WorldWideScience

Sample records for trainable gene regulation

  1. Trainability of the Prepubescent Child.

    Science.gov (United States)

    Bar-Or, Oded

    1989-01-01

    Examines whether prepubescents are trainable in competitive sports, noting trainability differences between prepubescents and older groups. Changes in maximal aerobic power, metabolic cost of walking and running, muscle strength and power, and local muscle endurance are examined. Strength training is recommended only for rehabilitation or…

  2. TEACHER'S GUIDE FOR THE TRAINABLE PROGRAM.

    Science.gov (United States)

    Baltimore City Public Schools, MD.

    THE TRAINABLE PROGRAM IS DISCUSSED IN TERMS OF CONTENT, SCHEDULING, PLANNING, AND RECORDS. PROGRAM CONTENT IS OUTLINED UNDER THE MAIN CATEGORIES OF BASIC HABITS AND ATTITUDES, CLASSROOM ACTIVITIES, SENSE TRAINING ACTIVITIES, SOCIAL LIVING ACTIVITIES, HEALTH-SAFETY-SCIENCE, MUSIC ACTIVITIES, AND HANDICRAFT ACTIVITIES. SCHEDULING A DAILY PROGRAM IS…

  3. Trainable Methods for Surface Natural Language Generation

    OpenAIRE

    Ratnaparkhi, Adwait

    2000-01-01

    We present three systems for surface natural language generation that are trainable from annotated corpora. The first two systems, called NLG1 and NLG2, require a corpus marked only with domain-specific semantic attributes, while the last system, called NLG3, requires a corpus marked with both semantic attributes and syntactic dependency information. All systems attempt to produce a grammatical natural language phrase from a domain-specific semantic representation. NLG1 serves a baseline syst...

  4. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  5. Trainability of young athletes and overtraining.

    Science.gov (United States)

    Matos, Nuno; Winsley, Richard J

    2007-09-01

    Exercise adaptations to strength, anaerobic and aerobic training have been extensively studied in adults, however, young people appear to respond differently to such exercise stimulus in comparison to adults. In addition, because overtraining in young athletes has received little attention, this important area is also discussed. Resistance training in children can be safe and effective. It has the potential to improve sport performance, enhance body composition and reduce the rate of sport incurred injury. Furthermore, with the appropriate stimulus, prepubertal and adolescent athletes can show significant increments in muscle strength (13 - 30%). Children can improve anaerobic power (3%-10% Mean Power and 4%-20% in Peak Power), although the mechanisms responsible for the improvements in children remain unclear. Children show a 'reduced' trainability of peak VO2 in comparison to adults. Nevertheless, their aerobic power is trainable, with improvements reported at approximately 5%. Moreover, improvements in other variables like exercise economy or lactate threshold may occur without significant changes in peak VO2 The limited evidence available indicates that overtraining is occurring in young athletes (30% prevalence), highlighting the importance of further research in to all the possible contributing factors - physiological, psychological and emotional - when investigating overtraining. Key pointsChildren's strength, anaerobic and aerobic power is trainable, although the improvements may be smaller than seen in adults.Children can demonstrate significant gains in muscle strength with resistance training (13 - 30%).Improvements in mean power (3 - 10%) and peak power (4 - 20%) are reported in children.Aerobic fitness can improve with training in children by approximately 5%.Limited available evidence indicates an occurrence of overtraining in young athletes of around 30%.

  6. TRAINABILITY OF YOUNG ATHLETES AND OVERTRAINING

    Directory of Open Access Journals (Sweden)

    Nuno Matos

    2007-09-01

    Full Text Available Exercise adaptations to strength, anaerobic and aerobic training have been extensively studied in adults, however, young people appear to respond differently to such exercise stimulus in comparison to adults. In addition, because overtraining in young athletes has received little attention, this important area is also discussed. Resistance training in children can be safe and effective. It has the potential to improve sport performance, enhance body composition and reduce the rate of sport incurred injury. Furthermore, with the appropriate stimulus, prepubertal and adolescent athletes can show significant increments in muscle strength (13 - 30%. Children can improve anaerobic power (3%-10% Mean Power and 4%-20% in Peak Power, although the mechanisms responsible for the improvements in children remain unclear. Children show a 'reduced' trainability of peak VO2 in comparison to adults. Nevertheless, their aerobic power is trainable, with improvements reported at approximately 5%. Moreover, improvements in other variables like exercise economy or lactate threshold may occur without significant changes in peak VO2 The limited evidence available indicates that overtraining is occurring in young athletes (30% prevalence, highlighting the importance of further research in to all the possible contributing factors - physiological, psychological and emotional - when investigating overtraining

  7. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  8. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    cells are capable of regulating their gene expression, so that each cell can only express a particular set of genes yielding limited numbers of proteins with specialized functions. Therefore a rigid control of differential gene expression is necessary for cellular diversity. On the other hand, aberrant...... gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis......, genome-wide assays have increased our understanding of gene regulation significantly. This thesis describes the integration and analysis of HTS data across different important aspects of gene regulation. Gene expression can be regulated at different stages when the genetic information is passed from gene...

  9. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  10. Mathematical Models of Gene Regulation

    Science.gov (United States)

    Mackey, Michael C.

    2004-03-01

    This talk will focus on examples of mathematical models for the regulation of repressible operons (e.g. the tryptophan operon), inducible operons (e.g. the lactose operon), and the lysis/lysogeny switch in phage λ. These ``simple" gene regulatory elements can display characteristics experimentally of rapid response to perturbations and bistability, and biologically accurate mathematical models capture these aspects of the dynamics. The models, if realistic, are always nonlinear and contain significant time delays due to transcriptional and translational delays that pose substantial problems for the analysis of the possible ranges of dynamics.

  11. Dynamics of bacterial gene regulation

    Science.gov (United States)

    Narang, Atul

    2009-03-01

    The phenomenon of diauxic growth is a classical problem of bacterial gene regulation. The most well studied example of this phenomenon is the glucose-lactose diauxie, which occurs because the expression of the lac operon is strongly repressed in the presence of glucose. This repression is often explained by appealing to molecular mechanisms such as cAMP activation and inducer exclusion. I will begin by analyzing data showing that these molecular mechanisms cannot explain the strong lac repression because they exert a relatively weak effect. I will then present a minimal model accounting only for enzyme induction and dilution, which yields strong repression despite the absence of catabolite repression and inducer exclusion. The model also explains the growth patterns observed in batch and continuous cultures of various bacterial strains and substrate mixtures. The talk will conclude with a discussion of the experimental evidence regarding positive feedback, the key component of the minimal model.

  12. Trainability of junior Rugby Union players | Hendricks | South African ...

    African Journals Online (AJOL)

    Taking into consideration the long term developmental models, and the requirements to succeed in rugby, this review aims to prescribe the trainability of junior rugby players using a scientifically evidence based long-term player development approach. As there have been several recent and comprehensive reviews of the ...

  13. Trainable COSFIRE Filters for Keypoint Detection and Pattern Recognition

    NARCIS (Netherlands)

    Azzopardi, G.; Petkov, N.

    2013-01-01

    Background: Keypoint detection is important for many computer vision applications. Existing methods suffer from insufficient selectivity regarding the shape properties of features and are vulnerable to contrast variations and to the presence of noise or texture. Methods: We propose a trainable

  14. Trainable COSFIRE Filters for Keypoint Detection and Pattern Recognition

    NARCIS (Netherlands)

    Azzopardi, George; Petkov, Nicolai

    Background: Keypoint detection is important for many computer vision applications. Existing methods suffer from insufficient selectivity regarding the shape properties of features and are vulnerable to contrast variations and to the presence of noise or texture. Methods: We propose a trainable

  15. QTLminer: identifying genes regulating quantitative traits

    Directory of Open Access Journals (Sweden)

    Schughart Klaus

    2010-10-01

    Full Text Available Abstract Background Quantitative trait locus (QTL mapping identifies genomic regions that likely contain genes regulating a quantitative trait. However, QTL regions may encompass tens to hundreds of genes. To find the most promising candidate genes that regulate the trait, the biologist typically collects information from multiple resources about the genes in the QTL interval. This process is very laborious and time consuming. Results QTLminer is a bioinformatics tool that automatically performs QTL region analysis. It is available in GeneNetwork and it integrates information such as gene annotation, gene expression and sequence polymorphisms for all the genes within a given genomic interval. Conclusions QTLminer substantially speeds up discovery of the most promising candidate genes within a QTL region.

  16. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  17. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  18. Small RNA regulation of rice homeobox genes.

    Science.gov (United States)

    Jain, Mukesh; Khurana, Jitendra P

    2008-11-01

    Recently, we reported the genome-wide identification of 107 homeobox genes in rice and classified them into ten distinct subfamilies based upon their domain composition and phylogenetic analysis. Microarray analysis revealed the tissue-specific and overlapping expression profiles of these genes during various stages of floral transition, panicle development and seed set. Several homeobox genes were also found to be differentially expressed under abiotic stress conditions. Based on massively parallel signature sequencing (MPSS) data analysis, we report here that a large number of small RNA signatures are associated with rice homeobox genes, which may be involved in their tissue-specific/developmental regulation and stress responses. The association of a very large number of small RNA signatures suggested an unusually high degree of regulation of homeobox genes by small RNAs during inflorescence development.

  19. Gene regulation by steroid hormones III

    Energy Technology Data Exchange (ETDEWEB)

    Roy, A.K.; Clark, J.H.

    1987-01-01

    In this book, the authors discuss the latest advances in molecular endocrinology: - steroid receptor binding to DNA sequences of hormonally controlled genes, - structure of genes controlled by steroid hormones, - heterogeneity of steroid receptors, - immunochemical approaches to receptor studies, and - the most recent approaches to steroid hormone action and biological response. The Contents discussed are: Biochemical Evidence for the Exclusive Nuclear Localization of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor. - Structure, Dynamics, and Cloning of the Estrogen Receptor - Physical and Functional Parameters of Isolated Estrogen Receptor - Type II Binding Sites: Cellular Origin and an Endogeneous Ligand. - The Two Phosphorylation Reactions of the Progesterone Receptor. - Receptor Mediated Action of the Vitamin D Hormone. - Characterization of the Nuclear Binding Sites (Acceptor Sites) for a Steroid Receptor. Antibodies in Estrogen, Progesterone, Glucocorticoid, Vitamin D Receptors and Autoantibodies to Antrogene Receptor. - Isolation and Characterization of cDNA probes for Human CBG and Rat ABP. Ornithine Decarboxy lase mRNAs in Murine Kidney: Structure and Regulation by Androgens - Glucocorticoid Receptors and the Control of Gene Expression. - Activation and Regulation of the Vitellogenin Gene Family. - Intra- and Intercellular Aspects of the Hormonal Regulation of the ..cap alpha..2..mu.. Globulin Gene Expression. - Hormonal Regulation of Sexually Differentiated Isozymes of Cytochrome P-450 in Rat Liver. - Interaction of Thyroid Hormone and Carbohydrates on Hepatic Gene Expression.

  20. Gene regulation by dietary microRNAs.

    Science.gov (United States)

    Zempleni, Janos; Baier, Scott R; Howard, Katherine M; Cui, Juan

    2015-12-01

    MicroRNAs (miRNAs) silence genes through destabilizing mRNA or preventing translation of mRNA, thereby playing an essential role in gene silencing. Traditionally, miRNAs have been considered endogenous regulators of genes, i.e., miRNAs synthesized by an organism regulate the genes in that organism. Recently, that dogma has been challenged in studies suggesting that food-borne miRNAs are bioavailable and affect gene expression in mice and humans. While the evidence in support of this theory may be considered weak for miRNAs that originate in plants, there is compelling evidence to suggest that humans use bovine miRNAs in cow's milk and avian miRNAs in chicken eggs for gene regulation. Importantly, evidence also suggests that mice fed a miRNA-depleted diet cannot compensate for dietary depletion by increased endogenous synthesis. Bioinformatics predictions implicate bovine miRNAs in the regulation of genes that play roles in human health and development. Current challenges in this area of research include that some miRNAs are unable to establish a cause-and-effect between miRNA depletion and disease in miRNA knockout mice, and sequence similarities and identities for bovine and human miRNAs render it difficult to distinguish between exogenous and endogenous miRNAs. Based on what is currently known about dietary miRNAs, the body of evidence appears to be sufficient to consider milk miRNA bioactive compounds in foods, and to increase research activities in this field.

  1. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Li, Bo; Fang, Lusheng; Li, Bo

    2011-01-01

    is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  2. Gene expression regulation in roots under drought.

    Science.gov (United States)

    Janiak, Agnieszka; Kwaśniewski, Mirosław; Szarejko, Iwona

    2016-02-01

    Stress signalling and regulatory networks controlling expression of target genes are the basis of plant response to drought. Roots are the first organs exposed to water deficiency in the soil and are the place of drought sensing. Signalling cascades transfer chemical signals toward the shoot and initiate molecular responses that lead to the biochemical and morphological changes that allow plants to be protected against water loss and to tolerate stress conditions. Here, we present an overview of signalling network and gene expression regulation pathways that are actively induced in roots under drought stress. In particular, the role of several transcription factor (TF) families, including DREB, AP2/ERF, NAC, bZIP, MYC, CAMTA, Alfin-like and Q-type ZFP, in the regulation of root response to drought are highlighted. The information provided includes available data on mutual interactions between these TFs together with their regulation by plant hormones and other signalling molecules. The most significant downstream target genes and molecular processes that are controlled by the regulatory factors are given. These data are also coupled with information about the influence of the described regulatory networks on root traits and root development which may translate to enhanced drought tolerance. This is the first literature survey demonstrating the gene expression regulatory machinery that is induced by drought stress, presented from the perspective of roots. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. Results from a trainable UT instrument - ALN 4060

    International Nuclear Information System (INIS)

    Behravesh, M.

    1984-01-01

    The ALN 4060 Flaw Discriminator is a Z-80 microprocessor based ultrasonic flaw detector/discriminator which is operator trainable on up to three classes of reflectors. It can be applied to any testing situations where normal pulse-echo ultrasonics are used. Received ultrasonic RF waveforms are digitized (at operator selectable rates of up to 160 MHz) before processing and thereafter all internal operations and displays, as well as operator interfaces, are performed in digital mode. The system can be trained to recognize and discriminate between reflectors and can be used in analyses to recognize and classify reflectors by their waveform signatures. In this paper a summary is presented of the evaluation results and the operational experiences that were obtained by the Electrical Power Research Institute nondestructive examination centre in the application of the ALN 4060 to the problem of inspection of intergranular stress corrosion cracks in stainless steel pipes of boiling water reactors. (U.K.)

  4. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    gene regulation will disrupt the cell’s fundamental processes, which in turn can cause disease. Hence, understanding gene regulation is essential for deciphering the code of life. Along with the development of high throughput sequencing (HTS) technology and the subsequent large-scale data analysis...... and temporal alterations of histone modifications (Papers I and II). Coupling the data with machine learning approaches, we established a prediction framework to assess the most informative histone marks as well as their most influential nucleosome positions in predicting the promoter usages. (Papers I......). Focusing on the same promoter across the cell cycle, we observed that histone modification undergoes very distinct temporal lterations compared to their regulatory functions spatially at different promoters (Papers II). By aggregating different HTS methods including CAGE, 3’end-seq, GRO-seq, RNAPII Ch...

  5. Regulation of lipogenic genes in obesity

    OpenAIRE

    Mandard, Stéphane; Kersten, Sander

    2006-01-01

    Lipogenesis describes the process of fatty acid and triglyceride synthesis. Lipogenesis mainly occurs in liver and fat tissue and is under the coordinated control of hormonal, nutritional and transcription factors. Several transcription factors have been identified as critical regulators that mediate the effect of hormones and nutrients on gene transcription. This includes the Sterol Regulatory Element Binding Protein-1c “SREBP-1c”, the CCAAT/Enhancer-Binding Protein-alpha “C/EBPalpha”, the n...

  6. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  7. Regulation of gene expression in human tendinopathy

    Directory of Open Access Journals (Sweden)

    Archambault Joanne M

    2011-05-01

    Full Text Available Abstract Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics.

  8. Dietary Methanol Regulates Human Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  9. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  10. Limb development: a paradigm of gene regulation.

    Science.gov (United States)

    Petit, Florence; Sears, Karen E; Ahituv, Nadav

    2017-04-01

    The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

  11. Nuclear pore complexes as hubs for gene regulation.

    Science.gov (United States)

    D'Angelo, Maximiliano A

    2018-01-01

    Nuclear pore complexes (NPCs), the channels connecting the nucleus with the cytoplasm, are the largest protein structures of the nuclear envelope. In addition to their role in regulating nucleocytoplasmic transport, increasing evidence shows that these multiprotein structures play central roles in the regulation of gene activity. In light of recent discoveries, NPCs are emerging as scaffolds that mediate the regulation of specific gene sets at the nuclear periphery. The function of NPCs as genome organizers and hubs for transcriptional regulation provides additional evidence that the compartmentalization of genes and transcriptional regulators within the nuclear space is an important mechanism of gene expression regulation.

  12. Endogenous methanol regulates mammalian gene activity.

    Science.gov (United States)

    Komarova, Tatiana V; Petrunia, Igor V; Shindyapina, Anastasia V; Silachev, Denis N; Sheshukova, Ekaterina V; Kiryanov, Gleb I; Dorokhov, Yuri L

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  13. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  14. Redox regulation of photosynthetic gene expression.

    Science.gov (United States)

    Queval, Guillaume; Foyer, Christine H

    2012-12-19

    Redox chemistry and redox regulation are central to the operation of photosynthesis and respiration. However, the roles of different oxidants and antioxidants in the regulation of photosynthetic or respiratory gene expression remain poorly understood. Leaf transcriptome profiles of a range of Arabidopsis thaliana genotypes that are deficient in either hydrogen peroxide processing enzymes or in low molecular weight antioxidant were therefore compared to determine how different antioxidant systems that process hydrogen peroxide influence transcripts encoding proteins targeted to the chloroplasts or mitochondria. Less than 10 per cent overlap was observed in the transcriptome patterns of leaves that are deficient in either photorespiratory (catalase (cat)2) or chloroplastic (thylakoid ascorbate peroxidase (tapx)) hydrogen peroxide processing. Transcripts encoding photosystem II (PSII) repair cycle components were lower in glutathione-deficient leaves, as were the thylakoid NAD(P)H (nicotinamide adenine dinucleotide (phosphate)) dehydrogenases (NDH) mRNAs. Some thylakoid NDH mRNAs were also less abundant in tAPX-deficient and ascorbate-deficient leaves. Transcripts encoding the external and internal respiratory NDHs were increased by low glutathione and low ascorbate. Regulation of transcripts encoding specific components of the photosynthetic and respiratory electron transport chains by hydrogen peroxide, ascorbate and glutathione may serve to balance non-cyclic and cyclic electron flow pathways in relation to oxidant production and reductant availability.

  15. Human glucagon gene promoter sequences regulating tissue-specific versus nutrient-regulated gene expression.

    Science.gov (United States)

    Nian, Min; Gu, Jun; Irwin, David M; Drucker, Daniel J

    2002-01-01

    The glucagon-like peptides (GLPs) are synthesized and secreted in a nutrient-dependent manner in rodents; however, the factors regulating human GLP-1 and GLP-2 biosynthesis remain unclear. To understand how nutrients regulate human proglucagon gene expression, we studied the expression of a human proglucagon promoter-growth hormone (GH) transgene in 1.6 human glucagon-GH transgenic mice. Fasting-refeeding significantly decreased and increased the levels of circulating mouse insulin and transgene-derived hGH (P fasting vs. refeeding) and decreased and upregulated, respectively, the levels of endogenous mouse proglucagon RNA in the ileum but not in the jejunum or colon. High-fiber feeding significantly increased the levels of glucose-stimulated circulating hGH and upregulated levels of mouse intestinal proglucagon gene expression in the jejunum, ileum, and colon (P fasting-refeeding nor a high-fiber diet upregulated the expression of the human proglucagon promoter-hGH transgene. These findings demonstrate that human proglucagon gene regulatory sequences specifying tissue-specific expression in gut endocrine cells are not sufficient for recognition of energy-derived signals regulating murine glucagon gene expression in enteroendocrine cells in vivo.

  16. Fine mapping of gene regions regulating neurodegeneration.

    Directory of Open Access Journals (Sweden)

    Maria Swanberg

    Full Text Available BACKGROUND: Damage to nerve cells and axons leading to neurodegeneration is a characteristic feature of many neurological diseases. The degree of genetic influence on susceptibility to axotomy-induced neuronal death has so far been unknown. We have examined two gene regions, Vra1 and Vra2, previously linked to nerve cell loss after ventral root avulsion in a rat F2 intercross between the DA and PVG inbred rat strains. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we use two generations (G8 and G10 cohorts of an advanced intercross line between DA and PVG(av1 to reproduce linkage to Vra1 and to fine-map this region. By isolating the effect from Vra1 in congenic strains, we demonstrate that Vra1 significantly regulates the loss of motoneurons after avulsion. The regulatory effect mediated by Vra1 thus resides in a congenic fragment of 9 megabases. Furthermore, we have used the advanced intercross lines to give more support to Vra2, originally detected as a suggestive QTL. CONCLUSIONS/SIGNIFICANCE: The results demonstrated here show that naturally occurring allelic variations affect susceptibility to axotomy-induced nerve cell death. Vra1 and Vra2 represent the first quantitative trait loci regulating this phenotype that are characterized and fine mapped in an advanced intercross line. In addition, congenic strains provide experimental evidence for the Vra1 effect on the extent of injury-induced neurodegeneration. Identification of the underlying genetic variations will increase our understanding of the regulation and mechanisms of neurodegeneration.

  17. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  18. Method of Creation of “Core-Gisseismic Attributes” Dependences With Use of Trainable Neural Networks

    Directory of Open Access Journals (Sweden)

    Gafurov Denis

    2016-01-01

    Full Text Available The study describes methodological techniques and results of geophysical well logging and seismic data interpretation by means of trainable neural networks. Objects of research are wells and seismic materials of Talakan field. The article also presents forecast of construction and reservoir properties of Osa horizon. The paper gives an example of creation of geological (lithological -facial model of the field based on developed methodical techniques of complex interpretation of geologicgeophysical data by trainable neural network. The constructed lithological -facial model allows specifying a geological structure of the field. The developed methodical techniques and the trained neural networks may be applied to adjacent sites for research of carbonate horizons.

  19. Does perceived trainability of dog (Canis lupus familiaris) breeds reflect differences in learning or differences in physical ability?

    Science.gov (United States)

    Helton, William S

    2010-03-01

    Researchers have reported perceived differences in trainability between different dog breeds. These reports could either be the result of underlying differences in learning or differences in physical capabilities. Four studies were conducted to investigate this issue. In Study 1 the level of agility metal-winners amongst those breeds perceived to be high and low in trainability did not deviate significantly from their respective levels of participation in the sport. In Study 2 the level of precision amongst those dogs perceived to be high and low in trainability did not deviate significantly in a real agility competition (P>0.05), but these dogs did differ in speed (Pagility precision mastery did not significantly differ amongst dogs from breeds perceived to be high and low in trainability (P>0.05), but there was a significant difference in speed. Finally, in Study 4 breeds considered to be high in trainability were found to be relatively physically homogenous in respects to height, in comparison to breeds considered to be low in trainability. Overall, the results of these studies are more supportive of a physical capability interpretation of perceived breed differences in trainability, than a more cognitive interpretation. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  20. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  1. Mining significant high utility gene regulation sequential patterns.

    Science.gov (United States)

    Zihayat, Morteza; Davoudi, Heidar; An, Aijun

    2017-12-14

    Mining frequent gene regulation sequential patterns in time course microarray datasets is an important mining task in bioinformatics. Although finding such patterns are of paramount important for studying a disease, most existing work do not consider gene-disease association during gene regulation sequential pattern discovery. Moreover, they consider more absent/existence effects of genes during the mining process than taking the degrees of genes expression into account. Consequently, such techniques discover too many patterns which may not represent important information to biologists to investigate the relationships between the disease and underlying reasons hidden in gene regulation sequences. We propose a utility model by considering both the gene-disease association score and their degrees of expression levels under a biological investigation. We propose an efficient method called Top-HUGS, for discoverying significant high utility gene regulation sequential patterns from a time-course microarray dataset. In this study, the proposed methods were evaluated on a publicly available time course microarray dataset. The experimental results show higher accuracies compared to the baseline methods. Our proposed methods found that several new gene regulation sequential patterns involved in such patterns were useful for biologists and provided further insights into the mechanisms underpinning biological processes. To effectively work with the proposed method, a web interface is developed to our system using Java. To the best of our knowledge, this is the first demonstration for significant high utility gene regulation sequential pattern discovery.

  2. Automatic detection of vascular bifurcations in segmented retinal images using trainable COSFIRE filters

    NARCIS (Netherlands)

    Azzopardi, George; Petkov, Nicolai

    2013-01-01

    Background: The vascular tree observed in a retinal fundus image can provide clues for cardiovascular diseases. Its analysis requires the identification of vessel bifurcations and crossovers. Methods: We use a set of trainable keypoint detectors that we call Combination Of Shifted Filter REsponses

  3. Increased generalization capability of trainable COSFIRE filters with application to machine vision

    NARCIS (Netherlands)

    Azzopardi, George; Fernandez-Robles, Laura; Alegre, Enrique; Petkov, Nicolai

    2017-01-01

    The recently proposed trainable COSFIRE filters are highly effective in a wide range of computer vision applications, including object recognition, image classification, contour detection and retinal vessel segmentation. A COSFIRE filter is selective for a collection of contour parts in a certain

  4. Treatment of a Psychotic Trainable Retarded Child in a Day Hospital for Children with Average Intelligence.

    Science.gov (United States)

    Zang, Louis C.; Cohen, Jonathan L.

    The case study describes the progress of a psychotic trainable mentally retarded child who at age seven entered a day psychiatric hospital for disturbed children with average intelligence. The boy's therapist describes changes in the child's peer interaction, academic performance, group psychotherapy participation, and psychological test…

  5. [Gene networks that regulate secondary metabolism in actinomycetes: pleiotropic regulators].

    Science.gov (United States)

    Rabyk, M V; Ostash, B O; Fedorenko, V O

    2014-01-01

    Current advances in the research and practical applications of pleiotropic regulatory genes for antibiotic production in actinomycetes are reviewed. The basic regulatory mechanisms found in these bacteria are outlined. Examples described in the review show the importance of the manipulation of regulatory systems that affect the synthesis of antibiotics for the metabolic engineering of the actinomycetes. Also, the study of these genes is the basis for the development of genetic engineering approaches towards the induction of "cryptic" part of the actinomycetes secondary metabolome, which capacity for production of biologically active compounds is much bigger than the diversity of antibiotics underpinned by traditional microbiological screening. Besides the practical problems, the study of regulatory genes for antibiotic biosynthesis will provide insights into the process of evolution of complex regulatory systems that coordinate the expression of gene operons, clusters and regulons, involved in the control of secondary metabolism and morphogenesis of actinomycetes.

  6. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...... efficacy. Consequently, differences in the miRNA expression among individuals could be an important factor contributing to differential drug response. Pharmacogenomics genes can be divided into drug target genes termed as pharmacodynamics genes (PD) and genes involved in drug transport and metabolism...

  7. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  8. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  9. Epigenetic Regulation of Higher Order Chromatin Conformations and Gene Transcription

    OpenAIRE

    Göndör, Anita

    2007-01-01

    Epigenetic states constitute heritable features of the chromatin to regulate when, where and how genes are expressed in the developing conceptus. A special case of epigenetic regulation, genomic imprinting, is defined as parent of origin-dependent monoallelic expression. The Igf2-H19 locus is considered as paradigm of genomic imprinting with a growth-promoting gene, Igf2, expressed paternally and a growth antagonist, H19 encoding a non-coding transcript, expressed only from the maternal allel...

  10. Unraveling the complex epigenetic mechanisms that regulate gene activity

    NARCIS (Netherlands)

    Bemer, Marian

    2018-01-01

    Our understanding of the epigenetic mechanisms that regulate gene expression has been largely increased in recent years by the development and refinement of different techniques. This has revealed that gene transcription is highly influenced by epigenetic mechanisms, i.e., those that do not involve

  11. Regulation of gene expression in entomopathogenic fungi in three ...

    African Journals Online (AJOL)

    The entomopathogenic fungi are subject to regulation system known as signal transduction that regulates the expression of the different genes required for each life stage, first comprising cuticle adhesion and degradation, later the survival in the hemolymph, and finally the fungal growth in soils. There are two ...

  12. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    Science.gov (United States)

    2006-07-01

    S., Bertucci, F., Birnbaum, D., Nguyen, C., Harousseau, J.L., Bataille , R., Houlgatte, R., and Minvielle, S. 2003. Gene expression profiling of...role of Rho in cell transformation by oncogenic Ras. Oncogene 10:2289-2296. 182. Pykett, M.J., Murphy, M., Harnish, P.R., and George , D.L. 1994. The

  13. Regulation of Clock Genes by Adrenergic Receptor Signaling in Osteoblasts.

    Science.gov (United States)

    Hirai, Takao

    2018-01-01

    The clock system has been identified as one of the major mechanisms controlling cellular functions. Circadian clock gene oscillations also actively participate in the functions of various cell types including bone-related cells. Previous studies demonstrated that clock genes were expressed in bone tissue and also that their expression exhibited circadian rhythmicity. Recent findings have shown that sympathetic tone plays a central role in biological oscillations in bone. Adrenergic receptor (AR) signaling regulates the expression of clock genes in cancellous bone. Furthermore, α 1 -AR signaling in osteoblasts is known to negatively regulate the expression of bone morphogenetic protein-4 (Bmp4) by up-regulating nuclear factor IL-3 (Nfil3)/e4 promoter-binding protein 4 (E4BP4). The ablation of α 1B -AR signaling also increases the expression of the Bmp4 gene in bone. The findings of transient overexpression and siRNA experiments have supported the involvement of the transcription factor CCAAT/enhancer-binding protein delta (C/EBPδ, Cebpd) in Nfil3 and Bmp4 expression in MC3T3-E1 cells. These findings suggest that the effects of Cebpd are due to the circadian regulation of Bmp4 expression, at least in part, by the up-regulated expression of the clock gene Nfil3 in response to α 1B -AR signaling in osteoblasts. Therefore, AR signaling appears to modulate cellular functionality through the expression of clock genes that are circadian rhythm regulators in osteoblasts. The expression of clock genes regulated by the sympathetic nervous system and clock-controlled genes that affect bone metabolism are described herein.

  14. Plant defense genes are regulated by ethylene

    Energy Technology Data Exchange (ETDEWEB)

    Ecker, J.R.; Davis, R.W.

    1987-08-01

    One of the earliest detectable events during plant-pathogen interaction is a rapid increase in ethylene biosynthesis. This gaseous plant stress hormone may be a signal for plants to activate defense mechanisms against invading pathogens such as bacteria, fungi, and viruses. The effect of ethylene on four plant genes involved in three separate plant defense response pathways was examined; these included (i and ii) genes that encode L-phenylalanine ammonia-lyase (EC 4.3.1.5) and 4-coumarate:CoA ligase (4-coumarate:CoA ligase (AMP-forming), EC 6.2.1.12), enzymes of the phenylpropanoid pathway, (iii) the gene encoding chalcone synthase, an enzyme of the flavonoid glycoside pathway, and (iv) the genes encoding hydroxyproline-rich glycoprotein, a major protein component(s) of plant cell walls. Blot hybridization analysis of mRNA from ethylene-treated carrot roots reveals marked increases in the levels of phenylalanine ammonia-lyase mRNA, 4-coumarate CoA ligase mRNA, chalcone synthase mRNA, and certain hydroxyproline-rich glycoprotein transcripts. The effect of ethylene on hydroxyproline-rich glycoprotein mRNA accumulation was different from that of wounding. Ethylene induces two hydroxyproline-rich glycoprotein mRNAs (1.8 and 4.0 kilobases), whereas wounding of carrot root leads to accumulation of an additional hydroxyproline-rich mRNA (1.5 kilobases). These results indicate that at least two distinct signals, ethylene and a wound signal, can affect the expression of plant defense-response genes.

  15. Regulation of bacterial gene expression by ribosome stalling and rescuing.

    Science.gov (United States)

    Jin, Yongxin; Jin, Shouguang; Wu, Weihui

    2016-05-01

    Ribosome is responsible for protein synthesis and is able to monitor the sequence and structure of the nascent peptide. Such ability plays an important role in determining overall gene expression profile of the bacteria through ribosome stalling and rescuing. In this review, we briefly summarize our current understanding of the regulation of gene expression through ribosome stalling and rescuing in bacteria, as well as mechanisms that modulate ribosome activity. Understanding the mechanisms of how bacteria modulate ribosome activity will provide not only fundamental insights into bacterial gene regulation, but also new candidate targets for the development of novel antimicrobial agents.

  16. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  17. Trainability and reversibility in physical fitness among elderly persons taking part in an intervention program

    OpenAIRE

    Seemann,Taysi; Schmitt,Carolina Weber; Guimarães,Adriana Coutinho de Azevedo; Korn,Simone; Simas,Joseani Paulini Neves; Souza,Melissa de Carvalho; Machado,Zenite

    2016-01-01

    Objective To assess the trainability and reversibility of variables of physical fitness in elderly participants in Active Living Functional Gymnastics. Method This ex post facto study was composed of 115 elderly women from six functional fitness groups in the Active Living Program in Florianopolis. The Rikli and Jones battery of tests (Chair Stand Test, Arm Curl Test, Chair Sit and Reach Test, Back Scratch Test, 8-Foot Up and Go Test, 6 Minute Walk Test) was used. The intervention period las...

  18. A Network-based End-to-End Trainable Task-oriented Dialogue System

    OpenAIRE

    Wen, Tsung-Hsien; Vandyke, David; Mrksic, Nikola; Gasic, Milica; Rojas-Barahona, Lina M.; Su, Pei-Hao; Ultes, Stefan; Young, Steve

    2016-01-01

    Teaching machines to accomplish tasks by conversing naturally with humans is challenging. Currently, developing task-oriented dialogue systems requires creating multiple components and typically this involves either a large amount of handcrafting, or acquiring costly labelled datasets to solve a statistical learning problem for each component. In this work we introduce a neural network-based text-in, text-out end-to-end trainable goal-oriented dialogue system along with a new way of collectin...

  19. The trainable trajectory formation model TD-HMM parameterized for the LIPS 2008 challenge

    OpenAIRE

    Bailly , Gérard; Govokhina , Oxana; Breton , Gaspard; Elisei , Frédéric; Savariaux , Christophe

    2008-01-01

    International audience; We describe here the trainable trajectory formation model that will be used for the LIPS'2008 challenge organized at InterSpeech'2008. It predicts articulatory trajectories of a talking face from phonetic input. It basically uses HMM-based synthesis but asynchrony between acoustic and gestural boundaries - taking for example into account non audible anticipatory gestures - is handled by a phasing model that predicts the delays between the acoustic boundaries of allopho...

  20. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  1. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  2. Y Chromosome Regulation of Autism Susceptibility Genes

    Science.gov (United States)

    2009-06-01

    autistic children. Such distorted ratio could be as high as 8:1 in some populations [12, 13]. Sexual dimorphism in autism is a key and consistent... autism [18-24]. Recent studies in our laboratory suggest that genes on the Y chromosome could contribute to such sexual dimorphisms, thereby raising the...contribute to autism susceptibility, have provided a critical clue that the male-only chromosome is potentially a key player in the sexual dimorphism

  3. Does negative auto-regulation increase gene duplicability?

    Directory of Open Access Journals (Sweden)

    Lercher Martin J

    2009-08-01

    Full Text Available Abstract Background A prerequisite for a duplication to spread through and persist in a given population is retaining expression of both gene copies. Yet changing a gene's dosage is frequently detrimental to fitness. Consequently, dosage-sensitive genes are less likely to duplicate. However, in cases where the level of gene product is controlled, via negative feedback, by its own abundance, an increase in gene copy number can in principle be decoupled from an increase in protein while both copies remain expressed. Using data from the transcriptional networks of E. coli and S. cerevisiae, we test the hypothesis that genes under negative auto-regulation show enhanced duplicability. Results Controlling for several known correlates of duplicability, we find no statistically significant support in either E. coli or S. cerevisiae that transcription factors under negative auto-regulation hold a duplicability advantage over transcription factors with no auto-regulation. Conclusion Based on the analysis of transcriptional networks in E. coli and S. cerevisiae, there is no evidence that negative auto-regulation has contributed, on a genome-wide scale, to the variability in gene family sizes in these species.

  4. Aerobic Fitness and Trainability in Healthy Youth: Gaps in Our Knowledge.

    Science.gov (United States)

    Armstong, Neil; McNarry, Melitta

    2016-05-01

    Peak oxygen uptake (VO2) is widely recognized as the criterion measure of young people's aerobic fitness. Peak VO2 in youth has been assessed and documented for over 75 years but the interpretation of peak VO2 and its trainability are still shrouded in controversy. Causal mechanisms and their modulation by chronological age, biological maturation and sex remain to be resolved. Furthermore, exercise of the intensity and duration required to determine peak VO2 is rarely experienced by most children and adolescents. In sport and in everyday life young people are characterized by intermittent bouts of exercise and rapid changes in exercise intensity. In this context it is the transient kinetics of pulmonary VO2 (pVO2), not peak VO2, which best describe aerobic fitness. There are few rigorously determined and appropriately analyzed data from young people's pVO2 kinetics responses to step changes in exercise intensity. Understanding of the trainability of pVO2 kinetics is principally founded on comparative studies of trained and untrained youth and much remains to be elucidated. This paper reviews peak VO2, pVO2 kinetics, and their trainability in youth. It summarizes "what we know," identifies significant gaps in our knowledge, raises relevant questions, and indicates avenues for future research.

  5. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  6. The NSL Complex Regulates Housekeeping Genes in Drosophila

    Science.gov (United States)

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  7. Divergence of gene regulation through chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Messing Joachim

    2010-11-01

    Full Text Available Abstract Background The molecular mechanisms that modify genome structures to give birth and death to alleles are still not well understood. To investigate the causative chromosomal rearrangements, we took advantage of the allelic diversity of the duplicated p1 and p2 genes in maize. Both genes encode a transcription factor involved in maysin synthesis, which confers resistance to corn earworm. However, p1 also controls accumulation of reddish pigments in floral tissues and has therefore acquired a new function after gene duplication. p1 alleles vary in their tissue-specific expression, which is indicated in their allele designation: the first suffix refers to red or white pericarp pigmentation and the second to red or white glume pigmentation. Results Comparing chromosomal regions comprising p1-ww[4Co63], P1-rw1077 and P1-rr4B2 alleles with that of the reference genome, P1-wr[B73], enabled us to reconstruct additive events of transposition, chromosome breaks and repairs, and recombination that resulted in phenotypic variation and chimeric regulatory signals. The p1-ww[4Co63] null allele is probably derived from P1-wr[B73] by unequal crossover between large flanking sequences. A transposon insertion in a P1-wr-like allele and NHEJ (non-homologous end-joining could have resulted in the formation of the P1-rw1077 allele. A second NHEJ event, followed by unequal crossover, probably led to the duplication of an enhancer region, creating the P1-rr4B2 allele. Moreover, a rather dynamic picture emerged in the use of polyadenylation signals by different p1 alleles. Interestingly, p1 alleles can be placed on both sides of a large retrotransposon cluster through recombination, while functional p2 alleles have only been found proximal to the cluster. Conclusions Allelic diversity of the p locus exemplifies how gene duplications promote phenotypic variability through composite regulatory signals. Transposition events increase the level of genomic complexity

  8. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  9. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  10. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  11. The dynamic landscape of gene regulation during Bombyx mori oogenesis.

    Science.gov (United States)

    Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze

    2017-09-11

    Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.

  12. Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

    Science.gov (United States)

    Xi, Ting; Zhang, Guizhi

    2017-02-01

    Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. [Regulation of extramitochondrial malic enzyme gene expression in lipogenic tissues].

    Science.gov (United States)

    Stelmańska, Ewa

    2007-11-06

    Extramitochondrial malic enzyme is widely distributed in mammalian tissues, including humans. The major role of this protein in the liver and white adipose tissue is the production of NADPH required for fatty-acid synthesis. Malic enzyme thus belongs to the family of lipogenic enzymes. Malic enzyme activity is regulated both by gene transcription and mRNA stability. Malic enzyme gene expression is tightly controlled by hormonal (i.e. insulin, glucagon, triiodothyronine) and nutritional conditions. There are many transcription factors which recognize special response elements present in the malic enzyme gene promoter. In this paper some important information about the structure and regulation of malic enzyme gene expression in mammalian lipogenic tissues is presented.

  14. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  15. PARP-1 and gene regulation: progress and puzzles.

    Science.gov (United States)

    Kraus, W Lee; Hottiger, Michael O

    2013-12-01

    Poly(ADP-ribose) polymerase-1 (PARP-1), also referred to as ADP-ribosyltransferase Diphtheria toxin-like 1 (ARTD1), is an abundant nuclear protein that plays key roles in a variety of nuclear processes, including the regulation of transcription. PARP-1 possesses an intrinsic enzymatic activity that catalyzes the transfer of ADP-ribose (ADPR) units from nicotinamide adenine dinucleotide (NAD(+)) onto target gene regulatory proteins, thereby modulating their activities. Although great strides have been made in the past decade in deciphering the seemingly opposing and varied roles of PARP-1 in gene regulation, many puzzles remain. In this review, we discuss the current state of understanding in this area, especially how PARP-1 interfaces with various components of gene regulatory pathways (e.g., the basal transcription machinery, DNA-binding transcription factors, coregulators, chromatin remodeling, histone modifications, and DNA methylation). In addition, we discuss some gene-specific, cell type-specific, and cell state-specific effects of PARP-1 on gene regulation, which might contribute to its biological functions. Finally, we review some of the recent progress targeting PARPs using chemical inhibitors, some of which may alter PARP-1-dependent gene regulatory programs to promote therapeutic outcomes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Decapping of long noncoding RNAs regulates inducible genes.

    Science.gov (United States)

    Geisler, Sarah; Lojek, Lisa; Khalil, Ahmad M; Baker, Kristian E; Coller, Jeff

    2012-02-10

    Decapping represents a critical control point in regulating expression of protein coding genes. Here, we demonstrate that decapping also modulates expression of long noncoding RNAs (lncRNAs). Specifically, levels of >100 lncRNAs in yeast are controlled by decapping and are degraded by a pathway that occurs independent of decapping regulators. We find many lncRNAs degraded by DCP2 are expressed proximal to inducible genes. Of these, we show several genes required for galactose utilization are associated with lncRNAs that have expression patterns inversely correlated with their mRNA counterpart. Moreover, decapping of these lncRNAs is critical for rapid and robust induction of GAL gene expression. Failure to destabilize a lncRNA known to exert repressive histone modifications results in perpetuation of a repressive chromatin state that contributes to reduced plasticity of gene activation. We propose that decapping and lncRNA degradation serve a vital role in transcriptional regulation specifically at inducible genes. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  18. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  19. Epigenetic regulation of inducible gene expression in the immune system.

    Science.gov (United States)

    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha

    2013-07-01

    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation. © 2013 John Wiley & Sons Ltd.

  20. Regulation of human autoimmune regulator (AIRE) gene translation by miR-220b.

    Science.gov (United States)

    Matsuo, Tomohito; Noguchi, Yukiko; Shindo, Mieko; Morita, Yoshifumi; Oda, Yoshie; Yoshida, Eiko; Hamada, Hiroko; Harada, Mine; Shiokawa, Yuichi; Nishida, Takahiro; Tominaga, Ryuji; Kikushige, Yoshikane; Akashi, Koichi; Kudoh, Jun; Shimizu, Nobuyoshi; Tanaka, Yuka; Umemura, Tsukuru; Taniguchi, Taketoshi; Yoshimura, Akihiko; Kobayashi, Takashi; Mitsuyama, Masao; Kurisaki, Hironori; Katsuta, Hitoshi; Nagafuchi, Seiho

    2013-11-01

    Although mutations of autoimmune regulator (AIRE) gene are responsible for autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED), presenting a wide spectrum of many characteristic and non-characteristic clinical features, some patients lack AIRE gene mutations. Therefore, something other than a mutation, such as dysregulation of AIRE gene, may be a causal factor for APECED or its related diseases. However, regulatory mechanisms for AIRE gene expression and/or translation have still remained elusive. We found that IL-2-stimulated CD4(+) T (IL-2T) cells showed a high expression of AIRE gene, but very low AIRE protein production, while Epstein-Barr virus-transformed B (EBV-B) cells express both AIRE gene and AIRE protein. By using microarray analysis, we could identify miR-220b as a possible regulatory mechanism for AIRE gene translation in IL-2T cells. Here we report that miR-220b significantly reduced the expression of AIRE protein in AIRE gene with 3'UTR region transfected 293T cells, whereas no alteration of AIRE protein production was observed in the open reading frame of AIRE gene alone transfected cells. In addition, anti-miR-220b reversed the inhibitory function of miR-220b for the expression of AIRE protein in AIRE gene with 3'UTR region transfected cells. Moreover, when AIRE gene transfected cells with mutated 3'UTR were transfected with miR-220b, no reduction of AIRE protein production was observed. Taken together, it was concluded that miR-220b inhibited the AIRE gene translation through the 3'UTR region of AIRE gene, indicating that miR-220b could serve as a regulator for human AIRE gene translation. © 2013.

  1. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  2. Genes, epigenetics and miRNA regulation in the placenta.

    Science.gov (United States)

    Vaiman, Daniel

    2017-04-01

    This text reviews briefly the context in which epigenetics regulate gene expression in trophoblast development and function. It is an attempt to focus on a limited number of recent papers that, according to the author, shed new light on placental development, and constitute possible trails for improving knowledge and women follow-up in pathological pregnancies. Copyright © 2016. Published by Elsevier Ltd.

  3. What DNA sequence tells us about gene regulation - The ...

    Indian Academy of Sciences (India)

    Rahul Siddharthan

    2007-11-03

    Nov 3, 2007 ... Predicting cis-regulatory modules: eve enhancers. Performance, even without prior WMs, comparable to dedicated CRM prediction programs like Stubb. Rahul Siddharthan. (The Institute of Mathematical Sciences, Chennai 600 113. What DNA sequence tells us about gene regulation. 03/11/2007. 27 / 34 ...

  4. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    Introduction. The genetic regulation of adult brain development has re- mained enigmatic to developmental biologists since long. The practical difficulty in understanding the adult brain de- velopment is that most of the mutational searches done for genes in different model systems yield mutations inducing embryonic ...

  5. Gene Expression Profiling of Apoptosis Regulators in Patients with Sepsis

    NARCIS (Netherlands)

    Hoogerwerf, Jacobien J.; van Zoelen, Marieke A.; Wiersinga, W. Joost; van 't Veer, Cornelis; de Vos, Alex F.; de Boer, Anita; Schultz, Marcus J.; Hooibrink, Berend; de Jonge, Evert; van der Poll, Tom

    2010-01-01

    Introduction: Sepsis is associated with a dysregulation of apoptosis in immune cells, which has been implicated in both immunosuppression and multiple organ failure. We describe the expression profiles of genes encoding key regulators of apoptosis in highly purified monocytes, granulocytes and CD4+

  6. ApoM: gene regulation and effects on HDL metabolism

    DEFF Research Database (Denmark)

    Nielsen, Lars B; Christoffersen, Christina; Ahnström, Josefin

    2009-01-01

    The recently discovered apolipoprotein M (apoM) is a plasma protein of the lipocalin family associated with the lipoproteins (mainly high-density lipoproteins, or HDLs). Expression of the apoM gene in the liver is regulated by transcription factors that control key steps in hepatic lipid and gluc...

  7. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    2Flinders Centre for Innovation in Cancer, School of Medicine, Flinders University, Flinders Medical Centre,. Adelaide 5042, Australia .... gene regulation mechanisms, lncRNAs have distinct features from other regulatory ncRNAs ...... blastoma (RB) in human colorectal cancer (Tsang et al. 2010; Hauptman and Glavac 2013) ...

  8. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-08-01

    Full Text Available Abstract Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in

  9. Early development of Moniliophthora perniciosa basidiomata and developmentally regulated genes

    Science.gov (United States)

    2009-01-01

    Background The hemibiotrophic fungus Moniliophthora perniciosa is the causal agent of Witches' broom, a disease of Theobroma cacao. The pathogen life cycle ends with the production of basidiocarps in dead tissues of the infected host. This structure generates millions of basidiospores that reinfect young tissues of the same or other plants. A deeper understanding of the mechanisms underlying the sexual phase of this fungus may help develop chemical, biological or genetic strategies to control the disease. Results Mycelium was morphologically analyzed prior to emergence of basidiomata by stereomicroscopy, light microscopy and scanning electron microscopy. The morphological changes in the mycelium before fructification show a pattern similar to other members of the order Agaricales. Changes and appearance of hyphae forming a surface layer by fusion were correlated with primordia emergence. The stages of hyphal nodules, aggregation, initial primordium and differentiated primordium were detected. The morphological analysis also allowed conclusions on morphogenetic aspects. To analyze the genes involved in basidiomata development, the expression of some selected EST genes from a non-normalized cDNA library, representative of the fruiting stage of M. perniciosa, was evaluated. A macroarray analysis was performed with 192 selected clones and hybridized with two distinct RNA pools extracted from mycelium in different phases of basidiomata formation. This analysis showed two groups of up and down-regulated genes in primordial phases of mycelia. Hydrophobin coding, glucose transporter, Rho-GEF, Rheb, extensin precursor and cytochrome p450 monooxygenase genes were grouped among the up-regulated. In the down-regulated group relevant genes clustered coding calmodulin, lanosterol 14 alpha demethylase and PIM1. In addition, 12 genes with more detailed expression profiles were analyzed by RT-qPCR. One aegerolysin gene had a peak of expression in mycelium with primordia and a

  10. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  11. Identification of Master Regulator Genes in Human Periodontitis.

