypermethylation pattern was more dominant than hypomethylation and the majority of de novo methylated loci were within or close to CpG islands in tumors. The comparative methylome analysis reveals hypermethylation at chromosome 6p21.3 frequently occurred in NPC (false discovery rate; FDR=1.33 × 10 −9 ), but was less obvious in other types of solid tumors except for prostate and Epstein–Barr virus (EBV)-positive gastric cancer (FDR<10 −3 ). Bisulfite pyrosequencing results further confirmed the aberrant methylation at 6p in an additional patient cohort. Evident enrichment of the repressive mark H3K27me3 and active mark H3K4me3 derived from human embryonic stem cells were found at these regions, indicating both DNA methylation and histone modification function together, leading to epigenetic deregulation in NPC. Our study highlights the importance of epigenetic deregulation in NPC. Polycomb Complex 2 (PRC2), responsible for H3K27 trimethylation, is a promising therapeutic target. A key genomic region on 6p with aberrant methylation was identified. This region contains several important genes having potential use as biomarkers for NPC detection
DNA methylation-based variation between human populations.
Kader, Farzeen; Ghai, Meenu
2017-02-01
Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.
DEFF Research Database (Denmark)
Lashkari, Saman; Jensen, Søren Krogh
2017-01-01
in the methylation steps, as they are sensitive to pH changes and oxidation. The present study was carried out to determine the efficiency of different methylation procedures on quantitative determination of conjugated linoleic acid (CLA), PUFA and response of internal standard. The highest response of internal...... standard was observed for boron trifluoride (BF3)/methanol and methanolic HCl followed by NaOCH3, while cis-9, trans-11 CLA, total CLA and PUFA was higher with methanolic HCl followed by NaOCH3 compared with the BF3 method. These data can be useful for quantitating of milk FA....
Ring transformations of heterocyclic halogeno compounds with nucleophiles. 39
Geerts, J.P.; Plas, van der H.C.
1978-01-01
Treatment of 4-chloro-2-dimethylaminopyrimidine (1a) and its 5-phenyl derivative (1b) with potassium amide in liquid ammonia and subsequent workup of the reaction mixtures lead to the formation of 2-dimethylamino-4-methyl-s-triazine and 4-benzyl-2-dimethylamino-s-triazine, respectively. By extensive
Surface relief grating formation on a single crystal of 4-(dimethylamino)azobenzene
International Nuclear Information System (INIS)
Nakano, Hideyuki; Tanino, Takahiro; Shirota, Yasuhiko
2005-01-01
Surface relief grating (SRG) formation on an organic single crystal by irradiation with two coherent laser beams has been demonstrated by using 4-(dimethylamino)azobenzene (DAAB). It was found that the SRG formation was greatly depending upon both the coordination of the crystal and the polarization of the writing beams. The dependence of the polarization of writing beams on the SRG formation using the single crystal was found to be quite different from that reported for amorphous polymers and photochromic amorphous molecular materials, suggesting that the mechanism of the SRG formation on the organic crystal is somewhat different from that on amorphous materials
Trans advanced surface laser ablation (TransPRK) outcomes using SmartPulseTechnology.
Aslanides, Ioannis M; Kymionis, George D
2017-02-01
To evaluate early visual rehabilitation, post-operative pain, epithelial healing and haze after transepithelial photorefractive keratectomy (TransPRK) using the SmartPulseTechnology (SPT) of Schwind Amaris (Schwind eye-tech-solutions GmbH, Kleinostheim, Germany). This was a retrospective comparative evaluation of a cohort of myopic patients undergoing TransPRK with SPT (group 1), with one matched control group that underwent conventional TransPRK (group 2). All cases had a 6-month post-operative follow-up including visual acuity and slit-lamp examination. Subjective evaluation of pain was recorded post-operatively. 49 eyes of 25 patients in group 1 and 40 eyes of 20 patients in group 2 were enrolled. The patients' visual rehabilitation was significantly faster in group 1, one day and one week post-operatively (P0.05). TransPRK using SPT provides promising results in the early post-operative period. Visual rehabilitation, re-epithelialization and pain were faster in the early post-operative period in group 1 in comparison with group 2. Haze formation was not significantly different between the two groups; however, it was consistently less in group 1. Copyright © 2016 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.
The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver
International Nuclear Information System (INIS)
Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.
2007-01-01
It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes
Directory of Open Access Journals (Sweden)
Der Jiun Ooi
2016-06-01
Full Text Available Increasing evidence from both experimental and clinical studies depicts the involvement of oxidative stress in the pathogenesis of various diseases. Specifically, disruption of homeostatic redox balance in accumulated body fat mass leads to obesity-associated metabolic syndrome. Strategies for the restoration of redox balance, potentially by exploring potent plant bioactives, have thus become the focus of therapeutic intervention. The present study aimed to bioprospect the potential use of the curculigoside-cinnamic acid-rich fraction from Molineria latifolia rhizome as an antioxidant therapeutic agent. The ethyl acetate fraction (EAF isolated from M. latifolia rhizome methanolic extract (RME contained the highest amount of phenolic compounds, particularly curculigoside and cinnamic acid. EAF demonstrated glycation inhibitory activities in both glucose- and fructose-mediated glycation models. In addition, in vitro chemical-based and cellular-based antioxidant assays showed that EAF exhibited high antioxidant activities and a protective effect against oxidative damage in 3T3-L1 preadipocytes. Although the efficacies of individual phenolics differed depending on the structure and concentration, a correlational study revealed strong correlations between total phenolic contents and antioxidant capacities. The results concluded that enriched phenolic contents in EAF (curculigoside-cinnamic acid-rich fraction contributed to the overall better reactivity. Our data suggest that this bioactive-rich fraction warrants therapeutic potential against oxidative stress-related disorders.
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Papain-like protease (PLpro) inhibitory effects of cinnamic amides from Tribulus terrestris fruits.
Song, Yeong Hun; Kim, Dae Wook; Curtis-Long, Marcus John; Yuk, Heung Joo; Wang, Yan; Zhuang, Ningning; Lee, Kon Ho; Jeon, Kwon Seok; Park, Ki Hun
2014-01-01
Tribulus terrestris fruits are well known for their usage in pharmaceutical preparations and food supplements. The methanol extract of T. terrestris fruits showed potent inhibition against the papain-like protease (PLpro), an essential proteolylic enzyme for protection to pathogenic virus and bacteria. Subsequent bioactivity-guided fractionation of this extract led to six cinnamic amides (1-6) and ferulic acid (7). Compound 6 emerged as new compound possessing the very rare carbinolamide motif. These compounds (1-7) were evaluated for severe acute respiratory syndrome coronavirus (SARS-CoV) PLpro inhibitory activity to identify their potencies and kinetic behavior. Compounds (1-6) displayed significant inhibitory activity with IC50 values in the range 15.8-70.1 µM. The new cinnamic amide 6 was found to be most potent inhibitor with an IC50 of 15.8 µM. In kinetic studies, all inhibitors exhibited mixed type inhibition. Furthermore, the most active PLpro inhibitors (1-6) were proven to be present in the native fruits in high quantities by HPLC chromatogram and liquid chromatography with diode array detection and electrospray ionization mass spectrometry (LC-DAD-ESI/MS).
High CpG island methylation ofp16 gene and loss of p16 protein ...
Indian Academy of Sciences (India)
Navya
:Tetralogy of Fallot;p16 gene;p16 protein;CpG islands;Methylation;Promoter regions ... of congenital heart disease, as well as the exclusion of previous history of ..... malignant progression of oral epithelial dysplasia: a prospective cohort study.
Spectroscopic and density functional theory studies of trans-3-(trans-4-imidazolyl)acrylic acid.
Arjunan, V; Remya, P; Sathish, U; Rani, T; Mohan, S
2014-08-14
The structural parameters, thermodynamic properties and vibrational frequencies of the optimised geometry of trans-3-(trans-4-imidazolyl)acrylic acid have been determined from B3LYP methods with 6-311++G(**) and cc-pVTZ basis sets. The effects of substituents (acrylyl group) on the imidazole vibrational frequencies are analysed. The vibrational frequencies of the fundamental modes of trans-3-(trans-4-imidazolyl)acrylic acid have been precisely assigned and analysed and the theoretical results are compared with the experimental vibrations. (1)H and (13)C NMR isotropic chemical shifts are calculated and the assignments made are compared with the experimental values. The energies of important MO's of the compound are also determined from DFT method. The total electron density and electrostatic potential of the compound are determined by natural bond orbital analysis. Various reactivity and selectivity descriptors such as chemical hardness, chemical potential, softness, electrophilicity, nucleophilicity and the appropriate local quantities employing natural population analysis (NPA) are calculated. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Itoh, Hiroaki [Department of Epidemiology and Environmental Health, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113–8421 Japan (Japan); Iwasaki, Motoki, E-mail: moiwasak@ncc.go.jp [Epidemiology Division, Research Center for Cancer Prevention and Screening, National Cancer Center, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104–0045 Japan (Japan); Kasuga, Yoshio [Department of Surgery, Nagano Matsushiro General Hospital, 183 Matsushiro, Matsushiro-cho, Nagano City, Nagano Prefecture 381–1231 Japan (Japan); Yokoyama, Shiro; Onuma, Hiroshi [Department of Breast and Thyroid Surgery, Nagano Red Cross Hospital, 5-22-1 Wakasato, Nagano City, Nagano Prefecture 380–8582 Japan (Japan); Nishimura, Hideki [Department of Respiratory Surgery and Breast Surgery, Nagano Municipal Hospital, 1333–1 Tomitake, Nagano City, Nagano Prefecture 381–8551 Japan (Japan); Kusama, Ritsu [Department of Surgery, Hokushin General Hospital, 1-5-63 Nishi, Nakano City, Nagano Prefecture 383–8505 Japan (Japan); Yoshida, Teruhiko [Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104–0045 Japan (Japan); Yokoyama, Kazuhito [Department of Epidemiology and Environmental Health, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113–8421 Japan (Japan); Tsugane, Shoichiro [Dierctor Research Center for Cancer Prevention and Screening, National Cancer Center, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104–0045 Japan (Japan)
2014-08-15
While the global methylation level of leukocyte DNA may be a suitable biomarker for cancer risk, the level may be influenced by multiple factors, both environmental and host-related, one of which is exposure to environmental pollutants. To date, three epidemiologic studies have examined associations between serum organochlorine levels and global DNA methylation level, but their findings are not fully consistent, and the associations thus require confirmation in other well-characterized populations. We tested the association between organochlorine exposure and the global DNA methylation level of leukocytes in Japanese women. We conducted a cross-sectional study using the control group of a breast cancer case–control study in Japan. Subjects were 403 Japanese women who provided blood samples. Serum polychlorinated biphenyls (PCBs) and nine pesticide-related organochlorines were measured by gas chromatography isotope-dilution high-resolution mass spectrometry. Further, global methylation level of peripheral leukocyte DNA among 399 women was measured by luminometric methylation assay. Linear trends in the association between methylation and quartile levels of organochlorines were evaluated by regression coefficients in a multivariable linear regression model. We found significant inverse associations between the global methylation level in leukocyte DNA and many of the organochlorine levels measured. Global methylation level was significantly decreased by 0.33–0.83% per quartile category for serum o,p′-dichlorodiphenyltrichloroethane (o,p′-DDT), p,p′-DDT, p,p′-dichlorodiphenyldichloroethylene, trans-nonachlor, oxychlordane, hexachlorobenzene, β-hexachlorocyclohexane, PCB17, PCB52/69, PCB74, PCB114, and PCB183. Serum organochlorine levels were inversely associated with the global methylation level of leukocyte DNA in a relatively large sample of Japanese women. - Highlights: • Many serum organochlorine pesticides were inversely associated with the global
Ichimura, Norihisa; Shinjo, Keiko; An, Byonggu; Shimizu, Yasuhiro; Yamao, Kenji; Ohka, Fumiharu; Katsushima, Keisuke; Hatanaka, Akira; Tojo, Masayuki; Yamamoto, Eiichiro; Suzuki, Hiromu; Ueda, Minoru; Kondo, Yutaka
2015-08-01
Inactivation of methylcytosine dioxygenase, ten-eleven translocation (TET) is known to be associated with aberrant DNA methylation in cancers. Tumors with a CpG island methylator phenotype (CIMP), a distinct subgroup with extensive DNA methylation, show characteristic features in the case of colorectal cancer. The relationship between TET inactivation and CIMP in colorectal cancers is not well understood. The expression level of TET family genes was compared between CIMP-positive (CIMP-P) and CIMP-negative (CIMP-N) colorectal cancers. Furthermore, DNA methylation profiling, including assessment of the TET1 gene, was assessed in colorectal cancers, as well as colon polyps. The TET1 was silenced by DNA methylation in a subset of colorectal cancers as well as cell lines, expression of which was reactivated by demethylating agent. TET1 methylation was more frequent in CIMP-P (23/55, 42%) than CIMP-N (2/113, 2%, P CIMP-P, 16/40, 40%; CIMP-N, 2/24, 8%; P = 0.002), suggesting that TET1 methylation is an early event in CIMP tumorigenesis. TET1 methylation was significantly associated with BRAF mutation but not with hMLH1 methylation in the CIMP-P colorectal cancers. Colorectal cancers with TET1 methylation have a significantly greater number of DNA methylated genes and less pathological metastasis compared to those without TET1 methylation (P = 0.007 and 0.045, respectively). Our data suggest that TET1 methylation may contribute to the establishment of a unique pathway in respect to CIMP-mediated tumorigenesis, which may be incidental to hMLH1 methylation. In addition, our findings provide evidence that TET1 methylation may be a good biomarker for the prediction of metastasis in colorectal cancer. ©2015 American Association for Cancer Research.
Involvement of an autotoxic compound in asparagus decline.
Kato-Noguchi, Hisashi; Nakamura, Keisuke; Okuda, Nobuyuki
2018-03-19
Asparagus (Asparagus officinalis L.) is a widely cultivated perennial veritable and can be harvested more than ten years. However, the crop quality and yield decline after a few year's cultivation, which is called "asparagus decline". Even though those asparagus plants were replaced with new young asparagus plants, the productivity and quality of the crop remain relatively low, which is known as a "asparagus replant problem". One of the possible reasons for "asparagus decline" and "asparagus replant problem" is thought to be autotoxicity of asparagus. However, the compounds involved in the autotoxicity is not clear. The objective of this study was therefore to determine the potential role of autotoxicity in the "asparagus decline" and "asparagus replant problem". An aqueous methanol extract of 10-year-asparagus-cultivated soils inhibited the growth of asparagus seedlings and other two test plants with concentration dependent manner. The result confirmed that the asparagus soils have autotoxic activity. The extract was then purified by several chromatographies with monitoring the inhibitory activity and a potent growth inhibitory substance causing the autotoxic effect was isolated. The chemical structures of the compound was determined by spectral data to be trans-cinnamic acid. trans-Cinnamic acid inhibited the growth of asparagus seedlings at concentrations greater than 10 μM. The concentrations required for 50% growth inhibition of asparagus (IC 50 ) were 24.1-41.6 μM. trans-Cinnamic acid accumulated 174 μM in the 10-year-asparagus-cultivated soils, which may be enough levels to cause the growth inhibition on asparagus considering its IC 50 value. Therefore, trans-cinnamic acid may contribute to the autotoxic effect of asparagus soils, and may be in part responsible for "asparagus decline" and "asparagus replant problem". Copyright © 2018 Elsevier GmbH. All rights reserved.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-01
Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Directory of Open Access Journals (Sweden)
Inga Hinrichsen
Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Directory of Open Access Journals (Sweden)
Chunli Xu
2018-03-01
Full Text Available Controllable pesticide release in response to environmental stimuli is highly desirable for better efficacy and fewer adverse effects. Combining the merits of natural and synthetic polymers, pH and temperature dual-responsive chitosan copolymer (CS-g-PDMAEMA was facilely prepared through free radical graft copolymerization with 2-(dimethylamino ethyl 2-methacrylate (DMAEMA as the vinyl monomer. An emulsion chemical cross-linking method was used to expediently fabricate pyraclostrobin microcapsules in situ entrapping the pesticide. The loading content and encapsulation efficiency were 18.79% and 64.51%, respectively. The pyraclostrobin-loaded microcapsules showed pH-and thermo responsive release. Microcapsulation can address the inherent limitation of pyraclostrobin that is photo unstable and highly toxic on aquatic organisms. Compared to free pyraclostrobin, microcapsulation could dramatically improve its photostability under ultraviolet light irradiation. Lower acute toxicity against zebra fish on the first day and gradually similar toxicity over time with that of pyraclostrobin technical concentrate were in accordance with the release profiles of pyraclostrobin microcapsules. This stimuli-responsive pesticide delivery system may find promising application potential in sustainable plant protection.
Xu, Chunli; Cao, Lidong; Zhao, Pengyue; Zhou, Zhaolu; Cao, Chong; Zhu, Feng; Li, Fengmin; Huang, Qiliang
2018-03-14
Controllable pesticide release in response to environmental stimuli is highly desirable for better efficacy and fewer adverse effects. Combining the merits of natural and synthetic polymers, pH and temperature dual-responsive chitosan copolymer (CS- g -PDMAEMA) was facilely prepared through free radical graft copolymerization with 2-(dimethylamino) ethyl 2-methacrylate (DMAEMA) as the vinyl monomer. An emulsion chemical cross-linking method was used to expediently fabricate pyraclostrobin microcapsules in situ entrapping the pesticide. The loading content and encapsulation efficiency were 18.79% and 64.51%, respectively. The pyraclostrobin-loaded microcapsules showed pH-and thermo responsive release. Microcapsulation can address the inherent limitation of pyraclostrobin that is photo unstable and highly toxic on aquatic organisms. Compared to free pyraclostrobin, microcapsulation could dramatically improve its photostability under ultraviolet light irradiation. Lower acute toxicity against zebra fish on the first day and gradually similar toxicity over time with that of pyraclostrobin technical concentrate were in accordance with the release profiles of pyraclostrobin microcapsules. This stimuli-responsive pesticide delivery system may find promising application potential in sustainable plant protection.
Trans-esterification of poultry skin fat to produce biodiesel
International Nuclear Information System (INIS)
Anees, H.; Shah, S.F.A.; Ali, Z.M.
2016-01-01
Chicken skin and its fat are sources of solid waste that are usually not utilized and add solid pollution. This research work deals with the production of useful biodiesel from utilizing the waste chicken (fat and its skins). Waste chicken fat and its skins (sourced from local shops of Hyderabad, Sindh, Pakistan) were extracted and trans-estrification was made. The product of trans-estrification was fatty acid methyl esters (FAME) commonly known as biodiesel. Sodium Hydroxide (NaOH) was used as catalyst and glycerol was obtained as a by-product. The FAME produced was tested for six parameters namely calorific value, cloud point, pour point, flash point, density and viscosity when compared to ASTM E2515-11 standard values. The results of this experiment showed that the calorific value, cloud point, pour point, flash point, density and viscosity values of FAME produced from chicken skin and its fat were close to that of petroleum derived diesel. (author)
Polyphenol compounds of the kino of Eucalyptus citriodora
International Nuclear Information System (INIS)
Freitas, Marinalva Oliveira; Lima, Mary Anne S.; Silveira, Edilberto R.
2007-01-01
Phytochemical analysis of the kino of Eucalyptus citriodora led to the isolation of 1-O,2-O-digaloil-6-O-trans-p-cumaroil-beta-D-glucopyranoside, 1-O-trans-p-cumaroil-6-O-cinamoil-beta-D-glucopyranoside, alpha and beta 6-O-trans-p-cumaroil-D-glucopyranoside, 7-methylaromadendrin-4'-O-6 - trans-p-cumaroil-beta-Dglucopyranoside, aromadendrin, aromadendrin-7-methyl-ether, naringenin, sakuranetin, kaempferol-7-methyl-ether and galic acid. Structural elucidation of the isolated compounds was established on the basis of spectral data, particularly by the use of 1D NMR and several 2D shift correlated NMR pulse sequences ( 1 H, 1 H-COSY, HMQC, HMBC). (author)
Aw, Beng-Hwee; Hor, T. S. Andy; Selvaratnam, S.; Mok, K. F.; White, Andrew J. P.; Williams, David J.; Rees, Nicholas H.; McFarlane, William; Leung, Pak-Hing
1997-05-07
The organopalladium complex containing ortho-metalated (S)-(1-(dimethylamino)ethyl)naphthalene as the chiral auxiliary has been used successfully to promote the asymmetric [4+2] Diels-Alder reactions between 1-phenyl-3,4-dimethylphosphole and the following coordinated dienophiles: (a) diphenylvinylphosphine; (b) (E)-diphenyl-1-propenylphosphine; (c) (Z)-diphenyl-1-propenylphosphine. Reaction a generates three carbon and one phosphorus stereogenic centers while reactions b and c each produce four carbon and one phosphorus chiral centers. In dichloromethane, all three reactions proceeded smoothly at room temperature giving the corresponding rigid diphosphines in high yields. Under similar reaction conditions, the reaction times observed for reactions a-c are 2, 3, and 50 h, respectively. Two-dimensional ROESY NMR studies confirmed that the prolonged reaction time required for reaction c is due to several major repulsive interactions between the chiral naphthylamine auxiliary and the (Z)-methyl-substituted vinylphosphine in the transition state. Nevertheless, all three reactions gave the corresponding rigid diphosphine in high yields. The absolute stereochemistries of the three bidentate phosphine ligands that were produced from the cycloaddition reactions have been assigned by 2D ROESY NMR spectroscopy. These diphosphines are powerful sequesterers of group 8 metals although they are highly air-sensitive in the free ligand form. The coordination chemistry and the absolute stereochemistry of the optically active complex [1alpha,4alpha,5alpha(S),6alpha(S),7R]-dichloro[5-(diphenylphosphino)-2,3,6-trimethy-7-phenyl-7-phosphabicyclo[2.2.1]-hept-2-ene-P(5)(),P(7)()]palladium(II) has been studied by single-crystal X-ray analysis. Crystal structure data: C(27)H(28)Cl(2)P(2)Pd, M(r) = 591.7; triclinic; space group P1; a = 8.643(3), b = 9.044(6), c = 9.058(4) Å; alpha = 102.75(4) degrees, beta = 108.59(2) degrees, gamma = 97.82(3) degrees; V = 638.0(5) Å(3); Z = 1; R(1) = 0.036.
Balashov, S. P.; Govindjee, R.; Ebrey, T. G.
1991-01-01
At high pH (> 8) the 570 nm absorption band of all-trans bacteriorhodopsin (bR) in purple membrane undergoes a small (1.5 nm) shift to longer wavelengths, which causes a maximal increase in absorption at 615 nm. The pK of the shift is 9.0 in the presence of 167 mM KCl, and its intrinsic pK is ∼8.3. The red shift of the trans-bR absorption spectrum correlates with the appearance of the fast component in the light-induced L to M transition, and absorption increases at 238 and 297 nm which are a...
de Moraes, M de L; Polakiewicz, B; Mattua, M F; Tavares, M F
1998-01-01
Atracurium besylate is a highly selective nondepolarizing neuromuscular blocking agent routinely used during anesthetic procedures. The commercial presentation of this drug is a mixture of positional isomers, cis-cis, cis-trans, and trans-trans. Reversed-phase high-performance liquid chromatography has been the technique of choice for the analysis of atracurium besylate formulations at the quality control laboratory of Núcleo de Desenvolvimento Cristália (São Paulo, Brazil), a local pharmaceutical company. HPLC analysis is usually conducted under gradient elution using acetonitrile/0.1 M phosphate buffer eluent mixture as mobile phase and an octadecyl silica (ODS)-packed column. The complete elution of the three isomers takes about 1 hr. In this work, an alternative capillary electrophoresis methodology was developed. The complete resolution of all three isomers was accomplished in about 13 min (+20 kV/72 cm, 211 nm direct detection) using a 60-mM phosphate buffer solution (pH 4) containing 20 mM beta-cyclodextrin and 4 M urea. The isomer ratio was found to be 59.1% cis-cis, 35.9% cis-trans, and 5.02% trans-trans (expected ratio: 59:35:6). Laudanosine, a major metabolite of atracurium besylate, was identified in two commercially available formulations, Tracur (Núcleo de Desenvolvimento Cristália) and Tracrium (Glaxo Wellcome, S.A., Rio de Janeiro, Brazil). Its concentration increases considerably during storage of the product, even if the product is stored at low temperatures.
[Central muscle relaxant activities of 2-methyl-3-aminopropiophenone derivatives].
Kontani, H; Mano, A; Koshiura, R; Yamazaki, M; Shimada, Y; Oshita, M; Morikawa, K; Kato, H; Ito, Y
1987-02-01
In this experiment, we synthetized new 2-methyl-3-aminopropiophenone (MP) derivatives, whose structure is known to have central muscle relaxant activities, and quinolizidine and indan . tetralin derivatives derived from MP by cyclization, and we investigated the central muscle relaxant activity. Among the quinolizidine derivatives, there was a very strong central depressant agent, trans (3H, 9aH)-3-(p-chloro) benzoyl-quinolizidine (HSR-740), and among the indan . tetralin derivatives, there was an excitant agents, trans (1H, 2H)-5-methoxy-3, 3-dimethyl-2-piperidinomethyl indan-1-ol (HSR-719). From the results, these derivatives were not considered to be adequate for central muscle relaxant. Among the MP derivatives, (4'-chloro-2'-methoxy-3-piperidino) propiophenone HCl (HSR-733) and (4'-ethyl-2-methyl-3-pyrrolidino) propiophenone HCl (HSR-770) strongly inhibited the cooperative movement in the rotating rod method using mice, and it exerted almost the same depressant activity on the cross extensor reflex using alpha-chloralose anesthetized rats. However, the inhibitory effects of HSR-733 on the anemic decerebrate rigidity and the rigidity induced by intracollicular decerebration in rats were weaker than those of HSR-770 and eperisone. In spinal cats, at a low dose (5 mg/kg, i.v.), HSR-733 depressed monosynaptic and dorsal root reflex potentials as compared with polysynaptic reflex potentials, and inhibitory effects of HSR-733 on these three reflex potentials were more potent than those of eperisone and HSR-770. Although HSR-770 acts on the spinal cord and supraspinal level on which eperisone has been reported to act, HSR-733 may mainly act on the spinal cord. These results indicate that the MP derivative with a 2-methyl group may be suitable as a central muscle relaxant. HSR-770, which has equipotent muscle relaxant activity to eperisone, exerted strong inhibitory effects on oxotremorine-induced tremor and weak inhibitory effects on spontaneous motor activity in the
Dehalogenation Activity of Selected Fungi Toward δ-Iodo-γ-Lactone Derived from trans,trans-Farnesol.
Gliszczyńska, Anna; Gładkowski, Witold; Świtalska, Marta; Wietrzyk, Joanna; Szumny, Antoni; Gębarowska, Elżbieta; Wawrzeńczyk, Czesław
2016-04-01
Time-course of biotransformation of racemic trans-4-((E)-4',8'-dimethylnona-3',7'-dien-1-yl)-5-iodomethyl-4-methyldihydrofuran-2-one (1) in fungal and yeast cultures was investigated. In these conditions, the substrate 1 was enantioselectively dehalogenated yielding 4-((E)-4',8'-dimethylnona-3',7'-dien-1-yl)-4-methyl-5-methylenedihydrofuran-2-one (2) and its structure was established based on the spectroscopic data. The most effective biocatalyst used was Didymosphaeria igniaria, which catalyzed the process with highest rate and enantioselectivity (ee of product = 76%). The antiproliferative activity of δ-iodo-γ-lactone 1, product of its biotransformation 2, and starting substrate (farnesol) were evaluated toward two cancer cell lines: A549 (human lung adenocarcinoma) and HL-60 (human promyelocytic leukemia). © 2016 Verlag Helvetica Chimica Acta AG, Zürich.
Cord blood buffy coat DNA methylation is comparable to whole cord blood methylation.
Dou, John; Schmidt, Rebecca J; Benke, Kelly S; Newschaffer, Craig; Hertz-Picciotto, Irva; Croen, Lisa A; Iosif, Ana-Maria; LaSalle, Janine M; Fallin, M Daniele; Bakulski, Kelly M
2018-01-01
Cord blood DNA methylation is associated with numerous health outcomes and environmental exposures. Whole cord blood DNA reflects all nucleated blood cell types, while centrifuging whole blood separates red blood cells, generating a white blood cell buffy coat. Both sample types are used in DNA methylation studies. Cell types have unique methylation patterns and processing can impact cell distributions, which may influence comparability. We evaluated differences in cell composition and DNA methylation between cord blood buffy coat and whole cord blood samples. Cord blood DNA methylation was measured with the Infinium EPIC BeadChip (Illumina) in eight individuals, each contributing buffy coat and whole blood samples. We analyzed principal components (PC) of methylation, performed hierarchical clustering, and computed correlations of mean-centered methylation between pairs. We conducted moderated t-tests on single sites and estimated cell composition. DNA methylation PCs were associated with individual (P PC1 = 1.4 × 10 -9 ; P PC2 = 2.9 × 10 -5 ; P PC3 = 3.8 × 10 -5 ; P PC4 = 4.2 × 10 -6 ; P PC5 = 9.9 × 10 -13 , P PC6 = 1.3 × 10 -11 ) and not with sample type (P PC1-6 >0.7). Samples hierarchically clustered by individual. Pearson correlations of mean-centered methylation between paired samples ranged from r = 0.66 to r = 0.87. No individual site significantly differed between buffy coat and whole cord blood when adjusting for multiple comparisons (five sites had unadjusted Pcoat and whole cord blood are much lower than inter-individual variation, demonstrating that both sample preparation types can be analytically combined and compared.
Gas chromatographic--mass spectrometric quantitation of 16, 16-dimethyl-trans-delta 2-PGE1
Energy Technology Data Exchange (ETDEWEB)
Dimov, V.; Green, K.; Bygdeman, M.; Konishi, Y.; Imaki, K.; Hayashi, M.
1983-02-01
Di-deuterated and di-tritiated 16,16-dimethyl-trans-delta 2-PGE1 has been synthesized and used for development of a GC-MS method for quantitation of corresponding unlabelled drug in patient plasma. Although these carrier/internal standard molecules only contain 2 deuterium atoms the lower limit of detection at each injection is as low as about 40 pg. The maximum plasma levels of this drug following administration of vaginal suppositories used in clinical studies (1 mg 16,16-dimethyl-trans-delta 2-PGE1 methyl ester in 0.8 g Witepsol S-52) were 100-350 pg/ml i.e. in the same order of magnitude as earlier seen for 16,16-dimethyl-PGE2.
Gas chromatographic--mass spectrometric quantitation of 16, 16-dimethyl-trans-delta 2-PGE1
International Nuclear Information System (INIS)
Dimov, V.; Green, K.; Bygdeman, M.; Konishi, Y.; Imaki, K.; Hayashi, M.
1983-01-01
Di-deuterated and di-tritiated 16,16-dimethyl-trans-delta 2-PGE1 has been synthesized and used for development of a GC-MS method for quantitation of corresponding unlabelled drug in patient plasma. Although these carrier/internal standard molecules only contain 2 deuterium atoms the lower limit of detection at each injection is as low as about 40 pg. The maximum plasma levels of this drug following administration of vaginal suppositories used in clinical studies (1 mg 16,16-dimethyl-trans-delta 2-PGE1 methyl ester in 0.8 g Witepsol S-52) were 100-350 pg/ml i.e. in the same order of magnitude as earlier seen for 16,16-dimethyl-PGE2
Fukushima, Noriyoshi; Sato, Norihiro; Ueki, Takashi; Rosty, Christophe; Walter, Kimberly M.; Wilentz, Robb E.; Yeo, Charles J.; Hruban, Ralph H.; Goggins, Michael
2002-01-01
Pancreatic intraductal neoplasia (PanIN) is thought to be the precursor to infiltrating pancreatic ductal adenocarcinoma. We have previously shown that the preproenkephalin (ppENK) and p16 genes are aberrantly methylated in pancreatic adenocarcinoma. In this study we define the methylation status of the ppENK and p16 genes in various grades of PanINs. One hundred seventy-four samples (28 nonneoplastic pancreatic epithelia, 7 reactive epithelia, 29 PanIN-1A, 48 PanIN-1B, 27 PanIN-2, 14 PanIN-3...
Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia
2004-06-01
G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for
Sugihara, J; Furuuchi, S
1988-02-01
The intestinal absorption process of 1-O-[p-(myristyloxy)-alpha-methylcinnamoyl] glycerol (LK-903), a new hypolipidemic compound, was studied in rats. When 3H-LK-903 or 3H-LKA [3H-p- (myristyloxy)-alpha-methyl cinnamic acid], labeled at the cinnamic acid moiety, or 14C-LK-903, labeled at the glycerol moiety, were administered orally to thoracic duct-cannulated rats at a dose of 0.233 mmol/kg, 31.1, 6.7 and 18.1% of the dose, respectively, appeared in the lymph within 24 h. In this case, radioactive compounds in the lymph lipids consisted of LKA (radioactivity was not detected in the fraction of LKA with 14C-LK-903), LK-903, diglyceride analogues and triglyceride analogues. The percentages of the triglyceride analogues were the highest, followed by the diglyceride analogues. On the other hand, when doubly labeled LK-903 (3H/14C = 1, corrected ratio) was administered orally, the values of 3H/14C for the monoglyceride, diglyceride and triglyceride analogues in the lymph were 1.2-1.5, 1.7-1.9 and 1.9-2.7, respectively. The lymphatic absorption of LK-903 was stimulated by the presence of lecithin but inhibited by a high dose of triolein. The results indicated that (1) LK-903 formed micelles in the intestine, (2) a large part of LK-903 was absorbed as such, (3) a part of LK-903 was hydrolyzed in the intestinal mucosa, and (4) a part of LKA formed by hydrolysis was again utilized to synthesize the higher glycerides and absorbed via the lymphatic absorption route for lipids.
Fatty acid methyl esters production: chemical process variables
Directory of Open Access Journals (Sweden)
Paulo César Narváez Rincón
2004-05-01
Full Text Available The advantages of fatty acid methyl esters as basic oleochemicals over fatty acids, the seventies world energy crisis and the use of those oleochemicals as fuels, have increased research interest on fats and oils trans-esterification. In this document, a review about basic aspects, uses, process variables and problems associated to the production process of fatty acid methyl esters is presented. A global view of recent researches, most of them focused in finding a new catalyst with same activity as the alcohol-soluble hydroxides (NaOH, KOH, and suitable to be used in transforming fats and oils with high levels of free fatty acids and water avoiding separation problems and reducing process costs, is also discussed.
[Trans fatty acids in the nutrition of children with neurological disorders].
Cortés, E; Aguilar, M J; Rizo, M M; Hidalgo, M J
2013-01-01
Trans-fatty acids are present in various foods, being the only source of the same in humans. Its presence in high concentrations is a risk factor for health, being involved in a series of events, cardiovascular, inflammatory, etc. Therefore, steps have been taken for its decrease in the diet. The aim is to determine serum and phospholipids of membranes in healthy children and neurological alterations. It has analyzed the fatty acids trans in 34 healthy children and 374 with various neurological pathologies. Serum and blood cells, making the lipid extraction, samples have been separation of the phospholipids of cells membranes, methylation of fatty acids, separation by gas chromatography and quantification using mass detector. The data have been processed statistically. The distribution of trans fatty acids and their sum is not normally distributed, so its nonparemetric tests were used. The values are higher than in serum phospholipids and membrane with a weak but significant correlation. The tC18: 1 is in a double proportion in children with neurological disorders in healthy children, both in serum and membrane phospholipids, with significant differences. The highest proportion of trans-fatty acids in the group of children with neurological disorders is caused no doubt by an increase in intake, due to less adequate food. Copyright © AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.
Ultrafast non-adiabatic dynamics of methyl substituted ethylenes: The π3s Rydberg state
Wu, Guorong; Boguslavskiy, Andrey E.; Schalk, Oliver; Schuurman, Michael S.; Stolow, Albert
2011-10-01
Excited state unimolecular reactions of some polyenes exhibit localization of their dynamics at a single ethylenic double bond. Here we present studies of the fundamental photophysical processes in the ethylene unit itself. Combined femtosecond time-resolved photoelectron spectroscopy (TRPES) and ab initio quantum chemical calculations was applied to the study of excited state dynamics in cis-butene, trans-butene, trimethylethylene, and tetramethylethylene, following initial excitation to their respective π3s Rydberg states. The wavelength dependence of the π3s Rydberg state dynamics of tetramethylethylene was investigated in more detail. The π3s Rydberg to ππ* valence state decay rate varies greatly with substituent: the 1,2-di- and tri-methyl substituted ethylenes (cis-butene, trans-butene, and trimethylethylene) show an ultrafast decay (˜20 fs), whereas the fully methylated tetramethylethylene shows a decay rate of 2 to 4 orders of magnitude slower. These observations are rationalized in terms of topographical trends in the relevant potential energy surfaces, as found from ab initio calculations: (1) the barrier between the π3s state and the ππ* state increases with increasing methylation, and (2) the π3s/ππ* minimum energy conical intersection displaces monotonically away from the π3s Franck-Condon region with increasing methylation. The use of systematic methylation in combination with TRPES and ab initio computation is emerging as an important tool in discerning the excited state dynamics of unsaturated hydrocarbons.
Photocatalytic Degradation of Methyl Orange over Metalloporphyrins Supported on TiO2 Degussa P25
Directory of Open Access Journals (Sweden)
Xing-Jiao Huang
2012-01-01
Full Text Available The photocatalytic activity of meso-tetraphenylporphyrins with different metal centers (Fe, Co, Mn and Cu adsorbed on TiO2 (Degussa P25 surface has been investigated by carrying out the photodegradation of methyl orange (MO under visible and ultraviolet light irradiation. The photocatalysts were characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, diffuse reflectance UV (DRS-UV-vis and infrared spectra. Copper porphyrin-sensitized TiO2 photocatalyst (CuP-TiO2 showed excellent activity for the photodegradation of MO whether under visible or ultraviolet light irradiation. Natural Bond Orbital (NBO charges analysis showed that methyl orange ion is adsorbed easier by CuP-TiO2 catalyst due to the increase of induced interactions.
Carvalho, O V; Botelho, C V; Ferreira, C G T; Ferreira, H C C; Santos, M R; Diaz, M A N; Oliveira, T T; Soares-Martins, J A P; Almeida, M R; Silva, A
2013-10-01
Infection caused by canine distemper virus (CDV) is a highly contagious disease with high incidence and lethality in the canine population. Antiviral activity of flavonoids quercetin, morin, rutin and hesperidin, and phenolic cinnamic, trans-cinnamic and ferulic acids were evaluated in vitro against the CDV using the time of addition assay to determine which step of the viral replicative cycle was affected. All flavonoids displayed great viral inhibition when they were added at the times 0 (adsorption) and 1h (penetration) of the viral replicative cycle. Both quercetin and hesperidin presented antiviral activity at the time 2h (intracellular). In the other hand, cinnamic acid showed antiviral activity at the times 0 and 2h while trans-cinnamic acid showed antiviral effect at the times -1h (pre-treatment) and 0 h. Ferulic acid inhibited CDV replicative cycle at the times 0 and 1h. Our study revealed promising candidates to be considered in the treatment of CDV. Structural differences among compounds and correlation to their antiviral activity were also explored. Our analysis suggest that these compounds could be useful in order to design new antiviral drugs against CDV as well as other viruses of great meaning in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.
Wang, Fang; Sun, Wei; Xia, Chungu; Wang, Yong
2017-10-01
Through the introduction of dimethylamino (Me 2 N) substituent at the pyridine ring of 2-((R)-2-[(R)-1-(pyridine-2-ylmethyl)pyrrolidin-2-yl]pyrrolidin-1-ylmethyl)pyridine (PDP) ligand, the non-heme Fe II ( Me2N PDP)/H 2 O 2 /AcOH catalyst system was found to exhibit significant higher catalytic activity and enantioselectivity than the non-substituent one in the asymmetric epoxidation experiments. The mechanistic origin of the remarkable substituent effects in these oxidation reactions has not been well established. To ascertain the potent oxidant and the related reaction mechanism, a detailed DFT calculation was performed. Interestingly, a novel Fe(IV)-oxo Me2N PDP cation radical species, [( Me2N PDP) + · Fe IV (O)(OAc)] 2+ ( Me2N 5), with about one spin spreading over the non-heme Me2N PDP ligand was formed via a carboxylic-acid-assisted O-O bond heterolysis, which is reminiscent of Compound I (an Fe(IV)(O)(porphyrin cation radical) species) in cytochrome P450 chemistry. Me2N 5 is energetically comparable with the cyclic ferric peracetate species Me2N 6, while in the pristine Fe(PDP) catalyst system, H 6 is more stable than H 5. Comparison of the activation energy for the ethylene epoxidation promoted by Me2N 5 and Me2N 6, Me2N 5 is supposed as the true oxidant triggering the epoxidation of olefins. In addition, a systematic research on the substituent effects varied from the electron-donating substituent (dMM, the substituents at sites 3, 4, and 5 of the pyridine ring: methyl, methoxyl, and methyl) to the electron-withdrawing one (CF 3 , 2,6-bis(trifluoromethyl)phenyl) on the electronic structure of the reaction intermediates has also been investigated. An alternative cyclic ferric peracetate complex is obtained, indicating that the substituents at the pyridine ring of PDP ligands have significant impacts on the electronic structure of the oxidants.
Directory of Open Access Journals (Sweden)
Huizi Lei
Full Text Available BACKGROUND AIMS: Gastric cancer is the most frequent gastrointestinal tumor in adults and is the most lethal form of human cancer. Despite of the improvements in treatments, the underlying mechanism of gastric carcinogenesis is not well known. To define novel modulators that regulate susceptibility to tumorgenesis, we focused on miR-219-2-3p. METHODS: Quantitative RT-PCR was employed to investigate the level of miR-219-2-3p in gastric cancer (GC tissues (n = 113 and their matched adjacent normal tissues (n = 113. In vitro cell proliferation, apoptosis assays, cell migration, and invasion assays were performed to elucidate biological effects of miR-219-2-3p. Since silencing of miRNA by promoter CpG island methylation may be an important mechanism in tumorgenesis, GC cells were treated with 5-aza-2'-deoxycytidine and trichostatin A, and expression changes of miR-219-2-3p were subsequently examined by quantitative RT-PCR. Finally, the methylation status of CpG island upstream of miR-219-2-3p was analyzed by methylation-specific PCR in GC tissues (n = 22. RESULTS: miR-219-2-3p was down-regulated in GC and cell lines. In addition, the experiments documented the lower expression of miR-219-2-3p in GC specimens with higher grade and later stage tumors. Meanwhile, miR-219-2-3p exerted antiproliferative, proapoptotic, and antimetastatic roles and reduced levels of p-ERK1/2 in GC cells. Furthermore, 5-aza-2'-deoxycytidine and trichostatin A increased the expression (~2 fold of miR-219-2-3p in GC cells. By methylation-specific PCR, DNA methylation in the upstream region of miR-219-2-3p was detected in both adjacent normal tissues and cancer tissues. As expected, the methylation level was considerably higher in the miR-219-2-3p down-regulated group than up-regulated group. CONCLUSIONS: miR-219-2-3p is potentially involved in gastric cancer progression and metastasis by regulating ERK1/2-related signal pathways, which may provide a novel therapeutic strategy
Energy Technology Data Exchange (ETDEWEB)
Freitas, Marinalva Oliveira; Lima, Mary Anne S.; Silveira, Edilberto R. [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Quimica Organica e Inorganica]. E-mail: edil@ufc.br
2007-07-01
Phytochemical analysis of the kino of Eucalyptus citriodora led to the isolation of 1-O,2-O-digaloil-6-O-trans-p-cumaroil-beta-D-glucopyranoside, 1-O-trans-p-cumaroil-6-O-cinamoil-beta-D-glucopyranoside, alpha and beta 6-O-trans-p-cumaroil-D-glucopyranoside, 7-methylaromadendrin-4'-O-6{sup -}trans-p-cumaroil-beta-Dglucopyranoside, aromadendrin, aromadendrin-7-methyl-ether, naringenin, sakuranetin, kaempferol-7-methyl-ether and galic acid. Structural elucidation of the isolated compounds was established on the basis of spectral data, particularly by the use of 1D NMR and several 2D shift correlated NMR pulse sequences ({sup 1}H,{sup 1}H-COSY, HMQC, HMBC). (author)
Directory of Open Access Journals (Sweden)
Marinalva Oliveira Freitas
2007-01-01
Full Text Available Phytochemical analysis of the kino of Eucalyptus citriodora led to the isolation of 1-O,2-O-digaloil-6-O-trans -p-cumaroil-beta-D-glucopyranoside, 1-O-trans-p-cumaroil-6-O -cinamoil-beta-D-glucopyranoside, alpha and beta 6-O-trans-p-cumaroil-D-glucopyranoside, 7-methylaromadendrin-4'-O-6''- trans-p-cumaroil-beta-D-glucopyranoside, aromadendrin, aromadendrin-7-methyl-ether, naringenin, sakuranetin, kaempferol-7-methyl-ether and galic acid. Structural elucidation of the isolated compounds was established on the basis of spectral data, particularly by the use of 1D NMR and several 2D shift correlated NMR pulse sequences (¹H,¹H-COSY, HMQC, HMBC.
pH-dependent fluorescence property of methyl red isomers in silver colloids
International Nuclear Information System (INIS)
Wong, Jian-How; Lee, Szetsen
2012-01-01
We report the use of silver (Ag) colloids in the spectroscopic differentiation of methyl red (MR) isomers (o-MR, m-MR, p-MR) by fluorescence techniques. Under different pH conditions, the formation of MR-Ag complex has an impact on the fluorescence band shapes and peak position shift, which are distinctive between MR isomers. The fluorescence quenching between 400 and 414 nm accompanied by simultaneous enhancement between 510 and 541 nm changes with pH are closely related to energy transfer efficiency and the interaction between the MR isomers and the Ag surface.
Kneusel, R.; Matern, U.; Nicolaij, K.
1989-01-01
A novel hydroxylase activity catalyzing the formation of trans-caffeoyl-CoA from trans-4-coumaroyl-CoA was identified in crude extracts from cultured parsley cells. The extracts were less active (Vmax/Km) in converting trans-4-coumaric to trans-caffeic acid. Optimal hydroxylase activity was found at
(Benzyl isocyanide-κC1chlorido(2-chloro-3-dimethylamino-1-phenylprop-1-en-1-yl-κ2C1,Npalladium(II
Directory of Open Access Journals (Sweden)
Ana C. Mafud
2013-01-01
Full Text Available In the title compound, [Pd(C11H13ClNCl(C8H7N], which crystallized in the chiral space group P212121, the PdII atom is coordinated by two C atoms, a Csp2 atom of the 2-chloro-3-dimethylamino-1-phenylprop-1-en-1-yl ligand and a Csp atom from the benzyl isocyanide ligand, as well as an N atom of the ligand and a Cl atom, in a square-planar geometry. In the complex, there is a short C—H...Cl hydrogen bond and a C—H...π interaction. In the crystal, molecules are linked via C—H...Cl hydrogen bonds, forming chains along the a-axis direction.
Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity
International Nuclear Information System (INIS)
Meiller, A.
2004-03-01
Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein
Lebedeva, Tamara L.; Shandryuk, George A.; Sycheva, Tatyana I.; Bezborodov, Vladimir S.; Talroze, Raissa V.; Platé, Nicolai A.
1995-07-01
The type of bonds responsible for the complexation of di- and polyacids with the tertiary amine β- N-dimethylamino-4-dodecyloxypropiophenone is studied by means of FTIR spectroscopy. The complexes are shown to be stable due to strong H-bonding with partial charge transfer. The characteristic composition for complexes of polyacrylic, polymethacrylic and malonic acids is calculated as 2:1 (number of carboxylic groups per number of amine molecules) whereas glutaric acid forms complexes of different composition including 1:1. The characteristic composition results from the structure of the initial acid. The structures of both the characteristic complex and "excess" acid are also discussed.
