WorldWideScience

Sample records for traditional pakistani domestic

  1. Comparative study of combustion product emissions of Pakistani coal briquettes and traditional Pakistani domestic fuels

    International Nuclear Information System (INIS)

    Wachter, E.A.; Gammage, R.B.; Haas, J.W. III; Wilson, D.L.; DePriest, J.C.; Wade, J.; Ahmad, N.; Sibtain, F.; Zahid Raza, M.

    1992-10-01

    A comparative emissions study was conducted on combustion products of various solid domestic cooking fuels; the objective was to compare relative levels of organic and inorganic toxic emissions from traditional Pakistani fuels (wood, wood charcoal, and dried animal dung) with manufactured low-rank coal briquettes (Lakhra and Sor- Range coals) under conditions simulating domestic cooking. A small combustion shed 12 m 3 internal volume, air exchange rate 14 h -1 was used to simulate south Asian cooking rooms. 200-g charges of the various fuels were ignited in an Angethi stove located inside the shed, then combusted to completion; effluents from this combustion were monitored as a function of time. Measurements were made of respirable particulates, volatile and semi-volatile organics, CO, SO 2 , and NO x . Overall it appears that emissions from coal briquettes containing combustion amendments (slaked lime, clay, and potassium nitrate oxidizer) are no greater than emissions from traditional fuels, and in some cases are significantly lower; generally, emissions are highest for all fuels in the early stages of combustion

  2. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen.

    Science.gov (United States)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K; Cantarero-Arévalo, Lourdes

    2017-01-20

    Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants used in households. Data were collected through in-depth, semi-structured interviews with sixteen ethnic Pakistanis aged 30-80 years. Interviews were transcribed verbatim and analysed through Emerson's two-phased analysis method. Medicinal plant products in the interviewees' households were collected, photographed, identified and deposited at Museum of Natural Medicine at University of Copenhagen. A total number of 121 Pakistani traditional medicines were identified, and found to represent both medicinal plants and foods. The average number of quoted Pakistani Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas (homemade medicinal preparation), religious knowledge and the occurrence of recent illness within the family. Further, the upkeep of traditional use depends on the availability of Pakistani traditional medicines. The study enhanced understanding of ethnic Pakistanis' perception and continued use of traditional medicines within the household after migration to the West. In the context of Western biomedicine, little is known of the potential toxicity and side-effects of many of the Pakistani traditional medicines found to be used in households in Copenhagen. Copyright

  3. Traditional medicine among people of Pakistani descent in the capital region of Copenhagen

    DEFF Research Database (Denmark)

    Ramzan, Sara; Soelberg, Jens; Jäger, Anna K

    2017-01-01

    ETHNOPHARMACOLOGICAL RELEVANCE: Studies show that ethnic minorities continue to use their cultural traditional medicines also after migration to the West. Research in this field is necessary, given that little is known about traditional medicines' impact on health-related problems. This study sheds...... light on the issue through a qualitative study among ethnic Pakistanis residing in Denmark. AIM OF THE STUDY: The study addresses perception, knowledge and attitudes regarding the use of medicinal plants among Pakistanis living in Copenhagen. We furthermore document and identify the medicinal plants...... Traditional Medicines was 18 (N=16). Interviewees independently reported the same traditions for preparation and consumption of Pakistani traditional medicines. Factors that play a role in choosing to use Pakistani traditional medicines are frequent visits to Pakistan, belief in the healing power of totkas...

  4. Comparative emissions from Pakistani coals and traditional coals

    Energy Technology Data Exchange (ETDEWEB)

    Du, Y X [Guangzhou Medical College (China). Dept. of Hygiene; Huang, L F [Guangzhou Health and Anti-epidemic Station (China)

    1994-12-31

    Briquette coal has been widely used for domestic cooking and heating in many Chinese cites over the last two decades. To determine whether burning briquette coal contributes significantly to indoor air pollution, a study was performed in cities-of Southern China in which the measured levels of SO{sub 2}, NO{sub x}, TSP, SD, B(a)P in the kitchens of coal burning families were compared with levels obtained in families using gas. Significantly higher contentions of these pollutants, whose peaks correlated with daily cooking episodes, were detected in coal burning families. The levels of TSP and B(a)P were further found to be dependent on cooking methods, with deep frying and stir-frying of meat generating the most indoor TSP and B(a)P. Briquette coal burning was found to be the source of B(a)P contamination in food. A higher incidence of chronic pharyngitis as well as a suppressed salivary bacteriolytic enzyme activity were found in children of coal burning families. Epidemiologic and laboratory studies also show a close association between coal burning and the incidence of lung cancer in females. (author)

  5. Chemical composition of particles from traditional burning of Pakistani wood species

    Science.gov (United States)

    Shahid, Imran; Kistler, Magdalena; Mukhtar, Azam; Ramirez-Santa Cruz, Carlos; Bauer, Heidi; Puxbaum, Hans

    2015-11-01

    Total particulate matter (TPM) emitted during burning of three types of Pakistani wood (eucalyptus camaldulensis, local name Safeeda; acacia nilotica, local name Kikar, Babul; dalbergia sissoo, Shisham, Tali) in a traditional brick stove were collected and analyzed for anhydrosugars, sugar alcohols, trace metals, soluble ions and carbonaceous species. This is a first study reporting anhydrosugars in wood smoke particles emitted during traditional burning of common wood types in Pakistan. Carbonaceous species showed the highest contribution to the particulate matter. Although the total carbon (TC) contribution was similar for all burnings (64.8-70.2%), the EC/OC ratio varied significantly, from 0.2 to 0.3 for Accacia and Dalbergia to 0.7-0.8 for Eucalyptus and Wood-mix. Among inorganic constituents potassium chloride and silicon were found at levels higher than 1%. The levoglucosan concentrations ranged from 3.0 to 6.6% (average 5.6%) with the highest value for Accacia and lowest value for the wood-mix. The high levoglucosan/mannosan ratios of 20-28 were typical for hardwood. The ratio between levoglucosan and galactosan varied stronger and was found to be around 13-20 for Accacia, Eucalyptus and Wood mix, and 43 for Dalbergia. The determined levoglucosan concentrations allowed assessing the conversion factor for calculation of biomass smoke contribution to ambient particulate matter levels in Pakistan.

  6. Preservation of Cultural Heritage Embodied in Traditional Crafts in the Developing Countries. A Case Study of Pakistani Handicraft Industry

    Directory of Open Access Journals (Sweden)

    Yongzhong Yang

    2018-04-01

    Full Text Available Cultural heritage embodied in traditional crafts is an integral part of any nation which reflects the culture and tradition of a particular region. Although the importance of handicraft has been widely recognized, the literature regarding preservation of traditional craft is scarce. The present paper aimed to explore and identify issues faced by traditional craftsmanship in developing countries and to address those issues in order to contribute to the sustainability of traditional craft heritage and ensure continuous transmission of craft skills and knowledge from generation to generation. Our study identified several key issues which poses substantial challenges to the preservation of traditional craft heritage in developing countries. In order to add empirical evidence, we examined the case of Pakistani handicraft industry that provided further understanding of highlighted issues which traditional craft heritage face. We have suggested some policies to promote, develop and preserve the traditional craft heritage. The significance of these policy suggestions is underlined with the case study of Pakistan.

  7. Positive and negative psychological correlates, gender specific and traditional factors for first onset angina in a sample of pakistani women

    International Nuclear Information System (INIS)

    Rafiq, R.; Anjum, A.

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Methods: Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Results: Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85 % of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49 % of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional

  8. POSITIVE AND NEGATIVE PSYCHOLOGICAL CORRELATES, GENDER SPECIFIC AND TRADITIONAL FACTORS FOR FIRST ONSET ANGINA IN A SAMPLE OF PAKISTANI WOMEN.

    Science.gov (United States)

    Rafique, Rafia; Anjum, Afifa

    2015-01-01

    Coronary Heart Disease (CHD) occurs to a greater extent in developed than developing countries like Pakistan. Our understanding of risk factors leading to this disease in women, are largely derived from studies carried out on samples obtained from developed countries. Since prevalence of CHD in Pakistan is growing, it seems pertinent to infer risk and protective factors prevalent within the Pakistani women. This case control study investigated the role of psychological, traditional and gender specific risk and protective factors for Angina in a sample of Pakistani women aged between 35-65 years. Female patients admitted with first episode of Angina fulfilling the study inclusion/exclusion criteria were recruited within the first three days of stay in the hospital. One control per case matched on age was recruited. Translated versions of standardized tools: Life Orientation Test (LOT), The Hope Scale, Subjective Happiness Scale and Depression, Anxiety and Stress Scale (DASS) were used to measure the psychological variables. Information on medical conditions like diabetes, hypertension, family history of IHD, presence and absence of menopause and use of oral contraceptive pills was obtained from the participants. Body Mass Index for cases and controls was calculated separately with the help of height and weight recorded for the participants. Multivariate logistic regression analyses revealed that depression, anxiety and stress are risk factors, were as optimism and hope are protective predictors of Angina. 64% and 85% of variance in Angina were attributed to psychological factors. Menopause, diabetes and hypertension are significantly associated with the risk of Angina, explaining 37% and 49% of variance in Angina. The study provides evidence for implementation of gender specific risk assessment and preventive strategies for Angina. The study gives directions for large scale prospective, epidemiological, longitudinal as well as interventional studies, to be tailored

  9. Association of various reproductive rights, domestic violence and marital rape with depression among Pakistani women

    Directory of Open Access Journals (Sweden)

    Israr Syed M

    2009-12-01

    Full Text Available Abstract Background Depression among women is common in developing countries. Gender inequality can contribute to women's risk for depression. Lack of reproductive and sexual rights is an important marker of gender inequality and women do not have the freedom to express their reproductive and sexual needs in many parts of the world. Therefore we designed this study to determine the association of depression with lack of various reproductive rights and domestic violence among married women in Karachi, Pakistan. Methods A case-control study with 152 cases and 152 controls, which included women 15-48 years, recruited from two teaching hospitals from 1st June 2007 through 31st August 2007. The SRQ was administered to all subjects. A cut off score of 8 was used to confirm cases of depression diagnosed by physicians, and to exclude cases of depression from the controls. Self-administered questionnaire was used to assess the risk factors. Results 61% of the cases and 43% of the controls were ever abused by spouse and the frequency of marital rape was 33% in cases and 13% in controls. After adjusting for the effects of other variables in the model, less than 18 years of age at marriage (OR 2.00; 95% CI = 1.07, 3.7, decision for marriage by parents (OR 3.51; 95% CI = 1.67, 7.37, abuse by in laws (OR 4.91; 95% CI = 2.66, 9.06, ≤ 3 hours per day spent with husband (OR 2.33; 95% CI = 1.34, 4.08, frequency of intercourse ≤ 2 times per week (OR 1.85; 95% CI = 1.06, 3.22 and marital rape (OR 3.03; 95% CI = 1.50, 6.11 were associated with depression among women. Conclusion In our study depression in married women was associated with younger age at marriage, lack of autonomy in marriage decisions, marital rape and domestic abuse by in-laws. Efforts should be directed towards creating awareness about the reproductive and sexual rights of women in Pakistan. Physicians should be trained to screen and identify women who may be at risk for psychological distress

  10. Association of various reproductive rights, domestic violence and marital rape with depression among Pakistani women.