    Science.gov (United States)

    Sawle, A D; Kebschull, M; Demmer, R T; Papapanou, P N

    2016-08-01

    Analytic approaches confined to fold-change comparisons of gene expression patterns between states of health and disease are unable to distinguish between primary causal disease drivers and secondary noncausal events. Genome-wide reverse engineering approaches can facilitate the identification of candidate genes that may distinguish between causal and associative interactions and may account for the emergence or maintenance of pathologic phenotypes. In this work, we used the algorithm for the reconstruction of accurate cellular networks (ARACNE) to analyze a large gene expression profile data set (313 gingival tissue samples from a cross-sectional study of 120 periodontitis patients) obtained from clinically healthy (n = 70) or periodontitis-affected (n = 243) gingival sites. The generated transcriptional regulatory network of the gingival interactome was subsequently interrogated with the master regulator inference algorithm (MARINA) and gene expression signature data from healthy and periodontitis-affected gingiva. Our analyses identified 41 consensus master regulator genes (MRs), the regulons of which comprised between 25 and 833 genes. Regulons of 7 MRs (HCLS1, ZNF823, XBP1, ZNF750, RORA, TFAP2C, and ZNF57) included >500 genes each. Gene set enrichment analysis indicated differential expression of these regulons in gingival health versus disease with a type 1 error between 2% and 0.5% and with >80% of the regulon genes in the leading edge. Ingenuity pathway analysis showed significant enrichment of 36 regulons for several pathways, while 6 regulons (those of MRs HCLS1, IKZF3, ETS1, NHLH2, POU2F2, and VAV1) were enriched for >10 pathways. Pathways related to immune system signaling and development were the ones most frequently enriched across all regulons. The unbiased analysis of genome-wide regulatory networks can enhance our understanding of the pathobiology of human periodontitis and, after appropriate validation, ultimately identify target molecules of

  12. Mutations in some Polycomb group genes of Drosophila interfere with regulation of segmentation genes.

    Science.gov (United States)

    McKeon, J; Slade, E; Sinclair, D A; Cheng, N; Couling, M; Brock, H W

    1994-09-01

    Mutations in several Polycomb (Pc) group genes cause maternal-effect or zygotic segmentation defects, suggesting that Pc group genes may regulate the segmentation genes of Drosophila. We show that individuals doubly heterozygous for mutations in polyhomeotic and six other Pc group genes show gap, pair rule, and segment polarity segmentation defects. We examined double heterozygous combinations of Pc group and segmentation mutations for enhancement of adult and embryonic segmentation defects. Posterior sex combs and polyhomeotic interact with Krüppel and enhance embryonic phenotypes of hunchback and knirps, and polyhomeotic enhances even-skipped. Surprisingly, flies carrying duplications of extra sex combs (esc), that were heterozygous for mutations of even-skipped (eve), were extremely subvital. Embryos and surviving adults of this genotype showed strong segmentation defects in even-numbered segments. Antibody studies confirm that expression of eve is suppressed by duplications of esc. However, esc duplications have no effect on other gap or pair rule genes tested. To our knowledge, this is only the second triplo-abnormal phenotype associated with Pc group genes. Duplications of nine other Pc group genes have no detectable effect on eve. Expression of engrailed (en) was abnormal in the central nervous systems of most Pc group mutants. These results support a role for Pc genes in regulation of some segmentation genes, and suggest that esc may act differently from other Pc group genes.

  13. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  14. Functional Enhancers As Master Regulators of Tissue-Specific Gene Regulation and Cancer Development

    Science.gov (United States)

    Ko, Je Yeong; Oh, Sumin; Yoo, Kyung Hyun

    2017-01-01

    Tissue-specific transcription is critical for normal development, and abnormalities causing undesirable gene expression may lead to diseases such as cancer. Such highly organized transcription is controlled by enhancers with specific DNA sequences recognized by transcription factors. Enhancers are associated with chromatin modifications that are distinct epigenetic features in a tissue-specific manner. Recently, super-enhancers comprising enhancer clusters co-occupied by lineage-specific factors have been identified in diverse cell types such as adipocytes, hair follicle stem cells, and mammary epithelial cells. In addition, noncoding RNAs, named eRNAs, are synthesized at super-enhancer regions before their target genes are transcribed. Many functional studies revealed that super-enhancers and eRNAs are essential for the regulation of tissue-specific gene expression. In this review, we summarize recent findings concerning enhancer function in tissue-specific gene regulation and cancer development. PMID:28359147

  15. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  16. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  17. Gene Regulation System of Vasopressin and Corticotoropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Masanori Yoshida

    2008-01-01

    Full Text Available The neurohypophyseal hormones, arginine vasopressin and corticotropin-releasing hormone (CRH, play a crucial role in the physiological and behavioral response to various kinds of stresses. Both neuropeptides activate the hypophysialpituitary-adrenal (HPA axis, which is a central mediator of the stress response in the body. Conversely, they receive the negative regulation by glucocorticoid, which is an end product of the HPA axis. Vasopressin and CRH are closely linked to immune response; they also interact with pro-inflammatory cytokines. Moreover, as for vasopressin, it has another important role, which is the regulation of water balance through its potent antidiuretic effect. Hence, it is conceivable that vasopressin and CRH mediate the homeostatic responses for survival and protect organisms from the external world. A tight and elaborate regulation system of the vasopressin and CRH gene is required for the rapid and flexible response to the alteration of the surrounding environments. Several important regulatory elements have been identified in the proximal promoter region in the vasopressin and CRH gene. Many transcription factors and intracellular signaling cascades are involved in the complicated gene regulation system. This review focuses on the current status of the basic research of vasopressin and CRH. In addition to the numerous known facts about their divergent physiological roles, the recent topics of promoter analyses will be discussed.

  18. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  19. Epigenetic Modification of the Repair Donor Regulates Targeted Gene Correction

    Directory of Open Access Journals (Sweden)

    Olivier Humbert

    2012-01-01

    Full Text Available Optimizing design of vectors is critical to effective gene therapy. In targeted gene correction (TGC, cleavage of chromosomal DNA near a mutation stimulates homology-directed repair of a target gene using a donor provided in trans. We have systematically addressed epigenetic parameters of donor design, using a flow-based assay to quantify correction frequencies and expression levels of a green fluorescent protein (GFP reporter gene in a human cell line. We show that active transcription of the donor increased correction frequency by threefold, establishing that a proximal promoter enhances donor use. Conversely, CpG methylation of the donor diminished correction frequency and reduced expression of the repaired gene. However, bisulfite sequencing of the target revealed no transfer of methylation marks during repair with a methylated donor. Treatment with histone deacetylase (HDAC inhibitors can partially compensate for epigenetic inactivation, suggesting a role for class I and II HDACs in regulation of donor use. These results establish that epigenetic status of a trans-donor determines both the efficiency and outcome of gene correction, and identify and clarify parameters that should guide donor design for targeted gene therapy.

  20. Carbon Catabolite Repression Regulates Glyoxylate Cycle Gene Expression in Cucumber.

    Science.gov (United States)

    Graham, I. A.; Denby, K. J.; Leaver, C. J.

    1994-01-01

    We have previously proposed that metabolic status is important in the regulation of cucumber malate synthase (MS) and isocitrate lyase (ICL) gene expression during plant development. In this article, we used a cell culture system to demonstrate that intracellular metabolic status does influence expression of both of these genes. Starvation of cucumber cell cultures resulted in the coordinate induction of the expression of MS and ICL genes, and this effect was reversed when sucrose was returned to the culture media. The induction of gene expression was closely correlated with a drop in intracellular sucrose, glucose, and fructose below threshold concentrations, but it was not correlated with a decrease in respiration rate. Glucose, fructose, or raffinose in the culture media also resulted in repression of MS and ICL. Both 2-deoxyglucose and mannose, which are phosphorylated by hexokinase but not further metabolized, specifically repressed MS and ICL gene expression relative to a third glyoxylate cycle gene, malate dehydrogenase. However, the addition of 3-methylglucose, an analog of glucose that is not phosphorylated, did not result in repression of either MS or ICL. It is proposed that the signal giving rise to a change in gene expression originates from the intracellular concentration of hexose sugars or the flux of hexose sugars into glycolysis. PMID:12244257

  1. Proposed Regulation of Gene Expression by Glucose in Rodent Heart

    Directory of Open Access Journals (Sweden)

    Martin E. Young

    2007-01-01

    Full Text Available Background: During pressure overload-induced hypertrophy, unloading-induced atrophy, and diabetes mellitus, the heart induces ‘fetal’ genes (e.g. myosin heavy chain β; mhcβ.Hypothesis: We propose that altered glucose homeostasis within the cardiomyocyte acts as a central mechanism for the regulation of gene expression in response to environmental stresses. The evidence is as follows. Methods and Results: Forced glucose uptake both ex vivo and in vivo results in mhc isoform switching. Restricting dietary glucose prevents mhc isoform switching in hearts of both GLUT1-Tg mice and rats subjected to pressure overload-induced hypertrophy. Thus, glucose availability correlates with mhc isoform switching under all conditions investigated. A potential mechanism by which glucose affects gene expression is through O-linked glycosylation of specific transcription factors. Glutamine:fructose-6-phosphate amidotransferase (GFAT catalyzes the flux generating step in UDP-N-acetylglucosamine biosynthesis, the rate determining metabolite in protein glycosylation. Ascending aortic constriction increased intracellular levels of UDP-N-acetylglucosamine, and the expression of gfat2, but not gfat1, in the rat heart.Conclusions: Collectively, the results strongly suggest glucose-regulated gene expression in the heart, and the involvement of glucose metabolites in isoform switching of sarcomeric proteins characteristic for the fetal gene program.

  2. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  3. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  4. Differential regulation of NAB corepressor genes in Schwann cells

    Directory of Open Access Journals (Sweden)

    Sachdev Shrikesh

    2007-12-01

    Full Text Available Abstract Background Myelination of peripheral nerves by Schwann cells requires not only the Egr2/Krox-20 transactivator, but also the NGFI-A/Egr-binding (NAB corepressors, which modulate activity of Egr2. Previous work has shown that axon-dependent expression of Egr2 is mediated by neuregulin stimulation, and NAB corepressors are co-regulated with Egr2 expression in peripheral nerve development. NAB corepressors have also been implicated in macrophage development, cardiac hypertrophy, prostate carcinogenesis, and feedback regulation involved in hindbrain development. Results To test the mechanism of NAB regulation in Schwann cells, transfection assays revealed that both Nab1 and Nab2 promoters are activated by Egr2 expression. Furthermore, direct binding of Egr2 at these promoters was demonstrated in vivo by chromatin immunoprecipitation analysis of myelinating sciatic nerve, and binding of Egr2 to the Nab2 promoter was stimulated by neuregulin in primary Schwann cells. Although Egr2 expression activates the Nab2 promoter more highly than Nab1, we surprisingly found that only Nab1 – but not Nab2 – expression levels were reduced in sciatic nerve from Egr2 null mice. Analysis of the Nab2 promoter showed that it is also activated by ETS proteins (Ets2 and Etv1/ER81 and is bound by Ets2 in vivo. Conclusion Overall, these results indicate that induction of Nab2 expression in Schwann cells involves not only Egr2, but also ETS proteins that are activated by neuregulin stimulation. Although Nab1 and Nab2 play partially redundant roles, regulation of Nab2 expression by ETS factors explains several observations regarding regulation of NAB genes. Finally, these data suggest that NAB proteins are not only feedback inhibitors of Egr2, but rather that co-induction of Egr2 and NAB genes is involved in forming an Egr2/NAB complex that is crucial for regulation of gene expression.

  5. Mechanisms of biotin-regulated gene expression in microbes

    Directory of Open Access Journals (Sweden)

    J. Satiaputra

    2016-03-01

    Full Text Available Biotin is an essential micronutrient that acts as a co-factor for biotin-dependent metabolic enzymes. In bacteria, the supply of biotin can be achieved by de novo synthesis or import from exogenous sources. Certain bacteria are able to obtain biotin through both mechanisms while others can only fulfill their biotin requirement through de novo synthesis. Inability to fulfill their cellular demand for biotin can have detrimental consequences on cell viability and virulence. Therefore understanding the transcriptional mechanisms that regulate biotin biosynthesis and transport will extend our knowledge about bacterial survival and metabolic adaptation during pathogenesis when the supply of biotin is limited. The most extensively characterized protein that regulates biotin synthesis and uptake is BirA. In certain bacteria, such as Escherichia coli and Staphylococcus aureus, BirA is a bi-functional protein that serves as a transcriptional repressor to regulate biotin biosynthesis genes, as well as acting as a ligase to catalyze the biotinylation of biotin-dependent enzymes. Recent studies have identified two other proteins that also regulate biotin synthesis and transport, namely BioQ and BioR. This review summarizes the different transcriptional repressors and their mechanism of action. Moreover, the ability to regulate the expression of target genes through the activity of a vitamin, such as biotin, may have biotechnological applications in synthetic biology.

  6. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  7. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  8. Gene regulation in the immune system by long noncoding RNAs.

    Science.gov (United States)

    Chen, Y Grace; Satpathy, Ansuman T; Chang, Howard Y

    2017-08-22

    Long noncoding RNAs (lncRNAs) are emerging as critical regulators of gene expression in the immune system. Studies have shown that lncRNAs are expressed in a highly lineage-specific manner and control the differentiation and function of innate and adaptive cell types. In this Review, we focus on mechanisms used by lncRNAs to regulate genes encoding products involved in the immune response, including direct interactions with chromatin, RNA and proteins. In addition, we address new areas of lncRNA biology, such as the functions of enhancer RNAs, circular RNAs and chemical modifications to RNA in cellular processes. We emphasize critical gaps in knowledge and future prospects for the roles of lncRNAs in the immune system and autoimmune disease.

  9. TRAINABILITY OF BODY COMPOSITION, AEROBIC POWER AND MUSCULAR ENDURANCE OF CADET WRESTLERS

    Directory of Open Access Journals (Sweden)

    Mirzaei Bahman

    2016-10-01

    Full Text Available Purpose: The purpose of the present study was to investigate the trainability of body composition, aerobic power and muscular endurance of cadet wrestlers. Material: Fifteen cadet wrestlers (age: 15.20±0.94 years participated in this study. Methods: The testing was conducted twice, before and after four-week training period. The physiological parameters included aerobic power, muscular endurance and body composition. Results: A significant decrease in the body fat was observed following the training (p0.05. In general, although a lot of factors including skill, mental, genetic and other fitness factors render some influences on a wrestler's success, improvement of physical fitness plays an important role in championship. Based on results of the present study more time is needed to improve muscular and cardiovascular endurance, therefore wrestling coaches and trainers are recommended to pay special attention to these factors. Conclusion: Our results indicated that wrestlers experienced significant changes in their body fat percentage during four-week training period. Cadet wrestlers’ aerobic power, muscular endurance and body composition are trainable, although these improvements may be less than what has been observed in junior and senior wrestlers.

  10. Regulation of clock-controlled genes in mammals.

    Directory of Open Access Journals (Sweden)

    Katarzyna Bozek

    Full Text Available The complexity of tissue- and day time-specific regulation of thousands of clock-controlled genes (CCGs suggests that many regulatory mechanisms contribute to the transcriptional output of the circadian clock. We aim to predict these mechanisms using a large scale promoter analysis of CCGs.Our study is based on a meta-analysis of DNA-array data from rodent tissues. We searched in the promoter regions of 2065 CCGs for highly overrepresented transcription factor binding sites. In order to compensate the relatively high GC-content of CCG promoters, a novel background model to avoid a bias towards GC-rich motifs was employed. We found that many of the transcription factors with overrepresented binding sites in CCG promoters exhibit themselves circadian rhythms. Among the predicted factors are known regulators such as CLOCKratioBMAL1, DBP, HLF, E4BP4, CREB, RORalpha and the recently described regulators HSF1, STAT3, SP1 and HNF-4alpha. As additional promising candidates of circadian transcriptional regulators PAX-4, C/EBP, EVI-1, IRF, E2F, AP-1, HIF-1 and NF-Y were identified. Moreover, GC-rich motifs (SP1, EGR, ZF5, AP-2, WT1, NRF-1 and AT-rich motifs (MEF-2, HMGIY, HNF-1, OCT-1 are significantly overrepresented in promoter regions of CCGs. Putative tissue-specific binding sites such as HNF-3 for liver, NKX2.5 for heart or Myogenin for skeletal muscle were found. The regulation of the erythropoietin (Epo gene was analysed, which exhibits many binding sites for circadian regulators. We provide experimental evidence for its circadian regulated expression in the adult murine kidney. Basing on a comprehensive literature search we integrate our predictions into a regulatory network of core clock and clock-controlled genes. Our large scale analysis of the CCG promoters reveals the complexity and extensiveness of the circadian regulation in mammals. Results of this study point to connections of the circadian clock to other functional systems including

  11. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  12. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  13. Alternative RNA Structure-Coupled Gene Regulations in Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Feng-Chi Chen

    2014-12-01

    Full Text Available Alternative RNA structures (ARSs, or alternative transcript isoforms, are critical for regulating cellular phenotypes in humans. In addition to generating functionally diverse protein isoforms from a single gene, ARS can alter the sequence contents of 5'/3' untranslated regions (UTRs and intronic regions, thus also affecting the regulatory effects of these regions. ARS may introduce premature stop codon(s into a transcript, and render the transcript susceptible to nonsense-mediated decay, which in turn can influence the overall gene expression level. Meanwhile, ARS can regulate the presence/absence of upstream open reading frames and microRNA targeting sites in 5'UTRs and 3'UTRs, respectively, thus affecting translational efficiencies and protein expression levels. Furthermore, since ARS may alter exon-intron structures, it can influence the biogenesis of intronic microRNAs and indirectly affect the expression of the target genes of these microRNAs. The connections between ARS and multiple regulatory mechanisms underline the importance of ARS in determining cell fate. Accumulating evidence indicates that ARS-coupled regulations play important roles in tumorigenesis. Here I will review our current knowledge in this field, and discuss potential future directions.

  14. Globalisation reaches gene regulation: the case for vertebrate limb development.

    Science.gov (United States)

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  15. Regulation of vesicular trafficking by Parkinson's disease-associated genes

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Inoshita

    2015-10-01

    Full Text Available The regulatory mechanisms that control intracellular vesicular trafficking play important roles in cellular function and viability. Neurons have specific vesicular trafficking systems for synaptic vesicle formation, release and recycling. Synaptic vesicular trafficking impairments induce neuronal dysfunction and physiological and behavioral disorders. Parkinson's disease (PD is an age-dependent neurodegenerative disorder characterized by dopamine depletion and loss of dopamine neurons in the midbrain. The molecular mechanism responsible for the neurodegeneration that occurs during PD is still not understood; however, recent functional analyses of familial PD causative genes suggest that a number of PD causative genes regulate intracellular vesicular trafficking, including synaptic vesicular dynamics. This review focuses on recent insights regarding the functions of PD causative genes, their relationship with vesicular trafficking and how mutations associated with PD affect vesicular dynamics and neuronal survival.

  16. Methods and compositions for regulating gene expression in plant cells

    Science.gov (United States)

    Beachy, Roger N. (Inventor); Luis, Maria Isabel Ordiz (Inventor); Dai, Shunhong (Inventor)

    2010-01-01

    Novel chimeric plant promoter sequences are provided, together with plant gene expression cassettes comprising such sequences. In certain preferred embodiments, the chimeric plant promoters comprise the BoxII cis element and/or derivatives thereof. In addition, novel transcription factors are provided, together with nucleic acid sequences encoding such transcription factors and plant gene expression cassettes comprising such nucleic acid sequences. In certain preferred embodiments, the novel transcription factors comprise the acidic domain, or fragments thereof, of the RF2a transcription factor. Methods for using the chimeric plant promoter sequences and novel transcription factors in regulating the expression of at least one gene of interest are provided, together with transgenic plants comprising such chimeric plant promoter sequences and novel transcription factors.

  17. LEF-1 Regulates Tyrosinase Gene Transcription In Vitro.

    Directory of Open Access Journals (Sweden)

    Xueping Wang

    Full Text Available TYR, DCT and MITF are three important genes involved in maintaining the mature phenotype and producing melanin; they therefore participate in neural crest cell development into melanocytes. Previous studies have revealed that the Wnt signaling factor lymphoid enhancer-binding factor (LEF-1 can enhance DCT and MITF gene expression. However, whether LEF-1 also affects TYR gene expression remains unclear. In the present study, we found that LEF-1 regulated TYR transcription in vitro. LEF-1 overexpression increased TYR gene promoter activity, whereas LEF-1 knockdown by RNA interference significantly decreased TYR expression. Moreover, the core GTTTGAT sequence (-56 to -50 within the TYR promoter is essential for the effect of LEF-1 on TYR expression, and chromatin immunoprecipitation (ChIP assay indicated that endogenous LEF-1 interacts with the TYR promoter. In addition, we observed a synergistic transactivation of the TYR promoter by LEF-1 and MITF. These data suggest that Wnt signaling plays an important role in regulating melanocyte development and differentiation.

  18. Gene regulation networks generate diverse pigmentation patterns in plants.

    Science.gov (United States)

    Albert, Nick W; Davies, Kevin M; Schwinn, Kathy E

    2014-01-01

    The diversity of pigmentation patterns observed in plants occurs due to the spatial distribution and accumulation of colored compounds, which may also be associated with structural changes to the tissue. Anthocyanins are flavonoids that provide red/purple/blue coloration to plants, often forming complex patterns such as spots, stripes, and vein-associated pigmentation, particularly in flowers. These patterns are determined by the activity of MYB-bHLH-WDR (MBW) transcription factor complexes, which activate the anthocyanin biosynthesis genes, resulting in anthocyanin pigment accumulation. Recently, we established that the MBW complex controlling anthocyanin synthesis acts within a gene regulation network that is conserved within at least the Eudicots. This network involves hierarchy, reinforcement, and feedback mechanisms that allow for stringent and responsive regulation of the anthocyanin biosynthesis genes. The gene network and mobile nature of the WDR and R3-MYB proteins provide exciting new opportunities to explore the basis of pigmentation patterning, and to investigate the evolutionary history of the MBW components in land plants.

  19. Trainable Mentally Impaired/Severely Multiply Impaired/Autistic Impaired/Severely Mentally Impaired. Product Evaluation Report 1989-1990.

    Science.gov (United States)

    Claus, Richard N.; And Others

    The evaluation report describes special education services provided to trainable mentally impaired (TMI), autistic impaired (AI), severely multiply impaired (SXI), and severely mentally impaired (SMI) students at and through the Melvin G. Millet Learning Center (Bridgeport, Michigan). The eight program components are described individually and…

  20. MTA3 regulates CGB5 and Snail genes in trophoblast

    International Nuclear Information System (INIS)

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-01-01

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  1. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  2. Decorin gene expression and its regulation in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: → We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. → Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. → Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. → Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  3. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  4. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  5. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  6. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  7. The Prolactin Gene: A Paradigm of Tissue-Specific Gene Regulation with Complex Temporal Transcription Dynamics

    Science.gov (United States)

    Featherstone, K; White, M R H; Davis, J R E

    2012-01-01

    Transcription of numerous mammalian genes is highly pulsatile, with bursts of expression occurring with variable duration and frequency. The presence of this stochastic or ‘noisy’ expression pattern has been relatively unexplored in tissue systems. The prolactin gene provides a model of tissue-specific gene regulation resulting in pulsatile transcription dynamics in both cell lines and endocrine tissues. In most cell culture models, prolactin transcription appears to be highly variable between cells, with differences in transcription pulse duration and frequency. This apparently stochastic transcription is constrained by a transcriptional refractory period, which may be related to cycles of chromatin remodelling. We propose that prolactin transcription dynamics result from the summation of oscillatory cellular inputs and by regulation through chromatin remodelling cycles. Observations of transcription dynamics in cells within pituitary tissue show reduced transcriptional heterogeneity and can be grouped into a small number of distinct patterns. Thus, it appears that the tissue environment is able to reduce transcriptional noise to enable coordinated tissue responses to environmental change. We review the current knowledge on the complex tissue-specific regulation of the prolactin gene in pituitary and extra-pituitary sites, highlighting differences between humans and rodent experimental animal models. Within this context, we describe the transcription dynamics of prolactin gene expression and how this may relate to specific processes occurring within the cell. PMID:22420298

  8. DMPD: Interferon gene regulation: not all roads lead to Tolls. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16095970 Interferon gene regulation: not all roads lead to Tolls. Jefferies CA, Fit...zgerald KA. Trends Mol Med. 2005 Sep;11(9):403-11. (.png) (.svg) (.html) (.csml) Show Interferon gene regulation: not all roads lead... to Tolls. PubmedID 16095970 Title Interferon gene regulation: not all roads lead to

  9. Strategies to identify long noncoding RNAs involved in gene regulation

    Directory of Open Access Journals (Sweden)

    Lee Catherine

    2012-11-01

    Full Text Available Abstract Long noncoding RNAs (lncRNAs have been detected in nearly every cell type and found to be fundamentally involved in many biological processes. The characterization of lncRNAs has immense potential to advance our comprehensive understanding of cellular processes and gene regulation, along with implications for the treatment of human disease. The recent ENCODE (Encyclopedia of DNA Elements study reported 9,640 lncRNA loci in the human genome, which corresponds to around half the number of protein-coding genes. Because of this sheer number and their functional diversity, it is crucial to identify a pool of potentially relevant lncRNAs early on in a given study. In this review, we evaluate the methods for isolating lncRNAs by immunoprecipitation and review the advantages, disadvantages, and applications of three widely used approaches – microarray, tiling array, and RNA-seq – for identifying lncRNAs involved in gene regulation. We also look at ways in which data from publicly available databases such as ENCODE can support the study of lncRNAs.

  10. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  11. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    International Nuclear Information System (INIS)

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  12. Intron retention as a component of regulated gene expression programs.

    Science.gov (United States)

    Jacob, Aishwarya G; Smith, Christopher W J

    2017-09-01

    Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

  13. Feedback regulation of DNA methyltransferase gene expression by methylation.

    Science.gov (United States)

    Slack, A; Cervoni, N; Pinard, M; Szyf, M

    1999-08-01

    This paper tests the hypothesis that expression of the DNA methyltransferase, dnmt1, gene is regulated by a methylation-sensitive DNA element. Methylation of DNA is an attractive system for feedback regulation of DNA methyltransferase as the final product of the reaction, methylated DNA, can regulate gene expression in cis. We show that an AP-1-dependent regulatory element of dnmt1 is heavily methylated in most somatic tissues and in the mouse embryonal cell line, P19, and completely unmethylated in a mouse adrenal carcinoma cell line, Y1. dnmt1 is highly over expressed in Y1 relative to P19 cell lines. Global inhibition of DNA methylation in P19 cells by 5-azadeoxycytidine results in demethylation of the AP-1 regulatory region and induction of dnmt1 expression in P19cells, but not Y1 cells. We propose that this regulatory region of dnmt1 acts as a sensor of the DNA methylation capacity of the cell. These results provide an explanation for the documented coexistence of global hypomethylation and high levels of DNA methyltransferase activity in many cancer cells and for the carcinogenic effect of hypomethylating diets.

  14. Hedgehog signaling regulates gene expression in planarian glia.

    Science.gov (United States)

    Wang, Irving E; Lapan, Sylvain W; Scimone, M Lucila; Clandinin, Thomas R; Reddien, Peter W

    2016-09-09

    Hedgehog signaling is critical for vertebrate central nervous system (CNS) development, but its role in CNS biology in other organisms is poorly characterized. In the planarian Schmidtea mediterranea, hedgehog (hh ) is expressed in medial cephalic ganglia neurons, suggesting a possible role in CNS maintenance or regeneration. We performed RNA sequencing of planarian brain tissue following RNAi of hh and patched (ptc) , which encodes the Hh receptor. Two misregulated genes, intermediate filament-1 (if-1 ) and calamari (cali ), were expressed in a previously unidentified non-neural CNS cell type. These cells expressed orthologs of astrocyte-associated genes involved in neurotransmitter uptake and metabolism, and extended processes enveloping regions of high synapse concentration. We propose that these cells are planarian glia. Planarian glia were distributed broadly, but only expressed if-1 and cali in the neuropil near hh + neurons. Planarian glia and their regulation by Hedgehog signaling present a novel tractable system for dissection of glia biology.

  15. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  16. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    for maintaining genomic integrity. The aim of the present study was to characterize the pattern of cerebral DNA repair enzyme regulation after stress through the quantification of a targeted range of gene products involved in different types of DNA repair. 72 male Sprague-Dawley rats were subjected to either......Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  17. Gene regulation and noise reduction by coupling of stochastic processes.

    Science.gov (United States)

    Ramos, Alexandre F; Hornos, José Eduardo M; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  18. Gene networks and the neuroendocrine regulation of puberty.

    Science.gov (United States)

    Ojeda, Sergio R; Dubay, Christopher; Lomniczi, Alejandro; Kaidar, Gabi; Matagne, Valerie; Sandau, Ursula S; Dissen, Gregory A

    2010-08-05

    A sustained increase in pulsatile release of gonadotrophin releasing hormone (GnRH) from the hypothalamus is an essential, final event that defines the initiation of mammalian puberty. This increase depends on coordinated changes in transsynaptic and glial-neuronal communication, consisting of activating neuronal and glial excitatory inputs to the GnRH neuronal network and the loss of transsynaptic inhibitory tone. It is now clear that the prevalent excitatory systems stimulating GnRH secretion involve a neuronal component consisting of excitatory amino acids (glutamate) and at least one peptide (kisspeptin), and a glial component that uses growth factors and small molecules for cell-cell signaling. GABAergic and opiatergic neurons provide transsynaptic inhibitory control to the system, but GABA neurons also exert direct excitatory effects on GnRH neurons. The molecular mechanisms that provide encompassing coordination to this cellular network are not known, but they appear to involve a host of functionally related genes hierarchically arranged. We envision that, as observed in other gene networks, the highest level of control in this network is provided by transcriptional regulators that, by directing expression of key subordinate genes, impose an integrative level of coordination to the neuronal and glial subsets involved in initiating the pubertal process. The use of high-throughput and gene manipulation approaches coupled to systems biology strategies should provide not only the experimental bases supporting this concept, but also unveil the existence of crucial components of network control not yet identified. Copyright (c) 2009 Elsevier Ireland Ltd. All rights reserved.

  19. SUPERMAN, a regulator of floral homeotic genes in Arabidopsis.

    Science.gov (United States)

    Bowman, J L; Sakai, H; Jack, T; Weigel, D; Mayer, U; Meyerowitz, E M

    1992-03-01

    We describe a locus, SUPERMAN, mutations in which result in extra stamens developing at the expense of the central carpels in the Arabidopsis thaliana flower. The development of superman flowers, from initial primordium to mature flower, is described by scanning electron microscopy. The development of doubly and triply mutant strains, constructed with superman alleles and previously identified homeotic mutations that cause alterations in floral organ identity, is also described. Essentially additive phenotypes are observed in superman agamous and superman apetala2 double mutants. The epistatic relationships observed between either apetala3 or pistillata and superman alleles suggest that the SUPERMAN gene product could be a regulator of these floral homeotic genes. To test this, the expression patterns of AGAMOUS and APETALA3 were examined in superman flowers. In wild-type flowers, APETALA3 expression is restricted to the second and third whorls where it is required for the specification of petals and stamens. In contrast, in superman flowers, APETALA3 expression expands to include most of the cells that would normally constitute the fourth whorl. This ectopic APETALA3 expression is proposed to be one of the causes of the development of the extra stamens in superman flowers. The spatial pattern of AGAMOUS expression remains unaltered in superman flowers as compared to wild-type flowers. Taken together these data indicate that one of the functions of the wild-type SUPERMAN gene product is to negatively regulate APETALA3 in the fourth whorl of the flower. In addition, superman mutants exhibit a loss of determinacy of the floral meristem, an effect that appears to be mediated by the APETALA3 and PISTILLATA gene products.

  20. Up-regulation of SNCA gene expression: implications to synucleinopathies.

    Science.gov (United States)

    Tagliafierro, L; Chiba-Falek, O

    2016-07-01

    Synucleinopathies are a group of neurodegenerative diseases that share a common pathological lesion of intracellular protein inclusions largely composed by aggregates of alpha-synuclein protein. Accumulating evidence, including genome wide association studies, has implicated alpha-synuclein (SNCA) gene in the etiology of synucleinopathies. However, the precise variants within SNCA gene that contribute to the sporadic forms of Parkinson's disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA), and other synucleinopathies and their molecular mechanisms of action remain elusive. It has been suggested that SNCA expression levels are critical for the development of these diseases. Here, we review several model systems that have been developed to advance the understanding of the role of SNCA expression levels in the etiology of synucleinopathies. We also describe different molecular mechanisms that regulate SNCA gene expression and discuss possible strategies for SNCA down-regulation as means for therapeutic approaches. Finally, we highlight some examples that underscore the relationships between the genetic association findings and the regulatory mechanisms of SNCA expression, which suggest that genetic variability in SNCA locus is directly responsible, at least in part, to the changes in gene expression and explain the reported associations of SNCA with synucleinopathies. Future studies utilizing induced pluripotent stem cells (iPSCs)-derived neuronal lines and genome editing by CRISPR/Cas9, will allow us to validate, characterize, and manipulate the effects of particular cis-genetic variants on SNCA expression. Moreover, this model system will enable us to compare different neuronal and glial lineages involved in synucleinopathies representing an attractive strategy to elucidate-common and specific-SNCA-genetic variants, regulatory mechanisms, and vulnerable expression levels underlying synucleinopathy spectrum disorders. This forthcoming

  1. Dynamic model of gene regulation for the lac operon

    Science.gov (United States)

    Angelova, Maia; Ben-Halim, Asma

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  2. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  3. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...... is that unstable activation and stable repression is a requirement for the motif to produce oscillations. The last part of this thesis studies the emergence of communication networks. In this study we constructed a simple e-mail game. E-mails from two session with 16 players, who had never met before, showed how...

  4. Gene Regulation and Quality Control in Murine Polyomavirus Infection

    Directory of Open Access Journals (Sweden)

    Gordon G. Carmichael

    2016-10-01

    Full Text Available Murine polyomavirus (MPyV infects mouse cells and is highly oncogenic in immunocompromised hosts and in other rodents. Its genome is a small, circular DNA molecule of just over 5000 base pairs and it encodes only seven polypeptides. While seemingly simply organized, this virus has adopted an unusual genome structure and some unusual uses of cellular quality control pathways that, together, allow an amazingly complex and varied pattern of gene regulation. In this review we discuss how MPyV leverages these various pathways to control its life cycle.

  5. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    My thesis consists of three parts. The first part covers ageing phenomena. In the first project I measured the mobility of two DNA repair proteins. Contrasting diffusion coefficients from literature I was able to classify DNA repair protein into either "scanners" or "responders". In a second...... project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...

  6. Shh regulates chick Ebf1 gene expression in somite development.

    Science.gov (United States)

    El-Magd, Mohammed Abu; Allen, Steve; McGonnell, Imelda; Mansour, Ali A; Otto, Anthony; Patel, Ketan

    2015-01-01

    The chick early B-cell factor 1 (cEbf1) is a member of EBF family of helix loop helix transcription factors. Recently, we have proved that cEbf1 expression in feather is regulated by Shh. It is therefore possible that the somitic expression of cEbf1 is controlled by Shh signals from the notochord. To assess this hypothesis, the expression profile of cEbf1 was first detailed in somites of chick embryos (from HH8 to HH28). cEbf1 expression was mainly localised in the medial sclerotome and later around the vertebral cartilage anlagen of body and pedicles. Tissue manipulations (notochord ablation) and Shh gain and loss of function experiments were then performed to analyse whether the notochord and/or Shh regulate cEbf1 expression. Results from these experiments confirmed our hypothesis that the medial somitic expression of cEbf1 is regulated by Shh from the notochord. In conclusion, cEbf1 gene is considered as a medial sclerotome marker, downstream to and regulated by the notochord derived Shh, which may be functionally involved in somitogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Gene expression in human hippocampus from cocaine abusers identifies genes which regulate extracellular matrix remodeling.

    Directory of Open Access Journals (Sweden)

    Deborah C Mash

    2007-11-01

    Full Text Available The chronic effects of cocaine abuse on brain structure and function are blamed for the inability of most addicts to remain abstinent. Part of the difficulty in preventing relapse is the persisting memory of the intense euphoria or cocaine "rush". Most abused drugs and alcohol induce neuroplastic changes in brain pathways subserving emotion and cognition. Such changes may account for the consolidation and structural reconfiguration of synaptic connections with exposure to cocaine. Adaptive hippocampal plasticity could be related to specific patterns of gene expression with chronic cocaine abuse. Here, we compare gene expression profiles in the human hippocampus from cocaine addicts and age-matched drug-free control subjects. Cocaine abusers had 151 gene transcripts upregulated, while 91 gene transcripts were downregulated. Topping the list of cocaine-regulated transcripts was RECK in the human hippocampus (FC = 2.0; p<0.05. RECK is a membrane-anchored MMP inhibitor that is implicated in the coordinated regulation of extracellular matrix integrity and angiogenesis. In keeping with elevated RECK expression, active MMP9 protein levels were decreased in the hippocampus from cocaine abusers. Pathway analysis identified other genes regulated by cocaine that code for proteins involved in the remodeling of the cytomatrix and synaptic connections and the inhibition of blood vessel proliferation (PCDH8, LAMB1, ITGB6, CTGF and EphB4. The observed microarray phenotype in the human hippocampus identified RECK and other region-specific genes that may promote long-lasting structural changes with repeated cocaine abuse. Extracellular matrix remodeling in the hippocampus may be a persisting effect of chronic abuse that contributes to the compulsive and relapsing nature of cocaine addiction.

  8. VO2max trainability and high intensity interval training in humans: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Andrew P Bacon

    Full Text Available Endurance exercise training studies frequently show modest changes in VO2max with training and very limited responses in some subjects. By contrast, studies using interval training (IT or combined IT and continuous training (CT have reported mean increases in VO2max of up to ~1.0 L · min(-1. This raises questions about the role of exercise intensity and the trainability of VO2max. To address this topic we analyzed IT and IT/CT studies published in English from 1965-2012. Inclusion criteria were: 1≥ 3 healthy sedentary/recreationally active humans <45 yrs old, 2 training duration 6-13 weeks, 3 ≥ 3 days/week, 4 ≥ 10 minutes of high intensity work, 5 ≥ 1:1 work/rest ratio, and 6 results reported as mean ± SD or SE, ranges of change, or individual data. Due to heterogeneity (I(2 value of 70, statistical synthesis of the data used a random effects model. The summary statistic of interest was the change in VO2max. A total of 334 subjects (120 women from 37 studies were identified. Participants were grouped into 40 distinct training groups, so the unit of analysis was 40 rather than 37. An increase in VO2max of 0.51 L · min(-1 (95% CI: 0.43 to 0.60 L · min(-1 was observed. A subset of 9 studies, with 72 subjects, that featured longer intervals showed even larger (~0.8-0.9 L · min(-1 changes in VO2max with evidence of a marked response in all subjects. These results suggest that ideas about trainability and VO2max should be further evaluated with standardized IT or IT/CT training programs.

  9. Quorum Sensing Gene Regulation by LuxR/HapR Master Regulators in Vibrios.

    Science.gov (United States)

    Ball, Alyssa S; Chaparian, Ryan R; van Kessel, Julia C

    2017-10-01

    The coordination of group behaviors in bacteria is accomplished via the cell-cell signaling process called quorum sensing. Vibrios have historically been models for studying bacterial communication due to the diverse and remarkable behaviors controlled by quorum sensing in these bacteria, including bioluminescence, type III and type VI secretion, biofilm formation, and motility. Here, we discuss the Vibrio LuxR/HapR family of proteins, the master global transcription factors that direct downstream gene expression in response to changes in cell density. These proteins are structurally similar to TetR transcription factors but exhibit distinct biochemical and genetic features from TetR that determine their regulatory influence on the quorum sensing gene network. We review here the gene groups regulated by LuxR/HapR and quorum sensing and explore the targets that are common and unique among Vibrio species. Copyright © 2017 American Society for Microbiology.

  10. Neuronal identity genes regulated by super-enhancers are preferentially down-regulated in the striatum of Huntington's disease mice.

    Science.gov (United States)

    Achour, Mayada; Le Gras, Stéphanie; Keime, Céline; Parmentier, Frédéric; Lejeune, François-Xavier; Boutillier, Anne-Laurence; Néri, Christian; Davidson, Irwin; Merienne, Karine

    2015-06-15

    Huntington's disease (HD) is a neurodegenerative disease associated with extensive down-regulation of genes controlling neuronal function, particularly in the striatum. Whether altered epigenetic regulation underlies transcriptional defects in HD is unclear. Integrating RNA-sequencing (RNA-seq) and chromatin-immunoprecipitation followed by massively parallel sequencing (ChIP-seq), we show that down-regulated genes in HD mouse striatum associate with selective decrease in H3K27ac, a mark of active enhancers, and RNA Polymerase II (RNAPII). In addition, we reveal that decreased genes in HD mouse striatum display a specific epigenetic signature, characterized by high levels and broad patterns of H3K27ac and RNAPII. Our results indicate that this signature is that of super-enhancers, a category of broad enhancers regulating genes defining tissue identity and function. Specifically, we reveal that striatal super-enhancers display extensive H3K27 acetylation within gene bodies, drive transcription characterized by low levels of paused RNAPII, regulate neuronal function genes and are enriched in binding motifs for Gata transcription factors, such as Gata2 regulating striatal identity genes. Together, our results provide evidence for preferential down-regulation of genes controlled by super-enhancers in HD striatum and indicate that enhancer topography is a major parameter determining the propensity of a gene to be deregulated in a neurodegenerative disease. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes.

    Directory of Open Access Journals (Sweden)

    Tulika Prakash

    Full Text Available From the ENCODE project, it is realized that almost every base of the entire human genome is transcribed. One class of transcripts resulting from this arises from the conjoined gene, which is formed by combining the exons of two or more distinct (parent genes lying on the same strand of a chromosome. Only a very limited number of such genes are known, and the definition and terminologies used for them are highly variable in the public databases. In this work, we have computationally identified and manually curated 751 conjoined genes (CGs in the human genome that are supported by at least one mRNA or EST sequence available in the NCBI database. 353 representative CGs, of which 291 (82% could be confirmed, were subjected to experimental validation using RT-PCR and sequencing methods. We speculate that these genes are arising out of novel functional requirements and are not merely artifacts of transcription, since more than 70% of them are conserved in other vertebrate genomes. The unique splicing patterns exhibited by CGs reveal their possible roles in protein evolution or gene regulation. Novel CGs, for which no transcript is available, could be identified in 80% of randomly selected potential CG forming regions, indicating that their formation is a routine process. Formation of CGs is not only limited to human, as we have also identified 270 CGs in mouse and 227 in drosophila using our approach. Additionally, we propose a novel mechanism for the formation of CGs. Finally, we developed a database, ConjoinG, which contains detailed information about all the CGs (800 in total identified in the human genome. In summary, our findings reveal new insights about the functionality of CGs in terms of another possible mechanism for gene regulation and genomic evolution and the mechanism leading to their formation.

  12. Myeloid translocation genes differentially regulate colorectal cancer programs

    Science.gov (United States)

    Parang, Bobak; Bradley, Amber M.; Mittal, Mukul K.; Short, Sarah P.; Thompson, Joshua J.; Barrett, Caitlyn W.; Naik, Rishi D.; Bilotta, Anthony J.; Washington, Mary K.; Revetta, Frank L.; Smith, Jesse J.; Chen, Xi; Wilson, Keith T.; Hiebert, Scott W.; Williams, Christopher S.

    2016-01-01

    Myeloid translocation genes (MTGs), originally identified as chromosomal translocations in acute myelogenous leukemia, are transcriptional corepressors that regulate hematopoietic stem cell programs. Analysis of The Cancer Genome Atlas (TCGA) database revealed that MTGs were mutated in epithelial malignancy and suggested that loss of function might promote tumorigenesis. Genetic deletion of MTGR1 and MTG16 in the mouse has revealed unexpected and unique roles within the intestinal epithelium. Mtgr1−/− mice have progressive depletion of all intestinal secretory cells, and Mtg16−/− mice have a decrease in goblet cells. Furthermore, both Mtgr1−/− and Mtg16−/− mice have increased intestinal epithelial cell proliferation. We thus hypothesized that loss of MTGR1 or MTG16 would modify Apc1638/+-dependent intestinal tumorigenesis. Mtgr1−/− mice, but not Mtg16−/− mice, had a 10-fold increase in tumor multiplicity. This was associated with more advanced dysplasia, including progression to invasive adenocarcinoma, and augmented intratumoral proliferation. Analysis of ChIP-seq datasets for MTGR1 and MTG16 targets indicated that MTGR1 can regulate Wnt and Notch signaling. In support of this, immunohistochemistry and gene expression analysis revealed that both Wnt and Notch signaling pathways were hyperactive in Mtgr1−/− tumors. Furthermore, in human colorectal cancer (CRC) samples MTGR1 was downregulated at both the transcript and protein level. Overall our data indicates that MTGR1 has a context dependent effect on intestinal tumorigenesis. PMID:27270437

  13. Regulation of Corticosteroidogenic Genes by MicroRNAs

    Directory of Open Access Journals (Sweden)

    Stacy Robertson

    2017-01-01

    Full Text Available The loss of normal regulation of corticosteroid secretion is important in the development of cardiovascular disease. We previously showed that microRNAs regulate the terminal stages of corticosteroid biosynthesis. Here, we assess microRNA regulation across the whole corticosteroid pathway. Knockdown of microRNA using Dicer1 siRNA in H295R adrenocortical cells increased levels of CYP11A1, CYP21A1, and CYP17A1 mRNA and the secretion of cortisol, corticosterone, 11-deoxycorticosterone, 18-hydroxycorticosterone, and aldosterone. Bioinformatic analysis of genes involved in corticosteroid biosynthesis or metabolism identified many putative microRNA-binding sites, and some were selected for further study. Manipulation of individual microRNA levels demonstrated a direct effect of miR-125a-5p and miR-125b-5p on CYP11B2 and of miR-320a-3p levels on CYP11A1 and CYP17A1 mRNA. Finally, comparison of microRNA expression profiles from human aldosterone-producing adenoma and normal adrenal tissue showed levels of various microRNAs, including miR-125a-5p to be significantly different. This study demonstrates that corticosteroidogenesis is regulated at multiple points by several microRNAs and that certain of these microRNAs are differentially expressed in tumorous adrenal tissue, which may contribute to dysregulation of corticosteroid secretion. These findings provide new insights into the regulation of corticosteroid production and have implications for understanding the pathology of disease states where abnormal hormone secretion is a feature.

  14. Feeding Regulates the Expression of Pancreatic Genes in Gastric Mucosa

    Directory of Open Access Journals (Sweden)

    Maria Rita De Giorgio

    2010-01-01

    Full Text Available The ineffective short-term control of feeding behavior compromises energy homeostasis and can lead to obesity. The gastrointestinal tract secretes several regulatory peptides. However, little is known about the stomach peptide contribution to the acute regulation of intake. In an attempt to identify new gastric signals, the serial analysis of gene expression (SAGE method was used for the transcription profiling of stomach mucosa in 7 groups of mice: fasting and sacrificed 30 minutes, 1 hour, 3 hours after a low-fat (LF or high-fat (HF ad libitum meal. In total, 35 genes were differentially modulated by LF and HF meals compared to fasting, including 15 mRNAs coding for digestive enzymes/secretory proteins, and 10 novel transcripts. Although the basic expression profile did not undergo substantial variations, both LF and HF meals influenced the transcription. This study represents the first global analysis of stomach transcriptome as induced by different nutritional stimuli. Further studies including the characterization of novel genes may help to identify new targets for the therapy and prevention of obesity.

  15. The Evolution of gene regulation research in Lactococcus lactis.

    Science.gov (United States)

    Kok, Jan; van Gijtenbeek, Lieke A; de Jong, Anne; van der Meulen, Sjoerd B; Solopova, Ana; Kuipers, Oscar P

    2017-08-01

    Lactococcus lactis is a major microbe. This lactic acid bacterium (LAB) is used worldwide in the production of safe, healthy, tasteful and nutritious milk fermentation products. Its huge industrial importance has led to an explosion of research on the organism, particularly since the early 1970s. The upsurge in the research on L. lactis coincided not accidentally with the advent of recombinant DNA technology in these years. The development of methods to take out and re-introduce DNA in L. lactis, to clone genes and to mutate the chromosome in a targeted way, to control (over)expression of proteins and, ultimately, the availability of the nucleotide sequence of its genome and the use of that information in transcriptomics and proteomics research have enabled to peek deep into the functioning of the organism. Among many other things, this has provided an unprecedented view of the major gene regulatory pathways involved in nitrogen and carbon metabolism and their overlap, and has led to the blossoming of the field of L. lactis systems biology. All of these advances have made L. lactis the paradigm of the LAB. This review will deal with the exciting path along which the research on the genetics of and gene regulation in L. lactis has trodden. © FEMS 2017.

  16. Pitx2, an atrial fibrillation predisposition gene, directly regulates ion transport and intercalated disc genes.

    Science.gov (United States)

    Tao, Ye; Zhang, Min; Li, Lele; Bai, Yan; Zhou, Yuefang; Moon, Anne M; Kaminski, Henry J; Martin, James F

    2014-02-01

    Pitx2 is the homeobox gene located in proximity to the human 4q25 familial atrial fibrillation (AF) locus. When deleted in the mouse germline, Pitx2 haploinsufficiency predisposes to pacing-induced AF, indicating that reduced Pitx2 promotes an arrhythmogenic substrate. Previous work focused on Pitx2 developmental functions that predispose to AF. Although Pitx2 is expressed in postnatal left atrium, it is unknown whether Pitx2 has distinct postnatal and developmental functions. To investigate Pitx2 postnatal function, we conditionally inactivated Pitx2 in the postnatal atrium while leaving its developmental function intact. Unstressed adult Pitx2 homozygous mutant mice display variable R-R interval with diminished P-wave amplitude characteristic of sinus node dysfunction, an AF risk factor in human patients. An integrated genomics approach in the adult heart revealed Pitx2 target genes encoding cell junction proteins, ion channels, and critical transcriptional regulators. Importantly, many Pitx2 target genes have been implicated in human AF by genome-wide association studies. Immunofluorescence and transmission electron microscopy studies in adult Pitx2 mutant mice revealed structural remodeling of the intercalated disc characteristic of human patients with AF. Our findings, revealing that Pitx2 has genetically separable postnatal and developmental functions, unveil direct Pitx2 target genes that include channel and calcium handling genes, as well as genes that stabilize the intercalated disc in postnatal atrium.

  17. The Cpx System Regulates Virulence Gene Expression in Vibrio cholerae

    Science.gov (United States)

    Acosta, Nicole; Pukatzki, Stefan

    2015-01-01

    Bacteria possess signal transduction pathways capable of sensing and responding to a wide variety of signals. The Cpx envelope stress response, composed of the sensor histidine kinase CpxA and the response regulator CpxR, senses and mediates adaptation to insults to the bacterial envelope. The Cpx response has been implicated in the regulation of a number of envelope-localized virulence determinants across bacterial species. Here, we show that activation of the Cpx pathway in Vibrio cholerae El Tor strain C6706 leads to a decrease in expression of the major virulence factors in this organism, cholera toxin (CT) and the toxin-coregulated pilus (TCP). Our results indicate that this occurs through the repression of production of the ToxT regulator and an additional upstream transcription factor, TcpP. The effect of the Cpx response on CT and TCP expression is mostly abrogated in a cyclic AMP receptor protein (CRP) mutant, although expression of the crp gene is unaltered. Since TcpP production is controlled by CRP, our data suggest a model whereby the Cpx response affects CRP function, which leads to diminished TcpP, ToxT, CT, and TCP production. PMID:25824837

  18. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  19. [Prediction and bioinformatics analysis of human gene expression profiling regulated by amifostine].