Eyelid Dermatitis: Contact Allergy to 3-(Dimethylamino)propylamine
Knopp, Eleanor; Watsky, Kalman
2014-01-01
We present the case of a 42-year-old woman with intractable eyelid dermatitis. Patch testing revealed sensitization to 3-(dimethylamino)propylamine (DMAPA). DMAPA is an important etiology of allergic contact dermatitis of the eyelids and face but is easily missed even with expanded-series patch testing. We also review the most common causative allergens in eyelid dermatitis cited in the literature over the past decade. DMAPA is a reagent used in the formation of cocamidopropyl betaine (CAPB), a common additive to liquid soaps, shampoos, and other cleansing products because of its utility as a surfactant. Beginning in the 1980s, reports of allergy to CAPB surfaced in the literature. Ultimately, a majority of patch testing studies have shown that clinical allergy to CAPB-containing products actually reflects allergy to contaminant DMAPA in most cases. Amidoamine, another intermediate in the formation of CAPB, may also be implicated through a proposed mechanism of conversion to DMAPA in the skin. When patch-testing for eyelid and facial dermatitis, it is crucial to test with DMAPA directly, not just with CAPB; unlike commercial-grade CAPB, the CAPB in patch test kits is ultrapure and does not contain contaminant DMAPA. PMID:19134437
Saadallah-Kallel, Amana; Abdelmaksoud-Dammak, Rania; Triki, Mouna; Charfi, Slim; Khabir, Abdelmajid; Sallemi-Boudawara, Tahia; Mokdad-Gargouri, Raja
2017-08-01
Aberrant DNA methylation of CpG islands occurred frequently in CRC and associated with transcriptional silencing of key genes. In this study, the CIMP combined with MLH1 or p16 INK4a methylation status was determined in CRC patients and correlated with clinicopathological parameters and overall survival. Our data showed that CIMP+ CRCs were identified in 32.9% of cases and that CACNAG1 is the most frequently methylated promoter. When we combined the CIMP with the MLH1 or the p16 INK4a methylation status, we found that CIMP-/MLH1-U (37.8%) and CIMP-/p16 INK4a -U (35.4%) tumors were the most frequent among the four subtypes. Statistical analysis showed that tumor location, lymphovascular invasion, TNM stage, and MSI differed among the group of patients. Kaplan-Meier analyses revealed differences in overall survival according to the CIMP combined with MLH1 or p16 INK4a methylation status. In a multivariate analysis, CIMP/MLH1 and CIMP/p16 INK4a methylation statuses were predictive of prognosis, and the OS was longer for patients with tumors CIMP-/MLH1-M, as well as CIMP-/p16 INK4a -M. Furthermore, DNMT1 is significantly overexpressed in tumors than in normal tissues as well as in CIMP+ than CIMP- tumors. Our results suggest that tumor classification based on the CIMP status combined with MLH1 or p16 INK4a methylation is useful to predict prognosis in CRC patients.
International Nuclear Information System (INIS)
Qian Jiesheng; Li Zhengran; Jiang Zaibo; Zhu Kangshun; Guan Shouhai; Zhou Bing; Xu Changmou; He Keke; Shang Hong
2009-01-01
Objective: To investigate the feasibility and efficacy of trans-jugular catheter-directed thrombolysis (CDT) together with trans-dorsalis pedis vein thrombolysis for the treatment of deep venous thrombosis (DVT) of the lower limbs. Methods: Jugular vein puncture, indwelling catheter and placement of IVC filter were performed in 18 patients with DVT (study group) followed by continuous trans-jugular CDT together with trans-dorsalis pedis vein thrombolysis. During the corresponding period, 16 patients with DVT (control group) received trans-dorsalis pedis vein thrombolysis only. Results: The thrombolytic time and total dose of urokinase in study group and control group were (6.6 ± 2.3) days, (5.52 ± 2.24) x 106 units and (8.2 ± 1.4) days, (7.00 ± 1.66) x 106 units respectively. The thrombolytic time and total dose of urokinase in study group were significantly lower than that in control group (P < 0.05). After the treatment the thigh circumference and calf circumference in study group showed a reduction of (4.6 ± 2.1) cm and (4.0 ± 2.1) cm respectively, which were (3.2 ± 1.7) cm and (2.7 ± 1.5) cm respectively in control group, the difference between two groups was statistically significant (P < 0.05). The complete patent of the veins was 66.7% in study group and 31.3% in control group, the difference between two groups was significant (P < 0.05). In four cases of the study group, the filters were withdrawn through the original puncture site after the thrombus was completely dissolved. Conclusion: Trans-jugular CDT combined with trans-dorsalis pedis vein thrombolysis is an effective and safe therapeutic technique for the treatment of deep venous thrombosis of the lower extremities, moreover, the filter can be taken back via the original puncture site when the thrombus is completely dissolved. (authors)
Bardhan, Kankana; Paschall, Amy V; Yang, Dafeng; Chen, May R; Simon, Priscilla S; Bhutia, Yangzom D; Martin, Pamela M; Thangaraju, Muthusamy; Browning, Darren D; Ganapathy, Vadivel; Heaton, Christopher M; Gu, Keni; Lee, Jeffrey R; Liu, Kebin
2015-07-01
Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A have been the subject of extensive studies; however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wild-type mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoter to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoter to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer, and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. ©2015 American Association for Cancer Research.
Bardhan, Kankana; Paschall, Amy V.; Yang, Dafeng; Chen, May R.; Simon, Priscilla S.; Bhutia, Yangzom; Martin, Pamela M.; Thangaraju, Muthusamy; Browning, Darren D.; Ganapathy, Vadivel; Heaton, Christopher M.; Gu, Keni; Lee, Jeffrey R.; Liu, Kebin
2015-01-01
Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A has been the subject of extensive studies, however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wildtype mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoters to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoters to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. PMID:25735954
Pajunen, Taina
2009-01-01
The autoxidation of conjugated linoleic acid (CLA) is poorly understood in spite of increasing interest in the beneficial biological properties of CLA and growing consumption of CLA-rich foods. In this thesis, the autoxidation reactions of the two major CLA isomers, 9-cis,11-trans-octadecadienoic acid and 10-trans,12-cis-octadecadienoic acid, are investigated. The results contribute to an understanding of the early stages of the autoxidation of CLA methyl ester, and provide for the first time...
HPLC determination of phenolic acids, flavonoids and juglone in walnut leaves.
Nour, Violeta; Trandafir, Ion; Cosmulescu, Sina
2013-10-01
A high-performance liquid chromatographic method with gradient elution and diode-array detection was developed to quantify free phenolic acids (gallic, vanillic, chlorogenic, caffeic, syringic, p-coumaric, ferulic, sinapic, salycilic, elagic and trans-cinnamic), flavonoids (catechin, epicatechin, rutin, myricetin and quercetin) and juglone in walnut leaves. Chromatographic separation was performed on a Hypersil Gold C18 column (5 µm particle size, 250 × 4.6 mm) and detection was conducted at three different wavelengths (254, 278 and 300 nm) according to the absorption maxima of the analyzed compounds. Validation procedures were conducted and the method was proven to be precise, accurate and sensitive. The developed method has been applied to analyze walnut leaves samples from nine different cultivars, with the same agricultural, geographical and climatic conditions. The experimental results revealed high concentrations of myricetin, catechin hydrate and rutin, and low concentrations of quercetin and epicatechin aglycones. Ellagic acid was established as the dominating phenolic acid of walnut leaves, followed by trans-cinnamic, chlorogenic and caffeic acids. Juglone content varied between 44.55 and 205.12 mg/100 g fresh weight. Significant differences were detected among cultivars for the concentration levels of phenolics.
Institute of Scientific and Technical Information of China (English)
QIU Kunyuan; ZHANG Zhanghua; FENG Xinde
1992-01-01
The effects of N-2-hydroxyethyl-N-methyl-p-toluidine (HMT) on MMA polymerization using organic peroxide as an initiator and on AN photoinduced polymerization have been investigated respectively. The kinetics of polymerization and the overall activation energy of polymerization were determined. Based on kinetics study and the end group analysis of the polymer obtained by UV spectrum method, the initiation mechanism is proposed.
Directory of Open Access Journals (Sweden)
Silce Adeline Danelon Guassi
2008-03-01
Full Text Available O presente trabalho objetivou a determinação do perfil lipídico de ovos integrais desidratados, bem como de gemas desidratadas, a fim de enfatizar seu conteúdo de ácidos graxos de configuração trans. A fração lipídica das amostras foi extraída com hexano/isopropanol e, a seguir, metilada. Os ácidos graxos foram identificados via cromatografia gasosa. Constatou-se que a natureza lipídica dos ovos tem caráter predominantemente insaturado: 63,65% dos lipídios totais nos ovos integrais e 62,63% nas gemas. Além disso, foram identificados apenas traços de gorduras trans (0,24% nos ovos integrais e 0,27% nas gemas.The objective of this work was to determine fatty acids composition in dehydrated eggs and egg yolks emphasizing its contents of trans fatty acids. The fatty acids fraction of the samples was extracted with hexane/isopropanol (3:2 and then methylated. The profile of the fatty acids was identified by gas chromatography with predominant evidence of insaturated character: 63.65 and 62.63% of the lipids were unsatureted in the eggs and in the egg yolks, respectively. Traces of trans fatty were also identified (0.24% in the hole eggs and 0.27% in the egg yolks.
Design of Trypanosoma rangeli sialidase mutants with improved trans-sialidase activity.
Directory of Open Access Journals (Sweden)
Christian Nyffenegger
Full Text Available A sialidase (EC 3.2.1.18 from the non-pathogenic Trypanosoma rangeli, TrSA, has been shown to exert trans-sialidase activity after mutation of five specific amino acids in the active site (M96V, A98P, S120Y, G249Y, Q284P to form the so-called TrSA5mut enzyme. By computational and hypothesis driven approaches additional mutations enhancing the trans-sialidase activity have been suggested. In the present work, we made a systematic combination of these mutations leading to seven new variants of the T. rangeli sialidase, having 6-16 targeted amino acid mutations. The resulting enzyme variants were analyzed via kinetics for their ability to carry out trans-sialidase reaction using CGMP and D-lactose as substrates. The sialidase variants with 15 and 16 mutations, respectively, exhibited significantly improved trans-sialidase activity for D-lactose sialylation. Our results corroborate, that computational studies of trans-glycosylation can be a valuable input in the design of novel trans-glycosidases, but also highlight the importance of experimental validation in order to assess the performance. In conclusion, two of the seven mutants displayed a dramatic switch in specificity from hydrolysis towards trans-sialylation and constitute the most potent trans-sialidase mutants of TrSA described in literature to date.
McCormick, D L; Rao, K V; Dooley, L; Steele, V E; Lubet, R A; Kelloff, G J; Bosland, M C
1998-08-01
The influence of chemical carcinogen, hormonal stimulation, and chronic dietary administration of the synthetic retinoid, N-(4-hydroxyphenyl)-all-trans-retinamide (4-HPR), on the induction of prostate cancer in male Wistar-Unilever rats was determined. Three different tumor induction regimens were used: (a) a single i.v. dose of 50 mg of N-methyl-N-nitrosourea (MNU) per kg body weight, followed by chronic androgen stimulation via s.c. implantation of two silastic capsules containing 40 mg testosterone each; (b) a single i.v. dose of 50 mg of MNU per kg body weight (no testosterone treatment); and (c) chronic androgen stimulation with implanted testosterone capsules (no MNU treatment). In a fourth series of animals, the incidence of spontaneous prostate tumors was determined in groups of rats receiving neither carcinogen nor hormone stimulation. Within each series, parallel groups of animals were fed a control (vehicle-supplemented) diet or control diet supplemented with 4-HPR beginning 1 day after carcinogen administration; retinoid administration was continuous until termination of the study at 450 days. The incidence of accessory sex gland cancer in rats treated sequentially with MNU + testosterone was >60%, in comparison with cancer incidences of Unilever rats.
International Nuclear Information System (INIS)
Matsumoto, Hideo; Kubota, Hisako; Murakami, Haruaki
2010-01-01
We inspected the feasibility of minimally invasive surgery for superficial esophageal cancer, the trans-hiatal approach without thoracotomy. We examined the surgical outcomes of 33 superficial esophageal cancer whose cancer had invaded the submucosal layer and who underwent resection in our hospital between April 2003 and April 2009. The patients who had tumor invasion of within the sm1 and no metastasis to the upper and middle mediastinum lymph nodes were operated on by the trans-hiatal esophagectomy (THE). The other patients were underwent ordinary trans-thoracic esophagectomy (TTE). After the operations, we recommended adjuvant chemoradiation therapy for all patients whose tumor were histopathologically proved to involve the sm2 layer as well as the vessels and/or lymphatic duct. Of our 33 cases, nine were diagnosed as pM1 or pM2. Two were diagnosed as pM3, one of which had lymph node metastasis. Eleven cases were diagnosed as pSM1, four as pSM2, and seven as pSM3; and lymph node metastasis was observed in 4 pSM1 cases (36%), 2 pSM2 cases (50%) and 5 pSM3 cases (71.4%). The five-year survival rate in all cases was 89.6%. The five-year survival rate by operating method was 100% in THE cases or 80.9% in TTE cases. The rates by tumor depth of invasion was 100% in pM1-2 cases, 92.3% in pM3-SM1 cases and 78.8% in pSM2-3 cases. It is concluded that the surgical outcome of THE in accordance with our indication criteria is equal to that of TTE for superficial esophageal cancer. (author)
DEFF Research Database (Denmark)
Harris, Pernille; Kofod, Pauli
2002-01-01
Some disorder is seen in the crystal structure of [Rh(CH3)(NH3)5]0.73[RhCl(NH3)5]2.27(S2O6)3. It is, however, clear that the methyl group has a pronounced trans influence on the Rh-N distance, with an elongation of 0.11 Å. No trans influence is observed for the Rh-N distance due to the Cl- ion. B...
Directory of Open Access Journals (Sweden)
Silvia Veganzones-de-Castro
2012-03-01
Full Text Available Introduction: p16 gene plays an important role in the cell cycle regulation and is considered an important tumor suppressor gene. Several mechanisms of gene inactivation have been described; in this study we have focused on p16 gene promoter methylation. In colorectal cancer p16 gene methylation is a frequent event. Methods: 326 patients with sporadic colorectal cancer were included. DNA was extracted from tumor tissue samples obtained during the surgical procedure. Promoter methylation was analyzed using bisulfite modification and was detected by quantitative methylation-specific PCR. Frequency of p16 methylation was analyzed and compared with other clinicopathological variables. Results: p16 gene methylation was detected in 24,8% of patients. Methylation was associated with differentiation grade and with tumor location: methylation was frequent in poorly differentiated tumors and had low frequency in distal colon. The p16 promoter methylation discriminated a subgroup of patients with better prognosis in poorly differentiated tumors. Conclusions: p16 methylation was a frequent event in our population and was able to induce differences in the overall survival of patients with poorly differentiated tumors.Introducción: el gen p16 está implicado en la regulación del ciclo celular y se considera un importante gen supresor de tumores. Objetivos: se han descrito diferentes mecanismos de inactivación génica, en este estudio nos hemos centrado en la metilación del promotor del gen p16. En el cáncer colorrectal la metilación de p16 es una alteración frecuente. Material y métodos: se incluyeron 326 pacientes con cáncer colorrectal esporádico. El ADN se extrajo de muestras tumorales obtenidas durante la cirugía. La metilación del promotor se analizó mediante un proceso de modificación con bisulfito y posterior PCR cuantitativa especifica para metilación. Se analizó la frecuencia de la metilación de p16 y se comparó con las variables
Priji, Prakasan; Sajith, Sreedharan; Faisal, Panichikkal Abdul; Benjamin, Sailas
2017-12-01
The present study describes the characteristics of a thermotolerant and alkaline lipase secreted by Pseudomonas sp. BUP6, a novel rumen bacterium isolated from Malabari goat, and its trans -esterification efficiency in producing biodiesel from used cooking oil (UCO). The extracellular lipase was purified to homogeneity (35.8 times purified with 14.8% yield) employing (NH 4 ) 2 SO 4 salt precipitation and Sephadex G-100 chromatography. The apparent molecular weight of this lipase on SDS-PAGE was 35 kDa, the identity of which was further confirmed by MALDI-TOF/MS. The purified lipase was found stable at a pH range of 7-9 with the maximum activity (707 U/ml) at pH 8.2; and was active at the temperature ranging from 35 to 50 °C with the optimum at 45 °C (891 U/ml). Triton X-100 and EDTA had no effect on the activity of lipase; whereas SDS, Tween-80 and β-mercaptoethanol inhibited its activity significantly. Moreover, Ca 2+ (1.0 mM) enhanced the activity of lipase (1428 U/ml) by 206% vis-à-vis initial activity; while Zn 2+ , Fe 2+ and Cu 2+ decreased the activity significantly. Using para -nitrophenyl palmitate as substrate, the K m (11.6 mM) and V max [668.9 μmol/(min/mg)] of the purified lipase were also determined. Crude lipase was used for analyzing its trans -esterification efficiency with used cooking oil and methanol which resulted in the worthy yield of fatty acid methyl esters, FAME (45%) at 37 °C, indicating its prospects in biodiesel industry. Thus, the lipase secreted by the rumen bacterium, Pseudomonas sp. BUP6, offers great potentials to be used in various industries including the production of biodiesel by trans -esterification.
Methyl 2-(4a,8-Dimethyl-7-oxodecahydronaphthalen-2-ylacrylate
Directory of Open Access Journals (Sweden)
Mohamed Tebbaa
2012-08-01
Full Text Available The title compound, C16H24O3, was isolated from the aerial part of Inula Viscosa (L Aiton [or Dittrichia Viscosa (L Greuter]. The molecule contains two fused (trans six-membered rings which both exibit a chair conformation. In the crystal, molecules are linked into chains along [100] by weak C—H...O hydrogen bonds involving the methyl and carbonyl groups.
Trans-dinitroglycoluril isomers-A DFT treatment
Directory of Open Access Journals (Sweden)
Lemi Türker
2017-02-01
Full Text Available Isomers of trans-1,4-Dinitroglycoluril (trans-DINGU and their 1,3-tautomers are considered within the constraints of B3LYP/6-31++G (d,p and B3LYP/CC-PVTZ levels of DFT calculations. Additionally, the interactions of these isomers and proton in vacuum are investigated. The data have revealed that two of the three isomers undergo CH bond cleavage as the result of interaction with proton in vacuum. The total energies, some structural properties, the calculated IR and UV spectra are discussed.
Synthesis of (+-)-(1,1'- sup 15 N sub 2 , 2'- sup 13 C)-trans-3'-methylnicotine
Energy Technology Data Exchange (ETDEWEB)
Sirimanne, S.R.; Maggio, V.L.; Patterson, D.G. Jr. (Department of Health and Human Services, Atlanta, GA (United States))
1992-03-01
The synthesis of ({+-})- (1,1'-{sup 15}N{sub 2}, 2'-{sup 13}C)-trans-3'-methylnicotine is reported. {sup 15}N-3-Bromopyridine obtained from bromination of pyridine was formylated with nBuLi/(carbonyl-{sup 13}C)-methyl formate. The resulting {sup 15}n-Pyridine-3-({sup 13}C-carbonyl)-carboxaldehyde was reacted with {sup 15}N-methylamine and then the resulting Schiff's base was condensed with succinic anhydride to give ({+-})- (1,1'-{sup 15}N{sub 2}, 5'-{sup 13}C)-trans-4'-carboxycotinine. Reduction with lithium aluminum hydride and mesylation followed by reduction with Zn/NaI gave ({+-})-(1,1'-{sup 15}N{sub 2}, 2'-{sup 13}C)-trans-3'-methylnicotine. (Author).
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
Directory of Open Access Journals (Sweden)
S. Lashkari
2017-12-01
Full Text Available Fatty acids are commonly analysed by gas chromatography as their corresponding fatty acid (FA methyl esters (FAME. For quantitative determination of individual FA an internal standard like C17:0 is necessary. Conjugated FA and polyunsaturated fatty acid (PUFA represents a challenge in the methylation steps, as they are sensitive to pH changes and oxidation. The present study was carried out to determine the efficiency of different methylation procedures on quantitative determination of conjugated linoleic acid (CLA, PUFA and response of internal standard. The highest response of internal standard was observed for boron trifluoride (BF3/methanol and methanolic HCl followed by NaOCH3, while cis-9, trans-11 CLA, total CLA and PUFA was higher with methanolic HCl followed by NaOCH3 compared with the BF3 method. These data can be useful for quantitating of milk FA. Keywords: Methylation procedures, Milk fatty acid, Conjugated linoleic acid
Thomas, Saji; Shandilya, Sanjeev; Bharati, Amber; Paul, Saroj Kumar; Agarwal, Ashutosh; Mathela, Chandra S
2012-01-05
Six impurities were detected at trace level in rivastigmine tartrate drug substance by a newly developed high performance liquid chromatography method. Three impurities were characterized rapidly and three impurities were found to be unknown. The unknown impurities were enriched and identified with a combination of semi-preparative HPLC and LC/MS/MS techniques. Proposed structures were further confirmed by characterization using NMR, FT-IR, and EA techniques of impurity standards. Based on the spectroscopic, spectrometric and elemental analysis data unknown impurities were characterized as 3-[1-(dimethylamino)ethyl]phenyl N-ethyl-N-methyl carbamate N-oxide, ethyl-methyl-carbamic acid 4-(1-dimethylamino-ethyl)-phenyl ester and ethyl-methyl-carbamic acid 2-(1-dimethylamino-ethyl)-phenyl ester. A plausible mechanism for the formation of these impurities is also proposed. The method was validated according to ICH guidelines for fourteen impurities to demonstrate specificity, precision, linearity, accuracy and stability indicating nature of the method. Regression analysis showed correlation coefficient value greater than 0.999 for rivastigmine tartrate and its impurities. Accuracy of the method was established based on the recovery obtained between 93.41 and 113.33% for all impurities. Copyright © 2011 Elsevier B.V. All rights reserved.
Trans fatty acid isomers and the trans-9/trans-11 index in fat containing foods
Kuhnt, Katrin; Baehr, Melanie; Rohrer, Carsten; Jahreis, Gerhard
2011-01-01
To determine trans fatty acid (TFA) distribution of contemporary foods, especially regarding individual trans octadecenoic acids (trans C18:1), 339 German foods of six categories (semi-solid fats, deep-fried potato products, bakery products, confectioneries, instant products and butter) were analysed using two GC methods. Results showed a high variation of TFA content between and within the categories containing between 0 and 40.5% of FAME except in butter, which is a source of natural TFA. The mean TFA values were below 2.0% of FAME, however, bakery products contained 4.5% and butter fat 3.2%, respectively. In addition, the distribution of individual trans C18:1 differed. In samples containing ruminant fat (butter and various confectioneries), vaccenic acid (t11-C18:1, t11) predominated, while in foods containing industrially hydrogenated fats, elaidic acid (trans-9, t9-) and t10-C18:1 were the major trans isomers.. This was reflected by a low t9/t11 index of 0.3 and 0.5 in butter and ruminant fat containing confectioneries, respectively, whilst the highest index was observed in shortenings and deep-fried potato products at 5.2 and 6.8, respectively. In conclusion, the TFA content of foods available on the German market is generally declining, but substantial variations are present. The t9/t11 index could be used as an indicator to determine ruminant fat. Practical applications: A number of studies provide evidence that a high TFA intake, particularly of industrial origin, adversely affects human health. The TFA content of foods could be reduced due to the introduction of several mandatory regulations and modifications regarding the hydrogenation process of oils. The most abundant dietary TFA are the isomers of trans C18:1. Unfortunately, the differentiation of these isomers is not yet very common, though the trans C18:1 profile differs depending on its origin (bacterial hydrogenation in the rumen or industrial hydrogenation). To date, data for TFA content
Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Zhang, Xin-Tian; Li, Min; Li, Yao; Pang, Jing; Dong, Stephanie; Strauss-Soukup, Juliane K; Chen, Xian-Ming
2018-05-01
Intestinal infection by Cryptosporidium parvum causes significant alterations in the gene expression profile in host epithelial cells. Previous studies demonstrate that a panel of parasite RNA transcripts of low protein-coding potential are delivered into infected host cells and may modulate host gene transcription. Using in vitro models of human intestinal cryptosporidiosis, we report here that trans-suppression of the cadherin 3 (CDH3) and lysyl oxidase like 4 (LOXL4) genes in human intestinal epithelial cells following C. parvum infection involves host delivery of the Cdg7_FLc_1000 RNA, a C. parvum RNA that has been previously demonstrated to be delivered into the nuclei of infected host cells. Downregulation of CDH3 and LOXL4 genes was detected in host epithelial cells following C. parvum infection or in cells expressing the parasite Cdg7_FLc_1000 RNA. Knockdown of Cdg7_FLc_1000 attenuated the trans-suppression of CDH3 and LOXL4 genes in host cells induced by infection. Interestingly, Cdg7_FLc_1000 was detected to be recruited to the promoter regions of both CDH3 and LOXL4 gene loci in host cells following C. parvum infection. Host delivery of Cdg7_FLc_1000 promoted the PH domain zinc finger protein 1 (PRDM1)-mediated H3K9 methylation associated with trans-suppression in the CDH3 gene locus, but not the LOXL4 gene. Therefore, our data suggest that host delivery of Cdg7_FLc_1000 causes CDH3 trans-suppression in human intestinal epithelial cells following C. parvum infection through PRDM1-mediated H3K9 methylation in the CDH3 gene locus, whereas Cdg7_FLc_1000 induces trans-suppression of the host LOXL4 gene through H3K9/H3K27 methylation-independent mechanisms. Copyright © 2018 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.
Phytotoxic Effects of Cinnamic Acid on Cabbage (Brassica oleracea var. capitata
Directory of Open Access Journals (Sweden)
Singh, N. B.
2013-04-01
Full Text Available The present study deals with the effects of exogenous application of cinnamic acid (CA on growth and metabolism in growing seedlings of Brassica oleracea var. capitata (cabbage in hydroponic culture. CA was added at 0.5, 1.0 and 1.5 mM concentrations. CA has shown inhibitory effects on shoot and root length, fresh and dry weight of seedlings. CA significantly decreased the photosynthetic pigments, nitrate reductase activity and protein content. Graded concentrations of CA increased lipid peroxidation and sugar content. The increasing concentrations of CA significantly increased the antioxidative enzyme activities viz. superoxide dismutase, catalase, peroxidase against the oxidative stress caused by CA.
Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.
Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode
2017-01-01
Maternal nutrition during pregnancy and infant nutrition in the early postnatal period (lactation) are critically involved in the development and health of the newborn infant. The Maternal Nutrition and Offspring's Epigenome (MANOE) study was set up to assess the effect of maternal methyl-group donor intake (choline, betaine, folate, methionine) on infant DNA methylation. Maternal intake of dietary methyl-group donors was assessed using a food-frequency questionnaire (FFQ). Before and during pregnancy, we evaluated maternal methyl-group donor intake through diet and supplementation (folic acid) in relation to gene-specific ( IGF2 DMR, DNMT1 , LEP , RXRA ) buccal epithelial cell DNA methylation in 6 months old infants ( n = 114) via pyrosequencing. In the early postnatal period, we determined the effect of maternal choline intake during lactation (in mothers who breast-fed for at least 3 months) on gene-specific buccal DNA methylation ( n = 65). Maternal dietary and supplemental intake of methyl-group donors (folate, betaine, folic acid), only in the periconception period, was associated with buccal cell DNA methylation in genes related to growth ( IGF2 DMR), metabolism ( RXRA ), and appetite control ( LEP ). A negative association was found between maternal folate and folic acid intake before pregnancy and infant LEP (slope = -1.233, 95% CI -2.342; -0.125, p = 0.0298) and IGF2 DMR methylation (slope = -0.706, 95% CI -1.242; -0.107, p = 0.0101), respectively. Positive associations were observed for maternal betaine (slope = 0.875, 95% CI 0.118; 1.633, p = 0.0241) and folate (slope = 0.685, 95% CI 0.245; 1.125, p = 0.0027) intake before pregnancy and RXRA methylation. Buccal DNMT1 methylation in the infant was negatively associated with maternal methyl-group donor intake in the first and second trimester of pregnancy and negatively in the third trimester. We found no clear association between maternal choline intake
Zhao, Ji-Zong; Wang, Shuo; Zhang, Mao-Zhi; Wang, Lei; Wang, Rong; Tang, Ya-Juan
2009-01-06
To explore the feasibility and value of trans-fissure approaches in brain surgery through individually designed craniotomy. Ninety patients with intracranial space-occupying lesions, 47 males and 58 females, aged (43 +/- 14) (1 - 68), were treated by individualized trans-fissure approach surgeries. Linear scalp incision or "horseshoe shape" scalp incision were designed to perform the operation, with a bone flap 3 - 4 cm in diameter. The shortest approach to reach the lesion was decided under the guidance of neuro-navigation and real-time B-mode ultrasonography. Then the lesions were removed through natural cortical fissures. Another 79 patients with intracranial space-occupying lesions, 53 males and 51 females, aged (42 +/- 11) (15 -73), undergoing classical surgeries in the same period were used as control group. The average operation time, size of bone flap, amount of blood loss, hospitalization time, and hospitalization cost were compared between these 2 groups. The operation time of the individually designed trans-fissure approach group was (3.1 +/- 1.6) hours (1.33 - 10.83 hours), significantly shorter than that of the control group [(4.8 +/- 1.9) hrs, P trans-fissure approach group was (173 +/- 168) ml (20 m - 500 ml), significantly less than that of the control group [(410 +/- 61) ml, P trans-fissure approach group was (12 +/- 5) cm2 [(1 - 25) cm2], significantly smaller than that of the control group [(20. +/- 9) cm2, P trans-fissure approach group received retransfusion, compared to 15 in the control group, during operation. No infection or other significant complications occurred after operation in the individually designed trans-fissure approach group. The hospitalization time of the individually designed trans-fissure approach group was (20 +/- 6) days (9 - 39 days), significantly shorter than that of the control group [(24 +/- 7) days, P trans-fissure approach group was (23171 +/- 7280) yuan RMB; significantly lower than that of the control group
Energy Technology Data Exchange (ETDEWEB)
Cadorin, Bruno Mena, E-mail: brunomenacadorin@gmail.com [Department of Chemistry, Universidade Federal de Santa Catarina (Brazil); Tralli, Vitor Douglas [Department of Chemistry, Universidade Federal de Santa Catarina (Brazil); Ceriani, Elisa [Department of Chemical Sciences, Università di Padova (Italy); Benetoli, Luís Otávio de Brito [Department of Chemistry, Universidade Federal de Santa Catarina (Brazil); Marotta, Ester, E-mail: ester.marotta@unipd.it [Department of Chemical Sciences, Università di Padova (Italy); Ceretta, Claudio [Department of Industrial Engineering, Università di Padova (Italy); Debacher, Nito Angelo [Department of Chemistry, Universidade Federal de Santa Catarina (Brazil); Paradisi, Cristina [Department of Chemical Sciences, Università di Padova (Italy)
2015-12-30
Highlights: • Nitration of methyl orange is one of the main processes in treatment with N{sub 2}-plasma. • MS/MS analysis shows preferred nitration of methyl orange in ortho position. • N{sub 2} plasma, N{sub 2}-PAW, reaction with NO{sub 2}{sup −} or NO{sub 2}{sup −}/H{sub 2}O{sub 2} at pH 2 give the same products. - Abstract: Methyl orange (MO) azo dye served as model organic pollutant to investigate the role of reactive nitrogen species (RNS) in non-thermal plasma (NTP) induced water treatments. The results of experiments in which MO aqueous solutions were directly exposed to N{sub 2}-NTP are compared with those of control experiments in which MO was allowed to react with nitrite, nitrate and hydrogen peroxide, which are species formed in water exposed to N{sub 2}-NTP. Treatment of MO was also performed in PAW, Plasma Activated Water, that is water previously exposed to N{sub 2}-NTP. Both direct N{sub 2}-NTP and N{sub 2}-PAW treatments induced the rapid decay of MO. No appreciable reaction was instead observed when MO was treated with NO{sub 3}{sup −} and H{sub 2}O{sub 2} either under acidic or neutral pH. In contrast, in acidic solutions MO decayed rapidly when treated with NO{sub 2}{sup −} and with a combination of NO{sub 2}{sup −} and H{sub 2}O{sub 2}. Thorough product analysis was carried out by HPLC coupled with UV–vis and ESI–MS/MS detectors. In all experiments in which MO reaction was observed, the major primary product was a derivative nitro-substituted at the ortho position with respect to the N,N-dimethylamino group of MO. The reactions of RNS are discussed and a mechanism for the observed nitration products is proposed.
Fathi, Yasmin; Price, Chelsea; Meloni, Giovanni
2017-04-20
This work studies the oxidation of 2-methyl-3-buten-2-ol initiated by O( 3 P) atoms. The oxidation was investigated at room temperature, 550, and 650 K. Using the synchrotron radiation from the Advanced Light Source (ALS) of the Lawrence Berkley National Laboratory, reaction intermediates and products were studied by multiplexed photoionization mass spectrometry. Mass-to-charge ratios, kinetic time traces, photoionization spectra, and adiabatic ionization energies for each primary reaction species were obtained and used to characterize their identity. Using electronic structure calculations, potential energy surface scans of the different species produced throughout the oxidation were examined and presented in this paper to further validate the primary chemistry occurring. Branching fractions of primary products at all three temperatures were also provided. At room temperature only three primary products formed: ethenol (26.6%), acetaldehyde (4.2%), and acetone (53.4%). At 550 and 650 K the same primary products were observed in addition to propene (5.1%, 11.2%), ethenol (18.1%, 2.8%), acetaldehyde (8.9%, 5.7%), cyclobutene (1.6%, 10.8%), 1-butene (2.0%, 10.9%), trans-2-butene (3.2%, 23.1%), acetone (50.4%, 16.8%), 3-penten-2-one (1.0%, 11.5%), and 3-methyl-2-butenal (0.9%, 2.5%), where the first branching fraction value in parentheses corresponds to the 550 K data. At the highest temperature, a small amount of propyne (1.0%) was also observed.
Kolb, E W; Tkachev, I I
2007-01-01
Two previously proposed conjectures--gravitational trans-Planckian particle creation in the expanding universe, and the existence of ultra-heavy stable particles with masses up to the Planck scale (wimpzillas)--are combined in a proposal for trans-Planckian particle creation of wimpzillas. It is shown that the trans-Planckian particle creation parameter should be rather small to avoid overproduction of such particles. This ensures that wimpzillas are mainly created at the end of primordial inflation. Conditions under which trans-Planckian wimpzillas can constitute the present dark matter are determined.
International Nuclear Information System (INIS)
Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio
2005-01-01
Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells
A p-coumaroyl esterase from Rhizoctonia solani with a pronounced chlorogenic acid esterase activity.
Nieter, Annabel; Kelle, Sebastian; Linke, Diana; Berger, Ralf G
2017-07-25
Extracellular esterase activity was detected in submerged cultures of Rhizoctonia solani grown in the presence of sugar beet pectin or Tween 80. Putative type B feruloyl esterase (FAE) coding sequences found in the genome data of the basidiomycete were heterologously expressed in Pichia pastoris. Recombinant enzyme production on the 5-L bioreactor scale (Rs pCAE: 3245UL -1 ) exceeded the productivity of the wild type strain by a factor of 800. Based on substrate specificity profiling, the purified recombinant Rs pCAE was classified as a p-coumaroyl esterase (pCAE) with a pronounced chlorogenic acid esterase side activity. The Rs pCAE was also active on methyl cinnamate, caffeate and ferulate and on feruloylated saccharides. The unprecedented substrate profile of Rs pCAE together with the lack of sequence similarity to known FAEs or pCAEs suggested that the Rs pCAE represents a new type of enzyme. Hydroxycinnamic acids were released from agro-industrial side-streams, such as destarched wheat bran (DSWB), sugar beet pectin (SBP) and coffee pulp (CP). Overnight incubation of coffee pulp with the Rs pCAE resulted in the efficient release of p-coumaric (100%), caffeic (100%) and ferulic acid (85%) indicating possible applications for the valorization of food processing wastes and for the enhanced degradation of lignified biomass. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Fernanda Nahoum Carestiato
2013-09-01
Full Text Available SUMMARY High-risk human papillomavirus (hr-HPV infection is necessary but not sufficient for cervical cancer development. Recently, P16INK4A gene silencing through hypermethylation has been proposed as an important cofactor in cervical carcinogenesis due to its tumor suppressor function. We aimed to investigate P16INK4A methylation status in normal and neoplastic epithelia and evaluate an association with HPV infection and genotype. This cross-sectional study was performed with 141 cervical samples from patients attending Hospital Moncorvo Filho, Rio de Janeiro. HPV detection and genotyping were performed through PCR and P16INK4A methylation by nested-methylation specific PCR (MSP. HPV frequency was 62.4% (88/141. The most common HPV were HPV16 (37%, HPV18 (16.3% and HPV33/45(15.2%. An upward trend was observed concerning P16INK4A methylation and lesion degree: normal epithelia (10.7%, low grade lesions (22.9%, high grade (57.1% and carcinoma (93.1% (p < 0.0001. A multivariate analysis was performed to evaluate an association between methylation, age, tobacco exposure, HPV infection and genotyping. A correlation was found concerning methylation with HPV infection (p < 0.0001, hr-HPV (p = 0.01, HSIL (p < 0.0007 and malignant lesions (p < 0.0001. Since viral infection and epigenetic alterations are related to cervical carcinoma, we suggest that P16INK4A methylation profile maybe thoroughly investigated as a biomarker to identify patients at risk of cancer.
Haitjema, HJ; Buruma, R; VanEkenstein, GORA; Tan, YY; Challa, G
1996-01-01
The title (co)polymers, used for our investigations on their photoresponsive behaviour were obtained by free radical (co)polymerization. The monomer was either an acrylate or a methacrylate to which an azobenzene group, modified with a para-placed dimethylamino or a carboxylic pendant group, was
Methylation alterations are not a major cause of PTTG1 missregulation
International Nuclear Information System (INIS)
Hidalgo, Manuel; Royo, Jose Luis; Galan, Jose Jorge; Sáez, Carmen; Ferrero, Eduardo; Castilla, Carolina; Ramirez-Lorca, Reposo; Pelaez, Pablo; Ruiz, Agustin; Japón, Miguel A
2008-01-01
On its physiological cellular context, PTTG1 controls sister chromatid segregation during mitosis. Within its crosstalk to the cellular arrest machinery, relies a checkpoint of integrity for which gained the over name of securin. PTTG1 was found to promote malignant transformation in 3T3 fibroblasts, and further found to be overexpressed in different tumor types. More recently, PTTG1 has been also related to different processes such as DNA repair and found to trans-activate different cellular pathways involving c-myc, bax or p53, among others. PTTG1 over-expression has been correlated to a worse prognosis in thyroid, lung, colorectal cancer patients, and it can not be excluded that this effect may also occur in other tumor types. Despite the clinical relevance and the increasing molecular characterization of PTTG1, the reason for its up-regulation remains unclear. We analysed PTTG1 differential expression in PC-3, DU-145 and LNCaP tumor cell lines, cultured in the presence of the methyl-transferase inhibitor 5-Aza-2'-deoxycytidine. We also tested whether the CpG island mapping PTTG1 proximal promoter evidenced a differential methylation pattern in differentiated thyroid cancer biopsies concordant to their PTTG1 immunohistochemistry status. Finally, we performed whole-genome LOH studies using Affymetix 50 K microarray technology and FRET analysis to search for allelic imbalances comprising the PTTG1 locus. Our data suggest that neither methylation alterations nor LOH are involved in PTTG1 over-expression. These data, together with those previously reported, point towards a post-transcriptional level of missregulation associated to PTTG1 over-expression
Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I
Gupta, Yogesh K.; Chan, Siu-Hong; Xu, Shuang-Yong; Aggarwal, Aneel K.
2015-06-01
Type III R-M enzymes were identified >40 years ago and yet there is no structural information on these multisubunit enzymes. Here we report the structure of a Type III R-M system, consisting of the entire EcoP15I complex (Mod2Res1) bound to DNA. The structure suggests how ATP hydrolysis is coupled to long-range diffusion of a helicase on DNA, and how a dimeric methyltransferase functions to methylate only one of the two DNA strands. We show that the EcoP15I motor domains are specifically adapted to bind double-stranded DNA and to facilitate DNA sliding via a novel `Pin' domain. We also uncover unexpected `division of labour', where one Mod subunit recognizes DNA, while the other Mod subunit methylates the target adenine--a mechanism that may extend to adenine N6 RNA methylation in mammalian cells. Together the structure sheds new light on the mechanisms of both helicases and methyltransferases in DNA and RNA metabolism.
Directory of Open Access Journals (Sweden)
A. Jahubar Ali
2011-06-01
Full Text Available The crystal structure of the title compound (systematic name: 2-amino-1-methyl-4-oxo-4,5-dihydro-1H-imidazol-3-ium 3-phenylprop-2-enoate, C4H8N3O+·C9H7O2−, is stabilized by N—H...O hydrogen bonding. Cations are linked to anions to form ion pairs with an R22(8 ring motif. These ion pairs are connected through a C22(6 chain motif extending along the c axis of the unit cell. This crystal packing is characterized by hydrophobic layers at x ∼ 1/2 packed between hydrophilic layers at x ∼ 0.
International Nuclear Information System (INIS)
Pandey, Puneet Kumar; Pandey, Vrijesh Kumar; Awasthi, Anjali; Nain, Anil Kumar; Awasthi, Aashees
2014-01-01
Graphical abstract: The densities and ultrasonic speeds of the binary mixtures over the entire composition range were measured at various temperatures at atmospheric pressure. The excess molar volumes, isentropic compressibilities, and molar isentropic compressions have been calculated. The variations of these parameters with composition and temperature are discussed. The IR spectra were recorded they further supported the conclusion drawn from excess parameters, which indicates the presence of intermolecular hydrogen bonding between the oxygen atom of DMAE molecules and hydrogen atom of methanol and ethanol molecules in these mixtures.. - Highlights: • The study reports density and ultrasonic velocity data of 2-(dimethylamino)ethanol + methanol/ethanol mixtures. • To elucidate the interactions in 2-(dimethylamino)ethanol + methanol/ethanol binary mixtures. • Provides information on nature and relative strength of interactions in these mixtures. • Correlates physicochemical properties with interactions in these mixtures. - Abstract: The densities, ρ and ultrasonic speeds, u of the binary mixtures of 2-(dimethylamino)ethanol (DMAE) with methanol/ethanol, including those of pure liquids, over the entire composition range were measured at 298.15, 308.15 and 318.15 K. From the experimental data, the excess molar volumes, V m E and excess isentropic compressibilities, κ s E have been calculated. The excess partial molar volumes, V ¯ m,1 E and V ¯ m,2 E and excess partial molar isentropic compressions, K ¯ s,m,1 E and K ¯ s,m,2 E over the whole composition range; and partial molar volumes, V ¯ m,1 ° and V ¯ m,2 ° , partial molar isentropic compressions, K ¯ s,m,1 ° and K ¯ s,m,2 ° , excess partial molar volumes, V ¯ m,1 °E and V ¯ m,2 °E , and excess partial molar isentropic compressions, K ¯ s,m,1 °E and K ¯ s,m,2 °E at infinite dilution have also been calculated. The variations of these parameters with composition and temperature are
Information Thermodynamics of Cytosine DNA Methylation.
Directory of Open Access Journals (Sweden)
Robersy Sanchez
Full Text Available Cytosine DNA methylation (CDM is a stable epigenetic modification to the genome and a widespread regulatory process in living organisms that involves multicomponent molecular machines. Genome-wide cytosine methylation patterning participates in the epigenetic reprogramming of a cell, suggesting that the biological information contained within methylation positions may be amenable to decoding. Adaptation to a new cellular or organismal environment also implies the potential for genome-wide redistribution of CDM changes that will ensure the stability of DNA molecules. This raises the question of whether or not we would be able to sort out the regulatory methylation signals from the CDM background ("noise" induced by thermal fluctuations. Here, we propose a novel statistical and information thermodynamic description of the CDM changes to address the last question. The physical basis of our statistical mechanical model was evaluated in two respects: 1 the adherence to Landauer's principle, according to which molecular machines must dissipate a minimum energy ε = kBT ln2 at each logic operation, where kB is the Boltzmann constant, and T is the absolute temperature and 2 whether or not the binary stretch of methylation marks on the DNA molecule comprise a language of sorts, properly constrained by thermodynamic principles. The study was performed for genome-wide methylation data from 152 ecotypes and 40 trans-generational variations of Arabidopsis thaliana and 93 human tissues. The DNA persistence length, a basic mechanical property altered by CDM, was estimated with values from 39 to 66.9 nm. Classical methylome analysis can be retrieved by applying information thermodynamic modelling, which is able to discriminate signal from noise. Our finding suggests that the CDM signal comprises a language scheme properly constrained by molecular thermodynamic principles, which is part of an epigenomic communication system that obeys the same thermodynamic
Dietary and supplemental maternal methyl-group donor intake and cord blood DNA methylation.
Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; A S Langie, Sabine; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode
2017-01-02
Maternal nutrition is critically involved in the development and health of the fetus. We evaluated maternal methyl-group donor intake through diet (methionine, betaine, choline, folate) and supplementation (folic acid) before and during pregnancy in relation to global DNA methylation and hydroxymethylation and gene specific (IGF2 DMR, DNMT1, LEP, RXRA) cord blood methylation. A total of 115 mother-infant pairs were enrolled in the MAternal Nutrition and Offspring's Epigenome (MANOE) study. The intake of methyl-group donors was assessed using a food-frequency questionnaire. LC-MS/MS and pyrosequencing were used to measure global and gene specific methylation, respectively. Dietary intake of methyl-groups before and during pregnancy was associated with changes in LEP, DNMT1, and RXRA cord blood methylation. Statistically significant higher cord blood LEP methylation was observed when mothers started folic acid supplementation more than 6 months before conception compared with 3-6 months before conception (34.6 ± 6.3% vs. 30.1 ± 3.6%, P = 0.011, LEP CpG1) or no folic acid used before conception (16.2 ± 4.4% vs. 13.9 ± 3%, P = 0.036 for LEP CpG3 and 24.5 ± 3.5% vs. 22.2 ± 3.5%, P = 0.045 for LEP mean CpG). Taking folic acid supplements during the entire pregnancy resulted in statistically significantly higher cord blood RXRA methylation as compared with stopping supplementation in the second trimester (12.3 ± 1.9% vs. 11.1 ± 2%, P = 0.008 for RXRA mean CpG). To conclude, long-term folic acid use before and during pregnancy was associated with higher LEP and RXRA cord blood methylation, respectively. To date, pregnant women are advised to take a folic acid supplement of 400 µg/day from 4 weeks before until 12 weeks of pregnancy. Our results suggest significant epigenetic modifications when taking a folic acid supplement beyond the current advice.
beta-Methyl-15-p-iodophenylpentadecanoic acid metabolism and kinetics in the isolated rat heart.