    Science.gov (United States)

    Ali, Faridah A; Israr, Syed M; Ali, Badar S; Janjua, Naveed Z

    2009-12-01

    Depression among women is common in developing countries. Gender inequality can contribute to women's risk for depression. Lack of reproductive and sexual rights is an important marker of gender inequality and women do not have the freedom to express their reproductive and sexual needs in many parts of the world. Therefore we designed this study to determine the association of depression with lack of various reproductive rights and domestic violence among married women in Karachi, Pakistan. A case-control study with 152 cases and 152 controls, which included women 15-48 years, recruited from two teaching hospitals from 1st June 2007 through 31st August 2007. The SRQ was administered to all subjects. A cut off score of 8 was used to confirm cases of depression diagnosed by physicians, and to exclude cases of depression from the controls. Self-administered questionnaire was used to assess the risk factors. 61% of the cases and 43% of the controls were ever abused by spouse and the frequency of marital rape was 33% in cases and 13% in controls. After adjusting for the effects of other variables in the model, less than 18 years of age at marriage (OR 2.00; 95% CI = 1.07, 3.7), decision for marriage by parents (OR 3.51; 95% CI = 1.67, 7.37), abuse by in laws (OR 4.91; 95% CI = 2.66, 9.06), rape (OR 3.03; 95% CI = 1.50, 6.11) were associated with depression among women. In our study depression in married women was associated with younger age at marriage, lack of autonomy in marriage decisions, marital rape and domestic abuse by in-laws. Efforts should be directed towards creating awareness about the reproductive and sexual rights of women in Pakistan. Physicians should be trained to screen and identify women who may be at risk for psychological distress as a result of denial of reproductive rights so that they can support positive mental health outcomes through individual, family or marital counseling.

  11. Reintegration of Pakistani return migrants from the Middle East in the domestic labour market.

    Science.gov (United States)

    Arif, G M

    1998-01-01

    This study compared the unemployment rates among return migrants and nonmigrants and examined the reintegration pattern of returnees in the domestic labor market. The study utilized three data sets: the 1980 World Bank Survey of Return Migrant Households; the 1986 ILO/ARTEP Survey of Return Migrant Households; the 1991 Pakistan Integrated Household Survey. Findings showed that unemployment rates were much higher among return migrants than nonmigrants. Although this difference narrowed with the passage of time, even among those who returned to Pakistan at least 18 months prior to the surveys, more than 10% of workers were unemployed. The multivariate analysis further showed that returnees, irrespective of the period elapsed since their return, were more likely to be unemployed than nonmigrants. With respect to the reintegration pattern of return migrants, the study revealed that variables indicating their human capital, such as occupation and pre-migration and during-migration work experience, appear to have a greater influence on their post-return adjustment than the variables related to economic positions such as savings. The results also showed that the types of jobs unemployed returnees were looking for differed substantially from those held by employed return migrants. A possibility was that unemployed returnees could not save enough from their overseas earnings to become self-employed. Thus, provision of credit for self-employment seems to be the right way to accommodate these workers.

  12. A cross-cultural comparison of British and Pakistani medical students' understanding of schizophrenia.

    Science.gov (United States)

    Furnham, Adrian; Raja, Nazia; Khan, Umar Ali

    2008-06-30

    This study aimed to compare British, British Pakistani and Native Pakistani (from Pakistan) medical students' beliefs about the manifestation, causes and cures of schizophrenia, prior to any psychiatric training. A total of 305 participants completed a questionnaire on general beliefs about people with schizophrenia, causal explanations concerning the aetiology of schizophrenia and the role of hospitals and society in treating people with schizophrenia. It was predicted that compared with the British and British Pakistanis, the Pakistanis would have more negative beliefs and attitudes, considering people with schizophrenia to be more dangerous and unpredictable; they were also expected to use more superstitious beliefs to explain the cause of schizophrenia and its symptoms; as well as believe more in seeking help from God and faith healers. There was strong evidence to suggest that Pakistanis possessed more negative beliefs and attitudes about people with schizophrenia, but there was no evidence to indicate that Pakistanis believed more in superstitious causal explanations. Pakistanis were more likely to consider seeking help from faith healers, but not God, compared with British Pakistanis and the British. Results confirm previous European-Asian difference in the understanding of the cause, manifestation and cure of schizophrenia. The impact of traditional and Western cultural influences on British Pakistanis is considered.

  13. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks.

    Science.gov (United States)

    Islam, Kazi Md Mukitul; Asadullah, M Niaz

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used.

  14. Gender stereotypes and education: A comparative content analysis of Malaysian, Indonesian, Pakistani and Bangladeshi school textbooks

    Science.gov (United States)

    Islam, Kazi Md. Mukitul

    2018-01-01

    Using government secondary school English language textbooks from Malaysia, Indonesia, Pakistan and Bangladesh, we conducted a quantitative content analysis in order to identify gender stereotypes in school education. In total, 21 categories of exclusion and quality of representation were used to study gender stereotypes. Our analysis confirms a pro-male bias in textbooks: the aggregate female share is 40.4% in textual and pictorial indicators combined. Female occupations are mostly traditional and less prestigious while the characters are predominantly introverted and passive in terms of personality traits. Women are also shown to be mostly involved in domestic and in-door activities while men have a higher presence in professional roles. Systematic underrepresentation of females is evident regardless of whether we look at the text or pictures. A cross-country analysis shows that the female share in picture content is only 35.2% in Malaysia and Bangladesh. Overall, the proportion of female to male characters (text and pictures combined) is balanced in Malaysia and Indonesia (44.4% and 44.1% respectively) while this share is only 24.4% and 37.3% in Pakistani and Bangladeshi textbooks respectively. The finding of underrepresentation of women in Pakistani textbooks, in terms of quality and quantity, is robust to the selection of province-, grade- and subject-specific textbooks, as well as the range and type of categories used. PMID:29351305

  15. The population genetics of cultivation: domestication of a traditional Chinese medicine, Scrophularia ningpoensis Hemsl. (Scrophulariaceae.

    Directory of Open Access Journals (Sweden)

    Chuan Chen

    Full Text Available BACKGROUND: Domestic cultivation of medicinal plants is an important strategy for protecting these species from over harvesting. Some species of medicinal plants have been brought into cultivation for more than hundreds years. Concerns about severe loss of genetic diversity and sustainable cultivation can potentially limit future use of these valuable plants. Genetic studies with comprehensive sampling of multiple medicinal species by molecular markers will allow for assessment and management of these species. Here we examine the population genetic consequences of cultivation and domestication in Scrophularia ningpoensis Hemsl. We used chloroplast DNA and genomic AFLP markers to clarify not only the effects of domestication on genetic diversity, but also determine the geographic origins of cultivars and their genetic divergence from native populations. These results will allow both better management of cultivated populations, but also provide insights for crop improvement. RESULTS: Twenty-one cpDNA haplotypes of S. ningpoensis were identified. Wild populations contain all haplotypes, whereas only three haplotypes were found in cultivated populations with wild populations having twice the haplotype diversity of cultivated populations. Genetic differentiation between cultivated populations and wild populations was significant. Genomic AFLP markers revealed similar genetic diversity patterns. Furthermore, Structure analysis grouped all wild populations into two gene pools; two of which shared the same gene pool with cultivated S. ningpoensis. The result of Neighbor-Joining analysis was consistent with the structure analysis. In principal coordinate analysis, three cultivated populations from Zhejiang Province grouped together and were separated from other cultivated populations. CONCLUSIONS: These results suggest that cultivated S. ningpoensis has experienced dramatic loss of genetic diversity under anthropogenic influence. We postulate that strong

  16. The population genetics of cultivation: domestication of a traditional Chinese medicine, Scrophularia ningpoensis Hemsl. (Scrophulariaceae).

    Science.gov (United States)

    Chen, Chuan; Li, Pan; Wang, Rui-Hong; Schaal, Barbara A; Fu, Cheng-Xin

    2014-01-01

    Domestic cultivation of medicinal plants is an important strategy for protecting these species from over harvesting. Some species of medicinal plants have been brought into cultivation for more than hundreds years. Concerns about severe loss of genetic diversity and sustainable cultivation can potentially limit future use of these valuable plants. Genetic studies with comprehensive sampling of multiple medicinal species by molecular markers will allow for assessment and management of these species. Here we examine the population genetic consequences of cultivation and domestication in Scrophularia ningpoensis Hemsl. We used chloroplast DNA and genomic AFLP markers to clarify not only the effects of domestication on genetic diversity, but also determine the geographic origins of cultivars and their genetic divergence from native populations. These results will allow both better management of cultivated populations, but also provide insights for crop improvement. Twenty-one cpDNA haplotypes of S. ningpoensis were identified. Wild populations contain all haplotypes, whereas only three haplotypes were found in cultivated populations with wild populations having twice the haplotype diversity of cultivated populations. Genetic differentiation between cultivated populations and wild populations was significant. Genomic AFLP markers revealed similar genetic diversity patterns. Furthermore, Structure analysis grouped all wild populations into two gene pools; two of which shared the same gene pool with cultivated S. ningpoensis. The result of Neighbor-Joining analysis was consistent with the structure analysis. In principal coordinate analysis, three cultivated populations from Zhejiang Province grouped together and were separated from other cultivated populations. These results suggest that cultivated S. ningpoensis has experienced dramatic loss of genetic diversity under anthropogenic influence. We postulate that strong artificial selection for medicinal quality has

  17. Between Tradition and Modernity: Determining Spatial Systems of Privacy in the Domestic Architecture of Contemporary Iraq

    Directory of Open Access Journals (Sweden)

    Ali Al-Thahab

    2014-11-01

    Full Text Available The notion of privacy represents a central criterion for both indoor and outdoor social spaces in most traditional Arab settlements. This paper investigates privacy and everyday life as determinants of the physical properties of the built and urban fabric and will study their impact on traditional settlements and architecture of the home in the contemporary Iraqi city. It illustrates the relationship between socio-cultural aspects of public/private realms using the notion of the social sphere as an investigative tool of the concept of social space in Iraqi houses and local communities (Mahalla. This paper reports that in spite of the impact of other factors in articulating built forms, privacy embodies the primary role under the effects of Islamic rules, principles and culture. The crucial problem is the underestimation of traditional inherited values through opening social spaces to the outside that giving unlimited accesses to the indoor social environment creating many problems with regard to privacy and communal social integration.