    Science.gov (United States)

    Yang, Bo; Cai, Li-Li; Chi, Xiao-Hua; Lu, Xue-Chun; Zhang, Feng; Tuo, Shuai; Zhu, Hong-Li; Liu, Li-Hong; Yan, Jiang-Wei; Tuo, Chao-Wei

    2011-06-01

    Objective of this study was to perform bioinformatics analysis of the characteristics of gene expression profiling regulated by amifostine and predict its novel potential biological function to provide a direction for further exploring pharmacological actions of amifostine and study methods. Amifostine was used as a key word to search internet-based free gene expression database including GEO, affymetrix gene chip database, GenBank, SAGE, GeneCard, InterPro, ProtoNet, UniProt and BLOCKS and the sifted amifostine-regulated gene expression profiling data was subjected to validity testing, gene expression difference analysis and functional clustering and gene annotation. The results showed that only one data of gene expression profiling regulated by amifostine was sifted from GEO database (accession: GSE3212). Through validity testing and gene expression difference analysis, significant difference (p < 0.01) was only found in 2.14% of the whole genome (460/192000). Gene annotation analysis showed that 139 out of 460 genes were known genes, in which 77 genes were up-regulated and 62 genes were down-regulated. 13 out of 139 genes were newly expressed following amifostine treatment of K562 cells, however expression of 5 genes was completely inhibited. Functional clustering displayed that 139 genes were divided into 11 categories and their biological function was involved in hematopoietic and immunologic regulation, apoptosis and cell cycle. It is concluded that bioinformatics method can be applied to analysis of gene expression profiling regulated by amifostine. Amifostine has a regulatory effect on human gene expression profiling and this action is mainly presented in biological processes including hematopoiesis, immunologic regulation, apoptosis and cell cycle and so on. The effect of amifostine on human gene expression need to be further testified in experimental condition.

  20. Gene expression dosage regulation in an allopolyploid fish.

    Directory of Open Access Journals (Sweden)

    I Matos

    Full Text Available How allopolyploids are able not only to cope but profit from their condition is a question that remains elusive, but is of great importance within the context of successful allopolyploid evolution. One outstanding example of successful allopolyploidy is the endemic Iberian cyprinid Squalius alburnoides. Previously, based on the evaluation of a few genes, it was reported that the transcription levels between diploid and triploid S. alburnoides were similar. If this phenomenon occurs on a full genomic scale, a wide functional ''diploidization'' could be related to the success of these polyploids. We generated RNA-seq data from whole juvenile fish and from adult livers, to perform the first comparative quantitative transcriptomic analysis between diploid and triploid individuals of a vertebrate allopolyploid. Together with an assay to estimate relative expression per cell, it was possible to infer the relative sizes of transcriptomes. This showed that diploid and triploid S. alburnoides hybrids have similar liver transcriptome sizes. This in turn made it valid to directly compare the S. alburnoides RNA-seq transcript data sets and obtain a profile of dosage responses across the S. alburnoides transcriptome. We found that 64% of transcripts in juveniles' samples and 44% in liver samples differed less than twofold between diploid and triploid hybrids (similar expression. Yet, respectively 29% and 15% of transcripts presented accurate dosage compensation (PAA/PA expression ratio of 1 instead of 1.5. Therefore, an exact functional diploidization of the triploid genome does not occur, but a significant down regulation of gene expression in triploids was observed. However, for those genes with similar expression levels between diploids and triploids, expression is not globally strictly proportional to gene dosage nor is it set to a perfect diploid level. This quantitative expression flexibility may be a strong contributor to overcome the genomic shock

  1. Regulation of Plastid Gene Expression during Photooxidative Stress.

    Science.gov (United States)

    Tonkyn, J C; Deng, X W; Gruissem, W

    1992-08-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a "plastid factor" in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  2. Regulation of Plastid Gene Expression during Photooxidative Stress 1

    Science.gov (United States)

    Tonkyn, John C.; Deng, Xing-Wang; Gruissem, Wilhelm

    1992-01-01

    We have used the carotenoid biosynthesis inhibitor norflurazon to study the relationship between chloroplast and nuclear gene expression and the mechanisms by which plastid mRNA accumulation is regulated in response to photooxidative stress. By treating 4-week-old hydroponic spinach plants (Spinacea oleracea), we were able to determine the response at two distinct stages of chloroplast development. For all parameters studied, differences were found between the norflurazon-treated young and mature leaves. Young leaves lost essentially all pigment content in the presence of norflurazon, whereas mature leaves retained more than 60% of their chlorophyll and carotenoids. The accumulation of plastid mRNA was determined for several genes, and we found a decrease in mRNA levels for all genes except psbA in herbicide-treated young leaves. For genes such as atpB, psbB, and psaA, there was a corresponding change in the relative level of transcription, but for psbA and rbcL, transcription and mRNA accumulation were uncoupled. In norflurazon-treated mature leaves, all plastid mRNAs except psaA accumulated to normal levels, and transcription levels were either normal or higher than corresponding controls. This led to the conclusion that plastid mRNA accumulation is regulated both transcriptionally and posttranscriptionally in response to photooxidative stress. Although direct photooxidative damage is confined to the plastid and peroxisome, there is a feedback of information controlling the transcription of nuclear-encoded plastid proteins. Considerable evidence has accumulated implicating a “plastid factor” in this control. Therefore, the expression of several nuclear-encoded plastid proteins and the corresponding mRNAs were determined. Although the levels of both the small subunit of ribulose-1,5-bisphosphate carboxylase and the light harvesting chlorophyll a/b-binding protein and corresponding mRNAs were reduced, a 28-kilodalton chloroplast RNA-binding protein and

  3. Substrate availability and transcriptional regulation of metabolic genes in human skeletal muscle during recovery from exercise

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Osada, Takuya; Andersen, Lisbeth Tingsted

    2005-01-01

    In skeletal muscle of humans, transcription of several metabolic genes is transiently induced during recovery from exercise when no food is consumed. To determine the potential influence of substrate availability on the transcriptional regulation of metabolic genes during recovery from exercise, 9...... the transcriptional regulation of metabolic genes in skeletal muscle of humans during recovery from exercise....

  4. Regulation and Function of Adult Neurogenesis: From Genes to Cognition

    Science.gov (United States)

    Aimone, James B.; Li, Yan; Lee, Star W.; Clemenson, Gregory D.; Deng, Wei; Gage, Fred H.

    2014-01-01

    Adult neurogenesis in the hippocampus is a notable process due not only to its uniqueness and potential impact on cognition but also to its localized vertical integration of different scales of neuroscience, ranging from molecular and cellular biology to behavior. This review summarizes the recent research regarding the process of adult neurogenesis from these different perspectives, with particular emphasis on the differentiation and development of new neurons, the regulation of the process by extrinsic and intrinsic factors, and their ultimate function in the hippocampus circuit. Arising from a local neural stem cell population, new neurons progress through several stages of maturation, ultimately integrating into the adult dentate gyrus network. The increased appreciation of the full neurogenesis process, from genes and cells to behavior and cognition, makes neurogenesis both a unique case study for how scales in neuroscience can link together and suggests neurogenesis as a potential target for therapeutic intervention for a number of disorders. PMID:25287858

  5. ROG, repressor of GATA, regulates the expression of cytokine genes.

    Science.gov (United States)

    Miaw, S C; Choi, A; Yu, E; Kishikawa, H; Ho, I C

    2000-03-01

    GATA-3 is a T cell-specific transcription factor and is essential for the development of the T cell lineage. Recently, it was shown that the expression of GATA-3 is further induced in CD4+ helper T cells upon differentiation into type 2 but not type 1 effector cells. Here, we report the molecular cloning of a GATA-3 interacting protein, repressor of GATA (ROG). ROG is a lymphoid-specific gene and is rapidly induced in Th cells upon stimulation with anti-CD3. In in vitro assays, ROG represses the GATA-3-induced transactivation. Furthermore, overexpression of ROG in Th clones inhibits the production of Th cytokines. Taken together, our results suggest that ROG might play a critical role in regulating the differentiation and activation of Th cells.

  6. Competition between target sites of regulators shapes post-transcriptional gene regulation.

    Science.gov (United States)

    Jens, Marvin; Rajewsky, Nikolaus

    2015-02-01

    Post-transcriptional gene regulation (PTGR) of mRNA turnover, localization and translation is mediated by microRNAs (miRNAs) and RNA-binding proteins (RBPs). These regulators exert their effects by binding to specific sequences within their target mRNAs. Increasing evidence suggests that competition for binding is a fundamental principle of PTGR. Not only can miRNAs be sequestered and neutralized by the targets with which they interact through a process termed 'sponging', but competition between binding sites on different RNAs may also lead to regulatory crosstalk between transcripts. Here, we quantitatively model competition effects under physiological conditions and review the role of endogenous sponges for PTGR in light of the key features that emerge.

  7. Stimuli-Regulated Smart Polymeric Systems for Gene Therapy

    Directory of Open Access Journals (Sweden)

    Ansuja Pulickal Mathew

    2017-04-01

    Full Text Available The physiological condition of the human body is a composite of different environments, each with its own parameters that may differ under normal, as well as diseased conditions. These environmental conditions include factors, such as pH, temperature and enzymes that are specific to a type of cell, tissue or organ or a pathological state, such as inflammation, cancer or infection. These conditions can act as specific triggers or stimuli for the efficient release of therapeutics at their destination by overcoming many physiological and biological barriers. The efficacy of conventional treatment modalities can be enhanced, side effects decreased and patient compliance improved by using stimuli-responsive material that respond to these triggers at the target site. These stimuli or triggers can be physical, chemical or biological and can be internal or external in nature. Many smart/intelligent stimuli-responsive therapeutic gene carriers have been developed that can respond to either internal stimuli, which may be normally present, overexpressed or present in decreased levels, owing to a disease, or to stimuli that are applied externally, such as magnetic fields. This review focuses on the effects of various internal stimuli, such as temperature, pH, redox potential, enzymes, osmotic activity and other biomolecules that are present in the body, on modulating gene expression by using stimuli-regulated smart polymeric carriers.

  8. Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

    Energy Technology Data Exchange (ETDEWEB)

    Serganov, A.; Huang, L; Patel, D

    2009-01-01

    The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains. FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.

  9. Flg22-triggered immunity negatively regulates key BR biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Tamara eJiménez-Góngora

    2015-11-01

    Full Text Available In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR have emerged as negative regulators of pathogen-associated molecular pattern (PAMP-triggered immunity (PTI, promoting growth at the expense of defence. The crosstalk between BR and PTI signalling was described as negative and unidirectional, since activation of PTI does not affect several analysed steps in the BR signalling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signalling, and occurs within 15 minutes of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  10. Reconstructing nonlinear dynamic models of gene regulation using stochastic sampling

    Directory of Open Access Journals (Sweden)

    Reinelt Gerhard

    2009-12-01

    Full Text Available Abstract Background The reconstruction of gene regulatory networks from time series gene expression data is one of the most difficult problems in systems biology. This is due to several reasons, among them the combinatorial explosion of possible network topologies, limited information content of the experimental data with high levels of noise, and the complexity of gene regulation at the transcriptional, translational and post-translational levels. At the same time, quantitative, dynamic models, ideally with probability distributions over model topologies and parameters, are highly desirable. Results We present a novel approach to infer such models from data, based on nonlinear differential equations, which we embed into a stochastic Bayesian framework. We thus address both the stochasticity of experimental data and the need for quantitative dynamic models. Furthermore, the Bayesian framework allows it to easily integrate prior knowledge into the inference process. Using stochastic sampling from the Bayes' posterior distribution, our approach can infer different likely network topologies and model parameters along with their respective probabilities from given data. We evaluate our approach on simulated data and the challenge #3 data from the DREAM 2 initiative. On the simulated data, we study effects of different levels of noise and dataset sizes. Results on real data show that the dynamics and main regulatory interactions are correctly reconstructed. Conclusions Our approach combines dynamic modeling using differential equations with a stochastic learning framework, thus bridging the gap between biophysical modeling and stochastic inference approaches. Results show that the method can reap the advantages of both worlds, and allows the reconstruction of biophysically accurate dynamic models from noisy data. In addition, the stochastic learning framework used permits the computation of probability distributions over models and model parameters

  11. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  12. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  13. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  14. Quasi-Genes: The Many-Body Theory of Gene Regulation in the Presence of Decoys

    Science.gov (United States)

    Burger, Anat

    During transcriptional regulation, transcription factor proteins bind to particular sites in the genome in order to switch genes on or off. The regulatory binding site intended for a transcription factor is just one out of millions of potential sites where the transcription factor can bind. Specificity of a binding motif determines whether less than one or up to tens of thousands of strong affinity binding sites can be expected by pure chance. The roles that these additional "decoy" binding sites play in the functioning of a cell are currently unknown. We incorporate decoys into traditional mass action and stochastic models of a simple gene network-the self-regulated gene-and use numerical and analytical techniques to quantify the effects that these extra sites have on altering gene expression properties. Counter-intuitively, we find that if bound transcription factors are protected from degradation, the mean steady state concentration of unbound transcription factors, , is insensitive to the addition of decoys. Many other gene expression properties do change as decoys are added. Decoys linearly increase the time necessary to reach steady state. Noise buffering by decoys occurs because of a coupling between the unbound proteomic environment and the reservoir of sites that can be very large, but the noise reduction is limited Poisson statistics because of the inherent noise resulting from binding and unbinding of transcription factors to DNA. This noise buffering is optimized for a given protein concentration when decoys have a 1/2 probability of being occupied. Decoys are able to preferentially stabilize one state of a bimodal system over the other, and exponentially increase the time to epigenetically switch between these states. In the limit that binding and unbinding rates are fast compared to the fluctuations in transcription factor copy number, we exploit timescale differences to collapse the model and derive analytical expressions that explain our numerical

  15. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    Science.gov (United States)

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  16. Gene regulation and genetics in neurochemistry, past to future.

    Science.gov (United States)

    Barger, Steven W

    2016-10-01

    Ask any neuroscientist to name the most profound discoveries in the field in the past 60 years, and at or near the top of the list will be a phenomenon or technique related to genes and their expression. Indeed, our understanding of genetics and gene regulation has ushered in whole new systems of knowledge and new empirical approaches, many of which could not have even been imagined prior to the molecular biology boon of recent decades. Neurochemistry, in the classic sense, intersects with these concepts in the manifestation of neuropeptides, obviously dependent upon the central dogma (the established rules by which DNA sequence is eventually converted into protein primary structure) not only for their conformation but also for their levels and locales of expression. But, expanding these considerations to non-peptide neurotransmitters illustrates how gene regulatory events impact neurochemistry in a much broader sense, extending beyond the neurochemicals that translate electrical signals into chemical ones in the synapse, to also include every aspect of neural development, structure, function, and pathology. From the beginning, the mutability - yet relative stability - of genes and their expression patterns were recognized as potential substrates for some of the most intriguing phenomena in neurobiology - those instances of plasticity required for learning and memory. Near-heretical speculation was offered in the idea that perhaps the very sequence of the genome was altered to encode memories. A fascinating component of the intervening progress includes evidence that the central dogma is not nearly as rigid and consistent as we once thought. And this mutability extends to the potential to manipulate that code for both experimental and clinical purposes. Astonishing progress has been made in the molecular biology of neurochemistry during the 60 years since this journal debuted. Many of the gains in conceptual understanding have been driven by methodological

  17. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    Energy Technology Data Exchange (ETDEWEB)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

  18. Expression and chromatin structures of cellulolytic enzyme gene regulated by heterochromatin protein 1

    OpenAIRE

    Zhang, Xiujun; Qu, Yinbo; Qin, Yuqi

    2016-01-01

    Background Heterochromatin protein 1 (HP1, homologue HepA in Penicillium oxalicum) binding is associated with a highly compact chromatin state accompanied by gene silencing or repression. HP1 loss leads to the derepression of gene expression. We investigated HepA roles in regulating cellulolytic enzyme gene expression, as an increasingly number of studies have suggested that cellulolytic enzyme gene expression is not only regulated by transcription factors, but is also affected by the chromat...

  19. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  20. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  1. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    Science.gov (United States)

    Castelli, Erick C.; Veiga-Castelli, Luciana C.; Yaghi, Layale; Donadi, Eduardo A.

    2014-01-01

    HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i) it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii) the proximal promoter region (within 200 bases from the first translated ATG) does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii) the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements) and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region. PMID:24741620

  2. Transcriptional and Posttranscriptional Regulations of the HLA-G Gene

    Directory of Open Access Journals (Sweden)

    Erick C. Castelli

    2014-01-01

    Full Text Available HLA-G has a relevant role in immune response regulation. The overall structure of the HLA-G coding region has been maintained during the evolution process, in which most of its variable sites are synonymous mutations or coincide with introns, preserving major functional HLA-G properties. The HLA-G promoter region is different from the classical class I promoters, mainly because (i it lacks regulatory responsive elements for IFN-γ and NF-κB, (ii the proximal promoter region (within 200 bases from the first translated ATG does not mediate transactivation by the principal HLA class I transactivation mechanisms, and (iii the presence of identified alternative regulatory elements (heat shock, progesterone and hypoxia-responsive elements and unidentified responsive elements for IL-10, glucocorticoids, and other transcription factors is evident. At least three variable sites in the 3′ untranslated region have been studied that may influence HLA-G expression by modifying mRNA stability or microRNA binding sites, including the 14-base pair insertion/deletion, +3142C/G and +3187A/G polymorphisms. Other polymorphic sites have been described, but there are no functional studies on them. The HLA-G coding region polymorphisms might influence isoform production and at least two null alleles with premature stop codons have been described. We reviewed the structure of the HLA-G promoter region and its implication in transcriptional gene control, the structure of the HLA-G 3′UTR and the major actors of the posttranscriptional gene control, and, finally, the presence of regulatory elements in the coding region.

  3. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    Science.gov (United States)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  4. Brain training in progress: a review of trainability in healthy seniors

    Directory of Open Access Journals (Sweden)

    Jessika I. V. Buitenweg

    2012-06-01

    Full Text Available The cognitive deterioration associated with aging is accompanied by structural alterations and loss of functionality of the frontostriatal dopamine system. The question arises how such deleterious cognitive effects could be countered. Brain training, currently highly popular among young and old alike, promises that users will improve on certain neurocognitive skills, and this has indeed been confirmed in a number of studies. Based on these results, it seems reasonable to expect beneficial effects of brain training in the elderly as well. A selective review of the existing literature suggests, however, that the results are neither robust nor consistent, and that transfer and sustained effects thus far appear limited. Based on this review, we argue for a series of elements that hold potential for progress in successful types of brain training: (i including flexibility and novelty as features of the training, (ii focusing on a number of promising, yet largely unexplored domains, such as decision-making and memory strategy training, and (iii tailoring the training adaptively to the level and progress of the individual. We also emphasize the need for covariance-based MRI methods in linking structural and functional changes in the aging brain to individual differences in neurocognitive efficiency and trainability in order to further uncover the underlying mechanisms.

  5. Flexible three-dimensional artificial synapse networks with correlated learning and trainable memory capability.

    Science.gov (United States)

    Wu, Chaoxing; Kim, Tae Whan; Choi, Hwan Young; Strukov, Dmitri B; Yang, J Joshua

    2017-09-29

    If a three-dimensional physical electronic system emulating synapse networks could be built, that would be a significant step toward neuromorphic computing. However, the fabrication complexity of complementary metal-oxide-semiconductor architectures impedes the achievement of three-dimensional interconnectivity, high-device density, or flexibility. Here we report flexible three-dimensional artificial chemical synapse networks, in which two-terminal memristive devices, namely, electronic synapses (e-synapses), are connected by vertically stacking crossbar electrodes. The e-synapses resemble the key features of biological synapses: unilateral connection, long-term potentiation/depression, a spike-timing-dependent plasticity learning rule, paired-pulse facilitation, and ultralow-power consumption. The three-dimensional artificial synapse networks enable a direct emulation of correlated learning and trainable memory capability with strong tolerances to input faults and variations, which shows the feasibility of using them in futuristic electronic devices and can provide a physical platform for the realization of smart memories and machine learning and for operation of the complex algorithms involving hierarchical neural networks.High-density information storage calls for the development of modern electronics with multiple stacking architectures that increase the complexity of three-dimensional interconnectivity. Here, Wu et al. build a stacked yet flexible artificial synapse network using layer-by-layer solution processing.

  6. Distinct pathways of insulin-regulated versus diabetes-regulated gene expression: an in vivo analysis in MIRKO mice.

    Science.gov (United States)

    Yechoor, Vijay K; Patti, Mary-Elizabeth; Ueki, Kohjiro; Laustsen, Palle G; Saccone, Robert; Rauniyar, Ravi; Kahn, C Ronald

    2004-11-23

    Diabetes mellitus is a complex metabolic disorder accompanied by alterations in cellular physiology, metabolism, and gene expression. These alterations can be primary (due to loss of direct insulin action) or secondary (due to the metabolic perturbations associated with the disease). To dissect and quantitate these two separate effects, we compared the skeletal muscle gene-expression profiles of muscle insulin receptor knockout (MIRKO) mice and their Lox controls in the basal, streptozotocin-induced diabetic, and insulin-treated diabetic states. Pure deficiency of insulin action as present in the MIRKO mouse results in regulation of 130 genes, with down-regulation of NSF (N-ethylmaleimide-sensitive fusion protein) and VAMP-2 (vesicle-associated membrane protein 2), stearoyl CoA desaturase 1, and cAMP-specific phosphodiesterase 4B, as well as up-regulation of some signaling-related genes, such as Akt2, and the fatty-acid transporter CD36. In diabetes, additional transcriptional mechanisms are activated, resulting in alterations in expression of approximately 500 genes, including a highly coordinated down-regulation of genes of the mitochondrial electron-transport chain and one of the mammalian homologues of the histone deacetylase Sir2, which has been implicated in the link between nutrition and longevity. These distinct pathways of direct and indirect regulation of gene expression provide insights into the complex mechanisms of transcriptional control in diabetes and areas of potential therapeutic targeting.

  7. Coordinate gene regulation by fimbriae-induced signal transduction

    DEFF Research Database (Denmark)

    Schembri, Mark; Klemm, Per

    2001-01-01

    whether fimbriae expression can affect expression of other genes, Analysis of gene expression in two E.coli strains, differing in the fim locus, indicated the flu gene to be affected. The flu gene encodes the antigen 43 (Ag43) surface protein, specifically involved in bacterial aggregation...

  8. Role of Hfq in iron-dependent and -independent gene regulation in Neisseria meningitidis.

    Science.gov (United States)

    Mellin, J R; McClure, Ryan; Lopez, Delia; Green, Olivia; Reinhard, Bjorn; Genco, Caroline

    2010-08-01

    In Neisseria meningitidis, iron-responsive gene regulation is mediated primarily by the ferric uptake regulator (Fur) protein. When complexed with iron, Fur represses gene expression by preventing transcription initiation. Fur can also indirectly activate gene expression via the repression of regulatory small RNAs (sRNA). One such Fur- and iron-regulated sRNA, NrrF, was previously identified in N. meningitidis and shown to repress expression of the sdhA and sdhC genes encoding subunits of the succinate dehydrogenase complex. In the majority of Gram-negative bacteria, sRNA-mediated regulation requires a cofactor RNA-binding protein (Hfq) for proper gene regulation and stabilization. In this study, we examined the role of Hfq in NrrF-mediated regulation of the succinate dehydrogenase genes in N. meningitidis and the effect of an hfq mutation on iron-responsive gene regulation more broadly. We first demonstrated that the stability of NrrF, as well as the regulation of sdhC and sdhA in vivo, was unaltered in the hfq mutant. Secondly, we established that iron-responsive gene regulation of the Fur-regulated sodB gene was dependent on Hfq. Finally, we demonstrated that in N. meningitidis, Hfq functions in a global manner to control expression of many ORFs and intergenic regions via iron-independent mechanisms. Collectively these studies demonstrate that in N. meningitidis, iron- and NrrF-mediated regulation of sdhC and sdhA can occur independently of Hfq, although Hfq functions more globally to control regulation of other N. meningitidis genes primarily by iron-independent mechanisms.

  9. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori*

    Science.gov (United States)

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-01-01

    Hox genes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hox genes can also function in terminally differentiated tissue of the lepidopteran Bombyx mori. In this species, Antennapedia (Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antp can regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antp in the posterior silk gland induced ectopic expression of major silk protein genes such as sericin-3, fhxh4, and fhxh5. These genes are normally expressed specifically in the middle silk gland as is Antp. Therefore, the evidence strongly suggests that Antp activates these silk protein genes in the middle silk gland. The putative sericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antp directly activates their expression. We also found that the pattern of gene expression was well conserved between B. mori and the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori. We suggest that Hox genes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. PMID:26814126

  10. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

    Science.gov (United States)

    Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

    2005-08-11

    Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

  11. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures...... containing different ammonium concentrations (NH4+; 0, 9.5 or 191 mM) and with different nitrogen sources (N-acetylglucosamine (GlcNAc) or glutamate (glt)). S91 chiA expression was found to depend on both the NH4+ concentration and source of nitrogen in marine minimal medium (MMM). Pseudoalteromonas sp. S91...... and S91CX can use either GlcNAc or glt as a sole source of carbon in MMM containing a standard concentration of 9.5 mM NH4+. Adding excess NH4+, 20 times the standard concentration, to MMM significantly reduced chiA activity below that found in the presence of either GlcNAc or glt. When no NH4...

  12. Salicin regulates the expression of functional 'youth gene clusters' to reflect a more youthful gene expression profile.

    Science.gov (United States)

    Gopaul, R; Knaggs, H E; Lephart, J

    2011-10-01

    There are a variety of biological mechanisms that contribute to specific characteristics of ageing skin; for example, the loss of skin structure proteins, increased susceptibility to UV-induced pigmentation and/or loss of hydration. Each of these biological processes is influenced by specific groups of genes. In this research, we have identified groups of genes associated with specific clinical signs of skin ageing and refer to these as functional 'youth gene clusters'. In this study, quantitative real-time polymerase chain reaction (qPCR) was used to investigate the effects of topical application of salicin in regulating the expression of functional 'youth gene clusters' to reflect a more youthful skin profile and reduce the appearance of attributes associated with skin ageing. Results showed that salicin significantly influences the gene expression profiles of treated human equivalent full-thickness skin, by regulating the expression of genes associated with various biological processes involving skin structure, skin hydration, pigmentation and cellular differentiation. Based on the findings from this experiment, salicin was identified as a key ingredient that may regulate functional 'youth gene clusters' to reflect a more youthful gene expression profile by increasing the expression of genes responsible for youthful skin and decreasing the expression of genes responsible for the appearance of aged skin. © 2011 The Authors. ICS © 2011 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  13. Cholinergic regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Kristensen, Bo; Georg, Birgitte; Fahrenkrug, Jan

    1997-01-01

    Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing......Vasoactive intestinal polypeptide, muscarinic receptor, neuroblastoma cell, mRNA, gene expression, peptide processing...

  14. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  15. CsACO4, an ACC oxidase gene regulating male differentiation in ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    Arabidopsis ethylene-response gene ETR1: similarity of product to two- component regulators. Science, 262: 539-544. Chen YH, Zhang JH, Ouyang B, Li HX, Ye ZB (2005). Cloning of ACC oxidase gene and inhibition of endogenous gene expression with. RNAi in cauliflower. Acta Genetica Sinica, 32: 764-769. (in chinese).

  16. Genome-wide gene expression regulation as a function of genotype and age in C. elegans

    NARCIS (Netherlands)

    Viñuela Rodriguez, A.; Snoek, L.B.; Riksen, J.A.G.; Kammenga, J.E.

    2010-01-01

    Gene expression becomes more variable with age, and it is widely assumed that this is due to a decrease in expression regulation. But currently there is no understanding how gene expression regulatory patterns progress with age. Here we explored genome-wide gene expression variation and regulatory

  17. Global profiling of alternative splicing events and gene expression regulated by hnRNPH/F.

    Science.gov (United States)

    Wang, Erming; Aslanzadeh, Vahid; Papa, Filomena; Zhu, Haiyan; de la Grange, Pierre; Cambi, Franca

    2012-01-01

    In this study, we have investigated the global impact of heterogeneous nuclear Ribonuclear Protein (hnRNP) H/F-mediated regulation of splicing events and gene expression in oligodendrocytes. We have performed a genome-wide transcriptomic analysis at the gene and exon levels in Oli-neu cells treated with siRNA that targets hnRNPH/F compared to untreated cells using Affymetrix Exon Array. Gene expression levels and regulated exons were identified with the GenoSplice EASANA algorithm. Bioinformatics analyses were performed to determine the structural properties of G tracts that correlate with the function of hnRNPH/F as enhancers vs. repressors of exon inclusion. Different types of alternatively spliced events are regulated by hnRNPH/F. Intronic G tracts density, length and proximity to the 5' splice site correlate with the hnRNPH/F enhancer function. Additionally, 6% of genes are differently expressed upon knock down of hnRNPH/F. Genes that regulate the transition of oligodendrocyte progenitor cells to oligodendrocytes are differentially expressed in hnRNPH/F depleted Oli-neu cells, resulting in a decrease of negative regulators and an increase of differentiation-inducing regulators. The changes were confirmed in developing oligodendrocytes in vivo. This is the first genome wide analysis of splicing events and gene expression regulated by hnRNPH/F in oligodendrocytes and the first report that hnRNPH/F regulate genes that are involved in the transition from oligodendrocyte progenitor cells to oligodendrocytes.

  18. The Trainability of Adolescent Soccer Players to Brief Periodized Complex Training.

    Science.gov (United States)

    Chatzinikolaou, Athanasios; Michaloglou, Konstantinos; Avloniti, Alexandra; Leontsini, Diamanda; Deli, Chariklia K; Vlachopoulos, Dimitris; Gracia-Marco, Luis; Arsenis, Sotirios; Athanailidis, Ioannis; Draganidis, Dimitrios; Jamurtas, Athanasios Z; Williams, Craig A; Fatouros, Ioannis G

    2018-02-12

    Τo investigate the effect of a complex, short-term strength/power training protocol on performance and body composition of elite early-adolescent soccer players. Twenty-two players (14-15 years) were randomly assigned to (a) an experimental (EG, n=12, participated in a 5-week training protocol with traditional multi-joint power resistance exercises, Olympic-style lifts, plyometric drills and speed work, four times/week) or (b) a control group (CG, n=10). Strength and power performance [jumping, speed, change of direction, repeated sprint ability, endurance, isokinetic strength of knee flexors and extensors, maximal strength in various lifts, speed-endurance) were evaluated pre- and post-training. Cessation of training for five weeks in the CG induced a marked performance deterioration (~5-20%). Training not only prevented strength performance deterioration but also increased it (~2-30%). Endurance and RSA declined to a smaller extent in EG compared to CG (15% vs. 7.5%). Isometric strength, and body composition remained unaltered in both groups. Results demonstrate that (i) young players exhibit a high level of trainability of their strength/power performance (but not endurance) in response a short-term complex training protocol during early adolescence, (ii) Olympic-style lifts are characterized by increased safety in this age group and appear to be highly effective, (iii) it appears that lifts incorporating a hip thrust result in increased strength of both knee extensors and flexors, (iv) cessation of training for only five weeks results in marked deterioration of strength/power and endurance performance and (v) improvement of strength/power performance may be related to neural-based adaptation since body composition remained unaffected.

  19. Trainability of Muscular Activity Level during Maximal Voluntary Co-Contraction: Comparison between Bodybuilders and Nonathletes

    Science.gov (United States)

    Maeo, Sumiaki; Takahashi, Takumi; Takai, Yohei; Kanehisa, Hiroaki

    2013-01-01

    Antagonistic muscle pairs cannot be fully activated simultaneously, even with maximal effort, under conditions of voluntary co-contraction, and their muscular activity levels are always below those during agonist contraction with maximal voluntary effort (MVE). Whether the muscular activity level during the task has trainability remains unclear. The present study examined this issue by comparing the muscular activity level during maximal voluntary co-contraction for highly experienced bodybuilders, who frequently perform voluntary co-contraction in their training programs, with that for untrained individuals (nonathletes). The electromyograms (EMGs) of biceps brachii and triceps brachii muscles during maximal voluntary co-contraction of elbow flexors and extensors were recorded in 11 male bodybuilders and 10 nonathletes, and normalized to the values obtained during the MVE of agonist contraction for each of the corresponding muscles (% EMGMVE). The involuntary coactivation level in antagonist muscle during the MVE of agonist contraction was also calculated. In both muscles, % EMGMVE values during the co-contraction task for bodybuilders were significantly higher (Pbodybuilders vs. 46±13% in nonathletes, triceps brachii: 74±16% vs. 57±9%). There was a significant positive correlation between a length of bodybuilding experience and muscular activity level during the co-contraction task (r = 0.653, P = 0.03). Involuntary antagonist coactivation level during MVE of agonist contraction was not different between the two groups. The current result indicates that long-term participation in voluntary co-contraction training progressively enhances muscular activity during maximal voluntary co-contraction. PMID:24260233

  20. Trainability of muscular activity level during maximal voluntary co-contraction: comparison between bodybuilders and nonathletes.

    Directory of Open Access Journals (Sweden)

    Sumiaki Maeo

    Full Text Available Antagonistic muscle pairs cannot be fully activated simultaneously, even with maximal effort, under conditions of voluntary co-contraction, and their muscular activity levels are always below those during agonist contraction with maximal voluntary effort (MVE. Whether the muscular activity level during the task has trainability remains unclear. The present study examined this issue by comparing the muscular activity level during maximal voluntary co-contraction for highly experienced bodybuilders, who frequently perform voluntary co-contraction in their training programs, with that for untrained individuals (nonathletes. The electromyograms (EMGs of biceps brachii and triceps brachii muscles during maximal voluntary co-contraction of elbow flexors and extensors were recorded in 11 male bodybuilders and 10 nonathletes, and normalized to the values obtained during the MVE of agonist contraction for each of the corresponding muscles (% EMGMVE. The involuntary coactivation level in antagonist muscle during the MVE of agonist contraction was also calculated. In both muscles, % EMGMVE values during the co-contraction task for bodybuilders were significantly higher (P<0.01 than those for nonathletes (biceps brachii: 66±14% in bodybuilders vs. 46±13% in nonathletes, triceps brachii: 74±16% vs. 57±9%. There was a significant positive correlation between a length of bodybuilding experience and muscular activity level during the co-contraction task (r = 0.653, P = 0.03. Involuntary antagonist coactivation level during MVE of agonist contraction was not different between the two groups. The current result indicates that long-term participation in voluntary co-contraction training progressively enhances muscular activity during maximal voluntary co-contraction.

  1. Strength performance in youth: trainability of adolescents and children in the back and front squats.

    Science.gov (United States)

    Keiner, Michael; Sander, Andre; Wirth, Klaus; Caruso, Oliver; Immesberger, Peter; Zawieja, Martin

    2013-02-01

    A basic question for many athletic coaches pertains to the maximum attainable strength level for youth athletes. The aim of this investigation was to establish reference values for the strength performance in the front and back squats in youth athletes. The strength performance in front and back squats of 141 elite youth soccer players was tested by a 1 repetition maximum (1RM) and 1RM related to bodyweight (SREL). The subjects aged between 11 and 19 years and were divided into 2 groups and 4 subgroups (A = younger than 19 years, B = younger than 17 years, C = younger than 15 years, and D = younger than 13 years). For approximately 2 years, one group (control group [CG]) only participated in routine soccer training and the other group (strength training group [STG]) participated in an additional strength training program along with the routine soccer training. Additionally, the strength performance in a 5RM in both squat variants of 105 young elite weightlifters (National Weightlifting Organization Baden Württemberg, [BWG]) was examined to show the high level of trainability of children and adolescents and to determine the reference strength values for young athletes. The STG performed in the parallel front squat SREL in the subgroups A 1.7 +/- 0.2, B 1.6 +/- 0.2, C 1.4 +/-0.2 and D 0.9 +/- 0.3. The STG had significantly (p strength values in 1RM and SREL than CG. The BWG had higher strength values than STG, but the BWG was not part of the statistical analysis because of the different test protocols (1RM vs. 5RM). Our data show that the SREL in parallel squat for young elite athletes with long-term training experience should be a minimum of 2.0 for 16- to 19-year-olds, 1.5 for 13- to 15-year-olds, and 0.7 for 11- to 12-year-olds.

  2. A Bayesian model for pooling gene expression studies that incorporates co-regulation information.

    Directory of Open Access Journals (Sweden)

    Erin M Conlon

    Full Text Available Current Bayesian microarray models that pool multiple studies assume gene expression is independent of other genes. However, in prokaryotic organisms, genes are arranged in units that are co-regulated (called operons. Here, we introduce a new Bayesian model for pooling gene expression studies that incorporates operon information into the model. Our Bayesian model borrows information from other genes within the same operon to improve estimation of gene expression. The model produces the gene-specific posterior probability of differential expression, which is the basis for inference. We found in simulations and in biological studies that incorporating co-regulation information improves upon the independence model. We assume that each study contains two experimental conditions: a treatment and control. We note that there exist environmental conditions for which genes that are supposed to be transcribed together lose their operon structure, and that our model is best carried out for known operon structures.

  3. Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

    Directory of Open Access Journals (Sweden)

    Jennifer Ferguson

    Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

  4. Gene therapy: Regulations, ethics and its practicalities in liver disease

    OpenAIRE

    Jin, Xi; Yang, Yi-Da; Li, You-Ming

    2008-01-01

    Gene therapy is a new and promising approach which opens a new door to the treatment of human diseases. By direct transfer of genetic materials to the target cells, it could exert functions on the level of genes and molecules. It is hoped to be widely used in the treatment of liver disease, especially hepatic tumors by using different vectors encoding the aim gene for anti-tumor activity by activating primary and adaptive immunity, inhibiting oncogene and angiogenesis. Despite the huge curati...

  5. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  6. Analysis of mammary specific gene locus regulation in differentiated cells derived by somatic cell fusion

    International Nuclear Information System (INIS)

    Robinson, Claire; Kolb, Andreas F.

    2009-01-01

    The transcriptional regulation of a gene is best analysed in the context of its normal chromatin surroundings. However, most somatic cells, in contrast to embryonic stem cells, are refractory to accurate modification by homologous recombination. We show here that it is possible to introduce precise genomic modifications in ES cells and to analyse the phenotypic consequences in differentiated cells by using a combination of gene targeting, site-specific recombination and somatic cell fusion. To provide a proof of principle, we have analysed the regulation of the casein gene locus in mammary gland cells derived from modified murine ES cells by somatic cell fusion. A β-galactosidase reporter gene was inserted in place of the β-casein gene and the modified ES cells, which do not express the reporter gene, were fused with the mouse mammary gland cell line HC11. The resulting cell clones expressed the β-galactosidase gene to a similar extent and with similar hormone responsiveness as the endogenous gene. However, a reporter gene under the control of a minimal β-casein promoter (encompassing the two consensus STAT5 binding sites which mediate the hormone response of the casein genes) was unable to replicate expression levels or hormone responsiveness of the endogenous gene when inserted into the same site of the casein locus. As expected, these results implicate sequences other than the STAT5 sites in the regulation of the β-casein gene

  7. Regulation of mitochondrial gene expression, the epigenetic enigma

    NARCIS (Netherlands)

    Mposhi, Archibold; van der Wijst, Monique G. P.; Faber, Klaas Nico; Rots, Marianne G.

    2017-01-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether

  8. Gene program-specific regulation of PGC-1{alpha} activity

    DEFF Research Database (Denmark)

    Schmidt, Søren F; Mandrup, Susanne

    2011-01-01

    . 1232-1244) demonstrated that phosphorylation of PGC-1α by the p70 ribosomal protein S6 kinase 1 (S6K1) specifically interfered with the interaction between PGC-1α and HNF4α in liver and blocked the coactivation of the gluconeogenic target genes. This demonstrates how independent fine-tuning of gene...

  9. Anthocyanin biosynthesis in fruit tree crops: Genes and their regulation

    African Journals Online (AJOL)

    The anthocyanin biosynthesis pathway is a little complex with branches responsible for the synthesis of a variety of metabolites. In fruit tree crops, during the past decade, many structural genes encoding enzymes in the anthocyanin biosynthetic pathway and various regulatory genes encoding transcription factors that ...

  10. Stability and flexibility of epigenetic gene regulation in mammalian development.

    Science.gov (United States)

    Reik, Wolf

    2007-05-24

    During development, cells start in a pluripotent state, from which they can differentiate into many cell types, and progressively develop a narrower potential. Their gene-expression programmes become more defined, restricted and, potentially, 'locked in'. Pluripotent stem cells express genes that encode a set of core transcription factors, while genes that are required later in development are repressed by histone marks, which confer short-term, and therefore flexible, epigenetic silencing. By contrast, the methylation of DNA confers long-term epigenetic silencing of particular sequences--transposons, imprinted genes and pluripotency-associated genes--in somatic cells. Long-term silencing can be reprogrammed by demethylation of DNA, and this process might involve DNA repair. It is not known whether any of the epigenetic marks has a primary role in determining cell and lineage commitment during development.

  11. Highly sensitive inference of time-delayed gene regulation by network deconvolution.

    Science.gov (United States)

    Chen, Haifen; Mundra, Piyushkumar A; Zhao, Li Na; Lin, Feng; Zheng, Jie

    2014-01-01

    Gene regulatory network (GRN) is a fundamental topic in systems biology. The dynamics of GRN can shed light on the cellular processes, which facilitates the understanding of the mechanisms of diseases when the processes are dysregulated. Accurate reconstruction of GRN could also provide guidelines for experimental biologists. Therefore, inferring gene regulatory networks from high-throughput gene expression data is a central problem in systems biology. However, due to the inherent complexity of gene regulation, noise in measuring the data and the short length of time-series data, it is very challenging to reconstruct accurate GRNs. On the other hand, a better understanding into gene regulation could help to improve the performance of GRN inference. Time delay is one of the most important characteristics of gene regulation. By incorporating the information of time delays, we can achieve more accurate inference of GRN. In this paper, we propose a method to infer time-delayed gene regulation based on cross-correlation and network deconvolution (ND). First, we employ cross-correlation to obtain the probable time delays for the interactions between each target gene and its potential regulators. Then based on the inferred delays, the technique of ND is applied to identify direct interactions between the target gene and its regulators. Experiments on real-life gene expression datasets show that our method achieves overall better performance than existing methods for inferring time-delayed GRNs. By taking into account the time delays among gene interactions, our method is able to infer GRN more accurately. The effectiveness of our method has been shown by the experiments on three real-life gene expression datasets of yeast. Compared with other existing methods which were designed for learning time-delayed GRN, our method has significantly higher sensitivity without much reduction of specificity.

  12. The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

    Science.gov (United States)

    Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

    2013-09-01

    The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

  13. Overexpression and Down-Regulation of Barley Lipoxygenase LOX2.2 Affects Jasmonate-Regulated Genes and Aphid Fecundity

    Directory of Open Access Journals (Sweden)

    Aleksandra Losvik

    2017-12-01

    Full Text Available Aphids are pests on many crops and depend on plant phloem sap as their food source. In an attempt to find factors improving plant resistance against aphids, we studied the effects of overexpression and down-regulation of the lipoxygenase gene LOX2.2 in barley (Hordeum vulgare L. on the performance of two aphid species. A specialist, bird cherry-oat aphid (Rhopalosiphum padi L. and a generalist, green peach aphid (Myzus persicae Sulzer were studied. LOX2.2 overexpressing lines showed up-regulation of some other jasmonic acid (JA-regulated genes, and antisense lines showed down-regulation of such genes. Overexpression or suppression of LOX2.2 did not affect aphid settling or the life span on the plants, but in short term fecundity tests, overexpressing plants supported lower aphid numbers and antisense plants higher aphid numbers. The amounts and composition of released volatile organic compounds did not differ between control and LOX2.2 overexpressing lines. Up-regulation of genes was similar for both aphid species. The results suggest that LOX2.2 plays a role in the activation of JA-mediated responses and indicates the involvement of LOX2.2 in basic defense responses.

  14. From Biophysics to Evolutionary Genetics: Statistical Aspects of Gene Regulation

    Science.gov (United States)

    Lässig, Michael

    Genomic functions often cannot be understood at the level of single genes but require the study of gene networks. This systems biology credo is nearly commonplace by now. Evidence comes from the comparative analysis of entire genomes: current estimates put, for example, the number of human genes at around 22,000, hardly more than the 14,000 of the fruit fly, and not even an order of magnitude higher than the 6,000 of baker's yeast. The complexity and diversity of higher animals, therefore, cannot be explained in terms of their gene numbers. If, however, a biological function requires the concerted action of several genes, and conversely, a gene takes part in several functional contexts, an organism may be defined less by its individual genes but by their interactions. The emerging picture of the genome as a strongly interacting system with many degrees of freedom brings new challenges for experiment and theory, many of which are of a statistical nature. And indeed, this picture continues to make the subject attractive to a growing number of statistical physicists.

  15. The precise regulation of different COR genes by individual CBF transcription factors in Arabidopsis thaliana.

    Science.gov (United States)

    Shi, Yihao; Huang, Jiaying; Sun, Tianshu; Wang, Xuefei; Zhu, Chenqi; Ai, Yuxi; Gu, Hongya

    2017-02-01

    The transcription factors CBF1/2/3 are reported to play a dominant role in the cold responsive network of Arabidopsis by directly regulating the expression levels of cold responsive (COR) genes. In this study, we obtained CRISPR/Cas9-mediated loss-of-function mutants of cbf1∼3. Over 3,000 COR genes identified by RNA-seq analysis showed a slight but significant change in their expression levels in the mutants compared to the wild-type plants after being treated at 4 °C for 12 h. The C-repeat (CRT) motif (5'-CCGAC-3') was enriched in promoters of genes that were up-regulated by CBF2 and CBF3 but not in promoters of genes up-regulated by CBF1. These data suggest that CBF2 and CBF3 play a more important role in directing the cold response by regulating different sets of downstream COR genes. More than 2/3 of COR genes were co-regulated by two or three CBFs and were involved mainly in cellular signal transduction and metabolic processes; less than 1/3 of the genes were regulated by one CBF, and those genes up-regulated were enriched in cold-related abiotic stress responses. Our results indicate that CBFs play an important role in the trade-off between cold tolerance and plant growth through the precise regulation of COR genes in the complicated transcriptional network. © 2016 The Authors. Journal of Integrative Plant Biology Published by John Wiley & Sons Australia, Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  16. Lipopolysaccharide triggers nuclear import of Lpcat1 to regulate inducible gene expression in lung epithelia.

    Science.gov (United States)

    Ellis, Bryon; Kaercher, Leah; Snavely, Courtney; Zhao, Yutong; Zou, Chunbin

    2012-07-26

    To report that Lpcat1 plays an important role in regulating lipopolysaccharide (LPS) inducible gene transcription. Gene expression in Murine Lung Epithelial MLE-12 cells with LPS treatment or Haemophilus influenza and Escherichia coli infection was analyzed by employing quantitative Reverse Transcription Polymerase Chain Reaction techniques. Nucleofection was used to deliver Lenti-viral system to express or knock down Lpcat1 in MLE cells. Subcellular protein fractionation and Western blotting were utilized to study Lpcat1 nuclear relocation. Lpcat1 translocates into the nucleus from the cytoplasm in murine lung epithelia (MLE) after LPS treatment. Haemophilus influenza and Escherichia coli, two LPS-containing pathogens that cause pneumonia, triggered Lpcat1 nuclear translocation from the cytoplasm. The LPS inducible gene expression profile was determined by quantitative reverse transcription polymerase chain reaction after silencing Lpcat1 or overexpression of the enzyme in MLE cells. We detected that 17 out of a total 38 screened genes were upregulated, 14 genes were suppressed, and 7 genes remained unchanged in LPS treated cells in comparison to controls. Knockdown of Lpcat1 by shRNA dramatically changed the spectrum of the LPS inducible gene transcription, as 18 genes out of 38 genes were upregulated, of which 20 genes were suppressed or unchanged. Notably, in Lpcat1 overexpressed cells, 25 genes out of 38 genes were reduced in the setting of LPS treatment. These observations suggest that Lpcat1 relocates into the nucleus in response to bacterial infection to differentially regulate gene transcriptional repression.

  17. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Prakash

    PEPCK) and glucose-6-phosphatase. (G6Pase), respectively. PEPCK gene expression is increased not only in diabetes but also in hyperthyroidism and in various nutritional states such as high protein diets and fasting (Hanson and Reshef 1997).

  18. LncRNAs: emerging players in gene regulation and disease ...

    Indian Academy of Sciences (India)

    that some of the ribosome-associated lncRNAs modulate the translation of protein-coding genes (Yoon et al. 2012). Genomic and cellular location of lncRNAs. LncRNAs can be located in either DNA strands or in both. (Wang et al. 2011a). Based on genomic distribution with respect to protein-coding genes, lncRNAs can be ...