DeGrado, T R; Holden, J E; Ng, C K; Raffel, D M; Gatley, S J
1989-01-01
The use of 15-p-iodophenyl-beta-methyl-pentadecanoic acid (beta Me-IPPA) as an indicator of long chain fatty acid (LCFA) utilization in nuclear medicine studies was evaluated in the isolated, perfused, working rat heart. Time courses of radioactivity (residue curves) were obtained following bolus injections of both beta Me-IPPA and its straight chain counterpart 15-p-iodophenyl-pentadecanoic acid (IPPA). IPPA kinetics clearly indicated flow independent impairment of fatty acid oxidation caused by the carnitine palmitoyltransferase I inhibitor 2[5(4-chlorophenyl)pentyl]oxirane-2-carboxylate (POCA). In contrast, beta Me-IPPA kinetics were insensitive to changes in fatty acid oxidation rate and net utilization of long chain fatty acid. Analysis of radiolabeled species in coronary effluent and heart homogenates showed the methylated fatty acid to be readily incorporated into complex lipids but a poor substrate for oxidation. POCA did not significantly alter metabolism of the tracer, suggesting that the tracer is poorly metabolized beyond beta Me-IPPA-CoA in the oxidative pathway.
beta. -methyl-15-p-iodophenylpentadecanoic acid metabolism and kinetics in the isolated rat heart
Energy Technology Data Exchange (ETDEWEB)
DeGrado, T.R.; Holden, J.E.; Ng, C.K.; Raffel, D.M.; Gatley, S.J.
1989-02-01
The use of 15-p-iodophenyl-..beta..-methyl-pentadecanoic acid (..beta..Me-IPPA) as an indicator of long chain fatty acid (LCFA) utilization in nuclear medicine studies was evaluated in the isolated, perfused, working rat heart. Time courses of radioactivity (residue curves) were obtained following bolus injections of both ..beta..Me-IPPA and its straight chain counterpart 15-p-iodophenyl-pentadecanoic acid (IPPA). IPPA kinetics clearly indicated flow independent impairment of fatty acid oxidation caused by the carnitine palmitoyltransferase I inhibitor 2(5(4-chlorophenyl)pentyl)oxirane-2-carboxylate (POCA). In contrast, ..beta..Me-IPPA kinetics were insensitive to changes in fatty acid oxidation rate and net utilization of long chain fatty acid. Analysis of radiolabeled species in coronary effluent and heart homogenates showed the methylated fatty acid to be readily incorporated into complex lipids but a poor substrate for oxidation. POCA did not significantly alter metabolism of the tracer, suggesting that the tracer is poorly metabolized beyond ..beta..Me-IPPA-CoA in the oxidative pathway.
Hybrid e-learning tool TransLearning
Meij, van der Marjoleine G.; Kupper, Frank; Beers, P.J.; Broerse, Jacqueline E.W.
2016-01-01
<p>E-learning and storytelling approaches can support informal vicarious learning within geographically widely distributed multi-stakeholder collaboration networks. This case study evaluates hybrid e-learning and video-storytelling approach ‘TransLearning’ by investigation into how its storytelling
Directory of Open Access Journals (Sweden)
Shuji Ogino
2006-06-01
Full Text Available Cyclooxygenase-2 (COX-2 overexpression and mutations of p53 (a known COX-2 regulator are inversely associated with microsatellite instability—high (MSI-H and CpG island methylator phenotype (CIMP, characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A, CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15% tumors were CIMP-high (≥ 4 of 5 methylated promoters, 251 (33% were CIMP-low (1 to 3 methylated promoters, and the remaining 385 (51% were CIMP-0 (no methylated promoters. CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6% than in COX-2+/p53- tumors (19%; P < .0001, COX-2-/p53+ tumors (17%; P = .04, and COX-2-/p53- tumors (28%; P < .0001. In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7% than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P < .0001. In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone.
Directory of Open Access Journals (Sweden)
2008-08-01
Full Text Available Two methacrylate monomers containing azo and electronical push and pull structure, e.g. 2-Methyl-acrylic-acid-2-{[4-(4-cyano-phenylazo-3-methyl-phenyl]-ethyl-amino-ethyl ester (MACP with cyano substituted and 2-Methylacrylic-acid-2-{ethyl-[4-(4-methoxy-phenylazo-3-methyl-phenyl]-amino}-ethyl ester (MAMP with methoxy substituted, were synthesized and polymerized using 2-cyanoprop-2-yl dithiobenzoate (CPDB as chain transfer agent and 2,2'-azobisisobutyronitrile (AIBN as initiator. The results showed that the polymerization displayed characteristics of ‘living’/controlled free radical polymerization. Thus, the obtained polymers, polyMACP (pMACP and polyMAMP (pMAMP, had controlled molecular weights and narrow molecular weights distribution. The chain extension experiments of pMACP and pMAMP using styrene as the second monomer were successfully carried out. The photo-induced trans-cis-trans isomerization kinetic of pMACP and pMAMP in chloroform solution were described. Marked differences in rate for the trans-cis and cis-trans isomerization of pMACP and pMAMP were observed in chloroform solution due to the different electronic effects in these two polymers. Photoinduced birefringence and surface relief grating (SRG of the pMACP and pMAMP were investigated in thin film state.
Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I
2016-09-01
Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases.
Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A
2015-01-01
Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.
Energy Technology Data Exchange (ETDEWEB)
Mylvaganam, K.; Bacskay, G.B.; Hush, N.S.
2000-03-08
The C-H activation of methane catalyzed by cis- and trans-platin in aqueous solution has been studied by density functional based computational methods. By analogy with the Shilov reaction, the initial step is the replacement of an ammonia ligand by methane, followed by the formation of a methyl complex and the elimination o a proton. The computations utilize the B3LYP hybrid functionals, effective core potentials, and double-{zeta} to polarized double-{zeta} basis sets and include solvation effects by a dielectric continuum method. In contrast with the Shilov reaction studied by Seigbahn and Crabtree (J.Am.Chem.Soc. 1996, 118, 4443), in the platins the replacement of an ammonia ligand by methane is found to be effectively rate determining, in that the energy barriers to C-H activation are comparable with those of the initial substitution reaction, viz. {approximately} 34 and 44 kcal/mol for cis- and trans-platin, respectively. Several reaction pathways for C-H activation and subsequent proton elimination were identified. For cis-platin the energy barriers associated with the oxidative addition and {sigma}-bond metathesis type mechanisms were found to be comparable, while for trans-platin oxidative addition is predicted to be strongly preferred over {sigma}-bond metathesis, which, interestingly, also proceeds through a Pt(IV) methyl hydrido complex as reaction intermediate. In line with accepted ideas on trans influence, the methyl and hydride ligands in the Pt(IV) complexes that arise in the oxidative addition reactions were always found to be cis to each other. On the basis of the population analyses on the Pt(IV) complexes it is suggested that the Pt-H and Pt-CH{sub 3} bonds are best described as covalent bonds and, further, that the preference of the hydride and methyl anions to be cis to each other is a consequence of such covalent bonding. In light of these findings, the energies of several methyl Pt(IV) hydrido bisulfate complexes were also recalculated
Talebi, Mohsen; Patil, Rahul A; Sidisky, Leonard M; Berthod, Alain; Armstrong, Daniel W
2017-12-06
Twelve bis- or dicationic ionic liquids (ILs) including eight based on imidazolium, a single one based on phosphonium, and three based on pyrrolidinium cationic units were prepared with the bis(trifluoromethyl sulfonyl) imide anion. The two identical cationic moieties were attached by different alkyl spacers having three or five carbons and differing alkyl substituents attached to the spacer. The SLB-IL111 column, as the most polar commercial stationary phase known, was included in the study for comparison. Isothermal separations of a rapeseed oil fatty acid methyl ester (FAME) sample were used to study and compare the 12 IL-based column performances and selectivities. The retention times of the most retained methyl esters of lignoceric (C24:0) and erucic (C22:1) acids were used to estimate the IL polarity. The phosphonium dicationic IL column was, by far, the least polar. Imidazolium-based dicationic IL columns were the most polar. Polarity and selectivity for the FAME separation were somewhat related. The separation of a 37-FAME standard mixture allowed the investigation of selectivity variations observed on the 12 IL-based columns under temperature gradients up to 230 °C. The remarkable selectivity of the IL-based columns is demonstrated by the detailed analysis of the cis/trans C18:1 isomers of a partially hydrogenated vegetable oil sample on 30-m columns, separations competing with that done following an "official method" performed on a 100-m column. Graphical abstract Separation of fatty acid methyl esters on a 30-m 3m 2 C 5 (mpy) 2 . 2NTf 2 branched-chain dicationic IL-based column. Branched chain dicationic ILs show great selectivity for separation of cis/trans, ω-3/ω-6, and detailed analysis of cis/trans fats.
Directory of Open Access Journals (Sweden)
Sarojni Choy
2017-01-01
Full Text Available Over the last decade, there has been a rapid increase in doctoral enrolments of Asian international students in Australian universities. While policies have been developed to meet the needs of these students, there seems to be some confusion around the terms internationalisation, globalisation, bi-cultural, inter-cultural, multi-cultural, and trans-cultural within these policies. In this paper, we define these terms and advocate for a policy position which orients to a futurist definition of culture. We then review the work of Michael Singh and his research team at Western Sydney University who have responded to this rapid increase in Asian international student doctoral enrolments in Australian universities by developing pedagogic principles around notions of trans-language and trans-cultural practices. In the final section of the paper, we then draw on our own experiences of doctoral supervision in Australian universities to reflect on our positioning within the pedagogic principles around trans-language and trans-cultural practices.
Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Suemoto, Yuko; Meyerhardt, Jeffrey A; Fuchs, Charles S
2007-11-01
The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer. In contrast, a phenotype with less widespread promoter methylation (CIMP-low) has not been well characterised. O-6-methylguanine-DNA methyltransferase (MGMT) promoter methylation and silencing have been associated with G>A mutations and microsatellite instability-low (MSI-low). To examine molecular correlates with MGMT methylation/silencing in colorectal cancer. Utilising MethyLight technology, we quantified DNA methylation in MGMT and eight other markers (a CIMP-diagnostic panel; CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1) in 920 population-based colorectal cancers. Tumours with both MGMT methylation and loss were correlated positively with MSI-low (p = 0.02), CIMP-high (>or=6/8 methylated CIMP markers, p = 0.005), CIMP-low (1/8-5/8 methylated CIMP markers, p = 0.002, compared to CIMP-0 with 0/8 methylated markers), KRAS G>A mutation (p = 0.02), and inversely with 18q loss of heterozygosity (p = 0.0002). Tumours were classified into nine MSI/CIMP subtypes. Among the CIMP-low group, tumours with both MGMT methylation and loss were far more frequent in MSI-low tumours (67%, 12/18) than MSI-high tumours (5.6%, 1/18; p = 0.0003) and microsatellite stable (MSS) tumours (33%, 52/160; p = 0.008). However, no such relationship was observed among the CIMP-high or CIMP-0 groups. The relationship between MGMT methylation/silencing and MSI-low is limited to only CIMP-low tumours, supporting the suggestion that CIMP-low in colorectal cancer may be a different molecular phenotype from CIMP-high and CIMP-0. Our data support a molecular difference between MSI-low and MSS in colorectal cancer, and a possible link between CIMP-low, MSI-low, MGMT methylation/loss and KRAS mutation.
Directory of Open Access Journals (Sweden)
Daniela Menozzi
2015-03-01
Full Text Available The present work reports the synthesis and complexation properties of five mixed bridge P=O/P=S cavitands toward N,N-methyl butyl ammonium chloride (1 as prototype guest. The influence of number and position of P=O and P=S groups on the affinity of phosphonate cavitands toward 1 is assessed via ITC titrations in DCE as solvent. Comparison of the resulting Kass values, the enthalpic and entropic contributions to the overall binding with those of the parent tetraphosphonate Tiiii and tetrathiophosphonate TSiiii cavitands allows one to single out the simultaneous dual H-bond between the cavitand and the salt as the major player in complexation.
Evidence that alpha-methyl-p-tyramine is implicated in behavioural augmentation to amphetamine.
Dougan, D F; Labrie, S L; Paull, P D; Duffield, P H; Wade, D N
1986-01-01
Behavioural studies showed that administration of alpha-methyl-p-tyramine (AMT; 10 mg/kg i.p.) to rats 24 hr before treatment with d-amphetamine (AMPHET; 4 mg/kg i.p.) resulted in augmentation of AMPHET-induced stereotype activity. Parallel experiments involving electro-chemical estimation of dopamine metabolites in the striatum showed that the decrease in the concentration of homovanillic acid (HVA) produced by AMPHET (4 mg/kg) was enhanced in AMT (10 mg/kg) pretreated animals. These findings suggest that AMT derived from previous doses of AMPHET may play a role in the phenomena of behavioural augmentation observed after chronic administration of AMPHET.
Pine weevil (Hylobius abietis) antifeedants from lodgepole pine (Pinus contorta).
Bratt, K; Sunnerheim, K; Nordenhem, H; Nordlander, G; Langström, B
2001-11-01
Pine weevils (Hylobius abietis) fed less on bark of lodgepole pine (Pinus contorta) than on bark of Scots pine (P. sylvestris). Two pine weevil antifeedants, ethyl trans-cinnamate and ethyl 2,3-dibromo-3-phenyl-propanoate, were isolated from bark of lodgepole pine. These two compounds significantly reduced pine weevil feeding in a laboratory bioassay. In field assays, the second compound significantly decreased pine weevil damage on planted seedlings. Ethyl 2,3-dibromo-3-phenylpropanoate has not previously been reported as a natural product.
Directory of Open Access Journals (Sweden)
S. Panda
2011-01-01
Full Text Available The compounds 2-[5'-benzylidene-2'-phenyl-4'-oxo-1', 3'-thiazolidine]-1, 3-benzothiazole and 2-[5'-(p-N,N-dimethylamino- benzylidene-2'-phenyl-4'-oxo-1', 3'-thiazolidine]-1, 3-benzothiazole have been synthesized in their purest forms starting from 2-aminobenzothiazole. The inclusion complexes of the above compounds have been prepared with β-cyclodextrin to increase their solubility and bioaccessibility in polar medium. The formation of inclusion complexes have been ascertained by study of spectral characteristic before and after inclusion complex formation. The stability of inclusion complexes and nature of interaction between the host and guest are known from the determination of thermodynamic parameters. Further the antibacterial and antifungal activities of the compounds are determined which is found to increase significantly after inclusion complex formation
Jourian, T J; Simmons, Symone L
2017-06-01
Focusing on emerging literature on trans* and gender-nonconforming students and their leadership, this chapter outlines the ways trans* students are engaged in leadership in educational institutions and outside of them and discusses implications for staff and faculty regarding how to support and engage these students and their leadership. © 2017 Wiley Periodicals, Inc., A Wiley Company.
Energy Technology Data Exchange (ETDEWEB)
Eswaramma, S. [Polymer Biomaterial Design and Synthesis Laboratory, Department of Chemistry, Yogi Vemana University, Kadapa, Andhra Pradesh, 516003 (India); Reddy, N. Sivagangi [Advanced Nanomaterials Lab, Department of Polymer Science and Engineering, Pusan National University, Busan, 46241 (Korea, Republic of); Rao, K.S.V. Krishna, E-mail: ksvkr@yogivemanauniversity.ac.in [Polymer Biomaterial Design and Synthesis Laboratory, Department of Chemistry, Yogi Vemana University, Kadapa, Andhra Pradesh, 516003 (India)
2017-07-01
pH-sensitive interpenetrating polymer network (IPN) microgels of chitosan (CS) and guargum-g-poly((2-dimethylamino)ethylmethacrylate) (GG-g-PDMAEMA) were developed by emulsion crosslinking method using glutaraldehyde as a crosslinker. In this regard, primarily guargum (GG) is grafted with (2-dimethylamino)ethylmethacrylate (DMAEMA) followed by blended with CS to prepare various microgel formulations. These microgels were treated as responsive drug carriers for an anticancer agent, 5-fluorouracil (5-FU). The maximum % encapsulation efficiency was found to be 81. Fourier transform infrared analysis was used to investigate the formation of graft copolymer (GG-g-PDMAEMA), chemical structure of microgels as well as the chemical interactions of drug molecules with the polymer matrix. The surface morphological studies and average particle size were examined by scanning electron microscopy. The average size of microgels is 130 ± 20 μm. Thermal behavior and molecular distribution of 5-FU within the polymer matrix were confirmed from thermogravimetric analysis and X-ray diffraction experiments. The pH-sensitive swelling behavior of IPN microgels was investigated in different pH solutions. To study the release profile of 5-FU, in vitro release profiles were performed in both pH 1.2 and 7.4. The release kinetics showed pH- dependent drug release and IPN microgels exhibited an excellent controlled release pattern for 5-FU over a period of more than 24 h. The release mechanism was analyzed by evaluating the release data using different empirical equations. - Highlights: • poly((2-dimethylamino)ethylmethacrylate) was grafted on to guargum backbone. • pH-responsive IPN microgels were developed from chitosan and graft copolymer. • Microgels were treated as responsive drug carriers for an anticancer agent, 5-fluorouracil. • Swelling and drug release studies were greatly dependent on pH.
International Nuclear Information System (INIS)
Eswaramma, S.; Reddy, N. Sivagangi; Rao, K.S.V. Krishna
2017-01-01
pH-sensitive interpenetrating polymer network (IPN) microgels of chitosan (CS) and guargum-g-poly((2-dimethylamino)ethylmethacrylate) (GG-g-PDMAEMA) were developed by emulsion crosslinking method using glutaraldehyde as a crosslinker. In this regard, primarily guargum (GG) is grafted with (2-dimethylamino)ethylmethacrylate (DMAEMA) followed by blended with CS to prepare various microgel formulations. These microgels were treated as responsive drug carriers for an anticancer agent, 5-fluorouracil (5-FU). The maximum % encapsulation efficiency was found to be 81. Fourier transform infrared analysis was used to investigate the formation of graft copolymer (GG-g-PDMAEMA), chemical structure of microgels as well as the chemical interactions of drug molecules with the polymer matrix. The surface morphological studies and average particle size were examined by scanning electron microscopy. The average size of microgels is 130 ± 20 μm. Thermal behavior and molecular distribution of 5-FU within the polymer matrix were confirmed from thermogravimetric analysis and X-ray diffraction experiments. The pH-sensitive swelling behavior of IPN microgels was investigated in different pH solutions. To study the release profile of 5-FU, in vitro release profiles were performed in both pH 1.2 and 7.4. The release kinetics showed pH- dependent drug release and IPN microgels exhibited an excellent controlled release pattern for 5-FU over a period of more than 24 h. The release mechanism was analyzed by evaluating the release data using different empirical equations. - Highlights: • poly((2-dimethylamino)ethylmethacrylate) was grafted on to guargum backbone. • pH-responsive IPN microgels were developed from chitosan and graft copolymer. • Microgels were treated as responsive drug carriers for an anticancer agent, 5-fluorouracil. • Swelling and drug release studies were greatly dependent on pH.
Directory of Open Access Journals (Sweden)
Özlem Tokuşoğlu
2008-06-01
Full Text Available Conjugated linoleic acids (CLAs exhibit protective effects against various types of cancer and heart diseases. With the newly developed capillary gas chromatographic method (GC, cis9, trans11 and trans10, cis12 octadecadienoic acid isomers of CLA (C18:2 were determined in crude and refined corn oils as qualitative and quantitative measurements. Cis 9, trans11 C18:2 (c9, t11 CLA was the major CLA isomer in both oils. It was found that c9, t11 CLA was 0.62% of the total lipid in crude oil and 1.24% of the total lipid in refined oil. Using the refining process, the total CLA was 1.38% whereas that of crude corn oil was 0.62%. An approximate 2.2 fold increase in the total CLA was found in refined oil (n = 9 (p y = 2.782x + 0.046 (R2 = 0.9999] were performed (p El ácido linoleico conjugado (CLA parece exhibir efecto protector frente a enfermedades cardiovasculares y varios tipos de cáncer. En este trabajo, se establece un mátodo analítico mediante cromatografía de gases con columna capilar para la determinación cualitativa y cuantitativa de los isómeros cis 9,trans 11 y trans 10, cis 12 en aceites de maiz crudo y refinado. El isómero cis 9, trans11 C18:2 fue el mayoritario encontrándose en concentraciones de 0.62% en el aceite cru,do y de 1.24 % en el aceite refinado. La cantidad total de CLA encontrada en el aceite refinado (n = 9 (p 2 = 0.9999 y de recuperación [y = 2.782x+0.046 (R2 = 0.9999]. El método cromatográfico propuesto podría ser usado para el control de calidad de los aceites vegetales.
ATM Mediates pRB Function To Control DNMT1 Protein Stability and DNA Methylation
Suzuki, Misa; Hayashi, Naoyuki; Kobayashi, Masahiko; Sasaki, Nobunari; Nishiuchi, Takumi; Doki, Yuichiro; Okamoto, Takahiro; Kohno, Susumu; Muranaka, Hayato; Kitajima, Shunsuke; Yamamoto, Ken-ichi
2013-01-01
The retinoblastoma tumor suppressor gene (RB) product has been implicated in epigenetic control of gene expression owing to its ability to physically bind to many chromatin modifiers. However, the biological and clinical significance of this activity was not well elucidated. To address this, we performed genetic and epigenetic analyses in an Rb-deficient mouse thyroid C cell tumor model. Here we report that the genetic interaction of Rb and ATM regulates DNMT1 protein stability and hence controls the DNA methylation status in the promoters of at least the Ink4a, Shc2, FoxO6, and Noggin genes. Furthermore, we demonstrate that inactivation of pRB promotes Tip60 (acetyltransferase)-dependent ATM activation; allows activated ATM to physically bind to DNMT1, forming a complex with Tip60 and UHRF1 (E3 ligase); and consequently accelerates DNMT1 ubiquitination driven by Tip60-dependent acetylation. Our results indicate that inactivation of the pRB pathway in coordination with aberration in the DNA damage response deregulates DNMT1 stability, leading to an abnormal DNA methylation pattern and malignant progression. PMID:23754744
β-methyl-15-p-iodophenylpentadecanoic acid metabolism and kinetics in the isolated rat heart
International Nuclear Information System (INIS)
DeGrado, T.R.; Holden, J.E.; Ng, C.K.; Raffel, D.M.; Gatley, S.J.
1989-01-01
The use of 15-p-iodophenyl-β-methyl-pentadecanoic acid (βMe-IPPA) as an indicator of long chain fatty acid (LCFA) utilization in nuclear medicine studies was evaluated in the isolated, perfused, working rat heart. Time courses of radioactivity (residue curves) were obtained following bolus injections of both βMe-IPPA and its straight chain counterpart 15-p-iodophenyl-pentadecanoic acid (IPPA). IPPA kinetics clearly indicated flow independent impairment of fatty acid oxidation caused by the carnitine palmitoyltransferase I inhibitor 2[5(4-chlorophenyl)pentyl]oxirane-2-carboxylate (POCA). In contrast, βMe-IPPA kinetics were insensitive to changes in fatty acid oxidation rate and net utilization of long chain fatty acid. Analysis of radiolabeled species in coronary effluent and heart homogenates showed the methylated fatty acid to be readily incorporated into complex lipids but a poor substrate for oxidation. POCA did not significantly alter metabolism of the tracer, suggesting that the tracer is poorly metabolized beyond βMe-IPPA-CoA in the oxidative pathway. (orig.)
Biotransformation of trans-1-chloro-3,3,3-trifluoropropene (trans-HCFO-1233zd)
International Nuclear Information System (INIS)
Schmidt, Tobias; Bertermann, Rüdiger; Rusch, George M.; Tveit, Ann; Dekant, Wolfgang
2013-01-01
trans-1-Chloro-3,3,3-trifluoropropene (trans-HCFO-1233zd) is a novel foam blowing and precision cleaning agent with a very low impact for global warming and ozone depletion. trans-HCFO-1233zd also has a low potential for toxicity in rodents and is negative in genotoxicity testing. The biotransformation of trans-HCFO-1233zd and kinetics of metabolite excretion with urine were assessed in vitro and in animals after inhalation exposures. For in vitro characterization, liver microsomes from rats, rabbits and humans were incubated with trans-HCFO-1233zd. Male Sprague Dawley rats and female New Zealand White rabbits were exposed to 2,000, 5,000 and 10,000 ppm for 6 h and urine was collected for 48 h after the end of the exposure. Study specimens were analyzed for metabolites using 19 F NMR, LC-MS/MS and GC/MS. S-(3,3,3-trifluoro-trans-propenyl)-glutathione was identified as predominant metabolite of trans-HCFO-1233zd in all microsomal incubation experiments in the presence of glutathione. Products of the oxidative biotransformation of trans-HCFO-1233zd were only minor metabolites when glutathione was present. In rats, both 3,3,3-trifluorolactic acid and N-acetyl-(3,3,3-trifluoro-trans-propenyl)-L-cysteine were observed as major urinary metabolites. 3,3,3-Trifluorolactic acid was not detected in the urine of rabbits. Quantitation showed rapid excretion of both metabolites in both species (t 1/2 1/2 < 6 h). ► Glutathione adduct as predominant in vitro metabolite in all tested species. ► Toxic metabolites could not be detected in any great extent
Siegel discs via trans-quasiconformal surgery
DEFF Research Database (Denmark)
Petersen, Carsten Lunde
2014-01-01
kompleksstruktur kan integreres, det vil sige definerer en kompleksstruktur. I denne komplekse struktur er den nye afbildning holomorf og har en Siegel disk. Der findes imidlertid masser af tilfælde hvor dette ikke lader sig gøre, men hvor man istedet kan finde en trans-kvasikonform udvidelse til enheds-disken af...... mængde af rotationstal med fuldt mål på cirklen har konjugationen en trans-kvasi-konform udvidelse til disken. Dette er et skridt i beviset for at for næsten alle (i Lebeguemåls forstand) rotations tal, er randen af Siegel-disken for et kvadratisk polynomium med en Siegel disk med et sådant rotationstal...
Directory of Open Access Journals (Sweden)
Cross M
2013-06-01
Full Text Available Michael Cross,1 Enrica Bach,1 Thao Tran,1 Rainer Krahl,1 Nadja Jaekel,1 Dietger Niederwieser,1 Christian Junghanss,2 Georg Maschmeyer,3 Haifa Kathrin Al-Ali11Division of Hematology and Oncology, University of Leipzig, Leipzig, Germany; 2Clinic for Hematology, Oncology and Palliative Medicine, University of Rostock, Rostock, Germany; 3Clinic for Hematology, Oncology and Palliative Medicine, Ernst-von-Bergmann Clinic, Potsdam, GermanyBackground: Epigenetic modulations, including changes in DNA cytosine methylation, are implicated in the pathogenesis and progression of acute myeloid leukemia (AML. Azacitidine is a hypomethylating agent that is incorporated into RNA as well as DNA. Thus, there is a rationale to its use in patients with AML. We determined whether baseline and/or early changes in the methylation of long interspersed element (LINE-1 or CDH13 correlate with bone marrow blast clearance, hematological response, or survival in patients with AML treated with azacitidine.Methods: An open label, phase I/II trial was performed in 40 AML patients (median bone marrow blast count was 42% unfit for intensive chemotherapy treated with azacitidine 75 mg/m2/day subcutaneously for 5 days every 4 weeks. Bone marrow mononuclear cell samples were taken on day 0 (pretreatment and day 15 during the first treatment cycle; LINE-1 and CDH13 methylation levels were quantified by methylation-specific, semiquantitative, real-time polymerase chain reaction.Results: Treatment with azacitidine significantly reduced LINE-1 but not CDH13 methylation levels over the first cycle (P < 0.0001. Absolute LINE-1 methylation levels tended to be lower on day 0 (P = 0.06 and day 15 of cycle 1 (P = 0.03 in patients who went on to achieve subsequent complete remission, partial remission or hematological improvement versus patients with stable disease. However, the decrease in LINE-1 methylation over the first treatment cycle did not correlate with subsequent response (P = 0
Soares-Miranda, Luisa; Stein, Phyllis K; Imamura, Fumiaki; Sattelmair, Jacob; Lemaitre, Rozenn N; Siscovick, David S; Mota, Jorge; Mozaffarian, Dariush
2014-01-01
Background Trans-fatty acid (TFA) consumption is associated with risk of coronary heart disease, and trans-18:2, but not trans-18:1, in red blood cells membranes has been associated with sudden cardiac arrest. Abnormal heart rate variability (HRV) reflects autonomic dysfunction and predicts cardiac death. Relationships between TFA consumption and HRV remain under-studied. We determined whether total TFA consumption, as well as trans-18:1 and trans-18:2 TFA consumption, were independently associated with HRV in two independent cohorts in the US and Portugal. Methods and Results In two independent cohorts of older US adults (Cardiovascular Health Study ([CHS], age=72±5yrs, 1989/1995) and young Portuguese adults (Porto, age=19±2yrs, 2008/2010), we assessed habitual TFA intake by food frequency questionnaires in CHS (separately estimating trans-18:1 and trans-18:2) and multiple 24-hour recalls in Porto (estimating total TFA only, which in a subset correlated with circulating trans-18:2, but not trans-18:1, suggesting that we captured the former). HRV was assessed using 24-hour Holters in CHS (N=1,076) and repeated short-term (5-min) ECGs in Porto (N=160). We used multivariate-adjusted linear regression to relate TFA consumption to HRV cross-sectionally (CHS, Porto) and longitudinally (CHS). In CHS, higher trans-18:2 consumption was associated with lower 24-hour standard-deviation-of-all-normal-to-normal-intervals (SDNN) both cross-sectionally (−12%, 95%CI=6–19%, p=0.001) and longitudinally (−15%, 95%CI=4–25 %, p= 0.009), and lower 24-hour SDANN and SDNN-index (pHRV, in particular time-domain indices (SDNN, SDANN, SDNN-index; pHRV in both older and young adults. Trans-18:1 consumption is associated with more favorable HRV indices in older adults. Our results support the need to investigate potential HRV related mechanisms whereby trans-18:2 may increase arrhythmic risk. PMID:22772898
Directory of Open Access Journals (Sweden)
Sonaglio V
2013-06-01
Full Text Available Viviane Sonaglio,1 Ana C de Carvalho,2 Silvia R C Toledo,3,4 Carolina Salinas-Souza,3,4 André L Carvalho,5 Antonio S Petrilli,3 Beatriz de Camargo,6 André L Vettore21Pediatrics Department, A C Camargo Hospital, São Paulo, Brazil; 2Biological Science Department, Federal University of São Paulo, Diadema, Brazil; 3Department of Pediatrics, Pediatric Oncology Institute, GRAACC/Federal University of São Paulo, São Paulo, Brazil; 4Department of Morphology and Genetics, Federal University of São Paulo, São Paulo, Brazil; 5Department of Head and Neck Surgery, PIO XII Foundation, Barretos Cancer Hospital, Barretos, São Paulo, Brazil; 6Research Program Pediatric Oncology Program, CPNq, Instituto Nacional do Cancer, Rio de Janeiro, BrazilAbstract: Osteosarcoma (OS is the eighth most common form of childhood and adolescence cancer. Approximately 10%–20% of patients present metastatic disease at diagnosis and the 5-year overall survival remains around 70% for nonmetastatic patients and around 30% for metastatic patients. Metastatic disease at diagnosis and the necrosis grade induced by preoperative treatment are the only well-established prognostic factors for osteosarcoma. The DNA aberrant methylation is a frequent epigenetic alteration in humans and has been described as a molecular marker in different tumor types. This study evaluated the DNA aberrant methylation status of 18 genes in 34 OS samples without previous chemotherapy treatment and in four normal bone specimens and compared the methylation profile with clinicopathological characteristics of the patients. We were able to define a three-gene panel (AIM1, p14ARF, and ESR1 in which methylation was correlated with OS cases. The hypermethylation of p14ARF showed a significant association with the absence of metastases at diagnoses, while ESR1 hypermethylation was marginally associated with worse overall survival. This study demonstrated that aberrant promoter methylation is a common event
Ulma, Zeni; Rahayuningsih, Edia; Dwi Wahyuningsih, Tutik
2018-01-01
The stability of natural dyes to the changes of pH is really necessary when the natural dyes are applied either on fabric or food. This research aimed to increase the stability of brazilein, a compound contained within the secang wood extract, to the changes of pH. The methylation process was done by reacting Dimethyl Carbonate (DMC) with the brazilein on the secang wood extract. DMC acts as a substance that substitute hydroxyl group on brazilein. The methylation reaction of brazilein on secang wood extract was operated on a three-necked round-bottomed flask fitted with mercury-sealed stirrer and reflux condenser under 80°C temperature and 250 rpm stirring speed. There were two variables observed in this research; the DMC amount ratio to the amount of secang wood extract and the time of the methylation process. The research showed that at the 1:10 the DMC amount ratio to the amount of wood extract and 8 hours of the methylation process give the better stability of color of the secang wood extract than the variation of the other variables.
Survey of the trans-resveratrol and trans-piceid content of cocoa-containing and chocolate products.
Hurst, W Jeffrey; Glinski, Jan A; Miller, Kenneth B; Apgar, Joan; Davey, Matthew H; Stuart, David A
2008-09-24
Dietary resveratrol (3,4',5-trihydroxystilbene) has been implicated in the health benefits associated with grapes and red wine, more specifically with potential benefits for metabolic syndrome, energy use, and increased endurance. Levels of trans-resveratrol and its glucoside, trans-piceid, were determined in 19 top selling commercially available cocoa-containing and chocolate products from the U.S. market. Amounts of trans-resveratrol and trans-piceid were closely correlated with the amount of nonfat cocoa solids (NFCS) in the cocoa-containing products. Among these products, trans-resveratrol levels were highest in cocoa powders (1.85 +/- 0.43 microg/g), followed by unsweetened baking chocolates (1.24 +/- 0.22), semisweet chocolate baking chips (0.52 +/- 0.14), dark chocolates (0.35 +/- 0.08), milk chocolates (0.10 +/- 0.05), and chocolate syrups (0.09 +/- 0.02). These cocoa-containing and chocolate products have about 3-5 times more trans-piceid than trans-resveratrol. Levels of trans-piceid were highest in the cocoa powders (7.14 +/- 0.80 microg/g), followed by unsweetened baking chocolates (4.04 +/- 0.14), semisweet chocolate baking chips (2.01 +/- 0.18), dark chocolates (1.82 +/- 0.36), milk chocolates (0.44 +/- 0.06), and chocolate syrups (0.35 +/- 0.06). On an equal weight basis, cocoa powder had about half as much trans-resveratrol as the average California red wine. On a per serving basis, cocoa-containing and chocolate products had less trans-resveratrol than red wine and grape juice but more than roasted peanuts. Overall, these cocoa-containing and chocolate products rank second after red wines and grape juice in foods with the highest levels of total trans-resveratrol in the diet.
In vivo metabolism of (+)-trans-delta-9-tetrahydrocannabinol in the mouse.
Harvey, D J
1988-01-15
(+)-trans-Delta-9-tetrahydrocannabinol [(+)-delta-9-THC], a biologically inactive isomer of (-)-trans-delta-9-THC, the major psychoactive constituent of cannabis, was administered intraperitoneally to male Charles River CD-1 mice; hepatic metabolites were extracted with ethyl acetate and isolated by chromatography on Sephadex LH-20 in chloroform. The metabolites were converted into trimethylsilyl (TMS), 2H9-TMS and methyl ester/TMS derivatives for examination by gas chromatography/mass spectrometry and additional samples were prepared by reduction of metabolic fractions with lithium aluminium deuteride. Sixteen metabolites were characterized: these were alcohols and carboxylic acids, together with several of their hydroxylated analogues. The major biotransformation pathway was hydroxylation at C(11) to give the major metabolite, followed by oxidation of this compound to a carboxylic acid. Hydroxylated analogues of these two compounds were substituted mainly in the side-chain. Although metabolism was very similar to that of the naturally occurring (-)-isomer as far as positions of substitution were concerned, some differences were observed. These related mainly to the positions of hydroxylation on the side-chain, where 1'-hydroxylation was preferred to hydroxylation at the 2'-position. The major difference in metabolism between the two isomers was that much less oxidation of the 11-hydroxy group to a carboxylic acid occurred and there was less hydroxylation at the 8-position. Thus, 11-hydroxy-(+)-trans-delta-9-THC was the major metabolite and most other metabolites were hydroxylated derivatives of this compound.
Nutrient-dependent methylation of a membrane-associated protein of Escherichia coli
International Nuclear Information System (INIS)
Young, C.C.; Alvarez, J.D.; Bernlohr, R.W.
1990-01-01
Starvation of a mid-log-phase culture of Escherichia coli B/r for nitrogen, phosphate, or carbon resulted in methylation of a membrane-associated protein of about 43,000 daltons (P-43) in the presence of chloramphenicol and [methyl-3H]methionine. The in vivo methylation reaction occurred with a doubling time of 2 to 5 min and was followed by a slower demethylation process. Addition of the missing nutrient to a starving culture immediately prevented further methylation of P-43. P-43 methylation is not related to the methylated chemotaxis proteins because P-43 is methylated in response to a different spectrum of nutrients and because P-43 is methylated on lysine residues. The characteristics of P-43 are similar to those of a methylated protein previously described in Bacillus subtilis and B. licheniformis and are consistent with the proposal that methylation of this protein functions in nutrient sensing
Hu, Marian Y; Lein, Etienne; Bleich, Markus; Melzner, Frank; Stumpp, Meike
2018-04-16
Experimental simulation of near-future ocean acidification (OA) has been demonstrated to affect growth and development of echinoderm larval stages through energy allocation towards ion and pH compensatory processes. To date, it remains largely unknown how major pH regulatory systems and their energetics are affected by trans-generational exposure to near-future acidification levels. Here we used the common sea star Asterias rubens in a reciprocal transplant experiment comprising different combinations of OA scenarios, in order to study trans-generational plasticity using morphological and physiological endpoints. Acclimation of adults to pH T 7.2 (pCO 2 3500μatm) led to reductions in feeding rates, gonad weight, and fecundity. No effects were evident at moderate acidification levels (pH T 7.4; pCO 2 2000μatm). Parental pre-acclimation to pH T 7.2 for 85 days reduced developmental rates even when larvae were raised under moderate and high pH conditions, whereas pre-acclimation to pH T 7.4 did not alter offspring performance. Microelectrode measurements and pharmacological inhibitor studies carried out on larval stages demonstrated that maintenance of alkaline gastric pH represents a substantial energy sink under acidified conditions that may contribute up to 30% to the total energy budget. Parental pre-acclimation to acidification levels that are beyond the pH that is encountered by this population in its natural habitat (e.g. pH T 7.2) negatively affected larval size and development, potentially through reduced energy transfer. Maintenance of alkaline gastric pH and reductions in maternal energy reserves probably constitute the main factors for a reduced juvenile recruitment of this marine keystone species under simulated OA. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ma, Yan-Long; Zhou, Ru-Jin; Zeng, Xing-Ye; An, Ya-Xiong; Qiu, Song-Shan; Nie, Li-Jun
2014-04-01
Six novel cis/trans-but-2-enedioic acid esters had been synthesized to discover the new bioactive molecules that could kill food-related bacteria and fungi. Their structures were analyzed by melting point, LC-MS, 1H NMR and 13C NMR. 4-(Methoxycarbonyl) phenyl ethyl fumarate (6b) was also characterized by single-crystal X-ray diffraction. Their antimicrobial activities were evaluated in vitro by measuring the minimal inhibitory concentration (MIC). Compared with the single monomethyl fumarate and methyl 4-hydroxybenzoate, these compounds had stronger antimicrobial activity against all the eight microorganisms. Among the antibacterial and antifungal compounds, 4-(methoxycarbonyl) phenyl methyl fumarate (6a) showed the best antimicrobial activity. The electronic properties of these compounds were calculated by the density functional theory (DFT) method with 6-31G (d, p) basis set. DFT studies indicated that molecular electrostatic potential (MEP) map, ELUMO, energy gap, electronegativity and electrophilicity index could be helpful to understand the various antimicrobial activities among these compounds. The antimicrobial activity of compound 6a was evaluated in vitro against Salmonellacholeraesuis subsp. choleraesuis, Lactococcus lactis subsp. lactis and Saccharomyces cerevisiae by time-kill, and it was found that compound 6a exhibited significant microbiocidal activity against the three microorganisms.
Homologous SV40 RNA trans-splicing: Special case or prime example of viral RNA trans-splicing?
Directory of Open Access Journals (Sweden)
Sushmita Poddar
2014-06-01
Full Text Available To date the Simian Virus 40 (SV40 is the only proven example of a virus that recruits the mechanism of RNA trans-splicing to diversify its sequences and gene products. Thereby, two identical viral transcripts are efficiently joined by homologous trans-splicing triggering the formation of a highly transforming 100 kDa super T antigen. Sequences of other viruses including HIV-1 and the human adenovirus type 5 were reported to be involved in heterologous trans-splicing towards cellular or viral sequences but the meaning of these events remains unclear. We computationally and experimentally investigated molecular features associated with viral RNA trans-splicing and identified a common pattern: Viral RNA trans-splicing occurs between strong cryptic or regular viral splice sites and strong regular or cryptic splice sites of the trans-splice partner sequences. The majority of these splice sites are supported by exonic splice enhancers. Splice sites that could compete with the trans-splicing sites for cis-splice reactions are weaker or inexistent. Finally, all but one of the trans-splice reactions seem to be facilitated by one or more complementary binding domains of 11 to 16 nucleotides in length which, however occur with a statistical probability close to one for the given length of the involved sequences. The chimeric RNAs generated via heterologous viral RNA trans-splicing either did not lead to fusion proteins or led to proteins of unknown function. Our data suggest that distinct viral RNAs are highly susceptible to trans-splicing and that heterologous viral trans-splicing, unlike homologous SV40 trans-splicing, represents a chance event.
International Nuclear Information System (INIS)
Cuskin, Fiona; Solovyova, Alexandra S.; Lewis, Richard J.; Race, Paul R.
2011-01-01
The expression, purification and crystallization of the trans-acting acyltransferase PksC from the bacillaene hybrid polyketide synthase/nonribosomal peptide synthetase is described. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and diffracted to 1.44 Å resolution. The antibiotic bacillaene is biosynthesized in Bacillus subtilis by a hybrid type 1 modular polyketide synthase/nonribosomal peptide synthetase of the trans-acyltransferase (trans-AT) class. Within this system, the essential acyl-group loading activity is provided by the action of three free-standing trans-acting acyltransferases. Here, the recombinant expression, purification and crystallization of the bacillaene synthase trans-acting acyltransferase PksC are reported. A diffraction data set has been collected from a single PksC crystal to 1.44 Å resolution and the crystal was found to belong to the orthorhombic space group P2 1 2 1 2 1
Suresh Kumar, G. S.; Seethalakshmi, P. G.; Bhuvanesh, N.; Kumaresan, S.
2013-10-01
Two organic cocrystals namely, caffeine:cinnamic acid [(caf)(ca)] (1) and caffeine:eosin dihydrate [(caf)(eos)]·2H2O (2) were synthesized and studied by FT-IR, TGA/DTA, and single crystal XRD. The crystal system of cocrystal 1 is triclinic with space group P-1 and Z = 2 and that of cocrystal 2 is monoclinic with space group P21/C and Z = 4. An imidazole-carboxylic acid synthon is observed in the cocrystal 1. The intermolecular hydrogen bond, O-H⋯N and π-π interactions play a major role in stabilizing 1 whereas the intermolecular hydrogen bonds, O-H⋯O, O-H⋯N, and intramolecular hydrogen bond, O-H⋯Br; along with π-π interactions together play a vital role in stabilizing the structure of 2. The antimicrobial- and DPPH radical scavenging activities of both the cocrystals were studied.
Maternal Methyl-Group Donor Intake and Global DNA (HydroxyMethylation before and during Pregnancy
Directory of Open Access Journals (Sweden)
Sara Pauwels
2016-08-01
Full Text Available It is still unclear to which extent methyl-group intake during pregnancy can affect maternal global DNA (hydroxylmethylation. Pregnancy methylation profiling and its link with methyl-group intake in a healthy population could enhance our understanding of the development of pregnancy related disorders. One hundred forty-eight women were enrolled in the MANOE (MAternal Nutrition and Offspring’s Epigenome study. Thiry-four women were enrolled before pregnancy and 116 during the first trimester of pregnancy. Global DNA (hydroxymethylation in blood using LC-MS/MS and dietary methyl-group intake (methionine, folate, betaine, and choline using a food-frequency questionnaire were estimated pre-pregnancy, during each trimester, and at delivery. Global DNA (hydroxymethylation levels were highest pre-pregnancy and at weeks 18–22 of pregnancy. We observed a positive relation between folic acid and global DNA methylation (p = 0.04 and hydroxymethylation (p = 0.04. A high intake of methionine pre-pregnancy and in the first trimester showed lower (hydroxymethylation percentage in weeks 11–13 and weeks 18–22, respectively. Choline and betaine intake in the first weeks was negatively associated with hydroxymethylation. Women with a high intake of these three methyl groups in the second and third trimester showed higher hyrdoxymethylation/methylation levels in the third trimester. To conclude, a time trend in DNA (hydroxymethylation was found and women with higher methyl-group intake showed higher methylation in the third trimester, and not in earlier phases of pregnancy.
Amano, Hirotaka; Kazamori, Daichi; Itoh, Kenji
2016-01-01
Three major organosulfur compounds of aged garlic extract, S-allyl-L-cysteine (SAC), S-methyl-L-cysteine (SMC), and trans-S-1-propenyl-L-cysteine (S1PC), were examined for their effects on the activities of five major isoforms of human CYP enzymes: CYP1A2, 2C9, 2C19, 2D6, and 3A4. The metabolite formation from probe substrates for the CYP isoforms was examined in human liver microsomes in the presence of organosulfur compounds at 0.01-1 mM by using liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis. Allicin, a major component of garlic, inhibited CYP1A2 and CYP3A4 activity by 21-45% at 0.03 mM. In contrast, a CYP2C9-catalyzed reaction was enhanced by up to 1.9 times in the presence of allicin at 0.003-0.3 mM. SAC, SMC, and S1PC had no effect on the activities of the five isoforms, except that S1PC inhibited CYP3A4-catalyzed midazolam 1'-hydroxylation by 31% at 1 mM. The N-acetylated metabolites of the three compounds inhibited the activities of several isoforms to a varying degree at 1 mM. N-Acetyl-S-allyl-L-cysteine and N-acetyl-S-methyl-L-cysteine inhibited the reactions catalyzed by CYP2D6 and CYP1A2, by 19 and 26%, respectively, whereas trans-N-acetyl-S-1-propenyl-L-cysteine showed weak to moderate inhibition (19-49%) of CYP1A2, 2C19, 2D6, and 3A4 activities. On the other hand, both the N-acetylated and S-oxidized metabolites of SAC, SMC, and S1PC had little effect on the reactions catalyzed by the five isoforms. These results indicated that SAC, SMC, and S1PC have little potential to cause drug-drug interaction due to CYP inhibition or activation in vivo, as judged by their minimal effects (IC 50 >1 mM) on the activities of five major isoforms of human CYP in vitro.
Abbott, Laurence C; Batchelor, Stephen N; Moore, John N
2013-03-07
UV-visible absorption, resonance Raman, and (1)H NMR spectroscopy, allied with density functional theory (DFT) calculations, have been used to study the structure, bonding, and alkaline hydrolysis mechanism of the cationic thiazloium azo dye, 2-[2-[4-(diethylamino)phenyl]diazenyl]-3-methyl-thiazolium (1a), along with a series of six related dyes with different 4-dialkylamino groups and/or other phenyl ring substituents (2a-c, 3a-c) and the related isothiazolium azo dye, 5-[2-[4-(dimethylamino)phenyl]diazenyl]-2-methyl-isothiazolium (4). These diazahemicyanine dyes are calculated to have a similar low-energy structure that is cis, trans at the (iso)thiazolium-azo group, and for which the calculated Raman spectra provide a good match with the experimental data; the calculations on these structures are used to assign and discuss the transitions giving rise to the experimental spectra, and to consider the bonding and its variation between the dyes. UV-visible, Raman, and NMR spectra recorded from minutes to several weeks after raising the pH of an aqueous solution of 1a to ca. 11.5 show that the dominant initial step in the reaction is loss of diethylamine to produce a quinonimine (ca. hours), with subsequent reactions occurring on longer time scales (ca. days to weeks); kinetic analyses give a rate constant of 2.6 × 10(-2) dm(3) mol(-1) s(-1) for reaction of 1a with OH(-). UV-visible spectra recorded on raising the pH of the other dyes in solution show similar changes that are attributed to the same general reaction mechanism, but with different rate constants for which the dependence on structure is discussed.