  18. Factors causing stress among Pakistani working women

    Directory of Open Access Journals (Sweden)

    Ahmed Arif

    2017-09-01

    Full Text Available Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to explore the critical factors creating stress among Pakistani working women. Based on literature review, the key stressors were identified to be as work life balance, gender discrimination, peers behaviour, lack of promotional opportunities and sexual harassment. These factors were found to be creating physiological, behavioural and psychological problems. The target of this study was the women working in secretarial and administrative positions in Pakistani organisations. Regression analysis was conducted to find out the impact of these stressors on working women. The results revealed that sexual harassment, peers behaviour and lack of promotional opportunities were the most dominant stressors.

  19. Impact on indoor air quality during burning of Pakistani coal briquettes

    International Nuclear Information System (INIS)

    Gammage, R.B.; Wachter, E.A.; Wade, J.; Wilson, D.L.; Ahmad, N.; Sibtain, F.; Raza, M.Z.

    1993-01-01

    A comparison was made of airborne emissions from combustion of new types of Pakistani coal briquettes and traditional fuels. A mud-lined Angethi stove was operated under the standard nominal conditions of burning 200 g charges of fuel inside a 12 m 3 shed with a forced rate of air exchange of 14/hr. Coal was cold briquetted with lime, clay, and oxidant. Traditional fuels were wood, charcoal, and animal dung. Compared to raw coal, the amended coal gave fourfold reduced emission of respirable-size particles (RSP) while dramatically reducing overall SO 2 release. Initial burning was restricted to the outer layers of the briquettes during which time reaction of SO 2 with lime was incomplete and early emissions of SO 2 were substantial. The measurements overall indicated that, with respect to CO, SO 2 , NO x , and RSP, substitution of amended coal briquettes for traditional fuels will not worsen indoor air quality during domestic cooking. The traditional fuels and coal briquettes emit elevated peak amounts of CO (100-250μL/L), SO 2 (2-5 μL/L), and NO x (1-5 μL/L) in the early phase of volatiles burning with much reduced emissions in the later char-burning phase. Stove operators can substantially lower exposures by lighting the fuel outside and later moving the stove inside

  20. Global and Domestic Spheres: Impact on The Traditional Settlement of Penglipuran in Bali

    Science.gov (United States)

    Suartika, G. A. M.

    2018-02-01

    The issue addressed is how to situate the ‘life-world’ of a traditional Balinese village in the context of global tourism which is now worth USD 7.61 trillion, This problem has been brought sharply into focus, indeed amplified, by the recently adopted policy of local government in Bali to designate specific villages as tourist sites. Such action appears to be taking place in the absence of any prior studies of the social, environmental and other impacts on local communities. The following paper represents an initial attempt to sketch out the breadth of the problem from the global to the local. The paper first proceeds by examining the conceptual framework of globalisation - fundamentally an economic process, - from which global cultural identities merge. It proceeds to give an overview of policy at a global level starting with the idea of designated United Nations World Heritage sites and the inevitable commodification of ‘place.’ Then the issues and problems that flow from these first sections are discussed. Next, the situation in Indonesia as a whole is brought into sharp relief, focussing on policy and legislation that affect the internationally celebrated island of Bali. Finally, a case study of Penglipuran, a traditional Bali Aga village is discussed taking into account the preceding context. In conclusion, suggestions are made as to the significant research and policy issues that need to be addressed concurrently with the development of the settlement. The study documented in this paper was conducted using phenomenological approaches. It was grounded by researcher's experiences, gained from her deep involvement in community life as well as physical and site observation activities during data collection period.

  1. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    OpenAIRE

    Syeda Bushra Zaidi

    2016-01-01

    This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textu...

  2. A Controversial Role Model for Pakistani Women

    Directory of Open Access Journals (Sweden)

    Faiza Mushtaq

    2012-03-01

    Full Text Available Al-Huda is a movement of Islamic education and reform with a dedicated female following in Pakistani cities. Its founder and leader is a woman, Dr. Farhat Hashmi, who has become a well-known public figure in Pakistan. This paper explores how Hashmi derives her authority, displays it, and defends it against challenges. Women who become active participants in her classes claim she transforms their understanding of Islam and inspires them to change their lives. However she is criticized by the secular-liberal elites of the country and by the traditional male leadership of Islamic institutions, who question her religious expertise and are uncomfortable with the role of both gender and class in this movement. This analysis highlights the collective interactions and organizational innovations through which Hashmi’s teachings acquire an authoritative status for selected women.

  3. Tradition

    DEFF Research Database (Denmark)

    Otto, Ton

    2016-01-01

    : beliefs, practices, institutions, and also things. In this sense, the meaning of the term in social research is very close to its usage in common language and is not always theoretically well developed (see Shils, 1971: 123). But the concept of tradition has also been central to major theoretical debates...... on the nature of social change, especially in connection with the notion of modernity. Here tradition is linked to various forms of agency as a factor of both stability and intentional change....

  4. Benazir Bhutto. Pakistani nimel vaenlasega voodisse / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2007-01-01

    Pakistani endise peaministri Benazir Bhutto elukäigust, elust eksiilis, karjäärist, korruptsioonisüüdistustest, vastasseisust president Pervez Musharrafiga, plaanist naasta Pakistani 18. oktoobril. Vt. samas: Kahtlased võimumängud

  5. The wisdom of the deep south of Thailand: Case study on utilization of herbal medicine to treat domestic animal diseases by traditional doctors in Pattani, Yala and Narathiwat

    Directory of Open Access Journals (Sweden)

    Poh-etae A.

    2007-03-01

    Full Text Available This survey research was conducted to investigate the wisdom of the Deep South of Thailand: case study on utilization of herbal medicine to treat domestic animal diseases by traditional doctors in Pattani, Yala and Narathiwat. A purposive sampling method was applied in selecting 133 subjects from 33 districts of these provinces. The interview design was checked by experts for content validity index and adjusted after testing on 13 non-target men. Quantitative and qualitative data were analyzed using percentage and groups split by symptoms.The results showed that most traditional doctors (68.4% were males; 52.6% were 41-60 years old and 39.1% were more than 61 years of age. 60.2% of the subjects were Muslims; 73.7% of them were agri- culturalists; 63.2% of them had the income ranging from 3,001-6,000 baht/month. Most of the subjects (77.4% had only primary education, and 15.0% finished high school level. Only 6.0% practised traditional medicine as their main occupation and most of them (94.0% did not practise traditional medicine as their main occupation. Most traditional doctors (91.0% had experience in using medicinal herbs for animal treatment; 30.0% citing that herbal medicine was easy to find in local areas; 26.8% citing that it was cheap. For domestic animal utilization of herbal medicine, cats (54.1%, were first on the list of non-ruminants, chickens (62.9% came first among poultry, cattle (50.7% came first among ruminants and decorative fish e.g. goldfish (50.0% were commonest among aquatic animals. The single herbal medicine used to treat domestic animal diseases by traditional doctors were reported as follows: to chase away insects, citronella grass or tobacco (3.0% was used; to treat diarrhea, Tinospora crispa (2.3% was used; to treat antitussives, lemon grass or Andrographis paniculata (2.3% was used; as an expectorant, curcuma rhizomes (2.3% was used; to treat pus from worms, Phyllanthus reticularud or Cassytha filiformis (2.3% was

  6. Future US energy demands based upon traditional consumption patterns lead to requirements which significantly exceed domestic supply

    Science.gov (United States)

    1975-01-01

    Energy consumption in the United States has risen in response to both increasing population and to increasing levels of affluence. Depletion of domestic energy reserves requires consumption modulation, production of fossil fuels, more efficient conversion techniques, and large scale transitions to non-fossile fuel energy sources. Widening disparity between the wealthy and poor nations of the world contributes to trends that increase the likelihood of group action by the lesser developed countries to achieve political and economic goals. The formation of anticartel cartels is envisioned.

  7. Pakistani labour emigration: new destinations in Europe

    Directory of Open Access Journals (Sweden)

    Nasra M. Shah

    2005-01-01

    Full Text Available In the first part of this paper a historical overview is made of Pakistani labour emigration to the countries of the Persian Gulf, and to Anglo-Saxon countries in general and to the United Kingdom in particular. In the second part of the paper the new European labourmarkets which Pakistani emigrants have been increasingly discovering is analyzed. In this sense, Spain has become one of the new destinations. The author goes on to point out the specific nature of this new situation and at the same time details some of the future implications for Spain.

  8. Comparative Analysis of the Indian and Pakistani Nuclear Energy Development Programmes

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2015-01-01

    Full Text Available Due to the traditional competition between India and Pakistan, their strategic fields developing are interdependent. Nuclear power development programs are concerned as well. Pakistan falls behind India in this branch, however the specifics of the nuclear infrastructure let the potential of the states be relatively balanced. After Nuclear Suppliers Group granted a waiver to India in 2008 and Russia, France and USA, the new participants, broke into the market, India obtained an opportunity to make a breakthrough in the national nuclear program development, thus violating a status quo in fuel cycle technologies. Such chances stimulated China to violate the NSG guidelines and non-proliferations principles to get involved in Pakistani nuclear program development. The nuclear power Indian-Pakistani competition prospects largely depend on the Chinese position. Despite the international community suspects the Pakistani officials in nuclear black market dealing and the NSG guidelines China obviously supports the Pakistani nuclear field. This may result in preventing of escalation of tensions in the region. 

  9. Perceptions of Disease State Management Among Pakistani ...

    African Journals Online (AJOL)

    Purpose: To explore the perceptions of disease state management among Pakistani hypertensive patients. Methods: A focus group discussion was conducted with 19 hypertensive patients in order to obtain an insight into their self-management practices. The study was conducted in Sandeman Provincial Hospital, Quetta, ...

  10. Crawling up the value chain: domestic institutions and non-traditional foreign direct investment in Brazil, 1990-2010

    Directory of Open Access Journals (Sweden)

    PATRICK J. W. EGAN

    2015-03-01

    Full Text Available Brazil attracted relatively little innovation-intensive and export-oriented foreign investment during the liberalization period of 1990 to 2010, especially compared with competitors such as China and India. Adopting an institutionalist perspective, I argue that multinational firm investment profiles can be partly explained by the characteristics of investment promotion policies and bureaucracies charged with their implementation. Brazil's FDI policies were passive and non-discriminating in the second half of the 1990s, but became more selective under Lula. Investment promotion efforts have often been undercut by weakly coordinated and inconsistent institutions. The paper highlights the need for active, discriminating investment promotion policies if benefits from non-traditional FDI are to be realized.

  11. Adoption of Social Networking Sites among Pakistani University Students: A Case of Face-Book

    OpenAIRE

    Raja Irfan Sabir; Wasim Ahmad; Nabila Noor; Asad-ur-Rehman

    2013-01-01

    Since birth of Social Networking Sites (SNSs), these attracted millions of users from all around the world. The SNSs have changed the communication ways of people from more traditional to modern approaches. This study aims to examine diffusion and adoption of Facebook.com among Pakistani university students using Technology Acceptance Model (TAM) and Theory of Reasoned Action (TRA) with an extension of Theory of Planned Behavior (TPB). The study used stratified random & pre-tested questionnai...