  19. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A

    2008-09-01

    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  20. Autism and increased paternal age related changes in global levels of gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Mark D Alter

    2011-02-01

    Full Text Available A causal role of mutations in multiple general transcription factors in neurodevelopmental disorders including autism suggested that alterations in global levels of gene expression regulation might also relate to disease risk in sporadic cases of autism. This premise can be tested by evaluating for changes in the overall distribution of gene expression levels. For instance, in mice, variability in hippocampal-dependent behaviors was associated with variability in the pattern of the overall distribution of gene expression levels, as assessed by variance in the distribution of gene expression levels in the hippocampus. We hypothesized that a similar change in variance might be found in children with autism. Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL of children with autism (n = 82 and controls (n = 64. Variance in the distribution of gene expression levels from each microarray was compared between groups of children. Also tested was whether a risk factor for autism, increased paternal age, was associated with variance. A decrease in the variance in the distribution of gene expression levels in PBL was associated with the diagnosis of autism and a risk factor for autism, increased paternal age. Traditional approaches to microarray analysis of gene expression suggested a possible mechanism for decreased variance in gene expression. Gene expression pathways involved in transcriptional regulation were down-regulated in the blood of children with autism and children of older fathers. Thus, results from global and gene specific approaches to studying microarray data were complimentary and supported the hypothesis that alterations at the global level of gene expression regulation are related to autism and increased paternal age. Global regulation of transcription, thus, represents a possible point of convergence for multiple etiologies of autism and other

  1. Stripy Ftz target genes are coordinately regulated by Ftz-F1.

    Science.gov (United States)

    Hou, Hui Ying; Heffer, Alison; Anderson, W Ray; Liu, Jingnan; Bowler, Timothy; Pick, Leslie

    2009-11-15

    During development, cascades of regulatory genes act in a hierarchical fashion to subdivide the embryo into increasingly specified body regions. This has been best characterized in Drosophila, where genes encoding regulatory transcription factors form a network to direct the development of the basic segmented body plan. The pair-rule genes are pivotal in this process as they are responsible for the first subdivision of the embryo into repeated metameric units. The Drosophila pair-rule gene fushi tarazu (ftz) is a derived Hox gene expressed in and required for the development of alternate parasegments. Previous studies suggested that Ftz achieves its distinct regulatory specificity as a segmentation protein by interacting with a ubiquitously expressed cofactor, the nuclear receptor Ftz-F1. However, the downstream target genes regulated by Ftz and other pair-rule genes to direct segment formation are not known. In this study, we selected candidate Ftz targets by virtue of their early expression in Ftz-like stripes. This identified two new Ftz target genes, drumstick (drm) and no ocelli (noc), and confirmed that Ftz regulates a serotonin receptor (5-HT2). These are the earliest Ftz targets identified to date and all are coordinately regulated by Ftz-F1. Engrailed (En), the best-characterized Ftz/Ftz-F1 downstream target, is not an intermediate in regulation. The drm genomic region harbors two separate seven-stripe enhancers, identified by virtue of predicted Ftz-F1 binding sites, and these sites are necessary for stripe expression in vivo. We propose that pair-rule genes, exemplified by Ftz/Ftz-F1, promote segmentation by acting at different hierarchical levels, regulating first, other segmentation genes; second, other regulatory genes that in turn control specific cellular processes such as tissue differentiation; and, third, 'segmentation realizator genes' that are directly involved in morphogenesis.

  2. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factorsin flower development

    NARCIS (Netherlands)

    Pajoro, A.; Madrigal, P.; Muiño, J.M.; Tomas Matus, J.; Jin, J.; Mecchia, M.A.; Debernardi, J.M.; Palatnik, J.F.; Balazadeh, S.; Arif, M.; Ó’Maoiléidigh, D.S.; Wellmer, F.; Krajewski, P.; Riechmann, J.L.; Angenent, G.C.

    2014-01-01

    Background: Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the

  3. Beijerinck Centennial Microbial Physiology and Gene Regulation : Emerging Principles and Applications

    NARCIS (Netherlands)

    Scheffers, W.A.; Van Dijken, J.P.

    1995-01-01

    Book of abstracts of Beijerinck Centennial Microbial Physiology and Gene Regulation: Emerging Principles and Applications, 10-14 December 1995 The Hague, The Netherlands. Under the auspices of the Netherlands Foundation for Biotechnology.

  4. PREFACE: Physics approaches to protein interactions and gene regulation Physics approaches to protein interactions and gene regulation

    Science.gov (United States)

    Nussinov, Ruth; Panchenko, Anna R.; Przytycka, Teresa

    2011-06-01

    networks have been identified, including scale free distribution of the vertex degree, network motifs, and modularity, to name a few. These studies of network organization require the network to be as complete as possible, which given the limitations of experimental techniques is not currently the case. Therefore, experimental procedures for detecting biomolecular interactions should be complemented by computational approaches. The paper by Lees et al provides a review of computational methods, integrating multiple independent sources of data to infer physical and functional protein-protein interaction networks. One of the important aspects of protein interactions that should be accounted for in the prediction of protein interaction networks is that many proteins are composed of distinct domains. Protein domains may mediate protein interactions while proteins and their interaction networks may gain complexity through gene duplication and expansion of existing domain architectures via domain rearrangements. The latter mechanisms have been explored in detail in the paper by Cohen-Gihon et al. Protein-protein interactions are not the only component of the cell's interactome. Regulation of cell activity can be achieved at the level of transcription and involve a transcription factor—DNA binding which typically requires recognition of a specific DNA sequence motif. Chip-Chip and the more recent Chip-Seq technologies allow in vivo identification of DNA binding sites and, together with novel in vitro approaches, provide data necessary for deciphering the corresponding binding motifs. Such information, complemented by structures of protein-DNA complexes and knowledge of the differences in binding sites among homologs, opens the door to constructing predictive binding models. The paper by Persikov and Singh provides an example of such a model in the Cys2His2 zinc finger family. Recent studies have indicated that the presence of such binding motifs is, however, neither necessary

  5. Are the perceptual and decision-making components of agility trainable? A preliminary investigation.

    Science.gov (United States)

    Serpell, Benjamin G; Young, Warren B; Ford, Matthew

    2011-05-01

    Agility is an open motor skill; requiring change of direction speed (CODS) and perceptual and decision-making ability. The aim of this study was to determine whether the perceptual and decision-making component of agility can be trained. Fifteen rugby league players were tested on a sport-specific reactive agility test (RAT) and a CODS test. Players were then allocated to a training group (n = 8) or a nontraining group (n = 7). The training group underwent 3 weeks of reactive agility training that was designed to enhance perceptual and decision-making ability. After 3 weeks, all players were tested again. The training group's mean reactive agility time was 1.92 ± 0.17 seconds preintervention and 1.66 ± 0.14 seconds postintervention. The nontraining group's mean reactive agility time was 1.89 ± 0.16 and 1.87 ± 0.15 seconds, respectively. Mean CODS time for the training group was 1.64 ± 0.15 seconds preintervention and 1.66 ± 0.14 seconds postintervention. The nontraining group's mean CODS time was 1.61 ± 0.12 and 1.62 ± 0.12 seconds. Mean perception and response time for the training group, measured on the RAT, was 0.33 ± 0.33 seconds preintervention and 0.04 ± 0.22 seconds postintervention. The nontraining group's values were 0.34 ± 0.20 and 0.27 ± 0.28 seconds, respectively (results are ±σ). Differences in mean reactive agility time and perception and response time from pre to postintervention for the training group were statistically significant, as were differences in those values between the training and nontraining group post intervention. All other comparisons were not. Results from this study suggest that the perceptual and decision-making components of agility are trainable. Coaches should incorporate some open motor skills training in their programs when training agility.

  6. Integration of Genome Scale Metabolic Networks and Gene Regulation of Metabolic Enzymes With Physiologically Based Pharmacokinetics

    Science.gov (United States)

    Maldonado, Elaina M.; Leoncikas, Vytautas; Fisher, Ciarán P.; Moore, J. Bernadette; Plant, Nick J.

    2017-01-01

    The scope of physiologically based pharmacokinetic (PBPK) modeling can be expanded by assimilation of the mechanistic models of intracellular processes from systems biology field. The genome scale metabolic networks (GSMNs) represent a whole set of metabolic enzymes expressed in human tissues. Dynamic models of the gene regulation of key drug metabolism enzymes are available. Here, we introduce GSMNs and review ongoing work on integration of PBPK, GSMNs, and metabolic gene regulation. We demonstrate example models. PMID:28782239

  7. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  8. Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker's yeast

    NARCIS (Netherlands)

    van Eunen, Karen; Bouwman, Jildau; Lindenbergh, Alexander; Westerhoff, Hans V.; Bakker, Barbara M.

    2009-01-01

    Time-dependent regulation analysis is a new methodology that allows us to unravel, both quantitatively and dynamically, how and when functional changes in the cell are brought about by the interplay of gene expression and metabolism. In this first experimental implementation, we dissect the initial

  9. Differential regulation of the period genes in striatal regions following cocaine exposure.

    Science.gov (United States)

    Falcon, Edgardo; Ozburn, Angela; Mukherjee, Shibani; Roybal, Kole; McClung, Colleen A

    2013-01-01

    Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc) and Caudate Putamen (CP), regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per) genes and Neuronal PAS Domain Protein 2 (Npas2) are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput)) protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2.

  10. Differential regulation of the period genes in striatal regions following cocaine exposure.

    Directory of Open Access Journals (Sweden)

    Edgardo Falcon

    Full Text Available Several studies have suggested that disruptions in circadian rhythms contribute to the pathophysiology of multiple psychiatric diseases, including drug addiction. In fact, a number of the genes involved in the regulation of circadian rhythms are also involved in modulating the reward value for drugs of abuse, like cocaine. Thus, we wanted to determine the effects of chronic cocaine on the expression of several circadian genes in the Nucleus Accumbens (NAc and Caudate Putamen (CP, regions of the brain known to be involved in the behavioral responses to drugs of abuse. Moreover, we wanted to explore the mechanism by which these genes are regulated following cocaine exposure. Here we find that after repeated cocaine exposure, expression of the Period (Per genes and Neuronal PAS Domain Protein 2 (Npas2 are elevated, in a somewhat regionally selective fashion. Moreover, NPAS2 (but not CLOCK (Circadian Locomotor Output Cycles Kaput protein binding at Per gene promoters was enhanced following cocaine treatment. Mice lacking a functional Npas2 gene failed to exhibit any induction of Per gene expression after cocaine, suggesting that NPAS2 is necessary for this cocaine-induced regulation. Examination of Per gene and Npas2 expression over twenty-four hours identified changes in diurnal rhythmicity of these genes following chronic cocaine, which were regionally specific. Taken together, these studies point to selective disruptions in Per gene rhythmicity in striatial regions following chronic cocaine treatment, which are mediated primarily by NPAS2.

  11. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  12. Co-regulation of metabolic genes is better explained by flux coupling than by network distance.

    Directory of Open Access Journals (Sweden)

    Richard A Notebaart

    2008-01-01

    Full Text Available To what extent can modes of gene regulation be explained by systems-level properties of metabolic networks? Prior studies on co-regulation of metabolic genes have mainly focused on graph-theoretical features of metabolic networks and demonstrated a decreasing level of co-expression with increasing network distance, a naïve, but widely used, topological index. Others have suggested that static graph representations can poorly capture dynamic functional associations, e.g., in the form of dependence of metabolic fluxes across genes in the network. Here, we systematically tested the relative importance of metabolic flux coupling and network position on gene co-regulation, using a genome-scale metabolic model of Escherichia coli. After validating the computational method with empirical data on flux correlations, we confirm that genes coupled by their enzymatic fluxes not only show similar expression patterns, but also share transcriptional regulators and frequently reside in the same operon. In contrast, we demonstrate that network distance per se has relatively minor influence on gene co-regulation. Moreover, the type of flux coupling can explain refined properties of the regulatory network that are ignored by simple graph-theoretical indices. Our results underline the importance of studying functional states of cellular networks to define physiologically relevant associations between genes and should stimulate future developments of novel functional genomic tools.

  13. Transcriptional regulation of cardiac genes balance pro- and anti-hypertrophic mechanisms in hypertrophic cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Nina Gennebäck

    2012-06-01

    Full Text Available Hypertrophic cardiomyopathy (HCM is characterized by unexplained left ventricular hypertrophy. HCM is often hereditary, but our knowledge of the mechanisms leading from mutation to phenotype is incomplete. The transcriptional expression patterns in the myocar - dium of HCM patients may contribute to understanding the mechanisms that drive and stabilize the hypertrophy. Cardiac myectomies/biopsies from 8 patients with hypertrophic obstructive cardiomyopathy (HOCM and 5 controls were studied with whole genome Illumina microarray gene expression (detecting 18 189 mRNA. When comparing HOCM myocardium to controls, there was significant transcriptional down-regulation of the MYH6, EGR1, APOB and FOS genes, and significant transcriptional up-regulation of the ACE2, JAK2, NPPA (ANP, APOA1 and HDAC5 genes. The transcriptional regulation revealed both pro- and anti-hypertrophic mechanisms. The pro-hypertrophic response was explained by the transcriptional down-regulation of MYH6, indicating that the switch to the fetal gene program is maintained, and the transcriptional up-regulation of JAK2 in the JAK-STAT pathway. The anti-hypertrophic response was seen as a transcriptional down-regulation of the immediate early genes (IEGs, FOS and EGR1, and a transcriptional up-regulation of ACE2 and HDAC5. This can be interpreted as a transcriptional endogenous protection system in the heart of the HOCM patients, neither growing nor suppressing the already hypertrophic myocardium.

  14. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    Science.gov (United States)

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-02-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  15. The importance of topoisomerases for chromatin regulated genes

    DEFF Research Database (Denmark)

    Fredsøe, Jacob Christian; Pedersen, Jakob Madsen; Rødgaard, Morten Terpager

    2013-01-01

    DNA topoisomerases are enzymes, which function to relieve torsional stress in the DNA helix by introducing transient breaks into the DNA molecule. By use of Saccharomyces cerevisiae and microarray technology we have previously shown that topoisomerases are required for the activation of chromatin...... topoisomerases for optimal activation, but in contrast to the PHO5 gene, topoisomerases are not required for chromatin remodeling of the GAL1/10 promoter region, indicating a different role of the enzymes. We are currently performing a detailed investigation of the GAL genes to elucidate the precise role...

  16. Major genes regulating total serum immunoglobulin E levels in families with asthma

    NARCIS (Netherlands)

    Postma, DS; Howard, TD; Koppelman, GH; Zheng, SL; Stine, OC; Bleecker, ER; Meyers, DA

    2000-01-01

    Immunoglobulin E (IgE) has a major role in the pathogenesis of allergic disorders and asthma. Previous data from 92 families, each identified through a proband with asthma, showed evidence for two major genes regulating total serum IgE levels. One of these genes mapped to 5q31-33. In the current

  17. Estrogen regulates the expression of cathepsin E-A-like gene via ...

    Indian Academy of Sciences (India)

    徐春林

    by estrogen, and the regulative effect was predominantly mediated via ER-β in chicken liver. Keywords: Estrogen ... the RNA-seq technique to investigate the mechanism of hepatic lipid metabolism (Li et al. 2015). ... To clone the cathepsin E-A-like gene and investigate the effect of estrogen on expression of the gene, a total ...

  18. Honey Bee Aggression Supports a Link Between Gene Regulation and Behavioral Evolution

    Science.gov (United States)

    A prominent theory holds that animal phenotypes arise by evolutionary changes in the regulation of gene expression. Emerging from studies of animal development, evidence for this theory consists largely of differences in temporal or spatial patterns of gene expression that are related to morphologi...

  19. Conservation of the response regulator gene gacA in Pseudomonas species

    NARCIS (Netherlands)

    Souza, J.T.; Mazzola, M.; Raaijmakers, J.M.

    2003-01-01

    The response regulator gene gacA influences the production of several secondary metabolites in both pathogenic and beneficial Pseudomonas spp. In this study, we developed primers and a probe for the gacA gene of Pseudomonas species and sequenced a 425 bp fragment of gacA from ten Pseudomonas strains

  20. TET-catalyzed 5-hydroxymethylcytosine regulates gene expression in differentiating colonocytes and colon cancer

    Science.gov (United States)

    Chapman, Christopher G.; Mariani, Christopher J.; Wu, Feng; Meckel, Katherine; Butun, Fatma; Chuang, Alice; Madzo, Jozef; Bissonette, Marc B.; Kwon, John H.; Godley, Lucy A.

    2015-01-01

    The formation of differentiated cell types from pluripotent progenitors involves epigenetic regulation of gene expression. DNA hydroxymethylation results from the enzymatic oxidation of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by the ten-eleven translocation (TET) 5-mC dioxygenase enzymes. Previous work has mapped changes in 5-mC during differentiation of intestinal stem cells. However, whether or not 5-hmC regulates colonocyte differentiation is unknown. Here we show that 5-hmC regulates gene expression during colonocyte differentiation and controls gene expression in human colon cancers. Genome-wide profiling of 5-hmC during in vitro colonic differentiation demonstrated that 5-hmC is gained at highly expressed and induced genes and is associated with intestinal transcription factor binding sites, including those for HNF4A and CDX2. TET1 induction occurred during differentiation, and TET1 knockdown altered gene expression and inhibited barrier formation of colonocytes. We find that the 5-hmC distribution in primary human colonocytes parallels the distribution found in differentiated cells in vitro, and that gene-specific 5-hmC changes in human colon cancers are directly correlated with changes in gene expression. Our results support a model in which 5-hmC regulates differentiation of adult human intestine and 5-hmC alterations contribute to the disrupted gene expression in colon cancer. PMID:26631571

  1. TET-catalyzed 5-hydroxymethylcytosine regulates gene expression in differentiating colonocytes and colon cancer.

    Science.gov (United States)

    Chapman, Christopher G; Mariani, Christopher J; Wu, Feng; Meckel, Katherine; Butun, Fatma; Chuang, Alice; Madzo, Jozef; Bissonette, Marc B; Kwon, John H; Godley, Lucy A

    2015-12-03

    The formation of differentiated cell types from pluripotent progenitors involves epigenetic regulation of gene expression. DNA hydroxymethylation results from the enzymatic oxidation of 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC) by the ten-eleven translocation (TET) 5-mC dioxygenase enzymes. Previous work has mapped changes in 5-mC during differentiation of intestinal stem cells. However, whether or not 5-hmC regulates colonocyte differentiation is unknown. Here we show that 5-hmC regulates gene expression during colonocyte differentiation and controls gene expression in human colon cancers. Genome-wide profiling of 5-hmC during in vitro colonic differentiation demonstrated that 5-hmC is gained at highly expressed and induced genes and is associated with intestinal transcription factor binding sites, including those for HNF4A and CDX2. TET1 induction occurred during differentiation, and TET1 knockdown altered gene expression and inhibited barrier formation of colonocytes. We find that the 5-hmC distribution in primary human colonocytes parallels the distribution found in differentiated cells in vitro, and that gene-specific 5-hmC changes in human colon cancers are directly correlated with changes in gene expression. Our results support a model in which 5-hmC regulates differentiation of adult human intestine and 5-hmC alterations contribute to the disrupted gene expression in colon cancer.

  2. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-01-01

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  3. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  4. The vertebrate RCAN gene family: novel insights into evolution, structure and regulation.

    Directory of Open Access Journals (Sweden)

    Eva Serrano-Candelas

    Full Text Available Recently there has been much interest in the Regulators of Calcineurin (RCAN proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1. How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5' region of the genes, the existence of antisense transcripts (NAT associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies.

  5. Transcriptional regulation of the Drosophila catalase gene by the DRE/DREF system

    OpenAIRE

    Park, So Young; Kim, Young-Shin; Yang, Dong-Jin; Yoo, Mi-Ae

    2004-01-01

    Reactive oxygen species (ROS) cause oxidative stress and aging. The catalase gene is a key component of the cellular antioxidant defense network. However, the molecular mechanisms that regulate catalase gene expression are poorly understood. In this study, we have identified a DNA replication-related element (DRE; 5′-TATCGATA) in the 5′-flanking region of the Drosophila catalase gene. Gel mobility shift assays revealed that a previously identified factor called DREF (DRE- binding factor) bind...

  6. Nup98 regulation of histone methylation promotes normal gene expression and may drive leukemogenesis.

    Science.gov (United States)

    Sump, Bethany; Brickner, Jason H

    2017-11-15

    Nuclear pore proteins (Nups) interact with chromosomes to regulate gene expression and chromatin structure. A new study by Franks and colleagues (pp. 2222-2234) provides new mechanistic insight into the molecular basis by which Nup98 promotes gene activation in normal hematopoietic cells and how that process is altered by translocations to cause excess expression of developmental genes in leukemia. © 2017 Sump and Brickner; Published by Cold Spring Harbor Laboratory Press.

  7. An Effective Tri-Clustering Algorithm Combining Expression Data with Gene Regulation Information

    Directory of Open Access Journals (Sweden)

    Ao Li

    2009-04-01

    Full Text Available Motivation: Bi-clustering algorithms aim to identify sets of genes sharing similar expression patterns across a subset of conditions. However direct interpretation or prediction of gene regulatory mechanisms may be difficult as only gene expression data is used. Information about gene regulators may also be available, most commonly about which transcription factors may bind to the promoter region and thus control the expression level of a gene. Thus a method to integrate gene expression and gene regulation information is desirable for clustering and analyzing. Methods: By incorporating gene regulatory information with gene expression data, we define regulated expression values (REV as indicators of how a gene is regulated by a specific factor. Existing bi-clustering methods are extended to a three dimensional data space by developing a heuristic TRI-Clustering algorithm. An additional approach named Automatic Boundary Searching algorithm (ABS is introduced to automatically determine the boundary threshold. Results: Results based on incorporating ChIP-chip data representing transcription factor-gene interactions show that the algorithms are efficient and robust for detecting tri-clusters. Detailed analysis of the tri-cluster extracted from yeast sporulation REV data shows genes in this cluster exhibited significant differences during the middle and late stages. The implicated regulatory network was then reconstructed for further study of defined regulatory mechanisms. Topological and statistical analysis of this network demonstrated evidence of significant changes of TF activities during the different stages of yeast sporulation, and suggests this approach might be a general way to study regulatory networks undergoing transformations.

  8. Mendelian and non-Mendelian regulation of gene expression in maize.

    Directory of Open Access Journals (Sweden)

    Lin Li

    Full Text Available Transcriptome variation plays an important role in affecting the phenotype of an organism. However, an understanding of the underlying mechanisms regulating transcriptome variation in segregating populations is still largely unknown. We sought to assess and map variation in transcript abundance in maize shoot apices in the intermated B73 × Mo17 recombinant inbred line population. RNA-based sequencing (RNA-seq allowed for the detection and quantification of the transcript abundance derived from 28,603 genes. For a majority of these genes, the population mean, coefficient of variation, and segregation patterns could be predicted by the parental expression levels. Expression quantitative trait loci (eQTL mapping identified 30,774 eQTL including 96 trans-eQTL "hotspots," each of which regulates the expression of a large number of genes. Interestingly, genes regulated by a trans-eQTL hotspot tend to be enriched for a specific function or act in the same genetic pathway. Also, genomic structural variation appeared to contribute to cis-regulation of gene expression. Besides genes showing Mendelian inheritance in the RIL population, we also found genes whose expression level and variation in the progeny could not be predicted based on parental difference, indicating that non-Mendelian factors also contribute to expression variation. Specifically, we found 145 genes that show patterns of expression reminiscent of paramutation such that all the progeny had expression levels similar to one of the two parents. Furthermore, we identified another 210 genes that exhibited unexpected patterns of transcript presence/absence. Many of these genes are likely to be gene fragments resulting from transposition, and the presence/absence of their transcripts could influence expression levels of their ancestral syntenic genes. Overall, our results contribute to the identification of novel expression patterns and broaden the understanding of transcriptional variation in

  9. Identification of Plagl1/Zac1 binding sites and target genes establishes its role in the regulation of extracellular matrix genes and the imprinted gene network.

    Science.gov (United States)

    Varrault, Annie; Dantec, Christelle; Le Digarcher, Anne; Chotard, Laëtitia; Bilanges, Benoit; Parrinello, Hugues; Dubois, Emeric; Rialle, Stéphanie; Severac, Dany; Bouschet, Tristan; Journot, Laurent

    2017-10-13

    PLAGL1/ZAC1 undergoes parental genomic imprinting, is paternally expressed, and is a member of the imprinted gene network (IGN). It encodes a zinc finger transcription factor with anti-proliferative activity and is a candidate tumor suppressor gene on 6q24 whose expression is frequently lost in various neoplasms. Conversely, gain of PLAGL1 function is responsible for transient neonatal diabetes mellitus, a rare genetic disease that results from defective pancreas development. In the present work, we showed that Plagl1 up-regulation was not associated with DNA damage-induced cell cycle arrest. It was rather associated with physiological cell cycle exit that occurred with contact inhibition, growth factor withdrawal, or cell differentiation. To gain insights into Plagl1 mechanism of action, we identified Plagl1 target genes by combining chromatin immunoprecipitation and genome-wide transcriptomics in transfected cell lines. Plagl1-elicited gene regulation correlated with multiple binding to the proximal promoter region through a GC-rich motif. Plagl1 target genes included numerous genes involved in signaling, cell adhesion, and extracellular matrix composition, including collagens. Plagl1 targets also included 22% of the 409 genes that make up the IGN. Altogether, this work identified Plagl1 as a transcription factor that coordinated the regulation of a subset of IGN genes and controlled extracellular matrix composition. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Tight regulation of the intS gene of the KplE1 prophage: a new paradigm for integrase gene regulation.

    Directory of Open Access Journals (Sweden)

    Gaël Panis

    2010-10-01

    Full Text Available Temperate phages have the ability to maintain their genome in their host, a process called lysogeny. For most, passive replication of the phage genome relies on integration into the host's chromosome and becoming a prophage. Prophages remain silent in the absence of stress and replicate passively within their host genome. However, when stressful conditions occur, a prophage excises itself and resumes the viral cycle. Integration and excision of phage genomes are mediated by regulated site-specific recombination catalyzed by tyrosine and serine recombinases. In the KplE1 prophage, site-specific recombination is mediated by the IntS integrase and the TorI recombination directionality factor (RDF. We previously described a sub-family of temperate phages that is characterized by an unusual organization of the recombination module. Consequently, the attL recombination region overlaps with the integrase promoter, and the integrase and RDF genes do not share a common activated promoter upon lytic induction as in the lambda prophage. In this study, we show that the intS gene is tightly regulated by its own product as well as by the TorI RDF protein. In silico analysis revealed that overlap of the attL region with the integrase promoter is widely encountered in prophages present in prokaryotic genomes, suggesting a general occurrence of negatively autoregulated integrase genes. The prediction that these integrase genes are negatively autoregulated was biologically assessed by studying the regulation of several integrase genes from two different Escherichia coli strains. Our results suggest that the majority of tRNA-associated integrase genes in prokaryotic genomes could be autoregulated and that this might be correlated with the recombination efficiency as in KplE1. The consequences of this unprecedented regulation for excessive recombination are discussed.

  11. LCGbase: A Comprehensive Database for Lineage-Based Co-regulated Genes.

    Science.gov (United States)

    Wang, Dapeng; Zhang, Yubin; Fan, Zhonghua; Liu, Guiming; Yu, Jun

    2012-01-01

    Animal genes of different lineages, such as vertebrates and arthropods, are well-organized and blended into dynamic chromosomal structures that represent a primary regulatory mechanism for body development and cellular differentiation. The majority of genes in a genome are actually clustered, which are evolutionarily stable to different extents and biologically meaningful when evaluated among genomes within and across lineages. Until now, many questions concerning gene organization, such as what is the minimal number of genes in a cluster and what is the driving force leading to gene co-regulation, remain to be addressed. Here, we provide a user-friendly database-LCGbase (a comprehensive database for lineage-based co-regulated genes)-hosting information on evolutionary dynamics of gene clustering and ordering within animal kingdoms in two different lineages: vertebrates and arthropods. The database is constructed on a web-based Linux-Apache-MySQL-PHP framework and effective interactive user-inquiry service. Compared to other gene annotation databases with similar purposes, our database has three comprehensible advantages. First, our database is inclusive, including all high-quality genome assemblies of vertebrates and representative arthropod species. Second, it is human-centric since we map all gene clusters from other genomes in an order of lineage-ranks (such as primates, mammals, warm-blooded, and reptiles) onto human genome and start the database from well-defined gene pairs (a minimal cluster where the two adjacent genes are oriented as co-directional, convergent, and divergent pairs) to large gene clusters. Furthermore, users can search for any adjacent genes and their detailed annotations. Third, the database provides flexible parameter definitions, such as the distance of transcription start sites between two adjacent genes, which is extendable to genes that flanking the cluster across species. We also provide useful tools for sequence alignment, gene

  12. Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR alpha

    International Nuclear Information System (INIS)

    Genoux, Annelise; Dehondt, Helene; Helleboid-Chapman, Audrey; Duhem, Christian; Hum, Dean W.; Martin, Genevieve; Pennacchio, Len; Staels, Bart; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-01-01

    Apolipoprotein A5 has recently been identified as a crucial determinant of plasma triglyceride levels. Our results showed that RORa up-regulates human APOA5 but has no effect on mouse apoa5 promoter. These data suggest an additional important physiological role for RORa in the regulation of genes involved in plasma triglyceride homeostasis in human and probably in the development of atherosclerosis

  13. Jarid1b targets genes regulating development and is involved in neural differentiation

    DEFF Research Database (Denmark)

    Schmitz, Sandra U; Albert, Mareike; Malatesta, Martina

    2011-01-01

    H3K4 methylation is associated with active transcription and in combination with H3K27me3 thought to keep genes regulating development in a poised state. The contribution of enzymes regulating trimethylation of lysine 4 at histone 3 (H3K4me3) levels to embryonic stem cell (ESC) self-renewal and d...

  14. E2Fs regulate the expression of genes involved in differentiation, development, proliferation, and apoptosis

    DEFF Research Database (Denmark)

    Müller, H; Bracken, A P; Vernell, R

    2001-01-01

    The retinoblastoma protein (pRB) and its two relatives, p107 and p130, regulate development and cell proliferation in part by inhibiting the activity of E2F-regulated promoters. We have used high-density oligonucleotide arrays to identify genes in which expression changed in response to activation...

  15. Transcriptional Regulation of Apolipoprotein A5 Gene Expression by the Nuclear Receptor ROR alpha

    Energy Technology Data Exchange (ETDEWEB)

    Genoux, Annelise; Dehondt, Helene; Helleboid-Chapman, Audrey; Duhem, Christian; Hum, Dean W.; Martin, Genevieve; Pennacchio, Len; Staels, Bart; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2004-10-01

    Apolipoprotein A5 has recently been identified as a crucial determinant of plasma triglyceride levels. Our results showed that RORa up-regulates human APOA5 but has no effect on mouse apoa5 promoter. These data suggest an additional important physiological role for RORa in the regulation of genes involved in plasma triglyceride homeostasis in human and probably in the development of atherosclerosis

  16. Human nutrigenomics of gene regulation by dietary fatty acids

    NARCIS (Netherlands)

    Afman, L.A.; Muller, M.R.

    2012-01-01

    Nutrigenomics employs high-throughput genomics technologies to unravel how nutrients modulate gene and protein expression and ultimately influence cellular and organism metabolism. The most often-applied genomics technique so far is transcriptomics, which allows quantifying genome-wide changes in

  17. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Here, we report the identification of a novel submergence response (RS1) gene that is specifically induced in the Sub1A-mediated submergence tolerance response. Under submergence, RS1 was upregulated in M202 (Sub1A) but downregulated in M202 in RNA-seq and microarray assays. Expression analyses of various ...

  18. Genome Binding and Gene Regulation by Stem Cell Transcription Factors

    NARCIS (Netherlands)

    J.H. Brandsma (Johan)

    2016-01-01

    markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters

  19. Early gene regulation of osteogenesis in embryonic stem cells

    KAUST Repository

    Kirkham, Glen R.

    2012-01-01

    The early gene regulatory networks (GRNs) that mediate stem cell differentiation are complex, and the underlying regulatory associations can be difficult to map accurately. In this study, the expression profiles of the genes Dlx5, Msx2 and Runx2 in mouse embryonic stem cells were monitored over a 48 hour period after exposure to the growth factors BMP2 and TGFβ1. Candidate GRNs of early osteogenesis were constructed based on published experimental findings and simulation results of Boolean and ordinary differential equation models were compared with our experimental data in order to test the validity of these models. Three gene regulatory networks were found to be consistent with the data, one of these networks exhibited sustained oscillation, a behaviour which is consistent with the general view of embryonic stem cell plasticity. The work cycle presented in this paper illustrates how mathematical modelling can be used to elucidate from gene expression profiles GRNs that are consistent with experimental data. © 2012 The Royal Society of Chemistry.

  20. Global profiling of alternative splicing events and gene expression regulated by hnRNPH/F.

    Directory of Open Access Journals (Sweden)

    Erming Wang

    Full Text Available In this study, we have investigated the global impact of heterogeneous nuclear Ribonuclear Protein (hnRNP H/F-mediated regulation of splicing events and gene expression in oligodendrocytes. We have performed a genome-wide transcriptomic analysis at the gene and exon levels in Oli-neu cells treated with siRNA that targets hnRNPH/F compared to untreated cells using Affymetrix Exon Array. Gene expression levels and regulated exons were identified with the GenoSplice EASANA algorithm. Bioinformatics analyses were performed to determine the structural properties of G tracts that correlate with the function of hnRNPH/F as enhancers vs. repressors of exon inclusion. Different types of alternatively spliced events are regulated by hnRNPH/F. Intronic G tracts density, length and proximity to the 5' splice site correlate with the hnRNPH/F enhancer function. Additionally, 6% of genes are differently expressed upon knock down of hnRNPH/F. Genes that regulate the transition of oligodendrocyte progenitor cells to oligodendrocytes are differentially expressed in hnRNPH/F depleted Oli-neu cells, resulting in a decrease of negative regulators and an increase of differentiation-inducing regulators. The changes were confirmed in developing oligodendrocytes in vivo. This is the first genome wide analysis of splicing events and gene expression regulated by hnRNPH/F in oligodendrocytes and the first report that hnRNPH/F regulate genes that are involved in the transition from oligodendrocyte progenitor cells to oligodendrocytes.

  1. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  2. Arabidopsis MAP Kinase 4 regulates gene expression via transcription factor release in the nucleus

    DEFF Research Database (Denmark)

    Qiu, Jin-Long; Fiil, Berthe Katrine; Petersen, Klaus

    2008-01-01

    Plant and animal perception of microbes through pathogen surveillance proteins leads to MAP kinase signalling and the expression of defence genes. However, little is known about how plant MAP kinases regulate specific gene expression. We report that, in the absence of pathogens, Arabidopsis MAP...... supported by the suppression of PAD3 expression in mpk4-wrky33 double mutant backgrounds. Our data establish direct links between MPK4 and innate immunity and provide an example of how a plant MAP kinase can regulate gene expression by releasing transcription factors in the nucleus upon activation....

  3. The DAF-7 TGF-β signaling pathway regulates chemosensory receptor gene expression in C. elegans

    OpenAIRE

    Nolan, Katherine M.; Sarafi-Reinach, Trina R.; Horne, Jennifer G.; Saffer, Adam M.; Sengupta, Piali

    2002-01-01

    Regulation of chemoreceptor gene expression in response to environmental or developmental cues provides a mechanism by which animals can alter their sensory responses. Here we demonstrate a role for the daf-7 TGF-β pathway in the regulation of expression of a subset of chemoreceptor genes in Caenorhabditis elegans. We describe a novel role of this pathway in maintaining receptor gene expression in the adult and show that the DAF-4 type II TGF-β receptor functions cell-autonomously to modulate...

  4. Identification of a novel submergence response gene regulated by ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-12-07

    -regulation of RS1 in M202(Sub1A)×Kitaake lead to weaken submergence tolerance. We hypothesize that RS1 may ..... Each data point represents the mean±SD of 3 independent biological replicates. The student's t-test was ...

  5. Unsaturated fatty acid: Metabolism, synthesis and gene regulation ...

    African Journals Online (AJOL)

    In both plants and animals, unsaturated fatty acids are considered to be essential membrane components. Also they play key roles in many cellular events. The synthesis and metabolism of unsaturated fatty acid are very complex processes, involving a variety of enzymes and regulated pathways. Most recently, research has ...

  6. Mechanisms for the environmental regulation of gene expression ...

    Indian Academy of Sciences (India)

    Unknown

    The environment can play a significant role in the production of phenotypes. However, the ... phenotype production by the environment should be considered a normal component of development and devel- opmental biology. .... Hormonal regulation mediates the environmentally controlled pigmentation of Araschnia. In the.

  7. Hormonal regulation of gluconeogenic gene transcription in the liver

    Indian Academy of Sciences (India)

    Glucose homeostasis in mammals is achieved by the actions of counterregulatory hormones, namely insulin, glucagon and glucocorticoids. Glucose levels in the circulation are regulated by the liver, the metabolic centre which produces glucose when it is scarce in the blood. This process is catalysed by two rate-limiting ...

  8. The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.

    Science.gov (United States)

    Zhao, D; Yu, Q; Chen, M; Ma, H

    2001-07-01

    The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.

  9. Intramacrophage Mycobacterium tuberculosis efflux pump gene regulation after rifampicin and verapamil exposure.

    Science.gov (United States)

    Canezin, Pedro Henrique; Caleffi-Ferracioli, Katiany Rizzieri; Scodro, Regiane Bertin de Lima; Siqueira, Vera Lúcia Dias; Pavan, Fernando Rogério; Barros, Isabella Letícia Esteves; Cardoso, Rosilene Fressatti

    2018-03-22

    Since resistance of Mycobacterium tuberculosis (Mtb) partially derives from efflux pumps (EPs) in the plasma membrane, the current study evaluates EPs in Mtb exposed to rifampicin in the presence of the EP inhibitor verapamil, within a macrophage environment. Human acute monocytic leukaemia cell line THP-1 was infected with Mtb H37Rv and exposed to rifampicin and verapamil alone and in combination for 24 and 72 h. After RNA extraction, quantitative PCR was carried out for 11 EP genes using SYBR green PCR master mix in the StepOne™ Real-Time PCR System. After 24 h of exposure to rifampicin, Mtb H37Rv showed that 10 EP genes were up-regulated when compared with the control. The rifampicin/verapamil combination induced down-regulation of 54.5% (6/11) of the EP genes. At 72 h, rifampicin exposure induced up-regulation of 10 EP genes and rifampicin/verapamil induced down-regulation of 8 EP genes, which suggests effective EP-inhibitory activity of verapamil against Mtb H37Rv in an intramacrophage environment. The current study demonstrated that rifampicin/verapamil caused down-regulation of several EP genes in Mtb inside the macrophage environment. In vivo trials may show that rifampicin/verapamil therapy could be of value in enhancing anti-TB treatment.

  10. Hormonal regulation of platypus Beta-lactoglobulin and monotreme lactation protein genes.

    Science.gov (United States)

    Enjapoori, Ashwantha Kumar; Lefèvre, Christophe M; Nicholas, Kevin R; Sharp, Julie A

    2017-02-01

    Endocrine regulation of milk protein gene expression in marsupials and eutherians is well studied. However, the evolution of this complex regulation that began with monotremes is unknown. Monotremes represent the oldest lineage of extant mammals and the endocrine regulation of lactation in these mammals has not been investigated. Here we characterised the proximal promoter and hormonal regulation of two platypus milk protein genes, Beta-lactoglobulin (BLG), a whey protein and monotreme lactation protein (MLP), a monotreme specific milk protein, using in vitro reporter assays and a bovine mammary epithelial cell line (BME-UV1). Insulin and dexamethasone alone provided partial induction of MLP, while the combination of insulin, dexamethasone and prolactin was required for maximal induction. Partial induction of BLG was achieved by insulin, dexamethasone and prolactin alone, with maximal induction using all three hormones. Platypus MLP and BLG core promoter regions comprised transcription factor binding sites (e.g. STAT5, NF-1 and C/EBPα) that were conserved in marsupial and eutherian lineages that regulate caseins and whey protein gene expression. Our analysis suggests that insulin, dexamethasone and/or prolactin alone can regulate the platypus MLP and BLG gene expression, unlike those of therian lineage. The induction of platypus milk protein genes by lactogenic hormones suggests they originated before the divergence of marsupial and eutherians. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Inter-chromosomal gene regulation in the mammalian cell nucleus.

    Science.gov (United States)

    de Laat, Wouter; Grosveld, Frank

    2007-10-01

    Cellular phenotypes can critically rely on mono-allelic gene expression. Recent studies suggest that in mammalian cells inter-chromosomal DNA interactions may mediate the decision which allele to activate and which to silence. Here, these findings are discussed in the context of knowledge on gene competition, chromatin dynamics, and nuclear organization. We argue that data obtained by 4C technology strongly support the idea that chromatin folds according to self-organizing principles. In this concept, the nuclear positioning of a given locus is probabilistic as it also depends on the properties of neighbouring DNA segments and, by extrapolation, the whole chromosome. The linear distribution of repetitive DNA sequences and of active and inactive DNA regions is important for the folding and relative positioning of chromosomes. This stochastic concept of nuclear organization predicts that tissue-specific interactions between two selected loci present on different chromosomes will be rare.

  12. An alternative pathway for gene regulation by Myc

    DEFF Research Database (Denmark)

    Peukert, K; Staller, P; Schneider, A

    1997-01-01

    The c-Myc protein activates transcription as part of a heteromeric complex with Max. However, Myc-transformed cells are characterized by loss of expression of several genes, suggesting that Myc may also repress gene expression. Two-hybrid cloning identifies a novel POZ domain Zn finger protein (Miz......-1; Myc-interacting Zn finger protein-1) that specifically interacts with Myc, but not with Max or USF. Miz-1 binds to start sites of the adenovirus major late and cyclin D1 promoters and activates transcription from both promoters. Miz-1 has a potent growth arrest function. Binding of Myc to Miz-1...... requires the helix-loop-helix domain of Myc and a short amphipathic helix located in the carboxy-terminus of Miz-1. Expression of Myc inhibits transactivation, overcomes Miz-1-induced growth arrest and renders Miz-1 insoluble in vivo. These processes depend on Myc and Miz-1 association and on the integrity...

  13. Uncovering transcriptional regulation of glycerol metabolism in Aspergilli through genome-wide gene expression data anlysis

    DEFF Research Database (Denmark)

    Salazar, Margarita Pena; Vongsangnak, Wanwipa; Panagiotou, Gianni

    2009-01-01

    Glycerol is catabolized by a wide range of microorganisms including Aspergillus species. To identify the transcriptional regulation of glycerol metabolism in Aspergillus, we analyzed data from triplicate batch fermentations of three different Aspergilli (Aspergillus nidulans, Aspergillus oryzae...... and Aspergillus niger) with glucose and glycerol as carbon sources. Protein comparisons and cross-analysis with gene expression data of all three species resulted in the identification of 88 genes having a conserved response across the three Aspergilli. A promoter analysis of the up-regulated genes led....... niger. Our transcriptome analysis indicated that genes involved in ethanol, glycerol, fatty acid, amino acids and formate utilization are putatively regulated by Adr1 in Aspergilli as in Saccharomyces cerevisiae and this transcription factor therefore is likely to be cross-species conserved among...

  14. An integrated machine learning approach for predicting DosR-regulated genes in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Bacon Joanna

    2010-03-01

    Full Text Available Abstract Background DosR is an important regulator of the response to stress such as limited oxygen availability in Mycobacterium tuberculosis. Time course gene expression data enable us to dissect this response on the gene regulatory level. The mRNA expression profile of a regulator, however, is not necessarily a direct reflection of its activity. Knowing the transcription factor activity (TFA can be exploited to predict novel target genes regulated by the same transcription factor. Various approaches have been proposed to reconstruct TFAs from gene expression data. Most of them capture only a first-order approximation to the complex transcriptional processes by assuming linear gene responses and linear dynamics in TFA, or ignore the temporal information in data from such systems. Results In this paper, we approach the problem of inferring dynamic hidden TFAs using Gaussian processes (GP. We are able to model dynamic TFAs and to account for both linear and nonlinear gene responses. To test the validity of the proposed approach, we reconstruct the hidden TFA of p53, a tumour suppressor activated by DNA damage, using published time course gene expression data. Our reconstructed TFA is closer to the experimentally determined profile of p53 concentration than that from the original study. We then apply the model to time course gene expression data obtained from chemostat cultures of M. tuberculosis under reduced oxygen availability. After estimation of the TFA of DosR based on a number of known target genes using the GP model, we predict novel DosR-regulated genes: the parameters of the model are interpreted as relevance parameters indicating an existing functional relationship between TFA and gene expression. We further improve the prediction by integrating promoter sequence information in a logistic regression model. Apart from the documented DosR-regulated genes, our prediction yields ten novel genes under direct control of DosR. Conclusions

  15. Transcriptional regulation of the prolactin gene in turkeys

    OpenAIRE

    Kurima, Kiyoto

    1996-01-01

    Poor reproductive performance by turkey hens compared with chickens is partially due to the early cessation of egg production associated with the onset of incubation behavior. Prolactin (Prl) is involved in the induction and maintenance of incubation behavior in birds, and understanding the regulatory mechanism(s) of Prl gene expression will provide fundamental information to manipulate Prl production for better reproductive performance in turkey hens.

  16. Transcriptional regulation of the Kluyveromyces lactis beta-galactosidase gene.

    OpenAIRE

    Lacy, L R; Dickson, R C

    1981-01-01

    We examined the molecular basis for beta-D-galactosidase (EC 3.2.1.23) induction in the yeast Kluyveromyces lactis. The protein synthesis inhibitor anisomycin effectively blocked both protein synthesis and enzyme induction by lactose. Further, hybridization analysis with the cloned beta-galactosidase gene indicated coordinate increases in the concentration of beta-galactosidase messenger ribonucleic acid and enzyme activity. The half-life of beta-galactosidase messenger ribonucleic acid was t...

  17. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    Science.gov (United States)

    2004-04-01

    subclones used the Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific...a P-element inserted in the first intron of the Nf1 gene. Both mutations abolish NF1 protein production (The et al., 1997). The k33 wild type...injections. The location of the six point mutations that were generated and successfully introduced into transgenic flies is diagrammed in Figure 1A

  18. Regulation of inflammatory gene expression in PBMCs by immunostimulatory botanicals.

    Directory of Open Access Journals (Sweden)

    Karen L Denzler

    Full Text Available Many hundreds of botanicals are used in complementary and alternative medicine for therapeutic use as antimicrobials and immune stimulators. While there exists many centuries of anecdotal evidence and few clinical studies on the activity and efficacy of these botanicals, limited scientific evidence exists on the ability of these botanicals to modulate the immune and inflammatory responses. Using botanogenomics (or herbogenomics, this study provides novel insight into inflammatory genes which are induced in peripheral blood mononuclear cells following treatment with immunomodulatory botanical extracts. These results may suggest putative genes involved in the physiological responses thought to occur following administration of these botanical extracts. Using extracts from immunostimulatory herbs (Astragalus membranaceus, Sambucus cerulea, Andrographis paniculata and an immunosuppressive herb (Urtica dioica, the data presented supports previous cytokine studies on these herbs as well as identifying additional genes which may be involved in immune cell activation and migration and various inflammatory responses, including wound healing, angiogenesis, and blood pressure modulation. Additionally, we report the presence of lipopolysaccharide in medicinally prepared extracts of these herbs which is theorized to be a natural and active component of the immunostimulatory herbal extracts. The data presented provides a more extensive picture on how these herbs may be mediating their biological effects on the immune and inflammatory responses.

  19. Trans gene regulation in adaptive evolution: a genetic algorithm model.

    Science.gov (United States)

    Behera, N; Nanjundiah, V

    1997-09-21

    This is a continuation of earlier studies on the evolution of infinite populations of haploid genotypes within a genetic algorithm framework. We had previously explored the evolutionary consequences of the existence of indeterminate-"plastic"-loci, where a plastic locus had a finite probability in each generation of functioning (being switched "on") or not functioning (being switched "off"). The relative probabilities of the two outcomes were assigned on a stochastic basis. The present paper examines what happens when the transition probabilities are biased by the presence of regulatory genes. We find that under certain conditions regulatory genes can improve the adaptation of the population and speed up the rate of evolution (on occasion at the cost of lowering the degree of adaptation). Also, the existence of regulatory loci potentiates selection in favour of plasticity. There is a synergistic effect of regulatory genes on plastic alleles: the frequency of such alleles increases when regulatory loci are present. Thus, phenotypic selection alone can be a potentiating factor in a favour of better adaptation. Copyright 1997 Academic Press Limited.

  20. Androgen regulated genes in human prostate xenografts in mice: relation to BPH and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Harold D Love

    2009-12-01

    Full Text Available Benign prostatic hyperplasia (BPH and prostate carcinoma (CaP are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1 highly expressed in prostate, 2 had significant expression changes in response to androgens, and, 3 encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues.

  1. Link between the causative genes of holoprosencephaly: Zic2 directly regulates Tgif1 expression.

    Science.gov (United States)

    Ishiguro, Akira; Hatayama, Minoru; Otsuka, Maky I; Aruga, Jun

    2018-02-01

    One of the causal genes for holoprosencephaly (HPE) is ZIC2 (HPE5). It belongs to the zinc finger protein of the cerebellum (Zic) family of genes that share a C2H2-type zinc finger domain, similar to the GLI family of genes. In order to clarify the role of Zic2 in gene regulation, we searched for its direct target genes using chromatin immunoprecipitation (ChIP). We identified TGIF1 (HPE4), another holoprosencephaly-causative gene in humans. We identified Zic2-binding sites (ZBS) on the 5' flanking region of Tgif1 by in vitro DNA binding assays. ZBS were essential for Zic2-dependent transcriptional activation in reporter gene assays. Zic2 showed a higher affinity to ZBS than GLI-binding sequences. Zic2-binding to the cis-regulatory element near the Tgif1 promoter may be involved in the mechanism underlying forebrain development and incidences of HPE.

  2. Investigation of epigenetic gene regulation in Arabidopsis modulated by gamma radiation

    International Nuclear Information System (INIS)

    Woo, Hye Ryun; Kim, Jae Sung; Lee, Myung Jin; Lee, Dong Joon; Kim, Young Min; Jung, Joon Yong; Han, Wan Keun; Kang, Soo Jin

    2011-12-01

    To investigate epigenetic gene regulation in Arabidopsis modulated by gamma radiation, we examined the changes in DNA methylation and histone modification after gamma radiation and investigated the effects of gamma radiation on epigenetic information and gene expression. We have selected 14 genes with changes in DNA methylation by gamma radiation, analyzed the changes of histone modification in the selected genes to reveal the relationship between DNA methylation and histone modification by gamma radiation. We have also analyzed the effects of gamma radiation on gene expression to investigate the relationship between epigenetic information and gene expression by gamma radiation. The results will be useful to reveal the effects of gamma radiation on DNA methylation, histone modification and gene expression. We anticipate that the information generated in this proposal will help to find out the mechanism underlying the changes in epigenetic information by gamma radiation

  3. RNA Binding Proteins Posttranscriptionally Regulate Genes Involved In Oncogenesis

    Science.gov (United States)

    2010-06-01

    lysed in triple- detergent RIPA buffer with protease inhibitor cocktail (Roche, Pleasanton, CA). For nuclear and cytoplasmic fractionation, the NE-PER kit...Posttranscriptional regulation of IL-13 in T cells: role of the RNA-binding protein HuR. The Journal of allergy and clinical immunology 2008, 121(4):853-859...and western blot analysis. Western analysis was performed as described previously.12 For detection of VEGFα and TSP1 from tumors, triple- detergent

  4. Dynamics of chromatin accessibility and gene regulation by MADS-domain transcription factors in flower development.

    Science.gov (United States)

    Pajoro, Alice; Madrigal, Pedro; Muiño, Jose M; Matus, José Tomás; Jin, Jian; Mecchia, Martin A; Debernardi, Juan M; Palatnik, Javier F; Balazadeh, Salma; Arif, Muhammad; Ó'Maoiléidigh, Diarmuid S; Wellmer, Frank; Krajewski, Pawel; Riechmann, José-Luis; Angenent, Gerco C; Kaufmann, Kerstin

    2014-03-03

    Development of eukaryotic organisms is controlled by transcription factors that trigger specific and global changes in gene expression programs. In plants, MADS-domain transcription factors act as master regulators of developmental switches and organ specification. However, the mechanisms by which these factors dynamically regulate the expression of their target genes at different developmental stages are still poorly understood. We characterized the relationship of chromatin accessibility, gene expression, and DNA binding of two MADS-domain proteins at different stages of Arabidopsis flower development. Dynamic changes in APETALA1 and SEPALLATA3 DNA binding correlated with changes in gene expression, and many of the target genes could be associated with the developmental stage in which they are transcriptionally controlled. We also observe dynamic changes in chromatin accessibility during flower development. Remarkably, DNA binding of APETALA1 and SEPALLATA3 is largely independent of the accessibility status of their binding regions and it can precede increases in DNA accessibility. These results suggest that APETALA1 and SEPALLATA3 may modulate chromatin accessibility, thereby facilitating access of other transcriptional regulators to their target genes. Our findings indicate that different homeotic factors regulate partly overlapping, yet also distinctive sets of target genes in a partly stage-specific fashion. By combining the information from DNA-binding and gene expression data, we are able to propose models of stage-specific regulatory interactions, thereby addressing dynamics of regulatory networks throughout flower development. Furthermore, MADS-domain TFs may regulate gene expression by alternative strategies, one of which is modulation of chromatin accessibility.