Directory of Open Access Journals (Sweden)
Li-Juan Fu
2014-01-01
Full Text Available DNA (cytosine-5- methylation silencing of GSTP1 function occurs in prostate adenocarcinoma (PCa. Previous studies have shown that there is an inverse relationship between dietary lycopene intake and the risk of PCa. However, it is unknown whether lycopene reactivates the tumor suppressor gene glutathioneS-transferase-π (GSTP1 by demethylation of the hypermethylated CpGs that act to silence the GSTP1 promoter. Here, we demonstrated that lycopene treatment significantly decreased the methylation levels of the GSTP1 promoter and increased the mRNA and protein levels of GSTP1 in an androgen-independent PC-3 cell line. In contrast, lycopene treatment did not demethylate the GSTP1 promoter or increase GSTP1 expression in the androgen-dependent LNCaP cell line. DNA methyltransferase (DNMT 3A protein levels were downregulated in PC-3 cells following lycopene treatment; however, DNMT1 and DNMT3B levels were unchanged. Furthermore, the long interspersed element (LINE-1 and short interspersed element ALU were not demethylated when treated by lycopene. In LNCaP cells, lycopene treatment did not affect any detected DNMT protein expression, and the methylation levels of LINE-1 and ALU were decreased. These results indicated that the protective effect of lycopene on the prostate is different between androgen-dependent and androgen-independent derived PCa cells. Further, in vivo studies should be conducted to confirm these promising results and to evaluate the potential role of lycopene in the protection of the prostate.
Panneerselvam, Chellasamy; Murugan, Kadarkarai; Roni, Mathath; Aziz, Al Thabiani; Suresh, Udaiyan; Rajaganesh, Rajapandian; Madhiyazhagan, Pari; Subramaniam, Jayapal; Dinesh, Devakumar; Nicoletti, Marcello; Higuchi, Akon; Alarfaj, Abdullah A; Munusamy, Murugan A; Kumar, Suresh; Desneux, Nicolas; Benelli, Giovanni
2016-03-01
Malaria remains a major public health problem due to the emergence and spread of Plasmodium falciparum strains resistant to chloroquine. There is an urgent need to investigate new and effective sources of antimalarial drugs. This research proposed a novel method of fern-mediated synthesis of silver nanoparticles (AgNP) using a cheap plant extract of Pteridium aquilinum, acting as a reducing and capping agent. AgNP were characterized by UV-vis spectrophotometry, Fourier transform infrared (FTIR) spectroscopy, energy-dispersive X-ray spectroscopy (EDX), and X-ray diffraction (XRD). Phytochemical analysis of P. aquilinum leaf extract revealed the presence of phenols, alkaloids, tannins, flavonoids, proteins, carbohydrates, saponins, glycosides, steroids, and triterpenoids. LC/MS analysis identified at least 19 compounds, namely pterosin, hydroquinone, hydroxy-acetophenone, hydroxy-cinnamic acid, 5, 7-dihydroxy-4-methyl coumarin, trans-cinnamic acid, apiole, quercetin 3-glucoside, hydroxy-L-proline, hypaphorine, khellol glucoside, umbelliferose, violaxanthin, ergotamine tartrate, palmatine chloride, deacylgymnemic acid, methyl laurate, and palmitoyl acetate. In DPPH scavenging assays, the IC50 value of the P. aquilinum leaf extract was 10.04 μg/ml, while IC50 of BHT and rutin were 7.93 and 6.35 μg/ml. In mosquitocidal assays, LC50 of P. aquilinum leaf extract against Anopheles stephensi larvae and pupae were 220.44 ppm (larva I), 254.12 ppm (II), 302.32 ppm (III), 395.12 ppm (IV), and 502.20 ppm (pupa). LC50 of P. aquilinum-synthesized AgNP were 7.48 ppm (I), 10.68 ppm (II), 13.77 ppm (III), 18.45 ppm (IV), and 31.51 ppm (pupa). In the field, the application of P. aquilinum extract and AgNP (10 × LC50) led to 100 % larval reduction after 72 h. Both the P. aquilinum extract and AgNP reduced longevity and fecundity of An. stephensi adults. Smoke toxicity experiments conducted against An. stephensi adults showed that P. aquilinum leaf-, stem-, and root-based coils
Tompkins, Avery Brooks
2014-01-01
This article adds to a small, but growing, body of work on trans sexualities and partnerships, and provides a much-needed inquiry into the complex and contested politics of desire when we take trans identities, bodies, and sexualities into account. Using digital ethnographic data from YouTube videos along with in-person observational data from LGBTQ and trans conferences in the U.S., Tompkins argues that a sex-positive trans politics cannot emerge in trans and trans-allied communities if the rhetoric of the "tranny chaser" continues to inform discourses of desire and attraction to trans people.
Methylation in hepatocellular carcinoma
Directory of Open Access Journals (Sweden)
Regina M. Santella
2007-02-01
Full Text Available <p class="MsoNormal">The development of HCC is a complex, multistep, multistage process. The molecular pathogenesis of HCC appears to involve multiple genetic aberrations in the molecular control of hepatocyte proliferation, differentiation and death and the maintenance of genomic integrity. This process is influenced by the cumulative activation and inactivation of oncogenes, tumor suppressor genes and other genes. p53, a tumor suppressor gene, is the most frequently mutated gene in human cancers. There is also a striking sequence specific binding and induction of mutations by AFB1 at codon 249 of p53 in HCC.p> <p class="MsoNormal">Epigenetic alterations are also involved in cancer development and progression. Methylation of promoter CpG islands is associated with inhibition of transcriptional initiation and permanent silencing of downstream genes.p> <p class="MsoNormal">It is now known that most important tumor suppressor genes are inactivated, not only by mutations and deletions but also by promoter methylation. Several studies indicated that p16, p15, RASSF1A, MGMT, and GSTP1 promoter hypermethylation are prevalent in HCC. In addition, geographic variation in the methylation status of tumor DNA indicates that environmental factors may influence the frequent and concordant degree of hypermethylation in multiple genes in HCC and that epigeneticenvironmental interactions may be involved in hepatocarcinogenesis. We have found significant relationships between promoter methylation and AFB1-DNA adducts confirming the impact of environmental exposures on gene methylation.
> <p class="MsoNormal">DNA isolated from serum or plasma of cancer patients frequently contains the same genetic andChakravarti, Leela J; Jarrold, Michael D; Gibbin, Emma M; Christen, Felix; Massamba-N'Siala, Gloria; Blier, Pierre U; Calosi, Piero
2016-10-01
Human-assisted, trans-generational exposure to ocean warming and acidification has been proposed as a conservation and/or restoration tool to produce resilient offspring. To improve our understanding of the need for and the efficacy of this approach, we characterized life-history and physiological responses in offspring of the marine polychaete Ophryotrocha labronica exposed to predicted ocean warming (OW: + 3°C), ocean acidification (OA: pH -0.5) and their combination (OWA: + 3°C, pH -0.5), following the exposure of their parents to either control conditions ( within-generational exposure ) or the same conditions ( trans-generational exposure ). Trans-generational exposure to OW fully alleviated the negative effects of within-generational exposure to OW on fecundity and egg volume and was accompanied by increased metabolic activity. While within-generational exposure to OA reduced juvenile growth rates and egg volume, trans-generational exposure alleviated the former but could not restore the latter. Surprisingly, exposure to OWA had no negative impacts within- or trans-generationally. Our results highlight the potential for trans-generational laboratory experiments in producing offspring that are resilient to OW and OA. However, trans-generational exposure does not always appear to improve traits and therefore may not be a universally useful tool for all species in the face of global change.
Sehat, N; Rickert, R; Mossoba, M M; Kramer, J K; Yurawecz, M P; Roach, J A; Adlof, R O; Morehouse, K M; Fritsche, J; Eulitz, K D; Steinhart, H; Ku, Y
1999-04-01
Operating from one to six silver ion-high-performance liquid chromatography (Ag+-HPLC) columns in series progressively improved the resolution of the methyl esters of conjugated linoleic acid (CLA) isomeric mixtures from natural and commercial products. In natural products, the 8 trans, 10 cis-octadecadienoic (18:2) acid was resolved from the more abundant 7 trans, 9 cis-18:2, and the 10 trans, 12 cis-18:2 was separated from the major 9 cis, 11 trans-18:2 peak. In addition, both 11 trans, 13 cis-18:2 and 11 cis, 13 trans-18:2 isomers were found in natural products and were separated; the presence of the latter, 11 cis, 13 trans-18:2, was established in commercial CLA preparations. Three Ag+-HPLC columns in series appeared to be the best compromise to obtain satisfactory resolution of most CLA isomers found in natural products. A single Ag+-HPLC column in series with one of several normal-phase columns did not improve the resolution of CLA isomers as compared to that of the former alone. The 20:2 conjugated fatty acid isomers 11 cis, 13 trans-20:2 and 12 trans, 14 cis-20:2, which were synthesized by alkali isomerization from 11 cis, 14 cis-20:2, eluted in the same region of the Ag+-HPLC chromatogram just before the corresponding geometric CLA isomers. Therefore, CLA isomers will require isolation based on chain length prior to Ag+-HPLC separation. The positions of conjugated double bonds in 20:2 and 18:2 isomers were established by gas chromatography-electron ionization mass spectrometry as their 4,4-dimethyloxazoline derivatives. The double-bond geometry was determined by gas chromatography-direct deposition-Fourier transform infrared spectroscopy and by the Ag+-HPLC relative elution order.
International Nuclear Information System (INIS)
Konakahara, T.; Wurdeman, R.L.; Gold, B.
1988-01-01
The synthesis and characterization of an N-methyl-N-nitrosourea (MNU) analogue that is covalently linked to methidium nucleus (9) is described. At 37/degrees/C in pH 8.0 buffer 9 hydrolyzes via pseudo-first-order kinetics, with a calculated t/sub 1/2/ = 77 min. By use of polyacrylamide sequencing gels the formation of piperidine-labile N 7 -methylguanine adducts from the reaction of 9 and MNU with 5'- 32 P-end-labeled DNA restriction fragments is reported. DNA methylation by 9 in 10 mM Tris buffer is enhanced with increasing ionic strength (50-200 mM NaCl), which contrasts to the inhibition of MNU-induced cleavage with increasing salt. In addition, 9 methylates all G sites equally, while MNU shows a clear preference for d(G)/sub n/ (n ≥ 3) runs and an asymmetrical methylation pattern within these G-rich regions. The results are discussed in terms of the delivery of the MNU moiety to the DNA target by a non-sequence-specific intercalation process and the subsequent hydrolytic generation of a nondiffusible alkylating intermediate
Genetically contextual effects of smoking on genome wide DNA methylation.
Dogan, Meeshanthini V; Beach, Steven R H; Philibert, Robert A
2017-09-01
Smoking is the leading cause of death in the United States. It exerts its effects by increasing susceptibility to a variety of complex disorders among those who smoke, and if pregnant, to their unborn children. In prior efforts to understand the epigenetic mechanisms through which this increased vulnerability is conveyed, a number of investigators have conducted genome wide methylation analyses. Unfortunately, secondary to methodological limitations, these studies were unable to examine methylation in gene regions with significant amounts of genetic variation. Using genome wide genetic and epigenetic data from the Framingham Heart Study, we re-examined the relationship of smoking status to genome wide methylation status. When only methylation status is considered, smoking was significantly associated with differential methylation in 310 genes that map to a variety of biological process and cellular differentiation pathways. However, when SNP effects on the magnitude of smoking associated methylation changes are also considered, cis and trans-interaction effects were noted at a total of 266 and 4353 genes with no marked enrichment for any biological pathways. Furthermore, the SNP variation participating in the significant interaction effects is enriched for loci previously associated with complex medical illnesses. The enlarged scope of the methylome shown to be affected by smoking may better explicate the mediational pathways linking smoking with a myriad of smoking related complex syndromes. Additionally, these results strongly suggest that combined epigenetic and genetic data analyses may be critical for a more complete understanding of the relationship between environmental variables, such as smoking, and pathophysiological outcomes. © 2017 Wiley Periodicals, Inc.
Other chemical constituents isolated from Solanum crinitum Lam. (Solanaceae)
Cornelius, Marli T. F.; Carvalho, Mário G. de; Silva, Tania M. S. da; Alves, Cassia C. F.; Siston, Ana P. N.; Alves, Kelly Z.; Sant'Anna, Carlos M. R.; Neto, Mario B.; Eberlin, Marcos N.; Braz-Filho, Raimundo
2010-01-01
The phytochemical investigation of Solanum crinitum Lam led to the isolation from the fruit trichomes of four flavonoids, tiliroside (1), astragalin (2), kaempferol (3), biochanin A-7-O-β-D-apiofuranosyl-(1→5)-β-D-apiofuranosyl-(1→6)-β-D-glucopyranoside (7), along with 4-hydroxybenzoic acid (12), and four cinnamic acid derivatives, cis- and trans- coumaric acids (10 and 11) and cis- and trans- ethyl coumarate (8 and 9). Three tri-glycosyl-steroidal alkaloids, solama...
Directory of Open Access Journals (Sweden)
Gregory T. Sigurdson
2018-03-01
Full Text Available The color expression of anthocyanins can be affected by a variety of environmental factors and structural characteristics. Anthocyanin acylation (type and number of acids is known to be key, but the influence of acyl isomers (with unique stereochemistries remains to be explored. The objective of this study was to investigate the effects of cis–trans configuration of the acylating group on the spectral and colorimetric properties of anthocyanins. Petunidin-3-rutinoside-5-glucoside (Pt-3-rut-5-glu and Delphinidin-3-rutinoside-5-glucoside (Dp-3-rut-5-glu and their cis and trans coumaroylated derivatives were isolated from black goji and eggplant, diluted in pH 1–9 buffers, and analyzed spectrophotometrically (380–700 nm and colorimetrically (CIELAB during 72 h of storage (25 °C, dark. The stereochemistry of the acylating group strongly impacted the spectra, color, and stability of the Dp and Pt anthocyanins. Cis acylated pigments exhibited the greatest λmax in all pH, as much as 66 nm greater than their trans counterparts, showing bluer hues. Cis acylation seemed to reduce hydration across pH, increasing color intensity, while trans acylation generally improved color retention over time. Dp-3-cis-p-cou-rut-5-glu exhibited blue hues even in pH 5 (C*ab = 10, hab = 256° where anthocyanins are typically colorless. Cis or trans double bond configurations of the acylating group affected anthocyanin spectral and stability properties.
Highly stereocontrolled synthesis of trans-enediynes via carbocupration of fluoroalkylated diynes
Directory of Open Access Journals (Sweden)
Tsutomu Konno
2012-12-01
Full Text Available Treatment of readily prepared (Z-6-benzyloxy-1,1,1,2-tetrafluoro-6-methyl-2-hepten-4-yne with 1.5 equiv of LHMDS in −78 °C for 1 h gave the corresponding trifluoromethylated diyne in an excellent yield. This diyne was found to be a good substrate for the carbocupration with various higher-ordered cyanocuprates to give the corresponding vinylcuprates in a highly regio- and stereoselective manner. The in situ generated vinylcuprates could react very smoothly with an excess amount of iodine, the vinyl iodides being obtained in high yields. Thus-obtained iodides underwent a very smooth Sonogashira cross-coupling reaction to afford various trans-enediynes in high yields.
Energy Technology Data Exchange (ETDEWEB)
Santos, Fernanda G.; Bonkovoski, Leticia C.; Witt, Maria A.; Rubira, Adley F.; Muniz, Edvani C. [Universidade Estadual de Maringa (GMPC/UEM), Maringa, PR (Brazil). Grupo de Materiais Polimericos e Compositos; Piai, Juliana F., E-mail: jupiai@yahoo.com.br [Universidade Estadual de Maringa (UEM), Umuarama, PR (Brazil)
2015-07-01
The present work comprises the fabrication of nanofiber meshes of polycaprolactone (PCL)/poly [(2-dimethylamino) ethyl methacrylate] (PDMAEMA) and the subsequent immobilization of silver nanoparticles, in order to obtain materials with potential application in tissue engineering. The nanofibers composed of different ratios of PDMAEMA / PCL (m/m) were obtained by electrospinning. These nanofiber meshes were then immersed in colloidal suspensions containing the AgNPs under different pH values to immobilize the nanoparticles onto the fiber's surface. A greater amount of AgNPs was deposited when the fibers were immersed in a solution of pH 5, as one can observe from the scanning electron microscopy (SEM) images and the X-ray spectroscopy (EDS) spectra. It was observed that the meshes of the blends suffered morphological changes after immersion in acid solution (pH 5), and, the deposition of AgNPs onto the meshes in general was more effective in acid environment (pH 5). (author)
p16(INK4a) promoter methylation and protein expression in breast fibroadenoma and carcinoma.
Di Vinci, Angela; Perdelli, Luisa; Banelli, Barbara; Salvi, Sandra; Casciano, Ida; Gelvi, Ilaria; Allemanni, Giorgio; Margallo, Edoardo; Gatteschi, Beatrice; Romani, Massimo
2005-04-10
The potential role of p16(INK4a) methylation in breast cancer is controversial whereas there are no data on fibroadenoma. To assess if inactivation of p16(INK4a) by promoter hypermethylation occurs in this hyperproliferative benign breast lesion or, on the contrary, it is strictly related to the carcinogenic process, we have tested the different histological components of 15 cases of fibroadenoma and the intraductal and infiltrating components of 15 cases of carcinoma and their adjacent non-tumoral epithelium. All samples were obtained by laser-assisted microdissection. The relationship between promoter methylation status, immunohistochemical protein expression and ki67 proliferative activity was evaluated for each lesion. Our data demonstrate that hypermethylation of p16(INK4a) promoter is a common event occurring at similar frequency in all the different histological areas of the benign and malignant breast lesions taken into exam. Conversely, protein p16 expression, although heterogeneously distributed within the section, is considerably higher in breast carcinoma as compared to fibroadenoma in both tumoral and non-tumoral epithelia and stroma. The protein localization was almost exclusively nuclear in fibroadenoma and non-tumoral epithelia whereas, in carcinoma, the staining was both nuclear and cytoplasmic or cytoplasmic alone. Furthermore, in a subset of fibroadenoma with higher proliferative activity, p16 protein expression was substantially decreased as compared to those showing lower proliferation. We did not observe this association in carcinomas. Our data demonstrate that the hypermethylation of the p16(INK4a) promoter is not specifically associated with malignancy and that, on the contrary, the overexpression of p16 and its cytoplasmic sequestration is a feature of breast carcinoma. (c) 2004 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Ivan V. Shamanaev
2017-11-01
Full Text Available The Ni2P/SiO2 catalyst, which was prepared by in situ temperature-programmed reduction and in the mixture with the inert (SiC, SiO2 or acidic (γ-Al2O3 material was studied in methyl palmitate hydrodeoxygenation (HDO. Methyl palmitate HDO was carried out at temperatures of 270–330 °C, H2/feed volume ratio of 600 Nm3/m3, and H2 pressure of 3.0 MPa. Ni2P/SiO2 catalyst, diluted with γ-Al2O3 showed a higher activity than Ni2P/SiO2 catalyst diluted with SiC or SiO2. The conversion of methyl palmitate increased significantly in the presence of γ-Al2O3 most probably due to the acceleration of the acid-catalyzed reaction of ester hydrolysis. The synergism of Ni2P/SiO2 and γ-Al2O3 in methyl palmitate HDO can be explained by the cooperation of the metal sites of Ni2P/SiO2 and the acid sites of γ-Al2O3 in consecutive metal-catalyzed and acid-catalyzed reactions of HDO. The obtained results let us conclude that the balancing of metal and acid sites plays an important role in the development of the efficient catalyst for the HDO of fatty acid esters over supported phosphide catalysts.
Salimi, Alireza; Sharifi, Guive; Bahrani, Houshang; Mohajerani, Seyed A; Jafari, Alireza; Safari, Farhad; Jalessi, Maryam; Mirkheshti, Alireza; Mottaghi, Kamran
2017-02-01
Excessive bleeding is an unwanted complication of trans-sphenoidal resection of pituitary adenoma due to increases in intracranial pressure (ICP) and hemodynamic instability. Dexmedetomidine (Dex) anα2-agonists is the drug of choice in intensive care units (ICU) and cardiac surgeries to control abrupt changes in hemodynamic. Severe cardiovascular responses occur during trans-sphenoidal resection (TSR) of the pituitary adenoma despite adequate depth of anesthesia. The aim of this paper was to determine the effect of Dexmedetomidine on bleeding as primary outcome, and surgeon's satisfaction and hemodynamic stability as secondary outcomes in patients undergoing trans-sphenoidal resection of pituitary adenoma. Total numbers of 60 patients between 18-65 years old and candidate for elective trans-sphenoidal resection of pituitary adenoma were randomLy allocated to two groups; Dexmedetomidine infusion (0.6µg/kg/hour) or normal saline infusion. Mean arterial pressure (MAP), heart rate (HR), dose of hypnotics and narcotics during surgery, bleeding, and surgeon's satisfaction were recorded. Propofol maintenance dose (µg/kg/min) and total Fentanyl use (µg) were significantly lower in Dex group compare to control group (P=0.01 and 0.003, respectively). Total bleeding amount during operation in Dex group was significantly lower than control group (P=0.012). Surgeon's satisfaction was significantly higher in Dex group at the end of surgery. MAP and heart rate throughout surgery were significantly lower in Dex group compare to control group (P=0.001). Dexmedetomidine infusion (0.6µg/kg/hour) could reduce bleeding and provide surgeon's satisfaction during trans-sphenoidal resection of pituitary adenoma.
International Nuclear Information System (INIS)
Liu, Yang; Gao, Weimin; Siegfried, Jill M; Weissfeld, Joel L; Luketich, James D; Keohavong, Phouthone
2007-01-01
Epidemiological studies indicate that some characteristics of lung cancer among never-smokers significantly differ from those of smokers. Aberrant promoter methylation and mutations in some oncogenes and tumor suppressor genes are frequent in lung tumors from smokers but rare in those from never-smokers. In this study, we analyzed promoter methylation in the ras-association domain isoform A (RASSF1A) and the death-associated protein kinase (DAPK) genes in lung tumors from patients with primarily non-small cell lung cancer (NSCLC) from the Western Pennsylvania region. We compare the results with the smoking status of the patients and the mutation status of the K-ras, p53, and EGFR genes determined previously on these same lung tumors. Promoter methylation of the RASSF1A and DAPK genes was analyzed by using a modified two-stage methylation-specific PCR. Data on mutations of K-ras, p53, and EGFR were obtained from our previous studies. The RASSF1A gene promoter methylation was found in tumors from 46.7% (57/122) of the patients and was not significantly different between smokers and never-smokers, but was associated significantly in multiple variable analysis with tumor histology (p = 0.031) and marginally with tumor stage (p = 0.063). The DAPK gene promoter methylation frequency in these tumors was 32.8% (40/122) and did not differ according to the patients' smoking status, tumor histology, or tumor stage. Multivariate analysis adjusted for age, gender, smoking status, tumor histology and stage showed that the frequency of promoter methylation of the RASSF1A or DAPK genes did not correlate with the frequency of mutations of the K-ras, p53, and EGFR gene. Our results showed that RASSF1A and DAPK genes' promoter methylation occurred frequently in lung tumors, although the prevalence of this alteration in these genes was not associated with the smoking status of the patients or the occurrence of mutations in the K-ras, p53 and EGFR genes, suggesting each of
TransAlta: More than a utility
International Nuclear Information System (INIS)
Mikalson, D.A.
1991-01-01
TransAlta Utilities Corporation is Canada's largest privately owned utility and is also a major coal mining company. In 1989, TransAlta produced 20.9% of all coal mined in Canada. A brief history of TransAlta is presented along with TransAlta's present coal operations and plans for the next three years. An overview is presented of how TransAlta Fuel Supply is organized to utilize contracted mining operation, engineering and environmental services and in-house capabilities. Recent strategic initiatives to improve organizational efficiency and the mining operations are discussed. These range from developing a common departmental vision to modifying major mining equipment. TransAlta's proactive role in clean coal combustion such as low NOx-SOx burner, integrated combined cycle gasification, and other energy research projects is reviewed. A summary is provided of recent participation of TransAlta in environmental management initiatives. Recent successes of TransAlta's unregulated subsidiary in the development of cogeneration facilities and the future of this area of business are discussed. 8 refs., 4 figs
Zhao, Sha; Zhang, Zhena; Zhu, Kongying; Chen, Jixiang
2017-05-01
A series of Ni2P/AlMCM-41-x bifunctional catalysts with different Si/Al ratios (x) were synthesized by in situ phosphorization of Ni/AlMCM-41-x with triphenylphosphine (nominal Ni/P ratio of 0.75) at 300 °C on a fixed-bed reactor. For comparison, NiP/AlMCM-41-5-TPR was also prepared by the TPR method from the supported nickel phosphate with the Ni/P ratio of 1.0, during which metallic Ni rather than Ni2P formed. TEM images show that Ni and Ni2P particles uniformly distributed in Ni2P/AlMCM-41-x and NiP/AlMCM-41-5-TPR. The Ni2P/AlMCM-41-x acidity increased with decreasing the Si/Al ratio. In the hydroconversion of methyl laurate, the conversions were close to 100% on all catalysts at 360 °C, 3.0 MPa, methyl laurate WHSV of 2 h-1 and H2/methyl laurate ratio of 25. As to Ni2P/AlMCM-41-x, with decreasing the Si/Al ratio, the total selectivity to C11 and C12 hydrocarbons decreased, while the total selectivity to isoundecane and isododecane (Si-C11+i-C12) firstly increased and then decreased. Ni2P/AlMCM-41-5 gave the largest Si-C11+i-C12 of 43.2%. While NiP/AlMCM-41-5-TPR gave higher Si-C11+i-C12 than Ni2P/AlMCM-41-5, it was more active for the undesired Csbnd C bond cleavage and methanation. We propose that the in-situ phosphorization adopted here is a promising approach to preparing Ni2P-based bifunctional catalysts.
Kathirvel, Poonkodi; Ravi, Subban
2012-01-01
This study examines the chemical composition and in vitro anticancer activity of the essential oil from Ocimum basilicum Linn. (Lamiaceae), cultivated in the Western Ghats of South India. The chemical compositions of basil fresh leaves were identified by GC-MS: 11 components were identified. The major constituents were found to be methyl cinnamate (70.1%), linalool (17.5%), β-elemene (2.6%) and camphor (1.52%). The results revealed that this plant may belong to the methyl cinnamate and linalool chemotype. A methyl thiazol tetrazolium assay was used for in vitro cytotoxicity screening against the human cervical cancer cell line (HeLa), human laryngeal epithelial carcinoma cell line (HEp-2) and NIH 3T3 mouse embryonic fibroblasts. The IC(50) values obtained were 90.5 and 96.3 µg mL(-1), respectively, and the results revealed that basil oil has potent cytotoxicity.
Patient radiation exposure in right versus left trans-radial approach for coronary procedures
Energy Technology Data Exchange (ETDEWEB)
Rigattieri, Stefano; Di Russo, Cristian; Cera, Maria; Fedele, Silvio; Sciahbasi, Alessandro [Interventional Cardiology Unit, Sandro Pertini Hospital, Rome (Italy); Pugliese, Francesco Rocco [Emergency Department Sandro Pertini Hospital, Rome (Italy)
2015-01-15
Objectives: The aim of this study was to compare radiation exposure, assessed by dose-area product (DAP), in right trans-radial approach (RR) versus left trans-radial approach (LR) for coronary procedures. Background: In LR the catheter course is more similar to trans-femoral approach, thus allowing an easier negotiation of coronary ostia which, in turn, might translate into reduced fluoroscopy time (FT) and radiation exposure as compared to RR. Methods: We retrospectively selected diagnostic and interventional procedures (PCI) performed by RR or LR at our center from May 2009 to May 2014. We only included in the analysis the procedures in which DAP values were available. Results: We analyzed 1464 procedures, 1175 of which performed by RR (80.3%) and 289 by LR (19.7%). Median DAP values were significantly higher in RR as compared to LR for diagnostic and interventional procedures (4482 vs. 3540 cGy.cm{sup 2} and 11523 vs. 10086 cGy.cm{sup 2}, respectively; p < 0.05). No significant differences were observed in FT and in contrast volume (CV). In the propensity-matched cohort, consisting of 269 procedures for each group, no significant differences between LR and RR were observed in median DAP values for both diagnostic and interventional procedures (3990 vs. 3542 cGy.cm{sup 2} and 9964 vs. 10216 cGy.cm{sup 2}, respectively; p = ns); FT and CV were also similar. At multiple linear regression analysis laterality of trans-radial approach was not associated with DAP. Conclusions: In an experienced trans-radial center LR is not associated with a reduction in radiation exposure, FT or CV as compared to RR. - Highlights: • Right trans-radial approach is by far more commonly used than left trans-radial approach. • Left trans-radial approach has the advantage of an easier catheter manipulation, more similar to trans-femoral approach. • This could reduce fluoroscopy time and radiation exposure. • We conducted a retrospective study to investigate patient radiation
Amano, Hirotaka; Kazamori, Daichi; Itoh, Kenji
2016-11-01
1. Pharmacokinetics and N-acetylation metabolism of S-methyl-L-cysteine (SMC) and trans-S-1-propenyl-L-cysteine (S1PC) were examined in rats and dogs. SMC and S1PC (2-5 mg/kg) were well absorbed in both species with high bioavailability (88-100%). 2. SMC and S1PC were excreted only to a small extent in the urine of rats and dogs. The small renal clearance values (l/h/kg) indicated the extensive renal reabsorption of SMC and S1PC, which potentially contributed to their long elimination half-lives (>5 h) in dogs. 3. S1PC, but not SMC, underwent N-acetylation extensively in vivo, which can be explained by the relative activities of N-acetylation of S1PC/SMC and deacetylation of their N-acetylated forms, N-acetyl-S1PC/N-acetyl-SMC, in the liver and kidney in vitro. The activities for S1PC N-acetylation were similar to or higher than those for N-acetyl-S1PC deacetylation in liver S9 fractions of rat and dog, whereas liver and kidney S9 fractions of rat and dog had little activity for SMC N-acetylation or considerably higher activities for N-acetyl-SMC deacetylation. 4. Our study demonstrated that the pharmacokinetics of SMC and S1PC in rats and dogs was characterized by high bioavailability and extensive renal reabsorption; however, the extent of undergoing the N-acetylation metabolism was extremely different between SMC and S1PC.
Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...
Synthesis of NMP, a Fluoxetine (Prozac) Precursor, in the Introductory Organic Laboratory
Perrine, Daniel M.; Sabanayagam, Nathan R.; Reynolds, Kristy J.
1998-10-01
A synthesis of the immediate precursor of the widely used antidepressant fluoxetine (Prozac) is described. The procedure is short, safe, and simple enough to serve as a laboratory exercise for undergraduate students in the second semester of introductory organic chemistry and is one which will be particularly interesting to those planning a career in the health sciences. The compound synthesized is (°)-N,N-dimethyl-3-(p-trifluoromethylphenoxy)-3-phenylpropylamine, or "N-methyl Prozac" (NMP). The synthesis of NMP requires one two-hour period and a second three-hour period. In the first period, a common Mannich base, 3-dimethylaminopropiophenone, is reduced with sodium borohydride to form (°)-3-dimethylamino-1-phenylpropanol. In the second period, potassium t-butoxide is used to couple (°)-3-dimethylamino-1-phenylpropanol with p-chlorotrifluoromethylbenzene to form NMP, which is isolated as its oxalate salt. All processes use equipment and materials that are inexpensive and readily available in most undergraduate laboratories. Detailed physical data are given on NMP, including high-field DEPT 13C NMR.
Influences of cinnamic aldehydes on H⁺ extrusion activity and ultrastructure of Candida.
Shreaz, Sheikh; Bhatia, Rimple; Khan, Neelofar; Muralidhar, Sumathi; Manzoor, Nikhat; Khan, Luqman Ahmad
2013-02-01
The antifungal effects of cinnamaldehyde, 4-hydroxy-3-methoxycinnamaldehyde (coniferyl aldehyde) and 3,5-dimethoxy-4-hydroxycinnamaldehyde (sinapaldehyde) were investigated against 65 strains of Candida (six standard, 39 fluconazole-sensitive and 20 fluconazole-resistant). MICs of cinnamaldehyde, coniferyl aldehyde and sinapaldehyde ranged from 100 to 500 µg ml(-1), 100 to 300 µg ml(-1) and 100 to 200 µg ml(-1), respectively. All tested isolates showed a marked sensitivity towards these aldehydes in spot and time-kill assays. Sinapaldehyde was found to be the most effective, followed by coniferyl aldehyde and cinnamaldehyde. At their respective MIC(90) values, the three compounds caused mean inhibition levels of glucose-stimulated H(+)-efflux of 36, 34 and 41 % (cinnamaldehyde), 41, 42 and 47 % (coniferyl aldehyde) and 43, 45 and 51 % (sinapaldehyde) for standard-sensitive, clinical-sensitive and clinical-resistant isolates, respectively. Inhibition levels of H(+)-efflux caused by plasma membrane ATPase inhibitors N,N'-dicyclohexylcarbodiimide (100 µM) and diethylstilbestrol (10 µM) were 34, 45 and 44 %, and 57, 39 and 35 %, for standard-sensitive, clinical-sensitive and clinical-resistant isolates, respectively. Intracellular pH (pHi) was found to decrease by 0.34, 0.42 and 0.50 units following incubation with three tested aldehydes from the control pHi of 6.70. Scanning electron microscopy and transmission electron microscopy analysis was performed on a representative strain, C. albicans 10261, showing alterations in morphology, cell wall, plasma membrane damage and lysis. Haemolytic activity of the three compounds varied from 10 to 15 % at their highest MIC compared to an activity level of 20 % shown by fluconazole at 30 µg ml(-1). In conclusion, this study shows significant activity of cinnamic aldehydes against Candida, including azole-resistant strains, suggesting that these molecules can be developed as antifungals.
Better faster cheaper: TransCanada PipeLines Ltd. 2000 annual report
International Nuclear Information System (INIS)
2000-01-01
Financial information from TransCanada was presented along with a review of their operations throughout 2000, including a summary of actions in the area of management, strategy, and policy. The company's efforts in 2000 were directed at restoring and strengthening their financial position by strengthening their balance sheet, restoring earnings, establishing a growth platform for future earnings and positioning the company with discretionary cash flow. In 2000, TransCanada substantially completed its divestiture program and sold assets for proceeds of nearly $3.4 billion. These proceeds have been used mainly to reduce debt and associated financial charges. TransCanada also made successful bids in Alberta's power auctions, increased ownership in Ocean State power and TransCanada Power, L.P. In addition, the company began development of two new power plants in Alberta. These initiatives are expected to contribute to an increase in earnings. tabs., figs
Directory of Open Access Journals (Sweden)
Aisa Ghaffarzad
2014-07-01
Full Text Available Trans fatty acids are considered to be the important modifiable factor of the ovulatory infertility disorder. The purpose of this study was to test the hypothesis that higher trans fatty acids of erythrocytes (RBC are associated with the risk of ovulatory infertility disorder in polycystic ovarian syndrome (PCOS. Thirty five infertile women with polycystic ovarian syndrome, defined by AES criteria and 29 age-matched healthy women as a control group were recruited for the study. After physical measurements and nutritional assessment, blood samples were collected. Fasting serum glucose and insulin were measured, and then insulin resistance was calculated by homeostasis model assessment (HOMA-IR. Erythrocyte fatty acids were measured by gas chromatography. The patients group had higher waist circumference (WC, insulin levels, HOMA-IR than controls (p< 0.05. Also, case group had lower percentage of normal BMI (BMI<25, physical activity and education levels than healthy women (p< 0.05. Among RBC trans fatty acids only trans linoleate (18:2t were significantly higher in case group than control women (p= 0.019. PCOS group tended to consume more food rich in TFAs than the control group. Logistic regression analysis also showed that only 18:2t is positively associated with risk of ovulatory disorder infertility in PCOS (OR= 1.225, 95% CI. 1.024-1.465; P= 0.026, which was not affected after adjustment for BMI, physical activity and education levels. The results suggested that RBC trans fatty acids might be a predictor of increased risk for ovulatory infertility disorder in women with PCOS.
Trans fat is a type of dietary fat . Of all the fats, trans fat is the worst for your health. Too much ... from solid margarine to soft margarine. Ask what type of fats foods are cooked in when you eat out ...
Merola, Joseph S.; Franks, Marion A.
2015-01-01
The crystal structures of two solvates of fac-tri-chlorido-tris-(tri-methyl-phosphane-κP)rhodium(III) are reported, i.e. one with water in the crystal lattice, fac-[RhCl3(Me3P)3]·H2O, and one with methanol in the crystal lattice, fac-[RhCl3(Me3P)3]·0.5CH3OH. These rhodium compounds exhibit distorted octahedral coordination spheres at the metal and are isotypic with the analogous iridium compounds previously reported by us [Merola et al. (2013 ▶). Polyhedron, 54, 67-73]. Comparison is made bet...
A prospective study of trans fat intake and risk of preeclampsia in Denmark
DEFF Research Database (Denmark)
Chavarro, J. E.; Halldorsson, T. I.; Leth, Torben
2011-01-01
Association of intake of trans fatty acids in the 2nd trimester of pregnancy with risk of preeclampsia was studied by following 67 186 pregnancies of women participating in the Danish National Birth Cohort between 1998 and 2003. Diet was assessed with a food frequency questionnaire at gestation wk...... 25; preeclampsia diagnosis was obtained by linkage with the Danish National Patient Registry. 1804 cases of preeclampsia and 402 cases of severe preeclampsia were identified in the cohort. Intake of trans fats decreased during the study period as a consequence of reduction in industrial trans fat...... intake. Intake of trans fats in the 2nd trimester was unrelated to risk of preeclampsia or severe preeclampsia. Relative risk (95% confidence interval; P, trend) of preeclampsia and severe preeclampsia comparing top to bottom quintiles of trans fat intake were 0.95 (0.81; 1.11, 0.33) and 1.07 (0.78; 1...
Methylation signature of lymph node metastases in breast cancer patients
International Nuclear Information System (INIS)
Barekati, Zeinab; Radpour, Ramin; Lu, Qing; Bitzer, Johannes; Zheng, Hong; Toniolo, Paolo; Lenner, Per; Zhong, Xiao Yan
2012-01-01
Invasion and metastasis are two important hallmarks of malignant tumors caused by complex genetic and epigenetic alterations. The present study investigated the contribution of aberrant methylation profiles of cancer related genes, APC, BIN1, BMP6, BRCA1, CST6, ESR-b, GSTP1, P14 (ARF), P16 (CDKN2A), P21 (CDKN1A), PTEN, and TIMP3, in the matched axillary lymph node metastasis in comparison to the primary tumor tissue and the adjacent normal tissue from the same breast cancer patients to identify the potential of candidate genes methylation as metastatic markers. The quantitative methylation analysis was performed using the SEQUENOM’s EpiTYPER™ assay which relies on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). The quantitative DNA methylation analysis of the candidate genes showed higher methylation proportion in the primary tumor tissue than that of the matched normal tissue and the differences were significant for the APC, BIN1, BMP6, BRCA1, CST6, ESR-b, P16, PTEN and TIMP3 promoter regions (P<0.05). Among those candidate methylated genes, APC, BMP6, BRCA1 and P16 displayed higher methylation proportion in the matched lymph node metastasis than that found in the normal tissue (P<0.05). The pathway analysis revealed that BMP6, BRCA1 and P16 have a role in prevention of neoplasm metastasis. The results of the present study showed methylation heterogeneity between primary tumors and metastatic lesion. The contribution of aberrant methylation alterations of BMP6, BRCA1 and P16 genes in lymph node metastasis might provide a further clue to establish useful biomarkers for screening metastasis
International Nuclear Information System (INIS)
Christopher, R.J.
1986-01-01
The cis and trans isomers of the synthetic pyrethroid, resmethrin (5-benzyl-3-furylmethyl-(IRS)-chrysanthemate), labeled with radiocarbon in either the alcohol or acid moiety, were individually administered orally to White Leghorn laying hens at a dosage of 10 mg/kg. With each isomer and label position, greater than 90% of the radiocarbon was eliminated in the excreta within 24 hours posttreatment. Radiocarbon residues in the egg white and yolk fractions were low, with peak levels observed at 1-2 and 4-5 days post-treatment in white and yolk, respectively. Residues were considerably lower in egg whites than in yolks. In birds killed 12 hours post-treatment, radiocarbon residues in tissues were low with peak levels in liver and kidney. Unmetabolized cis- or trans-resmethrin was detected in all tissues analyzed from birds killed at 12 hours post-treatment and represented the major metabolite in fat. The majority of the tissues from hens 14 days post-treatment contained no detectable levels of radiocarbon and would appear not to be indicative of appreciable residue retention. Numerous metabolites were isolated and were present in both the free and conjugated form. The metabolic routes for both resmethrin isomers arise from ester hydrolysis and oxidation of the hydrolytic products. Certain of these metabolites are further conjugated with glucuronic acid, sulfate or other unidentified compounds before excretion
Lawley, P. D.; Orr, D. J.; Shah, S. A.; Farmer, P. B.; Jarman, M.
1973-01-01
1. DNA was treated with N-methyl-N-nitrosourea at pH7–8, 37°C, degraded to yield 3- and 7-methylpurines and deoxyribonucleosides and the reaction products were separated by chromatography on ion-exchange resins. The following methods for identification and determination of products were used: with unlabelled N-methyl-N-nitrosourea, u.v. absorption; use of methyl-14C-labelled N-methyl-N-nitrosourea and use of [14C]thymine-labelled DNA. 2. The synthesis of O4-methylthymidine and its identification by u.v. and mass spectroscopy are reported. 3. 3-Methylthymidine and O4-methylthymidine were found as methylation products from N-methyl-N-nitrosourea with thymidine and with DNA, in relatively small yields. Unidentified products containing thymine were found in enzymic digests of N-methyl-N-nitrosourea-treated DNA, which may be phosphotriesters. 4. The possible role of formation of methylthymines in mutagenesis by N-methyl-N-nitrosourea is discussed. PMID:4798180
Gas chromatography-vacuum ultraviolet spectroscopy for analysis of fatty acid methyl esters.
Fan, Hui; Smuts, Jonathan; Bai, Ling; Walsh, Phillip; Armstrong, Daniel W; Schug, Kevin A
2016-03-01
A new vacuum ultraviolet (VUV) detector for gas chromatography was recently developed and applied to fatty acid methyl ester (FAME) analysis. VUV detection features full spectral acquisition in a wavelength range of 115-240nm, where virtually all chemical species absorb. VUV absorption spectra of 37 FAMEs, including saturated, monounsaturated, and polyunsaturated types were recorded. Unsaturated FAMEs show significantly different gas phase absorption profiles than saturated ones, and these classes can be easily distinguished with the VUV detector. Another advantage includes differentiating cis/trans-isomeric FAMEs (e.g. oleic acid methyl ester and linoleic acid methyl ester isomers) and the ability to use VUV data analysis software for deconvolution of co-eluting signals. As a universal detector, VUV also provides high specificity, sensitivity, and a fast data acquisition rate, making it a powerful tool for fatty acid screening when combined with gas chromatography. The fatty acid profile of several food oil samples (olive, canola, vegetable, corn, sunflower and peanut oils) were analyzed in this study to demonstrate applicability to real world samples. Copyright © 2015 Elsevier Ltd. All rights reserved.
Were policies in Brazil effective to reducing trans fat from industrial origin in foods?
Dias, Flávia da Silva Lima; Lima, Mário Ferreira; Velasco, Patricia Coelho de; Salles-Costa, Rosana; Sardinha, Fátima Lúcia de Carvalho; Carmo, Maria das Graças Tavares do
2018-04-09
To determine the trans fatty acids content of processed foods frequently consumed by adults living in a Rio de Janeiro, Brazil, after the enactment of a mandatory trans fatty acids labelling policy. Between February 2014 and January 2015, a specifically dietary questionnaire was completed by 107 adults to assess the frequency of processed foods consumption. The most commonly consumed products from the survey, including vegetable oils, margarine, biscuits, snacks, cheese bread (pão de queijo), french fries, cheeseburger and ice cream, were then analyzed for their trans fatty acids content using gas chromatography with a flame ionization detector. Differences in the levels of trans fatty acids were observed among 22 products analyzed, considering that trans fatty acids content ranged between 0.0 g/100 g in samples of cream cracker biscuit 1 and olive oil to 0.83 g/100 g in samples of cheeseburger (fast food), 0.51 g/100 g in samples of frozen pão de queijo and 12.92 g/100 g in samples of chocolate sandwich cookies with cream filling 2. The overall trans fatty acids content of the different samples of margarine brands was 0.20 g/100 g for brand 1 and 0.0 g/100 g for brand 2. These data are significantly lower than those observed in a survey conducted in 2003, when the regulation had been enacted. Our data indicate that Brazilian regulation is very likely implicated in the observed drop in trans fatty acids of the most processed foods but has yet to eliminate them, which reinforces the urgent need to revise the legislation, since a minimum amount of trans fat does not mean that the food product does not contain this type of fat.
Were policies in Brazil effective to reducing trans fat from industrial origin in foods?
Directory of Open Access Journals (Sweden)
Flávia da Silva Lima Dias
2018-04-01
Full Text Available ABSTRACT OBJECTIVE To determine the trans fatty acids content of processed foods frequently consumed by adults living in a Rio de Janeiro, Brazil, after the enactment of a mandatory trans fatty acids labelling policy. METHODS Between February 2014 and January 2015, a specifically dietary questionnaire was completed by 107 adults to assess the frequency of processed foods consumption. The most commonly consumed products from the survey, including vegetable oils, margarine, biscuits, snacks, cheese bread (pão de queijo, french fries, cheeseburger and ice cream, were then analyzed for their trans fatty acids content using gas chromatography with a flame ionization detector. RESULTS Differences in the levels of trans fatty acids were observed among 22 products analyzed, considering that trans fatty acids content ranged between 0.0 g/100 g in samples of cream cracker biscuit 1 and olive oil to 0.83 g/100 g in samples of cheeseburger (fast food, 0.51 g/100 g in samples of frozen pão de queijo and 12.92 g/100 g in samples of chocolate sandwich cookies with cream filling 2. The overall trans fatty acids content of the different samples of margarine brands was 0.20 g/100 g for brand 1 and 0.0 g/100 g for brand 2. These data are significantly lower than those observed in a survey conducted in 2003, when the regulation had been enacted. CONCLUSIONS Our data indicate that Brazilian regulation is very likely implicated in the observed drop in trans fatty acids of the most processed foods but has yet to eliminate them, which reinforces the urgent need to revise the legislation, since a minimum amount of trans fat does not mean that the food product does not contain this type of fat.
Jana, Sankar; Dalapati, Sasanka; Ghosh, Shalini; Kar, Samiran; Guchhait, Nikhil
2011-07-01
The excited state intramolecular charge transfer process in donor-chromophore-acceptor system 5-(4-dimethylamino-phenyl)-penta-2,4-dienenitrile (DMAPPDN) has been investigated by steady state absorption and emission spectroscopy in combination with Density Functional Theory (DFT) calculations. This flexible donor acceptor molecule DMAPPDN shows dual fluorescence corresponding to emission from locally excited and charge transfer state in polar solvent. Large solvatochromic emission shift, effect of variation of pH and HOMO-LUMO molecular orbital pictures support excited state intramolecular charge transfer process. The experimental findings have been correlated with the calculated structure and potential energy surfaces based on the Twisted Intramolecular Charge Transfer (TICT) model obtained at DFT level using B3LYP functional and 6-31+G( d, p) basis set. The theoretical potential energy surfaces for the excited states have been generated in vacuo and acetonitrile solvent using Time Dependent Density Functional Theory (TDDFT) and Time Dependent Density Functional Theory Polarized Continuum Model (TDDFT-PCM) method, respectively. All the theoretical results show well agreement with the experimental observations.