  12. GENDER ROLES IN PAKISTANI-URDU WEDDING SONGS

    Directory of Open Access Journals (Sweden)

    Syeda Bushra Zaidi

    2016-05-01

    Full Text Available This qualitative study of Pakistani-Urdu wedding songs allows a closer look at the gender situation, and towards the understanding of the process of construction and perpetuation of gender-based stereotypes. However, the major concern of this study is to understand the portrayal of each gender along with the question that does such portrayal underlines the traditional gender roles and gender inequality. Taking a discourse analysis perspective, this study analyzes textual data from the lyrics of the seventeen wedding songs. The song selection was based on purposive sampling technique. The data were collected through transcription and recording of the audios of the songs. As a result of thematic analysis thirteen themes emerged, ten portraying the female gender and four portraying the male gender. These themes reveal important findings that support and reinforce the gender-based stereotypes and also reflect gender hierarchy, normative heterosexual relationships, kinship norms and gender subversions.

  13. Brand equity in the Pakistani hotel industry

    OpenAIRE

    Ishaq, Muhammad Ishtiaq; Hussain, Nazia; Asim, Ali Ijaz; Cheema, Luqman J.

    2014-01-01

    Brand equity is considered as the most important aspect of branding, which is a set of brands' assets and liabilities, its symbol or name that subtracts from or adds the value provided by a product or service to a firm and customers. The current research endeavor was to identify the interrelationship of customer-based brand equity dimensions (brand awareness, brand loyalty, brand image, and service quality) in Pakistani hotel industry. Data was collected from 821 consumers who experienced the...

  14. Pakistani juht sepitseb endale teist ametiaega / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Autori sõnul üritab Pakistani president Pervez Musharraf saavutada oma tagasivalimist lubadusega hakata tsiviilisikust presidendiks. Võimud on ähvardanud maapaost naasva endise Pakistani peaministri Benazir Bhutto vangi panna, juba on välja saadetud teine ekspeaminister Nawaz Sharif. Lisa: Kodusõja oht. Piirialad ähvardavad lahku lüüa

  15. An Investigation of Generic Structures of Pakistani Doctoral Thesis Acknowledgements

    Science.gov (United States)

    Rofess, Sakander; Mahmood, Muhammad Asim

    2015-01-01

    This paper investigates Pakistani doctoral thesis acknowledgements from genre analysis perspective. A corpus of 235 PhD thesis acknowledgements written in English was taken from Pakistani doctoral theses collected from eight different disciplines. HEC Research Repository of Pakistan was used as a data sources. The theses written by Pakistani…

  16. Sõda terroriga võib paisuda Pakistanis revolutsiooniks / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Sisepoliitilisest olukorrast Pakistanis. Eksiilis viibiv ekspeaminister Benazir Bhutto nõuab president Pervez Musharrafi tagasiastumist, samas pidas Musharraf temaga hiljuti läbirääkimisi. Erakorralist seisukorda Pakistanis ei kehtestatud. Lisa: Ameeriklaste asendamatu sõber Afganistani külje all

  17. Bacteriological (fecal and total coliform) quality of Pakistani coastal water

    International Nuclear Information System (INIS)

    Mashiatullah, A.; Qureshi, R.M.; Javed, T.; Khan, M.S.; Chaudhary, M.Z.; Khalid, F.

    2010-01-01

    The coliform bacteria group consists of several genera of bacteria belonging to the family enterobacteriaceae. These are harmless bacteria, mostly live in soil, water, and digestive system of animals. Fecal coliform bacteria, which belongs to this group, are present in large numbers in feces and intestinal tract of human beings and other warm-blooded animals which can enter into water bodies from human and animal waste. Swimming in water having high levels of Fecal coliform bacteria increases the chance of developing illness (fever, nausea or stomach cramps) from pathogens entering the body through mouth, nose, ears or cuts in the skin. The objective of the present study was to characterize the bathing quality of Pakistani coastal water with respect to coliform bacteria. Total and Fecal coliform bacteria were determined at seven different locations along Pakistan coast using membrane filtration (MF) technique. 100 ml of water was passed through 0.45 micron (mu) filter paper. These filter papers were put on pads, soaked in Lauryle sulphate broth in petri-dishes and incubated at 44 deg. C for Fecal and 37 deg. for Total coliform for 24 hours. Significantly high population of Fecal and Total coliform bacteria was recorded at Karachi harbour area and Indus delta region. Results indicate that a large amount of domestically originated waste is being discharged into these locations without any pre-treatment (e.g., screening, activated sludge, by using filtration beds etc.) resulting in a poor seawater quality making it unfit for bathing. (author)

  18. Religion, male violence, and the control of women: Pakistani Muslim men in Bradford, UK.

    Science.gov (United States)

    Macey, M

    1999-03-01

    This paper examines Pakistani Muslim male violence in the public and private spheres in Bradford, UK. The article also explores the relationship between male violence and ideas of culture and religion. The material used was collected over a 4-year period from students and staff in further and higher education institutions; working women (prostitutes); survivors of domestic violence; police personnel who work with Asian women fleeing domestic violence or forced marriages; and staff of a children's society working with teenage prostitutes. Methodologies included lectures, seminars, focus groups, and interviews. Findings reveal that there is a difference between male and female attitudes towards Islam. Some men are using it to justify violence against women, while women of all ages and backgrounds are using it as a source of strength and to negotiate (with ingenuity and humor) the cultural and religious requirements which men try to impose upon them.

  19. Genetic heterogeneity in Pakistani microcephaly families

    DEFF Research Database (Denmark)

    Sajid Hussain, M; Bakhtiar, Syeda Marriam; Farooq, Muhammad

    2013-01-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational...... mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population....

  20. Evolution of Systemic Hypertension in Pakistani Population

    International Nuclear Information System (INIS)

    Aziz, K. U.

    2015-01-01

    The prevalence of essential hypertension is alarmingly increasing in Pakistani population inspite of the demographics being of lower BMI and nutrition. In this review, the possible factors responsible for this increase are identified by reviewing the population studies conducted in Pakistan. The prevalence rate is about 3 - 4% in childhood and steeply rises near the middle age. The factors peculiar to Pakistan were increased genetic susceptibility, environmental factors such as gender, females gender, urbanization, obesity and sedentary life styles particularly in middle age, cultural practices promoting sedentary life style in female. (author)

  1. Suicidal ideation in Pakistani college students.

    Science.gov (United States)

    Khokher, Sehar; Khan, Murad M

    2005-01-01

    Suicidal behavior includes ideation, attempts and completed suicides. Information on suicidal behavior from Pakistan, a conservative South Asian Islamic country, is lacking. To address the issue, a pilot study was carried out to assess the prevalence of suicidal ideation in Pakistani college students. Suicidal ideation was assessed on the basis of responses to four questions contained in the depression subscale of the General Health Questionnaire-28. Of the total 217 completed questionnaires, the overall rate of suicidal ideation was 31.4%. While there was no significant difference between genders, more females (33%) than males (29.2%) responded positively. Respondents belonging to single parent families and those living at home, compared to those using hostel facilities, reported higher rates. The reported rate in our sample is higher than similar studies conducted elsewhere. There is the need for more information in this important area of suicidal behavior, including studying such feelings in school going children as well as in a larger community sample. The findings of such studies can contribute to our understanding of the suicidal process in the Pakistani population and to address it at various levels.

  2. Genetic analysis of a consanguineous Pakistani family with Leber ...

    Indian Academy of Sciences (India)

    2014-08-01

    Aug 1, 2014 ... RESEARCH NOTE. Genetic analysis of a consanguineous Pakistani family with Leber .... representation of the deleterious mutation at genomic and protein level. ... In the last couple of years, numerous mutations in. GUCY2D ...

  3. PECUNIA EX MACHINA: PAKISTANI ENTREPRENEURS IN THE CITY OF BARCELONA

    Directory of Open Access Journals (Sweden)

    Hugo Valenzuela García

    2010-12-01

    Full Text Available The Pakistani migratory project is profoundly driven by economic objectives that are clearly apparent in their hard-working attitudes, their typically modest expenditure and consumption, the high rate of ethnic entrepreneurship and their remarkable commercial success. Nevertheless, the manifest economic inclination of the group involves a high social cost. This article analyses the economic and socio-cultural key issues that underlie the economic behavior of Pakistanis, as well as the social cost of the migratory enterprise. Furthermore, the paper describes the socio-cultural traits of the Pakistani community and, through a description of Pakistani settlement, it focuses on other important processes that concern the configuration of the city, such as gentrification, centrifugation and reproduction.

  4. Suitsiiditerrorist tappis Pakistani tipp-poliitiku / Kaivo Kopli

    Index Scriptorium Estoniae

    Kopli, Kaivo

    2007-01-01

    Pakistanis tapeti endine peaminister Benazir Bhutto. Samuti endise peaministri Navaz Sharifi juhitav opositsioonipartei, mis kavatses valimistel osaleda, otsustas valimiste boikotiga liituda. B. Bhutto isast ja vendadest. Lisa: Lääne haridusega huntade vastu võitleja

  5. Acceptability of GM foods among Pakistani consumers

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-01-01

    ABSTRACT In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers. PMID:27494790

  6. Acceptability of GM foods among Pakistani consumers.

    Science.gov (United States)

    Ali, Akhter; Rahut, Dil Bahadur; Imtiaz, Muhammad

    2016-04-02

    In Pakistan majority of the consumers do not have information about genetically modified (GM) foods. In developing countries particularly in Pakistan few studies have focused on consumers' acceptability about GM foods. Using comprehensive primary dataset collected from 320 consumers in 2013 from Pakistan, this study analyzes the determinants of consumers' acceptability of GM foods. The data was analyzed by employing the bivariate probit model and censored least absolute deviation (CLAD) models. The empirical results indicated that urban consumers are more aware of GM foods compared to rural consumers. The acceptance of GM foods was more among females' consumers as compared to male consumers. In addition, the older consumers were more willing to accept GM food compared to young consumers. The acceptability of GM foods was also higher among wealthier households. Low price is the key factor leading to the acceptability of GM foods. The acceptability of the GM foods also reduces the risks among Pakistani consumers.

  7. Domestic violence

    Science.gov (United States)

    ... violence; Spousal abuse; Elder abuse; Child abuse; Sexual abuse - domestic violence ... 2016. National Domestic Violence Hotline website. What is domestic violence? www.thehotline.org/is-this-abuse/abuse-defined . Accessed July 10, 2016.

  8. Bushi lepituskatse vallandas Pakistani ja Afganistani juhi teineteise süüdistamise / Triin Oppi

    Index Scriptorium Estoniae

    Oppi, Triin

    2006-01-01

    USA, Pakistani ja Afganistani presidendid leppisid kokku luureandmete vahetamises ja tõhusamas koostöös terroristide alistamiseks. Pakistani ja Afganistani presidentide Pervez Musharrafi ja Hamid Karzai omavahelised süüdistused

  9. Pakistani president korraldas riigipöörde ülemkohtunike vastu / Heiki Suurkask

    Index Scriptorium Estoniae

    Suurkask, Heiki, 1972-

    2007-01-01

    Pakistani president Pervez Musharraf kuulutas riigis välja erakorralise seisukorra, Pakistani ajalehe hinnangul on tegemist riigipöördega ülemkohtu vastu. Peaminister Shaukat Azizi kinnitusel on arreteeritud ligi 500 inimest

  10. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.