  5. Reverse-engineering of gene networks for regulating early blood development from single-cell measurements.

    Science.gov (United States)

    Wei, Jiangyong; Hu, Xiaohua; Zou, Xiufen; Tian, Tianhai

    2017-12-28

    Recent advances in omics technologies have raised great opportunities to study large-scale regulatory networks inside the cell. In addition, single-cell experiments have measured the gene and protein activities in a large number of cells under the same experimental conditions. However, a significant challenge in computational biology and bioinformatics is how to derive quantitative information from the single-cell observations and how to develop sophisticated mathematical models to describe the dynamic properties of regulatory networks using the derived quantitative information. This work designs an integrated approach to reverse-engineer gene networks for regulating early blood development based on singel-cell experimental observations. The wanderlust algorithm is initially used to develop the pseudo-trajectory for the activities of a number of genes. Since the gene expression data in the developed pseudo-trajectory show large fluctuations, we then use Gaussian process regression methods to smooth the gene express data in order to obtain pseudo-trajectories with much less fluctuations. The proposed integrated framework consists of both bioinformatics algorithms to reconstruct the regulatory network and mathematical models using differential equations to describe the dynamics of gene expression. The developed approach is applied to study the network regulating early blood cell development. A graphic model is constructed for a regulatory network with forty genes and a dynamic model using differential equations is developed for a network of nine genes. Numerical results suggests that the proposed model is able to match experimental data very well. We also examine the networks with more regulatory relations and numerical results show that more regulations may exist. We test the possibility of auto-regulation but numerical simulations do not support the positive auto-regulation. In addition, robustness is used as an importantly additional criterion to select candidate

  6. Growth hormone regulation of rat liver gene expression assessed by SSH and microarray.

    Science.gov (United States)

    Gardmo, Cissi; Swerdlow, Harold; Mode, Agneta

    2002-04-25

    The sexually dimorphic secretion of growth hormone (GH) that prevails in the rat leads to a sex-differentiated expression of GH target genes, particularly in the liver. We have used subtractive suppressive hybridization (SSH) to search for new target genes induced by the female-characteristic, near continuous, pattern of GH secretion. Microarrays and dot-blot hybridizations were used in an attempt to confirm differential ratios of expression of obtained SSH clones. Out of 173 unique SSH clones, 41 could be verified as differentially expressed. Among these, we identified 17 known genes not previously recognized as differentially regulated by the sex-specific GH pattern. Additional SSH clones may also represent genes subjected to sex-specific GH regulation since only transcripts abundantly expressed could be verified. Optimized analyses, specific for each gene, are required to fully characterize the degree of differential expression.

  7. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  8. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    their duplicate were found to be under less purifying selection. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to macromolecular complexes, whereas paralogs with different expression levels were enriched in terms associated...... new functions, or their gene products are in a dosage balance. Regulatory DNA elements - some of which are conserved across species and hence called conserved non-coding sequences (CNSs) - that control expression of duplicated genes are thus under similar purifying selection. In the present study, I...... have performed in-depth analyses of paralogous genes in Arabidopsis thaliana, their expression profile, their sequence conservation, and their functions, in order to investigate the relationship between gene expression and retention of paralogous genes. Paralogs with lower expression than...

  9. Lineage-specific Evolutionary Histories and Regulation of Major Starch Metabolism Genes during Banana Ripening

    Directory of Open Access Journals (Sweden)

    Cyril Jourda

    2016-12-01

    Full Text Available Starch is the most widespread and abundant storage carbohydrate in plants. It is also a major feature of cultivated bananas as it accumulates to large amounts during banana fruit development before almost complete conversion to soluble sugars during ripening. Little is known about the structure of major gene families involved in banana starch metabolism and their evolution compared to other species. To identify genes involved in banana starch metabolism and investigate their evolutionary history, we analyzed six gene families playing a crucial role in plant starch biosynthesis and degradation: the ADP-glucose pyrophosphorylases (AGPases, starch synthases (SS, starch branching enzymes (SBE, debranching enzymes (DBE, -amylases (AMY and -amylases (BAM. Using comparative genomics and phylogenetic approaches, these genes were classified into families and sub-families and orthology relationships with functional genes in Eudicots and in grasses were identified. In addition to known ancestral duplications shaping starch metabolism gene families, independent evolution in banana and grasses also occurred through lineage-specific whole genome duplications for specific sub-families of AGPases, SS, SBE and BAM genes; and through gene-scale duplications for AMY genes. In particular, banana lineage duplications yielded a set of AGPases, SBE and BAM genes that were highly or specifically expressed in banana fruits. Gene expression analysis highlighted a complex transcriptional reprogramming of starch metabolism genes during ripening of banana fruits. A differential regulation of expression between banana gene duplicates was identified for SBE and BAM genes, suggesting that part of starch metabolism regulation in the fruit evolved in the banana lineage

  10. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    DEFF Research Database (Denmark)

    Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate...... genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value

  11. Estradiol and progesterone exhibit similar patterns of hepatic gene expression regulation in the bovine model.

    Directory of Open Access Journals (Sweden)

    Carla A Piccinato

    Full Text Available Female sex steroid hormones, estradiol-17β (E2-17β and progesterone (P4 regulate reproductive function and gene expression in a broad range of tissues. Given the central role of the liver in regulating homeostasis including steroid hormone metabolism, we sought to understand how E2-17β and P4 interact to affect global gene expression in liver. Ovariectomized cows (n = 8 were randomly assigned to 4 treatment groups applied in a replicated Latin Square design: 1 No hormone supplementation, 2 E2-17β treatment (ear implant, 3 P4 treatment (intravaginal inserts, and 4 E2-17β combined with P4. After 14 d of treatment, liver biopsies were collected, allowing 28 d intervals between periods. Changes in gene expression in the liver biopsies were monitored using bovine-specific arrays. Treatment with E2-17β altered expression of 479 genes, P4 472 genes, and combined treatment significantly altered expression of 468 genes. In total, 578 genes exhibited altered expression including a remarkable number (346 genes that responded similarly to E2-17β, P4, or combined treatment. Additional evidence for similar gene expression actions of E2-17ß and/or P4 were: principal component analysis placed almost every treatment array at a substantial distance from controls; Venn diagrams indicated overall treatment effects for most regulated genes; clustering analysis indicated the two major clusters had all treatments up-regulating (172 genes or down-regulating (173 genes expression. Thus, unexpectedly, common biological pathways were regulated by E2-17β and/or P4 in liver. This indicates that the mechanism of action of these steroid hormones in the liver might be either indirect or might occur through non-genomic pathways. This unusual pattern of gene expression in response to steroid hormones is consistent with the idea that there are classical and non-classical tissue-specific responses to steroid hormone actions. Future studies are needed to elucidate

  12. Global identification of genes regulated by estrogen signaling and demethylation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Putnik, Milica; Zhao, Chunyan; Gustafsson, Jan-Åke; Dahlman-Wright, Karin

    2012-01-01

    Highlights: ► Estrogen signaling and demethylation can both control gene expression in breast cancers. ► Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. ► 137 genes are influenced by both 17β-estradiol and demethylating agent 5-aza-2′-deoxycytidine. ► A set of genes is identified as targets of both estrogen signaling and demethylation. ► There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between these two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17β-estradiol (E2) and a demethylating agent 5-aza-2′-deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment

  13. Profiling of Hepatocellular Carcinoma Cell Cycle Regulating Genes Targeted by Calycosin

    OpenAIRE

    Zhang, Dongqing; Wang, Shufang; Zhu, Liguo; Tian, Yaping; Wang, Haibao; Zhuang, Yuan; Li, Yu; Wang, Deqing

    2013-01-01

    We cocultured calycosin with human hepatocellular carcinoma cell line (BEL-7402) to investigate the effect on cell proliferation. Calycosin can markedly block the cell growth in G1 phase (P < 0.01) on the IC50 concentration. There were seventeen genes involved in cell-cycle regulation showing differentially expressed in treated cells detected by gene chip. Eight genes were upregulated and nine genes were downregulated. Downregulated TFDP-1, CDKN2D, and SPK2 and upregulated CDC2 and CCNB1 migh...

  14. Differential regulation of the foraging gene associated with task behaviors in harvester ants

    Directory of Open Access Journals (Sweden)

    Kleeman Lindsay

    2011-08-01

    Full Text Available Abstract Background The division of labor in social insect colonies involves transitions by workers from one task to another and is critical to the organization and ecological success of colonies. The differential regulation of genetic pathways is likely to be a key mechanism involved in plasticity of social insect task behavior. One of the few pathways implicated in social organization involves the cGMP-activated protein kinase gene, foraging, a gene associated with foraging behavior in social insect species. The association of the foraging gene with behavior is conserved across diverse species, but the observed expression patterns and proposed functions of this gene vary across taxa. We compared the protein sequence of foraging across social insects and explored whether the differential regulation of this gene is associated with task behaviors in the harvester ant, Pogonomyrmex occidentalis. Results Phylogenetic analysis of the coding region of the foraging gene reveals considerable conservation in protein sequence across insects, particularly among hymenopteran species. The absence of amino acid variation in key active and binding sites suggests that differences in behaviors associated with this gene among species may be the result of changes in gene expression rather than gene divergence. Using real time qPCR analyses with a harvester ant ortholog to foraging (Pofor, we found that the brains of harvester ant foragers have a daily fluctuation in expression of foraging with mRNA levels peaking at midday. In contrast, young workers inside the nest have low levels of Pofor mRNA with no evidence of daily fluctuations in expression. As a result, the association of foraging expression with task behavior within a species changes depending on the time of day the individuals are sampled. Conclusions The amino acid protein sequence of foraging is highly conserved across social insects. Differences in foraging behaviors associated with this gene among

  15. Cognitive function affects trainability for physical performance in exercise intervention among older adults with mild cognitive impairment.

    Science.gov (United States)

    Uemura, Kazuki; Shimada, Hiroyuki; Makizako, Hyuma; Doi, Takehiko; Yoshida, Daisuke; Tsutsumimoto, Kota; Anan, Yuya; Suzuki, Takao

    2013-01-01

    Although much evidence supports the hypothesis that cognitive function and physical function are interrelated, it is unclear whether cognitive decline with mild cognitive impairment influences trainability of physical performance in exercise intervention. The purpose of this study was to examine the association between cognitive function at baseline and change in physical performance after exercise intervention in older adults with mild cognitive impairment. Forty-four older adults diagnosed with mild cognitive impairment based on the Peterson criteria (mean age 74.8 years) consented to and completed a 6-month twice weekly exercise intervention. The Timed Up and Go (TUG) test was used as a measure of physical performance. The Mini-Mental State Examination (MMSE), Trail Making Test Part B, Geriatric Depression Scale, baseline muscle strength of knee extension, and attendance rate of intervention, were measured as factors for predicting trainability. In the correlation analysis, the change in TUG showed modest correlations with attendance rate in the exercise program (r = -0.354, P = 0.027) and MMSE at baseline (r = -0.321, P = 0.034). A multiple regression analysis revealed that change in TUG was independently associated with attendance rate (β = -0.322, P = 0.026) and MMSE score (β = -0.295, P = 0.041), controlling for age and gender. General cognitive function was associated with improvements in physical performance after exercise intervention in subjects with mild cognitive impairment. Further research is needed to examine the effects of exercise programs designed to address cognitive obstacles in older adults with mild cognitive impairment.

  16. Ventral-stream-like shape representation: from pixel intensity values to trainable object-selective COSFIRE models

    Directory of Open Access Journals (Sweden)

    George eAzzopardi

    2014-07-01

    Full Text Available The remarkable abilities of the primate visual cortex have inspired the construction of computational models of some visual neurons. We propose a trainable hierarchical object recognition model, which we call S-COSFIRE (S stands for Shape and COSFIRE stands for Combination Of Shifted FIlter REsponses and use it to localize and recognize objects of interests embedded in complex scenes. It is inspired by the visual processing in the ventral stream (V1/V2 -> V4 -> TEO. Recognition and localization of objects embedded in complex scenes is important for many computer vision applications. Most existing methods require prior segmentation of the objects from the background which on its turn requires recognition. A S-COSFIRE filter is automatically configured to be selective for an arrangement of contour-based features that belong to a prototype shape specified by an example. The configuration comprises selecting relevant vertex detectors and determining certain blur and shift parameters. The response is computed as the weighted geometric mean of the blurred and shifted responses of the selected vertex detectors. S-COSFIRE filters share similar properties with some neurons in inferotemporal cortex, which provided inspiration for this work. We demonstrate the effectiveness of S-COSFIRE filters in two applications: letter and keyword spotting in handwritten manuscripts and object spotting in complex scenes for the computer vision system of a domestic robot. S-COSFIRE filters are effective to recognize and localize (deformable objects in images of complex scenes without requiring prior segmentation. They are versatile trainable shape detectors, conceptually simple and easy to implement. The presented hierarchical shape representation contributes to a better understanding of the brain and to more robust computer vision algorithms.

  17. Imaging and quantification of endothelial cell loss in eye bank prepared DMEK grafts using trainable segmentation software.

    Science.gov (United States)

    Jardine, Griffin J; Holiman, Jeffrey D; Stoeger, Christopher G; Chamberlain, Winston D

    2014-09-01

    To improve accuracy and efficiency in quantifying the endothelial cell loss (ECL) in eye bank preparation of corneal endothelial grafts. Eight cadaveric corneas were subjected to Descemet Membrane Endothelial Keratoplasty (DMEK) preparation. The endothelial surfaces were stained with a viability stain, calcein AM dye (CAM) and then captured by a digital camera. The ECL rates were quantified in these images by three separate readers using trainable segmentation, a plug-in feature from the imaging software, Fiji. Images were also analyzed by Adobe Photoshop for comparison. Mean times required to process the images were measured between the two modalities. The mean ECL (with standard deviation) as analyzed by Fiji was 22.5% (6.5%) and Adobe was 18.7% (7.0%; p = 0.04). The mean time required to process the images through the two different imaging methods was 19.9 min (7.5) for Fiji and 23.4 min (12.9) for Adobe (p = 0.17). Establishing an accurate, efficient and reproducible means of quantifying ECL in graft preparation and surgical techniques can provide insight to the safety, long-term potential of the graft tissues as well as provide a quality control measure for eye banks and surgeons. Trainable segmentation in Fiji software using CAM is a novel approach to measuring ECL that captured a statistically significantly higher percentage of ECL comparable to Adobe and was more accurate in standardized testing. Interestingly, ECL as determined using both methods in eye bank-prepared DMEK grafts exceeded 18% on average.

  18. Ventral-stream-like shape representation: from pixel intensity values to trainable object-selective COSFIRE models.

    Science.gov (United States)

    Azzopardi, George; Petkov, Nicolai

    2014-01-01

    The remarkable abilities of the primate visual system have inspired the construction of computational models of some visual neurons. We propose a trainable hierarchical object recognition model, which we call S-COSFIRE (S stands for Shape and COSFIRE stands for Combination Of Shifted FIlter REsponses) and use it to localize and recognize objects of interests embedded in complex scenes. It is inspired by the visual processing in the ventral stream (V1/V2 → V4 → TEO). Recognition and localization of objects embedded in complex scenes is important for many computer vision applications. Most existing methods require prior segmentation of the objects from the background which on its turn requires recognition. An S-COSFIRE filter is automatically configured to be selective for an arrangement of contour-based features that belong to a prototype shape specified by an example. The configuration comprises selecting relevant vertex detectors and determining certain blur and shift parameters. The response is computed as the weighted geometric mean of the blurred and shifted responses of the selected vertex detectors. S-COSFIRE filters share similar properties with some neurons in inferotemporal cortex, which provided inspiration for this work. We demonstrate the effectiveness of S-COSFIRE filters in two applications: letter and keyword spotting in handwritten manuscripts and object spotting in complex scenes for the computer vision system of a domestic robot. S-COSFIRE filters are effective to recognize and localize (deformable) objects in images of complex scenes without requiring prior segmentation. They are versatile trainable shape detectors, conceptually simple and easy to implement. The presented hierarchical shape representation contributes to a better understanding of the brain and to more robust computer vision algorithms.

  19. A role for the clock period circadian regulator 2 gene in regulating the clock gene network in human oral squamous cell carcinoma cells.

    Science.gov (United States)

    Ao, Yiran; Zhao, Qin; Yang, Kai; Zheng, Gang; Lv, Xiaoqing; Su, Xiaoli

    2018-04-01

    Clock genes are the core of the circadian rhythms in the human body and are important in regulating normal physiological functions. To date, research has indicated that the clock gene, period circadian clock 2 ( PER2 ), is downregulated in numerous types of cancer, and that it is associated with cancer occurrence and progression via the regulation of various downstream cell cycle genes. However, it remains unclear whether the decreased expression of PER2 influences the expression of other clock genes in cancer cells. In the present study, short hairpin RNA interference was used to knockdown PER2 effectively in human oral squamous cell carcinoma SCC15 cells. Quantitative polymerase chain reaction was used to assess the mRNA expression levels of various clock genes and revealed that, following the knockdown of PER2 in SCC15 cells, the mRNA expression levels of PER3 , brain and muscle ARNT-like 1, deleted in esophageal cancer (DEC)1, DEC2 , cryptochrome circadian clock ( CRY )2, timeless circadian clock, retinoic acid receptor-related orphan receptor-alpha and neuronal PAS domain protein 2 were significantly downregulated, while the mRNA expression levels of PER1 and nuclear receptor subfamily 1 group D member 1 were significantly upregulated. In addition, flow cytometric analysis demonstrated that proliferation was enhanced and apoptosis was reduced following PER2 knockdown in SCC15 cells (Pclock genes of the clock gene network in cancer cells. This is of great significance in elucidating the molecular function and tumor suppression mechanism of PER2 .

  20. Mouse ribosomal RNA genes contain multiple differentially regulated variants.

    Directory of Open Access Journals (Sweden)

    Hung Tseng

    2008-03-01

    Full Text Available Previous cytogenetic studies suggest that various rDNA chromosomal loci are not equally active in different cell types. Consistent with this variability, rDNA polymorphism is well documented in human and mouse. However, attempts to identify molecularly rDNA variant types, which are regulated individually (i.e., independent of other rDNA variants and tissue-specifically, have not been successful. We report here the molecular cloning and characterization of seven mouse rDNA variants (v-rDNA. The identification of these v-rDNAs was based on restriction fragment length polymorphisms (RFLPs, which are conserved among individuals and mouse strains. The total copy number of the identified variants is less than 100 and the copy number of each individual variant ranges from 4 to 15. Sequence analysis of the cloned v-rDNA identified variant-specific single nucleotide polymorphisms (SNPs in the transcribed region. These SNPs were used to develop a set of variant-specific PCR assays, which permitted analysis of the v-rDNAs' expression profiles in various tissues. These profiles show that three v-rDNAs are expressed in all tissues (constitutively active, two are expressed in some tissues (selectively active, and two are not expressed (silent. These expression profiles were observed in six individuals from three mouse strains, suggesting the pattern is not randomly determined. Thus, the mouse rDNA array likely consists of genetically distinct variants, and some are regulated tissue-specifically. Our results provide the first molecular evidence for cell-type-specific regulation of a subset of rDNA.

  1. Desmin-regulated lentiviral vectors for skeletal muscle gene transfer.

    Science.gov (United States)

    Talbot, Gillian E; Waddington, Simon N; Bales, Olivia; Tchen, Rose C; Antoniou, Michael N

    2010-03-01

    Lentiviral vectors (LVs) are highly attractive as a gene therapy agent as they are able to stably integrate their genomes in both dividing and nondividing cells and, in principle, provide long-term therapeutic benefit. However, their performance in skeletal muscle in adult animals has, to date, been disappointing. In order to gain clearer insight into their utility in this tissue type, we have conducted an extensive quantitative comparison of constitutive and muscle-specific promoter activities in skeletal muscle and nonmuscle systems following LV delivery in cell lines and neonatal mice. Our data show that LV delivery to hind leg skeletal muscle of neonatal mouse results in long-term transgene expression in adulthood. We find that the human desmin (DES) promoter/enhancer is the first muscle-specific control region to match the activity of the highly active constitutive human cytomegalovirus (hCMV) promoter/enhancer in skeletal muscle within a LV context both in vitro and in vivo. Furthermore, the DES promoter/enhancer provides six- to eightfold greater expression per viral copy than the muscle-specific human muscle creatine kinase (CKM) promoter/enhancer. DES also confers a more reproducible and tissue-specific transgene expression profile compared to CKM and is therefore a highly attractive regulatory element for use in muscle gene therapy vectors.

  2. Regulation of Gene Expression with Double-Stranded Phosphorothioate Oligonucleotides

    Science.gov (United States)

    Bielinska, Anna; Shivdasani, Ramesh A.; Zhang, Liquan; Nabel, Gary J.

    1990-11-01

    Alteration of gene transcription by inhibition of specific transcriptional regulatory proteins is necessary for determining how these factors participate in cellular differentiation. The functions of these proteins can be antagonized by several methods, each with specific limitations. Inhibition of sequence-specific DNA-binding proteins was achieved with double-stranded (ds) phosphorothioate oligonucleotides that contained octamer or kappaB consensus sequences. The phosphorothioate oligonucleotides specifically bound either octamer transcription factor or nuclear factor (NF)-kappaB. The modified oligonucleotides accumulated in cells more effectively than standard ds oligonucleotides and modulated gene expression in a specific manner. Octamer-dependent activation of a reporter plasmid or NF-kappaB-dependent activation of the human immunodeficiency virus (HIV) enhancer was inhibited when the appropriate phosphorothioate oligonucleotide was added to a transiently transfected B cell line. Addition of phosphorothioate oligonucleotides that contained the octamer consensus to Jurkat T leukemia cells inhibited interleukin-2 (IL-2) secretion to a degree similar to that observed with a mutated octamer site in the IL-2 enhancer. The ds phosphorothioate oligonucleotides probably compete for binding of specific transcription factors and may provide anti-viral, immunosuppressive, or other therapeutic effects.

  3. Co-ordinate regulation of lactate metabolism genes in yeast: the role of the lactate permease gene JEN1.

    Science.gov (United States)

    Lodi, T; Fontanesi, F; Guiard, B

    2002-01-01

    In the yeast Saccharomyces cerevisiae, the first step in lactate metabolism is its transport across the plasma membrane, a proton symport process mediated by the product of the gene JEN1. Under aerobic conditions, the expression of JEN1 is regulated by the carbon source: the gene is repressed by glucose and induced by non-fermentable substrates. JEN1 expression is also controlled by oxygen availability, but is unaffected by the absence of haem biosynthesis. JEN1 is negatively regulated by the repressors Mig1p and Mig2p, and requires Cat8p for full derepression. In this report we demonstrate that, in addition to these regulators, the Hap2/3/4/5 complex interacts specifically with a CAAT-box element in the JEN1 promoter, and acts to derepress JEN1 expression. We also provide evidence for transcriptional stimulation of JEN1 by the protein kinase Snf1p. Data are presented which provide a better understanding of the molecular mechanisms implicated in the co-regulation of genes involved in the metabolism of lactate.

  4. Orthologous transcription factors in bacteria have different functions and regulate different genes.

    Directory of Open Access Journals (Sweden)

    Morgan N Price

    2007-09-01

    Full Text Available Transcription factors (TFs form large paralogous gene families and have complex evolutionary histories. Here, we ask whether putative orthologs of TFs, from bidirectional best BLAST hits (BBHs, are evolutionary orthologs with conserved functions. We show that BBHs of TFs from distantly related bacteria are usually not evolutionary orthologs. Furthermore, the false orthologs usually respond to different signals and regulate distinct pathways, while the few BBHs that are evolutionary orthologs do have conserved functions. To test the conservation of regulatory interactions, we analyze expression patterns. We find that regulatory relationships between TFs and their regulated genes are usually not conserved for BBHs in Escherichia coli K12 and Bacillus subtilis. Even in the much more closely related bacteria Vibrio cholerae and Shewanella oneidensis MR-1, predicting regulation from E. coli BBHs has high error rates. Using gene-regulon correlations, we identify genes whose expression pattern differs between E. coli and S. oneidensis. Using literature searches and sequence analysis, we show that these changes in expression patterns reflect changes in gene regulation, even for evolutionary orthologs. We conclude that the evolution of bacterial regulation should be analyzed with phylogenetic trees, rather than BBHs, and that bacterial regulatory networks evolve more rapidly than previously thought.

  5. Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

    2015-12-08

    This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

  6. Inducible gene expression and environmentally regulated genes in lactic acid bacteria

    NARCIS (Netherlands)

    Kok, Jan

    1996-01-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their

  7. Transcriptional regulation of the Hansenula polymorpha GSH2 gene in the response to cadmium ion treatment

    Directory of Open Access Journals (Sweden)

    O. V. Blazhenko

    2014-02-01

    Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring­ a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.

  8. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  9. Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation.

    Science.gov (United States)

    Zabidi, Muhammad A; Arnold, Cosmas D; Schernhuber, Katharina; Pagani, Michaela; Rath, Martina; Frank, Olga; Stark, Alexander

    2015-02-26

    Gene transcription in animals involves the assembly of RNA polymerase II at core promoters and its cell-type-specific activation by enhancers that can be located more distally. However, how ubiquitous expression of housekeeping genes is achieved has been less clear. In particular, it is unknown whether ubiquitously active enhancers exist and how developmental and housekeeping gene regulation is separated. An attractive hypothesis is that different core promoters might exhibit an intrinsic specificity to certain enhancers. This is conceivable, as various core promoter sequence elements are differentially distributed between genes of different functions, including elements that are predominantly found at either developmentally regulated or at housekeeping genes. Here we show that thousands of enhancers in Drosophila melanogaster S2 and ovarian somatic cells (OSCs) exhibit a marked specificity to one of two core promoters--one derived from a ubiquitously expressed ribosomal protein gene and another from a developmentally regulated transcription factor--and confirm the existence of these two classes for five additional core promoters from genes with diverse functions. Housekeeping enhancers are active across the two cell types, while developmental enhancers exhibit strong cell-type specificity. Both enhancer classes differ in their genomic distribution, the functions of neighbouring genes, and the core promoter elements of these neighbouring genes. In addition, we identify two transcription factors--Dref and Trl--that bind and activate housekeeping versus developmental enhancers, respectively. Our results provide evidence for a sequence-encoded enhancer-core-promoter specificity that separates developmental and housekeeping gene regulatory programs for thousands of enhancers and their target genes across the entire genome.

  10. Lateral Thinking: How Histone Modifications Regulate Gene Expression.

    Science.gov (United States)

    Lawrence, Moyra; Daujat, Sylvain; Schneider, Robert

    2016-01-01

    The DNA of each cell is wrapped around histone octamers, forming so-called 'nucleosomal core particles'. These histone proteins have tails that project from the nucleosome and many residues in these tails can be post-translationally modified, influencing all DNA-based processes, including chromatin compaction, nucleosome dynamics, and transcription. In contrast to those present in histone tails, modifications in the core regions of the histones had remained largely uncharacterised until recently, when some of these modifications began to be analysed in detail. Overall, recent work has shown that histone core modifications can not only directly regulate transcription, but also influence processes such as DNA repair, replication, stemness, and changes in cell state. In this review, we focus on the most recent developments in our understanding of histone modifications, particularly those on the lateral surface of the nucleosome. This region is in direct contact with the DNA and is formed by the histone cores. We suggest that these lateral surface modifications represent a key insight into chromatin regulation in the cell. Therefore, lateral surface modifications form a key area of interest and a focal point of ongoing study in epigenetics. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. A compendium of antibiotic-induced transcription profiles reveals broad regulation of Pasteurella multocida virulence genes.

    Science.gov (United States)

    Melnikow, E; Schoenfeld, C; Spehr, V; Warrass, R; Gunkel, N; Duszenko, M; Selzer, P M; Ullrich, H J

    2008-10-15

    The transcriptional responses of Pasteurella multocida to eight antibiotics with known mode of actions (MoAs) and one novel antibiotic compound with an unknown MoA were collected to create a compendium of transcriptional profiles for MoA studies. At minimal inhibitory concentration the three bactericidal compounds enrofloxacin, cefquinome and the novel compound had a minor impact on gene regulation with approximately 1% of the P. multocida genome affected, whilst the bacteriostatic compounds florfenicol, tilmicosin, rifampin, trimethoprim and brodimoprim regulated 20% of the genome. Novobiocin was special in that it regulated 40% of all P. multocida genes. Regulation of target genes was observed for novobiocin, rifampin, florfenicol and tilmicosin and signature genes were identified for most antibiotics. The transcriptional profile induced by the novel compound was unrelated to the compendium profiles suggesting a new MoA. The transcription of many P. multocida virulence factors, particularly genes involved in capsule synthesis and export, LPS synthesis, competence, adherence and iron transport were altered in the presence of antibiotics. Virulence gene transcription was mainly negatively affected, however the opposite effect was also observed in the case of rifampin where the up-regulation of the tad locus involved in tight adherence was seen. Novobiocin and trimethoprim caused a marked reduction in the transcription of capsule genes, which correlated with a concomitant reduction of the capsular layer on the surface of P. multocida. The broad negative impact on virulence gene transcription supports the notion that the therapeutic effect of some antibiotics could be a combination of growth and virulence inhibition.

  12. Expression Profiles of Fsh-Regulated Ovarian Genes during Oogenesis in Coho Salmon

    Science.gov (United States)

    Guzmán, José M.; Luckenbach, J. Adam; Yamamoto, Yoji; Swanson, Penny

    2014-01-01

    The function of follicle-stimulating hormone (Fsh) during oogenesis in fishes is poorly understood. Using coho salmon as a fish model, we recently identified a suite of genes regulated by Fsh in vitro and involved in ovarian processes mostly unexplored in fishes, like cell proliferation, differentiation, survival or extracellular matrix (ECM) remodeling. To better understand the role of these Fsh-regulated genes during oocyte growth in fishes, we characterized their mRNA levels at discrete stages of the ovarian development in coho salmon. While most of the transcripts were expressed at low levels during primary growth (perinucleolus stage), high expression of genes associated with cell proliferation (pim1, pcna, and mcm4) and survival (ddit4l) was found in follicles at this stage. The transition to secondary oocyte growth (cortical alveolus and lipid droplet stage ovarian follicles) was characterized by a marked increase in the expression of genes related to cell survival (clu1, clu2 and ivns1abpa). Expression of genes associated with cell differentiation and growth (wt2l and adh8l), growth factor signaling (inha), steroidogenesis (cyp19a1a) and the ECM (col1a1, col1a2 and dcn) peaked in vitellogenic follicles, showing a strong and positive correlation with transcripts for fshr. Other genes regulated by Fsh and associated with ECM function (ctgf, wapl and fn1) and growth factor signaling (bmp16 and smad5l) peaked in maturing follicles, along with increases in steroidogenesis-related gene transcripts. In conclusion, ovarian genes regulated by Fsh showed marked differences in their expression patterns during oogenesis in coho salmon. Our results suggest that Fsh regulates different ovarian processes at specific stages of development, likely through interaction with other intra- or extra-ovarian factors. PMID:25485989

  13. Identification of genes differentially regulated in rat alveolar bone wound healing by subtractive hybridization.

    Science.gov (United States)

    Ohira, T; Myokai, F; Shiomi, N; Yamashiro, K; Yamamoto, T; Murayama, Y; Arai, H; Nishimura, F; Takashiba, S

    2004-07-01

    Periodontal healing requires the participation of regulatory molecules, cells, and scaffold or matrix. Here, we hypothesized that a certain set of genes is expressed in alveolar bone wound healing. Reciprocal subtraction gave 400 clones from the injured alveolar bone of Wistar rats. Identification of 34 genes and analysis of their expression in injured tissue revealed several clusters of unique gene regulation patterns, including the up-regulation at 1 wk of cytochrome c oxidase regulating electron transfer and energy metabolism, presumably occurring at the site of inflammation; up-regulation at 2.5 wks of pro-alpha-2 type I collagen involving the formation of a connective tissue structure; and up-regulation at 1 and 2 wks and down-regulation at 2.5 and 4 wks of ubiquitin carboxyl-terminal hydrolase l3 involving cell cycle, DNA repair, and stress response. The differential expression of genes may be associated with the processes of inflammation, wound contraction, and formation of a connective tissue structure.

  14. Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

    Science.gov (United States)

    Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

    2016-05-01

    On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

  15. Candida albicans response regulator gene SSK1 regulates a subset of genes whose functions are associated with cell wall biosynthesis and adaptation to oxidative stress.

    Science.gov (United States)

    Chauhan, Neeraj; Inglis, Diane; Roman, Elvira; Pla, Jesus; Li, Dongmei; Calera, Jose A; Calderone, Richard

    2003-10-01

    Ssk1p of Candida albicans is a putative response regulator protein of the Hog1 two-component signal transduction system. In Saccharomyces cerevisiae, the phosphorylation state of Ssk1p determines whether genes that promote the adaptation of cells to osmotic stress are activated. We have previously shown that C. albicans SSK1 does not complement the ssk1 mutant of S. cerevisiae and that the ssk1 mutant of C. albicans is not sensitive to sorbitol. In this study, we show that the C. albicans ssk1 mutant is sensitive to several oxidants, including hydrogen peroxide, t-butyl hydroperoxide, menadione, and potassium superoxide when each is incorporated in yeast extract-peptone-dextrose (YPD) agar medium. We used DNA microarrays to identify genes whose regulation is affected by the ssk1 mutation. RNA from mutant cells (strain CSSK21) grown in YPD medium for 3 h at 30 degrees C was reverse transcribed and then compared with similarly prepared RNA from wild-type cells (CAF2). We observed seven genes from mutant cells that were consistently up regulated (three-fold or greater compared to CAF2). In S. cerevisiae, three (AHP1, HSP12, and PYC2) of the seven genes that were up regulated provide cells with an adaptation function in response to oxidative stress; another gene (GPH1) is regulated under stress conditions by Hog1p. Three other genes that are up regulated encode a cell surface protein (FLO1), a mannosyl transferase (MNN4-4), and a putative two-component histidine kinase (CHK1) that regulates cell wall biosynthesis in C. albicans. Of the down-regulated genes, ALS1 is a known cell adhesin in C. albicans. Verification of the microarray data was obtained by reverse transcription-PCR for HSP12, AHP1, CHK1, PYC2, GPH1, ALS1, MNN4-4, and FLO1. To further determine the function of Ssk1p in the Hog1p signal transduction pathway in C. albicans, we used Western blot analysis to measure phosphorylation of Hog1p in the ssk1 mutant of C. albicans when grown under either osmotic or

  16. Control of intestinal promoter activity of the cellular migratory regulator gene ELMO3 by CDX2 and SP1

    DEFF Research Database (Denmark)

    Coskun, Mehmet; Boyd, Mette; Olsen, Jørgen

    2010-01-01

    in the differentiated human intestinal cancer cell line Caco-2 in order to identify CDX2-regulated genes involved in cellular migration. The engulfment and cell motility 3 (ELMO3) gene was identified as a potential CDX2 target gene. ELMO3 is an essential upstream regulator of the GTP-binding protein RAC during cell...

  17. Integrative analysis of a cross-loci regulation network identifies App as a gene regulating insulin secretion from pancreatic islets.

    Directory of Open Access Journals (Sweden)

    Zhidong Tu

    Full Text Available Complex diseases result from molecular changes induced by multiple genetic factors and the environment. To derive a systems view of how genetic loci interact in the context of tissue-specific molecular networks, we constructed an F2 intercross comprised of >500 mice from diabetes-resistant (B6 and diabetes-susceptible (BTBR mouse strains made genetically obese by the Leptin(ob/ob mutation (Lep(ob. High-density genotypes, diabetes-related clinical traits, and whole-transcriptome expression profiling in five tissues (white adipose, liver, pancreatic islets, hypothalamus, and gastrocnemius muscle were determined for all mice. We performed an integrative analysis to investigate the inter-relationship among genetic factors, expression traits, and plasma insulin, a hallmark diabetes trait. Among five tissues under study, there are extensive protein-protein interactions between genes responding to different loci in adipose and pancreatic islets that potentially jointly participated in the regulation of plasma insulin. We developed a novel ranking scheme based on cross-loci protein-protein network topology and gene expression to assess each gene's potential to regulate plasma insulin. Unique candidate genes were identified in adipose tissue and islets. In islets, the Alzheimer's gene App was identified as a top candidate regulator. Islets from 17-week-old, but not 10-week-old, App knockout mice showed increased insulin secretion in response to glucose or a membrane-permeant cAMP analog, in agreement with the predictions of the network model. Our result provides a novel hypothesis on the mechanism for the connection between two aging-related diseases: Alzheimer's disease and type 2 diabetes.

  18. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    Science.gov (United States)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  19. Organization and regulation of the neurotoxin genes in Clostridium botulinum and Clostridium tetani.

    Science.gov (United States)

    Raffestin, Stéphanie; Marvaud, Jean Christophe; Cerrato, Rosario; Dupuy, Bruno; Popoff, Michel R

    2004-04-01

    Botulinum and tetanus neurotoxins are structurally and functionally related 150 kDa proteins that are potent inhibitors of neuroexocytosis. Botulinum neurotoxin associates with non-toxic proteins to form complexes of various sizes. The botulinum neurotoxin and non-toxic protein genes are clustered in a DNA segment called the botulinum locus. This locus is probably located on a mobile or degenerate mobile element, which accounts for the various genomic localizations (chromosome, plasmid, phage) in different Clostridium botulinum types. The botulinum neurotoxin and non-toxic protein genes are organized in two polycistronic operons (ntnh-bont and ha operons) transcribed in opposite orientations. The gene that separates the two operons of the botulinum locus in C. botulinum A encodes a 21 kDa protein BotR/A, which is a positive regulator of the expression of the botulinum locus genes. Similarly, in Clostridium tetani, the gene located immediately upstream of the tetanus toxin gene, encodes a positive regulatory protein, TetR. BotR and TetR are possibly alternative sigma factors related to TxeR and UviA, which regulate C. difficile toxin and C. perfringens bacteriocin production, respectively. TxeR and UviA define a new sub-group of the sigma(70) family of RNA polymerase initiation factors. In addition, the C. botulinum genome contains predicted two-component system genes, some of which are possibly involved in regulation of toxinogenesis.

  20. Expression Regulation of Polycistronic lee3 Genes of Enterohaemorrhagic Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Wei-Sheng W Sun

    Full Text Available Enterohaemorrhagic Escherichia coli O157:H7 (EHEC carries a pathogenic island LEE that is consisted mainly of five polycistronic operons. In the lee3 operon, mpc is the first gene and has been reported to down regulate the type-3 secretion system of EHEC when its gene product is over-expressed. Furthermore, mpc has been suggested to have a regulation function via translation but the mechanism remains unclear. To clarify this hypothesis, we dissected the polycistron and examined the translated products. We conclude that translation of mpc detrimentally governs the translation of the second gene, escV, which in turn affects the translation of the third gene, escN. Then sequentially, escN affects the expression of the downstream genes. Furthermore, we located a critical cis element within the mpc open-reading frame that plays a negative role in the translation-dependent regulation of lee3. Using qRT-PCR, we found that the amount of mpc RNA transcript present in EHEC was relatively limited when compared to any other genes within lee3. Taken together, when the transcription of LEE is activated, expression of mpc is tightly controlled by a restriction of the RNA transcript of mpc, translation of which is then critical for the efficient production of the operon's downstream gene products.

  1. Chromosome-biased binding and gene regulation by the Caenorhabditis elegans DRM complex.

    Science.gov (United States)

    Tabuchi, Tomoko M; Deplancke, Bart; Osato, Naoki; Zhu, Lihua J; Barrasa, M Inmaculada; Harrison, Melissa M; Horvitz, H Robert; Walhout, Albertha J M; Hagstrom, Kirsten A

    2011-05-01

    DRM is a conserved transcription factor complex that includes E2F/DP and pRB family proteins and plays important roles in development and cancer. Here we describe new aspects of DRM binding and function revealed through genome-wide analyses of the Caenorhabditis elegans DRM subunit LIN-54. We show that LIN-54 DNA-binding activity recruits DRM to promoters enriched for adjacent putative E2F/DP and LIN-54 binding sites, suggesting that these two DNA-binding moieties together direct DRM to its target genes. Chromatin immunoprecipitation and gene expression profiling reveals conserved roles for DRM in regulating genes involved in cell division, development, and reproduction. We find that LIN-54 promotes expression of reproduction genes in the germline, but prevents ectopic activation of germline-specific genes in embryonic soma. Strikingly, C. elegans DRM does not act uniformly throughout the genome: the DRM recruitment motif, DRM binding, and DRM-regulated embryonic genes are all under-represented on the X chromosome. However, germline genes down-regulated in lin-54 mutants are over-represented on the X chromosome. We discuss models for how loss of autosome-bound DRM may enhance germline X chromosome silencing. We propose that autosome-enriched binding of DRM arose in C. elegans as a consequence of germline X chromosome silencing and the evolutionary redistribution of germline-expressed and essential target genes to autosomes. Sex chromosome gene regulation may thus have profound evolutionary effects on genome organization and transcriptional regulatory networks.

  2. Eos negatively regulates human γ-globin gene transcription during erythroid differentiation.

    Directory of Open Access Journals (Sweden)

    Hai-Chuan Yu

    Full Text Available BACKGROUND: Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4, a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. METHODOLOGY/PRINCIPAL FINDINGS: Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs. DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3 of the β-globin locus control region (LCR, the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.

  3. MDM2 negatively regulates the human telomerase RNA gene promoter

    Directory of Open Access Journals (Sweden)

    Keith W Nicol

    2005-01-01

    Full Text Available Abstract Background We have previously demonstrated that NF-Y and Sp1 interact with the human telomerase RNA (hTR promoter and play a central role in its regulation. We have also shown that pRB activates the hTR promoter, but the mechanism of pRb directed activation is unknown. It has recently been reported that pRB induces Sp1 activity by relieving inhibition mediated by mdm2. The aim was to investigate possible roles for mdm2 in hTR promoter regulation. Methods Chromatin immunoprecipitation was used to determine binding of mdm2 to the hTR promoter. Transfection and luciferase assays were used to investigate mdm2 repression of the promoter activity and interaction with known transcriptional modulators. Results Here we show using chromatin immunoprecipitation that mdm2 specifically binds the hTR promoter in vivo. Transient co-transfection experiments using an hTR promoter luciferase reporter construct show that hTR promoter activity is inhibited by over-expression of mdm2 in 5637 bladder carcinoma cells (p53 and pRB negative, low mdm2. Titration of mdm2 was able to antagonise activation of hTR promoter activity mediated by pRB or Sp1 over-expression, although in the presence of pRB, mdm2 could not repress promoter activity below basal levels. Using an Sp1 binding site mutation construct we showed that mdm2 repression did not absolutely require Sp1 binding sites in the hTR promoter, suggesting the possibility of pRB/Sp1 independent mechanisms of repression. Finally, we show that NF-Y mediated transactivation of the hTR promoter was also suppressed by mdm2 in a dose-dependent manner. Conclusions These studies suggest that mdm2 may inhibit the hTR promoter by multiple mechanisms. Mdm2 may directly repress activation by both pRB and Sp1, or activation by NF-Y. Furthermore, the ability of mdm2 to interact and interfere with components of the general transcription machinery might partly explain the general repressive effect seen here. Elucidation of

  4. DMPD: Genetic regulation of macrophage priming/activation: the Lsh gene story. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 1757110 Genetic regulation of macrophage priming/activation: the Lsh gene story. Bl... (.svg) (.html) (.csml) Show Genetic regulation of macrophage priming/activation: the Lsh gene story. Pubmed...ID 1757110 Title Genetic regulation of macrophage priming/activation: the Lsh gen

  5. Computational characterization of modes of transcriptional regulation of nuclear receptor genes.

    Directory of Open Access Journals (Sweden)

    Yogita Sharma

    Full Text Available Nuclear receptors are a large structural class of transcription factors that act with their co-regulators and repressors to maintain a variety of biological and physiological processes such as metabolism, development and reproduction. They are activated through the binding of small ligands, which can be replaced by drug molecules, making nuclear receptors promising drug targets. Transcriptional regulation of the genes that encode them is central to gaining a deeper understanding of the diversity of their biochemical and biophysical roles and their role in disease and therapy. Even though they share evolutionary history, nuclear receptor genes have fundamentally different expression patterns, ranging from ubiquitously expressed to tissue-specific and spatiotemporally complex. However, current understanding of regulation in nuclear receptor gene family is still nascent.In this study, we investigate the relationship between long-range regulation of nuclear receptor family and their known functionality. Towards this goal, we identify the nuclear receptor genes that are potential targets based on counts of highly conserved non-coding elements. We validate our results using publicly available expression (RNA-seq and histone modification (ChIP-seq data from the ENCODE project. We find that nuclear receptor genes involved in developmental roles show strong evidence of long-range mechanism of transcription regulation with distinct cis-regulatory content they feature clusters of highly conserved non-coding elements distributed in regions spanning several Megabases, long and multiple CpG islands, bivalent promoter marks and statistically significant higher enrichment of enhancer mark around their gene loci. On the other hand nuclear receptor genes that are involved in tissue-specific roles lack these features, having simple transcriptional controls and a greater variety of mechanisms for producing paralogs. We further examine the combinatorial patterns of

  6. Differential regulation of an auxin-producing nitrilase gene family in Arabidopsis thaliana.

    Science.gov (United States)

    Bartel, B; Fink, G R

    1994-01-01

    Nitrilases (nitrile aminohydrolase, EC 3.5.5.1) convert nitriles to carboxylic acids. We report the cloning, characterization, and expression patterns of four Arabidopsis thaliana nitrilase genes (NIT1-4), one of which was previously described [Bartling, D., Seedorf, M., Mithöfer, A. & Weiler, E. W. (1992) Eur. J. Biochem. 205, 417-424]. The nitrilase genes encode very similar proteins that hydrolyze indole-3-acetonitrile to the phytohormone indole-3-acetic acid in vitro, and three of the four genes are tandemly arranged on chromosome III. Northern analysis using gene-specific probes and analysis of transgenic plants containing promoter-reporter gene fusions indicate that the four genes are differentially regulated. NIT2 expression is specifically induced around lesions caused by bacterial pathogen infiltration. The sites of nitrilase expression may represent sites of auxin biosynthesis in A. thaliana. Images PMID:8022831

  7. Regulation of gene expression with thyroid hormone in rats with myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Yue-Feng Chen

    Full Text Available The expression of hundreds of genes is altered in response to left ventricular (LV remodeling following large transmural myocardial infarction (MI. Thyroid hormone (TH improves LV remodeling and cardiac performance after MI. However, the molecular basis is unknown.MI was produced by ligation of the left anterior descending coronary artery in female SD rats. Rats were divided into the following groups: (1 Sham MI, (2 MI, and (3 MI+T4 treatment (T4 pellet 3.3 mg, 60 days release, implanted subcutaneously immediately following MI. Four weeks after surgery, total RNA was isolated from LV non-infarcted areas for microarray analysis using the Illumina RatRef-12 Expression BeadChip Platform.Signals were detected in 13,188 genes (out of 22,523, of which the expression of 154 genes were decreased and the expression of 200 genes were increased in MI rats compared with Sham MI rats (false discovery rate (FDR <0.05. Compared to MI rats, T4 treatment decreased expression of 27 genes and increased expression of 28 genes. In particular, 6 genes down-regulated by MI and 12 genes up-regulated by MI were reversed by T4. Most of the 55 genes altered by T4 treatment are in the category of molecular function under binding (24 and biological processes which includes immune system process (9, multi-organism process (5 and biological regulation (19 nonexclusively.These results suggest that altered expression of genes for molecular function and biological process may be involved in the beneficial effects of thyroid hormone treatment following MI in rats.

  8. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds.

    Directory of Open Access Journals (Sweden)

    Xiaoduo Lu

    Full Text Available Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it's a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively.The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis.In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs.