Nie, Ziyang; Zhang, Zhena; Chen, Jixiang
2017-10-01
SiO2 supported bifunctional MoP catalysts modified with different metal promoters (Ni, Ru, Pd, Pt), where Mo/Ni and Mo/M(M = Ru, Pd and Pt) atomic ratios was respectively 10 and 40, were prepared by TPR method from the phosphate precursors. It was found that the introduction of metal promoters facilitated the reduction of phosphate precursor and enhanced the dispersion of MoP. However, the MoP catalyst acidity was scarcely influenced by the small amount of metal promoters. In the hydroconversion of methyl laurate, the promoters enhanced the MoP catalyst activity for conversion of methyl laurate and hydrogenation of alkenes (intermediate), but reduced isomerization ability. Among the promoters, Ru was an optimum to decrease selectivity to alkenes while maintain high selectivity to iso-alkanes, and Mo40RuP showed better stability than MoP. At 380 °C and 3.0 MPa, the conversion of methyl laurate, the total selectivity to C11 and C12 hydrocarbons and the selectivity to iso-alkanes maintained at 100%, ∼94% and ∼30% on Mo40RuP during 102 h, respectively. The good stability of Mo40RuP is ascribed to that the presence of Ru prevented the sintering of MoP particles and suppressed carbon deposition.
Gaál, J; Batke, J; Borsodi, A; Rózsa, L; Somogyi, G
1989-01-01
A new family of tricyclic compounds, the dibenzodioxazocines were synthesized. These compounds were the following: 2-chloro-12-(2-piperidino-ethyl)-dibenzo d,g 1,3,6 dioxazocine hydrochloride: EGYT-2347, 2-chloro-12-(3-dimethylamino-2-methyl-propyl)-dibenzo [d,g] [1,3,6]-dibenzodioxazocine hydrochloride: EGYT-2509, 2-chloro-12-(3-dimethylamino-propyl)-dibenzo [d,g] [1,3,6] dioxazocine-maleate: EGYT-2474 and 2-chloro-12-2-(4-methyl-piperazino)-ethyl-dibenzo [d,g] [1,3,6]-dioxazocine-dihydrochloride: EGYT-2541. These compounds are inhibitors of both butyryl- and acetylcholinesterase to and they exhibited relatively good anticholinergic properties in receptor binding experiments. The most selective inhibitor of butyrylcholinesterase is the compound EGYT-2347 (Ki = 1.5 x 10(-7) M) which strongly binds to rat brain muscarinic cholinergic receptor (KD = 4.1 x 10(-8) M).
International Nuclear Information System (INIS)
Shah, Jinesh N; Shao, Genze; Hei, Tom K; Zhao, Yongliang
2008-01-01
Hypermethylation of the TGFBI promoter has been shown to correlate with decreased expression of this gene in human tumor cell lines. In this study, we optimized a methylation-specific polymerase chain reaction (MSP) method and investigated the methylation status of the TGFBI promoter in human lung and prostate cancer specimens. Methylation-specific primers were designed based on the methylation profiles of the TGFBI promoter in human tumor cell lines, and MSP conditions were optimized for accurate and efficient amplification. Genomic DNA was isolated from lung tumors and prostatectomy tissues of prostate cancer patients, bisulfite-converted, and analyzed by MSP. Among 50 lung cancer samples, 44.0% (22/50) harbored methylated CpG sites in the TGFBI promoter. An analysis correlating gene methylation status with clinicopathological cancer features revealed that dense methylation of the TGFBI promoter was associated with a metastatic phenotype, with 42.9% (6/14) of metastatic lung cancer samples demonstrating dense methylation vs. only 5.6% (2/36) of primary lung cancer samples (p < 0.05). Similar to these lung cancer results, 82.0% (41/50) of prostate cancer samples harbored methylated CpG sites in the TGFBI promoter, and dense methylation of the promoter was present in 38.9% (7/18) of prostate cancer samples with the feature of locoregional invasiveness vs. only 19.4% (6/31) of prostate cancer samples without locoregional invasiveness (p < 0.05). Furthermore, promoter hypermethylation correlated with highly reduced expression of the TGFBI gene in human lung and prostate tumor cell lines. We successfully optimized a MSP method for the precise and efficient screening of TGFBI promoter methylation status. Dense methylation of the TGFBI promoter correlated with the extent of TGFBI gene silencing in tumor cell lines and was related to invasiveness of prostate tumors and metastatic status of lung cancer tumors. Thus, TGFBI promoter methylation can be used as a potential
2-Bromo-2-methyl-N-p-tolylpropanamide
Directory of Open Access Journals (Sweden)
Rodolfo Moreno-Fuquen
2011-06-01
Full Text Available In the title molecule, C11H14BrNO, there is twist between the mean plane of the amide group and the benzene ring [C(=O—N—C...;C torsion angle = −31.2 (5°]. In the crystal, intermolecular N—H...O and weak C—H...O hydrogen bonds link molecules into chains along [100]. The methyl group H atoms are disordered over two sets of sites with equal occupancy.
Rodovalho,Amara Moira
2017-01-01
Cis, trans: above all, metaphors. Cisjordan, region skirting the Jordan River. Cisplatin, Uruguay’s ancient name, region occupying one of the banks of the Prata River. Trans- Amazonian, that which crosses the Amazon; transatlantic, that which crosses the Atlantic. Cisalpine, transalpine. The geometric isomerism of Organic Chemistry, where “cis” are atoms that, when molecules are divided in half, remain on the same side, and “trans” those remaining on opposite sides. Ev...
International Nuclear Information System (INIS)
Patel, G.N.
1975-01-01
Freeze-dried chain folded single crystals and the single crystals without amorphous surface layers (crystalline cores) of different thicknesses of linear polyethylene were irradiated with 60 Co γ-rays up to 600 Mrad. Concentration of trans-vinylene double bonds and conjugated diene produced during irradiation of the crystals was measured by infrared. Concentrations of trans-vinylene and of the conjugated diene were independent of thickness of crystalline core which suggest that the double bonds were randomly distributed in the crystalline parts of the crystals. Concentrations of trans-vinylene and of conjugated double bonds were lower in chain-folded crystals than in the crystalline cores and this suggests that the folds (amorphous surface layers) are less preferential sites for formation of the double bonds. The zero-order growth and first-order decay kinetics of trans-vinylene double bonds was studied by the equation derived by Dole et al. The equation is strictly obeyed up to 300 Mrad and the results then deviate. Since there is the decay of trans-vinylene double bonds and though there are no crosslinks in the crystalline cores, it has been suggested that the decay of the double bond does not result in the crosslinks
Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S
2006-07-01
The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, pCIMP MSS tumours (6.6%, pCIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.
PUTAS Y TRANS. ¿ESTÁN LAS MUJERES TRANS EN LAS NARRATIVAS SOBRE LA PROSTITUCIÓN?
Directory of Open Access Journals (Sweden)
Liza García Reyes
2015-06-01
Full Text Available Este artículo evidencia los principales resultados de la investigación cualitativa titulada: Putas y trans. Narrativas sobre mujeres trans en España –desarrollada en 2010–, la cual estudió su presencia en textos académicos sobre prostitución en España, producidos entre los años 2000-2009. El análisis de contenido de 34 narrativas evidenció que las referencias a mujeres trans resulta escasa en ellas, aun siendo ellas quienes tienen mayor presencia en la prostitución, en proporción con las mujeres biológicas. Solo nueve textos mencionan la experiencia trans al interior de la prostitución y, entre estos, el asunto solo aparece asertivamente descrito cuando son las propias mujeres trans quienes escriben. AbstractThis paper shows the results of a qualitative research entitled: Hookers and Trans Women: Narratives about trans women in Spain. This study was developed in 2010 and it is based on presence of trans women in the academic texts of prostitution in Spain produced between 2000 and 2009. The content analysis of thirty four narratives showed that the references to in transsexual women in these texts were few, although they have more presence into prostitution, in relation to the biological women. Only nine texts show an experience of prostitution and among these, transexperience only is described assertively when transsexual women write the texts themselves.
Energy Technology Data Exchange (ETDEWEB)
Tappin, Marcelo R.R.; Pereira, Jislaine F.G.; Lima, Lucilene A.; Siani, Antonio C. [Farmanguinhos - Inst. de Tecnologia em Farmacos, Rio de Janeiro, RJ (Brazil)]. E-mail: siani@far.fiocruz.br; Mazzei, Jose L. [Universidade Federal, Rio de Janeiro, RJ (Brazil). Escola de Quimica; Ramos, Monica F.S. [Universidade Federal, Rio de Janeiro, RJ (Brazil). Faculdade de Farmacia. Dept. de Medicamentos
2004-04-01
Quantitative GC-FID was evaluated for analysis of methylated copaiba oils, using trans-(-)-caryophyllene or methyl copalate as external standards. Analytical curves showed good linearity and reproducibility in terms of correlation coefficients (0.9992 and 0.996, respectively) and relative standard deviation (< 3%). Quantification of sesquiterpenes and diterpenic acids were performed with each standard, separately. When compared with the integrator response normalization, the standardization was statistically similar for the case of methyl copalate, but the response of trans-(-)-caryophyllene was statistically (P < 0.05) different. This method showed to be suitable for classification and quality control of commercial samples of the oils. (author)
International Nuclear Information System (INIS)
Tappin, Marcelo R.R.; Pereira, Jislaine F.G.; Lima, Lucilene A.; Siani, Antonio C.; Mazzei, Jose L.; Ramos, Monica F.S.
2004-01-01
Quantitative GC-FID was evaluated for analysis of methylated copaiba oils, using trans-(-)-caryophyllene or methyl copalate as external standards. Analytical curves showed good linearity and reproducibility in terms of correlation coefficients (0.9992 and 0.996, respectively) and relative standard deviation (< 3%). Quantification of sesquiterpenes and diterpenic acids were performed with each standard, separately. When compared with the integrator response normalization, the standardization was statistically similar for the case of methyl copalate, but the response of trans-(-)-caryophyllene was statistically (P < 0.05) different. This method showed to be suitable for classification and quality control of commercial samples of the oils. (author)
Effects of SMILE and Trans-PRK on corneal higher order aberrations after myopic correction
Directory of Open Access Journals (Sweden)
Jiao Zhao
2018-02-01
Full Text Available AIM:To observe the effects of small incision lenticule extraction(SMILEand trans-epithelial photorefractive keratectomy(Trans-PRKon corneal horizontal coma, vertical coma, and spherical aberration and total higher order aberrations after refractive correction for myopia. METHODS: This was a prospective non-randomized cohort study. The cohort included 40 patients(80 eyeswith myopia, who received refraction correction surgery from December 2016 to February 2017 in Leshan Ophthalmic Center. Twenty patients(40 eyesreceived SMILE surgery and the other 20 patients(40 eyesreceived Trans-PRK surgery. Corneal aberrations were determined by a high-resolution Pentacam Scheimpflug camera before the surgery and at 1 and 3mo after the operation. Statistical analyses were performed using analysis of variance of repeated measures. RESULTS: At 1 and 3mo post-operation, the uncorrected visual acuity in both groups was better than or equal to the preoperative best corrected visual acuity. The preoperative corneal aberrations showed no significant difference between the two groups(P>0.05. Significantly higher aberration was found after the surgery in both groups(PP>0.05. Post-operation, horizontal and vertical coma had no significant difference between the two groups(P>0.05, while SMILE group showed lower spherical aberration and lower total higher order aberration than Trans-PRK group(PCONCLUSION: Both SMILE and Trans-PRK increase corneal aberration and their effects on horizontal and vertical coma are similar. However, SMILE has a minor influence on spherical aberration and total high order aberration than Trans-PRK.
Numerical Evaluation of Parameter Correlation in the Hartmann-Tran Line Profile
Adkins, Erin M.; Reed, Zachary; Hodges, Joseph T.
2017-06-01
The partially correlated quadratic, speed-dependent hard-collision profile (pCqSDHCP), for simplicity referred to as the Hartmann-Tran profile (HTP), has been recommended as a generalized lineshape for high resolution spectroscopy. The HTP parameterizes complex collisional effects such as Dicke narrowing, speed dependent narrowing, and correlations between velocity-changing and dephasing collisions, while also simplifying to simpler profiles that are widely used, such as the Voigt profile. As advanced lineshape profiles are adopted by more researchers, it is important to understand the limitations that data quality has on the ability to retrieve physically meaningful parameters using sophisticated lineshapes that are fit to spectra of finite signal-to-noise ratio. In this work, spectra were simulated using the HITRAN Application Programming Interface (HAPI) across a full range of line parameters. Simulated spectra were evaluated to quantify the precision with which fitted lineshape parameters can be determined at a given signal-to-noise ratio, focusing on the numerical correlation between the retrieved Dicke narrowing frequency and the velocity-changing and dephasing collisions correlation parameter. Tran, H., N. Ngo, and J.-M. Hartmann, Journal of Quantitative Spectroscopy and Radiative Transfer 2013. 129: p. 89-100. Tennyson, et al., Pure Appl. Chem. 2014, 86: p. 1931-1943. Kochanov, R.V., et al., Journal of Quantitative Spectroscopy and Radiative Transfer 2016. 177: p. 15-30. Tran, H., N. Ngo, and J.-M. Hartmann, Journal of Quantitative Spectroscopy and Radiative Transfer 2013. 129: p. 199-203.
Directory of Open Access Journals (Sweden)
G. Vanangamudi
2009-01-01
Full Text Available The kinetics of oxidation of cinnamic acids by pyridinium bromochromate (PBC in the presence of oxalic acid has been studied in acetic acid-water (60:40% medium. The reaction shows unit order dependence each with respect to oxidant as well as oxalic acid [OX], the order with respect to [H+] and [CA] are fractional. The reaction is acid catalyzed and a low dielectric constant favours the reaction. Increase the ionic strength has no effect on the reaction rate. In the case of substituted cinnamic acids the order with respect to substrate vary depending upon the nature of the substituent present in the ring. In general, the electron withdrawing substituents retard the rate while the electron releasing substituents enhance the rate of reaction. From the kinetic data obtained the activation parameters have been computed and a suitable mechanism has been proposed.
Radical feminists & trans activists truce
Mackay, F.
2014-01-01
#GenderWeek: Truce! When radical feminists and trans feminists empathise\\ud Feminist Times\\ud By Finn Mackay \\ud read all #GenderWeek articles.\\ud We wanted to explore the ground between the polarised, entrenched positions in the so-called “TERF-war”. Radical feminists on one pole, trans-inclusionary feminists and trans activists on the other. The disputed territory being women-only space, language and the ever changing legal framework surrounding gender.\\ud Entrenchment leads to stalemate. S...
A novel pH optical sensor using methyl orange based on triacetylcellulose membranes as support.
Hosseini, Mohammad; Heydari, Rouhollah; Alimoradi, Mohammad
2014-07-15
A novel pH optical sensor based on triacetylcellulose membrane as solid support was developed by using immobilization of methyl orange indicator. The prepared optical sensor was fixed into a flow cell for on-line pH monitoring. Variables affecting sensor performance, such as pH of dye bonding to triacetylcellulose membrane and dye concentration have been fully evaluated and optimized. The calibration curve showed good behavior and precision (RSDpH range of 4.0-12.0. No significant variation was observed on sensor response with increasing the ionic strength in the range of 0.0-0.5M of sodium chloride. Determination of pH by using the proposed optical sensor is on-line, quick, inexpensive, selective and sensitive in the pH range of 4.0-12.0. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Fumiharu Ohka
Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.
Lan, Jin-Shuai; Hou, Jian-Wei; Liu, Yun; Ding, Yue; Zhang, Yong; Li, Ling; Zhang, Tong
2017-12-01
A novel family of cinnamic acid derivatives has been developed to be multifunctional cholinesterase inhibitors against AD by fusing N-benzyl pyridinium moiety and different substituted cinnamic acids. In vitro studies showed that most compounds were endowed with a noteworthy ability to inhibit cholinesterase, self-induced Aβ (1-42) aggregation, and to chelate metal ions. Especially, compound 5l showed potent cholinesterase inhibitory activity (IC 50 , 12.1 nM for eeAChE, 8.6 nM for hAChE, 2.6 μM for eqBuChE and 4.4 μM for hBuChE) and the highest selectivity toward AChE over BuChE. It also showed good inhibition of Aβ (1-42) aggregation (64.7% at 20 μM) and good neuroprotection on PC12 cells against amyloid-induced cell toxicity. Finally, compound 5l could penetrate the BBB, as forecasted by the PAMPA-BBB assay and proved in OF1 mice by ex vivo experiments. Overall, compound 5l seems to be a promising lead compound for the treatment of Alzheimer's diseases.
Trans as Contested Intelligibility
DEFF Research Database (Denmark)
Raun, Tobias
2014-01-01
Denne artikel rejser en række epistemologiske og metodologiske spørgsmål vedrørende læsningen af trans som identitetskategori. Disse spørgsmål er stærkt underbelyste i en skandinavisk akademisk kontekst, om end der el- lers i stigende grad produceres analyser af trans identitetsnarrativer. Artikl...
Colorectal Cancer "Methylator Phenotype": Fact or Artifact?
Directory of Open Access Journals (Sweden)
Charles Anacleto
2005-04-01
Full Text Available It has been proposed that human colorectal tumors can be classified into two groups: one in which methylation is rare, and another with methylation of several loci associated with a "CpG island methylated phenotype (CIMP," characterized by preferential proximal location in the colon, but otherwise poorly defined. There is considerable overlap between this putative methylator phenotype and the well-known mutator phenotype associated with microsatellite instability (MSI. We have examined hypermethylation of the promoter region of five genes (DAPK, MGMT, hMLH1, p16INK4a, and p14ARF in 106 primary colorectal cancers. A graph depicting the frequency of methylated loci in the series of tumors showed a continuous, monotonically decreasing distribution quite different from the previously claimed discontinuity. We observed a significant association between the presence of three or more methylated loci and the proximal location of the tumors. However, if we remove from analysis the tumors with hMLH1 methylation or those with MSI, the significance vanishes, suggesting that the association between multiple methylations and proximal location was indirect due to the correlation with MSI. Thus, our data do not support the independent existence of the so-called methylator phenotype and suggest that it rather may represent a statistical artifact caused by confounding of associations.
Synthesis of prostanoids; enantiomeric purity of alcohols by a 31P NMR technique
International Nuclear Information System (INIS)
Penning, T.D.
1985-01-01
The enone, 2,2-diemthyl-3aβ, 6aβ-dihydro-4H-cyclopenta-1,3-dioxol-4-one, has been synthesized in six steps from cyclopentadiene, resolved using sulfoximine chemistry, and converted into (-)-prostaglandin E 2 methyl ester in three steps. Introduction of the optically pure omega side-chain using a conjugate addition of a stabilized organocopper reagent, followed by direct alkylation of the enolate with the α side-chain allylic iodide in the presence of hexamethylphosphoramide, afforded a trans, vicinally disubstituted cyclopentanone. Deprotection of the C-15 alcohol, followed by aluminum amalgam reduction of the C-10/oxygen bond, provided (-)-PGE 2 methyl ester in 47% overall yield from the enone. In an extension of previously described work, 2-chloro-3,4-dimethyl-5-phenyl-1,3,2-oxazaphospholidine 2-sulfide, prepared from l-ephedrine and thiophosphoryl chloride, was used to determine the enantiomeric excess of chiral alcohols in conjunction with 31 P NMR. Chiral primary and secondary alcohols added quantitatively to the phospholidine to give diastereomers which could be analyzed by 31 P NMR and HPLC. A number of other phosphorus heterocycles were also explored as potential chiral derivatizing reagents
DEFF Research Database (Denmark)
Flebus, Luca; Lombart, Francois; Sevrin, Chantal
2015-01-01
Poly (2-dimethylamino ethylmethacrylate) (PDMAEMA) is an attractive non-degradable polymer studied as nonviral vector for gene delivery but it can be also adopted for delivery of other biopharmaceutical drugs. As a parenteral carrier, the PDMAEMA free form (FF) might interact with tissues and cells...... to a minor cytotoxicity compared to the higher ones.As main conclusion this study highlights the similitude in cell trafficking of FF PDMAEMA and data previously reported for PDMAEMA/DNA complexes....
Dilokpimol, Adiphol; Mäkelä, Miia R; Mansouri, Sadegh; Belova, Olga; Waterstraat, Martin; Bunzel, Mirko; de Vries, Ronald P; Hildén, Kristiina S
2017-07-25
A feruloyl esterase (FAE) from Aspergillus niger N402, FaeC was heterologously produced in Pichia pastoris X-33 in a yield of 10mg/L. FaeC was most active at pH 7.0 and 50°C, and showed broad substrate specificity and catalyzed the hydrolysis of methyl 3,4-dimethoxycinnamate, ethyl ferulate, methyl ferulate, methyl p-coumarate, ethyl coumarate, methyl sinapate, and methyl caffeate. The enzyme released both ferulic acid and p-coumaric acid from wheat arabinoxylan and sugar beet pectin (up to 3mg/g polysaccharide), and acted synergistically with a commercial xylanase increasing the release of ferulic acid up to six-fold. The expression of faeC increased over time in the presence of feruloylated polysaccharides. Cinnamic, syringic, caffeic, vanillic and ferulic acid induced the expression of faeC. Overall expression of faeC was very low in all tested conditions, compared to two other A. niger FAE encoding genes, faeA and faeB. Our data showed that the fae genes responded differently towards the feruloylated polysaccharides and tested monomeric phenolic compounds suggesting that the corresponding FAE isoenzymes may target different substrates in a complementary manner. This may increase the efficiency of the degradation of diverse plant biomass. Copyright © 2017 Elsevier B.V. All rights reserved.
Shukla, P. K.; Mishra, P. C.; Suhai, S.
Density functional theory (DFT) at the B3LYP/6-31+G* and B3LYP/AUG-cc-pVDZ levels was employed to study O6-methylation of guanine due to its reactions with methyl chloride and methyl bromide and to obtain explanation as to why the methyl halides cause genotoxicity and possess mutagenic and carcinogenic properties. Geometries of the various isolated species involved in the reactions, reactant complexes (RCs), and product complexes (PCs) were optimized in gas phase. Transition states connecting the reactant complexes with the product complexes were also optimized in gas phase at the same levels of theory. The reactant complexes, product complexes, and transition states were solvated in aqueous media using the polarizable continuum model (PCM) of the self-consistent reaction field theory. Zero-point energy (ZPE) correction to total energy and the corresponding thermal energy correction to enthalpy were made in each case. The reactant complexes of the keto form of guanine with methyl chloride and methyl bromide in water are appreciably more stable than the corresponding complexes involving the enol form of guanine. The nature of binding in the product complexes was found to be of the charge transfer type (O6mG+ · X-, X dbond Cl, Br). Binding of HCl, HBr, and H2O molecules to the PCs obtained with the keto form of guanine did not alter the positions of the halide anions in the PCs, and the charge transfer character of the PCs was also not modified due to this binding. Further, the complexes obtained due to the binding of HCl, HBr, and H2O molecules to the PCs had greater stability than the isolated PCs. The reaction barriers involved in the formation of PCs were found to be quite high (?50 kcal/mol). Mechanisms of genotoxicity, mutagenesis and carcinogenesis caused by the methyl halides appear to involve charge transfer-type complex formation. Thus the mechanisms of these processes involving the methyl halides appear to be quite different from those that involve the
The Danish trans-fatty acids ban
DEFF Research Database (Denmark)
Vallgårda, Signild
2017-01-01
In 2003 an executive order was issued banning industrially produced trans-fatty acids above a low level in food items in Denmark. To date, only a few other countries have followed Denmark’s example. The way health consequences of trans fats were translated by the different actors enabled the crea......In 2003 an executive order was issued banning industrially produced trans-fatty acids above a low level in food items in Denmark. To date, only a few other countries have followed Denmark’s example. The way health consequences of trans fats were translated by the different actors enabled...
Double-pass Mach-Zehnder fiber interferometer pH sensor.
Tou, Zhi Qiang; Chan, Chi Chiu; Hong, Jesmond; Png, Shermaine; Eddie, Khay Ming Tan; Tan, Terence Aik Huang
2014-04-01
A biocompatible fiber-optic pH sensor based on a unique double-pass Mach-Zehnder interferometer is proposed. pH responsive poly(2-hydroxyethyl methacrylate-co-2-(dimethylamino)ethyl methacrylate) hydrogel coating on the fiber swells/deswells in response to local pH, leading to refractive index changes that manifest as shifting of interference dips in the optical spectrum. The pH sensor is tested in spiked phosphate buffer saline and demonstrates high sensitivity of 1.71 nm/pH, pH 0.004 limit of detection with good responsiveness, repeatability, and stability. The proposed sensor has been successfully applied in monitoring the media pH in cell culture experiments to investigate the relationship between pH and cancer cell growth.
Methyl-Analyzer--whole genome DNA methylation profiling.
Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G
2011-08-15
Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.
Phenolic Acid Content and Antioxidant Properties of Extruded Corn Snacks Enriched with Kale
Kasprzak, Kamila; Oniszczuk, Tomasz; Waksmundzka-Hajnos, Monika; Nowak, Renata; Polak, Renata
2018-01-01
Prohealth food contains specific components which have positive influence on the health and well-being of the consumer. An important position among bioactive compounds occurs for polyphenols. Many results have indicated that an increased intake of phenolic compounds may reduce the risk of cardiovascular diseases and type 2 diabetes. The objective of the study was production of extruded corn snacks with addition (0, 2, 4, 6, and 8%) of kale (Brassica oleracea L. var. sabellica)—a polyphenol-rich plant. Afterwards, high-performance liquid chromatography-mass spectrometry (LC-ESI-MS/MS) and antioxidant activity analyses of snack extracts were performed. In the corn snacks enriched with kale, fifteen phenolic acids were indicated. These were protocatechuic, 4-OH-benzoic, vanillic, trans-caffeic, cis-caffeic, trans-p-coumaric, cis-p-coumaric, trans-ferulic, cis-ferulic, salicylic, gentisic, syringic, 3-OH-cinnamic, trans-sinapic, and cis-sinapic acids. Both the qualitative and quantitative content of polyphenols increased with the addition of B. oleracea. Data from spectrophotometric analyses of the samples showed high DPPH radical scavenging potential of snacks enriched with 4, 6, and 8% of kale. Snacks enriched with kale contain high level of phenolic acids and, therefore, have great potential to make a valuable source of natural antioxidants. High-temperature short-time extrusion-cooking process had no negative impact on polyphenol's activity. PMID:29507816
Phenolic Acid Content and Antioxidant Properties of Extruded Corn Snacks Enriched with Kale
Directory of Open Access Journals (Sweden)
Kamila Kasprzak
2018-01-01
Full Text Available Prohealth food contains specific components which have positive influence on the health and well-being of the consumer. An important position among bioactive compounds occurs for polyphenols. Many results have indicated that an increased intake of phenolic compounds may reduce the risk of cardiovascular diseases and type 2 diabetes. The objective of the study was production of extruded corn snacks with addition (0, 2, 4, 6, and 8% of kale (Brassica oleracea L. var. sabellica—a polyphenol-rich plant. Afterwards, high-performance liquid chromatography-mass spectrometry (LC-ESI-MS/MS and antioxidant activity analyses of snack extracts were performed. In the corn snacks enriched with kale, fifteen phenolic acids were indicated. These were protocatechuic, 4-OH-benzoic, vanillic, trans-caffeic, cis-caffeic, trans-p-coumaric, cis-p-coumaric, trans-ferulic, cis-ferulic, salicylic, gentisic, syringic, 3-OH-cinnamic, trans-sinapic, and cis-sinapic acids. Both the qualitative and quantitative content of polyphenols increased with the addition of B. oleracea. Data from spectrophotometric analyses of the samples showed high DPPH radical scavenging potential of snacks enriched with 4, 6, and 8% of kale. Snacks enriched with kale contain high level of phenolic acids and, therefore, have great potential to make a valuable source of natural antioxidants. High-temperature short-time extrusion-cooking process had no negative impact on polyphenol’s activity.
Phenolic Acid Content and Antioxidant Properties of Extruded Corn Snacks Enriched with Kale.
Kasprzak, Kamila; Oniszczuk, Tomasz; Wójtowicz, Agnieszka; Waksmundzka-Hajnos, Monika; Olech, Marta; Nowak, Renata; Polak, Renata; Oniszczuk, Anna
2018-01-01
Prohealth food contains specific components which have positive influence on the health and well-being of the consumer. An important position among bioactive compounds occurs for polyphenols. Many results have indicated that an increased intake of phenolic compounds may reduce the risk of cardiovascular diseases and type 2 diabetes. The objective of the study was production of extruded corn snacks with addition (0, 2, 4, 6, and 8%) of kale ( Brassica oleracea L. var. sabellica )-a polyphenol-rich plant. Afterwards, high-performance liquid chromatography-mass spectrometry (LC-ESI-MS/MS) and antioxidant activity analyses of snack extracts were performed. In the corn snacks enriched with kale, fifteen phenolic acids were indicated. These were protocatechuic, 4-OH-benzoic, vanillic, trans -caffeic, cis -caffeic, trans -p-coumaric, cis -p-coumaric, trans -ferulic, cis -ferulic, salicylic, gentisic, syringic, 3-OH-cinnamic, trans -sinapic, and cis -sinapic acids. Both the qualitative and quantitative content of polyphenols increased with the addition of B. oleracea . Data from spectrophotometric analyses of the samples showed high DPPH radical scavenging potential of snacks enriched with 4, 6, and 8% of kale. Snacks enriched with kale contain high level of phenolic acids and, therefore, have great potential to make a valuable source of natural antioxidants. High-temperature short-time extrusion-cooking process had no negative impact on polyphenol's activity.
Liu, Xin; Zheng, Yu; Samoshina, Nataliya M; Franz, Andreas H; Guo, Xin; Samoshin, Vyacheslav V
2012-12-01
A new type of pH-sensitive liposomes (fliposomes) was designed based on the amphiphiles that are able to perform a pH-triggered conformational flip (flipids). This flip disrupts the liposome membrane and causes rapid release of the liposome cargo, specifically in response to lowered pH. The flipids (1) and (2) are equipped with a trans-2-aminocyclohexanol conformational switch. pH-sensitive fliposomes containing one or both of these flipids, as well as POPC and PEG ceramide, were constructed and characterized. These compositions were stable at 4°C and pH 7.4 for several months. Fliposomes loaded with ANTS/DPX performed an unusually quick content release within a few seconds at pH below 8.5 (in case of 2) and 6.0 (in case of 1). This difference in pH sensitivity demonstrates a potential for the custom design of flipids by variation of the amino group to target areas with specific pH values. The pH titration curves for the fliposome leakage parallel the curves for the acid-induced conformational flip of 1 and 2 studied by ¹H NMR. A plausible mechanism of pH sensitivity starts with an acid-triggered conformational flip of 1 or 2, which changes the molecular size and shape, shortens the lipid tails, and perturbs the liposome membrane, resulting in the content leakage.
Brendler, T; Abeles, A; Austin, S
1995-08-15
The P1 plasmid replication origin P1oriR is controlled by methylation of four GATC adenine methylation sites within heptamer repeats. A comparable (13mer) region is present in the host origin, oriC. The two origins show comparable responses to methylation; negative control by recognition of hemimethylated DNA (sequestration) and a positive requirement for methylation for efficient function. We have isolated a host protein that recognizes the P1 origin region only when it is isolated from a strain proficient for adenine methylation. The substantially purified 22 kDa protein also binds to the 13mer region of oriC in a methylation-specific fashion. It proved to be the product of the seqA gene that acts in the negative control of oriC by sequestration. We conclude that the role of the SeqA protein in sequestration is to recognize the methylation state of P1oriR and oriC by direct DNA binding. Using synthetic substrates we show that SeqA binds exclusively to the hemimethylated forms of these origins forms that are the immediate products of replication in a methylation-proficient strain. We also show that the protein can recognize sequences with multiple GATC sites, irrespective of the surrounding sequence. The basis for origin specificity is primarily the persistence of hemimethylated forms that are over-represented in the natural. DNA preparations relative to controls.
Olivares, Christopher I.; Wang, Junqin; Silva Luna, Carlos D.; Field, Jim A.; Abrell, Leif; Sierra-Alvarez, Reyes
2017-01-01
N-methyl-p-nitroaniline (MNA) is an ingredient of insensitive munitions (IM) compounds that serves as a plasticizer and helps reduce unwanted detonations. As its use becomes widespread, MNA waste streams will be generated, necessitating viable treatment options. We studied MNA biodegradation and its inhibition potential to, a representative anaerobic microbial population in wastewater treatment, methanogens. Anaerobic biodegradation and toxicity assays were performed and an up-flow anaerobic sludge blanket reactor (UASB) was operated to test continuous degradation of MNA. MNA was transformed almost stoichiometrically to N-methyl-p-phenylenediamine (MPD). MPD was not mineralized, however, it was readily autoxidized and polymerized extensively upon aeration at pH = 9. In the UASB reactor, MNA was fully degraded up to a loading rate of 297.5 μM MNA d-1). Regarding toxicity, MNA was very inhibitory to acetoclastic methanogens (IC50 = 103 μM) whereas MPD was much less toxic, causing only 13.9% inhibition at the highest concentration tested (1025 μM). The results taken as a whole indicate that anaerobic sludge can transform MNA to MPD continuously, and that the transformation decreases the cytotoxicity of the parent pollutant. MPD can be removed through extensive polymerization. These insights could help define efficient treatment options for waste streams polluted with MNA. PMID:26454121
TransForm: TransAlta 2000 annual report
International Nuclear Information System (INIS)
2001-01-01
Financial information from TransAlta Corp. was presented along with a review of their operations throughout 2000 and a summary of the how the electric utility is doing in terms of power generation, independent power producers, transmission and energy marketing. The utility has changed from a regulated vertically integrated utility into one of Canada's largest non-regulated electric power generators. The utility sold its retail businesses in Alberta and New Zealand and now focuses on coal and hydro generation, gas generation, high-voltage transmission and energy marketing. The newly constructed Centralia, Washington generation facility was brought on line with 1,340 MW in May 2000, on time and on budget. This was the platform to diversify their generation into the United States. The utility reported a solid financial year with $177.9 million in earnings from continuing operations, an 83 per cent increase from 1999, driven mostly by the results of Centralia and power marketing and trading businesses. A financial loss was suffered when the Wabamum power plant in Alberta was shut down for several months to repair a boiler. The utility made excellent progress toward their goal of 15,000 megawatts by 2005 by starting with the construction of what will be one of Canada's largest cogeneration facilities at Sarnia, Ontario. TransAlta also commissioned a 360 MW cogeneration facility at Poplar Creek at Suncor's Fort McMurray oil sand facility. TransAlta also has an excellent track record in developing power generation projects internationally. refs., tabs., figs
Schmitt, Meghan L.; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene You Xian
2014-01-01
The organic phosphazene superbase, 1-tert-butyl-4,4,4-tris(dimethylamino)- 2,2-bis[tris(dimethylamino)phosphoranylid-enamino]-2λ5, 4λ5-catenadi(phosphazene) (t-Bu-P4), is found to directly initiate high-speed polymerization of the biomass-derived renewable γ-methyl-α-methylene-γ-butyrolactone (MMBL), in contrast to other polymerization systems using t-Bu-P4 which typically require addition of an organic acid or a nucleophile as a co-initiating component. This MMBL polymerization by t-Bu-P4 alone is extremely rapid; even with a low t-Bu-P4 loading of 0.1 mol% or 0.02 mol%, quantitative monomer conversion is achieved in 20 s or 1 min, respectively, affording medium to high molecular weight PMMBL bioplastics in a catalytic fashion. The combined experimental and theoretical/computational studies have yielded mechanisms of chain initiation through abstraction of a proton from a monomer by t-Bu-P 4, essentially barrier-less chain propagation through rapid conjugate addition of the enolate anion stabilized by the nano-size cation [t-Bu-P 4H]+ to the monomer, and chain termination through chain transfer to the monomer which generates a saturated termination chain end and the [t-Bu-P4H]+-stabilized anionic active species that starts a new chain. This journal is © the Partner Organisations 2014.
International Nuclear Information System (INIS)
Dabirian, Ali; Kuzminykh, Yury; Wagner, Estelle; Benvenuti, Giacomo; Rushworth, Simon; Hoffmann, Patrik
2014-01-01
Chemical vapour deposition (CVD) processes depend on the availability of suitable precursors. Precursors that deliver a stable vapour pressure are favourable in classical CVD processes, as they ensure process reproducibility. In high vacuum CVD (HV-CVD) process vapour pressure stability of the precursor is of particular importance, since no carrier gas assisted transport can be used. The dimeric Nb 2 (OEt) 10 does not fulfil this requirement since it partially dissociates upon heating. Dimethylamino functionalization of an ethoxy ligand of Nb(OEt) 5 acts as an octahedral field completing entity and leads to Nb(OEt) 4 (dmae). We show that Nb(OEt) 4 (dmae) evaporates as monomeric molecule and ensures a stable vapour pressure and, consequently, stable flow. A set of HV-CVD experiments were conducted using this precursor by projecting a graded molecular beam of the precursor onto the substrate at deposition temperatures from 320 °C to 650 °C. Film growth rates ranging from 8 nm·h −1 to values larger than 400 nm·h −1 can be obtained in this system illustrating the high level of control available over the film growth process. Classical CVD limiting conditions along with the recently reported adsorption–reaction limited conditions are observed and the chemical composition, and microstructural and optical properties of the films are related to the corresponding growth regime. Nb(OEt) 4 (dmae) provides a large process window of deposition temperatures and precursor fluxes over which carbon-free and polycrystalline niobium oxide films with growth rates proportional to precursor flux are obtained. This feature makes Nb(OEt) 4 (dmae) an attractive precursor for combinatorial CVD of niobium containing complex oxide films that are finding an increasing interest in photonics and photoelectrochemical water splitting applications. The adsorption–reaction limited conditions provide extremely small growth rates comparable to an atomic layer deposition (ALD) process
Hyper-Methylated Loci Persisting from Sessile Serrated Polyps to Serrated Cancers.
Andrew, Angeline S; Baron, John A; Butterly, Lynn F; Suriawinata, Arief A; Tsongalis, Gregory J; Robinson, Christina M; Amos, Christopher I
2017-03-02
Although serrated polyps were historically considered to pose little risk, it is now understood that progression down the serrated pathway could account for as many as 15%-35% of colorectal cancers. The sessile serrated adenoma/polyp (SSA/P) is the most prevalent pre-invasive serrated lesion. Our objective was to identify the CpG loci that are persistently hyper-methylated during serrated carcinogenesis, from the early SSA/P lesion through the later cancer phases of neoplasia development. We queried the loci hyper-methylated in serrated cancers within our rightsided SSA/Ps from the New Hampshire Colonoscopy Registry, using the Illumina Infinium Human Methylation 450 k panel to comprehensively assess the DNA methylation status. We identified CpG loci and regions consistently hyper-methylated throughout the serrated carcinogenesis spectrum, in both our SSA/P specimens and in serrated cancers. Hyper-methylated CpG loci included the known the tumor suppressor gene RET (p = 5.72 x 10-10), as well as loci in differentially methylated regions for GSG1L, MIR4493, NTNG1, MCIDAS, ZNF568, and RERG. The hyper-methylated loci that we identified help characterize the biology of SSA/P development, and could be useful as therapeutic targets, or for future identification of patients who may benefit from shorter surveillance intervals.
Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji
2008-03-01
The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (PCIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.
Directory of Open Access Journals (Sweden)
Teresa Cirillo
2004-12-01
Full Text Available <p>Occupational exposure to benzene in petrol pump attendants and in mechanics was studied by examining the benzene content in both the air breathed and in the urinary metabolite trans,trans-muconic acid (t,t-MA. Thirty petrol pump attendants and thirty mechanics (as exposed workers and thirty adult male office workers (as non exposed workers were involved in the study. Measures were taken at the begin and at the end of the working shifts.p> > The benzene concentrations in the breathing air samples varied from 2 to 88 μg m-3, lower than the EU acceptable limit for occupational environment. The average urinary t,t-MA in the petrol pump attendants at the begin and at the end of the working shifts ranged between 133 ± 69 and 255 ± 174 μg g-1 creatinine and in the mechanics between 204 ± 139 and 300 ± 211 μg g-1 creatinine, respectively.p> >In all the participants the mean levels of urinary t,t-MA at the end of the working shifts were significantly higher than those at the beginning. In the exposed workers mean levels of urinary t,t-MA were significantly higher than in those of the non-exposed workers. The influence of the smoking was demonstrated by the urinary t,t-MA levels in smoking non-exposed subjects.p>
TransCanada PipeLines Limited 1998 annual report : TransCanada energy solutions
International Nuclear Information System (INIS)
1999-01-01
Financial information from TransCanada PipeLines Limited and a review of the company's 1998 operations was made available for the benefit of shareholders. TransCanada's pipeline system transports natural gas and crude oil from Western Canada Sedimentary Basin to North America's major energy markets. Net earnings from continuing operations for 1998, before unusual charges, were $575 million ($ 355 million after unusual charges) compared to $522 million for 1997. Solid performances from the energy transmission and international business, when compared to 1997, were more than offset by a decreased contribution from energy processing. TransCanada recorded integration costs of $166 million, after tax, related to the merger with NOVA in 1998, which was the major operational accomplishment during the year, creating a seamless economic energy delivery, processing and marketing system from the wellhead to the market. tabs., figs
The infrared spectra of 1-methylthio-1-dimethylamino methyl ...
African Journals Online (AJOL)
metry, the nitrile stretching mode is coupled with the CD, asymmetric stretch through first-order. Coriolis and or second order centrifugal distortion interaction by rotation about the a or b axis. If there is a significant contribution of CN to the z- component of the dipole moment, then some Co- riolis coupling with the symmetric ...
LA POLITIZACIÓN DEL CUERPO: SUBJETIVIDADES TRANS EN RESISTENCIA
Directory of Open Access Journals (Sweden)
Manuel Roberto Escobar C
2013-01-01
Full Text Available Se indaga por la experiencia del cuerpo trans (transgénero o transexual, cuya “artificialidad” interpela los órdenes del sujeto en la modernidad. El estudio se ubica en el contexto de dos ciudades latinoamericanas: México D. F. y Bogotá. Se plantea un vínculo entre la corporalidad trans, la biografía y los nombramientos de unas subjetividades que devienen tensión al orden somático moderno, tanto en sus versiones de docilidad y disciplinamiento, como también de hiperestesia y consumo. Así, la intervención singular sobre un cuerpo se torna en politización macro en el ámbito de lo público.
Energy Technology Data Exchange (ETDEWEB)
Catal, Tunc [Department of Biological and Ecological Engineering, Oregon State University, 116 Gilmore Hall, Corvallis, OR 97331 (United States); Department of Wood Science and Engineering, Oregon State University, 102 97331, Corvallis, OR (United States); Department of Molecular Biology and Genetics, Istanbul Technical University, 34469-Maslak, Istanbul (Turkey); Fan, Yanzhen; Liu, Hong [Department of Biological and Ecological Engineering, Oregon State University, 116 Gilmore Hall, Corvallis, OR 97331 (United States); Li, Kaichang [Department of Wood Science and Engineering, Oregon State University, 102 97331, Corvallis, OR (United States); Bermek, Hakan [Department of Molecular Biology and Genetics, Istanbul Technical University, 34469-Maslak, Istanbul (Turkey)
2008-05-15
Lignocellulosic biomass is an attractive fuel source for MFCs due to its renewable nature and ready availability. Furan derivatives and phenolic compounds could be potentially formed during the pre-treatment process of lignocellulosic biomass. In this study, voltage generation from these compounds and the effects of these compounds on voltage generation from glucose in air-cathode microbial fuel cells (MFCs) were examined. Except for 5-hydroxymethyl furfural (5-HMF), all the other compounds tested were unable to be utilized directly for electricity production in MFCs in the absence of other electron donors. One furan derivate, 5-HMF and two phenolic compounds, trans-cinnamic acid and 3,5-dimethoxy-4-hydroxy-cinnamic acid did not affect electricity generation from glucose at a concentration up to 10 mM. Four phenolic compounds, including syringaldeyhde, vanillin, trans-4-hydroxy-3-methoxy, and 4-hydroxy cinnamic acids inhibited electricity generation at concentrations above 5 mM. Other compounds, including 2-furaldehyde, benzyl alcohol and acetophenone, inhibited the electricity generation even at concentrations less than 0.2 mM. This study suggests that effective electricity generation from the hydrolysates of lignocellulosic biomass in MFCs may require the employment of the hydrolysis methods with low furan derivatives and phenolic compounds production, or the removal of some strong inhibitors prior to the MFC operation, or the improvement of bacterial tolerance against these compounds through the enrichment of new bacterial cultures or genetic modification of the bacterial strains. (author)
Catal, Tunc; Fan, Yanzhen; Li, Kaichang; Bermek, Hakan; Liu, Hong
Lignocellulosic biomass is an attractive fuel source for MFCs due to its renewable nature and ready availability. Furan derivatives and phenolic compounds could be potentially formed during the pre-treatment process of lignocellulosic biomass. In this study, voltage generation from these compounds and the effects of these compounds on voltage generation from glucose in air-cathode microbial fuel cells (MFCs) were examined. Except for 5-hydroxymethyl furfural (5-HMF), all the other compounds tested were unable to be utilized directly for electricity production in MFCs in the absence of other electron donors. One furan derivate, 5-HMF and two phenolic compounds, trans-cinnamic acid and 3,5-dimethoxy-4-hydroxy-cinnamic acid did not affect electricity generation from glucose at a concentration up to 10 mM. Four phenolic compounds, including syringaldeyhde, vanillin, trans-4-hydroxy-3-methoxy, and 4-hydroxy cinnamic acids inhibited electricity generation at concentrations above 5 mM. Other compounds, including 2-furaldehyde, benzyl alcohol and acetophenone, inhibited the electricity generation even at concentrations less than 0.2 mM. This study suggests that effective electricity generation from the hydrolysates of lignocellulosic biomass in MFCs may require the employment of the hydrolysis methods with low furan derivatives and phenolic compounds production, or the removal of some strong inhibitors prior to the MFC operation, or the improvement of bacterial tolerance against these compounds through the enrichment of new bacterial cultures or genetic modification of the bacterial strains.
The EPA is providing notice of a proposed Administrative Penalty Assessment against Trans Ova Genetics, L.C., a business located at 2938 380th Street Sioux Center, IA 51250, for alleged violations at the Trans Ova Genetics, L.C.’s facility located in 12425
Directory of Open Access Journals (Sweden)
Z.Khamverdi
2016-11-01
Full Text Available Introduction: Th characteristics of a suitable restoration material is having acceptable mechanical properties, protecting teeth against decay and ease of use in clinics. Diet can affct properties of restorative materials in the mouth. Since amongst important properties of composite restorations are mechanical properties such as hardness, the aim of this study was evaluation of the effct of Coca-Cola Beverages on surface hardness of a silorane based p90( and methyl methacrylate p60( composites. Methods: In this experimental study, thirty disc-shaped specimens 5 × 2 mm( of each of methyl methacrylate based Filtek p60, 3M Dental Products, USA( and a silorane based Filtek p90, 3M Dental Products, USA( composite resins were prepared, according to manufacturers' instructions. Specimens were randomly divided to four groups as follows N = 15(: G1: Filtek p90 without exposure to Coca-Cola, G2: Filtek p90 with exposure to Coca-Cola, G3: Filtek p60 without expure to Coca-Cola, G4: Filtek p60 with expure to Coca-Cola. Th specimens were exposed to regular sof drinks Coca-Cola, Khoshgovar, Tehran, Iran( at room temperature for seven days with a frequency of three times daily for 20 minutes at a time. In the remaining times of the day, they were kept in distilled water. Thn, micro hardness measurements were made for each specimen with a Vickers hardness testing machine Buehler, Lake Bluff IL, USA( under 500 g of force for 15 seconds. Data were analyzed using SPSS 18 and independent t-test at a signifiance level of 0.05. Results: Micro hardness values of four groups were G1: 68.28 ± 2.65; G2:59.56 ± 6.61; G3: 93.5 ± 2.38; and G4:86.76 ± 5.47, respectively. Th results of this study showed that Coca-Cola reduces the surface hardness of the two composite materials P > 0.05(. Conclusions: Th results showed the hardness of both Filtek p90 and Filtek p60 composite signifiantly decreases with Coca-Cola but the reduction was equal.