    2015-01-01

    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  11. Pakistani childrens’ views of TV advertising

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2012-12-01

    Full Text Available This qualitative study explores Pakistani children’s views regarding TV advertising and outlines the factors impacting their choice of snack brands. Thirty-six children from three schools were selected purposefully and qualitative data was collected through focus group sessions held in schools. Findings suggest that children understand the intended message of snack brand advertisers. Different variants of brands focusing on some product- and non-product related elements are considered imperative, contributing towards purchase. Children identify brands through jingles and cartoon characters and are well-aware of the logic behind TV advertising. This study highlighted children as knowledgeable, straightforward, fun-loving and rational consumers, all of which have some important implications for food marketers. The research is an original contribution to the work in the field of consumer socialization; it is intended to help the readers understand children’s attitude with regard to TV advertising, and identify some of the elements contributing to the choice of snack brands among children.

  12. Anatomy of British Business School Brands: Attributes Affecting Choice Among Pakistani Postgraduate Students

    Directory of Open Access Journals (Sweden)

    Usman Ahmad

    2014-06-01

    Full Text Available The research studies that investigate business school brands from an Asian consumer perspective are scarce. Current study aims at discovering the branding attributes of UK Business Schools that influence Pakistani business students to apply for admission in higher degrees. Following a naturalistic tradition, data has been collected through semi-structured interviews from a sample of 25 students who were planning to study in United Kingdom. The respondents were identified through personal sources and were later selected using the purposive sampling technique. Thematic analysis was performed to generate themes from the collected data. The data analysis generated four dominant themes that influence the choice of a business school in United Kingdom. These are “financial assistance”, “employability”, “brand reputation” and “rankings”. The study is a pioneer work in the field of university branding from a developing country perspective of Pakistan. The research will be useful to British higher education marketers in devising student-centered branding initiatives. It will also benefit the Pakistani academia, as the country can develop business school brands as well by imparting these attributes to better compete with business schools in UK.

  13. Peripartum cardiomeyopathy in a pakistani cohort

    International Nuclear Information System (INIS)

    Munir, R.; Hussain, S.; Kayani, A.M.

    2016-01-01

    Objective: To describe the demographics, risk factors, and clinical presentation in Pakistani patients with peripartum cardiomyopathy. Study Design: A descriptive observational study. Place and Duration of Study: Rawalpindi Institute of Cardiology, Rawalpindi, from June 2014 to June 2015. Methodology: Seventy patients meeting criteria of peripartum cardiomyopathy were included in the study. Adetailed history, physical examination and investigations were done. Epidemiologic data, risk factors, New York Heart Association (NYHA) class and echocardiographic findings were recorded. Statistical analyses were done using SPSS version 19. Result: The mean age was 28.66 ±4.57 years. Mean parity and weight was 3.04 ±1.7 and 60.97 ±12.40 Kg, respectively. Fifty-five (78.6 percent) cases were diagnosed in the postpartum period. Thirty-three (50.8 percent) and 31 patients (44.7 percent) presented in NYHA- III and IV classes, respectively. Pregnancy-induced hypertension was seen in 16 (22.9 percent) cases, diabetes in 6 (8.6 percent), and twin pregnancy in 2 (2.9 percent) cases. The mean hemoglobin and brain natriuretic peptide (BNP) was 11.26 ±1.61 gm/dl and 1583.70 ±1237.65 pg/ml, respectively. Echocardiography showed mean ejection fraction of 21.74 ±7.45 percent. Left ventricle systolic and diastolic diameters were 53.71 ±9.74 mm and 63.37 ±8.48 mm, respectively. Conclusion: Peripartum cardiomyopathy was seen in younger women with higher parity and pregnancy induced hypertension, often manifesting in the postpartum period with NHYAclass III and IV status. (author)

  14. Storytelling and story testing in domestication

    DEFF Research Database (Denmark)

    Gerbault, Pascale; Allaby, Robin G; Boivin, Nicole

    2014-01-01

    The domestication of plants and animals marks one of the most significant transitions in human, and indeed global, history. Traditionally, study of the domestication process was the exclusive domain of archaeologists and agricultural scientists; today it is an increasingly multidisciplinary...

  15. Domestic Violence

    Science.gov (United States)

    Domestic violence is a type of abuse. It usually involves a spouse or partner, but it can also ... a child, elderly relative, or other family member. Domestic violence may include Physical violence that can lead to ...

  16. Domestic violence

    OpenAIRE

    Tačík, Michal

    2015-01-01

    Domestic violence The present thesis deals with the phenomenon of domestic violence, from the substantive, procedural and criminological aspects. The first part defines the specifics of domestic violence, its signs and forms. It shows a typology of victims and perpetrators. It analyzes in detail the basic facts of the crimes that are the most commonly perpetrated forms of domestic violence. It also describes the sanctions and some of the treatment programs that are available for perpetrators ...

  17. Entrepreneurial Attributes among Postgraduate Students of a Pakistani University

    Science.gov (United States)

    Ali, Akhtar; Topping, Keith J.; Tariq, Riaz H.

    2010-01-01

    This paper explores entrepreneurial attributes among the students of The Islamia University of Bahawalpur, a public sector Pakistani university. Multistage sampling was employed to maximize the representation. Five hundred and twenty one master's level students from thirty departments returned completed questionnaires. Three factors emerged: self…

  18. Assessment of Heavy Metal Content of Branded Pakistani Herbal ...

    African Journals Online (AJOL)

    Purpose: To investigate the heavy metals present in branded Pakistani herbal medicines used in the management of various human ailments. Method: The herbal dosage forms assessed were tablets, capsules and syrups. The samples were prepared for analysis by wet digestion method using nitric acid and perchloric acid ...

  19. Pattern of vitamin D among Pakistani pregnant women

    International Nuclear Information System (INIS)

    Nasir, J.A.; Zaidi, S.A.A.

    2018-01-01

    Vitamin D deficiency is an emerging health concern around the world, highly prevalent in south Asian population, despite abundant sunlight. In Pakistan, all age groups are vulnerable to Vitamin D deficiency including pregnant women. This systematic review aimed to determine the pattern of Vitamin D deficiency among Pakistani pregnant women as well as exploring the causes and possible interventions that have had a substantial effect on improving the vitamin D level. Three databases (PubMed, Pub Get and Google Scholar), for the present review up to 2016, were used for the identification of published peer reviewed original relevant studies regarding Vitamin D deficiency among Pakistani pregnant women with the keywords Vitamin D or 25-hydroxyvitamin D or 25(OH)D in combination with pregnant women. Five studies were included for the final analysis. Vitamin D deficiency was common and highly prevalent among Pakistani pregnant women and their neonates. The main reasons for this were found to be avoiding sun exposure, quality of diet, and lower intake of calcium. Maternal vitamin D supplementation was found to be a key intervention to improve the maternal and neonatal vitamin D status. These review findings can be emerging in ensuring the adequate vitamin D level for Pakistani pregnant women during pregnancy, ultimately to achieve positive maternal and neonate's health outcomes. (author)

  20. Genetic diversity of Pakistani maize genotypes using chromosome ...

    African Journals Online (AJOL)

    For improvement of maize crop presence of genetic diversity in the germplasm is very important. This study was conducted to determine genetic diversity among 17 Pakistani maize genotypes using 10 simple sequence repeat (SSR) primer sets. All the amplification products were in the range of <250-750 bp. To estimate the ...

  1. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  2. Cerebral Palsy in Pakistani Children: A Hospital Based Survey

    Directory of Open Access Journals (Sweden)

    Atif Ahmed Khan

    2014-08-01

    Conclusion:Spastic quadriplegia or spastic diplegia are the commonest presentations in Pakistani children diagnosed with CP. The frequent etiological factors in CP development are birth asphyxia, prematurity, meningoencephalitis and kernicterus. [Cukurova Med J 2014; 39(4.000: 705-711

  3. Evidence of long-term gene flow and selection during domestication from analyses of Eurasian wild and domestic pig genomes

    NARCIS (Netherlands)

    Frantz, L.A.F.; Schraiber, J.G.; Madsen, O.; Megens, H.J.W.C.; Cagan, A.; Bosse, M.; Paudel, Y.; Crooijmans, R.P.M.A.; Larson, G.; Groenen, M.A.M.

    2015-01-01

    Traditionally, the process of domestication is assumed to be initiated by humans, involve few individuals and rely on reproductive isolation between wild and domestic forms. We analyzed pig domestication using over 100 genome sequences and tested whether pig domestication followed a traditional

  4. She stands alone: Pakistani woman film director, Shireen Pasha.

    Science.gov (United States)

    Mustafa, A

    1995-01-01

    This article describes the activities of film director Shireen Pasha in promoting truth in the mass media in Pakistan. Pasha is described as one who finds it inexcusable in a state-subsidized system that national problems of poverty are not aired openly. Pasha has pursued the goal of exposing the real lives of Pakistanis on film in contrast to the publicly aired segments of "pretty girls in nice drawing rooms." Foreign channels available through satellite communications technology are viewed by Pasha as inappropriate with regard to people's needs and uncreative. Pakistan began with one channel, PTV, which recently refused to air her documentary on living conditions in Pakistan's rural areas "The Travelogue Pakistan." "The Walled City of Lahore" was her film about life in the old city. Both films poetically depicted the honor of humans and their struggle to stay alive. Some of her documentaries are made to show the value of indigenous skills, centuries old know-how, and traditions, regardless of the poverty. Pasha is described as fighting with PTV management over use of resources. Pasha desires to invest in training people to do documentaries or be more field-oriented rather than investing in equipment. Pasha joined PTV in 1975 and left in 1990. Pasha is recognized for her isolation as a woman in the business world, her commitment to exposing remote cultures and truth, and the odds she must confront in attaining her goals. Pasha is committed to doing extensive research, usually conducted during the summer months, in order to construct a credible story line that is produced usually during the winter months. One model of film story line is defined as one where women are portrayed as starting from an indigenous skill or knowledge and shifting to a greater position of power and control over their lives. Pasha believes that people who make films have the responsibility to evoke a reaction in people and to offer solutions. Two acclaimed films, which were supported by

  5. Understanding the Influence of the Pakistani Government in South Asia

    Science.gov (United States)

    2010-11-01

    boundaries . The earliest events confronting the newly formed Pakistani government emerged from the migration of Muslims into Pakistan. According...between the provinces in the East and West. This decision by the central government led to violence in Dhaka in East Pakistan, where the death of...sic] plan to murder the hostages by suicide explosion if any attempt was made to rescue them. In Mecca, Saudi Arabia, the holiest city in the Islamic

  6. Factors Affecting job satisfaction of employees in Pakistani banking sector

    OpenAIRE

    Ahmed Imran, Hunjra; Muhammad Irfan, Chani; Sher, Aslam; Muhammad, Azam; Kashif-Ur, Rehman

    2010-01-01

    The job satisfaction has got tremendous attention in organizational research. The focus of this study is to determine the impact of various human resource management practices like job autonomy, team work environment and leadership behavior on job satisfaction. It also investigates the major determinants of job satisfaction in Pakistani banking sector. This study further evaluates the level of difference in job satisfaction among male and female employees. The sample of the study consisted of...