  9. Genome-Wide Epigenetic Regulation of Gene Transcription in Maize Seeds

    Science.gov (United States)

    Chai, Zhenguang; Guo, Wenzhu; Chen, Rumei; Wang, Lei; Zhao, Jun; Lang, Zhihong; Fan, Yunliu; Zhao, Jiuran; Zhang, Chunyi

    2015-01-01

    Background Epigenetic regulation is well recognized for its importance in gene expression in organisms. DNA methylation, an important epigenetic mark, has received enormous attention in recent years as it’s a key player in many biological processes. It remains unclear how DNA methylation contributes to gene transcription regulation in maize seeds. Here, we take advantage of recent technologies to examine the genome-wide association of DNA methylation with transcription of four types of DNA sequences, including protein-coding genes, pseudogenes, transposable elements, and repeats in maize embryo and endosperm, respectively. Results The methylation in CG, CHG and CHH contexts plays different roles in the control of gene expression. Methylation around the transcription start sites and transcription stop regions of protein-coding genes is negatively correlated, but in gene bodies positively correlated, to gene expression level. The upstream regions of protein-coding genes are enriched with 24-nt siRNAs and contain high levels of CHH methylation, which is correlated to gene expression level. The analysis of sequence content within CG, CHG, or CHH contexts reveals that only CHH methylation is affected by its local sequences, which is different from Arabidopsis. Conclusions In summary, we conclude that methylation-regulated transcription varies with the types of DNA sequences, sequence contexts or parts of a specific gene in maize seeds and differs from that in other plant species. Our study helps people better understand from a genome-wide viewpoint that how transcriptional expression is controlled by DNA methylation, one of the important factors influencing transcription, and how the methylation is associated with small RNAs. PMID:26469520

  10. Low pH induces co-ordinate regulation of gene expression in oesophageal cells.

    Science.gov (United States)

    Duggan, Shane P; Gallagher, William M; Fox, Edward J P; Abdel-Latif, Mohammed M; Reynolds, John V; Kelleher, Dermot

    2006-02-01

    The development of gastro-oesophageal reflux disease (GORD) is known to be a causative risk factor in the evolution of adenocarcinoma of the oesophagus. The major component of this reflux is gastric acid. However, the impact of low pH on gene expression has not been extensively studied in oesophageal cells. This study utilizes a transcriptomic and bioinformatic approach to assess regulation of gene expression in response to low pH. In more detail, oesophageal adenocarcinoma cell lines were exposed to a range of pH environments. Affymetrix microarrays were used for gene-expression analysis and results were validated using cycle limitation and real-time RT-PCR analysis, as well as northern and western blotting. Comparative promoter transcription factor binding site (TFBS) analysis (MatInspector) of hierarchically clustered gene-expression data was employed to identify the elements which may co-ordinately regulate individual gene clusters. Initial experiments demonstrated maximal induction of EGR1 gene expression at pH 6.5. Subsequent array experimentation revealed significant induction of gene expression from such functional categories as DNA damage response (EGR1-4, ATF3) and cell-cycle control (GADD34, GADD45, p57). Changes in expression of EGR1, EGR3, ATF3, MKP-1, FOSB, CTGF and CYR61 were verified in separate experiments and in a variety of oesophageal cell lines. TFBS analysis of promoters identified transcription factors that may co-ordinately regulate gene-expression clusters, Cluster 1: Oct-1, AP4R; Cluster 2: NF-kB, EGRF; Cluster 3: IKRS, AP-1F. Low pH has the ability to induce genes and pathways which can provide an environment suitable for the progression of malignancy. Further functional analysis of the genes and clusters identified in this low pH study is likely to lead to new insights into the pathogenesis and therapeutics of GORD and oesophageal cancer.

  11. Genes with high penetrance for syndromic and non-syndromic autism typically function within the nucleus and regulate gene expression.

    Science.gov (United States)

    Casanova, Emily L; Sharp, Julia L; Chakraborty, Hrishikesh; Sumi, Nahid Sultana; Casanova, Manuel F

    2016-01-01

    Intellectual disability (ID), autism, and epilepsy share frequent yet variable comorbidities with one another. In order to better understand potential genetic divergence underlying this variable risk, we studied genes responsible for monogenic IDs, grouped according to their autism and epilepsy comorbidities. Utilizing 465 different forms of ID with known molecular origins, we accessed available genetic databases in conjunction with gene ontology (GO) to determine whether the genetics underlying ID diverge according to its comorbidities with autism and epilepsy and if genes highly penetrant for autism or epilepsy share distinctive features that set them apart from genes that confer comparatively variable or no apparent risk. The genetics of ID with autism are relatively enriched in terms associated with nervous system-specific processes and structural morphogenesis. In contrast, we find that ID with highly comorbid epilepsy (HCE) is modestly associated with lipid metabolic processes while ID without autism or epilepsy comorbidity (ID only) is enriched at the Golgi membrane. Highly comorbid autism (HCA) genes, on the other hand, are strongly enriched within the nucleus, are typically involved in regulation of gene expression, and, along with IDs with more variable autism, share strong ties with a core protein-protein interaction (PPI) network integral to basic patterning of the CNS. According to GO terminology, autism-related gene products are integral to neural development. While it is difficult to draw firm conclusions regarding IDs unassociated with autism, it is clear that the majority of HCA genes are tightly linked with general dysregulation of gene expression, suggesting that disturbances to the chronology of neural maturation and patterning may be key in conferring susceptibility to autism spectrum conditions.

  12. Microarray Analysis on Gene Regulation by Estrogen, Progesterone and Tamoxifen in Human Endometrial Stromal Cells

    Science.gov (United States)

    Ren, Chun-E; Zhu, Xueqiong; Li, Jinping; Lyle, Christian; Dowdy, Sean; Podratz, Karl C.; Byck, David; Chen, Hai-Bin; Jiang, Shi-Wen

    2015-01-01

    Epithelial stromal cells represent a major cellular component of human uterine endometrium that is subject to tight hormonal regulation. Through cell-cell contacts and/or paracrine mechanisms, stromal cells play a significant role in the malignant transformation of epithelial cells. We isolated stromal cells from normal human endometrium and investigated the morphological and transcriptional changes induced by estrogen, progesterone and tamoxifen. We demonstrated that stromal cells express appreciable levels of estrogen and progesterone receptors and undergo different morphological changes upon hormonal stimulation. Microarray analysis indicated that both estrogen and progesterone induced dramatic alterations in a variety of genes associated with cell structure, transcription, cell cycle, and signaling. However, divergent patterns of changes, and in some genes opposite effects, were observed for the two hormones. A large number of genes are identified as novel targets for hormonal regulation. These hormone-responsive genes may be involved in normal uterine function and the development of endometrial malignancies. PMID:25782154

  13. Chromatin-bound nuclear pore components regulate gene expression in higher eukaryotes

    Science.gov (United States)

    Capelson, Maya; Liang, Yun; Schulte, Roberta; Mair, William; Wagner, Ulrich; Hetzer, Martin W.

    2010-01-01

    Nuclear pore complexes have recently been shown to play roles in gene activation, however their potential involvement in metazoan transcription remains unclear. Here we show that the nucleoporins Sec13, Nup98 and Nup88, as well as a group of FG-repeat nucleoporins, bind to the Drosophila genome at functionally distinct loci that often do not represent NE contact sites. While Nup88 localizes to silent loci, Sec13, Nup98 and a subset of FG-repeat nucleoporins bind to developmentally regulated genes undergoing transcription induction. Strikingly, RNAi-mediated knockdown of intranuclear Sec13 and Nup98 specifically inhibits transcription of their target genes and prevents efficient reactivation of transcription after heat shock, suggesting an essential role of NPC components in regulating complex gene expression programs of multicellular organisms. PMID:20144761

  14. Microarray Analysis on Gene Regulation by Estrogen, Progesterone and Tamoxifen in Human Endometrial Stromal Cells

    Directory of Open Access Journals (Sweden)

    Chun-E Ren

    2015-03-01

    Full Text Available Epithelial stromal cells represent a major cellular component of human uterine endometrium that is subject to tight hormonal regulation. Through cell-cell contacts and/or paracrine mechanisms, stromal cells play a significant role in the malignant transformation of epithelial cells. We isolated stromal cells from normal human endometrium and investigated the morphological and transcriptional changes induced by estrogen, progesterone and tamoxifen. We demonstrated that stromal cells express appreciable levels of estrogen and progesterone receptors and undergo different morphological changes upon hormonal stimulation. Microarray analysis indicated that both estrogen and progesterone induced dramatic alterations in a variety of genes associated with cell structure, transcription, cell cycle, and signaling. However, divergent patterns of changes, and in some genes opposite effects, were observed for the two hormones. A large number of genes are identified as novel targets for hormonal regulation. These hormone-responsive genes may be involved in normal uterine function and the development of endometrial malignancies.

  15. Discovery and characterization of nutritionally regulated genes associated with muscle growth in Atlantic salmon.

    Science.gov (United States)

    Bower, Neil I; Johnston, Ian A

    2010-10-01

    A genomics approach was used to identify nutritionally regulated genes involved in growth of fast skeletal muscle in Atlantic salmon (Salmo salar L.). Forward and reverse subtractive cDNA libraries were prepared comparing fish with zero growth rates to fish growing rapidly. We produced 7,420 ESTs and assembled them into nonredundant clusters prior to annotation. Contigs representing 40 potentially unrecognized nutritionally responsive candidate genes were identified. Twenty-three of the subtractive library candidates were also differentially regulated by nutritional state in an independent fasting-refeeding experiment and their expression placed in the context of 26 genes with established roles in muscle growth regulation. The expression of these genes was also determined during the maturation of a primary myocyte culture, identifying 13 candidates from the subtractive cDNA libraries with putative roles in the myogenic program. During early stages of refeeding DNAJA4, HSPA1B, HSP90A, and CHAC1 expression increased, indicating activation of unfolded protein response pathways. Four genes were considered inhibitory to myogenesis based on their in vivo and in vitro expression profiles (CEBPD, ASB2, HSP30, novel transcript GE623928). Other genes showed increased expression with feeding and highest in vitro expression during the proliferative phase of the culture (FOXD1, DRG1) or as cells differentiated (SMYD1, RTN1, MID1IP1, HSP90A, novel transcript GE617747). The genes identified were associated with chromatin modification (SMYD1, RTN1), microtubule stabilization (MID1IP1), cell cycle regulation (FOXD1, CEBPD, DRG1), and negative regulation of signaling (ASB2) and may play a role in the stimulation of myogenesis during the transition from a catabolic to anabolic state in skeletal muscle.

  16. In vitro selection of mutants: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Winicov, I.; Bastola, D.R.; Deutch, C.E.; Pethe, V.V.; Petrusa, L.

    2001-01-01

    Regulation of differentially expressed genes in plants may be involved in inducing tolerance to stress. Isogenic salt-sensitive and salt-tolerant alfalfa lines were investigated for molecular differences in their response to salt. The genes, which are differentially induced by salt in the salt-tolerant alfalfa cells and are also regulated by salt at the whole plant level, were cloned. Both transcriptional and post- transcriptional mechanisms influenced salt-induced product accumulation in the salt-tolerant alfalfa. The salt-tolerant plants doubled proline concentration rapidly in roots, while salt-sensitive plants showed a delayed response. To understand the regulatory system in the salt-tolerant alfalfa, two genes that are expressed in roots were studied. Alfin1 encodes a zinc-finger type putative DNA transcription factor conserved in alfalfa, rice and Arabidopsis, and MsPRP2 encodes a protein that serves as a cell wall- membrane linker in roots. Recombinant Alfin1 protein was selected, amplified, cloned and its consensus sequence was identified. The recombinant Alfin1 also bound specifically to fragments of the MsPRP2 promoter in vitro, containing the Alfin1 binding consensus sequence. The results show unambiguously binding specificity of Alfin1 DNA, supporting its role in gene regulation. Alfin1 function was tested in transformed alfalfa in vivo by over-expressing Alfin1 from 35S CaMV promoter. The transgenic plants appeared normal. However, plants harboring the anti-sense construct did not grow well in soil, indicating that Alfin1 expression was essential. Alfin1 over-expression in transgenic alfalfa led to enhanced levels of MsPRP2 transcript accumulation, demonstrating that Alfin1 functioned in vivo in gene regulation. Since MsPRP2 gene is also induced by salt, it is likely that Alfin1 is an important transcription factor for gene regulation in salt-tolerant alfalfa, and an excellent target for manipulation to improve salt tolerance. (author)

  17. Histone deacetylase regulation of immune gene expression in tumor cells

    Science.gov (United States)

    Tomasi, Thomas B.

    2011-01-01

    Epigenetic modifications of chromatin, such as histone acetylation, are involved in repression of tumor antigens and multiple immune genes that are thought to facilitate tumor escape. The status of acetylation in a cell is determined by the balance of the activities of histone acetyltransferases and histone deacetylases. Inhibitors of histone deacetylase (HDACi) can enhance the expression of immunologically important molecules in tumor cells and HDACi treated tumor cells are able to induce immune responses in vitro and in vivo. Systemic HDACi are in clinical trails in cancer and also being used in several autoimmune disease models. To date, 18 HDACs have been reported in human cells and more than thirty HDACi identified, although only a few immune targets of these inhibitors have been identified. Here, we discuss the molecular pathways employed by HDACi and their potential role in inducing immune responses against tumors. We review data suggesting that selection of target specific HDACi and combinations with other agents and modalities, including those that activate stress pathways, may further enhance the efficacy of epigenetic therapies. PMID:18213528

  18. Transmembrane channel-like (tmc) gene regulates Drosophila larval locomotion.

    Science.gov (United States)

    Guo, Yanmeng; Wang, Yuping; Zhang, Wei; Meltzer, Shan; Zanini, Damiano; Yu, Yue; Li, Jiefu; Cheng, Tong; Guo, Zhenhao; Wang, Qingxiu; Jacobs, Julie S; Sharma, Yashoda; Eberl, Daniel F; Göpfert, Martin C; Jan, Lily Yeh; Jan, Yuh Nung; Wang, Zuoren

    2016-06-28

    Drosophila larval locomotion, which entails rhythmic body contractions, is controlled by sensory feedback from proprioceptors. The molecular mechanisms mediating this feedback are little understood. By using genetic knock-in and immunostaining, we found that the Drosophila melanogaster transmembrane channel-like (tmc) gene is expressed in the larval class I and class II dendritic arborization (da) neurons and bipolar dendrite (bd) neurons, both of which are known to provide sensory feedback for larval locomotion. Larvae with knockdown or loss of tmc function displayed reduced crawling speeds, increased head cast frequencies, and enhanced backward locomotion. Expressing Drosophila TMC or mammalian TMC1 and/or TMC2 in the tmc-positive neurons rescued these mutant phenotypes. Bending of the larval body activated the tmc-positive neurons, and in tmc mutants this bending response was impaired. This implicates TMC's roles in Drosophila proprioception and the sensory control of larval locomotion. It also provides evidence for a functional conservation between Drosophila and mammalian TMCs.

  19. Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Yanli [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Li, Hui [The Central Hospital of Wuhan, Tongji Medical College Huazhong University of Science Technology, Wuhan, 430000 (China); Zhang, Xiaoju [Department of Respiratory Medicine, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Shang, Jia [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Kang, Yi, E-mail: kykangyi@163.com [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China)

    2016-01-29

    Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.

  20. Bacterial translational regulations: high diversity between all mRNAs and major role in gene expression

    Directory of Open Access Journals (Sweden)

    Picard Flora

    2012-10-01

    Full Text Available Abstract Background In bacteria, the weak correlations at the genome scale between mRNA and protein levels suggest that not all mRNAs are translated with the same efficiency. To experimentally explore mRNA translational level regulation at the systemic level, the detailed translational status (translatome of all mRNAs was measured in the model bacterium Lactococcus lactis in exponential phase growth. Results Results demonstrated that only part of the entire population of each mRNA species was engaged in translation. For transcripts involved in translation, the polysome size reached a maximum of 18 ribosomes. The fraction of mRNA engaged in translation (ribosome occupancy and ribosome density were not constant for all genes. This high degree of variability was analyzed by bioinformatics and statistical modeling in order to identify general rules of translational regulation. For most of the genes, the ribosome density was lower than the maximum value revealing major control of translation by initiation. Gene function was a major translational regulatory determinant. Both ribosome occupancy and ribosome density were particularly high for transcriptional regulators, demonstrating the positive role of translational regulation in the coordination of transcriptional networks. mRNA stability was a negative regulatory factor of ribosome occupancy and ribosome density, suggesting antagonistic regulation of translation and mRNA stability. Furthermore, ribosome occupancy was identified as a key component of intracellular protein levels underlining the importance of translational regulation. Conclusions We have determined, for the first time in a bacterium, the detailed translational status for all mRNAs present in the cell. We have demonstrated experimentally the high diversity of translational states allowing individual gene differentiation and the importance of translation-level regulation in the complex process linking gene expression to protein

  1. Blood meal induced regulation of the chemosensory gene repertoire in the southern house mosquito.

    Science.gov (United States)

    Taparia, Tanvi; Ignell, Rickard; Hill, Sharon Rose

    2017-05-19

    The southern house mosquito, Culex quinquefasciatus, is one of the most prevalent vectors of lymphatic filariasis and flavivirus-induced encephalitis. Its vectorial capacity is directly affected by its reproductive feeding behaviors, such as host seeking, blood feeding, resting, and egg laying. In mosquitoes, these gonotrophic behaviors are odor-mediated and regulated following blood feeding. Immediately after a blood meal, female mosquitoes show reduced olfactory responsiveness and flight activity, as they enter a resting state. Insights into antennal chemosensory gene regulation at this time period can provide a foundation to identify targets involved in the state switch between host seeking and resting. This study used quantitative gene expression analyses to explore blood meal induced regulation of chemosensory gene families in the antennae of 6 days post-emergence C. quinquefasciatus females. Improved annotations for multiple chemosensory gene families, and a quantitative differential gene expression analysis between host seeking and 24 h post- blood fed females of the same age, allowed for the detection of transcripts that potentially play a role in the switch from host seeking to resting, in C. quinquefasciatus. The expression profiles of chemosensory genes varied significantly between the two treatments. Annotations for chemosensory gene repertoires in C. quinquefasciatus have been manually curated and corrected for 3' exon choice and transcript length, through sequence and transcriptome analyses. The gene expression analyses identified various molecular components of the peripheral olfactory system in C. quinquefasciatus, including odorant receptors, ionotropic receptors, odorant binding proteins and chemosensory proteins, that are regulated in response to blood feeding, and could be critical for the behavioral switch from host seeking to resting. Functional characterization of these proteins in the future can identify targets essential for the females

  2. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  3. Comparative genomic sequence analysis of the human and mouse cystic fibrosis transmembrane conductance regulator genes

    OpenAIRE

    Ellsworth, Rachel E.; Jamison, D. Curtis; Touchman, Jeffrey W.; Chissoe, Stephanie L.; Braden Maduro, Valerie V.; Bouffard, Gerard G.; Dietrich, Nicole L.; Beckstrom-Sternberg, Stephen M.; Iyer, Leslie M.; Weintraub, Lauren A.; Cotton, Marc; Courtney, Laura; Edwards, Jennifer; Maupin, Rachel; Ozersky, Philip

    2000-01-01

    The identification of the cystic fibrosis transmembrane conductance regulator gene (CFTR) in 1989 represents a landmark accomplishment in human genetics. Since that time, there have been numerous advances in elucidating the function of the encoded protein and the physiological basis of cystic fibrosis. However, numerous areas of cystic fibrosis biology require additional investigation, some of which would be facilitated by information about the long-range sequence context of the CFTR gene. Fo...

  4. Butyrate Specifically Down-Regulates Salmonella Pathogenicity Island 1 Gene Expression

    OpenAIRE

    Gantois, I.; Ducatelle, R.; Pasmans, F.; Haesebrouck, F.; Hautefort, I.; Thompson, A.; Hinton, J. C.; Van Immerseel, F.

    2006-01-01

    Invasion of intestinal epithelial cells by Salmonella enterica is decreased after exposure to butyric acid. To understand the molecular mechanisms of this phenomenon, a comparative transcriptomic analysis of Salmonella enterica serovar Enteritidis and Salmonella enterica serovar Typhimurium grown in medium supplemented with butyrate was performed. We found that butyrate down-regulated the expression of 19 genes common to both serovars by a factor of twofold or more, and 17 of these genes loca...

  5. Positive regulation of botulinum neurotoxin gene expression by CodY in Clostridium botulinum ATCC 3502.

    Science.gov (United States)

    Zhang, Zhen; Dahlsten, Elias; Korkeala, Hannu; Lindström, Miia

    2014-12-01

    Botulinum neurotoxin, produced mainly by the spore-forming bacterium Clostridium botulinum, is the most poisonous biological substance known. Here, we show that CodY, a global regulator conserved in low-G+C Gram-positive bacteria, positively regulates the botulinum neurotoxin gene expression. Inactivation of codY resulted in decreased expression of botA, encoding the neurotoxin, as well as in reduced neurotoxin synthesis. Complementation of the codY mutation in trans rescued neurotoxin synthesis, and overexpression of codY in trans caused elevated neurotoxin production. Recombinant CodY was found to bind to a 30-bp region containing the botA transcription start site, suggesting regulation of the neurotoxin gene transcription through direct interaction. GTP enhanced the binding affinity of CodY to the botA promoter, suggesting that CodY-dependent neurotoxin regulation is associated with nutritional status. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Regulation of hepatic PPARγ2 and lipogenic gene expression by melanocortin

    International Nuclear Information System (INIS)

    Poritsanos, Nicole J.; Wong, Davie; Vrontakis, Maria E.; Mizuno, Tooru M.

    2008-01-01

    The central melanocortin system regulates hepatic lipid metabolism. Hepatic lipogenic gene expression is regulated by transcription factors including sterol regulatory element-binding protein 1c (SREBP-1c), carbohydrate responsive element-binding protein (ChREBP), and peroxisome proliferator-activated receptor γ2 (PPARγ2). However, it is unclear if central melanocortin signaling regulates hepatic lipogenic gene expression through the activation of these transcription factors. To delineate the molecular mechanisms by which the melanocortin system regulates hepatic lipid metabolism, we examined the effect of intracerebroventricular injection of SHU9119, a melanocortin receptor antagonist, on hepatic expression levels of genes involved in lipid metabolism in mice. SHU9119 treatment increased hepatic triglyceride content and mRNA levels of lipogenic genes, SREBP-1c, and PPARγ2, whereas it did not cause any changes in hepatic ChREBP mRNA levels. These findings suggest that reduced central melanocortin signaling increases hepatic lipid deposition by stimulating hepatic lipogenic gene expression at least partly through the activation of SREBP-1c and PPARγ2

  7. Developmental regulation of tandem promoters for the major outer membrane protein gene of Chlamydia trachomatis.

    Science.gov (United States)

    Stephens, R S; Wagar, E A; Edman, U

    1988-01-01

    Chlamydia trachomatis has a biphasic developmental cycle which is characterized by qualitative and quantitative changes in protein expression. The molecular mechanisms that mediate these changes are unknown. Evidence for transcriptional regulation of the chlamydial major outer membrane protein gene (omp1) was found by Northern hybridization of RNA isolated sequentially during the chlamydial developmental cycle. Early in the growth cycle a single transcript was detected, which was followed hours later in the cycle by an additional transcript. Mapping of the initiating nucleotide for each transcript suggested that this gene is regulated by differential transcription from tandem promoters. Images PMID:2448291

  8. Uhrf1 is indispensable for normal limb growth by regulating chondrocyte differentiation through specific gene expression.

    Science.gov (United States)

    Yamashita, Michiko; Inoue, Kazuki; Saeki, Noritaka; Ideta-Otsuka, Maky; Yanagihara, Yuta; Sawada, Yuichiro; Sakakibara, Iori; Lee, Jiwon; Ichikawa, Koichi; Kamei, Yoshiaki; Iimura, Tadahiro; Igarashi, Katsuhide; Takada, Yasutsugu; Imai, Yuuki

    2018-01-08

    Transcriptional regulation can be tightly orchestrated by epigenetic regulators. Among these, ubiquitin-like with PHD and RING finger domains 1 (Uhrf1) is reported to have diverse epigenetic functions, including regulation of DNA methylation. However, the physiological functions of Uhrf1 in skeletal tissues remain unclear. Here, we show that limb mesenchymal cell-specific Uhrf1 conditional knockout mice ( Uhrf1 Δ Limb/ Δ Limb ) exhibit remarkably shortened long bones that have morphological deformities due to dysregulated chondrocyte differentiation and proliferation. RNA-seq performed on primary cultured chondrocytes obtained from Uhrf1 Δ Limb/ Δ Limb mice showed abnormal chondrocyte differentiation. In addition, integrative analyses using RNA-seq and MBD-seq revealed that Uhrf1 deficiency decreased genome-wide DNA methylation and increased gene expression through reduced DNA methylation in the promoter regions of 28 genes, including Hspb1 , which is reported to be an IL1-related gene and to affect chondrocyte differentiation. Hspb1 knockdown in cKO chondrocytes can normalize abnormal expression of genes involved in chondrocyte differentiation, such as Mmp13 These results indicate that Uhrf1 governs cell type-specific transcriptional regulation by controlling the genome-wide DNA methylation status and regulating consequent cell differentiation and skeletal maturation. © 2018. Published by The Company of Biologists Ltd.

  9. The role of RNA structure at 5' untranslated region in microRNA-mediated gene regulation.

    Science.gov (United States)

    Gu, Wanjun; Xu, Yuming; Xie, Xueying; Wang, Ting; Ko, Jae-Hong; Zhou, Tong

    2014-09-01

    Recent studies have suggested that the secondary structure of the 5' untranslated region (5' UTR) of messenger RNA (mRNA) is important for microRNA (miRNA)-mediated gene regulation in humans. mRNAs that are targeted by miRNA tend to have a higher degree of local secondary structure in their 5' UTR; however, the general role of the 5' UTR in miRNA-mediated gene regulation remains unknown. We systematically surveyed the secondary structure of 5' UTRs in both plant and animal species and found a universal trend of increased mRNA stability near the 5' cap in mRNAs that are regulated by miRNA in animals, but not in plants. Intra-genome comparison showed that gene expression level, GC content of the 5' UTR, number of miRNA target sites, and 5' UTR length may influence mRNA structure near the 5' cap. Our results suggest that the 5' UTR secondary structure performs multiple functions in regulating post-transcriptional processes. Although the local structure immediately upstream of the start codon is involved in translation initiation, RNA structure near the 5' cap site, rather than the structure of the full-length 5' UTR sequences, plays an important role in miRNA-mediated gene regulation. © 2014 Gu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Studies of Neuronal Gene Regulation Controlling the Molecular Mechanisms Underlying Neural Plasticity.

    Science.gov (United States)

    Fukuchi, Mamoru

    2017-01-01

    The regulation of the development and function of the nervous system is not preprogramed but responds to environmental stimuli to change neural development and function flexibly. This neural plasticity is a characteristic property of the nervous system. For example, strong synaptic activation evoked by environmental stimuli leads to changes in synaptic functions (known as synaptic plasticity). Long-lasting synaptic plasticity is one of the molecular mechanisms underlying long-term learning and memory. Since discovering the role of the transcription factor cAMP-response element-binding protein in learning and memory, it has been widely accepted that gene regulation in neurons contributes to long-lasting changes in neural functions. However, it remains unclear how synaptic activation is converted into gene regulation that results in long-lasting neural functions like long-term memory. We continue to address this question. This review introduces our recent findings on the gene regulation of brain-derived neurotrophic factor and discusses how regulation of the gene participates in long-lasting changes in neural functions.

  11. Opposing roles of STAT4 and Dnmt3a in Th1 gene regulation

    Science.gov (United States)

    Pham, Duy; Yu, Qing; Walline, Crystal C.; Muthukrishnan, Rajarajeswari; Blum, Janice S.; Kaplan, Mark H.

    2013-01-01

    The Signal Transducer and Activator of Transcription factor STAT4 is a critical regulator of Th1 differentiation and inflammatory disease. Yet, how STAT4 regulates gene expression is still unclear. In this report, we define a STAT4-dependent sequence of events including H3K4 methylation, Jmjd3 association with STAT4 target loci, and a Jmjd3-dependent decrease in H3K27 trimethylation and DNA methyltransferase (Dnmt) 3a association with STAT4 target loci. Dnmt3a has an obligate role in repressing Th1 gene expression, and in Th1 cultures deficient in both STAT4 and Dnmt3a, there is recovery in the expression of a subset of Th1 genes that is sufficient to increase IFNγ production. Moreover, although STAT4-deficient mice are protected from the development of EAE, mice deficient in STAT4 and conditionally-deficient in Dnmt3a in T cells develop paralysis. Th1 genes that are de-repressed in the absence of Dnmt3a have greater induction following the ectopic expression of the Th1-associated transcription factors T-bet and Hlx1. Together, these data demonstrate that STAT4 and Dnmt3a play opposing roles in regulating Th1 gene expression, and that one mechanism for STAT4-dependent gene programming is in establishing a de-repressed genetic state susceptible to transactivation by additional fate-determining transcription factors. PMID:23772023

  12. Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?

    Science.gov (United States)

    Cheregi, Otilia; Funk, Christiane

    2015-08-12

    In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.

  13. Histone Acetylation and the Regulation of Major Histocompatibility Class II Gene Expression.

    Science.gov (United States)

    Suzuki, K; Luo, Y

    Major histocompatibility complex (MHC) class II molecules are essential for processing and presenting exogenous pathogen antigens to activate CD4 + T cells. Given their central role in adaptive immune responses, MHC class II genes are tightly regulated in a tissue- and activation-specific manner. The regulation of MHC class II gene expression involves various transcription factors that interact with conserved proximal cis-acting regulatory promoter elements, as well as MHC class II transactivator that interacts with a variety of chromatin remodeling machineries. Recent studies also identified distal regulatory elements within MHC class II gene locus that provide enormous insight into the long-range coordination of MHC class II gene expression. Novel therapeutic modalities that can modify MHC class II genes at the epigenetic level are emerging and are currently in preclinical and clinical trials. This review will focus on the role of chromatin remodeling, particularly remodeling that involves histone acetylation, in the constitutive and inducible regulation of MHC class II gene expression. © 2017 Elsevier Inc. All rights reserved.

  14. Regulating Hypothalamus Gene Expression in Food Intake: Dietary Composition or Calorie Density?

    Directory of Open Access Journals (Sweden)

    Mi Jang

    2017-01-01

    Full Text Available BackgroundThe proportion of saturated fatty acids/unsaturated fatty acids in the diet seems to act as a physiological regulation on obesity, cardiovascular diseases, and diabetes. Differently composed fatty acid diets may induce satiety of the hypothalamus in different ways. However, the direct effect of the different fatty acid diets on satiety in the hypothalamus is not clear.MethodsThree experiments in mice were conducted to determine whether: different compositions of fatty acids affects gene mRNA expression of the hypothalamus over time; different types of fatty acids administered into the stomach directly affect gene mRNA expression of the hypothalamus; and fat composition changes in the diet affects gene mRNA expression of the hypothalamus.ResultsThe type of fat in cases of purified fatty acid administration directly into the stomach may cause changes of gene expressions in the hypothalamus. Gene expression by dietary fat may be regulated by calorie amount ingested rather than weight amount or type of fat.ConclusionTherefore, the calorie density factor of the diet in regulating hypothalamic gene in food intake may be detrimental, although the possibility of type of fat cannot be ruled out.

  15. The complex spatio-temporal regulation of the Drosophila myoblast attractant gene duf/kirre.

    Directory of Open Access Journals (Sweden)

    K G Guruharsha

    2009-09-01

    Full Text Available A key early player in the regulation of myoblast fusion is the gene dumbfounded (duf, also known as kirre. Duf must be expressed, and function, in founder cells (FCs. A fixed number of FCs are chosen from a pool of equivalent myoblasts and serve to attract fusion-competent myoblasts (FCMs to fuse with them to form a multinucleate muscle-fibre. The spatial and temporal regulation of duf expression and function are important and play a deciding role in choice of fibre number, location and perhaps size. We have used a combination of bioinformatics and functional enhancer deletion approaches to understand the regulation of duf. By transgenic enhancer-reporter deletion analysis of the duf regulatory region, we found that several distinct enhancer modules regulate duf expression in specific muscle founders of the embryo and the adult. In addition to existing bioinformatics tools, we used a new program for analysis of regulatory sequence, PhyloGibbs-MP, whose development was largely motivated by the requirements of this work. The results complement our deletion analysis by identifying transcription factors whose predicted binding regions match with our deletion constructs. Experimental evidence for the relevance of some of these TF binding sites comes from available ChIP-on-chip from the literature, and from our analysis of localization of myogenic transcription factors with duf enhancer reporter gene expression. Our results demonstrate the complex regulation in each founder cell of a gene that is expressed in all founder cells. They provide evidence for transcriptional control--both activation and repression--as an important player in the regulation of myoblast fusion. The set of enhancer constructs generated will be valuable in identifying novel trans-acting factor-binding sites and chromatin regulation during myoblast fusion in Drosophila. Our results and the bioinformatics tools developed provide a basis for the study of the transcriptional

  16. Expression and regulation of two novel anther-specific genes in Lilium longiflorum.

    Science.gov (United States)

    Tzeng, Jhih-Deng; Hsu, Ssu-Wei; Chung, Mei-Chu; Yeh, Fung-Ling; Yang, Chin-Ying; Liu, Ming-Che; Hsu, Yi-Feng; Wang, Co-Shine

    2009-03-01

    Two stage-specific genes have been isolated from a subtractive cDNA library constructed from developing anthers of lily (Lilium longiflorum). The proteins encoded by the two genes have a strong hydrophobic region at the N-terminus, indicating the presence of a signal peptide. The deduced LLA-67 is a new type of small cysteine-rich protein whose sequence exhibits four consecutive CX(3)CX(6-10) repeats that could form signal-receiving finger motifs, while the deduced LLA-115 protein shows significant similarities to a rice unknown protein, and putative cell wall proteins of Medicago truncatula and Arabidopsis. The transcripts of LLA-67 and LLA-115 were anther specific and differentially detected at the phase of microspore development. In situ hybridization with antisense riboprobes of the two genes in the anther showed strong signals localized to the tapetal layer of the anther wall. The LLA-67 mRNA was also detected in the microspore at the phase of microspore development but the LLA-115 mRNA was not. The LLA-115 gene can be exogenously induced by gibberellin (GA), whereas the LLA-67 gene cannot be induced. Studies with the GA biosynthesis inhibitor uniconazole and an inhibitor of ethylene activity, 2,5-norbornadien (NBD), revealed that the two genes were negatively regulated by ethylene and a cross-talk between GA and ethylene was involved in the regulation of the two genes occurring in young anthers. The treatment of NBD caused the tapetum to become densely cytoplasmic and highly polarized, whereas uniconazole arrested tapetal development to a status close to that of control. DNA blots of lily genomic DNA indicated that the two genes were encoded by a small gene family. The different actions of hormones on gene expression and the possible function of the gene products in young anthers are discussed.

  17. Inducible, tunable and multiplex human gene regulation using CRISPR-Cpf1-based transcription factors | Office of Cancer Genomics

    Science.gov (United States)

    Targeted and inducible regulation of mammalian gene expression is a broadly important research capability that may also enable development of novel therapeutics for treating human diseases. Here we demonstrate that a catalytically inactive RNA-guided CRISPR-Cpf1 nuclease fused to transcriptional activation domains can up-regulate endogenous human gene expression. We engineered drug-inducible Cpf1-based activators and show how this system can be used to tune the regulation of endogenous gene transcription in human cells.

  18. Transcriptional profiling of UlaR-regulated genes in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Sulman Shafeeq

    2015-06-01

    Full Text Available The transcriptional regulator UlaR belongs to the family of PRD-containing transcriptional regulators, which are mostly involved in the regulation of carbohydrate metabolism. The role of the transcriptional regulator UlaR in Streptococcus pneumoniae has recently been described [1]. Here, we report detailed genome-wide transcriptional profiling of UlaR-regulated genes in S. pneumoniae D39 and its ∆ulaR derivative, either in the presence of 10 mM ascorbic acid in M17 medium using microarray analysis. 10 mM concentration of ascorbic acid was supplemented to the M17 medium because our lacZ-fusion studies indicated that UlaR acts as a transcriptional activator of its targets in the presence of ascorbic acid and the expression of the ula operon was maximal at a 10 mM ascorbic acid concentration [1]. All transcriptional profiling data of UlaR-regulated genes was deposited to Gene Expression Omnibus (GEO database under accession number GSE61649.

  19. Identification of downstream metastasis-associated target genes regulated by LSD1 in colon cancer cells.

    Science.gov (United States)

    Chen, Jiang; Ding, Jie; Wang, Ziwei; Zhu, Jian; Wang, Xuejian; Du, Jiyi

    2017-03-21

    This study aims to identify downstream target genes regulated by lysine-specific demethylase 1 (LSD1) in colon cancer cells and investigate the molecular mechanisms of LSD1 influencing invasion and metastasis of colon cancer. We obtained the expression changes of downstream target genes regulated by small-interfering RNA-LSD1 and LSD1-overexpression via gene expression profiling in two human colon cancer cell lines. An Affymetrix Human Transcriptome Array 2.0 was used to identify differentially expressed genes (DEGs). We screened out LSD1-target gene associated with proliferation, metastasis, and invasion from DEGs via Gene Ontology and Pathway Studio. Subsequently, four key genes (CABYR, FOXF2, TLE4, and CDH1) were computationally predicted as metastasis-related LSD1-target genes. ChIp-PCR was applied after RT-PCR and Western blot validations to detect the occupancy of LSD1-target gene promoter-bound LSD1. A total of 3633 DEGs were significantly upregulated, and 4642 DEGs were downregulated in LSD1-silenced SW620 cells. A total of 4047 DEGs and 4240 DEGs were upregulated and downregulated in LSD1-overexpressed HT-29 cells, respectively. RT-PCR and Western blot validated the microarray analysis results. ChIP assay results demonstrated that LSD1 might be negative regulators for target genes CABYR and CDH1. The expression level of LSD1 is negatively correlated with mono- and dimethylation of histone H3 lysine4(H3K4) at LSD1- target gene promoter region. No significant mono-methylation and dimethylation of H3 lysine9 methylation was detected at the promoter region of CABYR and CDH1. LSD1- depletion contributed to the upregulation of CABYR and CDH1 through enhancing the dimethylation of H3K4 at the LSD1-target genes promoter. LSD1- overexpression mediated the downregulation of CABYR and CDH1expression through decreasing the mono- and dimethylation of H3K4 at LSD1-target gene promoter in colon cancer cells. CABYR and CDH1 might be potential LSD1-target genes in colon

  20. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    Directory of Open Access Journals (Sweden)

    González Mauricio

    2009-09-01

    Full Text Available Abstract Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we

  1. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis.

    Science.gov (United States)

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-09-22

    Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of unknown genes encoding

  2. [Effects of Down-regulating PPP2R5C Expression on Expression Profile of TAL1-related Regulating Genes in Jurkat Cells].

    Science.gov (United States)

    Chen, Yu; Liu, Si-Chu; Yang, Li-Jian; Chen, Shao-Hua; Zhang, Tao; Luo, Geng-Xin; Li, Yang-Qiu

    2015-04-01

    Based on our previous study showing the inhibition of lenkemia T cell proliferation by down-regulating PPP2R5C expression, this study was aimed to analyze the influence of down-regulating PPP2R5 expression via RNA interference on genes relatied with TAL1 signaling pathway by using gene chip technique. The PPP2R5C-siRNA799 was transduced into Jurkat cells by nucleofection, the total RNA was isolated from treated Jurkat cells after culture for 48 hours; the target sequences were prepared by revevse transcription after mRNA purification, and were hybridized with affymetrix gene expression profile chip 3' IVT. The original image data were collected using affymetrix gene chip scanner 3 000, and the gene expression profile was analyzed using gene spring GX 11.0 soflware. The expression of all 26 genes related with TAL1 signaling pathway was changed, out of which the expression of 15 genes were up-regulated and the expression of 11 genes was down-regulated in PPP2R5C-siRNA 799-transfected Jurkat cells. The genes with significantly up-regulated expression were GATA1, TCF4, XRCC6 and TCF3, while the genes with significantly down-regulated expression were SIN3A and RUNX1. The down-regulation of PPP2R5C gene expression in Jurkat cells via RNA interference to a certain degree can inhibit TAL1 signaling pathway genes, thereby suppresses the proliferation of Jurkat cells.

  3. Gene expression profiles in Parkinson disease prefrontal cortex implicate FOXO1 and genes under its transcriptional regulation.

    Directory of Open Access Journals (Sweden)

    Alexandra Dumitriu

    2012-06-01

    Full Text Available Parkinson disease (PD is a complex neurodegenerative disorder with largely unknown genetic mechanisms. While the degeneration of dopaminergic neurons in PD mainly takes place in the substantia nigra pars compacta (SN region, other brain areas, including the prefrontal cortex, develop Lewy bodies, the neuropathological hallmark of PD. We generated and analyzed expression data from the prefrontal cortex Brodmann Area 9 (BA9 of 27 PD and 26 control samples using the 44K One-Color Agilent 60-mer Whole Human Genome Microarray. All samples were male, without significant Alzheimer disease pathology and with extensive pathological annotation available. 507 of the 39,122 analyzed expression probes were different between PD and control samples at false discovery rate (FDR of 5%. One of the genes with significantly increased expression in PD was the forkhead box O1 (FOXO1 transcription factor. Notably, genes carrying the FoxO1 binding site were significantly enriched in the FDR-significant group of genes (177 genes covered by 189 probes, suggesting a role for FoxO1 upstream of the observed expression changes. Single-nucleotide polymorphisms (SNPs selected from a recent meta-analysis of PD genome-wide association studies (GWAS were successfully genotyped in 50 out of the 53 microarray brains, allowing a targeted expression-SNP (eSNP analysis for 52 SNPs associated with PD affection at genome-wide significance and the 189 probes from FoxO1 regulated genes. A significant association was observed between a SNP in the cyclin G associated kinase (GAK gene and a probe in the spermine oxidase (SMOX gene. Further examination of the FOXO1 region in a meta-analysis of six available GWAS showed two SNPs significantly associated with age at onset of PD. These results implicate FOXO1 as a PD-relevant gene and warrant further functional analyses of its transcriptional regulatory mechanisms.

  4. Genome-wide screening of Saccharomyces cerevisiae genes regulated by vanillin.

    Science.gov (United States)

    Park, Eun-Hee; Kim, Myoung-Dong

    2015-01-01

    During pretreatment of lignocellulosic biomass, a variety of fermentation inhibitors, including acetic acid and vanillin, are released. Using DNA microarray analysis, this study explored genes of the budding yeast Saccharomyces cerevisiae that respond to vanillin-induced stress. The expression of 273 genes was upregulated and that of 205 genes was downregulated under vanillin stress. Significantly induced genes included MCH2, SNG1, GPH1, and TMA10, whereas NOP2, UTP18, FUR1, and SPR1 were down regulated. Sequence analysis of the 5'-flanking region of upregulated genes suggested that vanillin might regulate gene expression in a stress response element (STRE)-dependent manner, in addition to a pathway that involved the transcription factor Yap1p. Retardation in the cell growth of mutant strains indicated that MCH2, SNG1, and GPH1 are intimately involved in vanillin stress response. Deletion of the genes whose expression levels were decreased under vanillin stress did not result in a notable change in S. cerevisiae growth under vanillin stress. This study will provide the basis for a better understanding of the stress response of the yeast S. cerevisiae to fermentation inhibitors.

  5. [Transposon expression and potential effects on gene regulation of Brassica rapa and B. oleracea genomes].

    Science.gov (United States)

    Zhao, Mei-Xia; Zhang, Biao; Liu, Sheng-Yi; Ma, Jian-Xin

    2013-08-01

    Transposons or transposable elements (TEs) are ubiquitous and most abundant DNA components in higher eukaryotes. Recent sequencing of the Brassica rapa and B. oleracea genomes revealed that the amplification of TEs is one of the main factors inducing the difference in genome size. However, the expressions of TEs and the TE effects on gene regulation and functions of these two Brassica diploid species were unclear. Here, we analyzed the RNA sequencing data of leaves, roots, and stems from B. rapa and B. oleracea. Our data showed that overall TEs in either genome expressed at very low levels, and the expression levels of different TE categories and families varied among different organs. Moreover, even for the same TE category or family, the expression activities were distinct between the two Brassica diploids. Forty-one and nine LTR retrotransposons with the transcripts that read into their adjacent sequences have the distances shorter than 2 kb and 100 bp compared to the downstream genes. These LTR retrotransposon readout transcriptions may produce sense or antisense transcripts of nearby genes, with the effects on activating or silencing corresponding genes. Meanwhile, intact LTRs were detected at stronger readout activities than solo LTRs. Of the TEs inserted into genes, the frequencies were ob-served at a higher level in B. rapa than in B. oleracea. In addition, DNA transposons were prone to insert or retain in the intronic regions of genes in either Brassica genomes. These results revealed that the TEs may have potential effects on regulating protein coding genes.

  6. Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2013-12-01

    Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.

  7. Role of type II protein arginine methyltransferase 5 in the regulation of Circadian Per1 gene.

    Directory of Open Access Journals (Sweden)

    Jungtae Na

    Full Text Available Circadian clocks are the endogenous oscillators that regulate rhythmic physiological and behavioral changes to correspond to daily light-dark cycles. Molecular dissections have revealed that transcriptional feedback loops of the circadian clock genes drive the molecular oscillation, in which PER/CRY complexes inhibit the transcriptional activity of the CLOCK/BMAL1 heterodimer to constitute a negative feedback loop. In this study, we identified the type II protein arginine methyltransferase 5 (PRMT5 as an interacting molecule of CRY1. Although the Prmt5 gene was constitutively expressed, increased interaction of PRMT5 with CRY1 was observed when the Per1 gene was repressed both in synchronized mouse liver and NIH3T3 cells. Moreover, rhythmic recruitment of PRMT5 and CRY1 to the Per1 gene promoter was found to be associated with an increased level of histone H4R3 dimethylation and Per1 gene repression. Consistently, decreased histone H4R3 dimethylation and altered rhythmic Per1 gene expression were observed in Prmt5-depleted cells. Taken together, these findings provide an insight into the link between histone arginine methylation by PRMT5 and transcriptional regulation of the circadian Per1 gene.

  8. [Factor analysis of interactions between alfalfa nodule bacteria (Sinorhizobium meliloti) genes that regulate symbiotic nitrogen fixation].

    Science.gov (United States)

    Provorov, N A; Chuklina, E; Vorob'ev, N I; Onishchuk, O P; Simarov, B V

    2013-04-01

    Factor analysis has been conducted for the data on the interaction between the genes of the root nodule bacteria (rhizobia), which influence the efficiency of symbiosis with leguminous plants, including dctA (encoding succinate permease), dctBD (activating the dctA gene due to binding its enhancer in the presence of succinate), rpoN (activating the promoters of dctA and nitrogenase genes nifHDK), and nifA (activating the nitrogenase genes due to binding their enhancers). The analysis of the alfalfa rhizobia (Sinorhizobium meliloti) recombinants that contain additional copies ofthese genes suggested the antagonistic (epistatic) interaction between nifA and rpoN. It may be associated either with the competition for C compounds imported into the nodules between the energy production and nitrogen assimilation processes or with the competition for redox potentials between the oxidative phosphorylation and nitrogen fixation processes. Since the phenotypic effects of the studied genes depend on the activity of nitrogen export into the aerial parts of plants, we suppose that its accumulation in bacteroids impairs the activation of the nifHDK genes by the NifA protein due to its interaction with the GlnB protein (the nitrogen metabolism regulator) or with the FixLJ and ActSR proteins (the redox potential regulators).

  9. Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Bogas, Andrea Cristina; Pomini, Armando M.; Andreote, Fernando Dini; Quecine, Maria Carolina; Marsaioli, Anita J.; Araújo, Welington Luiz

    2013-01-01

    Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically) with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules) and/or by the plant roots (e.g. flavonoids, ethanol and methanol), respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones) and plant exudates (including ethanol) in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF), adaptation to stressful environment (crtI, phoU and sss), to interactions with plant metabolism compounds (acdS) and pathogenicity (patatin and phoU). Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization), which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction. PMID:24688531

  10. Two differentially regulated Arabidopsis genes define a new branch of the DFR superfamily

    DEFF Research Database (Denmark)

    Østergaard, L; Lauvergeat, V; Naested, H

    2001-01-01

    Two tandem genes were identified on Arabidopsis chromosome II (AtCRL1 and AtCRL2) encoding proteins with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The encoded CRL1 and CRL2 proteins share 87% mutual amino acid sequence identity whereas their promoter regions...... are highly divergent, suggesting differential regulation of the CRL genes. Phylogenetic analysis placed CRL1 and CRL2 in a separate branch of the DFR superfamily. Northern blotting showed strong AtCRL1 induction by abscisic acid (ABA), drought, and heat shock, and high expression level in seeds, thus...... resembling the expression pattern of late embryogenic abundant ABA-responsive genes. Differential expression of the two genes during plant development was confirmed in plants expressing transcriptional fusions between the two promoters and the Escherichia coli beta-glucuronidase reporter gene. This showed...

  11. Frequent down-regulation of ABC transporter genes in prostate cancer

    International Nuclear Information System (INIS)

    Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata

    2015-01-01

    ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users

  12. Copper-dependent and -independent hypoxia-inducible factor-1 regulation of gene expression.

    Science.gov (United States)

    Zhang, Zhen; Qiu, Liying; Lin, Chen; Yang, Hong; Fu, Haiying; Li, Rui; Kang, Y James

    2014-10-01

    Hypoxia-inducible factor-1 (HIF-1) regulates the expression of the vascular endothelial growth factor (VEGF), a process requiring copper (Cu) participation. HIF-1 is also involved in the expression of more than a hundred of genes, but it is unknown how HIF-1 differentially controls the expression of these genes timely and spatially. The present study was undertaken to test the hypothesis that Cu is not required for the expression of all HIF-1-regulated genes, thus exploring mechanistic insights into the differential control of multiple gene expression by one transcription factor. Human umbilical vein endothelial cells (HUVECs) were treated with siRNA targeting HIF-1α to define the essential role of HIF-1 in the regulation of BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3) and insulin-like growth factor 2 (IGF-2) expression. A Cu chelator, tetraethylenepentamine (TEPA), was used to reduce intracellular availability of Cu. In comparison, a zinc chelator, N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine (TPEN), was used to reduce intracellular zinc concentration. The expression of both BNIP3 and IGF-2 was completely suppressed in the HIF-1α deficient cells. The removal of Cu suppressed the expression of BNIP3, but did not affect that of IGF-2. The reduction of intracellular zinc did not cause the same effect. Further screening identified a group of genes whose expression required Cu and the others did not need Cu. The present study thus demonstrates Cu-dependent and -independent HIF-1 regulation of gene expression, indicating a mechanism for differential control of multiple gene expression by one transcription factor.

  13. Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses

    Directory of Open Access Journals (Sweden)

    Redon Emma

    2008-07-01

    Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis

  14. Homologues of Genetic Transformation DNA Import Genes Are Required for Rhodobacter capsulatus Gene Transfer Agent Recipient Capability Regulated by the Response Regulator CtrA.