Ogino, S; Kawasaki, T; Kirkner, G J; Ogawa, A; Dorfman, I; Loda, M; Fuchs, C S
2006-10-01
p21 (CDKN1A/CIP1/WAF1), one of the cyclin-dependent kinase inhibitors, plays a key role in regulating the cell cycle and is transcriptionally regulated by p53. Down-regulation of p21 is caused by TP53 mutations in colorectal cancer. CpG island methylator phenotype (CIMP) appears to be a distinct subtype of colorectal cancer with concordant methylation of multiple gene promoters and is associated with a high degree of microsatellite instability (MSI-H) and BRAF mutations. However, no study to date has evaluated the relationship between p21 expression and CIMP in colorectal cancer. The purpose of this study was to examine the inter-relationships between p21, p53, CIMP, MSI and KRAS/BRAF status in colorectal cancer. We utilized 737 relatively unbiased samples of colorectal cancers from two large prospective cohort studies. Using quantitative real-time PCR (MethyLight), we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1 and NEUROG1]. CIMP-high (>or=4/5 methylated promoters) was diagnosed in 118 (16%) of the 737 tumours. We also assessed expression of p21 and p53 by immunohistochemistry. Among the 737 tumours, 371 (50%) showed p21 loss. Both p21 loss and p53 positivity were inversely associated with CIMP-high, MSI-H and BRAF mutations. The associations of p21 with these molecular features were still present after tumours were stratified by p53 status. In contrast, the associations of p53 positivity with the molecular features were no longer present after tumours were stratified by p21 status. When CIMP-high and non-CIMP-high tumours were stratified by MSI or KRAS/BRAF status, CIMP-high and MSI-H (but not BRAF mutations) were still inversely associated with p21 loss. In conclusion, down-regulation of p21 is inversely correlated with CIMP-high and MSI-H in colorectal cancer, independent of TP53 and BRAF status.
Directory of Open Access Journals (Sweden)
Hai B Zheng
2015-01-01
Conclusion: MSCs decrease the incidence of irradiation-induced thymoma, which may be mediated by improving thymus microenvironment and changing the methylation of p53 promoter, and subsequently maintaining genome′s stability.
Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping
Directory of Open Access Journals (Sweden)
Maruoka Shuichiro
2008-12-01
Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models
Directory of Open Access Journals (Sweden)
Cláudio E. Rodrigues-Santos
2015-09-01
Full Text Available In this work, the theoretical description of the 4- and 3-substituted-cinnamic acid esterification with different electron donating and electron withdrawing groups was performed at the B3LYP and M06-2X levels, as a two-step process: the O-protonation and the nucleophile attack by ethanol. In parallel, an experimental work devoted to the synthesis and characterization of the substituted-cinnamate esters has also been performed. In order to quantify the substituents effects, quantitative structure–property relationship (QSPR models based on the atomic charges, Fukui functions and the Frontier Effective-for-Reaction Molecular Orbitals (FERMO energies were investigated. In fact, the Fukui functions, ƒ+C and ƒ−O, indicated poor correlations for each individual step, and in contrast with the general literature, the O-protonation step is affected both by the FERMO energies and the O-charges of the carbonyl group. Since the process was shown to not be totally described by either charge- or frontier-orbitals, it is proposed to be frontier-charge-miscere controlled. Moreover, the observed trend for the experimental reaction yields suggests that the electron withdrawing groups favor the reaction and the same was observed for Step 2, which can thus be pointed out as the determining step.
Relic dark energy from the trans-Planckian regime
International Nuclear Information System (INIS)
Mersini, Laura; Bastero-Gil, Mar; Kanti, Panagiota
2001-01-01
As yet, there is no underlying fundamental theory for the trans-Planckian regime. There is a need to address the issue of how the observables in our present Universe are affected by processes that may have occurred at super-Planckian energies (referred to as the trans-Planckian regime). Specifically, we focus on the impact the trans-Planckian regime has on two observables: namely, dark energy and the cosmic microwave background radiation (CMBR) spectrum. We model the trans-Planckian regime by introducing a 1-parameter family of smooth non-linear dispersion relations which modify the frequencies at very short distances. A particular feature of the family of dispersion functions chosen is the production of ultralow frequencies at very high momenta k (for k>M P ). We name the range of the ultralow energy modes (of very short distances) that have frequencies equal to or less than the current Hubble rate H 0 as the tail modes. These modes are still frozen today due to the expansion of the Universe. We calculate their energy today and show that the tail provides a strong candidate for the dark energy of the Universe. During inflation, their energy is about 122 to 123 orders of magnitude smaller than the total energy, for any random value of the free parameter in the family of dispersion relations. For this family of dispersions, we present the exact solutions and show that the CMBR spectrum is that of a (nearly) blackbody, and that the adiabatic vacuum is the only choice for the initial conditions
Liao, James C.; Cho, Kwang Myung; Yan, Yajun; Huo, Yixin
2016-03-15
Provided herein are metabolically modified microorganisms characterized by having an increased keto-acid flux when compared with the wild-type organism and comprising at least one polynucleotide encoding an enzyme that when expressed results in the production of a greater quantity of a chemical product when compared with the wild-type organism. The recombinant microorganisms are useful for producing a large number of chemical compositions from various nitrogen containing biomass compositions and other carbon sources. More specifically, provided herein are methods of producing alcohols, acetaldehyde, acetate, isobutyraldehyde, isobutyric acid, n-butyraldehyde, n-butyric acid, 2-methyl-1-butyraldehyde, 2-methyl-1-butyric acid, 3-methyl-1-butyraldehyde, 3-methyl-1-butyric acid, ammonia, ammonium, amino acids, 2,3-butanediol, 1,4-butanediol, 2-methyl-1,4-butanediol, 2-methyl-1,4-butanediamine, isobutene, itaconate, acetoin, acetone, isobutene, 1,5-diaminopentane, L-lactic acid, D-lactic acid, shikimic acid, mevalonate, polyhydroxybutyrate (PHB), isoprenoids, fatty acids, homoalanine, 4-aminobutyric acid (GABA), succinic acid, malic acid, citric acid, adipic acid, p-hydroxy-cinnamic acid, tetrahydrofuran, 3-methyl-tetrahydrofuran, gamma-butyrolactone, pyrrolidinone, n-methylpyrrolidone, aspartic acid, lysine, cadeverine, 2-ketoadipic acid, and/or S-adenosyl-methionine (SAM) from a suitable nitrogen rich biomass.
Mode of de-esterification of alkaline and acidic pectin methyl esterases at different pH conditions.
Duvetter, Thomas; Fraeye, Ilse; Sila, Daniel N; Verlent, Isabel; Smout, Chantal; Hendrickx, Marc; Van Loey, Ann
2006-10-04
Highly esterified citrus pectin was de-esterified at pH 4.5 and 8.0 by a fungal pectin methyl esterase (PME) that was shown to have an acidic isoelectric pH (pI) and an acidic pH optimum and by a plant PME that was characterized by an alkaline pI and an alkaline pH optimum. Interchain and intrachain de-esterification patterns were studied by digestion of the pectin products with endo-polygalacturonase and subsequent analysis using size exclusion and anion-exchange chromatography. No effect of pH was observed on the de-esterification mode of either of the two enzymes. Acidic, fungal PME converted pectin according to a multiple-chain mechanism, with a limited degree of multiple attack at the intrachain level, both at pH 4.5 and at pH 8.0. A multiple-attack mechanism, with a high degree of multiple attack, was more appropriate to describe the action mode of alkaline, plant PME, both at pH 4.5 and at pH 8.0.
Fibrillarin methylates H2A in RNA polymerase I trans-active promoters in Brassica oleracea
Czech Academy of Sciences Publication Activity Database
Loza-Muller, L.; Rodriguez-Corona, U.; Sobol, Margaryta; Rodriguez-Zapata, L.C.; Hozák, Pavel; Castano, E.
2015-01-01
Roč. 6, Nov 6 (2015) ISSN 1664-462X R&D Projects: GA ČR GAP305/11/2232; GA ČR GA15-08738S; GA MPO FR-TI3/588; GA TA ČR(CZ) TE01020118; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : histones * methylation * RNA polymerase I * Brassica * phosphoinositide Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.495, year: 2015
Shigeyasu, Kunitoshi; Nagasaka, Takeshi; Mori, Yoshiko; Yokomichi, Naosuke; Kawai, Takashi; Fuji, Tomokazu; Kimura, Keisuke; Umeda, Yuzo; Kagawa, Shunsuke; Goel, Ajay; Fujiwara, Toshiyoshi
2015-01-01
Background To improve the outcome of patients suffering from gastric cancer, a better understanding of underlying genetic and epigenetic events in this malignancy is required. Although CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) have been shown to play pivotal roles in gastric cancer pathogenesis, the clinical significance of these events on survival outcomes in patients with gastric cancer remains unknown. Methods This study included a patient cohort with pathologically confirmed gastric cancer who had surgical resections. A cohort of 68 gastric cancers was analyzed. CIMP and MSI statuses were determined by analyzing promoter CpG island methylation status of 28 genes/loci, and genomic instability at 10 microsatellite markers, respectively. A Cox’s proportional hazards model was performed for multivariate analysis including age, stage, tumor differentiation, KRAS mutation status, and combined CIMP/MLH1 methylation status in relation to overall survival (OS). Results By multivariate analysis, longer OS was significantly correlated with lower pathologic stage (P = 0.0088), better tumor differentiation (P = 0.0267) and CIMP-high and MLH1 3' methylated status (P = 0.0312). Stratification of CIMP status with regards to MLH1 methylation status further enabled prediction of gastric cancer prognosis. Conclusions CIMP and/or MLH1 methylation status may have a potential to be prognostic biomarkers for patients with gastric cancer. PMID:26121593
Directory of Open Access Journals (Sweden)
Kunitoshi Shigeyasu
Full Text Available To improve the outcome of patients suffering from gastric cancer, a better understanding of underlying genetic and epigenetic events in this malignancy is required. Although CpG island methylator phenotype (CIMP and microsatellite instability (MSI have been shown to play pivotal roles in gastric cancer pathogenesis, the clinical significance of these events on survival outcomes in patients with gastric cancer remains unknown.This study included a patient cohort with pathologically confirmed gastric cancer who had surgical resections. A cohort of 68 gastric cancers was analyzed. CIMP and MSI statuses were determined by analyzing promoter CpG island methylation status of 28 genes/loci, and genomic instability at 10 microsatellite markers, respectively. A Cox's proportional hazards model was performed for multivariate analysis including age, stage, tumor differentiation, KRAS mutation status, and combined CIMP/MLH1 methylation status in relation to overall survival (OS.By multivariate analysis, longer OS was significantly correlated with lower pathologic stage (P = 0.0088, better tumor differentiation (P = 0.0267 and CIMP-high and MLH1 3' methylated status (P = 0.0312. Stratification of CIMP status with regards to MLH1 methylation status further enabled prediction of gastric cancer prognosis.CIMP and/or MLH1 methylation status may have a potential to be prognostic biomarkers for patients with gastric cancer.
Mota, Suellen F; Oliveira, Denilson F; Heleno, Vladimir C G; Soares, Ana Carolina F; Midiwo, Jacob O; Souza, Elaine A
2017-03-01
Kaurenoic acid derivatives were prepared and submitted to in vitro assays with the fungus Colletotrichum lindemuthianum, which causes anthracnose disease in the common bean. The most active substances were found to be methyl and p-bromobenzylesters, 7 and 9, respectively, of the hydrogenated kaurenoic acid, which presented a minimum inhibitory concentration (MIC) of 0.097 and 0.131 mM, respectively, while the commercial fungicide methyl thiophanate (MT) presented a MIC of 0.143 mM. Substances 7 (1.401 mM) and 9 (1.886 mM) reduced the severity of anthracnose in common bean to values statistically comparable to MT (2.044 mM). According to an in silico study, both compounds 7 and 9 are inhibitors of the ketosteroid isomerase (KSI) enzyme produced by other organisms, the amino acid sequence of which could be detected in fungal genomes. These substances appeared to act against C. lindemuthianum by inhibiting its KSI. Therefore, substances 7 and 9 are promising for the development of new fungicides.
Directory of Open Access Journals (Sweden)
Fakhr Tabatabai SA
1997-07-01
Full Text Available To improve visual disturbance, optic nerve decompression can be performed via transcranial or tran-sphenoidal approaches. Although the surgical exposure in transcranial approach is favourable, yet the optic nerve's presence in the field may make it vulnerable to damage. Of fighty patients with different types of pituitary adenomas, 35 cases with medium-sized (1-3 cm tumors have been studied in a randomized clinical trial during a three year period, to compare the applicability of these approaches. While short hospital stay with better visual outcome was observed in fifteen trans-sphenoidal cases, in comparison to 20 trans-cranial cases, however the preoperative visual status and underlying disorders were similar in both groups. Decompressing the optic apparatus, trans-sphenoidally, seems beneficial, where there are no contraindications for the procedure in medium-sized pituitary adenomas
International Nuclear Information System (INIS)
2007-01-01
In 2006 and 2007 Terasen Pipelines (Trans Mountain) Inc. (now Trans Mountain Pipeline Inc.) submitted a series of applications to the National Energy Board for revisions to the Trans Mountain Tariffs. They were filed in response to apportionment concerns on the Trans Mountain pipeline. Four of the applications involved pronounced and contentious changes to the capacity allocation procedures on the pipeline system. For ease of reference, the Board amalgamated its 4 decisions on these applications into a single document. A map of the Trans Mountain pipeline system as a whole was presented along with a detailed map indicating the delivery locations served by the system in the lower mainland of British Columbia and the state of Washington. The issues considered by the Board in each of these decisions included capacity allocation for Westridge Dock; capacity allocations to export destinations; common carriage requirements; and the need for creating a new barge subcategory. Relevant sections of the National Energy Board Act referred to in the decisions were highlighted. This document also listed the Trans Mountain Tariffs that have introduced notable revisions to the capacity allocation procedures on the system since September 2003. 16 refs., 2 figs., 3 appendices
Benzopyrene exposure disrupts DNA methylation and growth dynamics in breast cancer cells
International Nuclear Information System (INIS)
Sadikovic, Bekim; Rodenhiser, David I.
2006-01-01
Exposures to environmental carcinogens and unhealthy lifestyle choices increase the incidence of breast cancer. One such compound, benzo(a)pyrene (BaP), leads to covalent DNA modifications and the deregulation of gene expression. To date, these mechanisms of BaP-induced carcinogenesis are poorly understood, particularly in the case of breast cancer. We tested the effects of BaP exposure on cellular growth dynamics and DNA methylation in four breast cancer cell lines since disruptions in DNA methylation lead to deregulated gene expression and the loss of genomic integrity. We observed robust time- and concentration-dependent loss of proliferation, S phase and G2M accumulation and apoptosis in p53 positive MCF-7 and T47-D cells. We observed minimal responses in p53 negative HCC-1086 and MDA MB 231 cells. Furthermore, BaP increased p53 levels in both p53 positive cell lines, as well as p21 levels in MCF-7 cells, an effect that was prevented by the p53-specific inhibitor pifithrin-α. No changes in global levels of DNA methylation levels induced by BaP were detected by the methyl acceptor assay (MAA) in any cell line, however, methylation profiling by AIMS (amplification of intermethylated sites) analysis showed dynamic, sequence-specific hypo- and hypermethylation events in all cell lines. We also identified BaP-induced hypomethylation events at a number of genomic repeats. Our data confirm the p53-specific disruption of the cell cycle as well as the disruption of DNA methylation as a consequence of BaP treatment, thus reinforcing the link between environmental exposures, DNA methylation and breast cancer
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
International Nuclear Information System (INIS)
Costa, Vera L; Henrique, Rui; Ribeiro, Franclim R; Pinto, Mafalda; Oliveira, Jorge; Lobo, Francisco; Teixeira, Manuel R; Jerónimo, Carmen
2007-01-01
Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP) in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC), 13 papillary (pRCC), 10 chromophobe (chRCC), and 10 oncocytomas) and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007), PTGS2 (p = 0.002), and RASSF1A (p = 0.0001). CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively), whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004). RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035). In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031) and nuclear grade (p = 0.022), respectively. The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses
Methylation-sensitive amplification polymorphism analysis of fat and muscle tissues in pigs.
Ma, J D; Li, M Z; Zhou, S L; Zhou, C W; Li, X W
2012-09-26
DNA methylation may be involved in regulating the expression of protein-coding genes, resulting in different fat and muscle phenotypes. Using a methylation-sensitive amplified polymorphism approach, we obtained 7423 bands by selective amplification of genomic DNA from six different fat depots and two heterogeneous muscle types from Duroc/Landrace/Yorkshire cross-bred pigs. The degrees of DNA methylation, determined by the percentages of hemi- and fully methylated sites relative to the total number of CCGG sites, were similar in male and female pigs for each specific tissue [χ(2) test; P (two-tailed) > 0.05]. Gender bias was therefore ignored. There were significant differences in the degree of DNA methylation among the eight tissue types [χ(2) test; P(total) (two-tailed) = 0.009]. However, similar degrees of methylation were observed among the six fat depots [χ(2) test; P(fat) (two-tailed) = 0.24 > 0.05]and between the two muscle types [χ(2) test; P(muscle) (two-tailed) = 0.76 > 0.05]. We conclude that the degree of DNA methylation differs between porcine fat and muscle tissue, but that the methylation status of a particular tissue type is similar, despite being deposited at different body sites.
Micro-Sugar-Snap and -Wire-Cut Cookie Baking with Trans- and Zero-Trans-Fat Shortenings
The effect of trans- and zero-trans-fat shortenings on cookie-baking performance was evaluated, using the two AACC micro-cookie-baking methods. Regardless of fat type, sugar-snap cookies made with a given flour were larger in diameter, smaller in height, and greater in weight loss during baking tha...
An easily Prepared Fluorescent pH Probe Based on Dansyl.
Sha, Chunming; Chen, Yuhua; Chen, Yufen; Xu, Dongmei
2016-09-01
A novel fluorescent pH probe from dansyl chloride and thiosemicarbazide was easily prepared and fully characterized by (1)H NMR, (13)C NMR, LC-MS, Infrared spectra and elemental analysis. The probe exhibited high selectivity and sensitivity to H(+) with a pK a value of 4.98. The fluorescence intensity at 510 nm quenched 99.5 % when the pH dropped from 10.88 to 1.98. In addition, the dansyl-based probe could respond quickly and reversibly to the pH variation and various common metal ions showed negligible interference. The recognition could be ascribed to the intramolecular charge transfer caused by the protonation of the nitrogen in the dimethylamino group.
Wolken, W.A.M.; Have, R. ten; Werf, M.J. van der
2000-01-01
Under alkaline conditions, amino acids or proteins catalyze the deacetylation of citral, a major aroma component, resulting in methylheptenone and acetaldehyde formation. 3-Hydroxycitronellal is an intermediate in this reaction. Amino acids also catalyze the cis-trans isomerization of the pure
Eckel, Robert H; Borra, Susan; Lichtenstein, Alice H; Yin-Piazza, Shirley Y
2007-04-24
A 2-day forum was convened to discuss the current status and future implications of reducing trans fatty acids without increasing saturated fats in the food supply while maintaining functionality and consumer acceptance of packaged, processed, and prepared foods. Attendees represented the agriculture and oilseed industry and oil processing, food manufacturing, food service, government, food technology, and health and nutrition disciplines. Presentations included food science behind fatty acid technology, the health science of dietary fatty acids, alternatives to trans fatty acids, and the use of alternatives in food manufacturing and food service. The reduction of trans fatty acids in the food supply is a complex issue involving interdependent and interrelated stakeholders. Actions to reduce trans fatty acids need to carefully consider both intended and unintended consequences related to nutrition and public health. The unintended consequence of greatest concern is that fats and oils high in saturated fats, instead of the healthier unsaturated fats, might be used to replace fats and oils with trans fatty acids. Many different options of alternative oils and fats to replace trans fatty acids are available or in development. Decisions on the use of these alternatives need to consider availability, health effects, research and development investments, reformulated food quality and taste, supply-chain management, operational modifications, consumer acceptance, and cost. The conference demonstrated the value of collaboration between the food industry and health and nutrition professionals, and this conference model should be used to address other food development, processing, and/or technology issues.
Becoming lesbian: Monique Wittig's queer-trans-feminism.
Henderson, Kevin
2018-04-03
Inspired by Lynne Huffer's queer feminist genealogy, this article explores queer-trans-feminism as a project that would bring together queer, feminist, and transgender theory and politics into a shared critical lineage. I suggest that Monique Wittig is a neglected thinker who could re-enliven connections and debates within queer, feminist, and trans theory and politics. Utilizing recent historiographies of queer and feminist theory, I imagine what it would mean to hold on to the figure of the lesbian as a figure for queer-trans-feminist politics rather than render the lesbian anachronistic. I then explore the implications of Wittig's notion that "lesbians are not women" for a queer-trans-feminism. I argue that Wittig's critique of the language of the social sciences offers queer-trans-feminist scholars a source for contemporary self-critique and coalition.
Directory of Open Access Journals (Sweden)
Małgorzata Kowczyk-Sadowy
2015-02-01
Full Text Available This work is a continuation of research on a correlation between the molecular structure and electronic charge distribution of phenolic compounds and their biological activity. The influence of lithium, sodium, potassium, rubidium and cesium cations on the electronic system of trans o-coumaric (2-hydroxy-cinnamic acid was studied. We investigated the relationship between the molecular structure of the tested compounds and their antimicrobial activity. Complementary molecular spectroscopic techniques such as infrared (FT-IR, Raman (FT-Raman, ultraviolet-visible (UV-VIS and nuclear magnetic resonance (1H- and 13C-NMR were applied. Structures of the molecules were optimized and their structural characteristics were calculated by the density functional theory (DFT using the B3LYP method with 6-311++G** as a basis set. Geometric and magnetic aromaticity indices, atomic charges, dipole moments and energies were also calculated. Theoretical parameters were compared to the experimental characteristics of investigated compounds. Correlations between certain vibrational bands and some metal parameters, such as electronegativity, ionization energy, atomic and ionic radius, were found. The microbial activity of studied compounds was tested against Escherichia coli, Bacillus subtilis, Pseudomonas aeruginosa, Staphylococcus aureus, Proteus vulgaris and Candida albicans.
Bae, Woom-Yee; Choi, Jae-Sun; Kim, Ja-Eun; Jeong, Joo-Won
2015-11-01
During tumor progression, hypoxia-inducible factor 1 (HIF-1) plays a critical role in tumor angiogenesis and tumor growth by regulating the transcription of several genes in response to a hypoxic environment and changes in growth factors. This study was designed to investigate the effects of cinnamic aldehyde (CA) on tumor growth and angiogenesis and the mechanisms underlying CA's anti-angiogenic activities. We found that CA administration inhibits tumor growth and blocks tumor angiogenesis in BALB/c mice. In addition, CA treatment decreased HIF-1α protein expression and vascular endothelial growth factor (VEGF) expression in mouse tumors and Renca cells exposed to hypoxia in vitro. Interestingly, CA treatment did not affect the stability of von Hippel-Lindau protein (pVHL)-associated HIF-1α and CA attenuated the activation of mammalian target of rapamycin (mTOR) pathway. Collectively, these findings strongly indicate that the anti-angiogenic activity of CA is, at least in part, regulated by the mTOR pathway-mediated suppression of HIF-1α protein expression and these findings suggest that CA may be a potential drug for human cancer therapy. Copyright © 2015 Elsevier Inc. All rights reserved.
Genders and Individual Treatment Progress in (Non-)Binary Trans Individuals.
Koehler, Andreas; Eyssel, Jana; Nieder, Timo O
2018-01-01
Health care for transgender and transsexual (ie, trans) individuals has long been based on a binary understanding of gender (ie, feminine vs masculine). However, the existence of non-binary or genderqueer (NBGQ) genders is increasingly recognized by academic and/or health care professionals. To gain insight into the individual health care experiences and needs of binary and NBGQ individuals to improve their health care outcomes and experience. Data were collected using an online survey study on experiences with trans health care. The non-clinical sample consisted of 415 trans individuals. An individual treatment progress score was calculated to report and compare participants' individual progress toward treatment completion and consider the individual treatment needs and definitions of completed treatment (ie, amount and types of different treatments needed to complete one's medical transition). Main outcome measures were (i) general and trans-related sociodemographic data and (ii) received and planned treatments. Participants reported binary (81.7%) and different NBGQ (18.3%) genders. The 2 groups differed significantly in basic demographic data (eg, mean age; P < .05). NBGQ participants reported significantly fewer received treatments compared with binary participants. For planned treatments, binary participants reported more treatments related to primary sex characteristics only. Binary participants required more treatments for a completed treatment than NBGQ participants (6.0 vs 4.0). There were no differences with regard to individual treatment progress score. Because traditional binary-focused treatment practice could have hindered NBGQ individuals from accessing trans health care or sufficiently articulating their needs, health care professionals are encouraged to provide a holistic and individual treatment approach and acknowledge genders outside the gender binary to address their needs appropriately. Because the study was made inclusive for non
Trans-Kullo jagatakse tükkideks / Kadrin Karner
Karner, Kadrin
2008-01-01
Primos OÜ omanik ja Trans-Kullo osanik Endel Siff ütles, et Trans-Kullo on aktsionäride erinevate ärihuvide tõttu läinud jagunemisele, mis võib lõppeda ettevõtte likvideerimisega. Lisa: Trans-Kullo
Sexual desire in trans persons: associations with sex reassignment treatment.
Wierckx, Katrien; Elaut, Els; Van Hoorde, Birgit; Heylens, Gunter; De Cuypere, Griet; Monstrey, Stan; Weyers, Steven; Hoebeke, Piet; T'Sjoen, Guy
2014-01-01
Sex steroids and genital surgery are known to affect sexual desire, but little research has focused on the effects of cross-sex hormone therapy and sex reassignment surgery on sexual desire in trans persons. This study aims to explore associations between sex reassignment therapy (SRT) and sexual desire in a large cohort of trans persons. A cross-sectional single specialized center study including 214 trans women (male-to-female trans persons) and 138 trans men (female-to-male trans persons). Questionnaires assessing demographics, medical history, frequency of sexual desire, hypoactive sexual desire disorder (HSDD), and treatment satisfaction. In retrospect, 62.4% of trans women reported a decrease in sexual desire after SRT. Seventy-three percent of trans women never or rarely experienced spontaneous and responsive sexual desire. A third reported associated personal or relational distress resulting in a prevalence of HSDD of 22%. Respondents who had undergone vaginoplasty experienced more spontaneous sexual desire compared with those who planned this surgery but had not yet undergone it (P = 0.03). In retrospect, the majority of trans men (71.0%) reported an increase in sexual desire after SRT. Thirty percent of trans men never or rarely felt sexual desire; 39.7% from time to time, and 30.6% often or always. Five percent of trans men met the criteria for HSDD. Trans men who were less satisfied with the phalloplasty had a higher prevalence of HSDD (P = 0.02). Trans persons who were more satisfied with the hormonal therapy had a lower prevalence of HSDD (P = 0.02). HSDD was more prevalent in trans women compared with trans men. The majority of trans women reported a decrease in sexual desire after SRT, whereas the opposite was observed in trans men. Our results show a significant sexual impact of surgical interventions and both hormonal and surgical treatment satisfaction on the sexual desire in trans persons. © 2013 International Society for Sexual
International Nuclear Information System (INIS)
Jiang, Xiao-Bing; Hu, Bin; He, Dong-Sheng; Mao, Zhi-Gang; Wang, Xin; Song, Bing-Bing; Zhu, Yong-Hong; Wang, Hai-Jun
2015-01-01
Low-level expression of O 6 methylguanine-DNA-methyl transferase (MGMT) prolactinomas has been noted previously in case reports, although what modulates MGMT expression remains unclear. This study therefore aimed to delineate the factors regulating MGMT expression in prolactinomas. We retrospectively reviewed 136 prolactinoma patients who were treated in our center between January 2000 and September 2013. Expression of MGMT, Ki-67, and p53 protein were examined by immunohistochemical staining, and MGMT promoter methylation evaluated with methylation-specific PCR. MGMT immunopositivity was <25 % in 106/136 tumor specimens (77.94 %). MGMT immunoexpression was positively correlated with age (r = 0.251, p = 0.003), but inversely correlated with p53 staining (r = −0.153, p = 0.021). Moreover, reduced MGMT expression was more frequent in atypical prolactinomas (p = 0.044). Methylated MGMT promoter was confirmed in 10/46 specimens (21.7 %), all of which had low level or absent MGMT staining. Both p53 protein (r = −0.33, p = 0.025) and promoter methylation (r = −0.331, p = 0.025) were negatively associated with MGMT expression. Multivariate logistic analysis indicated that age (odds ratio [OR] = 1.127. 95 % confidence interval [CI] 1.027–1.236, p = 0.012) and p53 (OR = 0.116. 95 % CI 0.018–0.761, p = 0.025) staining were independent determents of MGMT expression. The majority of prolactinomas, especially atypical prolactinomas, showed low-level or no MGMT immunoexpression, providing a rationale for the utility of temozolomide as an alternative to managing prolactinomas. In summary, epigenetic and transcriptional regulation are involved in silencing MGMT expression
La politización del cuerpo: subjetividades trans en resistencia
Directory of Open Access Journals (Sweden)
Manuel Roberto Escobar C.
2013-04-01
Full Text Available Se indaga por la experiencia del cuerpo trans (transgénero o transexual, cuya “artificialidad” interpela los órdenes del sujeto en la modernidad. El estudio se ubica en el contexto de dos ciudades latinoamericanas: México D. F. y Bogotá. Se plantea un vínculo entre la corporalidad trans, la biografía y los nombramientos de unas subjetividades que devienen tensión al orden somático moderno, tanto en sus versiones de docilidad y disciplinamiento, como también de hiperestesia y consumo. Así, la intervención singular sobre un cuerpo se torna en politización macro en el ámbito de lo público.
Faria, Adelia F; Marques, Marcella C; Mercadante, Adriana Z
2011-06-15
The composition of carotenoids and phenolic compounds from jambolão fruits (Syzygium cumini) was determined by HPLC-DAD-MS/MS. Two main carotenoids were found in the fruits, all-trans-lutein (43.7%) and all-trans-β-carotene (25.4%). The anthocyanin composition was characterised by the presence of 3,5-diglucosides of five out of six aglycones commonly found in foods. This pattern was also observed for the other flavonoids, since diglucosides of dihydromyricetin, methyl-dihydromyricetin and dimethyl-dihydromyricetin, along with myricetin glucoside and a galloyl-glucose ester were identified. Furthermore, the antioxidant capacity of a functional extract rich in anthocyanins was evaluated through the scavenging capacities of ABTS(+) and peroxyl radical (ORAC) and the protective effect against singlet oxygen ((1)O2). The TEAC values indicated that the hemiacetals/chalcones and quinonoidal bases species (pH⩾5) possess higher scavenging capacity as compared to the flavylium cation (pH<3). The functional extract also showed 60% of dimethylanthracene protection against (1)O2 and an ORAC value of 16.4μmolTrolox/gfruit. Copyright © 2010 Elsevier Ltd. All rights reserved.
Aberrant gene promoter methylation associated with sporadic multiple colorectal cancer.
Directory of Open Access Journals (Sweden)
Victoria Gonzalo
Full Text Available BACKGROUND: Colorectal cancer (CRC multiplicity has been mainly related to polyposis and non-polyposis hereditary syndromes. In sporadic CRC, aberrant gene promoter methylation has been shown to play a key role in carcinogenesis, although little is known about its involvement in multiplicity. To assess the effect of methylation in tumor multiplicity in sporadic CRC, hypermethylation of key tumor suppressor genes was evaluated in patients with both multiple and solitary tumors, as a proof-of-concept of an underlying epigenetic defect. METHODOLOGY/PRINCIPAL FINDINGS: We examined a total of 47 synchronous/metachronous primary CRC from 41 patients, and 41 gender, age (5-year intervals and tumor location-paired patients with solitary tumors. Exclusion criteria were polyposis syndromes, Lynch syndrome and inflammatory bowel disease. DNA methylation at the promoter region of the MGMT, CDKN2A, SFRP1, TMEFF2, HS3ST2 (3OST2, RASSF1A and GATA4 genes was evaluated by quantitative methylation specific PCR in both tumor and corresponding normal appearing colorectal mucosa samples. Overall, patients with multiple lesions exhibited a higher degree of methylation in tumor samples than those with solitary tumors regarding all evaluated genes. After adjusting for age and gender, binomial logistic regression analysis identified methylation of MGMT2 (OR, 1.48; 95% CI, 1.10 to 1.97; p = 0.008 and RASSF1A (OR, 2.04; 95% CI, 1.01 to 4.13; p = 0.047 as variables independently associated with tumor multiplicity, being the risk related to methylation of any of these two genes 4.57 (95% CI, 1.53 to 13.61; p = 0.006. Moreover, in six patients in whom both tumors were available, we found a correlation in the methylation levels of MGMT2 (r = 0.64, p = 0.17, SFRP1 (r = 0.83, 0.06, HPP1 (r = 0.64, p = 0.17, 3OST2 (r = 0.83, p = 0.06 and GATA4 (r = 0.6, p = 0.24. Methylation in normal appearing colorectal mucosa from patients with multiple and solitary CRC showed no relevant
Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo
2012-04-01
Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.
Aberrant Methylation-Mediated Suppression of APAF1 in Myelodysplastic Syndrome.
Zaker, Farhad; Nasiri, Nahid; Amirizadeh, Naser; Razavi, Seyed Mohsen; Yaghmaie, Marjan; Teimoori-Toolabi, Ladan; Maleki, Ali; Bakhshayesh, Masoumeh
2017-04-01
Background: Myelodysplastic syndromes (MDSs) include a diverse group of clonal bone marrow disorders characterized by ineffective hematopoiesis and pancytopenia. It was found that down regulation of APAF1, a putative tumor suppressor gene (TSG), leads to resistance to chemotherapy and disease development in some cancers. In this study, we investigated the relation of APAF1 methylation status with its expression and clinicopathological factors in myelodysplastic syndrome (MDS) patients. Materials and Methods: Methylation Sensitive-High Resolution Melting Curve Analysis (MS-HRM) was employed in studying the methylation of CpG islands in the APAF1promoter region in MDS. Gene expression was analyzed by using real time RT-PCR. Results: 42.6% of patient samples were methylated in promoter region of APAF1analyzed, while methylation of the gene was not seen in controls (P<0.05). Methylation of APAF1was significantly associated with the suppression of its mRNA expression (P=0.00). The methylation status of APAF1in advanced-stage MDS patients (80%) was significantly higher than that of the early-stage MDS patients (28.2%) (P=0.001). The difference in frequency of hypermethylatedAPAF1 gene was significant between good (37.5%) and poor (85.71%) cytogenetic risk groups (P=0.043). In addition, a higher frequency of APAF1hypermethylation was observed in higher-risk MDS group (69.2%) compared to lower-risk MDS group (34.14%) (P=0.026). Conclusion: Our study indicated that APAF1hypermethylation in MDS was associated to high-risk disease classified according to the IPSS, WHO and cytogenetic risk.
Quantitative promoter methylation analysis of multiple cancer-related genes in renal cell tumors
Directory of Open Access Journals (Sweden)
Oliveira Jorge
2007-07-01
Full Text Available Abstract Background Aberrant promoter hypermethylation of cancer-associated genes occurs frequently during carcinogenesis and may serve as a cancer biomarker. In this study we aimed at defining a quantitative gene promoter methylation panel that might identify the most prevalent types of renal cell tumors. Methods A panel of 18 gene promoters was assessed by quantitative methylation-specific PCR (QMSP in 85 primarily resected renal tumors representing the four major histologic subtypes (52 clear cell (ccRCC, 13 papillary (pRCC, 10 chromophobe (chRCC, and 10 oncocytomas and 62 paired normal tissue samples. After genomic DNA isolation and sodium bisulfite modification, methylation levels were determined and correlated with standard clinicopathological parameters. Results Significant differences in methylation levels among the four subtypes of renal tumors were found for CDH1 (p = 0.0007, PTGS2 (p = 0.002, and RASSF1A (p = 0.0001. CDH1 hypermethylation levels were significantly higher in ccRCC compared to chRCC and oncocytoma (p = 0.00016 and p = 0.0034, respectively, whereas PTGS2 methylation levels were significantly higher in ccRCC compared to pRCC (p = 0.004. RASSF1A methylation levels were significantly higher in pRCC than in normal tissue (p = 0.035. In pRCC, CDH1 and RASSF1A methylation levels were inversely correlated with tumor stage (p = 0.031 and nuclear grade (p = 0.022, respectively. Conclusion The major subtypes of renal epithelial neoplasms display differential aberrant CDH1, PTGS2, and RASSF1A promoter methylation levels. This gene panel might contribute to a more accurate discrimination among common renal tumors, improving preoperative assessment and therapeutic decision-making in patients harboring suspicious renal masses.
Adenine N6-methylation in diverse fungi
Seidl, Michael F.
2017-01-01
<p>A DNA modification - methylation of cytosines and adenines - has important roles in diverse processes such as regulation of gene expression and genome stability, yet until recently adenine methylation had been considered to be only a hallmark of prokaryotes. A new study identifies abundant
Standing balance in people with trans-tibial amputation due to vascular causes: A literature review.
Seth, Mayank; Lamberg, Eric
2017-08-01
Balance is an important variable to consider during the rehabilitation process of individuals with trans-tibial amputation. Limited evidence exists on the balance abilities of people with trans-tibial amputation due to vascular causes. The purpose of this article is to review literature and determine if standing balance is diminished in people with trans-tibial amputation due to vascular causes. Literature review. Data were obtained from PubMed, Google Scholar, OandP.org , CINHAL, and Science Direct. Studies were selected only if they included standing balance assessment of people with unilateral trans-tibial amputation due to vascular causes. The review yielded seven articles that met the inclusion criteria. The general test methodology required participants to stand still on force platforms, with feet together, while center of pressure or postural sway was recorded. According to the findings of this review, individuals with trans-tibial amputees due to vascular causes have diminished balance abilities. Limited evidence suggests their balance might be further diminished as compared to individuals with trans-tibial amputation due to trauma. Although the evidence is limited, because of the underlying pathology and presence of comorbidities in individuals with trans-tibial amputation due to vascular causes, one cannot ignore these findings, as even a minor injury from a fall may develop into a non-healing ulcer and affect their health and well-being more severely than individuals with trans-tibial amputation due to trauma. Clinical relevance Individuals with trans-tibial amputation due to vascular causes have diminished balance abilities compared to healthy individuals and individuals with trans-tibial amputation due to trauma. This difference should be considered when designing and fabricating prostheses. Prosthetists and rehabilitation clinicians should consider designing amputation cause-specific rehabilitation interventions, focussing on balance and other
The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.
Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S
2015-08-21
The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.
Oxytetracycline (2-(amino-hydroxy-methylidene)-4-dimethylamino-5,6,10,11,12a-pentahydroxy-6-methyl-4,4a,5,5a-tetrahydrotetracene- 1,3,12-trione) is a majormember of the tetracycline antibiotics family ofwhich are widely administered to animals in concentrated animal feeding operations for purposes o...
Arjunan, V.; Anitha, R.; Thenmozhi, S.; Marchewka, M. K.; Mohan, S.
2016-06-01
The stable conformers of trans-2-methoxycinnamic acid (trans-2MCA) are determined by potential energy profile analysis. The energies of the s-cis and s-trans conformers of trans-2MCA determined by B3LYP/cc-pVTZ method are -612.9788331 Hartrees and -612.9780953 Hartrees, respectively. The vibrational and electronic investigations of the stable s-cis and s-trans conformers of trans-2-methoxycinnamic acid have been carried out extensively with FTIR and FT-Raman spectral techniques. The s-cis conformer (I) with a (C16-C17-C18-O19) dihedral angle equal to 0° is found to be more favoured relative to the one s-trans (II) with (C16-C17-C18-O19) = 180°, possibly due to delocalization, hydrogen bonding and steric repulsion effects between the methoxy and acrylic acid groups. The DFT studies are performed with B3LYP method by utilizing 6-311++G** and cc-pVTZ basis sets to determine the structure, thermodynamic properties, vibrational characteristics and chemical shifts of the compound. The total dipole moments of the conformers determined by B3LYP/cc-pVTZ method are 3.35 D and 4.87 D for s-cis and s-trans, respectively. It reveals the higher polarity of s-trans conformer of trans-2MCA molecule. The electronic and steric influence of the methoxy group on the skeletal frequencies has been analysed. The energies of the frontier molecular orbitals and the LUMO-HOMO energy gap have been determined. The MEP of s-cis conformer lie in the range +1.374e × 10-2 to -1.374e × 10-2 while for s-trans it is +1.591e × 10-2 to -1.591e × 10-2. The total electron density of s-cis conformer lie in the range +5.273e × 10-2 to -5.273e × 10-2 while for s-trans it is +5.403e × 10-2 to -5.403e × 10-2. The MEP and total electron density shows that the s-cis conformer is less polar, less reactive and more stable than the s-trans conformer. All the reactivity descriptors of the molecule have been discussed. Intramolecular electronic interactions and their stabilisation energies have analysed
Thermophysical study of methyl levulinate
International Nuclear Information System (INIS)
Lomba, Laura; Lafuente, Carlos; García-Mardones, Mónica; Gascón, Ignacio; Giner, Beatriz
2013-01-01
Highlights: • We have carried out a thermophysical characterization of methyl levulinate. • The study has been performed over a temperature range from (278.15 to 328.15) K. • pρT behavior has been studied over a temperature range from (333.15 to 453.15) K. • TRIDEN equation has been used to correlate pρT data. • Results have been compared with of ethyl and butyl levulinate and levulinic acid. -- Abstract: Several thermophysical properties (density, speed of sound, refractive index, surface tension, static permittivity and dynamic viscosity) of methyl levulinate have been measured under atmospheric pressure at temperatures from (278.15 to 338.15) K, while the vapor pressure was determined over a temperature range from (333.15 to 453.15) K. Furthermore, pρT behavior has been also investigated using a high-pressure, high-temperature vibrating tube densimeter over a temperature range from (283.15 to 338.15) K and a pressure range from (0.1 to 60.0) MPa. All these values obtained for methyl levulinate have been compared with other members of the levulinate family and also with levulinic acid
Analysis of Trans Fat in Edible Oils with Cooking Process
Song, Juhee; Park, Joohyeok; Jung, Jinyeong; Lee, Chankyu; Gim, Seo Yeoung; Ka, HyeJung; Yi, BoRa; Kim, Mi-Ja; Kim, Cho-il
2015-01-01
Trans fat is a unsaturated fatty acid with trans configuration and separated double bonds. Analytical methods have been introduced to analyze trans fat content in foods including infrared (IR) spectroscopy, gas chromatography (GC), Fourier transform-infrared (FT-IR) spectroscopy, reverses-phase silver ion high performance liquid chromatography, and silver nitrate thin layer chromatography. Currently, FT-IR spectroscopy and GC are mostly used methods. Trans fat content in 6 vegetable oils were analyzed and processing effects including baking, stir-frying, pan-frying, and frying on the formation of trans fat in corn oil was evaluated by GC. Among tested vegetable oils, corn oil has 0.25 g trans fat/100 g, whereas other oils including rapeseed, soybean, olive, perilla, and sesame oils did not have detectable amount of trans fat content. Among cooking methods, stir-frying increased trans fat in corn oil whereas baking, pan-frying, and frying procedures did not make changes in trans fat content compared to untreated corn oils. However, the trans fat content was so low and food label can be declared as ‘0’ trans based on the regulation of Ministry of Food ad Drug Safety (MFDS) (edible oil). PMID:26483890
4-Hydroxy-3-methoxycinnamate esters of milkweed oil: synthesis and characterization.
Harry-O'kuru, Rogers E
2005-11-01
The common milkweed (Asclepias syriaca L.) is a new industrial crop. Its seed oil (TAG) is highly polyunsaturated. In the search for novel applications for milkweed seed oil, the olefinic groups in the TAG were oxidized to polyhydroxy TAG via epoxidation and subsequent epoxy ring-opening reactions. These polyhydroxy TAG exhibit unique industrially desirable emulsoid properties in water. Esterification of the secondary polyhydroxy functionalities of the TAG derivatives of the oil with trans-4-hydroxy-3-methoxycinnamic acid (ferulic acid) has resulted in the development of novel cinnamate esters of milkweed oil. These cinnamates are also obtainable via direct ring-opening of the epoxy TAG intermediate with ferulic acid. Among the interesting characteristics of the ester derivatives is their UV radiation-absorbing property.
Ravindraswami, K.; Janardhana, K.; Gowda, Jayaprakash; Moolya, B. Narayana
2018-04-01
Non linear optical 1-phenyl-3-(4-dimethylamino phenyl) prop-2-en-1-one (PDAC) was synthesized using Claisen - Schmidt condensation method and studied for optical nonlinearity with an emphasis on structure-property relationship. The structural confirmation studies were carried out using 1H-NMR, FT-IR and single crystal XRD techniques. The nonlinear absorption and nonlinear refraction parameters in z-scan with nano second laser pulses were obtained by measuring the profile of propagated beam through the samples. The real and imaginary parts of third-order bulk susceptibility χ(3) were evaluated. Thermo gravimetric analysis is carried out to investigate the thermal stability.
Biotransformation of the sesquiterpene (+)-valencene by cytochrome P450cam and P450BM-3.
Sowden, Rebecca J; Yasmin, Samina; Rees, Nicholas H; Bell, Stephen G; Wong, Luet-Lok
2005-01-07
The sesquiterpenoids are a large class of naturally occurring compounds with biological functions and desirable properties. Oxidation of the sesquiterpene (+)-valencene by wild type and mutants of P450cam from Pseudomonas putida, and of P450BM-3 from Bacillus megaterium, have been investigated as a potential route to (+)-nootkatone, a fine fragrance. Wild type P450cam did not oxidise (+)-valencene but the mutants showed activities up to 9.8 nmol (nmol P450)(-1) min(-1), with (+)-trans-nootkatol and (+)-nootkatone constituting >85% of the products. Wild type P450BM-3 and mutants had higher activities (up to 43 min(-1)) than P450cam but were much less selective. Of the many products, cis- and trans-(+)-nootkatol, (+)-nootkatone, cis-(+)-valencene-1,10-epoxide, trans-(+)-nootkaton-9-ol, and (+)-nootkatone-13S,14-epoxide were isolated from whole-cell reactions and characterised. The selectivity patterns suggest that (+)-valencene has one binding orientation in P450cam but multiple orientations in P450BM-3.
Directory of Open Access Journals (Sweden)
Clayton Antunes Martin
2004-09-01
Full Text Available Este artigo revisa as principais fontes de ácidos graxos trans na dieta e as implicações nutricionais da ingestão elevada destes isômeros. São apresentados resumidamente os métodos analíticos utilizados na identificação e quantificação dos ácidos graxos trans, sendo abordados as suas vantagens e desvantagens. Os alimentos que empregam gordura parcialmente hidrogenada na sua produção, são fontes importantes de isômeros trans na dieta da maior parte da população em países industrializados. Este estudo compara os níveis de ácidos graxos trans em gorduras hidrogenadas, margarinas e batatas frita, analisados em diversos países, incluindo o Brasil. Esta avaliação indica a presença de níveis elevados de isômeros trans em alimentos produzidos no Brasil.This article review the main sources of trans fatty acids in the diet and nutritional implications of the high intake of these isomers. Analytical methods for the identification and quantification of trans fatty acids are presented briefly with regard to advantages and drawbacks of each method. Foods make with partially hidrogenated fats are important sources of trans isomers in the diets of most people in industrialized countries. It is made a comparison between levels of trans fatty acids in shortenings, margarines and potato chips evaluated in Brazil and in other countries. High levels of trans isomers are noted in Brazilian foods.