  7. Survival outcome of malignant minor salivary tumors in Pakistani population

    Directory of Open Access Journals (Sweden)

    Hassan Iqbal

    2014-01-01

    Full Text Available Objective: Malignant tumors of minor salivary glands (MSG are rare. Survival outcome in Pakistani population with malignant MSG tumors remains to be defined. The objective of this study was to report the clinical presentation, treatment modalities, and survival outcome of radically treated malignant tumors of MSG in Pakistani population. Materials and Methods: Between April 2003 and March 2011, 45 patients with malignant tumors of MSG were treated at Shaukat Khanum Cancer Hospital and included in the study. Patient characteristics and treatment modalities were assessed and local, regional, and distant failures determined. Relapse-free (RFS and overall survival (OS was calculated using Kaplan-Meier curves, and log-rank test was used to determine significance. Results: Median age was 40 (17-83 years. Male to female ratio was 1.25:1. Most common site was hard palate in 31 (69% patients. Adenoid cystic carcinoma (51% was the most common histological diagnosis. Nine patients (20% underwent surgery as the only treatment modality, six patients received (13% radiotherapy alone, and 30 patients (67% had surgery followed by adjuvant radiotherapy. Eight patients developed recurrence (four local, two regional, one locoregional, and one distant. The 5-year actuarial overall OS and RFS was 77 and 66%, respectively. Age, T-stage, and treatment modality were significant for RFS, whereas T-stage and treatment modality were significant factors for OS. Conclusion: Surgery as single modality or combined with radiation therapy resulted in acceptable survival in Pakistani population with malignant minor salivary tumors.

  8. LACK OF AWARENESS ABOUT SAFE BLOOD IN PAKISTANI POPULATION

    Directory of Open Access Journals (Sweden)

    Muhammad Usman

    2014-12-01

    Full Text Available Blood transfusion is a life saving procedure in various transfusion-dependent life threatening conditions and donation of safe blood is a prerequisite for achieving this goal. This study was designed to evaluate the awareness regarding “safe blood” in Pakistani population. This study was conducted at a large scale through a population survey. The test population was divided into two groups i.e. general population and students. The Performa was designed for a general and student population and included 20 questions related to awareness of safe blood. A total of 4900 individuals belonging to different ethnic groups were included in this population survey. Results of social survey were analyzed by using Usman and Moin awareness chart. Results of this study revealed profound unawareness about safe blood in Pakistani population. This study found lack of awareness about safe blood as a major factor that is playing a vital role in the propagation of blood borne diseases in Pakistan. To secure the recipients from blood borne complications through blood donation, it is necessary to create effective awareness about safe blood in Pakistani population.

  9. Factors causing stress among Pakistani working women

    OpenAIRE

    Arif, Ahmed; Naveed, Shaheryar; Aslam, Ramsha

    2017-01-01

    Women are traditionally considered to be confined within the four walls of their houses in the developing countries. They are still unable to play an active role in the development of society. They are striving to make their identity as an integral part of the society. Being a member of conservative developing society, women are still facing many hindrances, causing stressful situation for them, which prohibits them to participate actively in the economic development. This paper attempts to e...

  10. Domestic violence

    OpenAIRE

    Kiurski Jasmina

    2003-01-01

    Since the 1960s, there has been growing awareness regarding the issue of domestic violence as a form of violence against women, which has been largely influenced by the work of feminist activist and scholars in North America and Europe (Dobash and Dobash 1992). Other terms have been used to describe the same phenomenon, including domestic abuse, spousal abuse, wife battering, marital violence, intimate partner violence. Though there is no doubt that this problem has existed for much more than...

  11. Pakistani Students' Perceptions about Use of the Internet in Their Academic Activities

    Science.gov (United States)

    Ali, Zarqa S.

    2014-01-01

    The aim of the study is to explore Pakistani university students' use of the Internet in their studies and their perceptions of online academic life. Findings show that Internet use for academic purposes has both positive and negative aspects. There is a gender difference in Pakistani students' perceptions about the use of the Internet in their…

  12. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    OpenAIRE

    Summaira Naz

    2015-01-01

    The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997) and Satisfaction With Life Scale (Diener, ...

  13. Kauge rahva tragöödia : Eesti Päästemeeskond Pakistanis / Mati Raidma

    Index Scriptorium Estoniae

    Raidma, Mati, 1965-

    2006-01-01

    Eesti Päästemeeskonna ehk EDRT (Estonian Disaster Relief Team) missioonist Pakistani maavärina piirkonda 11.-25. oktoobril 2005. a. Kommenteerib meeskonna juht Tauno Suurkivi. Vt. samas: Rivo Salong. Eesti Päästemeeskonna logistikameeskond Pakistanis. Kommenteerib Eesti Päästemeeskonna otsingu-päästerühma juht Gert Teder

  14. [Traditional nostrum].

    Science.gov (United States)

    Sugiyama, Shigeru

    2006-01-01

    The commercialization of drugs started toward the end of Heian period (794-1192) when not only aristocrats and monks who were traditional patrons to drug makers, but also local clans and landlords who became powerful as a result of the disbanding of aristocratic manors accumulated enough wealth to spend money on medicine. Although traveling around the country was still a dangerous endeavor, merchants assembled groups to bring lucrative foreign drugs (mainly Chinese) to remote areas. The spread of commercial drugs to common people, however, did not happen until the early Edo period (1603-1867), when the so-called barrier system was installed nationwide to make domestic travel safe. Commercialization started in large cities and gradually spread to other areas. Many nostrums popular until recently appeared in the Genroku period (1688-1703) or later. Many such nostrums were all-cures, often consisting of such active ingredients as Saussureae radix, Agalloch, or Gambir. Even in the Edo period, many people living in agricultural or fishing villages, as well as those in the lower tier, were still poor. Much of the medication available to those people was therefore made of various plant or animal-derived substances that were traditionally used as folk medicines.

  15. PAKISTANIS IN ITALY: THE DISENCHANTMENTS OF “LIVING TRANSNATIONALLY”

    Directory of Open Access Journals (Sweden)

    Ali Nobil Ahmad

    2010-12-01

    Full Text Available This article begins with a constructive critique of theories on immigration and highlights the problems implicit in the suppositions of the social network/capital theory and in research on ethnic economies and “transnationalism”. From these theories, the author adopts the postulates that he considers to be most useful for applying to the analysis of the Pakistani diaspora in Italy, demystifying the old theories and calling for greater focus on the economic policy of the networks of emigrants that actually exist. He believes that diasporas act as organisms that are linked in space and time, and which progressively mutate. He goes on to observe how the relatively weak links that today’s emigrants maintain with their country of origin contrast with the undoubtedly stronger links that previous generations of Pakistani emigrants maintained in the United Kingdom; thus he suggests that we should break the reductionist chain of association that automatically attributes greater levels of transnationalism to the new emigration. In this respect, Nobil Ahmad notes that political and economic factors are sometimes more important than technology when it comes to shaping the intensity of the connections sustained between the issuing and welcoming societies in the migration process. Pakistanis in Italy have spent most of their energy working or standing up for their political rights in Europe rather than travelling or sending money home. Likewise, he notes that it is not always true that social networks necessarily carry out the function of mediation of emigration and reducing its costs; on the contrary, in the Mediterranean, the prominence of agenti in emigration networks suggests that we should be sensitive to the importance of mercantilised networks and to the commercial transactions between emigrants and autochthonous citizens. Finally, he calls attention to the individual experience of immigrants who have thrived businesswise, and whose experiences

  16. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria

    OpenAIRE

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-01-01

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for...

  17. Between Preferences: Marriage and Mobility among Danish Pakistani Youth

    DEFF Research Database (Denmark)

    Rytter, Mikkel

    2012-01-01

    and an increasing number of local love marriages have changed the overall picture. This article discusses how the new marriage preferences affect common notions of family relatedness, and suggest that young couples' decision to engage in a love marriage constitutes an act of symbolic mobility. Ultimately Danish...... Pakistanis are split between the marriage preferences set up by their families, the Danish nation-state and themselves. In this respect marriage is not only about entering adulthood and deciding one's future, but also constitutes a process where notions of identity and belonging are negotiated within local...

  18. Domestic and Foreign Banks’ Profitability: Differences and Their Determinants

    Directory of Open Access Journals (Sweden)

    Muhammad AZAM

    2012-01-01

    Full Text Available The purpose of this study to analyze and compare the profitability of domestic (Public & Private and foreign banks operating in the Pakistan Banking market between 2004 and 2010 on quarterly basis. Total 36 Commercial Banks of Pakistani Industry have represented our sample. To control for the effect of bank ownership on performance, we split the sample into three categories: (1 domestic banks with Government Control, (2 domestic banks with Private control, and (3 foreign banks. This study also finds that foreign banks are more profitable than all domestic banks regardless of their ownership structure by applying regression analysis. This may suggest that it is better for a multinational bank to establish a subsidiary/branch rather than acquiring an “existing player” in the host country. We also found that domestic and foreign banks have different profitability determinants, i.e. factors that are important in shaping domestic banks’ profitability are not necessary important for the foreign banks and vice versa. Empirical results show that foreign banks are less affected by the macroeconomic factors of the host country than domestic banks and they have a higher profitability margin in Pakistan.

  19. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Murtaza, B.N.; Bibi, A. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan); Rashid, M.U.; Khan, Y.I. [Shaukat Khanum Memorial Cancer Hospital and Research Centre, Johar Town, Lahore (Pakistan); Chaudri, M.S. [Services Institute of Medical Sciences, Lahore (Pakistan); Shakoori, A.R. [School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore (Pakistan)

    2013-11-29

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients.

  20. Assessment of Gender Dimorphism on Sagittal Cephalometry in Pakistani Population

    International Nuclear Information System (INIS)

    Qamruddin, I.; Shahid, F.; Tanveer, S.; Mukhtiar, M.; Asim, Z.; Alam, M. K.