    Science.gov (United States)

    Brimacombe, Cedric A; Ding, Hao; Johnson, Jeanette A; Beatty, J Thomas

    2015-08-01

    Gene transfer agents (GTAs) morphologically resemble small, double-stranded DNA (dsDNA) bacteriophages; however, their only known role is to package and transfer random pieces of the producing cell genome to recipient cells. The best understood GTA is that of Rhodobacter capsulatus, termed RcGTA. We discovered that homologues of three genes involved in natural transformation in other bacteria, comEC, comF, and comM, are essential for RcGTA-mediated gene acquisition. This paper gives genetic and biochemical evidence that RcGTA-borne DNA entry into cells requires the ComEC and ComF putative DNA transport proteins and genetic evidence that putative cytoplasmic ComM protein of unknown function is required for recipient capability. Furthermore, the master regulator of RcGTA production in bacterial horizontal gene transfer mechanisms, where donor DNA is packaged in transducing phage-like particles and recipient cells take up DNA using natural transformation-related machinery. Both of these differentiated subsets of a culture population, donors and recipients, are dependent on the same response regulator, CtrA. Horizontal gene transfer (HGT) is a major driver of bacterial evolution and adaptation to environmental stresses. Traits such as antibiotic resistance or metabolic properties can be transferred between bacteria via HGT; thus, HGT can have a tremendous effect on the fitness of a bacterial population. The three classically described HGT mechanisms are conjugation, transformation, and phage-mediated transduction. More recently, the HGT factor GTA was described, where random pieces of producing cell genome are packaged into phage-like particles that deliver DNA to recipient cells. In this report, we show that transport of DNA borne by the R. capsulatus RcGTA into recipient cells requires key genes previously thought to be specific to natural transformation pathways. These findings indicate that RcGTA combines central aspects of phage-mediated transduction and natural

  15. Array2BIO: from microarray expression data to functional annotation of co-regulated genes

    Directory of Open Access Journals (Sweden)

    Rasley Amy

    2006-06-01

    Full Text Available Abstract Background There are several isolated tools for partial analysis of microarray expression data. To provide an integrative, easy-to-use and automated toolkit for the analysis of Affymetrix microarray expression data we have developed Array2BIO, an application that couples several analytical methods into a single web based utility. Results Array2BIO converts raw intensities into probe expression values, automatically maps those to genes, and subsequently identifies groups of co-expressed genes using two complementary approaches: (1 comparative analysis of signal versus control and (2 clustering analysis of gene expression across different conditions. The identified genes are assigned to functional categories based on Gene Ontology classification and KEGG protein interaction pathways. Array2BIO reliably handles low-expressor genes and provides a set of statistical methods for quantifying expression levels, including Benjamini-Hochberg and Bonferroni multiple testing corrections. An automated interface with the ECR Browser provides evolutionary conservation analysis for the identified gene loci while the interconnection with Crème allows prediction of gene regulatory elements that underlie observed expression patterns. Conclusion We have developed Array2BIO – a web based tool for rapid comprehensive analysis of Affymetrix microarray expression data, which also allows users to link expression data to Dcode.org comparative genomics tools and integrates a system for translating co-expression data into mechanisms of gene co-regulation. Array2BIO is publicly available at http://array2bio.dcode.org.

  16. Spatial regulation of a common precursor from two distinct genes generates metabolite diversity

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Chun-Jun; Sun, Wei-Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C.

    2015-07-13

    In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes or non-ribosomal peptide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPS-like genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. More interestingly, further experiments revealed that the aspulvinone E produced by two different genes accumulates in different fungal compartments. And this spatial control of aspulvinone E production is likely to be regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is inserted in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. The study also identified one trans-prenyltransferase AbpB which is capable of prenylating two different substrates aspulvinones and butyrolactones. In total, our study shows the first example in which the locally distribution of the same natural product could lead to its incorporation into different SM pathways.

  17. Transcription profiling and regulation of fat metabolism genes in diapausing adults of the mosquito Culex pipiens

    Science.gov (United States)

    Sim, Cheolho

    2009-01-01

    Culex pipiens, the mosquito that vectors West Nile virus in North America, overwinters in an adult diapause (dormancy) that is programmed by the short day length and low temperatures of autumn. In response to these environmental signals, females cease feeding on blood and instead seek sources of nectar used to generate the huge lipid reserves required for winter survival. To identify regulatory networks that regulate fat accumulation and fat consumption during diapause, we compared expression of fat-related genes from nondiapausing females with expression of those same genes in early and late diapause and at diapause termination. Among the 31 genes we examined, 4 were expressed more highly in early diapause than in nondiapause, while 14 genes were downregulated in early diapause. In the transition from early to late diapause, 19 genes related to fat metabolism were upregulated. As reported previously, fatty acid synthase, identified as fas-1 in this study, was upregulated in early diapause. Numerous fat metabolism genes, including multiple kinetic classes and genes involved in β-oxidation, an energy-generation step, were suppressed in early diapause but were highly expressed in late diapause and at diapause termination. RNA interference (RNAi) analysis revealed that the fas-1 gene and others (fas-3 and fabp) have important roles in fat storage during early diapause. When expression of these genes is suppressed, female mosquitoes fail to sequester the lipids needed for overwintering. PMID:19706691

  18. The transcription factor FoxK participates with Nup98 to regulate antiviral gene expression.

    Science.gov (United States)

    Panda, Debasis; Gold, Beth; Tartell, Michael A; Rausch, Keiko; Casas-Tinto, Sergio; Cherry, Sara

    2015-04-07

    Upon infection, pathogen recognition leads to a rapidly activated gene expression program that induces antimicrobial effectors to clear the invader. We recently found that Nup98 regulates the expression of a subset of rapidly activated antiviral genes to restrict disparate RNA virus infections in Drosophila by promoting RNA polymerase occupancy at the promoters of these antiviral genes. How Nup98 specifically targets these loci was unclear; however, it is known that Nup98 participates with transcription factors to regulate developmental-gene activation. We reasoned that additional transcription factors may facilitate the Nup98-dependent expression of antiviral genes. In a genome-wide RNA interference (RNAi) screen, we identified a relatively understudied forkhead transcription factor, FoxK, as active against Sindbis virus (SINV) in Drosophila. Here we find that FoxK is active against the panel of viruses that are restricted by Nup98, including SINV and vesicular stomatitis virus (VSV). Mechanistically, we show that FoxK coordinately regulates the Nup98-dependent expression of antiviral genes. Depletion of FoxK significantly reduces Nup98-dependent induction of antiviral genes and reduces the expression of a forkhead response element-containing luciferase reporter. Together, these data show that FoxK-mediated activation of gene expression is Nup98 dependent. We extended our studies to mammalian cells and found that the mammalian ortholog FOXK1 is antiviral against two disparate RNA viruses, SINV and VSV, in human cells. Interestingly, FOXK1 also plays a role in the expression of antiviral genes in mammals: depletion of FOXK1 attenuates virus-inducible interferon-stimulated response element (ISRE) reporter expression. Overall, our results demonstrate a novel role for FOXK1 in regulating the expression of antiviral genes, from insects to humans. Innate immunity is characterized by rapid gene expression programs, from insects to mammals. Furthermore, we find that Nup98

  19. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes.

    Science.gov (United States)

    Brenner, Eric D; Katari, Manpreet S; Stevenson, Dennis W; Rudd, Stephen A; Douglas, Andrew W; Moss, Walter N; Twigg, Richard W; Runko, Suzan J; Stellari, Giulia M; McCombie, W R; Coruzzi, Gloria M

    2005-10-15

    Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate), female (megasporangiate), and vegetative organs (leaves) of Ginkgo biloba. RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants--many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and pollen evolution, and to resolve the ambiguous phylogenetic

  20. A precisely regulated gene expression cassette potently modulates metastasis and survival in multiple solid cancers.

    Directory of Open Access Journals (Sweden)

    Kun Yu

    2008-07-01

    Full Text Available Successful tumor development and progression involves the complex interplay of both pro- and anti-oncogenic signaling pathways. Genetic components balancing these opposing activities are likely to require tight regulation, because even subtle alterations in their expression may disrupt this balance with major consequences for various cancer-associated phenotypes. Here, we describe a cassette of cancer-specific genes exhibiting precise transcriptional control in solid tumors. Mining a database of tumor gene expression profiles from six different tissues, we identified 48 genes exhibiting highly restricted levels of gene expression variation in tumors (n = 270 compared to nonmalignant tissues (n = 71. Comprising genes linked to multiple cancer-related pathways, the restricted expression of this "Poised Gene Cassette" (PGC was robustly validated across 11 independent cohorts of approximately 1,300 samples from multiple cancer types. In three separate experimental models, subtle alterations in PGC expression were consistently associated with significant differences in metastatic and invasive potential. We functionally confirmed this association in siRNA knockdown experiments of five PGC genes (p53CSV, MAP3K11, MTCH2, CPSF6, and SKIP, which either directly enhanced the invasive capacities or inhibited the proliferation of AGS cancer cells. In primary tumors, similar subtle alterations in PGC expression were also repeatedly associated with clinical outcome in multiple cohorts. Taken collectively, these findings support the existence of a common set of precisely controlled genes in solid tumors. Since inducing small activity changes in these genes may prove sufficient to potently influence various tumor phenotypes such as metastasis, targeting such precisely regulated genes may represent a promising avenue for novel anti-cancer therapies.

  1. From genes to milk: genomic organization and epigenetic regulation of the mammary transcriptome.

    Science.gov (United States)

    Lemay, Danielle G; Pollard, Katherine S; Martin, William F; Freeman Zadrowski, Courtneay; Hernandez, Joseph; Korf, Ian; German, J Bruce; Rijnkels, Monique

    2013-01-01

    Even in genomes lacking operons, a gene's position in the genome influences its potential for expression. The mechanisms by which adjacent genes are co-expressed are still not completely understood. Using lactation and the mammary gland as a model system, we explore the hypothesis that chromatin state contributes to the co-regulation of gene neighborhoods. The mammary gland represents a unique evolutionary model, due to its recent appearance, in the context of vertebrate genomes. An understanding of how the mammary gland is regulated to produce milk is also of biomedical and agricultural importance for human lactation and dairying. Here, we integrate epigenomic and transcriptomic data to develop a comprehensive regulatory model. Neighborhoods of mammary-expressed genes were determined using expression data derived from pregnant and lactating mice and a neighborhood scoring tool, G-NEST. Regions of open and closed chromatin were identified by ChIP-Seq of histone modifications H3K36me3, H3K4me2, and H3K27me3 in the mouse mammary gland and liver tissue during lactation. We found that neighborhoods of genes in regions of uniquely active chromatin in the lactating mammary gland, compared with liver tissue, were extremely rare. Rather, genes in most neighborhoods were suppressed during lactation as reflected in their expression levels and their location in regions of silenced chromatin. Chromatin silencing was largely shared between the liver and mammary gland during lactation, and what distinguished the mammary gland was mainly a small tissue-specific repertoire of isolated, expressed genes. These findings suggest that an advantage of the neighborhood organization is in the collective repression of groups of genes via a shared mechanism of chromatin repression. Genes essential to the mammary gland's uniqueness are isolated from neighbors, and likely have less tolerance for variation in expression, properties they share with genes responsible for an organism's survival.

  2. Two polymorphisms in the glucocorticoid receptor gene directly affect glucocorticoid-regulated gene expression.

    NARCIS (Netherlands)

    H. Russcher (Henk); P. Smit (Pauline); E.L.T. van den Akker (Erica); E.F.C. van Rossum (Liesbeth); A.O. Brinkmann (Albert); F.H. de Jong (Frank); S.W.J. Lamberts (Steven); J.W. Koper (Jan)

    2005-01-01

    textabstractCONTEXT: Interindividual variation in glucocorticoid (GC)-sensitivity can be partly explained by polymorphisms in the GC receptor (GR) gene. The ER22/23EK and N363S polymorphisms have been described to be associated with lower and higher GC sensitivity, respectively. OBJECTIVE AND

  3. Thyroid hormone signalling genes are regulated by photoperiod in the hypothalamus of F344 rats.

    Directory of Open Access Journals (Sweden)

    Alexander W Ross

    Full Text Available Seasonal animals adapt their physiology and behaviour in anticipation of climate change to optimise survival of their offspring. Intra-hypothalamic thyroid hormone signalling plays an important role in seasonal responses in mammals and birds. In the F344 rat, photoperiod stimulates profound changes in food intake, body weight and reproductive status. Previous investigations of the F344 rat have suggested a role for thyroid hormone metabolism, but have only considered Dio2 expression, which was elevated in long day photoperiods. Microarray analysis was used to identify time-dependent changes in photoperiod responsive genes, which may underlie the photoperiod-dependent phenotypes of the juvenile F344 rat. The most significant changes are those related to thyroid hormone metabolism and transport. Using photoperiod manipulations and melatonin injections into long day photoperiod (LD rats to mimic short day (SD, we show photoinduction and photosuppression gene expression profiles and melatonin responsiveness of genes by in situ hybridization; TSHβ, CGA, Dio2 and Oatp1c1 genes were all elevated in LD whilst in SD, Dio3 and MCT-8 mRNA were increased. NPY was elevated in SD whilst GALP increased in LD. The photoinduction and photosuppression profiles for GALP were compared to that of GHRH with GALP expression following GHRH temporally. We also reveal gene sets involved in photoperiodic responses, including retinoic acid and Wnt/ß-catenin signalling. This study extends our knowledge of hypothalamic regulation by photoperiod, by revealing large temporal changes in expression of thyroid hormone signalling genes following photoperiod switch. Surprisingly, large changes in hypothalamic thyroid hormone levels or TRH expression were not detected. Expression of NPY and GALP, two genes known to regulate GHRH, were also changed by photoperiod. Whether these genes could provide links between thyroid hormone signalling and the regulation of the growth axis

  4. Comparative genomic sequence analysis of the human and mouse cystic fibrosis transmembrane conductance regulator genes

    Science.gov (United States)

    Ellsworth, Rachel E.; Jamison, D. Curtis; Touchman, Jeffrey W.; Chissoe, Stephanie L.; Braden Maduro, Valerie V.; Bouffard, Gerard G.; Dietrich, Nicole L.; Beckstrom-Sternberg, Stephen M.; Iyer, Leslie M.; Weintraub, Lauren A.; Cotton, Marc; Courtney, Laura; Edwards, Jennifer; Maupin, Rachel; Ozersky, Philip; Rohlfing, Theresa; Wohldmann, Patricia; Miner, Tracie; Kemp, Kimberley; Kramer, Jason; Korf, Ian; Pepin, Kimberlie; Antonacci-Fulton, Lucinda; Fulton, Robert S.; Minx, Patrick; Hillier, LaDeana W.; Wilson, Richard K.; Waterston, Robert H.; Miller, Webb; Green, Eric D.

    2000-01-01

    The identification of the cystic fibrosis transmembrane conductance regulator gene (CFTR) in 1989 represents a landmark accomplishment in human genetics. Since that time, there have been numerous advances in elucidating the function of the encoded protein and the physiological basis of cystic fibrosis. However, numerous areas of cystic fibrosis biology require additional investigation, some of which would be facilitated by information about the long-range sequence context of the CFTR gene. For example, the latter might provide clues about the sequence elements responsible for the temporal and spatial regulation of CFTR expression. We thus sought to establish the sequence of the chromosomal segments encompassing the human CFTR and mouse Cftr genes, with the hope of identifying conserved regions of biologic interest by sequence comparison. Bacterial clone-based physical maps of the relevant human and mouse genomic regions were constructed, and minimally overlapping sets of clones were selected and sequenced, eventually yielding ≈1.6 Mb and ≈358 kb of contiguous human and mouse sequence, respectively. These efforts have produced the complete sequence of the ≈189-kb and ≈152-kb segments containing the human CFTR and mouse Cftr genes, respectively, as well as significant amounts of flanking DNA. Analyses of the resulting data provide insights about the organization of the CFTR/Cftr genes and potential sequence elements regulating their expression. Furthermore, the generated sequence reveals the precise architecture of genes residing near CFTR/Cftr, including one known gene (WNT2/Wnt2) and two previously unknown genes that immediately flank CFTR/Cftr. PMID:10655503

  5. KNOX1 genes regulate lignin deposition and composition in monocots and dicots.

    Science.gov (United States)

    Townsley, Brad T; Sinha, Neelima R; Kang, Julie

    2013-01-01

    Plant secondary cell walls are deposited mostly in vascular tissues such as xylem vessels, tracheids, and fibers. These cell walls are composed of a complex matrix of compounds including cellulose, hemicellulose, and lignin. Lignin functions primarily to maintain the structural and mechanical integrity of both the transport vessel and the entire plant itself. Since lignin has been identified as a major source of biomass for biofuels, regulation of secondary cell wall biosynthesis has been a topic of much recent investigation. Biosynthesis and patterning of lignin involves many developmental and environmental cues including evolutionarily conserved transcriptional regulatory modules and hormonal signals. Here, we investigate the role of the class I Knotted1-like-homeobox (KNOX) genes and gibberellic acid in the lignin biosynthetic pathway in a representative monocot and a representative eudicot. Knotted1 overexpressing mutant plants showed a reduction in lignin content in both maize and tobacco. Expression of four key lignin biosynthesis genes was analyzed and revealed that KNOX1 genes regulate at least two steps in the lignin biosynthesis pathway. The negative regulation of lignin both in a monocot and a eudicot by the maize Kn1 gene suggests that lignin biosynthesis may be preserved across large phylogenetic distances. The evolutionary implications of regulation of lignification across divergent species are discussed.

  6. KNOX1 genes regulate lignin deposition and composition in monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Brad T Townsley

    2013-05-01

    Full Text Available Plant secondary cell walls are deposited mostly in vascular tissues such as xylem vessels, tracheids, and fibers. These cell walls are composed of a complex matrix of compounds including cellulose, hemicellulose, and lignin. Lignin functions primarily to maintain the structural and mechanical integrity of both the transport vessel and the entire plant itself. Since lignin has been identified as a major source of biomass for biofuels, regulation of secondary cell wall biosynthesis has been a topic of much recent investigation. Biosynthesis and patterning of lignin involves many developmental and environmental cues including evolutionarily conserved transcriptional regulatory modules and hormonal signals. Here, we investigate the role of the class I KNOX genes and gibberellic acid in the lignin biosynthetic pathway in a representative monocot and a representative eudicot. Knotted1 overexpressing mutant plants showed a reduction in lignin content in both maize and tobacco. Expression of four key lignin biosynthesis genes was analyzed and revealed that KNOX1 genes regulate at least two steps in the lignin biosynthesis pathway. The negative regulation of lignin both in a monocot and a eudicot by the maize Kn1 gene suggests that lignin biosynthesis may be preserved across large phylogenetic distances. The evolutionary implications of regulation of lignification across divergent species are discussed.

  7. NeuroD1: developmental expression and regulated genes in the rodent pineal gland

    DEFF Research Database (Denmark)

    Muñoz, Estela M; Bailey, Michael J; Rath, Martin F

    2007-01-01

    development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

  8. The tumor suppressor gene hypermethylated in cancer 1 is transcriptionally regulated by E2F1

    DEFF Research Database (Denmark)

    Jenal, Mathias; Trinh, Emmanuelle; Britschgi, Christian

    2009-01-01

    The Hypermethylated in Cancer 1 (HIC1) gene encodes a zinc finger transcriptional repressor that cooperates with p53 to suppress cancer development. We and others recently showed that HIC1 is a transcriptional target of p53. To identify additional transcriptional regulators of HIC1, we screened...

  9. What history tells us XIV. Regulation of gene expression by non ...

    Indian Academy of Sciences (India)

    2008-08-14

    Aug 14, 2008 ... Logo of the Indian Academy of Sciences. Indian Academy of Sciences. Home · About IASc · History · Memorandum of Association · Role of ... Journals; Journal of Biosciences; Volume 33; Issue 3. What history tells us XIV. Regulation of gene expression by non-coding RNAs: the early steps. Michel Morange.

  10. Mouse Protocadherin-1 Gene Expression Is Regulated by Cigarette Smoke Exposure In Vivo

    NARCIS (Netherlands)

    Koning, Henk; van Oosterhout, Antoon J. M.; Brouwer, Uilke; den Boef, Lisette E.; Gras, Renee; Reinders-Luinge, Marjan; Brandsma, Corry-Anke; van der Toorn, Marco; Hylkema, Machteld N.; Willemse, Brigitte W. M.; Sayers, Ian; Koppelman, Gerard H.; Nawijn, Martijn C.

    2014-01-01

    Protocadherin-1 (PCDH1) is a novel susceptibility gene for airway hyperresponsiveness, first identified in families exposed to cigarette smoke and is expressed in bronchial epithelial cells. Here, we asked how mouse Pcdh1 expression is regulated in lung structural cells in vivo under physiological

  11. MDP up-regulates the gene expression of type I interferons in human aortic endothelial cells.

    Science.gov (United States)

    Lv, Qingshan; Yang, Mei; Liu, Xueting; Zhou, Lina; Xiao, Zhilin; Chen, Xiaobin; Chen, Meifang; Xie, Xiumei; Hu, Jinyue

    2012-03-23

    Muramyldipeptide (MDP), the minimum essential structure responsible for the immuno-adjuvant activity of peptidoglycan, is recognized by intracellular nuclear-binding oligomerization domain 2 (NOD2). Here, we obtained evidence that the treatment of human aortic endothelial cells (HAECs) with MDP up-regulated the gene expression of type I interferons in a dose- and time-dependent manner. MDP also up-regulated the expression of the receptor NOD2, suggesting that MDP may induce a positive feedback response. The up-regulation of interferons was not dependent on the TNFa signaling, as HAECs did not express TNFa with the stimulation of MDP, and TNFa neutralizing antibody did not decrease the induction of IFNs induced by MDP. RT-PCR results showed that HAECs expressed the gene transcripts of interferon regulatory factor (IRF) 1, 2, 3, 9. The western blot results showed that MDP induced the phosphorylation of IRF3. These results suggested that MDP induced the up-regulation of gene transcript of interferons through the activation of IRF3 signaling pathway. Meanwhile, MDP induced the gene expression of pro-inflammatory cytokines, including IL-1ß, IL-8, and MCP-1. Taken together, these results suggested that HAECs may play roles in the anti-infection immune response and in the induction of innate immunity.

  12. MDP Up-Regulates the Gene Expression of Type I Interferons in Human Aortic Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Xiumei Xie

    2012-03-01

    Full Text Available Muramyldipeptide (MDP, the minimum essential structure responsible for the immuno-adjuvant activity of peptidoglycan, is recognized by intracellular nuclear-binding oligomerization domain 2 (NOD2. Here, we obtained evidence that the treatment of human aortic endothelial cells (HAECs with MDP up-regulated the gene expression of type I interferons in a dose- and time-dependent manner. MDP also up-regulated the expression of the receptor NOD2, suggesting that MDP may induce a positive feedback response. The up-regulation of interferons was not dependent on the TNFa signaling, as HAECs did not express TNFa with the stimulation of MDP, and TNFa neutralizing antibody did not decrease the induction of IFNs induced by MDP. RT-PCR results showed that HAECs expressed the gene transcripts of interferon regulatory factor (IRF 1, 2, 3, 9. The western blot results showed that MDP induced the phosphorylation of IRF3. These results suggested that MDP induced the up-regulation of gene transcript of interferons through the activation of IRF3 signaling pathway. Meanwhile, MDP induced the gene expression of pro-inflammatory cytokines, including IL-1ß, IL-8, and MCP-1. Taken together, these results suggested that HAECs may play roles in the anti-infection immune response and in the induction of innate immunity.

  13. Cdx and Hox Genes Differentially Regulate Posterior Axial Growth in Mammalian Embryos

    NARCIS (Netherlands)

    Young, Teddy; Rowland, Jennifer Elizabeth; van de Ven, Cesca; Bialecka, Monika; Novoa, Ana; Carapuco, Marta; van Nes, Johan; de Graaff, Wim; Duluc, Isabelle; Freund, Jean-Noel; Beck, Felix; Mallo, Moises; Deschamps, Jacqueline

    2009-01-01

    Hox and Cdx transcription factors regulate embryonic positional identities. Cdx mutant mice display posterior body truncations of the axial skeleton, neuraxis, and caudal urorectal structures. We show that trunk Hox genes stimulate axial extension, as they can largely rescue these Cdx mutant

  14. Increased fat oxidation and regulation of metabolic genes with ultraendurance exercise

    DEFF Research Database (Denmark)

    Helge, Jørn Wulff; Rehrer, N J; Pilegaard, H

    2007-01-01

    nmol kg(-1) d.w.; n = 7, P lipoprotein lipase and glycogen synthase increased (P ... exercise markedly increases plasma fatty acid availability and fat utilization during exercise. Exercise-induced regulation of genes encoding proteins involved in fatty acid recruitment and oxidation may contribute to these changes....

  15. The complexity of nitrogen metabolism and nitrogen-regulated gene expression in plant pathogenic fungi

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.

    2008-01-01

    Plant pathogens secrete effector molecules that contribute to the establishment of disease in their plant hosts. The identification of cellular cues that regulate effector gene expression is an important aspect of understanding the infection process. Nutritional status in the cell has been

  16. Identification of 2 novel genes developmentally regulated in the mouse aorta-gonad-mesonephros region

    NARCIS (Netherlands)

    C. Orelio; E.A. Dzierzak (Elaine)

    2003-01-01

    textabstractThe first adult-repopulating hematopoietic stem cells (HSCs) emerge in the mouse aorta-gonad-mesonephros (AGM) region at embryonic day 10.5 prior to their appearance in the yolk sac and fetal liver. Although several genes are implicated in the regulation of HSCs, there

  17. Integrative analyses shed new light on human ribosomal protein gene regulation.

    Science.gov (United States)

    Li, Xin; Zheng, Yiyu; Hu, Haiyan; Li, Xiaoman

    2016-06-27

    Ribosomal protein genes (RPGs) are important house-keeping genes that are well-known for their coordinated expression. Previous studies on RPGs are largely limited to their promoter regions. Recent high-throughput studies provide an unprecedented opportunity to study how human RPGs are transcriptionally modulated and how such transcriptional regulation may contribute to the coordinate gene expression in various tissues and cell types. By analyzing the DNase I hypersensitive sites under 349 experimental conditions, we predicted 217 RPG regulatory regions in the human genome. More than 86.6% of these computationally predicted regulatory regions were partially corroborated by independent experimental measurements. Motif analyses on these predicted regulatory regions identified 31 DNA motifs, including 57.1% of experimentally validated motifs in literature that regulate RPGs. Interestingly, we observed that the majority of the predicted motifs were shared by the predicted distal and proximal regulatory regions of the same RPGs, a likely general mechanism for enhancer-promoter interactions. We also found that RPGs may be differently regulated in different cells, indicating that condition-specific RPG regulatory regions still need to be discovered and investigated. Our study advances the understanding of how RPGs are coordinately modulated, which sheds light to the general principles of gene transcriptional regulation in mammals.

  18. Single-cell epigenomics: powerful new methods for understanding gene regulation and cell identity.

    Science.gov (United States)

    Clark, Stephen J; Lee, Heather J; Smallwood, Sébastien A; Kelsey, Gavin; Reik, Wolf

    2016-04-18

    Emerging single-cell epigenomic methods are being developed with the exciting potential to transform our knowledge of gene regulation. Here we review available techniques and future possibilities, arguing that the full potential of single-cell epigenetic studies will be realized through parallel profiling of genomic, transcriptional, and epigenetic information.

  19. Gene regulation in amphioxus: An insight from transgenic studies in amphioxus and vertebrates

    Czech Academy of Sciences Publication Activity Database

    Kozmiková, Iryna; Kozmik, Zbyněk

    2015-01-01

    Roč. 24, Dec (2015), s. 159-166 ISSN 1874-7787 R&D Projects: GA MŠk LO1419 Institutional support: RVO:68378050 Keywords : Transgenic animal * Vertebrates * Chordates * Gene regulation * Evolution Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.883, year: 2015

  20. Characterization of human FHL2 transcript variants and gene expression regulation in hepatocellular carcinoma.

    Science.gov (United States)

    Ng, Chor-Fung; Zhou, Wayne Jun-Wei; Ng, Patrick Kwok-Shing; Li, Man-Shan; Ng, Yuen-Keng; Lai, Paul Bo-San; Tsui, Stephen Kwok-Wing

    2011-07-15

    The four-and-a-half LIM protein 2 (FHL2) was originally identified to be expressed abundantly in the heart, as well as in a wide range of tissues demonstrated in various studies. The human FHL2 gene expresses different transcripts which are known to differ only in the 5'UTR region. However, little is known about the functional role of the different variants and the mechanism of gene regulation. In the present study, we characterized the different alternative spliced transcripts of FHL2 by in silico analysis and RT-PCR analysis. A novel transcript variant was identified. The FHL2 gene produces transcripts by different 5' exons, which may be responsible for tissue-specific regulation. To study the mechanism of FHL2 gene regulation, the potential promoter region was investigated. We have identified a functional promoter region upstream of the transcription start site. Deletion mutation analysis of 5' flanking region showed that the fragment from -138 to +292 bp have positive regulatory effect. We identified the binding sites of Pax-5/ZF5 in this region and found that Pax-5 and ZF5 expression in HCC samples had a significant positive correlation with FHL2 expression, suggesting a possible role for these transcription factors in the regulation of FHL2 expression. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Distinct C/EBPalpha motifs regulate lipogenic and gluconeogenic gene expression in vivo

    DEFF Research Database (Denmark)

    Pedersen, Thomas A; Bereshchenko, Oxana; Garcia-Silva, Susana

    2007-01-01

    gluconeogenesis and lipogenesis. In vivo deletion of a proline-histidine rich domain (PHR), dephosphorylated at S193 by insulin signaling, dysregulated genes involved in the generation of acetyl-CoA and NADPH for triglyceride synthesis and led to increased hepatic lipogenesis. These promoters bound SREBP-1....../EBPalpha phosphorylation as a PGC-1alpha-independent mechanism for regulating hepatic gluconeogenesis....

  2. Super-Enhancers at the Nanog Locus Differentially Regulate Neighboring Pluripotency-Associated Genes

    Directory of Open Access Journals (Sweden)

    Steven Blinka

    2016-09-01

    Full Text Available Super-enhancers are tissue-specific cis-regulatory elements that drive expression of genes associated with cell identity and malignancy. A cardinal feature of super-enhancers is that they are transcribed to produce enhancer-derived RNAs (eRNAs. It remains unclear whether super-enhancers robustly activate genes in situ and whether their functions are attributable to eRNAs or the DNA element. CRISPR/Cas9 was used to systematically delete three discrete super-enhancers at the Nanog locus in embryonic stem cells, revealing functional differences in Nanog transcriptional regulation. One distal super-enhancer 45 kb upstream of Nanog (−45 enhancer regulates both nearest neighbor genes, Nanog and Dppa3. Interestingly, eRNAs produced at the −45 enhancer specifically regulate Dppa3 expression by stabilizing looping of the −45 enhancer and Dppa3. Our work illustrates that genomic editing is required to determine enhancer function and points to a method to selectively target a subset of super-enhancer-regulated genes by depleting eRNAs.

  3. The pseudokinase NIPI-4 is a novel regulator of antimicrobial peptide gene expression.

    Directory of Open Access Journals (Sweden)

    Sid Ahmed Labed

    Full Text Available Hosts have developed diverse mechanisms to counter the pathogens they face in their natural environment. Throughout the plant and animal kingdoms, the up-regulation of antimicrobial peptides is a common response to infection. In C. elegans, infection with the natural pathogen Drechmeria coniospora leads to rapid induction of antimicrobial peptide gene expression in the epidermis. Through a large genetic screen we have isolated many new mutants that are incapable of upregulating the antimicrobial peptide nlp-29 in response to infection (i.e. with a Nipi or 'no induction of peptide after infection' phenotype. More than half of the newly isolated Nipi mutants do not correspond to genes previously associated with the regulation of antimicrobial peptides. One of these, nipi-4, encodes a member of a nematode-specific kinase family. NIPI-4 is predicted to be catalytically inactive, thus to be a pseudokinase. It acts in the epidermis downstream of the PKC∂ TPA-1, as a positive regulator of nlp antimicrobial peptide gene expression after infection. It also controls the constitutive expression of antimicrobial peptide genes of the cnc family that are targets of TGFß regulation. Our results open the way for a more detailed understanding of how host defense pathways can be molded by environmental pathogens.

  4. MADS-box genes and gibberellins regulate bolting in lettuce (Lactuca sativa L.

    Directory of Open Access Journals (Sweden)

    Yingyan Han

    2016-12-01

    Full Text Available Bolting in lettuce is promoted by high temperature and bolting resistance is of great economic importance for lettuce production. But how bolting is regulated at the molecular level remains elusive. Here, a bolting resistant line S24 and a bolting sensitive line S39 were selected for morphological, physiological, transcriptomic and proteomic comparisons. A total of 12204 genes were differentially expressed in S39 vs S24. Line S39 was featured with larger leaves, higher levels of chlorophyll, soluble sugar, anthocyanin and auxin, consistent with its up-regulation of genes implicated in photosynthesis, oxidation-reduction and auxin actions. Proteomic analysis identified 30 differentially accumulated proteins in lines S39 and S24 upon heat treatment, and 19 out of the 30 genes showed differential expression in the RNA-Seq data. Exogenous gibberellins (GA treatment promoted bolting in both S39 and S24, while 12 flowering promoting MADS-box genes were specifically induced in line S39, suggesting that although GA regulates bolting in lettuce, it may be the MADS-box genes, not GA, that plays a major role in differing the bolting resistance between these two lettuce lines.

  5. MADS-Box Genes and Gibberellins Regulate Bolting in Lettuce (Lactuca sativaL.).

    Science.gov (United States)

    Han, Yingyan; Chen, Zijing; Lv, Shanshan; Ning, Kang; Ji, Xueliang; Liu, Xueying; Wang, Qian; Liu, Renyi; Fan, Shuangxi; Zhang, Xiaolan

    2016-01-01

    Bolting in lettuce is promoted by high temperature and bolting resistance is of great economic importance for lettuce production. But how bolting is regulated at the molecular level remains elusive. Here, a bolting resistant line S24 and a bolting sensitive line S39 were selected for morphological, physiological, transcriptomic and proteomic comparisons. A total of 12204 genes were differentially expressed in S39 vs. S24. Line S39 was featured with larger leaves, higher levels of chlorophyll, soluble sugar, anthocyanin and auxin, consistent with its up-regulation of genes implicated in photosynthesis, oxidation-reduction and auxin actions. Proteomic analysis identified 30 differentially accumulated proteins in lines S39 and S24 upon heat treatment, and 19 out of the 30 genes showed differential expression in the RNA-Seq data. Exogenous gibberellins (GA) treatment promoted bolting in both S39 and S24, while 12 flowering promoting MADS-box genes were specifically induced in line S39, suggesting that although GA regulates bolting in lettuce, it may be the MADS-box genes, not GA, that plays a major role in differing the bolting resistance between these two lettuce lines.

  6. Synucleins and Gene Expression: Ramblers in a Crowd or Cops Regulating Traffic?

    Directory of Open Access Journals (Sweden)

    Alexei A. Surguchev

    2017-07-01

    Full Text Available Synuclein family consists of three members, α, β, and γ-synuclein. Due to their involvement in human diseases, they have been thoroughly investigated for the last 30 years. Since the first synuclein identification and description, members of this family are found in all vertebrates. Sequencing of their genes indicates high evolutionary conservation suggesting important function(s of these proteins. They are small naturally unfolded proteins prone to aggregate, easily change their conformation, and bind to the membranes. The genes for α, β, and γ-synuclein have different chromosomal localization and a well preserved general organization composed of five coding exons of similar size. Three genes encoding synucleins are present in the majority of vertebrates, however, a variable number of synuclein genes are described in fishes of different species. An important question concerns their normal function in cells and tissues. α-Synuclein is implicated in the regulation of synaptic activity through regulation of synaptic vesicle release, while the physiological functions of two other members of the family is understood less clearly. Here we discuss recent results describing their role in the regulation of gene expression.

  7. Selective serotonin reuptake inhibitor antidepressants potentiate methylphenidate (Ritalin)-induced gene regulation in the adolescent striatum.

    Science.gov (United States)

    Van Waes, Vincent; Beverley, Joel; Marinelli, Michela; Steiner, Heinz

    2010-08-01

    The psychostimulant methylphenidate (Ritalin) is used in conjunction with selective serotonin reuptake inhibitors (SSRIs) in the treatment of medical conditions such as attention-deficit hyperactivity disorder with anxiety/depression comorbidity and major depression. Co-exposure also occurs in patients on SSRIs who use psychostimulant 'cognitive enhancers'. Methylphenidate is a dopamine/norepinephrine reuptake inhibitor that produces altered gene expression in the forebrain; these effects partly mimic gene regulation by cocaine (dopamine/norepinephrine/serotonin reuptake inhibitor). We investigated whether the addition of SSRIs (fluoxetine or citalopram; 5 mg/kg) modified gene regulation by methylphenidate (2-5 mg/kg) in the striatum and cortex of adolescent rats. Our results show that SSRIs potentiate methylphenidate-induced expression of the transcription factor genes zif268 and c-fos in the striatum, rendering these molecular changes more cocaine-like. Present throughout most of the striatum, this potentiation was most robust in its sensorimotor parts. The methylphenidate + SSRI combination also enhanced behavioral stereotypies, consistent with dysfunction in sensorimotor striatal circuits. In so far as such gene regulation is implicated in psychostimulant addiction, our findings suggest that SSRIs may enhance the addiction potential of methylphenidate.

  8. Distinguishing the Transcription Regulation Patterns in Promoters of Human Genes with Different Function or Evolutionary Age

    KAUST Repository

    Alam, Tanvir

    2012-07-01

    Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.

  9. Differential expression of genes regulated in response to drought stress in diploid cotton (Gossypium arboreum) (abstract)

    International Nuclear Information System (INIS)

    Hussain, T.; Majeed, A.; Maqbool, A.; Hussain, S.S.; Ali, T.; Riazuddin, S.

    2005-01-01

    Negative effects on the Water status of plants is one of the most common and deleterious stresses experienced by wild and cultivated plants throughout the World. Our project is designed to identify, clone and characterize gene sequences regulated in response to Water stress (e.g., drought). We used the differential-display reverse transcriptase polymerase chain reaction (DD-RT- PCA) methodology to accomplish our Objectives. Structural and functional characterization of environmental stress-induced genes has contributed to a better understanding of how plants respond and adapt to different abiotic stresses. Differential display was used to compare overall difference in gene expression between draught stressed and unstressed (control) plants of diploid Cotton (Gossypium arboreum). DDRT-PCR product from stressed and unstressed samples resolved side by side on 6% PAGE to compare qualitative and quantitative difference in mRNA expression. A total of 81 primer combinations were tested. DDRT -PCR enabled us to identify differentially expressed transcripts between water stressed and non-stressed cotton seedlings. PAGE revealed a total of 347 DNA transcripts in stressed samples (New Transcripts) while 110 down regulated and 209 up regulated DNA transcripts were also recorded. Similarly. 22 DNA transcripts were identified based on the comparative study of PAGE and Agarose gel electrophoresis. These sequences showed various degree homology With draught tolerant genes in the gene bank. (author)

  10. Regulated gene expression in cultured type II cells of adult human lung.

    Science.gov (United States)

    Ballard, Philip L; Lee, Jae W; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R; Fischer, Horst; Illek, Beate; Gonzales, Linda W; Kolla, Venkatadri; Matthay, Michael A

    2010-07-01

    Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at approximately 95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days on collagen-coated dishes with or without DCI for the final 3 days. In freshly isolated cells, highly expressed genes included SFTPA/B/C, SCGB1A, IL8, CXCL2, and SFN in addition to ubiquitously expressed genes. Transcript abundance was correlated between fetal and adult cells (r = 0.88), with a subset of 187 genes primarily related to inflammation and immunity that were expressed >10-fold higher in adult cells. During control culture, expression increased for 8.1% of expressed genes and decreased for approximately 4% including 118 immune response and 10 surfactant-related genes. DCI treatment promoted lamellar body production and increased expression of approximately 3% of probed genes by > or =1.5-fold; 40% of these were also induced in fetal cells. Highly induced genes (> or =10-fold) included PGC, ZBTB16, DUOX1, PLUNC, CIT, and CRTAC1. Twenty-five induced genes, including six genes related to surfactant (SFTPA/B/C, PGC, CEBPD, and ADFP), also had decreased expression during control culture and thus are candidates for hormonal regulation in vivo. Our results further define the adult human type II cell molecular phenotype and demonstrate that a subset of genes remains hormone responsive in cultured adult cells.

  11. The ERK1/2 pathway regulates testosterone synthesis by coordinately regulating the expression of steroidogenic genes in Leydig cells.

    Science.gov (United States)

    Matzkin, Maria Eugenia; Yamashita, Soichi; Ascoli, Mario

    2013-05-06

    Adult mice with a Leydig cell specific deletion of MAPK kinase (MEK) 1 and 2 (Mek1(f)(/)(f);Mek2(-/-);Cre(+)) mice display Leydig cell hypoplasia and hypergonadotropic hypogonadism. We used radioimmunoassays and quantitative PCR to evaluate the function and expression of the Leydig cell genes involved in the conversion of cholesterol to testosterone (Star, Cyp11a1, Hsd3b6, Cyp17a1 and Hsd17b3), androgen metabolism (Srda1 and Dhrs9), and four transcription factors (Creb1, Nr5a1, Nr4a1 and Nr0b1) that regulate the expression of steroidogenic genes. We show that Star, Hsd3b6, Cyp17a1 and Hsd17b3 are downregulated in Ledyig cells of adult Mek1(f)(/)(f);Mek2(-/-);Cre(+) mice whereas Srda1 and Dhrs9 are upregulated and Creb1, Nr5a1, Nr4a1 and Nr0b1 are unchanged or upregulated. Functionally, all the downregulated genes but none of the upregulated genes contribute to the decrease in testosterone synthesis in Leydig cells of adult Mek1(f)(/)(f);Mek2(-/-);Cre(+) mice because they produce low testosterone and dihydrotestosterone when stimulated with hCG or when incubated with testosterone precursors such as progesterone or androstenedione. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Metabolic Impacts of Using Nitrogen and Copper-Regulated Promoters to Regulate Gene Expression in Neurospora crassa.

    Science.gov (United States)

    Ouyang, Shouqiang; Beecher, Consuelo N; Wang, Kang; Larive, Cynthia K; Borkovich, Katherine A

    2015-07-20

    The filamentous fungus Neurospora crassa is a long-studied eukaryotic microbial system amenable to heterologous expression of native and foreign proteins. However, relatively few highly tunable promoters have been developed for this species. In this study, we compare the tcu-1 and nit-6 promoters for controlled expression of a GFP reporter gene in N. crassa. Although the copper-regulated tcu-1 has been previously characterized, this is the first investigation exploring nitrogen-controlled nit-6 for expression of heterologous genes in N. crassa. We determined that fragments corresponding to 1.5-kb fragments upstream of the tcu-1 and nit-6 open reading frames are needed for optimal repression and expression of GFP mRNA and protein. nit-6 was repressed using concentrations of glutamine from 2 to 20 mM and induced in medium containing 0.5-20 mM nitrate as the nitrogen source. Highest levels of expression were achieved within 3 hr of induction for each promoter and GFP mRNA could not be detected within 1 hr after transfer to repressing conditions using the nit-6 promoter. We also performed metabolic profiling experiments using proton NMR to identify changes in metabolite levels under inducing and repressing conditions for each promoter. The results demonstrate that conditions used to regulate tcu-1 do not significantly change the primary metabolome and that the differences between inducing and repressing conditions for nit-6 can be accounted for by growth under nitrate or glutamine as a nitrogen source. Our findings demonstrate that nit-6 is a tunable promoter that joins tcu-1 as a choice for regulation of gene expression in N. crassa. Copyright © 2015 Ouyang et al.

  13. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  14. Mig-6 regulates endometrial genes involved in cell cycle and progesterone signaling

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jung-Yoon; Kim, Tae Hoon; Lee, Jae Hee [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Dunwoodie, Sally L. [Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, Darlinghurst, New South Wales 2010 (Australia); St. Vincent' s Clinical School and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Kensington, New South Wales 2033 (Australia); Ku, Bon Jeong, E-mail: bonjeong@cnu.ac.kr [Department of Internal Medicine, Chungnam National University School of Medicine, Daejeon (Korea, Republic of); Jeong, Jae-Wook, E-mail: JaeWook.Jeong@hc.msu.edu [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Department of Women' s Health, Spectrum Health System, Grand Rapids, MI (United States)

    2015-07-10

    Mitogen inducible gene 6 (Mig-6) is an important mediator of progesterone (P4) signaling to inhibit estrogen (E2) signaling in the uterus. Ablation of Mig-6 in the murine uterus leads to the development of endometrial hyperplasia and E2-induced endometrial cancer. To identify the molecular pathways regulated by Mig-6, we performed microarray analysis on the uterus of ovariectomized Mig-6{sup f/f} and PGR{sup cre/+}Mig-6{sup f/f} (Mig-6{sup d/d}) mice treated with vehicle or P4 for 6 h. The results revealed that 772 transcripts were significantly regulated in the Mig-6{sup d/d} uterus treated with vehicle as compared with Mig-6{sup f/f} mice. The pathway analysis showed that Mig-6 suppressed the expression of gene-related cell cycle regulation in the absence of ovarian steroid hormone. The epithelium of Mig-6{sup d/d} mice showed a significant increase in the number of proliferative cells compared to Mig-6{sup f/f} mice. This microarray analysis also revealed that 324 genes are regulated by P4 as well as Mig-6. Cited2, the developmentally important transcription factor, was identified as being regulated by the P4-Mig-6 axis. To determine the role of Cited2 in the uterus, we used the mice with Cited2 that were conditionally ablated in progesterone receptor-positive cells (PGR{sup cre/+}Cited2{sup f/f}; Cited2{sup d/d}). Ablation of Cited2 in the uterus resulted in a significant reduction in the ability of the uterus to undergo a hormonally induced decidual reaction. Identification and analysis of these responsive genes will help define the role of P4 as well as Mig-6 in regulating uterine biology. - Highlights: • We identify Mig-6- and P4-regulated uterine genes by microarray analysis. • Mig-6 suppresses cell cycle progression and epithelial cell proliferation in uterus. • We identify the Mig-6 dependent induced genes by P4. • Cited2 plays an important role for decidualization as a P4 and Mig-6 target gene.

  15. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

    Directory of Open Access Journals (Sweden)

    Lahiri Ansuman

    2011-09-01

    Full Text Available Abstract Background HIP1 Protein Interactor (HIPPI is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS, present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a

  16. Detecting coordinated regulation of multi-protein complexes using logic analysis of gene expression

    Directory of Open Access Journals (Sweden)

    Yeates Todd O

    2009-12-01

    Full Text Available Abstract Background Many of the functional units in cells are multi-protein complexes such as RNA polymerase, the ribosome, and the proteasome. For such units to work together, one might expect a high level of regulation to enable co-appearance or repression of sets of complexes at the required time. However, this type of coordinated regulation between whole complexes is difficult to detect by existing methods for analyzing mRNA co-expression. We propose a new methodology that is able to detect such higher order relationships. Results We detect coordinated regulation of multiple protein complexes using logic analysis of gene expression data. Specifically, we identify gene triplets composed of genes whose expression profiles are found to be related by various types of logic functions. In order to focus on complexes, we associate the members of a gene triplet with the distinct protein complexes to which they belong. In this way, we identify complexes related by specific kinds of regulatory relationships. For example, we may find that the transcription of complex C is increased only if the transcription of both complex A AND complex B is repressed. We identify hundreds of examples of coordinated regulation among complexes under various stress conditions. Many of these examples involve the ribosome. Some of our examples have been previously identified in the literature, while others are novel. One notable example is the relationship between the transcription of the ribosome, RNA polymerase and mannosyltransferase II, which is involved in N-linked glycan processing in the Golgi. Conclusions The analysis proposed here focuses on relationships among triplets of genes that are not evident when genes are examined in a pairwise fashion as in typical clustering methods. By grouping gene triplets, we are able to decipher coordinated regulation among sets of three complexes. Moreover, using all triplets that involve coordinated regulation with the ribosome

  17. The Schizophrenia-Associated BRD1 Gene Regulates Behavior, Neurotransmission, and Expression of Schizophrenia Risk Enriched Gene Sets in Mice.

    Science.gov (United States)

    Qvist, Per; Christensen, Jane Hvarregaard; Vardya, Irina; Rajkumar, Anto Praveen; Mørk, Arne; Paternoster, Veerle; Füchtbauer, Ernst-Martin; Pallesen, Jonatan; Fryland, Tue; Dyrvig, Mads; Hauberg, Mads Engel; Lundsberg, Birgitte; Fejgin, Kim; Nyegaard, Mette; Jensen, Kimmo; Nyengaard, Jens Randel; Mors, Ole; Didriksen, Michael; Børglum, Anders Dupont

    2017-07-01

    The schizophrenia-associated BRD1 gene encodes a transcriptional regulator whose comprehensive chromatin interactome is enriched with schizophrenia risk genes. However, the biology underlying the disease association of BRD1 remains speculative. This study assessed the transcriptional drive of a schizophrenia-associated BRD1 risk variant in vitro. Accordingly, to examine the effects of reduced Brd1 expression, we generated a genetically modified Brd1 +/- mouse and subjected it to behavioral, electrophysiological, molecular, and integrative genomic analyses with focus on schizophrenia-relevant parameters. Brd1 +/- mice displayed cerebral histone H3K14 hypoacetylation and a broad range of behavioral changes with translational relevance to schizophrenia. These behaviors were accompanied by striatal dopamine/serotonin abnormalities and cortical excitation-inhibition imbalances involving loss of parvalbumin immunoreactive interneurons. RNA-sequencing analyses of cortical and striatal micropunches from Brd1 +/- and wild-type mice revealed differential expression of genes enriched for schizophrenia risk, including several schizophrenia genome-wide association study risk genes (e.g., calcium channel subunits [Cacna1c and Cacnb2], cholinergic muscarinic receptor 4 [Chrm4)], dopamine receptor D 2 [Drd2], and transcription factor 4 [Tcf4]). Integrative analyses further found differentially expressed genes to cluster in functional networks and canonical pathways associated with mental illness and molecular signaling processes (e.g., glutamatergic, monoaminergic, calcium, cyclic adenosine monophosphate [cAMP], dopamine- and cAMP-regulated neuronal phosphoprotein 32 kDa [DARPP-32], and cAMP responsive element binding protein signaling [CREB]). Our study bridges the gap between genetic association and pathogenic effects and yields novel insights into the unfolding molecular changes in the brain of a new schizophrenia model that incorporates genetic risk at three levels: allelic

  18. Regulating expression of cell and tissue-specific genes by modifying transcription

    Energy Technology Data Exchange (ETDEWEB)

    Beachy, Roger N; Dai, Shunhong

    2010-06-14

    Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Rice bZIP transcription factors RF2a, RF2b and RLP1 play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV), through their interactions with the Box II essential cis element located in the promoter (Dai et al., 2006., Dai et al., 2004., Yin et al., 1997). RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. It is equally as important to recognize that these proteins control plant development by regulating differentiation and/or function of the vascular tissues. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins will not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants. We have proposed characterize the function domains of RF2a, RF2b and RLP1 and explore the biological function of the transcription repressor RLP1.