Directory of Open Access Journals (Sweden)
Tsang Percy CK
2006-08-01
Full Text Available Abstract Background Epigenetic gene silencing is one of the major causes of carcinogenesis. Its widespread occurrence in cancer genome could inactivate many cellular pathways including DNA repair, cell cycle control, apoptosis, cell adherence, and detoxification. The abnormal promoter methylation might be a potential molecular marker for cancer management. Methods For rapid identification of potential targets for aberrant methylation in gynecological cancers, methylation status of the CpG islands of 34 genes was determined using pooled DNA approach and methylation-specific PCR. Pooled DNA mixture from each cancer type (50 cervical cancers, 50 endometrial cancers and 50 ovarian cancers was made to form three test samples. The corresponding normal DNA from the patients of each cancer type was also pooled to form the other three control samples. Methylated alleles detected in tumors, but not in normal controls, were indicative of aberrant methylation in tumors. Having identified potential markers, frequencies of methylation were further analyzed in individual samples. Markers identified are used to correlate with clinico-pathological data of tumors using χ2 or Fisher's exact test. Results APC and p16 were hypermethylated across the three cancers. MINT31 and PTEN were hypermethylated in cervical and ovarian cancers. Specific methylation was found in cervical cancer (including CDH1, DAPK, MGMT and MINT2, endometrial cancer (CASP8, CDH13, hMLH1 and p73, and ovarian cancer (BRCA1, p14, p15, RIZ1 and TMS1. The frequencies of occurrence of hypermethylation in 4 candidate genes in individual samples of each cancer type (DAPK, MGMT, p16 and PTEN in 127 cervical cancers; APC, CDH13, hMLH1 and p16 in 60 endometrial cancers; and BRCA1, p14, p16 and PTEN in 49 ovarian cancers were examined for further confirmation. Incidence varied among different genes and in different cancer types ranging from the lowest 8.2% (PTEN in ovarian cancer to the highest 56
International Nuclear Information System (INIS)
Yang, Hui-Juan; Liu, Vincent WS; Wang, Yue; Tsang, Percy CK; Ngan, Hextan YS
2006-01-01
Epigenetic gene silencing is one of the major causes of carcinogenesis. Its widespread occurrence in cancer genome could inactivate many cellular pathways including DNA repair, cell cycle control, apoptosis, cell adherence, and detoxification. The abnormal promoter methylation might be a potential molecular marker for cancer management. For rapid identification of potential targets for aberrant methylation in gynecological cancers, methylation status of the CpG islands of 34 genes was determined using pooled DNA approach and methylation-specific PCR. Pooled DNA mixture from each cancer type (50 cervical cancers, 50 endometrial cancers and 50 ovarian cancers) was made to form three test samples. The corresponding normal DNA from the patients of each cancer type was also pooled to form the other three control samples. Methylated alleles detected in tumors, but not in normal controls, were indicative of aberrant methylation in tumors. Having identified potential markers, frequencies of methylation were further analyzed in individual samples. Markers identified are used to correlate with clinico-pathological data of tumors using χ 2 or Fisher's exact test. APC and p16 were hypermethylated across the three cancers. MINT31 and PTEN were hypermethylated in cervical and ovarian cancers. Specific methylation was found in cervical cancer (including CDH1, DAPK, MGMT and MINT2), endometrial cancer (CASP8, CDH13, hMLH1 and p73), and ovarian cancer (BRCA1, p14, p15, RIZ1 and TMS1). The frequencies of occurrence of hypermethylation in 4 candidate genes in individual samples of each cancer type (DAPK, MGMT, p16 and PTEN in 127 cervical cancers; APC, CDH13, hMLH1 and p16 in 60 endometrial cancers; and BRCA1, p14, p16 and PTEN in 49 ovarian cancers) were examined for further confirmation. Incidence varied among different genes and in different cancer types ranging from the lowest 8.2% (PTEN in ovarian cancer) to the highest 56.7% (DAPK in cervical cancer). Aberrant methylation
Trans-nationalisation Processes in the Ukrainian Economy
Bolharova Natalya K.; Panevnyk Tetyana M.
2013-01-01
The article considers main processes of trans-nationalisation of Ukrainian economy, identifies specific features of trans-national production and explains some theoretical aspects of these issues. It provides main stages of theoretical comprehension of activity of trans-national corporations (TNC), specific features of the theory of competitive advantages of TNC and specifies the basic ones of them. The article conducts analysis of flows of direct foreign investments into the Ukrainian econom...
Dickey, Lore M; Singh, Anneliese A
2017-08-01
This article explores some of the challenges faced by trans and gender diverse (TGD) individuals who not only are attempting to access trans-affirmative care, but who are also members of the very profession from which they are seeking services. The authors explore challenges related to finding supervision, accessing care for assessment services, and finding a provider for personal counseling. With each example, the authors unpack the challenges and also address the implications for training for all involved. Based on these challenges that TGD psychologists and trainees face in attempting to access care, the authors provide recommendations related to trans-affirmative training for psychologists. © 2017 Wiley Periodicals, Inc.
Clicked Cinnamic/Caffeic Esters and Amides as Radical Scavengers and 5-Lipoxygenase Inhibitors
Directory of Open Access Journals (Sweden)
Jérémie A. Doiron
2014-01-01
Full Text Available 5-Lipoxygenase (5-LO is the key enzyme responsible for the conversion of arachidonic acid to leukotrienes, a class of lipid mediators implicated in inflammatory disorders. In this paper, we describe the design, synthesis, and preliminary activity studies of novel clicked caffeic esters and amides as radical scavengers and 5-LO inhibitors. From known 5-LO inhibitor 3 as a lead, cinnamic esters 8a–h and amides 9a–h as well as caffeic esters 15a–h and amides 16a–h were synthesized by Cu(I-catalyzed [1,3]-dipolar cycloaddition with the appropriate azide precursors and terminal alkynes. All caffeic analogs are proved to be good radical scavengers (IC50: 10–20 μM. Esters 15g and 15f possessed excellent 5-LO inhibition activity in HEK293 cells and were equipotent with the known 5-LO inhibitor CAPE and more potent than Zileuton. Several synthesized esters possess activities rivaling Zileuton in stimulated human polymorphonuclear leukocytes.
Trans labilization of am(m)ine ligands from platinum(II) complexes by cancer cell extracts.
Kasherman, Yonit; Sturup, Stefan; Gibson, Dan
2009-03-01
Cisplatin, cis-[Pt(NH(3))(2)Cl(2)], is an effective anticancer agent in wide clinical use whose efficacy is affected by cellular interactions with sulfur-containing nucleophiles. These interactions can potentially enhance the efficacy of the drug by mediating its delivery to nuclear DNA or inactivate the drug by binding to it irreversibly or by labilizing the NH(3) ligands. Despite the potential importance of trans-labilization reactions in the mechanism of action of the drug, few detailed studies on trans labilization of the ammines have been conducted. We used 2D NMR to show that some trans labilization occurs in proliferating cells and that aqueous extracts of cancer cells labilized 20% of the amine ligands of cis-[PtCl(2)((13)CH(3)NH(2))(2)] after a 12-h incubation. Both low molecular mass nucleophiles (less than 3 kDa) and high molecular mass nucleophiles (more than 3 kDa) labilize the amines with similar efficiency. Studies with model compounds show that thiols and thioethers bind to platinum(II) at similar rates, but thioethers are significantly more efficient at labilizing the am(m)ine at lower pH. N-Acetylcysteine is a more efficient trans-labilizer than glutathione, suggesting that the displacement of the amine proceeds through an associative mechanism. The lag time, the time that elapses from the formation of the Pt-S bond till the release of the amine trans to the sulfur, depends on the pH (for thiols), increasing at lower pH. Quantification of the platinum adducts obtained from incubation of cisplatin with cell extracts indicates that two thirds of the platinum is bound to cellular components with molecular mass greater than 3 kDa.
Directory of Open Access Journals (Sweden)
Mansour S Al-Moundhri
Full Text Available BACKGROUND: Epigenetics, particularly DNA methylation, has recently been elucidated as important in gastric cancer (GC initiation and progression. We investigated the clinical and prognostic importance of whole blood global and site-specific DNA methylation in GC. METHODS: Genomic DNA was extracted from the peripheral blood of 105 Omani GC patients at diagnosis. DNA methylation was quantified by pyrosequencing of global DNA and specific gene promoter regions at 5 CpG sites for CDH1, 7 CpG sites for p16, 4 CpG sites for p53, and 3 CpG sites for RUNX3. DNA methylation levels in patients were categorized into low, medium, and high tertiles. Associations between methylation level category and clinicopathological features were evaluated using χ(2 tests. Survival analyses were carried out using the Kaplan-Meier method and log rank test. A backward conditional Cox proportional hazards regression model was used to identify independent predictors of survival. RESULTS: Older GC patients had increased methylation levels at specific CpG sites within the CDH1, p53, and RUNX-3 promoters. Male gender was significantly associated with reduced global and increased site-specific DNA methylation levels in CDH1, p16, and p53 promoters. Global DNA low methylation level was associated with better survival on univariate analysis. Patients with high and medium methylation vs. low methylation levels across p16 promoter CpG sites, site 2 in particular, had better survival. Multivariate analysis showed that global DNA hypermethylation was a significant independent predictor of worse survival (hazard ratio (HR = 2.0, 95% CI: 1.1-3.8; p = 0.02 and high methylation mean values across p16 promoter sites 1-7 were associated with better survival with HR of 0.3 (95% CI, 0.1-0.8; p = 0.02 respectively. CONCLUSIONS: Analysis of global and site-specific DNA methylation in peripheral blood by pyrosequencing provides quantitative DNA methylation values that may serve as important
Lawley, P. D.; Shah, S. A.
1972-01-01
1. The following methods for hydrolysis of methyl-14C-labelled RNA, and for chromatographic isolation and determination of the products, were investigated: enzymic digestion to nucleosides at pH6 or 8; alkaline hydrolysis and conversion into nucleosides; hydrolysis by acid to pyrimidine nucleotides and purine bases, or completely to bases; chromatography on Dowex 50 (NH4+ form) at pH6 or 8.9, or on Dowex 50 (H+ form), or on Sephadex G-10. 2. The suitability of the various methods for determination of methylation products was assessed. The principal product, 7-methylguanosine, was unstable under the conditions used for determinations of nucleosides. 3- and 7-Methyladenine and 3- and 7-methylguanine are best determined as bases; 1-methyladenine and 3-methylcytosine can be isolated as either nucleosides or bases; O6-methylguanine is unstable under the acid hydrolysis conditions used and can be determined as the nucleoside; 3-methyluracil was detected, but may be derived from methylation of the ionized form of uracil. 3. Differences between the patterns of methylation of RNA and homopolyribonucleotides by the N-methyl-N-nitroso compounds and dimethyl sulphate were found: the nitroso compounds were able to methylate O-6 of guanine, were relatively more reactive at N-7 of adenine and probably at N-3 of guanine, but less reactive at N-1 of adenine, N-3 of cytosine and probably at N-3 of uridine. They probably reacted more with the ribose–phosphate chain, but no products from this were identified. 4. The possible influences of these differences on biological action of the methylating agents is discussed. Nitroso compounds may differ principally in their ability to induce miscoding in the Watson–Crick sense by reaction at O-6 of guanine. Both types of agent may induce miscoding to a lesser extent through methylation at N-3 of guanine; both can methylate N atoms, presumably preventing Watson–Crick hydrogen-bonding. N-Methyl-N-nitrosourea can degrade RNA, possibly
Melatonin-Mediated Development of Ovine Cumulus Cells, Perhaps by Regulation of DNA Methylation
Directory of Open Access Journals (Sweden)
Yi Fang
2018-02-01
Full Text Available Cumulus cells of pre-pubertal domestic animals are dysfunctional, perhaps due to age-specific epigenetic events. This study was designed to determine effects of melatonin treatment of donors on methylation modification of pre-pubertal cumulus cells. Cumulus cells from germinal vesicle stage cumulus oocyte complexes (COCs were collected from eighteen lambs which were randomly divided into control group (C and melatonin group given an 18 mg melatonin implant subcutaneous (M. Compared to the C group, the M group had higher concentrations of melatonin in plasma and follicular fluid (p < 0.05, greater superovulation, a higher proportion of fully expanded COCs, and a lower proportion of apoptotic cumulus cells (p < 0.05. Real-time PCR results showed that melatonin up-regulated expression of genes MT1, Bcl2, DNMT1, DNMT3a and DNMT3b, but down-regulated expression of genes p53, Caspase 3 and Bax (p < 0.05. Furthermore, melatonin increased FI of FITC (global methylation level on cumulus cells (p < 0.05. To understand the regulation mechanism, the DNMTs promoter methylation sequence were analyzed. Compared to the C group, although there was less methylation at two CpG sites of DNMT1 (p < 0.05 and higher methylation at two CpG sites of DNMT3a (p < 0.05, there were no significant differences in methylation of the detected DNMT1 and DNMT3a promoter regions. However, there were lower methylation levels at five CpG sites of DNMT3b, which decreased methylation of detected DNMT3b promoter region on M group (p < 0.05. In conclusion, alterations of methylation regulated by melatonin may mediate development of cumulus cells in lambs.
{sup 13}C-Methyl isocyanide as an NMR probe for cytochrome P450 active sites
Energy Technology Data Exchange (ETDEWEB)
McCullough, Christopher R.; Pullela, Phani Kumar [Marquette University, Chemical Proteomics Facility at Marquette, Department of Chemistry (United States); Im, Sang-Choul; Waskell, Lucy [University of Michigan and VA Medical Center, Department of Anesthesiology (United States); Sem, Daniel S. [Marquette University, Chemical Proteomics Facility at Marquette, Department of Chemistry (United States)], E-mail: Daniel.sem@marquette.edu
2009-03-15
The cytochromes P450 (CYPs) play a central role in many biologically important oxidation reactions, including the metabolism of drugs and other xenobiotic compounds. Because they are often assayed as both drug targets and anti-targets, any tools that provide: (a) confirmation of active site binding and (b) structural data, would be of great utility, especially if data could be obtained in reasonably high throughput. To this end, we have developed an analog of the promiscuous heme ligand, cyanide, with a {sup 13}CH{sub 3}-reporter attached. This {sup 13}C-methyl isocyanide ligand binds to bacterial (P450cam) and membrane-bound mammalian (CYP2B4) CYPs. It can be used in a rapid 1D experiment to identify binders, and provides a qualitative measure of structural changes in the active site.
International Nuclear Information System (INIS)
Short, Duncan M.; Lyon, Robert; Watson, David G.; Barski, Oleg A.; McGarvie, Gail; Ellis, Elizabeth M.
2006-01-01
The reductive metabolism of trans, trans-muconaldehyde, a cytotoxic metabolite of benzene, was studied in mouse liver. Using an HPLC-based stopped assay, the primary reduced metabolite was identified as 6-hydroxy-trans, trans-2,4-hexadienal (OH/CHO) and the secondary metabolite as 1,6-dihydroxy-trans, trans-2,4-hexadiene (OH/OH). The main enzymes responsible for the highest levels of reductase activity towards trans, trans-muconaldehyde were purified from mouse liver soluble fraction first by Q-sepharose chromatography followed by either blue or red dye affinity chromatography. In mouse liver, trans, trans-muconaldehyde is predominantly reduced by an NADH-dependent enzyme, which was identified as alcohol dehydrogenase (Adh1). Kinetic constants obtained for trans, trans-muconaldehyde with the native Adh1 enzyme showed a V max of 2141 ± 500 nmol/min/mg and a K m of 11 ± 4 μM. This enzyme was inhibited by pyrazole with a K I of 3.1 ± 0.57 μM. Other fractions were found to contain muconaldehyde reductase activity independent of Adh1, and one enzyme was identified as the NADPH-dependent aldehyde reductase AKR1A4. This showed a V max of 115 nmol/min/mg and a K m of 15 ± 2 μM and was not inhibited by pyrazole
Directory of Open Access Journals (Sweden)
Cernatescu Corina
2004-01-01
Full Text Available The reactivity of the p-substituted methyl group in 1-methyl-2-p-tolylbenzimidazolium and 1-methyl-2-p-methylstyrylbenzimidazolium iodides with p-nitroso-dimethylaniline (p-NDMA and aromatic aldehydes was studied. According to literature data on the steric effects produced by the bulky N-l methyl group, the 2-p-tolyl substituted salt does not react with p-NDMA. On the other hand, 2-p-methylstyryl substituted salts give condensation reactions, similarly to 1,2,3-trimethylbenzimidazolium iodides. The compounds obtained from the reaction with aromatic aldehydes can be used as dyeing substances, photosensitizers or as dienic monomers, due to the conjugated chain from C-2.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Sha; Zhang, Zhena [Tianjin Key Laboratory of Applied Catalysis Science and Technology, Department of Catalysis Science and Engineering, School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China); Zhu, Kongying, E-mail: ausky@tju.edu.cn [Analysis and Measurement Center, Tianjin University, Tianjin 300072 (China); Chen, Jixiang, E-mail: jxchen@tju.edu.cn [Tianjin Key Laboratory of Applied Catalysis Science and Technology, Department of Catalysis Science and Engineering, School of Chemical Engineering and Technology, Tianjin University, Tianjin 300072 (China)
2017-05-15
Highlights: • Bifunctional Ni{sub 2}P/AlMCM-41 was prepared by in situ phosphorization at 300 °C. • There were similar Ni{sub 2}P particle sizes in Ni{sub 2}P/AlMCM-41 with different Si/Al ratios. • The acid amount of Ni{sub 2}P/AlMCM-41 increased with decreasing the Si/Al ratio. • Ni{sub 2}P/AlMCM-41 with the Si/Al ratio of 5 had the highest activity for isomerization. • Ni{sub 2}P/AlMCM-41 had very low activity for methanation and C−C bond hydrogenolysis. - Abstract: A series of Ni{sub 2}P/AlMCM-41-x bifunctional catalysts with different Si/Al ratios (x) were synthesized by in situ phosphorization of Ni/AlMCM-41-x with triphenylphosphine (nominal Ni/P ratio of 0.75) at 300 °C on a fixed-bed reactor. For comparison, NiP/AlMCM-41-5-TPR was also prepared by the TPR method from the supported nickel phosphate with the Ni/P ratio of 1.0, during which metallic Ni rather than Ni{sub 2}P formed. TEM images show that Ni and Ni{sub 2}P particles uniformly distributed in Ni{sub 2}P/AlMCM-41-x and NiP/AlMCM-41-5-TPR. The Ni{sub 2}P/AlMCM-41-x acidity increased with decreasing the Si/Al ratio. In the hydroconversion of methyl laurate, the conversions were close to 100% on all catalysts at 360 °C, 3.0 MPa, methyl laurate WHSV of 2 h{sup −1} and H{sub 2}/methyl laurate ratio of 25. As to Ni{sub 2}P/AlMCM-41-x, with decreasing the Si/Al ratio, the total selectivity to C11 and C12 hydrocarbons decreased, while the total selectivity to isoundecane and isododecane (S{sub i-C11+i-C12}) firstly increased and then decreased. Ni{sub 2}P/AlMCM-41-5 gave the largest S{sub i-C11+i-C12} of 43.2%. While NiP/AlMCM-41-5-TPR gave higher S{sub i-C11+i-C12} than Ni{sub 2}P/AlMCM-41-5, it was more active for the undesired C−C bond cleavage and methanation. We propose that the in-situ phosphorization adopted here is a promising approach to preparing Ni{sub 2}P-based bifunctional catalysts.
Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.
Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma
2014-03-01
Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®
Trans issues in Liz Lochhead's 'Not Changed'
Kaličanin Milena M.
2017-01-01
The paper is divided into four sections. In the first section entitled 'Introducing and Defining Trans (Issues)', the basic terms of transgender, transvestite, and transsexual are defined by relying on Stryker's Transgender History (2008). The second part of the paper, 'Trans Studies: In-Between Feminist and Queer Theory?', places transgender studies into an academic context by referring to the theoretical framework provided by trans theorists Stryker, Stone, and Ranck who unanimously claim t...
Trans fats in New Zealand: time for labelling regulations?
Gladding, Patrick; Benatar, Jocelyne R
2007-11-09
Trans fats (trans fatty acids) are commonly used for deep frying in restaurants and in the fast food, snack food, fried food, and baked goods industries, often to extend the shelf life of foods. However they are widely considered to be harmful to health. Trans fats were banned in New York City restaurants from 1 July 2007, and there is growing vocal opposition to trans fats in the European Union. Denmark became the first country, in March 2003, to introduce laws regulating the content of trans fats in food (maximum of 2% of edible fats and oils). What are trans fats, what harm do they cause, and should New Zealand also consider imposing mandatory regulations on their use in food? This article explores the issues.
Martinière, Alexandre; Bassil, Elias; Jublanc, Elodie; Alcon, Carine; Reguera, Maria; Sentenac, Hervé; Blumwald, Eduardo; Paris, Nadine
2013-10-01
The pH homeostasis of endomembranes is essential for cellular functions. In order to provide direct pH measurements in the endomembrane system lumen, we targeted genetically encoded ratiometric pH sensors to the cytosol, the endoplasmic reticulum, and the trans-Golgi, or the compartments labeled by the vacuolar sorting receptor (VSR), which includes the trans-Golgi network and prevacuoles. Using noninvasive live-cell imaging to measure pH, we show that a gradual acidification from the endoplasmic reticulum to the lytic vacuole exists, in both tobacco (Nicotiana tabacum) epidermal (ΔpH -1.5) and Arabidopsis thaliana root cells (ΔpH -2.1). The average pH in VSR compartments was intermediate between that of the trans-Golgi and the vacuole. Combining pH measurements with in vivo colocalization experiments, we found that the trans-Golgi network had an acidic pH of 6.1, while the prevacuole and late prevacuole were both more alkaline, with pH of 6.6 and 7.1, respectively. We also showed that endosomal pH, and subsequently vacuolar trafficking of soluble proteins, requires both vacuolar-type H(+) ATPase-dependent acidification as well as proton efflux mediated at least by the activity of endosomal sodium/proton NHX-type antiporters.
Physics of Trans-Planckian Gravity
Dvali, Gia; Germani, Cristiano
2011-01-01
We study aspects of the phenomenon of gravitational UV-self-completeness and its implications for deformations of Einstein gravity. In a ghost-free theory flowing to Einstein gravity in the IR trans-Planckian propagating quantum degrees of freedom cannot exist. The only physical meaning of a trans-Planckian pole is the one of a classical state (Black Hole) which is fully described by the light IR quantum degrees of freedom and gives exponentially-suppressed contributions to virtual processes. In this sense Einstein gravity is UV self-complete, although not Wilsonian. We show that this UV/IR correspondence puts a severe constraint on any attempt of conventional Wilsonian UV-completion of trans-Planckian gravity. In particular, there is no well-defined energy domain in which gravity could become asymptotically weak or safe.
Energy Technology Data Exchange (ETDEWEB)
Grieser, F.; Thistlethwaite, P.; Urquhart, R.; Patterson, L.K.
1987-09-24
The emission spectrum of N-(5-(dimethylamino)naphthalene-1-sulfonyl)dihexadecylamine (dansyldihexadecylamine) in monolayers at the air-water interface has been studied. In some cases sudden shifts in the dansyl emission can be correlated with particular features of the surface pressure-area isotherms. These spectral shifts can be explained in terms of a change in the conformation of the head group on the surface and with aggregation of the dansyldihexadecylamine. In other cases the dansyl emission shows a blue shift with increasing compression that can be associated with reduced head-group hydration.
Is there such a thing as Tech Trans?
DEFF Research Database (Denmark)
Helms, Niels Henrik
2009-01-01
This short paper is an attempt to start a discussion on some basic issues within the concept of Tech Trans especially the relationship between flow and structure within the concept. The background to this paper is first of all an academic interest in the relationship between flow and structure...... explores the concept of Tech Trans, show rooms and innovation systems, and it suggests that the notion of Tech Trans should be defined in the fix point of vertical and horizontal innovation. Finally this paper suggests a mathematical formula for evaluating Tech Trans....
Directory of Open Access Journals (Sweden)
Muamer Dizdar
2018-04-01
Full Text Available Phenolic acids and their derivatives found in nature are well-known for their potential biological activity. In this study, two amides derived from trans-caffeic/ferulic acid and dopamine were synthesized and characterized by Fourier-transform infrared spectroscopy (FTIR, mass spectrometry, proton and carbon-13 nuclear magnetic resonance spectroscopy. The compounds were tested for the inhibition of acetylcholinesterase (AChE from Electrophorus electricus and for antioxidant activity by scavenging 2,2-diphenyl-1-pycrylhydrazyl free radical (DPPH• and 2,2′-azinobis(3-ethylbenzothiazoline-6-sulphonic acid radical cation (ABTS•+, reducing ferric ions, and ferrous ions chelation. N-trans-Feruloyldopamine displayed the highest inhibitory effect on AChE with half-maximal inhibitory concentration (IC50 values of 8.52 μM. In addition, an in silico study was done to determine the most favorable AChE cluster with the synthesized compounds. Further, these clusters were investigated for binding positions at the lowest free binding energy. Both synthesized hydroxycinnamates were found to be better antioxidants than the parent acids in in vitro tests applied. N-trans-Caffeoyldopamine showed the best antioxidant activity in the three tested methods—against non-biological stable free radicals IC50 5.95 μM for DPPH•, 0.24 μM for the ABTS•+ method, and for reducing power (ascorbic acid equivalent (AAE 822.45 μmol/mmol—while for chelation activity against Fe2+ ions N-trans-feruloyldopamine had slightly better antioxidant activity (IC50 3.17 mM.
Meteoritic Evidence for Injection of Trans-Neptunian Objects into the Inner Solar System
Zolensky, M.; Johnson, J.; Ziegler, K.; Chan, Q.; Kebukawa, Y.; Bottke, W.; Fries, M.; Martinez, J.; Le, L.
2018-01-01
There is excellent evidence that a dynamical instability in the early solar system led to gravitational interactions between the giant planets and trans-Neptunian planetesimals. Giant planetary migration triggered by the instability dispersed a disk of primordial trans-Neptunian object (TNOs) and created a number of small body reservoirs (e.g. the Kuiper Belt, scattered disk, irregular satellites, and the Jupiter/Neptune Trojan populations). It also injected numerous bodies into the main asteroid belt, where modeling shows they can successfully reproduce the observed P and D-type asteroid populations.
Clinical research on high myopia treatments using AMARIS trans-epithelial PRK
Directory of Open Access Journals (Sweden)
Wu-Qiang Shan
2015-12-01
Full Text Available AIM:To evaluate the efficiency and safety of high myopia treatments using AMARIS trans-epithelial photorefractive keratectomy(PRK.METHODS:One hundred and thirty six eyes in 68 patients with high myopic were treated using Amaris trans-epithelial PRK during December 2012~December 2013. Post-operative pain, haze, visual acuity, refraction and intraocular pressure(IOPwere analyzed during 12mo follow-up post-operatively.RESULTS:One hundred and eight eyes in 54 patients felt no discomfort at all, while 28 eyes in 14 patients reported dry eye, slight pain and foreign body sensation. UCVA between the two groups showed statistically different at 3, 6mo and 1a(t=2.04, P=0.047. UCVA at 3mo was the best compared with those at other time pionts, and became stable at 6mo. UCVA of all patients were above 0.8 at 12mo,and had no difference with that before operations(t=1.508, P=0.1670. Haze were hardly seen, and most of them were between grade 0~1. The patients' satisfaction was over 85% according to the survey about night vision, dry eye and asthenopia.CONCLUSION:Because of the great advantages of no-touch, fast recovery and less side effects, trans-epithelial PRK has great efficiency, safety and satisfaction. It now is the most ideal method of surface ablation for high myopia treatments.
Energy Technology Data Exchange (ETDEWEB)
Omori, Alvaro Takeo; Portas, Viviane Barbosa; Oliveira, Camila de Souza de, E-mail: alvaro.omori@ufabc.edu.br [Centro de Ciencias Naturais e Humanas, Universidade Federal do ABC, SP (Brazil)
2012-07-01
The present paper describes a simple, low-costly and environmentally friendly procedure for reduction of 4-(dimethylamino)benzaldehyde using carrot bits in water. This interdisciplinary experiment can be used to introduce the concepts of biocatalysis and green chemistry to undergraduate students. (author)
Directory of Open Access Journals (Sweden)
Marcos Luiz Antunes
2008-02-01
Full Text Available O colesteatoma de orelha média atingia mais de 5 milhões de pessoas até a década de 80. Vários modelos animais já foram utilizados para alternativas de tratamento do colesteatoma sem sucesso. OBJETIVO: Estudar os efeitos do ácido trans-retinóico, uso tópico na orelha externa em cobaias, na inibição da formação do colesteatoma de orelha média induzido pelo propilenoglicol. Estudo experimental prospectivo. MATERIAL E MÉTODOS: 25 cobaias foram submetidas à aplicação de propilenoglicol a 100% na bula timpânica bilateralmente e uma solução de ácido trans-retinóico foi aplicada topicamente (total de 5 aplicações na orelha externa, região justa-timpânica, na orelha direita, enquanto na orelha esquerda aplicou-se solução fisiológica (orelha controle. As cobaias foram sacrificadas após 6 semanas do procedimento inicial e os ossos temporais foram separados, fixados e descalcificados, para análise macroscópica e histológica. RESULTADOS: Os achados macroscópicos evidenciaram a presença e suspeita de colesteatoma em 25% das orelhas direitas e 85% das orelhas esquerdas (P=0,0003*. Os achados histológicos dos 40 ossos temporais evidenciaram a presença de colesteatoma em 30% das orelhas direitas e 75% das orelhas esquerdas (P=0,0104*. CONCLUSÃO: O uso tópico do ácido trans-retinóico é efetivo na inibição da formação de colesteatoma induzido pelo propilenoglicol em cobaias.Middle ear cholesteatoma affected more than 5 million people until the 80`s. Many animal models were used, unsuccessfully, to study an alternative therapy to cholesteatoma. AIM: observe the effect of the trans-retinoic acid in the inhibition of middle ear cholesteatomas induced by propylene glycol. STUDY DESIGN: Clinical and Experimental. METHODS: 25 guinea pigs were submitted to the application of a 100% propylene glycol solution in their bulla bilaterally and a solution of trans-retinoic acid was applied locally in the external right ear, while
Trans issues in Liz Lochhead's 'Not Changed'
Directory of Open Access Journals (Sweden)
Kaličanin Milena M.
2017-01-01
Full Text Available The paper is divided into four sections. In the first section entitled 'Introducing and Defining Trans (Issues', the basic terms of transgender, transvestite, and transsexual are defined by relying on Stryker's Transgender History (2008. The second part of the paper, 'Trans Studies: In-Between Feminist and Queer Theory?', places transgender studies into an academic context by referring to the theoretical framework provided by trans theorists Stryker, Stone, and Ranck who unanimously claim that transgender studies should have a place of its own within the academia and that trans theory should solely be written by transsexuals. These ideas are applied in the interpretation of Lochhead's story 'Not Changed' in the third segment of the paper. The critical insights of Butler (Gender Trouble, 1990; Undoing Gender, 2004 are found to be most helpful in the interpretation of Lochhead's story about Michael who has willingly undergone Hormone Replacement Therapy to become transsexual Michele. Finally, in the concluding remarks, Lochhead's story is viewed as a trans woman manifesto, urging both non-transsexual and transsexual persons to embrace new beginnings in their relationship.
Trans-nationalisation Processes in the Ukrainian Economy
Directory of Open Access Journals (Sweden)
Bolharova Natalya K.
2013-12-01
Full Text Available The article considers main processes of trans-nationalisation of Ukrainian economy, identifies specific features of trans-national production and explains some theoretical aspects of these issues. It provides main stages of theoretical comprehension of activity of trans-national corporations (TNC, specific features of the theory of competitive advantages of TNC and specifies the basic ones of them. The article conducts analysis of flows of direct foreign investments into the Ukrainian economy. It shows distribution of direct foreign investments into Ukraine by main countries-investors, regions-recipients and types of economic activity. It conducts review and analysis of the modern state of trans-national corporations of foreign origin in the Ukrainian market. It considers functioning of domestic TNC in Ukraine and main tendencies of entering of Ukrainian companies into the world environment and also identifies directions of further development of these phenomena. Prospects of further studies in this direction are identification of the degree of trans-nationalisation processes in the Ukrainian economy and identification of the positive effect, in particular, synergy from integration and globalisation.
Formation of trans fats during food preparation.
Przybylski, Oman; Aladedunye, Felix A
2012-01-01
An investigation was completed to determine how typical cooking procedures used in food preparation, such as baking and stir-frying, affect trans fats formation. Canola oil was used as the main fat ingredient. Zucchini cake and gingersnap cookies were baked at 180o C and 200o C, while stir-fried chicken was prepared at 200o C and 275o C. The lipids from the food were extracted following the Folch procedure, and analyzed for trans fatty acids according to ISO official method 15304. Minimal changes were observed in the amount of trans fats during baking. Application of extreme temperatures during baking, which caused carbonization of the outer layer of products, yielded an insignificant increase in the amount of trans isomers. As with baking, stir-frying did not result in significant isomerization of the fatty acids, even when the oil was heated to 275o C and smoking heavily before the food was placed in it. Irrespective of the cooking procedure, linolenic acid was the most prone to isomerization with the highest amount of trans isomers formation. Baking and stir-frying at normal and/or extreme temperatures do not significantly affect the amounts of trans fats. Likewise, heating oil to the smoking point during stir-frying may decrease the amount of polyunsaturated fatty acids because of oxidative degradation.
Binge-type behavior in rats consuming trans-fat-free shortening.
Wojnicki, F H E; Charny, G; Corwin, R L W
2008-07-05
Studies from this and another laboratory involving an animal model of binge-type behavior have used vegetable shortening containing trans-fats. Due to reformulations by vegetable shortening manufacturers to remove trans-fats from their products, only trans-fat-free shortenings are now available. The goal of the present study was to assess binge-type behavior in rats with trans-fat and trans-free vegetable shortening. Trans-fat-free shortening was provided to three different groups of non-food-deprived male Sprague Dawley rats on different schedules of access: continuous access (24 h/day-7 days/week), daily access (1 h every day), and intermittent access (1 h on Mondays, Wednesdays, Fridays). Trans-fat shortening was provided to a fourth group on the intermittent access schedule. A fifth group had no shortening access (chow only). Both intermittent groups (trans-fat-free and trans-fat) consumed significantly more shortening during the 1-h period of availability than did the daily group, and there was no difference in shortening intakes between the intermittent groups. These results are identical to previous reports of binge-type behavior in rats using this model. Thus, binge-type behavior in the present behavioral model depends upon the schedule of access, not the presence of trans-fats in the shortening.
Predictive value of CHFR and MLH1 methylation in human gastric cancer.
Li, Yazhuo; Yang, Yunsheng; Lu, Youyong; Herman, James G; Brock, Malcolm V; Zhao, Po; Guo, Mingzhou
2015-04-01
Gastric carcinoma (GC) has one of the highest mortality rates of cancer diseases and has a high incidence rate in China. Palliative chemotherapy is the main treatment for advanced gastric cancer. It is necessary to compare the effectiveness and toxicities of different regimens. This study explores the possibility of methylation of DNA damage repair genes serving as a prognostic and chemo-sensitive marker in human gastric cancer. The methylation status of five DNA damage repair genes (CHFR, FANCF, MGMT, MLH1, and RASSF1A) was detected by nested methylation-specific PCR in 102 paraffin-embedded gastric cancer samples. Chi-square or Fisher's exact tests were used to evaluate the association of methylation status and clinic-pathological factors. The Kaplan-Meier method and Cox proportional hazards models were employed to analyze the association of methylation status and chemo-sensitivity. The results indicate that CHFR, MLH1, RASSF1A, MGMT, and FANCF were methylated in 34.3% (35/102), 21.6% (22/102), 12.7% (13/102), 9.8% (10/102), and 0% (0/102) of samples, respectively. No association was found between methylation of CHFR, MLH1, RASSF1A, MGMT, or FANCF with gender, age, tumor size, tumor differentiation, lymph node metastasis, and TNM stage. In docetaxel-treated gastric cancer patients, resistance to docetaxel was found in CHFR unmethylated patients by Cox proportional hazards model (HR 0.243, 95% CI, 0.069-0.859, p = 0.028), and overall survival is longer in the CHFR methylated group compared with the CHFR unmethylated group (log-rank, p = 0.036). In oxaliplatin-treated gastric cancer patients, resistance to oxaliplatin was found in MLH1 methylated patients (HR 2.988, 95% CI, 1.064-8.394, p = 0.038), and overall survival was longer in the MLH1 unmethylated group compared with the MLH1 methylated group (log-rank, p = 0.046). CHFR is frequently methylated in human gastric cancer, and CHFR methylation may serve as a docetaxel-sensitive marker. MLH1 methylation was
Fu, Tao; Pappou, Emmanouil P.; Guzzetta, Angela A.; Jeschke, Jana; Kwak, Ruby; Dave, Pujan; Hooker, Craig M.; Morgan, Richard; Baylin, Stephen B.; Iacobuzio-Donahue, Christine A.; Wolfgang, Christopher L.; Ahuja, Nita
2012-01-01
Purpose Little information is available on genetic and epigenetic changes in duodenal adenocarcinomas. The purpose was to identify possible subsets of duodenal adenocarcinomas based on microsatellite instability (MSI), DNA methylation, mutations in the KRAS and BRAF genes, clinicopathologic features, and prognosis. Experimental Design Demographics, tumor characteristics and survival were available for 99 duodenal adenocarcinoma patients. Testing for KRAS and BRAF mutations, MSI, MLH1 methylation and CpG island methylator phenotype (CIMP) status was performed. A Cox proportional hazard model was built to predict survival. Results CIMP+ was detected in 27 of 99 (27.3%) duodenal adenocarcinomas, and was associated with MSI (P = 0.011) and MLH1 methylation (P CIMP− tumors. No BRAF V600E mutation was detected. Among the CIMP+ tumors, 15 (55.6%) were CIMP+/MLH1-unmethylated (MLH1-U). Kaplan-Meier analysis showed tumors classified by CIMP, CIMP/MLH1 methylation status or CIMP/MSI status could predict overall survival (OS; P = 0.047, 0.002, and 0.002, respectively), while CIMP/MLH1 methylation status could also predict time-to-recurrence (TTR; P = 0.016). In multivariate analysis, CIMP/MLH1 methylation status showed a significant prognostic value regarding both OS (P CIMP+/MLH1-U tumors had the worst OS and TTR. Conclusions Our results demonstrate existence of CIMP in duodenal adenocarcinomas. The combination of CIMP+/MLH1-U appears to be independently associated with poor prognosis in patients with duodenal adenocarcinomas. This study also suggests that BRAF mutations are not involved in duodenal tumorigenesis, MSI or CIMP development. PMID:22825585
Energy Technology Data Exchange (ETDEWEB)
Peng, Cheng-Liang; Luo, Tsai-Yueh; Lin, Wuu-Jyh [Isotope Application Division, Institute of Nuclear Energy Research, PO Box 3-27, Longtan Taoyuan 325, Taiwan (China); Tsai, Han-Min; Yang, Shu-Jyuan; Lin, Chia-Fu; Shieh, Ming-Jium, E-mail: soloman@ntu.edu.tw [Institute of Biomedical Engineering, College of Medicine and College of Engineering, National Taiwan University, No 1, Section 1, Jen-Ai Road, Taipei 10051, Taiwan (China)
2011-07-01
Thermosensitive nanoparticles based on poly(N-isopropylacrylamide-co-((2-dimethylamino)ethylmethacrylate)) (poly(NIPA-co-DMAEMA)) copolymers were successfully fabricated by free radical polymerization. The lower critical solution temperature (LCST) of the synthesized nanoparticles was 41 deg. C and a temperature above which would cause the nanoparticles to undergo a volume phase transition from 140 to 100 nm, which could result in the expulsion of encapsulated drugs. Therefore, we used the poly(NIPA-co-DMAEMA) nanoparticles as a carrier for the controlled release of a hydrophobic anticancer agent, 7-ethyl-10-hydroxy-camptothecin (SN-38). The encapsulation efficiency and loading content of SN-38-loaded nanoparticles at an SN-38/poly(NIPA-co-DMAEMA) ratio of 1/10 (D/P = 1/10) were about 80% and 6.293%, respectively. Moreover, the release profile of SN-38-loaded nanoparticles revealed that the release rate at 42 deg. C (above LCST) was higher than that at 37 deg. C (below LCST), which demonstrated that the release of SN-38 could be controlled by increasing the temperature. The cytotoxicity of the SN-38-loaded poly(NIPA-co-DMAEMA) nanoparticles was investigated in human colon cancer cells (HT-29) to compare with the treatment of an anticancer drug, Irinotecan (CPT-11). The antitumor efficacy evaluated in a C26 murine colon tumor model showed that the SN-38-loaded nanoparticles in combination with hyperthermia therapy efficiently suppressed tumor growth. The results indicate that these thermo-responsive nanoparticles are potential carriers for controlled drug delivery.
Structural and mechanistic analysis of trans-3-chloroacrylic acid dehalogenase activity
Energy Technology Data Exchange (ETDEWEB)
Pegan, Scott D., E-mail: pegan@uic.edu [Center of Pharmaceutical Biotechnology and the Department of Medicinal Chemistry and Pharmacognosy, University of Illinois, Chicago (United States); Serrano, Hector; Whitman, Christian P. [Division of Medicinal Chemistry, College of Pharmacy, The University of Texas, Austin (United States); Mesecar, Andrew D., E-mail: pegan@uic.edu [Center of Pharmaceutical Biotechnology and the Department of Medicinal Chemistry and Pharmacognosy, University of Illinois, Chicago (United States)
2008-12-01
The X-ray structure of a noncovalently modified trans-3-chloroacrylic acid dehalogenase with a substrate-homolog acetate bound in the active site has been determined to 1.7 Å resolution. Elucidation of catalytically important water is reported and multiple conformations of the catalytic residue αGlu52 are observed. Trans-3-chloroacrylic acid dehalogenase (CaaD) is a critical enzyme in the trans-1, 3-dichloropropene (DCP) degradation pathway in Pseudomonas pavonaceae 170. This enzyme allows bacteria to use trans-DCP, a common component in commercially produced fumigants, as a carbon source. CaaD specifically catalyzes the fourth step of the pathway by cofactor-independent dehalogenation of a vinyl carbon–halogen bond. Previous studies have reported an X-ray structure of CaaD under acidic conditions with a covalent modification of the catalytic βPro1 residue. Here, the 1.7 Å resolution X-ray structure of CaaD under neutral (pH 6.5) conditions is reported without the presence of the covalent adduct. In this new structure, a substrate-like acetate molecule is bound within the active site in a position analogous to the putative substrate-binding site. Additionally, a catalytically important water molecule was identified, consistent with previously proposed reaction schemes. Finally, flexibility of the catalytically relevant side chain αGlu52 is observed in the structure, supporting its role in the catalytic mechanism.
Blood omega-3 and trans fatty acids in middle-aged acute coronary syndrome patients.
Harris, William S; Reid, Kimberly J; Sands, Scott A; Spertus, John A
2007-01-15
We tested the hypothesis that lower blood omega-3 (omega-3) fatty acids (FAs) and/or higher trans FAs are associated with the risk of an acute coronary syndrome (ACS). Higher levels of omega-3 FA have been associated with decreased risk of sudden cardiac death. However, their association with ACS risk is unclear. Although higher self-reported intakes of trans FAs have been linked to increased coronary risk, the association between blood levels of trans FA and ACS risk is also unknown. We analyzed the FA composition of whole blood from 94 subjects with ACS and 94 age-, gender-, and race-matched controls. Omega-3 and trans FA associations with ACS were assessed using multivariable models after adjusting for smoking status, alcohol use, diabetes, body mass index, serum lipids, and history of myocardial infarction or revascularization. Subjects' mean age was 47 years, 54% were men, and 80% were Caucasian. Whole blood long-chain omega-3 FA (eicosapentaenoic acid [EPA] plus docosahexaenoic acid [DHA]) content was 29% lower in patients than in controls (1.7 +/- 0.9% vs 2.4 +/- 1.4%, p ACS, but higher blood trans FA content is not. Blood EPA + DHA may serve as a new, modifiable risk factor for ACS.
Psychologické aspekty přeměny genderové role u trans-lidí v českém kontextu
Čechová, Helena
2014-01-01
The thesis presents the processes of gender role transition and sex reassignment from the perspectives of psychology, medicine, and sociology. Its main focus is on the various aspects influencing the psyche of a person undertaking transition. The thesis investigates why trans identity is commonly viewed as a pathology and the impact of pathologization on the self-perception of trans people. Furthemore, the traditional outline of the transition process in Czech sexology is compared to some cur...
[CONTENT OF TRANS FATTY ACIDS IN FOOD PRODUCTS IN SPAIN].
Robledo de Dios, Teresa; Dal Re Saavedra, M Ángeles; Villar Villalba, Carmen; Pérez-Farinós, Napoleón
2015-09-01
trans fatty acids are associated to several health disorders, as ischemic heart disease or diabetes mellitus. to assess the content of trans fatty acids in products in Spain, and the percentage of trans fatty acids respecting total fatty acids. 443 food products were acquired in Spain, and they were classified into groups. The content in fatty acids was analyzed using gas chromatography. Estimates of central tendency and variability of the content of trans fatty acids in each food group were computed (in g of trans fatty acids/100 g of product). The percentage of trans fatty acids respecting total fatty acids was calculated in each group. 443 products were grouped into 42 groups. Median of trans fatty acids was less than 0.55 g / 100 g of product in all groups except one. 83 % of groups had less than 2 % of trans fatty acids, and 71 % of groups had less than 1 %. the content of trans fatty acids in Spain is low, and it currently doesn't play a public health problem. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Neurokinin-1 enables measles virus trans-synaptic spread in neurons
International Nuclear Information System (INIS)
Makhortova, Nina R.; Askovich, Peter; Patterson, Catherine E.; Gechman, Lisa A.; Gerard, Norma P.; Rall, Glenn F.