    2016-01-01

    Objective: To determine and compare the cephalometric values among Pakistani males and females using commonly used sagittal skeletal measurements (ANB, Wits appraisal, Beta-angle) and newly developed cephalometric analyses (Yen-angle and W-angle). Study Design: Observational, cross-sectional study. Place and Duration of Study: Orthodontic Department of Baqai Medical University, Karachi, Pakistan, from August to October 2013. Methodology: A total of 209 pre-treatment lateral cephalometric radiographs of orthodontic patients were selected from departmental records, comprised of 92 males and 117 females. Radiographs were traced for measurements of ANB, Wits appraisal, Beta-angle, W-angle and Yen-angle. Patients were categorized into skeletal classes I, II, and III on the basis of performed measurements, incisor classification, and profile recorded from their records. Descriptive analysis was used to obtain median interquartile range in both the genders and Mann-Whitney U-test was used to observe gender dimorphism. Result: Skeletal class II was the most prevalent type of malocclusion. There were no difference in the obtained measurements between males and females except the Wits appraisal and Beta-angle in class II patients, which showed significant difference in values (p < 0.05). Conclusion: Pakistani population has no significant different difference in the craniofacial morphology of males and females, with the exception of Wits-appraisal and Beta-angle in class II cases. (author)

  1. Spectrum of K ras mutations in Pakistani colorectal cancer patients

    International Nuclear Information System (INIS)

    Murtaza, B.N.; Bibi, A.; Rashid, M.U.; Khan, Y.I.; Chaudri, M.S.; Shakoori, A.R.

    2013-01-01

    The incidence of colorectal cancer (CRC) is increasing daily worldwide. Although different aspects of CRC have been studied in other parts of the world, relatively little or almost no information is available in Pakistan about different aspects of this disease at the molecular level. The present study was aimed at determining the frequency and prevalence of K ras gene mutations in Pakistani CRC patients. Tissue and blood samples of 150 CRC patients (64% male and 36% female) were used for PCR amplification of K ras and detection of mutations by denaturing gradient gel electrophoresis, restriction fragment length polymorphism analysis, and nucleotide sequencing. The K ras mutation frequency was found to be 13%, and the most prevalent mutations were found at codons 12 and 13. A novel mutation was also found at codon 31. The dominant mutation observed was a G to A transition. Female patients were more susceptible to K ras mutations, and these mutations were predominant in patients with a nonmetastatic stage of CRC. No significant differences in the prevalence of K ras mutations were observed for patient age, gender, or tumor type. It can be inferred from this study that Pakistani CRC patients have a lower frequency of K ras mutations compared to those observed in other parts of the world, and that K ras mutations seemed to be significantly associated with female patients

  2. Valuing women’s labour: Law, empowerment and human rights of migrant filipino domestic workers in Pakistan 11th Asian Law Institute International Conference Law in Asia: Balancing Tradition and Modernization

    OpenAIRE

    Shahid, A

    2014-01-01

    International labour migration has expanded across the globe and is no more confined to migration from Asia to Europe, Americas and oil rich Gulf countries. New regional migration patterns have emerged, creating new labour markets within countries in Asia. Domestic service is an informal labour sector where international labour migration is taking place. Historically, domestic service for others' households has remained a principal way of earning a living for women. Affluent families in the d...

  3. Wall thickness of major coronary arteries in Pakistani population

    International Nuclear Information System (INIS)

    Ullah, Q.W.; Qamar, K.; Butt, S.A.; Butt, S.A.

    2012-01-01

    To measure the wall thickness of major coronary arteries in Pakistani population, through micrometry. Study design: An observational study. Place and duration of study: Combined Military Hospital Rawalpindi, Khyber Medical College Peshawar and District Headquarter Hospital, Rawalpindi, in collaboration with Departments of Anatomy and Pathology, Army Medical College Rawalpindi. The duration of study was six months with effect from September 2009 to March 2010. Material and methods: After incising pericardium, 1 mm long segments of major coronary arteries i.e. right coronary artery (RCA), left anterior descending artery (LAD) and left circumflex artery (LCX) were taken 1cm distal to their origin, from adult male cadavers of up to 40 years age. After processing for paraffin embedding, 5 mu m thick sections were prepared, mounted on glass slides and subsequently stained with Hematoxylin and Eosin (H and E) for routine histological study. Verhoeff's elastic stain was used to make the elastic lamina more prominent. Wall thickness for each section was measured through micrometry, circumferentially at eight different places along the planes at 45 deg. to each other and then their mean taken as a reading for the respective artery. Results: The total wall thickness of major coronary arteries and of the individual tunicae was less in Pakistani population. The mean thickness of RCA was 0.61 +- 0.05 mm; LAD had mean thickness of 0.55 +- 0.06 mm whereas that of LCX was 0.66 +- 0.13 mm. The mean thickness of tunica intima of RCA was noted to be 0.230 +- 0.044 mm; tunica media measured 0.205 +- 0.031 mm whereas tunica adventitia was 0.172 +- 0.023 mm thick. The mean thickness of tunica intima of LAD measured 0.156 +- 0.032 mm; tunica media was observed to be 0.224 +- 0.026 mm thick whereas the tunica adventitia was 0.170 +- 0.032 mm thick. The mean thickness of tunica intima of LCX was observed to be 0.203 +- 0.059 mm; tunica media to be 0.282 +- 0.097 mm whereas that of tunica

  4. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men

    OpenAIRE

    Saghir, Sheeba; Hyland, Lynda

    2017-01-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan (n = 56) and those who had immigrated to the United Arab Emirates (n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second m...

  5. Important TQM Implementation Contributors in Pakistani Petrochemical Sector

    Directory of Open Access Journals (Sweden)

    Yasir Latif

    2014-10-01

    Full Text Available This study discusses quality practices in Pakistani Petrochemical sector to understand TQM practices and their implementation in Pakistan. It helps to understand the role of leadership, vision & plan statement, employee participation and education & training as important constructs of TQM. It shows how these constructs help to speed up the TQM implementation in petrochemical sector like other constructs of TQM and finally company moves towards quality approach. The responses of executives, managerial staff and workers were received using questionnaire and online surveys which are sent through Google Drive. Data of 106 respondents was taken in this study and analyzed by SPSS18. Study shows that Total Quality Management culture is less understood by employees, thus less adopted and implemented in Pakistan. Petrochemical companies fail to adopt the TQM philosophy and processes, hence reducing productivity and profits. This research paper is very helpful for executives for TQM implementation in petrochemical sector.

  6. Analysis of toxic metals in branded Pakistani herbal products

    International Nuclear Information System (INIS)

    Saeed, M.; Muhammad, N.; Khan, H.

    2010-01-01

    The present study was designed to estimate the concentration of heavy toxic metals in Pakistani herbal products frequently used for the treatment of various ailments. For this purpose, twenty five herbal products of well reputed herbal manufacturers were selected. The results of our investigation revealed that the concentrations of lead, cadmium, nickel and chromium were far beyond the permissible limits proposed by the International Regulatory Authorities for herbal drugs. Therefore, this study conveys a strong message to the ministry of health to establish proper rules and regulations for the validation of herbal products on scientific grounds in order to protect the general public from the harmful effects of these heavy metals in herbal products. (author)

  7. Statistical Analysis of Pakistani Currency Regime before and after Floatation

    Directory of Open Access Journals (Sweden)

    Shahid ALI

    2011-05-01

    Full Text Available In this paper the trends of exchange rates for the foreign currency are studied yearly for Pakistan rupee. In 2000 State bank of Pakistan officially floated the rupee. In this studies the trends of the exchange rate before floating and after floating and then checks its impact on the GDP per capita of the country. Here we consider the daily data of exchange rates of Pakistani currency from 1995 to 2009. Data was analyzed from 1995 to 2000 in the first step. In the second step data from 2001 to 2009 was analyzed. The result shows that if one wants to fl oat currency he must keep in mind that the political condition or stable and that the economy is also stable so that the system of fl oat can perform its functions completely.

  8. HVDC Transmission an Outlook and Significance for Pakistani Power Sector

    Science.gov (United States)

    Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

    2018-04-01

    Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

  9. Clinical Presentation of Ulcerative Colitis in Pakistani Adults.

    Science.gov (United States)

    Qureshi, Mustafa; Abbas, Zaigham

    2015-01-01

    The aim of this study was to determine the clinical presentation and severity of ulcerative colitis (UC) in Pakistani adult patients. An observational study. Data were obtained by reviewing the medical records of patients who visited a gastroenterology clinic between 2008 and 2012. There were 54 patients diagnosed as UC. The male to female ratio was 1:1. Mean age at diagnosis of UC was 38.7 ± 11.8 years (median 36.5, range 18-64). The predominant presenting symptoms were mucus diarrhea in 49 (90.7%), gross blood in stools in 42 (77.8%), abdominal pain or cramps in 40 (74.1%) and weight loss in 15 (27.7%). Left-sided colitis was present in 23 (42.6%), pancolitis in 15 (27.8%), extensive colitis in 11 (20.4%), and proctitis in five (9.2%). The severity of UC as judged by the Mayo scoring system showed that 68.5% were suffering from moderate to severe disease while 31.5% had mild disease. The extra-intestinal manifestation were found only in seven patients; arthritis in five patients and anterior uveitis in two patients. The arthritis was unilateral and the sites were knee joint in three patients and sacroiliac joint in two patients. Ulcerative colitis presents in our adult patients may present at any age with no gender preponderance. The disease severity is moderate to severe in the majority of patients and more than half of them have left-sided colitis or pancolitis at the time of presentation. Extraintestinal manifestations were not common. Qureshi M, Abbas Z. Clinical Presentation of Ulcerative Colitis in Pakistani Adults. Euroasian J Hepato-Gastroenterol 2015;5(2):127-130.

  10. Domestic cat

    Science.gov (United States)

    Diffendorfer, James E.

    2017-01-01

    The familiar domestic cat is not native to southern California and is considered an invasive spe-cies by biologists and conservation organizations. When owners abandon their cats, wild or feral populations may arise, as they have in San Diego County. Cats’ pelage color, tail length, and hair thickness vary widely, given human fascination with breeding diverse phenotypes, but all have a typical felid body with upright ears, forward-looking eyes adapted for nocturnal foraging, protractible claws, and a sinuous, flexible body. Cats allowed outdoors and feral cats kill and eat a wide variety of vertebrates such as small mammals, birds, and reptiles

  11. Domestic violence

    Directory of Open Access Journals (Sweden)

    Kiurski Jasmina

    2003-01-01

    Full Text Available In this article author examines a definition of a family, the role of a family as a social and legal institution as well as state reaction in a situation of mal function of a family. Special attention is given to a definition of a family, its protective function and criminal law in modern legal systems. Author also analyzes recent reform of our legislation firstly new criminal offence (Article 118a of the Criminal Code of Republic of Serbia - Domestic Violence - and its relation to other similar criminal offences. Finally, author gives an overview of up-to-now practice from District and Municipal Prosecutors Offices in Belgrade and suggestions for solving observed problems in implementation of this criminal offence.

  12. Rigid Basement and the Evolution of the Pakistani Convergent Margin

    Science.gov (United States)

    Haq, S. S.; Davis, D. M.