  19. Stochastic modeling for the expression of a gene regulated by competing transcription factors.

    Directory of Open Access Journals (Sweden)

    Hsih-Te Yang

    Full Text Available It is widely accepted that gene expression regulation is a stochastic event. The common approach for its computer simulation requires detailed information on the interactions of individual molecules, which is often not available for the analyses of biological experiments. As an alternative approach, we employed a more intuitive model to simulate the experimental result, the Markov-chain model, in which a gene is regulated by activators and repressors, which bind the same site in a mutually exclusive manner. Our stochastic simulation in the presence of both activators and repressors predicted a Hill-coefficient of the dose-response curve closer to the experimentally observed value than the calculated value based on the simple additive effects of activators alone and repressors alone. The simulation also reproduced the heterogeneity of gene expression levels among individual cells observed by Fluorescence Activated Cell Sorting analysis. Therefore, our approach may help to apply stochastic simulations to broader experimental data.

  20. Adoption of the Q Transcriptional System for Regulating Gene Expression in Stem Cells.

    Science.gov (United States)

    Fitzgerald, Michael; Gibbs, Chelsea; Shimpi, Adrian A; Deans, Tara L

    2017-11-17

    The field of mammalian synthetic biology seeks to engineer enabling technologies to create novel approaches for programming cells to probe, perturb, and regulate gene expression with unprecedented precision. To accomplish this, new genetic parts continue to be identified that can be used to build novel genetic circuits to re-engineer cells to perform specific functions. Here, we establish a new transcription-based genetic circuit that combines genes from the quinic acid sensing metabolism of Neorospora crassa and the bacterial Lac repressor system to create a new orthogonal genetic tool to be used in mammalian cells. This work establishes a novel genetic tool, called LacQ, that functions to regulate gene expression in Chinese hamster ovarian (CHO) cells, human embryonic kidney 293 (HEK293) cells, and in mouse embryonic stem (ES) cells.

  1. Gene expression regulation in photomorphogenesis from the perspective of the central dogma.

    Science.gov (United States)

    Wu, Shu-Hsing

    2014-01-01

    Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.

  2. Regulation of the adrenoleukodystrophy-related gene (ABCD2): focus on oxysterols and LXR antagonists.

    Science.gov (United States)

    Trompier, Doriane; Gondcaille, Catherine; Lizard, Gérard; Savary, Stéphane

    2014-04-11

    The regulation of the ABCD2 gene is recognized as a possible therapeutic target for X-linked adrenoleukodystrophy, a rare neurodegenerative disease caused by mutations in the ABCD1 gene. Up-regulation of ABCD2 expression has indeed been demonstrated to compensate for ABCD1 deficiency, restoring peroxisomal β-oxidation of very-long-chain fatty acids. Besides the known inducers of the ABCD2 gene (phenylbutyrate and histone deacetylase inhibitors, fibrates, dehydroepiandrosterone, thyroid hormone and thyromimetics), this review will focus on LXR antagonists and 22S-hydroxycholesterol, recently described as inducers of ABCD2 expression. Several LXR antagonists have been identified and their possible indication for neurodegenerative disorders will be discussed. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Detection of oestrogenic chemicals by assaying the expression level of oestrogen regulated genes

    DEFF Research Database (Denmark)

    Jørgensen, M; Hummel, R; Bévort, M

    1998-01-01

    or the yeast E-screen, with methods that are based on mammalian cells or whole animals. An alternative is to assay gene expression directly by methods such as differential display, where the expression of both genes known to be regulated directly by the receptor and genes regulated by other pathways can...... pathways and its intrinsic transcriptional activity is highly influenced by phosphorylation and by its interaction with other proteins. This is clearly observed when the oestrogenicity of antioestrogens is tested since some compounds activate the receptor in yeast, but not in mammalian cells. However, when......, it is important to assay both their potency as activators of transcription as the effects caused by interactions with other signal transduction pathways. This may be possible by combining assay methods, such as direct in vitro measurement of interaction between a potential oestrogenic chemical and the receptor...

  4. Non-coding Transcripts from Enhancers: New Insights into Enhancer Activity and Gene Expression Regulation

    Directory of Open Access Journals (Sweden)

    Hongjun Chen

    2017-06-01

    Full Text Available Long non-coding RNAs (lncRNAs have gained widespread interest in the past decade owing to their enormous amount and surprising functions implicated in a variety of biological processes. Some lncRNAs exert function as enhancers, i.e., activating gene transcription by serving as the cis-regulatory molecules. Furthermore, recent studies have demonstrated that many enhancer elements can be transcribed and produce RNA molecules, which are termed as enhancer RNAs (eRNAs. The eRNAs are not merely the by-product of the enhancer transcription. In fact, many of them directly exert or regulate enhancer activity in gene activation through diverse mechanisms. Here, we provide an overview of enhancer activity, transcription of enhancer itself, characteristics of eRNAs, as well as their roles in regulating enhancer activity and gene expression.

  5. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  6. Regulation of gene expression and RNA editing in Drosophila adapting to divergent microclimates.

    Science.gov (United States)

    Yablonovitch, Arielle L; Fu, Jeremy; Li, Kexin; Mahato, Simpla; Kang, Lin; Rashkovetsky, Eugenia; Korol, Abraham B; Tang, Hua; Michalak, Pawel; Zelhof, Andrew C; Nevo, Eviatar; Li, Jin Billy

    2017-11-17

    Determining the mechanisms by which a species adapts to its environment is a key endeavor in the study of evolution. In particular, relatively little is known about how transcriptional processes are fine-tuned to adjust to different environmental conditions. Here we study Drosophila melanogaster from 'Evolution Canyon' in Israel, which consists of two opposing slopes with divergent microclimates. We identify several hundred differentially expressed genes and dozens of differentially edited sites between flies from each slope, correlate these changes with genetic differences, and use CRISPR mutagenesis to validate that an intronic SNP in prominin regulates its editing levels. We also demonstrate that while temperature affects editing levels at more sites than genetic differences, genetically regulated sites tend to be less affected by temperature. This work shows the extent to which gene expression and RNA editing differ between flies from different microclimates, and provides insights into the regulation responsible for these differences.

  7. FDA Regulation of Clinical Applications of CRISPR-CAS Gene-Editing Technology.

    Science.gov (United States)

    Grant, Evita V

    Scientists have repurposed an adaptive immune system of single cell organisms to create a new type of gene-editing tool: CRISPR (clustered regularly interspaced short palindromic repeats)-Cas technology. Scientists in China have reported its use in the genome modification of non-viable human embryos. This has ignited a spirited debate about the moral, ethical, scientific, and social implications of human germline genome engineering. There have also been calls for regulations; however, FDA has yet to formally announce its oversight of clinical applications of CRISPR-Cas systems. This paper reviews FDA regulation of previously controversial biotechnology breakthroughs, recombinant DNA and human cloning. It then shows that FDA is well positioned to regulate CRISPR-Cas clinical applications, due to its legislative mandates, its existing regulatory frameworks for gene therapies and assisted reproductive technologies, and other considerations.

  8. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh [Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014 (India); Godbole, Madan M., E-mail: madangodbole@yahoo.co.in [Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014 (India)

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  9. H-ferritin-regulated microRNAs modulate gene expression in K562 cells.

    Directory of Open Access Journals (Sweden)

    Flavia Biamonte

    Full Text Available In a previous study, we showed that the silencing of the heavy subunit (FHC offerritin, the central iron storage molecule in the cell, is accompanied by a modification in global gene expression. In this work, we explored whether different FHC amounts might modulate miRNA expression levels in K562 cells and studied the impact of miRNAs in gene expression profile modifications. To this aim, we performed a miRNA-mRNA integrative analysis in K562 silenced for FHC (K562shFHC comparing it with K562 transduced with scrambled RNA (K562shRNA. Four miRNAs, namely hsa-let-7g, hsa-let-7f, hsa-let-7i and hsa-miR-125b, were significantly up-regulated in silenced cells. The remarkable down-regulation of these miRNAs, following FHC expression rescue, supports a specific relation between FHC silencing and miRNA-modulation. The integration of target predictions with miRNA and gene expression profiles led to the identification of a regulatory network which includes the miRNAs up-regulated by FHC silencing, as well as91 down-regulated putative target genes. These genes were further classified in 9 networks; the highest scoring network, "Cell Death and Survival, Hematological System Development and Function, Hematopoiesis", is composed by 18 focus molecules including RAF1 and ERK1/2. We confirmed that, following FHC silencing, ERK1/2 phosphorylation is severely impaired and that RAF1 mRNA is significantly down-regulated. Taken all together, our data indicate that, in our experimental model, FHC silencing may affect RAF1/pERK1/2 levels through the modulation of a specific set of miRNAs and add new insights in to the relationship among iron homeostasis and miRNAs.

  10. Addiction-Related Gene Regulation: Risks of Exposure to Cognitive Enhancers vs. Other Psychostimulants

    Science.gov (United States)

    Steiner, Heinz; Van Waes, Vincent

    2012-01-01

    The psychostimulants methylphenidate (Ritalin, Concerta), amphetamine (Adderall), and modafinil (Provigil) are widely used in the treatment of medical conditions such as attention-deficit hyperactivity disorder and narcolepsy and, increasingly, as “cognitive enhancers” by healthy people. The long-term neuronal effects of these drugs, however, are poorly understood. A substantial amount of research over the past 2 decades has investigated the effects of psychostimulants such as cocaine and amphetamines on gene regulation in the brain because these molecular changes are considered critical for psychostimulant addiction. This work has determined in some detail the neurochemical and cellular mechanisms that mediate psychostimulant-induced gene regulation and has also identified the neuronal systems altered by these drugs. Among the most affected brain systems are corticostriatal circuits, which are part of cortico-basal ganglia-cortical loops that mediate motivated behavior. The neurotransmitters critical for such gene regulation are dopamine in interaction with glutamate, while other neurotransmitters (e.g., serotonin) play modulatory roles. This review presents (1) an overview of the main findings on cocaine- and amphetamine-induced gene regulation in corticostriatal circuits in an effort to provide a cellular framework for (2) an assessment of the molecular changes produced by methylphenidate, medical amphetamine (Adderall), and modafinil. The findings lead to the conclusion that protracted exposure to these cognitive enhancers can induce gene regulation effects in corticostriatal circuits that are qualitatively similar to those of cocaine and other amphetamines. These neuronal changes may contribute to the addiction liability of the psychostimulant cognitive enhancers. PMID:23085425

  11. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  12. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G.; Akman, Ozgur E.; Soyer, Orkun S.

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  13. Promoter methylation and gene polymorphism are two independent events in regulation of GSTP1 gene expression.

    Science.gov (United States)

    Bhat, Aaliya; Masood, A; Wani, K A; Bhat, Younus Ahmad; Nissar, Bushra; Khan, Nuzhat Shaheen; Ganai, B A

    2017-04-01

    Breast carcinogenesis is a multistep process, involving both genetic and epigenetic modification process of genes, involved in diverse pathways ranging from DNA repair to metabolic processes. This study was undertaken to assess the role of promoter methylation of GSTP1 gene, a member of glutathione-S-transferase family of enzymes, in relation to its expression, polymorphism, and clinicopathological parameters. Tissue samples were taken from breast cancer patients and paired with their normal adjacent tissues. A total of 51 subjects were studied, in which the frequency of promoter methylation in cancerous tissue was 37.25% as against 11% in the normal tissues ( p ≤ 0.001). The hypermethylated status of the gene was significantly associated with the loss of the protein expression ( r = -0.449, p = 0.001, odds ratio = 7.42, 95% confidence interval = 2.05-26.92). Furthermore, when compared with the clinical parameters, the significant association was found between the promoter hypermethylation and lymph node metastasis ( p ≤ 0.001), tumor stage ( p = 0.039), tumor grade ( p = 0.028), estrogen receptor status ( p = 0.018), and progesterone receptor status ( p = 0.046). Our study is the first of its kind in Kashmiri population, which indicates that GSTP1 shows aberrant methylation pattern in the breast cancer with the consequent loss in the protein expression. Furthermore, it also shows that the gene polymorphism (Ile105Val) at codon 105 is not related to the promoter methylation and two are the independent events in breast cancer development.

  14. Independent regulation of gene expression level and noise by histone modifications.

    Science.gov (United States)

    Wu, Shaohuan; Li, Ke; Li, Yingshu; Zhao, Tong; Li, Ting; Yang, Yu-Fei; Qian, Wenfeng

    2017-06-01

    The inherent stochasticity generates substantial gene expression variation among isogenic cells under identical conditions, which is frequently referred to as gene expression noise or cell-to-cell expression variability. Similar to (average) expression level, expression noise is also subject to natural selection. Yet it has been observed that noise is negatively correlated with expression level, which manifests as a potential constraint for simultaneous optimization of both. Here, we studied expression noise in human embryonic cells with computational analysis on single-cell RNA-seq data and in yeast with flow cytometry experiments. We showed that this coupling is overcome, to a certain degree, by a histone modification strategy in multiple embryonic developmental stages in human, as well as in yeast. Importantly, this epigenetic strategy could fit into a burst-like gene expression model: promoter-localized histone modifications (such as H3K4 methylation) are associated with both burst size and burst frequency, which together influence expression level, while gene-body-localized ones (such as H3K79 methylation) are more associated with burst frequency, which influences both expression level and noise. We further knocked out the only "writer" of H3K79 methylation in yeast, and observed that expression noise is indeed increased. Consistently, dosage sensitive genes, such as genes in the Wnt signaling pathway, tend to be marked with gene-body-localized histone modifications, while stress responding genes, such as genes regulating autophagy, tend to be marked with promoter-localized ones. Our findings elucidate that the "division of labor" among histone modifications facilitates the independent regulation of expression level and noise, extend the "histone code" hypothesis to include expression noise, and shed light on the optimization of transcriptome in evolution.

  15. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression

    Science.gov (United States)

    Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz

    2001-11-01

    Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.

  16. A novel role for Tm7sf2 gene in regulating TNFα expression.

    Directory of Open Access Journals (Sweden)

    Ilaria Bellezza

    Full Text Available We have explored the role of Tm7sf2 gene, which codifies for 3β-hydroxysterol Δ14-reductase, an endoplasmic reticulum resident protein, in the sensitivity to endoplasmic reticulum stress and in the resulting inflammatory response. We used mouse embryonic fibroblasts, derived from Tm7sf2(+/+ and Tm7sf2(-/- mice, to determine the in vitro effects of thapsigargin on NF-κB activation. Our results show that the Tm7sf2 gene controls the launch of the unfolded protein response and presides an anti-inflammatory loop thus its absence correlates with NF-κB activation and TNFα up-regulation. Our data also show that Tm7sf2 gene regulates liver X receptor activation and its absence inhibits LXR signalling. By expressing the hTm7sf2 gene in KO MEFs and observing a reduced NF-κB activation, we have confirmed that Tm7sf2 gene is linked to NF-κB activation. Finally we used genetically modified mice in an in vivo model of ER stress and of inflammation. Our results show a significant increase in renal TNFα expression after tunicamycin exposure and in the oedematogenic response in Tm7sf2(-/- mice. In conclusion, we have shown that the Tm7sf2 gene, to date involved only in cholesterol biosynthesis, also controls an anti-inflammatory loop thereby confirming the existence of cross talk between metabolic pathways and inflammatory response.

  17. Polyunsaturated fatty acid regulation of gene transcription: a molecular mechanism to improve the metabolic syndrome.

    Science.gov (United States)

    Clarke, S D

    2001-04-01

    This review addresses the hypothesis that polyunsaturated fatty acids (PUFA), particularly those of the (n-3) family, play pivotal roles as "fuel partitioners" in that they direct fatty acids away from triglyceride storage and toward oxidation, and that they enhance glucose flux to glycogen. In doing this, PUFA may protect against the adverse symptoms of the metabolic syndrome and reduce the risk of heart disease. PUFA exert their beneficial effects by up-regulating the expression of genes encoding proteins involved in fatty acid oxidation while simultaneously down-regulating genes encoding proteins of lipid synthesis. PUFA govern oxidative gene expression by activating the transcription factor peroxisome proliferator-activated receptor alpha. PUFA suppress lipogenic gene expression by reducing the nuclear abundance and DNA-binding affinity of transcription factors responsible for imparting insulin and carbohydrate control to lipogenic and glycolytic genes. In particular, PUFA suppress the nuclear abundance and expression of sterol regulatory element binding protein-1 and reduce the DNA-binding activities of nuclear factor Y, Sp1 and possibly hepatic nuclear factor-4. Collectively, the studies discussed suggest that the fuel "repartitioning" and gene expression actions of PUFA should be considered among criteria used in defining the dietary needs of (n-6) and (n-3) and in establishing the dietary ratio of (n-6) to (n-3) needed for optimum health benefit.

  18. Tag team: Roles of miRNAs and Proteolytic Regulators in Ensuring Robust Gene Expression Dynamics.

    Science.gov (United States)

    Weaver, Benjamin P; Han, Min

    2018-01-01

    Lack of prominent developmental defects arising from loss of many individual miRNAs is consistent with the observations of collaborative networks between miRNAs and roles for miRNAs in regulating stress responses. However, these characteristics may only partially explain the seemingly nonessential nature of many miRNAs. Non-miRNA gene expression regulatory mechanisms also collaborate with miRNA-induced silencing complex (miRISC) to support robust gene expression dynamics. Genetic enhancer screens have revealed roles of miRNAs and other gene repressive mechanisms in development or other cellular processes that were masked by genetic redundancy. Besides discussing the breadth of the non-miRNA genes, we use LIN-28 as an example to illustrate how distinct regulatory systems, including miRNAs and multiple protein stability mechanisms, work at different levels to target expression of a given gene and provide tissue-specific and stage-specific regulation of gene expression. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. POF and HP1 bind expressed exons, suggesting a balancing mechanism for gene regulation.

    Directory of Open Access Journals (Sweden)

    Anna-Mia Johansson

    2007-11-01

    Full Text Available Two specific chromosome-targeting and gene regulatory systems are present in Drosophila melanogaster. The male X chromosome is targeted by the male-specific lethal complex believed to mediate the 2-fold up-regulation of the X-linked genes, and the highly heterochromatic fourth chromosome is specifically targeted by the Painting of Fourth (POF protein, which, together with heterochromatin protein 1 (HP1, modulates the expression level of genes on the fourth chromosome. Here we use chromatin immunoprecipitation and tiling microarray analysis to map POF and HP1 on the fourth chromosome in S2 cells and salivary glands at high resolution. The enrichment profiles were complemented by transcript profiles to examine the link between binding and transcripts. The results show that POF specifically binds to genes, with a strong preference for exons, and the HP1 binding profile is a mirror image of POF, although HP1 displays an additional "peak" in the promoter regions of bound genes. HP1 binding within genes is much higher than the basal HP1 enrichment on Chromosome 4. Our results suggest a balancing mechanism for the regulation of the fourth chromosome where POF and HP1 competitively bind at increasing levels with increased transcriptional activity. In addition, our results contradict transposable elements as a major nucleation site for HP1 on the fourth chromosome.

  20. Characterization of a small PlcR-regulated gene co-expressed with cereolysin O

    Directory of Open Access Journals (Sweden)

    Lereclus Didier

    2007-06-01

    Full Text Available Abstract Background In the human pathogen Bacillus cereus, the expression of most extracellular virulence factors is controlled by the transcriptional activator PlcR. Among these virulence factors, cereolysin O (Clo is an haemolysin belonging to the cholesterol-dependant cytolysins, a protein family extensively studied in Gram-positive bacteria. Results In the genomes of bacteria belonging to the B. cereus group, including Bacillus anthracis and Bacillus thuringiensis, a small gene encoding a 26-amino acid peptide was present in multicopy. One copy was always found upstream from the gene encoding Clo. In B. cereus ATCC 14579, the small gene and the clo gene are co-transcribed. Transcriptional fusions showed that the three paralogues identified in this strain were expressed in a PlcR-dependent manner. We propose to name these peptides Spp for small PlcR-regulated peptides. We show that a synthetic peptide corresponding to the deduced product of the spp genes displayed antibacterial activity. Conclusion The co-expression of spp, a small PlcR-regulated multicopy gene with clo suggests a yet unidentified relationship between Spp and the cholesterol-dependent cytolysin in bacteria belonging to the B.cereus group.

  1. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    Energy Technology Data Exchange (ETDEWEB)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J. (Scripps Clinic and Research Foundation, La Jolla, CA (USA))

    1988-08-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5{prime} flanking region of the gene revealed a perfect TATA box at position {minus}28 to position {minus}23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5{prime} flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk{sup {minus}} fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides {minus}305 and +75 of the plasminogen activator inhibitor type 1 gene.

  2. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  3. DNA breaks and chromatin structural changes enhance the transcription of autoimmune regulator target genes.

    Science.gov (United States)

    Guha, Mithu; Saare, Mario; Maslovskaja, Julia; Kisand, Kai; Liiv, Ingrid; Haljasorg, Uku; Tasa, Tõnis; Metspalu, Andres; Milani, Lili; Peterson, Pärt

    2017-04-21

    The autoimmune regulator (AIRE) protein is the key factor in thymic negative selection of autoreactive T cells by promoting the ectopic expression of tissue-specific genes in the thymic medullary epithelium. Mutations in AIRE cause a monogenic autoimmune disease called autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy. AIRE has been shown to promote DNA breaks via its interaction with topoisomerase 2 (TOP2). In this study, we investigated topoisomerase-induced DNA breaks and chromatin structural alterations in conjunction with AIRE-dependent gene expression. Using RNA sequencing, we found that inhibition of TOP2 religation activity by etoposide in AIRE-expressing cells had a synergistic effect on genes with low expression levels. AIRE-mediated transcription was not only enhanced by TOP2 inhibition but also by the TOP1 inhibitor camptothecin. The transcriptional activation was associated with structural rearrangements in chromatin, notably the accumulation of γH2AX and the exchange of histone H1 with HMGB1 at AIRE target gene promoters. In addition, we found the transcriptional up-regulation to co-occur with the chromatin structural changes within the genomic cluster of carcinoembryonic antigen-like cellular adhesion molecule genes. Overall, our results suggest that the presence of AIRE can trigger molecular events leading to an altered chromatin landscape and the enhanced transcription of low-expressed genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Global analysis of epigenetic regulation of gene expression in response to drought stress in Sorghum.

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Anireddy [Colorado State Univ., Fort Collins, CO (United States); Ben-Hur, Asa [Colorado State Univ., Fort Collins, CO (United States)

    2017-11-22

    Abiotic stresses including drought are major limiting factors of crop yields and cause significant crop losses. Acquisition of stress tolerance to abiotic stresses requires coordinated regulation of a multitude of biochemical and physiological changes, and most of these changes depend on alterations in gene expression. The goal of this work is to perform global analysis of differential regulation of gene expression and alternative splicing, and their relationship with chromatin landscape in drought sensitive and tolerant cultivars. our Iso-Seq study revealed transcriptome-wide full-length isoforms at an unprecedented scale with over 11000 novel splice isoforms. Additionally, we uncovered alternative polyadenylation sites of ~11000 expressed genes and many novel genes. Overall, Iso-Seq results greatly enhanced sorghum gene annotations that are not only useful in analyzing all our RNA-seq, ChIP-seq and ATAC-seq data but also serve as a great resource to the plant biology community. Our studies identified differentially expressed genes and splicing events that are correlated with the drought-resistant phenotype. An association between alternative splicing and chromatin accessibility was also revealed. Several computational tools developed here (TAPIS and iDiffIR) have been made freely available to the research community in analyzing alternative splicing and differential alternative splicing.

  5. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: ljungman@umich.edu [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)

    2015-06-15

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.

  6. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells

    International Nuclear Information System (INIS)

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats

    2015-01-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death

  7. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

    Science.gov (United States)

    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

    2016-09-01

    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Cognitive function affects trainability for physical performance in exercise intervention among older adults with mild cognitive impairment

    Directory of Open Access Journals (Sweden)

    Uemura K

    2013-01-01

    Full Text Available Kazuki Uemura,1,3 Hiroyuki Shimada,1 Hyuma Makizako,1,3 Takehiko Doi,1 Daisuke Yoshida,1 Kota Tsutsumimoto,1 Yuya Anan,1 Takao Suzuki21Section for Health Promotion, Department for Research and Development to Support Independent Life of Elderly, Center for Gerontology and Social Science, National Center for Geriatrics and Gerontology, 2Research Institute, National Center for Geriatrics and Gerontology, Aichi, 3Japan Society for the Promotion of Science, Tokyo, JapanBackground: Although much evidence supports the hypothesis that cognitive function and physical function are interrelated, it is unclear whether cognitive decline with mild cognitive impairment influences trainability of physical performance in exercise intervention. The purpose of this study was to examine the association between cognitive function at baseline and change in physical performance after exercise intervention in older adults with mild cognitive impairment.Methods: Forty-four older adults diagnosed with mild cognitive impairment based on the Peterson criteria (mean age 74.8 years consented to and completed a 6-month twice weekly exercise intervention. The Timed Up and Go (TUG test was used as a measure of physical performance. The Mini-Mental State Examination (MMSE, Trail Making Test Part B, Geriatric Depression Scale, baseline muscle strength of knee extension, and attendance rate of intervention, were measured as factors for predicting trainability.Results: In the correlation analysis, the change in TUG showed modest correlations with attendance rate in the exercise program (r = -0.354, P = 0.027 and MMSE at baseline (r = -0.321, P = 0.034. A multiple regression analysis revealed that change in TUG was independently associated with attendance rate (ß = -0.322, P = 0.026 and MMSE score (ß = -0.295, P = 0.041, controlling for age and gender.Conclusion: General cognitive function was associated with improvements in physical performance after exercise intervention in

  9. Transcriptional Regulation of Aluminum-Tolerance Genes in Higher Plants: Clarifying the Underlying Molecular Mechanisms

    Directory of Open Access Journals (Sweden)

    Abhijit A. Daspute

    2017-08-01

    Full Text Available Aluminum (Al rhizotoxicity is one of the major environmental stresses that decrease global food production. Clarifying the molecular mechanisms underlying Al tolerance may contribute to the breeding of Al-tolerant crops. Recent studies identified various Al-tolerance genes. The expression of these genes is inducible by Al. Studies of the major Arabidopsis thaliana Al-tolerance gene, ARABIDOPSIS THALIANA ALUMINUM-ACTIVATED MALATE TRANSPORTER 1 (AtALMT1, which encodes an Al-activated malate transporter, revealed that the Al-inducible expression is regulated by a SENSITIVE TO PROTON RHIXOTOXICITY 1 (STOP1 zinc-finger transcription factor. This system, which involves STOP1 and organic acid transporters, is conserved in diverse plant species. The expression of AtALMT1 is also upregulated by several phytohormones and hydrogen peroxide, suggesting there is crosstalk among the signals involved in the transcriptional regulation of AtALMT1. Additionally, phytohormones and reactive oxygen species (ROS activate various transcriptional responses, including the expression of genes related to increased Al tolerance or the suppression of root growth under Al stress conditions. For example, Al suppressed root growth due to abnormal accumulation of auxin and cytokinin. It activates transcription of TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS 1 and other phytohormone responsive genes in distal transition zone, which causes suppression of root elongation. On the other hand, overexpression of Al inducible genes for ROS-detoxifying enzymes such as GLUTATHIONE–S-TRANSFERASE, PEROXIDASE, SUPEROXIDE DISMUTASE enhances Al resistance in several plant species. We herein summarize the complex transcriptional regulation of an Al-inducible genes affected by STOP1, phytohormones, and ROS.

  10. Progesterone receptor-dependent regulation of genes in the oviducts of female mice.

    Science.gov (United States)

    Akison, Lisa K; Boden, Michael J; Kennaway, David J; Russell, Darryl L; Robker, Rebecca L

    2014-08-15

    Oviducts play a critical role in gamete and embryo transport, as well as supporting early embryo development. Progesterone receptor (PGR) is a transcription factor highly expressed in oviductal cells, while its activating ligand, progesterone, surges to peak levels as ovulation approaches. Progesterone is known to regulate oviduct cilia beating and muscular contractions in vitro, but how PGR may mediate this in vivo is poorly understood. We used PGR null mice to identify genes potentially regulated by PGR in the oviducts during the periovulatory period. Histologically, oviducts from PGR null mice showed no gross structural or morphological defects compared with normal littermates. However, microarray analysis of oviducts at 8 h posthuman chorionic gonadotropin revealed >1,000 PGR-dependent genes. Using reverse-transcription polymerase chain reaction (RT-PCR) we selected 10 genes for validation based on their potential roles in oocyte/embryo transport and support. Eight genes were confirmed to be downregulated (Adamts1, Itga8, Edn3, Prlr, Ptgfr, Des, Myocd, and Actg2) and one upregulated (Agtr2) in PGR null oviducts. Expression of these genes was also assessed in oviducts of naturally cycling mice during ovulation and day 1 and day 4 of pregnancy. Adamts1, Itga8, Edn3, Prlr, and Ptgfr were significantly upregulated in oviducts at ovulation/mating. However, most genes showed basal levels of expression at other times. The exceptions were Prlr and Ptgfr, which showed pulsatile increases on day 1 and/or day 4 of pregnancy. This is the first, comprehensive study to elucidate putative PGR-regulated genes in the oviduct and reveals key downstream targets potentially mediating oocyte and embryo transport. Copyright © 2014 the American Physiological Society.

  11. Disbalance of calcium regulation-related genes in broiler hearts induced by selenium deficiency.

    Science.gov (United States)

    Zhang, Ziwei; Liu, Man; Guan, Zhenqiong; Yang, Jie; Liu, Zhonghua; Xu, Shiwen

    2017-06-01

    Dietary selenium (Se) deficiency may influence the calcium (Ca) homeostasis in broilers. Our objective was to investigate the effects of Se deficiency on Ca regulation-related genes in broiler hearts. In the present study, 1-day-old broilers were fed either a commercial diet (as control group) with 0.15 mg/kg Se or a Se-deficient diet (as L group) with 0.033 mg/kg Se for 35 days. We examined the mRNA expression levels of 15 Ca regulation-related genes (ITPR 1, ITPR 2, ITPR3, RyR2, RyR3, SERCA1s, SLC8A1, PMCA1, CACNA1S, TRPC1, TRPC3, stromal interacting molecule 1, ORAI1, calmodulin (CaLM) and calreticulin (CRT) in broiler hearts. Then, Kyoto Encyclopedia of Genes and Genomes analysis, protein-protein interactions (PPI) analysis and correlation analysis were performed to analyse the relationships between these genes. The results showed that the mRNA expression levels of ITPR 1, ITPR 2, RyR2, RyR3, SERCA1s, SLC8A1, PMCA1, CACNA1S, CaLM and CRT were generally decreased by Se deficiency, while mRNA expression levels of TRPC1, TRPC3, stromal interacting molecule 1, ORAI1 and ITPR3 were increased by Se deficiency. Kyoto Encyclopedia of Genes and Genomes and PPI analysis showed that these Ca regulation-related genes are involved in the Ca signalling pathway and a total of 15 PPIs with a combined score of >0.4 were obtained. In conclusion, the results demonstrated that Se deficiency might cause heart injury via modulating the Ca-related pathway genes, and then induce Ca 2+ overload in the heart of broilers.

  12. Global regulation of gene expression by the MafR protein of Enterococcus faecalis

    Directory of Open Access Journals (Sweden)

    Sofía eRuiz-Cruz

    2016-01-01

    Full Text Available Enterococcus faecalis is a natural inhabitant of the human gastrointestinal tract. However, as an opportunistic pathogen, it is able to colonize other host niches and cause life-threatening infections. Its adaptation to new environments involves global changes in gene expression. The EF3013 gene (here named mafR of E. faecalis strain V583 encodes a protein (MafR, 482 residues that has sequence similarity to global response regulators of the Mga/AtxA family. The enterococcal OG1RF genome also encodes the MafR protein (gene OG1RF_12293. In this work, we have identified the promoter of the mafR gene using several in vivo approaches. Moreover, we show that MafR influences positively the transcription of many genes on a genome-wide scale. The most significant target genes encode components of PTS-type membrane transporters, components of ABC-type membrane transporters, and proteins involved in the metabolism of carbon sources. Some of these genes were previously reported to be up-regulated during the growth of E. faecalis in blood and/or in human urine. Furthermore, we show that a mafR deletion mutant strain induces a significant lower degree of inflammation in the peritoneal cavity of mice, suggesting that enterococcal cells deficient in MafR are less virulent. Our work indicates that MafR is a global transcriptional regulator. It might facilitate the adaptation of E. faecalis to particular host niches and, therefore, contribute to its potential virulence.

  13. Regulation of Three Nitrogenase Gene Clusters in the Cyanobacterium Anabaena variabilis ATCC 29413

    Directory of Open Access Journals (Sweden)

    Teresa Thiel

    2014-12-01

    Full Text Available The filamentous cyanobacterium Anabaena variabilis ATCC 29413 fixes nitrogen under aerobic conditions in specialized cells called heterocysts that form in response to an environmental deficiency in combined nitrogen. Nitrogen fixation is mediated by the enzyme nitrogenase, which is very sensitive to oxygen. Heterocysts are microxic cells that allow nitrogenase to function in a filament comprised primarily of vegetative cells that produce oxygen by photosynthesis. A. variabilis is unique among well-characterized cyanobacteria in that it has three nitrogenase gene clusters that encode different nitrogenases, which function under different environmental conditions. The nif1 genes encode a Mo-nitrogenase that functions only in heterocysts, even in filaments grown anaerobically. The nif2 genes encode a different Mo-nitrogenase that functions in vegetative cells, but only in filaments grown under anoxic conditions. An alternative V-nitrogenase is encoded by vnf genes that are expressed only in heterocysts in an environment that is deficient in Mo. Thus, these three nitrogenases are expressed differentially in response to environmental conditions. The entire nif1 gene cluster, comprising at least 15 genes, is primarily under the control of the promoter for the first gene, nifB1. Transcriptional control of many of the downstream nif1 genes occurs by a combination of weak promoters within the coding regions of some downstream genes and by RNA processing, which is associated with increased transcript stability. The vnf genes show a similar pattern of transcriptional and post-transcriptional control of expression suggesting that the complex pattern of regulation of the nif1 cluster is conserved in other cyanobacterial nitrogenase gene clusters.

  14. Mechanisms of Hypoxic Up-Regulation of Versican Gene Expression in Macrophages.

    Directory of Open Access Journals (Sweden)

    Fattah Sotoodehnejadnematalahi

    Full Text Available Hypoxia is a hallmark of many pathological tissues. Macrophages accumulate in hypoxic sites and up-regulate a range of hypoxia-inducible genes. The matrix proteoglycan versican has been identified as one such gene, but the mechanisms responsible for hypoxic induction are not fully characterised. Here we investigate the up-regulation of versican by hypoxia in primary human monocyte-derived macrophages (HMDM, and, intriguingly, show that versican mRNA is up-regulated much more highly (>600 fold by long term hypoxia (5 days than by 1 day of hypoxia (48 fold. We report that versican mRNA decay rates are not affected by hypoxia, demonstrating that hypoxic induction of versican mRNA is mediated by increased transcription. Deletion analysis of the promoter identified two regions required for high level promoter activity of luciferase reporter constructs in human macrophages. The hypoxia-inducible transcription factor HIF-1 has previously been implicated as a key potential regulator of versican expression in hypoxia, however our data suggest that HIF-1 up-regulation is unlikely to be principally responsible for the high levels of induction observed in HMDM. Treatment of HMDM with two distinct specific inhibitors of Phosphoinositide 3-kinase (PI3K, LY290042 and wortmannin, significantly reduced induction of versican mRNA by hypoxia and provides evidence of a role for PI3K in hypoxic up-regulation of versican expression.

  15. MicroRNA 429 Regulates Mucin Gene Expression and Secretion in Murine Model of Colitis.

    Science.gov (United States)

    Mo, Ji-Su; Alam, Khondoker Jahengir; Kim, Hun-Soo; Lee, Young-Mi; Yun, Ki-Jung; Chae, Soo-Cheon

    2016-07-01

    miRNAs are non-coding RNAs that play important roles in the pathogenesis of human diseases by regulating target gene expression in specific cells or tissues. We aimed to detect miRNAs related to ulcerative colitis [UC], identify their target molecules, and analyse the correlation between the miRNAs and their target genes in colorectal cells and dextran sulphate sodium [DSS]-induced mouse colitis. UC-associated miRNAs were identified by miRNA microarray analysis using DSS-induced colitis and normal colon tissues. The results were validated by quantitative real-time polymerase chain reaction [RT-PCR]. We identified target genes of MIR429, a colitis-associated miRNA, from our screen by comparing the mRNA microarray analysis in MIR429-overexpressed cells with predicted candidate target genes. We constructed luciferase reporter plasmids to confirm the effect of MIR429 on target gene expression. The protein expression of the target genes was measured by western blot,enzyme-linked immunosorbent assay [ELISA] analysis, or immunohistochemistry. We identified 37 DSS-induced colitis associated miRNAs. We investigated MIR429 that is down-regulated in DSS-induced colitis, and identified 41 target genes of MIR429. We show that the myristoylated alanine-rich protein kinase C substrate [MARCKS] is a direct target of MIR429. MARCKS mRNA and protein expression levels are down-regulated by MIR429, and MIR429 regulates the expression of MARCKS and MARCKS-mediated mucin secretion in colorectal cells and DSS-induced colitis. In addition, anti-MIR429 up-regulates MARCKS expression in colorectal cell lines. Our findings suggest that MIR429 modulates mucin secretion in human colorectal cells and mouse colitis tissues by up-regulating of MARCKS expression, thereby making MIR429 a candidate for anti-colitis therapy in human UC. Copyright © 2016 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email

  16. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich

    2009-01-01

    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  17. Regulation of myelin genes implicated in psychiatric disorders by functional activity in axons

    Directory of Open Access Journals (Sweden)

    Philip R Lee

    2009-06-01

    Full Text Available Myelination is a highly dynamic process that continues well into adulthood in humans. Several recent gene expression studies have found abnormal expression of genes involved in myelination in the prefrontal cortex of brains from patients with schizophrenia and other psychiatric illnesses. Defects in myelination could contribute to the pathophysiology of psychiatric illness by impairing information processing as a consequence of altered impulse conduction velocity and synchrony between cortical regions carrying out higher level cognitive functions. Myelination can be altered by impulse activity in axons and by environmental experience. Psychiatric illness is treated by psychotherapy, behavioral modification, and drugs affecting neurotransmission, raising the possibility that myelinating glia may not only contribute to such disorders, but that activity-dependent effects on myelinating glia could provide one of the cellular mechanisms contributing to the therapeutic effects of these treatments. This review examines evidence showing that genes and gene networks important for myelination can be regulated by functional activity in axons.

  18. Undifferentiated embryonic cell transcription factor 1 regulates ESC chromatin organization and gene expression

    DEFF Research Database (Denmark)

    Kooistra, Susanne M; van den Boom, Vincent; Thummer, Rajkumar P

    2010-01-01

    Previous reports showed that embryonic stem (ES) cells contain hyperdynamic and globally transcribed chromatin-properties that are important for ES cell pluripotency and differentiation. Here, we demonstrate a role for undifferentiated embryonic cell transcription factor 1 (UTF1) in regulating ES...... cell chromatin structure. Using chromatin immunoprecipitation-on-chip analysis, we identified >1,700 UTF1 target genes that significantly overlap with previously identified Nanog, Oct4, Klf-4, c-Myc, and Rex1 targets. Gene expression profiling showed that UTF1 knock down results in increased expression...... of a large set of genes, including a significant number of UTF1 targets. UTF1 knock down (KD) ES cells are, irrespective of the increased expression of several self-renewal genes, Leukemia inhibitory factor (LIF) dependent. However, UTF1 KD ES cells are perturbed in their differentiation in response...

  19. Effects of stress and adrenalectomy on activity-regulated cytoskeleton protein (Arc) gene expression

    DEFF Research Database (Denmark)

    Mikkelsen, Jens D; Larsen, Marianne Hald

    2006-01-01

    Activity-regulated cytoskeletal-associated protein (Arc) is an effector immediate early gene induced by novelty and involved in consolidation of long-term memory. Since activation of glucocorticoid receptors is a prerequisite for memory consolidation, we therefore aimed to study the effect of acute...... restraint stress on Arc gene expression in adrenalectomized rats. Acute stress produced a significant increase in Arc gene expression in the medial prefrontal cortex, but not in the parietal cortex or in the pyramidal cell layer of the hippocampus. The basal level of Arc mRNA in adrenalectomized animals...... was high in the medial prefrontal cortex and unaffected by acute stress in these animals. These data are consistent with the role of Arc as an integrative modulator of synaptic plasticity by emphasizing the potential role of stress and glucocorticoids in the control of Arc gene expression....

  20. Transcriptional regulation of defence genes and involvement of the WRKY transcription factor in arbuscular mycorrhizal potato root colonization.

    Science.gov (United States)

    Gallou, Adrien; Declerck, Stéphane; Cranenbrouck, Sylvie

    2012-03-01

    The establishment of arbuscular mycorrhizal associations causes major changes in plant roots and affects significantly the host in term of plant nutrition and resistance against biotic and abiotic stresses. As a consequence, major changes in root transcriptome, especially in plant genes related to biotic stresses, are expected. Potato microarray analysis, followed by real-time quantitative PCR, was performed to detect the wide transcriptome changes induced during the pre-, early and late stages of potato root colonization by Glomus sp. MUCL 41833. The microarray analysis revealed 526 up-regulated and 132 down-regulated genes during the pre-stage, 272 up-regulated and 109 down-regulated genes during the early stage and 734 up-regulated and 122 down-regulated genes during the late stage of root colonization. The most important class of regulated genes was associated to plant stress and in particular to the WRKY transcription factors genes during the pre-stage of root colonization. The expression profiling clearly demonstrated a wide transcriptional change during the pre-, early and late stages of root colonization. It further suggested that the WRKY transcription factor genes are involved in the mechanisms controlling the arbuscular mycorrhizal establishment by the regulation of plant defence genes.

  1. Distinctive features and differential regulation of the DRTS genes of Arabidopsis thaliana.

    Science.gov (United States)

    Maniga, Antonio; Ghisaura, Stefania; Perrotta, Lara; Marche, Maria Giovanna; Cella, Rino; Albani, Diego

    2017-01-01

    In plants and protists, dihydrofolate reductase (DHFR) and thymidylate synthase (TS) are part of a bifunctional enzyme (DRTS) that allows efficient recycling of the dihydrofolate resulting from TS activity. Arabidopsis thaliana possesses three DRTS genes, called AtDRTS1, AtDRTS2 and AtDRTS3, that are located downstream of three members of the sec14-like SFH gene family. In this study, a characterization of the AtDRTS genes identified alternatively spliced transcripts coding for AtDRTS isoforms which may account for monofunctional DHFR enzymes supporting pathways unrelated to DNA synthesis. Moreover, we discovered a complex differential regulation of the AtDRTS genes that confirms the expected involvement of the AtDRTS genes in cell proliferation and endoreduplication, but indicates also functions related to other cellular activities. AtDRTS1 is widely expressed in both meristematic and differentiated tissues, whereas AtDRTS2 expression is almost exclusively limited to the apical meristems and AtDRTS3 is preferentially expressed in the shoot apex, in stipules and in root cap cells. The differential regulation of the AtDRTS genes is associated to distinctive promoter architectures and the expression of AtDRTS1 in the apical meristems is strictly dependent on the presence of an intragenic region that includes the second intron of the gene. Upon activation of cell proliferation in germinating seeds, the activity of the AtDRTS1 and AtDRTS2 promoters in meristematic cells appears to be maximal at the G1/S phase of the cell cycle. In addition, the promoters of AtDRTS2 and AtDRTS3 are negatively regulated through E2F cis-acting elements and both genes, but not AtDRTS1, are downregulated in plants overexpressing the AtE2Fa factor. Our study provides new information concerning the function and the regulation of plant DRTS genes and opens the way to further investigations addressing the importance of folate synthesis with respect to specific cellular activities.

  2. Unique structure and regulation of the nematode detoxification gene regulator SKN-1: implications to understanding and controlling drug resistance

    Science.gov (United States)

    Choe, Keith P.; Leung, Chi K.; Miyamoto, Michael M.

    2012-01-01

    Nematodes parasitize an alarming number of people and agricultural animals globally and cause debilitating morbidity and mortality. Anthelmintics have been the primary tools used to control parasitic nematodes for the past several decades, but drug resistance is becoming a major obstacle. Xenobiotic detoxification pathways defend against drugs and other foreign chemicals in diverse organisms, and evidence is accumulating that they play a role in mediating resistance to anthelmintics in nematodes. Related anti-oxidation pathways may also provide filarial parasites protection against host free radical-mediated immune responses. Upstream regulatory pathways have received almost no attention in nematode parasites despite their potential to co-regulate multiple detoxification and anti-oxidation genes. The NRF2 transcription factor mediates inducible detoxification and anti-oxidation defenses in mammals and recent studies have demonstrated that it promotes multidrug resistance in some human tumors. Recent studies in the free-living model nematode Caenorhabditis elegans have defined the homologous transcription factor SKN-1 as a master regulator of detoxification and anti-oxidation genes. Despite similar functions, SKN-1 and NRF2 have important differences in structure and regulatory pathways. Protein alignment and phylogenetic analyses indicate that these differences are shared among many nematodes making SKN-1 a candidate for specifically targeting nematode detoxification and anti-oxidation. PMID:22656429

  3. Divergent regulation of Arabidopsis SAUR genes: a focus on the SAUR10-clade.

    Science.gov (United States)

    van Mourik, Hilda; van Dijk, Aalt D J; Stortenbeker, Niek; Angenent, Gerco C; Bemer, Marian

    2017-12-19

    Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we focus on the regulatory regions of Arabidopsis SAUR genes, to predict the processes in which they play a role, and understand the dynamics of plant growth. In this study, we characterized in detail the entire SAUR10-clade: SAUR8, SAUR9, SAUR10, SAUR12, SAUR16, SAUR50, SAUR51 and SAUR54. Overexpression analysis revealed that the different proteins fulfil similar functions, while the SAUR expression patterns were highly diverse, showing expression throughout plant development in a variety of tissues. In addition, the response to application of different hormones largely varied between the different genes. These tissue-specific and hormone-specific responses could be linked to transcription factor binding sites using in silico analyses. These analyses also supported the existence of two groups of SAURs in Arabidopsis: Class I genes can be induced by combinatorial action of ARF-BZR-PIF transcription factors, while Class II genes are not regulated by auxin. SAUR10-clade genes generally induce cell-elongation, but exhibit diverse expression patterns and responses to hormones. Our experimental and in silico analyses suggest that transcription factors involved in plant development determine the tissue specific expression of the different SAUR genes, whereas the amplitude of this expression can often be controlled by hormone response transcription factors. This allows the plant to fine tune growth in a variety of tissues in response to internal and external signals.

  4. CITA/NLRC5: A critical transcriptional regulator of MHC class I gene expression.

    Science.gov (United States)

    Downs, Isaac; Vijayan, Saptha; Sidiq, Tabasum; Kobayashi, Koichi S

    2016-07-08

    Major histocompatibility complex (MHC) class I and class II molecules play essential roles in the development and activation of the human adaptive immune system. An NLR protein, CIITA (MHC class II transactivator) has been recognized as a master regulator of MHC class II gene expression, albeit knowledge about the regulatory mechanism of MHC class I gene expression had been limited. Recently identified MHC class I transactivator (CITA), or NLRC5, also belongs to the NLR protein family and constitutes a critical regulator for the transcriptional activation of MHC class I genes. In addition to MHC class I genes, CITA/NLRC5 induces the expression of β2 -microglobulin, TAP1 and LMP2, essential components of the MHC class I antigen presentation pathway. Therefore, CITA/NLRC5 and CIITA are transcriptional regulators that orchestrate the concerted expression of critical components in the MHC class I and class II pathways, respectively. © 2016 BioFactors, 42(4):349-357, 2016. © 2016 International Union of Biochemistry and Molecular Biology.

  5. NF-Y and the immune response: Dissecting the complex regulation of MHC genes.

    Science.gov (United States)

    Sachini, Nikoleta; Papamatheakis, Joseph

    2017-05-01

    Nuclear Factor Y (NF-Y) was first described as one of the CCAAT binding factors. Although CCAAT motifs were found to be present in various genes, NF-Y attracted a lot of interest early on, due to its role in Major Histocompatibility Complex (MHC) gene regulation. MHC genes are crucial in immune response and show peculiar expression patterns. Among other conserved elements on MHC promoters, an NF-Y binding CCAAT box was found to contribute to MHC transcriptional regulation. NF-Y along with other DNA binding factors assembles in a stereospecific manner to form a multiprotein scaffold, the MHC enhanceosome, which is necessary but not sufficient to drive transcription. Transcriptional activation is achieved by the recruitment of yet another factor, the class II transcriptional activator (CIITA). In this review, we briefly discuss basic findings on MHCII transcription regulation and we highlight NF-Y different modes of function in MHCII gene activation. This article is part of a Special Issue entitled: Nuclear Factor Y in Development and Disease, edited by Prof. Roberto Mantovani. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

    Science.gov (United States)

    Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

    2014-05-01

    Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

  7. Post-transcriptional bursting in genes regulated by small RNA molecules

    Science.gov (United States)

    Rodrigo, Guillermo

    2018-03-01

    Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.

  8. SSRI antidepressants potentiate methylphenidate (Ritalin)-induced gene regulation in the adolescent striatum

    Science.gov (United States)

    Van Waes, Vincent; Beverley, Joel; Marinelli, Michela; Steiner, Heinz

    2010-01-01

    The psychostimulant methylphenidate (Ritalin) is used in conjunction with selective serotonin reuptake inhibitors (SSRIs) in the treatment of medical conditions such as attention-deficit hyperactivity disorder with anxiety/depression comorbidity and major depression. Co-exposure also occurs in patients on SSRIs that use psychostimulant “cognitive enhancers”. Methylphenidate is a dopamine/norepinephrine reuptake inhibitor that produces altered gene expression in the forebrain; these effects partly mimic gene regulation by cocaine (dopamine/norepinephrine/serotonin reuptake inhibitor). We investigated whether the addition of SSRIs (fluoxetine or citalopram; 5 mg/kg) modified gene regulation by methylphenidate (2–5 mg/kg) in the striatum and cortex of adolescent rats. Our results show that SSRIs potentiate methylphenidate-induced expression of the transcription factors zif 268 and c-fos in the striatum, rendering these molecular changes more cocaine-like. Present throughout most of the striatum, this potentiation was most robust in its sensorimotor parts. The methylphenidate + SSRI combination also enhanced behavioral stereotypies, consistent with dysfunction in sensorimotor striatal circuits. In so far as such gene regulation is implicated in psychostimulant addiction, our findings suggest that SSRIs may enhance the addiction liability of methylphenidate. PMID:20704593

  9. Current major advances in the regulation of milk protein gene expression.

    Science.gov (United States)

    Qian, Xi; Zhao, Feng-Qi