2007-01-01
Measles virus (MV), a morbillivirus that remains a significant human pathogen, can infect the central nervous system, resulting in rare but often fatal diseases, such as subacute sclerosing panencephalitis. Previous work demonstrated that MV was transmitted trans-synaptically and that, while a cellular receptor for the hemagglutinin (H) protein was required for MV entry, it was dispensable for subsequent cell-to-cell spread. Here, we explored what role the other envelope protein, fusion (F), played in trans-synaptic transport. We made the following observations: (1) MV-F expression in infected neurons was similar to that seen in infected fibroblasts; (2) fusion inhibitory peptide (FIP), an inhibitor of MV fusion, prevented both infection and spread in primary neurons; (3) Substance P, a neurotransmitter with the same active site as FIP, also blocked neuronal MV spread; and (4) both genetic deletion and pharmacological inhibition of the Substance P receptor, neurokinin-1 (NK-1), reduced infection of susceptible mice. Together, these data implicate a role for NK-1 in MV CNS infection and spread, perhaps serving as an MV-F receptor or co-receptor on neurons
Okusa, Kensuke; Iwasaki, Yuki; Kuroda, Ikuma; Miwa, Shohei; Ohira, Masayoshi; Nagai, Toshiharu; Mizobe, Hoyo; Gotoh, Naohiro; Ikegami, Tohru; McCalley, David V; Tanaka, Nobuo
2014-04-25
A high-density, polymeric C18 stationary phase (Inertsil ODS-P) or a polymeric C30 phase (Inertsil C30) provided improved resolution of the isomeric fatty acids (FAs), FA methyl esters (FAMEs), triacylglycerols (TAGs), and tocopherols with an increase in pressure of 20-70MPa in reversed-phase HPLC. With respect to isomeric C18 FAMEs with one cis-double bond, ODS-P phase was effective for recognizing the position of a double bond among petroselinic (methyl 6Z-octadecenoate), oleic (methyl 9Z-octadecenoate), and cis-vaccenic (methyl 11Z-octadecenoate), especially at high pressure, but the differentiation between oleic and cis-vaccenic was not achieved by C30 phase regardless of the pressure. A monomeric C18 phase (InertSustain C18) was not effective for recognizing the position of the double bond in monounsaturated FAME, while the separation of cis- and trans-isomers was achieved by any of the stationary phases. The ODS-P and C30 phases provided increased separation for TAGs and β- and γ-tocopherols at high pressure. The transfer of FA, FAME, or TAG molecules from the mobile phase to the ODS-P stationary phase was accompanied by large volume reduction (-30∼-90mL/mol) resulting in a large increase in retention (up to 100% for an increase of 50MPa) and improved isomer separation at high pressure. For some isomer pairs, the ODS-P and C30 provided the opposite elution order, and in each case higher pressure improved the separation. The two stationary phases showed selectivity for the isomers having rigid structures, but only the ODS-P was effective for differentiating the position of a double bond in monounsaturated FAMEs. The results indicate that the improved isomer separation was provided by the increased dispersion interactions between the solute and the binding site of the stationary phase at high pressure. Copyright © 2014 Elsevier B.V. All rights reserved.
Identification of Differentially Methylated Sites with Weak Methylation Effects
Directory of Open Access Journals (Sweden)
Hong Tran
2018-02-01
Full Text Available Deoxyribonucleic acid (DNA methylation is an epigenetic alteration crucial for regulating stress responses. Identifying large-scale DNA methylation at single nucleotide resolution is made possible by whole genome bisulfite sequencing. An essential task following the generation of bisulfite sequencing data is to detect differentially methylated cytosines (DMCs among treatments. Most statistical methods for DMC detection do not consider the dependency of methylation patterns across the genome, thus possibly inflating type I error. Furthermore, small sample sizes and weak methylation effects among different phenotype categories make it difficult for these statistical methods to accurately detect DMCs. To address these issues, the wavelet-based functional mixed model (WFMM was introduced to detect DMCs. To further examine the performance of WFMM in detecting weak differential methylation events, we used both simulated and empirical data and compare WFMM performance to a popular DMC detection tool methylKit. Analyses of simulated data that replicated the effects of the herbicide glyphosate on DNA methylation in Arabidopsis thaliana show that WFMM results in higher sensitivity and specificity in detecting DMCs compared to methylKit, especially when the methylation differences among phenotype groups are small. Moreover, the performance of WFMM is robust with respect to small sample sizes, making it particularly attractive considering the current high costs of bisulfite sequencing. Analysis of empirical Arabidopsis thaliana data under varying glyphosate dosages, and the analysis of monozygotic (MZ twins who have different pain sensitivities—both datasets have weak methylation effects of <1%—show that WFMM can identify more relevant DMCs related to the phenotype of interest than methylKit. Differentially methylated regions (DMRs are genomic regions with different DNA methylation status across biological samples. DMRs and DMCs are essentially the same
Trans-nationalizing the African Public Sphere: What Role for Trans ...
African Journals Online (AJOL)
seriane.camara
2011-03-09
Mar 9, 2011 ... At a time when the notion of 'trans-national public spheres' is gaining .... ple refer specifically to the language and its speakers in Senegal and Mauri- .... of the Pulaar language and the improvement of the social and economic.
Synthesis, Antifungal Evaluation and In Silico Study of N-(4-Halobenzyl)amides.
Montes, Ricardo Carneiro; Perez, Ana Luiza A L; Medeiros, Cássio Ilan S; Araújo, Marianna Oliveira de; Lima, Edeltrudes de Oliveira; Scotti, Marcus Tullius; Sousa, Damião Pergentino de
2016-12-13
A collection of 32 structurally related N -(4-halobenzyl)amides were synthesized from cinnamic and benzoic acids through coupling reactions with 4-halobenzylamines, using (benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate (BOP) as a coupling agent. The compounds were identified by spectroscopic methods such as infrared, ¹H- and 13 C- Nuclear Magnetic Resonance (NMR) and high-resolution mass spectrometry. The compounds were then submitted to antimicrobial tests by the minimum inhibitory concentration method (MIC) and nystatin was used as a control in the antifungal assays. The purpose of the tests was to evaluate the influence of structural changes in the cinnamic and benzoic acid substructures on the inhibitory activity against strains of Candida albicans , Candida tropicalis , and Candida krusei . A quantitative structure-activity relationship (QSAR) study with KNIME v. 3.1.0 and Volsurf v. 1.0.7 softwares were realized, showing that descriptors DRDRDR, DRDRAC, L4LgS, IW4 and DD2 influence the antifungal activity of the haloamides. In general, 10 benzamides revealed fungal sensitivity, especially a vanillic amide which enjoyed the lowest MIC. The results demonstrate that a hydroxyl group in the para position, and a methoxyl at the meta position enhance antifungal activity for the amide skeletal structure. In addition, the double bond as a spacer group appears to be important for the activity of amide structures.
Directory of Open Access Journals (Sweden)
Wang Yifei
2004-09-01
Full Text Available Abstract Background Astrocytoma is a common aggressive intracranial tumor and presents a formidable challenge in the clinic. Association of altered DNA methylation patterns of the promoter CpG islands with the expression profile of cancer-related genes, has been found in many human tumors. Therefore, DNA methylation status as such may serve as an epigenetic biomarker for both diagnosis and prognosis of human tumors, including astrocytoma. Methods We used the methylation specific PCR in conjunction with sequencing verification to establish the methylation profile of the promoter CpG island of thirty four genes in astrocytoma tissues from fifty three patients (The WHO grading:. I: 14, II: 15, III: 12 and IV: 12 cases, respectively. In addition, compatible tissues (normal tissues distant from lesion from three non-astrocytoma patients were included as the control. Results Seventeen genes (ABL, APC, APAF1, BRCA1, CSPG2, DAPK1, hMLH1, LKB1, PTEN, p14ARF, p15INK4b, p27KIP1, p57KIP2, RASSF1C, RB1, SURVIVIN, and VHL displayed a uniformly unmethylated pattern in all the astrocytoma and non-astrocytoma tissues examined. However, the MAGEA1 gene that was inactivated and hypermethylated in non-astrocytoma tissues, was partially demethylated in 24.5% of the astrocytoma tissues (co-existence of the hypermethylated and demethylated alleles. Of the astrocytoma associated hypermethylated genes, the methylation pattern of the CDH13, cyclin a1, DBCCR1, EPO, MYOD1, and p16INK4a genes changed in no more than 5.66% (3/53 of astrocytoma tissues compared to non-astrocytoma controls, while the RASSF1A, p73, AR, MGMT, CDH1, OCT6,, MT1A, WT1, and IRF7 genes were more frequently hypermethylated in 69.8%, 47.2%, 41.5%, 35.8%, 32%, 30.2%, 30.2%, 30.2% and 26.4% of astrocytoma tissues, respectively. Demethylation mediated inducible expression of the CDH13, MAGEA1, MGMT, p73 and RASSF1A genes was established in an astrocytoma cell line (U251, demonstrating that expression of
Energy Technology Data Exchange (ETDEWEB)
Abonia, Rodrigo; Arteaga, Danny; Castillo, Juan; Insuasty, Braulio; Quiroga, Jairo; Ortiz, Alejandro, E-mail: rodrigo.abonia@correounivalle.edu.co [Universidad del Valle, Cali (Colombia). Department of Chemistry. Research Group of Heterocyclic Compounds
2013-09-15
Libraries of novel {beta}-aminoketones and {gamma}-aminoalcohols showing a wide structural diversity were easily obtained from a simple approach, using 3-(N,N-dimethylamino)propiophenone derivatives as key starting material. The procedure involved initially an N-alkylation of secondary benzylamines with propiophenone salts yielding the desired {beta}-aminoketones. Chemical or catalytic reduction of their carbonyl groups provided the final {gamma}-aminoalcohols in good yields. This protocol proved to be convenient as an alternative route for the synthesis of the local anesthetic Falicain Registered-Sign and for the topic antifungal drug Naftifine Registered-Sign . (author)
Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin
2015-01-01
To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.
Peel Region TransHelp's experience
Energy Technology Data Exchange (ETDEWEB)
NONE
2009-09-15
TransHelp was founded in the Peel Region of Ontario in 1981 to provide paratransit service to individuals unable to use conventional transit. The TransHelp vehicle fleet consists of 40 buses that make over 220,000 one way trips annually. Each vehicle has a typical life span of between 375,000 and 425,000 km. TransHelp vehicles spend much of their time idling in emissions-sensitive areas, such as outside hospitals. In order to reduce fuel costs, TransHelp adopted the use of propane to fuel its vehicles. However, difficulties were experienced with this technology, particularly on V-10 engines where increased maintenance was a problem. SFI Technologies Inc. provided a solution with their SEQUIN System which allows seamless transitioning between gasoline and propane under all conditions without any operator involvement in fuel selection. The technology favours propane as the fuel of choice and automatically switches between propane and gasoline based on the ideal conditions at the time of operation. The technology has received certification from the Environmental Protection Agency in the United States and the Canadian Standards Association. The use of the SEQUIN System has proven to successful for TransHelp. It has allowed the use of propane to be continued, meaning that vehicle emissions are greatly reduced relative to gasoline or diesel fuelled vehicles. TransHelp has realized a fuel savings of 15-20 per cent over gasoline and receives an additional federal transit rebate of 15 per cent for the conversion cost.
Trans Women Doing Sex in San Francisco.
Williams, Colin J; Weinberg, Martin S; Rosenberger, Joshua G
2016-10-01
This research investigates the sexuality of trans women (individuals who were assigned male status at birth who currently identify as women), by focusing on the "bodily techniques" (Crossley, 2006) they use in "doing" sexuality. The "doing sexuality" framework not only is modeled after the "doing gender" approach of West and Zimmerman (1987), but also utilizes the idea of "sexual embodiment" to emphasize the agency of trans women as they conceptualize and organize their sexuality in a socially recognized way. This is often difficult as they confront discrimination from medical and legal professionals as well as intimate partners who may find it difficult to adapt to the trans woman's atypical body and conception of gender. However, with a study group of 25 trans women from San Francisco, we found the study participants to be adept at overcoming such hurdles and developing techniques to "do" their sexuality. At the same time, we found trans women's agency constrained by the erotic habitus (Green, 2008) of the wider society. The interplay between innovation and cultural tradition provides an opportunity to fashion a more general model of "doing" sexuality.
Wang, Weijie; Yu, Yingcong; Li, Jing; Wang, Lin; Li, Zhi; Zhang, Chong; Zhen, Linlin; Ding, Lianshu; Wang, Gang; Sun, Xiaoyang; Xu, Ying
2017-08-01
Resveratrol has been widely studied in terms of it's potential to slow the progression of many diseases. But little is known about the mechanism of action in neuropathic pain. Neuropathic pain is the main type of chronic pain associated with tissue injury. Calcium channels and calcium/caffeine-sensitive pools are associated with analgesic pathway involving neuropathic pain. Our previous study suggested that the antinociceptive effect of resveratrol was involved in Ca 2+ /calmodulin-dependent signaling in the spinal cord of mice. The aim of this study was to explore the involvement of Ca 2+ in analgesic effects of trans-resveratrol in neuropathic pain and signal pathway in hippocampus. Hot plate test was used to assess antinociceptive response when mice were treated with trans-resveratrol alone or in combination with Mk 801, nimodipine, CaCl 2 , ryanodine or EGTA. The effects of trans-resveratrol and the combination on Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) and BDNF (brain-derived neurotrophic factor) expression in hippocampus were also investigated. The results showed that trans-resveratrol increased paw withdraw latency in the hot plate test. The effect of resveratrol was enhanced by Mk 801 and nimodipine. Central administration of Ca 2+ , however, abolished the antinociceptive effects of resveratrol. In contrast, centrally administered EGTA or ryanodine improved trans-resveratrol induced antinociception. There was a significant increase in p-CaMKII and BDNF expression in the hippocampus when resveratrol were combined with Mk 801, nimodipine, ryanodine and EGTA. Administration of CaCl 2 blocked changes in p-CaMKII and BDNF levels in the hippocampus. These findings suggest that trans-resveratrol exerts the effects of antinociception through regulation of calcium channels and calcium/caffeine-sensitive pools.
Trans-Z-source Neutral Point Clamped inverter
DEFF Research Database (Denmark)
Mo, W.; Loh, P. C.; Li, D.
2012-01-01
Transformer based Z-source (trans-Z-source) inverters are recently proposed by extending the traditional Z-source inverter with higher buck-boost capability as well as reducing the passive components at the same time. Multi-Level Z-source inverters are single-stage topological solutions used...... for buck-boost energy conversion with all the favourable advantages of multi-level switching retained. This paper presents three-level trans-Z-source Neutral Point Clamped (NPC) inverter topology, which achieves both the advantages of trans-Z-source and three-level NPC inverter configuration. With proper...... modulation scheme, the three-level trans-Z-source inverter can function with minimum of six device commutations per half carrier cycle (same as the traditional buck NPC inverter), while maintaining to produce the designed volt-sec average and inductive voltage boosting at ac output terminals. The designed...
Repair Activity of trans-Resveratrol toward 2'-Deoxyguanosine Radicals.
Cheng, Xing; An, Ping; Li, Shujin; Zhou, Liping
2018-04-26
In the present study, the repair activity of trans-resveratrol toward 2'-deoxyguanosine (dGuo) radicals in polar and nonpolar solvents was studied using density functional theory. The hydrogen transfer/proton coupled electron transfer and single electron transfer (SET) mechanisms between trans-resveratrol and dGuo-radicals were considered. Taking into consideration the molar fraction of neutral trans-resveratrol (ROH) and anionic trans-resveratrol (RO - ), the overall rate constants for repairing dGuo-radicals by trans-resveratrol are 9.94 × 10 8 and 2.01 × 10 9 dm 3 mol -1 s -1 in polar and nonpolar solvents, respectively, and the overall rate constant of repairing cation radical (dGuo •+ ) by trans-resveratrol via an SET mechanism is 7.17 × 10 9 dm 3 mol -1 s -1 . The repair activity of RO - toward dGuo-radicals is better than that of ROH, but the repair activity of ROH toward dGuo •+ is better than that of RO - . Unfortunately, neither ROH nor RO - can repair the 2'-deoxyribose radicals of dGuo. It can therefore be concluded that trans-resveratrol is an effective antioxidant for repairing base radicals of dGuo and dGuo •+ . The study can help us understand the repair activity of trans-resveratrol toward dGuo radicals.
International Nuclear Information System (INIS)
Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.
1987-01-01
Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection
Crystallization of an organic compound from an ionic liquid using carbon dioxide as anti-solvent
Kroon, M.C.; Toussaint, V.A.; Shariati - Sarabi, A.; Florusse, L.J.; Spronsen, van J.; Witkamp, G.J.; Peters, C.J.
2008-01-01
In this paper the anti-solvency behavior of supercritical carbon dioxide (CO2) as a way to recover an organic compound from an ionic liquid by crystallization is explored. As an example, the conditions for crystallization of the organic compound methyl-(Z)-a-acetamido cinnamate (MAAC) from the ionic
Rajesh, Mathur; Wang, Gang; Jones, Roger; Tretyakova, Natalia
2005-02-15
The p53 tumor suppressor gene is a primary target in smoking-induced lung cancer. Interestingly, p53 mutations observed in lung tumors of smokers are concentrated at guanine bases within endogenously methylated (Me)CG dinucleotides, e.g., codons 157, 158, 245, 248, and 273 ((Me)C = 5-methylcytosine). One possible mechanism for the increased mutagenesis at these sites involves targeted binding of metabolically activated tobacco carcinogens to (Me)CG sequences. In the present work, a stable isotope labeling HPLC-ESI(+)-MS/MS approach was employed to analyze the formation of guanine lesions induced by the tobacco-specific lung carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) within DNA duplexes representing p53 mutational "hot spots" and surrounding sequences. Synthetic DNA duplexes containing p53 codons 153-159, 243-250, and 269-275 were prepared, where (Me)C was incorporated at all physiologically methylated CG sites. In each duplex, one of the guanine bases was replaced with [1,7,NH(2)-(15)N(3)-2-(13)C]-guanine, which served as an isotope "tag" to enable specific quantification of guanine lesions originating from that position. After incubation with NNK diazohydroxides, HPLC-ESI(+)-MS/MS analysis was used to determine the yields of NNK adducts at the isotopically labeled guanine and at unlabeled guanine bases elsewhere in the sequence. We found that N7-methyl-2'-deoxyguanosine and N7-[4-oxo-4-(3-pyridyl)but-1-yl]guanine lesions were overproduced at the 3'-guanine bases within polypurine runs, while the formation of O(6)-methyl-2'-deoxyguanosine and O(6)-[4-oxo-4-(3-pyridyl)but-1-yl]-2'-deoxyguanosine adducts was specifically preferred at the 3'-guanine base of 5'-GG and 5'-GGG sequences. In contrast, the presence of 5'-neighboring (Me)C inhibited O(6)-guanine adduct formation. These results indicate that the N7- and O(6)-guanine adducts of NNK are not overproduced at the endogenously methylated CG dinucleotides within the p53 tumor suppressor gene
The importance of trans-generational effects in Lepidoptera.
Woestmann, Luisa; Saastamoinen, Marjo
2016-10-01
The importance of trans-generational effects in shaping an individuals' phenotype and fitness, and consequently even impacting population dynamics is increasingly apparent. Most of the research on trans-generational effects still focuses on plants, mammals, and birds. In the past few years, however, increasing number of studies, especially on maternal effects, have highlighted their importance also in many insect systems. Lepidoptera, specifically butterflies, have been used as model systems for studying the role of phenotypic plasticity within generations. As ectotherms, they are highly sensitive to environmental variation, and indeed many butterflies show adaptive phenotypic plasticity in response to environmental conditions. Here, we synthesize what is known about trans-generational effects in Lepidoptera, compile evidence for different environmental cues that are important drivers of trans-generational effects, and point out which offspring traits are mainly impacted. Finally, we emphasize directions for future research that are needed for better understanding of the adaptive nature of trans-generational effects in Lepidoptera in particular, but potentially also in other organisms.
Intricate Conformational Tunneling in Carbonic Acid Monomethyl Ester.
Linden, Michael M; Wagner, J Philipp; Bernhardt, Bastian; Bartlett, Marcus A; Allen, Wesley D; Schreiner, Peter R
2018-04-05
Disentangling internal and external effects is a key requirement for understanding conformational tunneling processes. Here we report the s- trans/ s- cis tunneling rotamerization of carbonic acid monomethyl ester (1) under matrix isolation conditions and make comparisons to its parent carbonic acid (3). The observed tunneling rate of 1 is temperature-independent in the 3-20 K range and accelerates when using argon instead of neon as the matrix material. The methyl group increases the effective half life (τ eff ) of the energetically disfavored s- trans-conformer from 3-5 h for 3 to 11-13 h for 1. Methyl group deuteration slows the rotamerization further (τ eff ≈ 35 h). CCSD(T)/cc-pVQZ//MP2/aug-cc-pVTZ computations of the tunneling probability suggest that the rate should be almost unaffected by methyl substitution or its deuteration. Thus the observed relative rates are puzzling, and they disagree with previous explanations involving fast vibrational relaxation after the tunneling event facilitated by the alkyl rotor.
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
Chen, Y; Feng, H; Chen, D; Abuduwaili, K; Li, X; Zhang, H
2018-01-01
The protective effects of folic acid on DNA damage and DNA methylation induced by N-methyl- N'-nitro- N-nitrosoguanidine (MNNG) in Kazakh esophageal epithelial cells were investigated using a 3 × 3 factorial design trial. The cells were cultured in vitro and exposed to media containing different concentrations of folic acid and MNNG, after which growth indices were detected. DNA damage levels were measured using comet assays, and genome-wide DNA methylation levels (MLs) were measured using high-performance liquid chromatography. The DNA methylation of methylenetetrahydrofolate reductase (MTHFR) and folate receptor- α (FR α) genes was detected by bisulfite sequencing polymerase chain reaction (PCR). The results showed significant increases in tail DNA concentration, tail length, and Olive tail moment ( p methylation frequencies of MTHFR and FR α genes. In particular, significant differences were observed in the promoter regions of both genes ( p methylation in Kazakh esophageal epithelial cells upon MNNG exposure. Thus, sufficient folic acid levels could play a protective role against the damage induced by this compound.
Electrochemical reduction of imazamethabenz methyl on mercury and carbon electrodes
Energy Technology Data Exchange (ETDEWEB)
Ruiz Montoya, Mercedes, E-mail: mmontoya@uhu.e [Departamento de Ingenieria Quimica, Quimica Fisica y Quimica Organica, Universidad de Huelva, Campus El Carmen, Facultad de Ciencias Experimentales, E-21071 Huelva (Spain); Pintado, Sara; Rodriguez Mellado, Jose Miguel [Departamento de Quimica Fisica y Termodinamica Aplicada, Universidad de Cordoba, Campus Universitario de Rabanales, edificio ' Marie Curie' , E-14014 Cordoba (Spain)
2010-03-30
This paper presents polarographic and voltammetric studies of the reduction of the herbicide imazamethabenz methyl (2/3-methyl-(4-isopropyl-4-methyl-5-oxo-2-imidazolin-2-yl)-p-toluate), on mercury and carbon electrodes. The electrochemical studies were performed in strongly acidic media (0.1-2.7 M H{sub 2}SO{sub 4}) as well as in the pH range of 1-12. The overall reduction process involves the uptake of two electrons. The results obtained in polarography show that there is the reduction of two species, related via an acid-base equilibrium, and having very close reduction potentials. The voltammetric results obtained with a glassy carbon electrode were very similar to those observed on mercury electrodes. The reducible group in the molecule is the imidazolinone ring. In strongly acidic media (pH < pK{sub a}), the reaction mechanism proposed is the reduction of the protonated herbicide by an electrochemical-chemical-electrochemical (ECE) process, being the r.d.s. the second electron transfer. At pH > pK{sub a} the neutral form of the herbicide is reduced and the second electron transfer becomes reversible or quasi-reversible. In basic media, the species reduced is the deprotonated imazamethabenz methyl and the r.d.s. is the second electron transfer.
Preparation and characterization of trans-RhCl(CO)(TPPTS)2-intercalated layered double hydroxides
International Nuclear Information System (INIS)
Zhang Xian; Wei Min; Pu Min; Li Xianjun; Chen Hua; Evans, David G.; Duan Xue
2005-01-01
trans-RhCl(CO)(TPPTS) 2 (TPPTS=tris(m-sulfonatophenyl)phosphine) has been intercalated into Zn-Al layered double hydroxides (LDHs) by the method of ion exchange. The structure, composition and thermal stability of the composite material have been characterized by powder X-ray diffraction, Fourier transform infrared and 31 P solid-state magic-angle spinning nuclear magnetic resonance spectroscopy, elemental analysis, thermogravimetry, and differential thermal analysis. The geometry of trans-RhCl(CO)(TPPTS) 2 was fully optimized using the PM3 semiempirical molecular orbital method, and a schematic model for the intercalated species has been proposed. The thermal stability of trans-RhCl(CO)(TPPTS) 2 is significantly enhanced by intercalation, which suggests that such materials may have prospective application as the basis of a supported catalyst system for the hydroformylation of higher olefins
Bouwman, Jordy; Fournier, Martin; Sims, Ian R; Leone, Stephen R; Wilson, Kevin R
2013-06-20
The reactions of C2H radicals with C4H8 isomers 1-butene, cis-2-butene, trans-2-butene, and isobutene are studied by laser photolysis-vacuum ultraviolet mass spectrometry in a Laval nozzle expansion at 79 K. Bimolecular-reaction rate constants are obtained by measuring the formation rate of the reaction product species as a function of the reactant density under pseudo-first-order conditions. The rate constants are (1.9 ± 0.5) × 10(-10), (1.7 ± 0.5) × 10(-10), (2.1 ± 0.7) × 10(-10), and (1.8 ± 0.9) × 10(-10) cm(3) s(-1) for the reaction of C2H with 1-butene, cis-2-butene, trans-2-butene, and isobutene, respectively. Bimolecular rate constants for 1-butene and isobutene compare well to values measured previously at 103 K using C2H chemiluminescence. Photoionization spectra of the reaction products are measured and fitted to ionization spectra of the contributing isomers. In conjunction with absolute-ionization cross sections, these fits provide isomer-resolved product branching fractions. The reaction between C2H and 1-butene yields (65 ± 10)% C4H4 in the form of vinylacetylene and (35 ± 10)% C5H6 in the form of 4-penten-1-yne. The cis-2-butene and trans-2-butene reactions yield solely 3-penten-1-yne, and no discrimination is made between cis- and trans-3-penten-1-yne. Last, the isobutene reaction yields (26 ± 15)% 3-penten-1-yne, (35 ± 15)% 2-methyl-1-buten-3-yne, and (39 ± 15)% 4-methyl-3-penten-1-yne. The branching fractions reported for the C2H and butene reactions indicate that these reactions preferentially proceed via CH3 or C2H3 elimination rather than H-atom elimination. Within the experimental uncertainties, no evidence is found for the formation of cyclic species.
Whole-genome methylation caller designed for methyl- DNA ...
African Journals Online (AJOL)
etchie
2013-02-20
Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.
Directory of Open Access Journals (Sweden)
Berenice Bento
2012-10-01
Full Text Available Depois dos estudos das masculinidades, não é possível pensar a produção das identidades de gênero sem referenciá-las ao caráter relacional. Esta mudança deveu-se à incorporação da perspectiva relacional nesse campo de estudos e à crítica ao conceito de gênero assentado em uma suposta natureza feminina e masculina para construir as interpretações sobre o lugar dos corpos da ordem de gênero. Os objetivos desse artigo são: 1 apontar como um determinado conceito de gênero pode visibilizar múltiplas expressões de gênero, a exemplo das identidades trans (transexuais, travestis, cross dress, drag queen, drag king, transgêneros ou invisibilizá-las e contribuir para sua patologização. O segundo objetivo será apresentar narrativas de homens trans e de mulheres trans, que nos contarão suas vivências sexuais. Os saberes médicos-psi advogam a inexistência de sexualidade em seus corpos, sendo este um dos indicadores para produção do diagnóstico de transexualidade. Tentarei argumentar que a base teórica que sustenta a patologização das identidades trans e a afirmação que as pessoas trans são assexuadas tem como fundamento uma concepção que atrela e condiciona as identidades de gênero às estruturas biológicas.In the aftermath of studies on masculinity, it is impossible to consider the production of gender identities without linking them to the relationship aspect. This change was due to the incorporation of the relationship perspective in this field of study and criticism of the concept of gender founded upon an alleged concept of femininity and masculinity to create interpretations of the place of bodies in the gender order. The objectives of this paper are: 1 to show how a given concept of gender can render multiple expressions of gender visible, like the trans identities (transsexuals, transvestites, cross dressers, drag queens, drag kings, transgenders or sublimate them and contribute to their pathologization
Directory of Open Access Journals (Sweden)
Radomir Jasiński
2016-07-01
Full Text Available Preliminary experiments shows, that [3+2] cycloadditions reactions proceeds with full regioselectivity and high stereoselectivity. In consequence, 3,4-trans-2-methyl-3-(3,4,5-trimethoxyphenyl-4-halo-4-nitroisoxazolidines are forming as predominantly (or sole products. Additionally, prognosis for the synthesized compounds to be potential ingredients of drugs is good.
Methyl Sartortuoate Inhibits Colon Cancer Cell Growth by Inducing Apoptosis and G2/M-Phase Arrest.
Lan, Qiusheng; Li, Shoufeng; Lai, Wei; Xu, Heyang; Zhang, Yang; Zeng, Yujie; Lan, Wenjian; Chu, Zhonghua
2015-08-17
The potential anti-neoplastic activity of terpenoids is of continued interest. In this study, we investigate whether methyl sartortuoate, a terpenoid isolated from soft coral, induced cell cycle arrest and apoptosis in a human colon cancer cell line. Culture studies found that methyl sartortuoate inhibited colon cancer cell (LoVo and RKO) growth and caused apoptotic death in a concentration- and time-dependent manner, by activation of caspase-8, caspase-9, caspase-3, p53 and Bax, and inactivation of B-cell lymphoma 2 (Bcl-2) apoptosis regulating proteins. Methyl sartortuoate treatment led to reduced expression of cdc2 and up-regulated p21 and p53, suggesting that Methyl sartortuoate induced G2-M arrest through modulation of p53/p21/cdc2 pathways. Methyl sartortuoate also up-regulated phospho-JNK and phospho-p38 expression levels. This resulted in cell cycle arrest at the G2-M phase and apoptosis in LoVo and RKO cells. Treatment with the JNK inhibitor SP600125 and the p38 MAPK inhibitor SB203580 prevented methyl sartortuoate-induced apoptosis in LoVo cells. Moreover, methyl sartortuoate also prevented neoplasm growth in NOD-SCID nude mice inoculated with LoVo cells. Taken together, these findings suggest that methyl sartortuoate is capable of leading to activation of caspase-8, -9, -3, increasing p53 and Bax/Bcl-2 ratio apoptosis through MAPK-dependent apoptosis and results in G2-M phase arrest in LoVo and RKO cells. Thus, methyl sartortuoate may be a promising anticancer candidate.
Feng, Hongxiang; Zhang, Zhenrong; Qing, Xin; Wang, Xiaowei; Liang, Chaoyang; Liu, Deruo
2016-02-01
Aberrant promoter hypermethylations of tumor suppressor genes are promising markers for lung cancer diagnosis and prognosis. The purpose of this study was to determine methylation status at APC and RAR-β promoters in primary NSCLC, and whether they have any relationship with survival. APC and RAR-β promoter methylation status were determined in 41 NSCLC patients using methylation specific PCR. APC promoter methylation was detectable in 9 (22.0%) tumor samples and 6 (14.6%) corresponding non-tumor samples (P=0.391). RAR-β promoter methylation was detectable in 13 (31.7%) tumor samples and 4 (9.8%) corresponding non-tumor samples (P=0.049) in the NSCLC patients. APC promoter methylation was found to be associated with T stage (P=0.046) and nodal status (P=0.019) in non-tumor samples, and with smoking (P=0.004) in tumor samples. RAR-β promoter methylation was found associated with age (P=0.031) in non-tumor samples and with primary tumor site in tumor samples. Patients with APC promoter methylation in tumor samples showed significantly longer survival than patients without it (Log-rank P=0.014). In a multivariate analysis of prognostic factors, APC methylation in tumor samples was an independent prognostic factor (P=0.012), as were N1 positive lymph node number (P=0.025) and N2 positive lymph node number (P=0.06). Our study shows that RAR-β methylation detected in lung tissue may be used as a predictive marker for NSCLC diagnosis and that APC methylation in tumor sample may be a useful marker for superior survival in NSCLC patients. Copyright © 2015. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Michael P Trimarchi
Full Text Available DNA methylation is a stable epigenetic mark that is frequently altered in tumors. DNA methylation features are attractive biomarkers for disease states given the stability of DNA methylation in living cells and in biologic specimens typically available for analysis. Widespread accumulation of methylation in regulatory elements in some cancers (specifically the CpG island methylator phenotype, CIMP can play an important role in tumorigenesis. High resolution assessment of CIMP for the entire genome, however, remains cost prohibitive and requires quantities of DNA not available for many tissue samples of interest. Genome-wide scans of methylation have been undertaken for large numbers of tumors, and higher resolution analyses for a limited number of cancer specimens. Methods for analyzing such large datasets and integrating findings from different studies continue to evolve. An approach for comparison of findings from a genome-wide assessment of the methylated component of tumor DNA and more widely applied methylation scans was developed.Methylomes for 76 primary endometrial cancer and 12 normal endometrial samples were generated using methylated fragment capture and second generation sequencing, MethylCap-seq. Publically available Infinium HumanMethylation 450 data from The Cancer Genome Atlas (TCGA were compared to MethylCap-seq data.Analysis of methylation in promoter CpG islands (CGIs identified a subset of tumors with a methylator phenotype. We used a two-stage approach to develop a 13-region methylation signature associated with a "hypermethylator state." High level methylation for the 13-region methylation signatures was associated with mismatch repair deficiency, high mutation rate, and low somatic copy number alteration in the TCGA test set. In addition, the signature devised showed good agreement with previously described methylation clusters devised by TCGA.We identified a methylation signature for a "hypermethylator phenotype" in
Heterogeneity of DNA methylation in multifocal prostate cancer.
Serenaite, Inga; Daniunaite, Kristina; Jankevicius, Feliksas; Laurinavicius, Arvydas; Petroska, Donatas; Lazutka, Juozas R; Jarmalaite, Sonata
2015-01-01
Most prostate cancer (PCa) cases are multifocal, and separate foci display histological and molecular heterogeneity. DNA hypermethylation is a frequent alteration in PCa, but interfocal heterogeneity of these changes has not been extensively investigated. Ten pairs of foci from multifocal PCa and 15 benign prostatic hyperplasia (BPH) samples were obtained from prostatectomy specimens, resulting altogether in 35 samples. Methylation-specific PCR (MSP) was used to evaluate methylation status of nine tumor suppressor genes (TSGs), and a set of selected TSGs was quantitatively analyzed for methylation intensity by pyrosequencing. Promoter sequences of the RASSF1 and ESR1 genes were methylated in all paired PCa foci, and frequent (≥75 %) DNA methylation was detected in RARB, GSTP1, and ABCB1 genes. MSP revealed different methylation status of at least one gene in separate foci in 8 out of 10 multifocal tumors. The mean methylation level of ESR1, GSTP1, RASSF1, and RARB differed between the paired foci of all PCa cases. The intensity of DNA methylation in these TSGs was significantly higher in PCa cases than in BPH (p epigenetic profile of recurrent tumors can be inferred from our data.
International Nuclear Information System (INIS)
Caselmann, W.H.; Meyer, M.; Kekule, A.S.; Lauer, U.; Hofschneider, P.H.; Koshy, R.
1990-01-01
The X gene of wild-type hepatitis B virus or integrated DNA has recently been shown to stimulate transcription of a variety of enhancers and promoters. To further delineate the viral sequences responsible for trans-activation in hepatomas, the authors cloned the single hepatitis B virus insert from human hepatocellular carcinoma DNA M1. The plasmid pM1 contains 2004 base of hepatitis B virus DNA subtype adr, including truncated preS/S sequences and the enhancer element. The X promoter and 422 nucleotides of the X coding region are present. The entire preC/C gene is deleted. In transient cotransfection assays using Chang liver cells (CCL 13), pM1 DNA exerts a 6- to 10-fold trans-activating effect on the expression of the pSV2CAT reporter plasmid. The transactivation occurs by stimulation of transcription and is dependent on the simian virus 40 enhancer in the reporter plasmid. Deletion analysis of pM1 subclones reveals that the transactivator is encoded by preS/S and not by X sequences. A frameshift mutation within the preS2 open reading frame shows that this portion is indispensable for the trans-activating function. Initiation of transcription has been mapped to the S1 promoter. A comparable trans-activating effect is also observed with cloned wild-type hepatitis B virus sequences similarly truncated. These results show that a transcriptional trans-activator function not present in the intact gene is generated by 3' truncation of integrated hepatitis B virus DNA preS/S sequences
Directory of Open Access Journals (Sweden)
Sharron Jenkins
2014-10-01
Full Text Available Studies linking high trans-fat diets to coronary heart disease (CHD have prompted the need to regulate, limit, or completely ban trans-fat from all commercial food products, including fast foods. Many U.S. fast food chains now claim that their food items, particularly French fries, have "no trans-fat". In a previous study, our lab tested the validity of trans-fat claims made by several popular fast food restaurants by experimentally determining the %trans-fat in oil extracted from fast food French fries. In some cases, the trans-fat content was nearly twice as high as the amount reported by the restaurant in their literature. Long John Silver's, for example, reported a trans-fat content of 25% for their French fries, while our lab actually found over 40% trans-fat. The purpose of this study is to broaden our study of Long John Silver's trans-fat claims by analyzing a variety of their food items and comparing our findings with the %trans-fat reported by the restaurant literature (nutrition fact tables. Variable Filter Array (VFA IR spectroscopy was used to assess the trans-fat content of oil extracted from food samples. Our preliminary findings suggest that nearly every food item under study contained considerably more trans-fat than the amount reported in the restaurant’s literature.
International Nuclear Information System (INIS)
Abedi Ravan, B
2012-01-01
In this paper, the electronic transport characteristics of Fe/trans-polyacetylene/Fe magnetic tunnel junctions (MTJs) are investigated using multi-band tight-binding calculations within the framework of nonequilibrium Green function theory. A CH 2 radical is added to different positions on the polymer chain and its effects on the tunnelling magnetoresistance of the MTJ are studied. The ferromagnetic electrodes are assumed to be single-band and their tight-binding parameters are chosen in such a way as to simulate the ab initio density functional calculations of the band structure of bcc-Fe along its [001] crystallographic direction. In building the Hamiltonian of the trans-polyacetylene (t-PA) chain, we have assumed an s orbital on the H atoms and one s and three p(p x ,p y ,p z ) orbitals on the C atoms, and the dimerization effects are taken into account. It is found that moving the radical out of the centre of the polymer chain enhances the tunnelling magnetoresistance of the MTJ.
Zhou, Zhong-Yu; Liu, Wan-Xue; Pei, Gang; Ren, Hui; Wang, Jing; Xu, Qiao-Lin; Xie, Hai-Hui; Wan, Fang-Hao; Tan, Jian-Wen
2013-12-04
A bioassay-directed phytochemical study was conducted to investigate potential allelochemicals in the roots of the invasive plant Ageratina adenophora. Eleven phenolic compounds, including seven new ones, 7-hydroxy-8,9-dehydrothymol 9-O-trans-ferulate (1), 7-hydroxythymol 9-O-trans-ferulate (2), 7,8-dihydroxythymol 9-O-trans-ferulate (3), 7,8-dihydroxythymol 9-O-cis-ferulate (4), methyl (7R)-3-deoxy-4,5-epoxy-D-manno-2-octulosonate 8-O-trans-p-coumarate (5), methyl (7R)-3-deoxy-4,5-epoxy-D-manno-2-octulosonate 8-O-cis-p-coumarate (6), and 3-(2-hydroxyphenyl)propyl methyl malonate (7), were isolated from a bioactive subfraction of the ethanol extract of the roots of A. adenophora. The new structures were established on the basis of detailed spectroscopic analysis. The potential phytotoxic effects of these compounds on the germination of Arabidopsis thaliana seeds were tested by a filter paper assay. Compound 7 and known compounds 3-(2-hydroxyphenyl)-1-propanol (8) and o-coumaric acid (9) remarkably showed inhibition activity against Arabidopsis seed germination at a concentration of 1.0 mM. Compounds 1, 2, 5, 6, and 10 showed slight inhibitory activity at the test concentration after treatment for 3 days, while the other compounds showed no obvious inhibitory effects. Moreover, 7-9 were further found to show obvious inhibitory activity on retarding the seedling growth of Ar. thaliana cultured in soil medium.
Zhang, Zhena; Tang, Mingxiao; Chen, Jixiang
2016-01-01
γ-Al2O3-supported nickel phosphides (mNi-Pn) were prepared by the TPR method and tested for the deoxygenation of methyl laurate to hydrocarbons. The effects of the P/Ni ratio (n = 1.0-2.5) and Ni content (m = 5-15 wt.%) in the precursors on their structure and performance were investigated. Ni/γ-Al2O3 was also studied for comparison. It was found that the formation of AlPO4 in the precursor inhibited the reduction of phosphate and so the formation of nickel phosphides. With increasing the P/Ni ratio and Ni content, the Ni, Ni3P, Ni12P5 and Ni2P phases orderly formed, accompanying with the increases of their particle size and the amount of weak acid sites (mainly due to P-OH group), while the CO uptake and the amount of medium strong acid sites (mainly related to Ni sites) reached maximum on 10%Ni-P1.5. In the deoxygenation reaction, compared with Ni/γ-Al2O3, the mNi-Pn catalysts showed much lower activities for decarbonylation, Csbnd C hydrogenolysis and methanation due to the ligand and ensemble effects of P. The conversion and the selectivity to n-C11 and n-C12 hydrocarbons achieved maximum on 10%Ni-P 2.0 for the 10%Ni-Pn catalysts and on 8%Ni-P2.0 for the mNi-P2.0 catalysts, while the turnover frequency (TOF) of methyl laurate mainly increased with the P/Ni ratio and Ni content. We propose that TOF was influenced by the nickel phosphide phases, the catalyst acidity and the particle size as well as the synergetic effect between the Ni site and acid site. Again, the hydrodeoxygenation pathway of methyl laurate was promoted with increasing P/Ni ratio and Ni content, ascribed to the phase change in the order of Ni, Ni3P, Ni12P5 and Ni2P in the prepared catalysts.
Nutritional profile of phytococktail from trans-Himalayan plants.
Directory of Open Access Journals (Sweden)
Priyanka Dhar
Full Text Available We estimated the nutritive value, vitamin content, amino acid composition, fatty acid content, and mineral profile of a phytococktail comprising sea buckthorn (Hippophae rhamnoides, apricot (Prunus armeniaca, and roseroot (Rhodiola imbricata from trans-Himalaya. The free vitamin forms in the phytococktail were determined by rapid resolution liquid chromatography/tandem mass spectrometry (RRLC-MS/MS. Vitamin E and B-complex vitamins were detected as the principle vitamins. Reversed-phase high performance liquid chromatography (RP-HPLC with pre-column derivatization was used for identification and quantification of amino acids. Eight essential and eleven non-essential amino acids were quantified, and the content ranged between 76.33 and 9485.67 µg/g. Among the essential amino acids, L-methionine, L-phenylalanine, L-lysine, L-leucine, and L-histidine were found to be the dominant contributors. We also quantified the fatty acids in the phytococktail by using gas chromatography coupled with a flame ionization detector (GC-FID with fatty acid methyl esters (FAMEs derivatization. The analysis revealed the presence of 4 major fatty acids contributing to the total lipid content. Palmitic acid was found to be the rich source of saturated fatty acid (SFA and constituted ∼31% of the total lipid content. Among the unsaturated fatty acids (UFAs, palmitoleic acid (43.47%, oleic acid (20.89%, and linoleic acid (4.31% were prominent. The mineral profiling was carried out by inductively coupled plasma optical emission spectrometer (ICP-OES, and it was found to contain a number of important dietary mineral elements. The harsh climatic conditions, difficult terrain, and logistic constraints at high altitude regions of Indian trans-Himalayan cold desert lead to the scarcity of fresh fruits and vegetables. Therefore, the source of multiple vitamins, essential amino acids, fatty acids, and dietary minerals from the phytococktail would provide great health benefit
International Nuclear Information System (INIS)
Uno, Tadayuki; Hatano, Keiichiro; Nishimura, Yoshifumi; Arata, Yoji
1988-01-01
The influence of axial ligand basicity on the bonding of iron(III) in cyano adducts of octaethylporphyrin has been studied by resonance Raman spectroscopy. In a six-coordinate ferric low-spin complex, cyano(pyridine)(octaethylporphinato)iron(III), Fe(OEP)(CN)(py), Raman lines at 449 and 191 cm -1 were assigned to the ν(Fe-CN) and ν(Fe-py) stretching modes, respectively. When pyridine was displaced with its derivatives, py-X, where X = 4-cyano, 3-acetyl, 3-methyl, 4-methyl, 3,4-dimethyl, and 4-dimethylamino, the ν(Fe-CN) stretching frequency was found to decrease in the complex with a high pyridine basicity. It was concluded that the stronger the trans pyridine basicity, the weaker the iron-carbon (cyanide) bond. A clear frequency shift was observed in the ν 4 model, though most of the porphyrin vibrations were insensitive to the ligand substitution. The frequency of the ν 4 mode, which is the C a -N(pyrrole) breathing vibration of the porphyrin skeleton, was found to increase with an increase in pyridine basicity. This is contrary to what was found in ferrous low-spin hemes as CO complexes. The ν 4 shift in the CN complexes was explained in terms of forward π donation; donation of electrons from the porphyrin π orbital to the d π vacancy of the low-spin iron(III) weakened the C a -N(pyrrole) bonds and hence decreased the ν 4 frequency. 32 references, 8 figures
Directory of Open Access Journals (Sweden)
Huarong Guo
2012-09-01
Full Text Available p21CIP1/WAF1 is a p53-target gene in response to cellular DNA damage. Here we report the development of a fish cell biosensor system for high throughput genotoxicity detection of new drugs, by stably integrating two reporter plasmids of pGL3-p21-luc (human p21 promoter linked to firefly luciferase and pRL-CMV-luc (CMV promoter linked to Renilla luciferase into marine flatfish flounder gill (FG cells, referred to as p21FGLuc. Initial validation of this genotoxicity biosensor system showed that p21FGLuc cells had a wild-type p53 signaling pathway and responded positively to the challenge of both directly acting genotoxic agents (bleomycin and mitomycin C and indirectly acting genotoxic agents (cyclophosphamide with metabolic activation, but negatively to cyclophosphamide without metabolic activation and the non-genotoxic agents ethanol and D-mannitol, thus confirming a high specificity and sensitivity, fast and stable response to genotoxic agents for this easily maintained fish cell biosensor system. This system was especially useful in the genotoxicity detection of Di(2-ethylhexyl phthalate (DEHP, a rodent carcinogen, but negatively reported in most non-mammalian in vitro mutation assays, by providing a strong indication of genotoxicity for DEHP. A limitation for this biosensor system was that it might give false positive results in response to sodium butyrate and any other agents, which can trans-activate the p21 gene in a p53-independent manner.
Methylation profiling in individuals with Russell-Silver syndrome.
Peñaherrera, Maria S; Weindler, Susanne; Van Allen, Margot I; Yong, Siu-Li; Metzger, Daniel L; McGillivray, Barbara; Boerkoel, Cornelius; Langlois, Sylvie; Robinson, Wendy P
2010-02-01
Russell-Silver syndrome (RSS) is a heterogeneous disorder associated with pre- and post-natal growth restriction and relative macrocephaly. Involvement of imprinted genes on both chromosome 7 and 11p15.5 has been reported. To further characterize the role of epimutations in RSS we evaluated the methylation status at both 11p15.5 imprinting control regions (ICRs): ICR1 associated with H19/IGF2 expression and ICR2 (KvDMR1) associated with CDKN1C expression in a series of 35 patients with RSS. We also evaluated methylation at the promoter regions of other imprinted genes involved in growth such as PLAGL1 (6q24), GCE (7q21), and PEG10 (7q21) in this series of 35 patients with RSS. Thirteen of the 35 patient samples, but none of 22 controls, showed methylation levels at ICR1 that were more than 2 SD below the mean for controls. Three RSS patients were highly methylated at the SCGE promoter, all of which were diagnosed with upd(7)mat. To identify further potential global methylation changes in RSS patients, a subset of 22 patients were evaluated at 1505 CpG sites by the Illumina GoldenGate methylation array. Among the few CpG sites displaying a significant difference between RSS patients and controls, was a CpG associated with the H19 promoter. No other sites associated with known imprinted genes were identified as abnormally methylated in RSS patients by this approach. While the association of hypomethylation of the H19/IGF2 ICR1 is clear, the continuous distribution of methylation values among the patients and controls complicates the establishment of clear cut-offs for clinical diagnosis. Copyright 2010 Wiley-Liss, Inc.