    2007-12-01

    In Pakistan, along the western edge of the Indian-Eurasian collision there are a series of fold-and-thrust belts that have highly variable strikes and shortening directions with respect to the local relative plate motion. Much of the complexity in the deformation of this margin can easily be explained by the shape, location, and long-term motion of a fragment of relatively rigid oceanic lithosphere that is believed to underlie the Katawaz Basin. In particular, the deformation that has formed the Sulaiman Range and Lobe is a direct consequence of the Katawaz Basin's over all higher strength. The presence of deformed sedimentary strata in the basin comparable to those presently found in the Indus delta are indicative of the basins long-term motion parallel to the Chaman fault zone. In Pakistan, the transition in the strike and shortening directions occurs over a short distance compared to the width of the fold-belts and the length of the margin. We present a series of analog models along with detailed quantitative analysis that we compare to the observed deformation as indicated by both geologic and geophysical data. By quantitatively distinguishing the style and magnitude of deformation in each of a variety of analog experiments we are able to evaluate the viability of various alternative models that have been proposed for fold- belt formation and evolution of the Pakistani margin, including our favored model. The model that best fits the geological and geophysical evidence suggests that the complexity of the Pakistani margin is a result of the long- term northeastward migration of the Katawaz basin along the curving trend of the Chaman fault zone. The vertically integrated mechanical strength of the Katawaz basin allows it to act as a strong 'backstop' that has relative motion to both stable India and stable Eurasia. This northeastward motion and the resulting clockwise rotation of the Katawaz 'block' during the margin's development can explain the location and

  13. Domestic connectivity: media, gender and the domestic sphere in Kenya

    DEFF Research Database (Denmark)

    Gustafsson, Jessica

    2017-01-01

    This article explores how increased media access influences Kenyan women’s everyday life and alters the domestic space. The study, which is set in Uasin Gishu County, Kenya, is based on 30 in-depth interviews with women. The article demonstrates that women have incorporated newly attained media i...... their traditional gender roles.......This article explores how increased media access influences Kenyan women’s everyday life and alters the domestic space. The study, which is set in Uasin Gishu County, Kenya, is based on 30 in-depth interviews with women. The article demonstrates that women have incorporated newly attained media...... into their daily lives and routines and that increased media access has opened up the home, turned the domestic space from a secluded place to a connected space, where women can get input from, connect and interact with the world beyond their immediate surrounding, while remaining at home concurrently fulfilling...

  14. Pakistani and Bangladeshi Young Men: Re-Racialization, Class and Masculinity within the Neo-Liberal School

    Science.gov (United States)

    Mac an Ghaill, Mairtin; Haywood, Chris

    2014-01-01

    This article explores Pakistani and Bangladeshi young men's experiences of schooling to examine what inclusion/exclusion means to them. Qualitative research was undertaken with 48 Pakistani and Bangladeshi young men living in areas of the West Midlands, England. The young men highlighted three key areas: the emergence of a schooling regime…

  15. Domestic Violence and Social Time

    Directory of Open Access Journals (Sweden)

    Donald Black

    2018-05-01

    Full Text Available A violência doméstica é o uso da força entre parceiros que vivem juntos como um casal. A maioria é uma forma de gestão de conflitos conhecida como autoajuda: o tratamento de uma queixa com agressão. Em Violência doméstica e tempo social eu introduzo dois princípios de violência doméstica que explicam 1 quais casais têm mais violência e 2 o que causa sua violência. O primeiro princípio - a violência doméstica é uma função direta da distância doméstica – explica por que algumas estruturas domésticas (como “patriarquias frias” têm mais violência do que outras (como “democracias estreitas”. O segundo princípio – a violência doméstica é uma função direta do movimento do tempo doméstico – explica casos particulares de violência doméstica com mudanças (como diminuição da intimidade ou aumento da desigualdade nas relações domésticas onde elas ocorrem. Esses princípios explicam a violência doméstica nas sociedades tradicionais e modernas, entre homens e mulheres, e em casais heterossexuais e do mesmo sexo. Domestic violence is the use of force between partners who live together as a couple. Most is a form of conflict management known as self-help: the handling of a grievance with aggression. Here I introduce two principles of domestic violence that explain 1 which couples have more violence and 2 what causes their violence. The first principle – domestic violence is a direct function of domestic distance – explains why some domestic structures (such as “cold patriarchies” have more violence than others (such as “close democracies”. The second principle – domestic violence is a direct function of the movement of domestic time – explains particular cases of domestic violence with changes (such as decreases of intimacy or increases of inequality in the domestic relationships where they occur. These principles explain domestic violence in traditional and modern societies, by men and

  16. Coronary anomalies in Pakistani children with tetralogy of fallot

    International Nuclear Information System (INIS)

    Hussain, I.; Patel, N.

    2010-01-01

    To determine coronary artery anomalies in tetralogy of Fallot in Pakistani children as seen on angiography. Study Design: Case series. Place and Duration of Study: The National Institute of Cardiovascular Diseases, Karachi, Pakistan from July 2006 to July 2007. Methodology: Children under 15 years of age with echocardiographic diagnosis of tetralogy of Fallot were included in the study. All patients had pre-operative cardiac catheterization and angiography. Coronary arteries were studied with a nonselective aortic root angiogram in standard cranially tilted left anterior oblique view. The frequency of a normal and an anomalous coronary was determined. Results: Of the 83 patients, 78% were male and had a mean age of 8.9 years. Their mean weight was 14.3 kilograms. Seventy six (91.6%) had a normal coronary anatomy while 7 (8.4%) patients had anomalous coronary arteries. Among the patients with coronary anomalies, the commonest was a single origin coronary artery in 04 (57.14%) cases. Three (42.86%) had an anomalous origin of left anterior descending artery from the right coronary artery. Conclusion: Coronary artery anomalies were detected in 8.4% of the cases with tetralogy of Fallot. Single origin coronary artery anomaly was the commonest anomaly. (author)

  17. Genetic characterization of different pakistani date palm varieties

    International Nuclear Information System (INIS)

    Akhtar, W.; Rashid, A.; Mahmood, T.

    2014-01-01

    Date palm (Phoenix dactylifera L.) is the oldest cultivated fruit tree and it has a great socioeconomic and nutritional value. Breeding programs and conservation rely on genetic characterization and diversity in gene pool. Its genetic diversity has not been focused more in Pakistan yet, therefore the present study aimed at the evaluation of genetic relationship based on chloroplast ribosomal protein gene (rps14). Rps14 gene was amplified and sequenced from selected varieties. Phylogram illustrated over all genetic distance of 0.001 representing close genetic relationship of selected P. dactylifera varieties. Pairwise distance was calculated for rps14 gene and very low genetic diversity values were observed ranging 0.003-0.017. Estimates of average evolutionary divergence of overall sequence pairs and nucleotide diversity were again found very low with 0.008 and 0.007 respectively. Sequences were analyzed by MEGA6, which revealed Pathri, Dhaddy, Makhi and Khudrawi as recent varieties. On the basis of rps14 genetic makeup, it can be suggested that Pakistani date palm varieties show very high degree of similarity. (author)

  18. Challenges of implementing e-learning in a Pakistani university

    Directory of Open Access Journals (Sweden)

    Ijaz A. Qureshi

    2012-09-01

    Full Text Available The integration of e-learning programs into the educational system has reshaped the process of acquisition and dissemination of knowledge throughout the society. Although numbers of researchers approve of the effectiveness of e-learning integration in terms of the innovation it offers to engage with students does not guarantee the success of e-learning programs. This can be observed in developing countries like Pakistan, which have not yet been able to benefit fully from the advantages of e-learning. Though the importance of this issue is theoretically highlighted in research, empirical evidence is scarce particularly regarding developing countries like Pakistan.Therefore, the purpose of this study is to identify the issues, related to e-learning through the feedback captured from students and provide strategies to successfully overcome the issues. In order to achieve this purpose, a number of issues prevailing in a Pakistani private university were identified through in depth literature review and discussion with the students. The findings demonstrated electricity failure and English proficiency as the most significant barriers to successful integration of e-learning. Lastly conclusion was drawn and suggestions were made on the basis of issues identified.

  19. Chest radiological findings in pakistani cement mill workers

    International Nuclear Information System (INIS)

    Meo, Sultan A.

    2003-01-01

    Chest radiological findings in Pakistani cement mill workers Even in the 21st century, in developing countries millions of people work daily in dusty environments. They are exposed to different types of health hazards namely, fumes, gases and dust, which are risk factors for developing occupational diseases. Therefore, the aim of this study was to perform chest radiology to determine the occupational hazards of cement dust on the lungs of cement mill workers. This study was carried out in the Department of Physiology, Faculty of Health and Medical Sciences, Hamdard University Karachi, Pakistan, during the period June to August 2000. In this study 50, apparently healthy volunteer male cement mill workers were randomly selected with an average of 13 years exposure with age ranging from 20-60 years. They were matched with 50, healthy male control subjects in terms of age, height, weight and socioeconomic status. Both groups met with exclusion criteria as per standard. Radiology was performed by Trophy radiology. Results: The present study demonstrated 12% of cases with interstitial lung disease and 2% of cases with pleural thickening and chronic bronchitis in cement mill workers. Conclusion: Exposure to cement dust causes interstitial lung disease, pleural thickening and chronic bronchitis in cement mill workers. (author)

  20. The prevalence of Y chromosome microdeletions in Pakistani infertile men

    Directory of Open Access Journals (Sweden)

    Rubina Tabassum Siddiqui

    2013-01-01

    Full Text Available Background: Microdeletions of the azoospermia factor locus of the long arm of Y chromosome are an etiological factor of severe oligozoospermia or azoospermia. Objective: The aim of this study was to investigate the prevalence of Y-chromosome microdeletions in AZF region and their role in infertility in Pakistani population. Materials and Methods: The type of deletions in AZF locus were detected in infertile men (n=113 and the association of Y chromosome microdeletions with male infertility was assessed by including men (50 with normal karyotype and having children. Y chromosome microdeletions were detected by multiplex PCR using 10 sequence tagged sites namely sY81, sY130, sY141, sY142, sY155, sY157, sY160, sY182, sY231, and sY202 that covered all three regions of AZF. Results: Individuals with severe oligozoospermia showed 2.86% deletion frequency in AZFc region as compared to azoospermic males (5.5%. Conclusion: The results of our study showed that deletions in Y chromosome are not playing major part in male infertility. Moreover, multiplex-PCR strategy might preferably be employed for the detection of Y chromosome microdeletions allied to male infertility.

  1. OWNERSHIP AND CAPITAL STRUCTURE OF PAKISTANI NON-FINANCIAL FIRMS

    Directory of Open Access Journals (Sweden)

    Khan Shoaib

    2016-07-01

    Full Text Available Existi ng literature has not yet defi ned a clear-cut relati onship between ownership structure and capital structure. This study aims to contribute to this controversial argument by examining the impact of internal (managerial ownership and external ownership on fi nancing preferences using the case of non-fi nancial fi rms listed on Karachi stock exchange during the period of 2008-2012. Our results suggest that the external ownership has a signifi cant eff ect on capital structure in accordance with the presence of blockholders. In contrast, the internal ownership has a complicated eff ect; it shows signifi cant positi ve and negati ve relati onship to leverage at lower and certain higher proporti on of managerial shareholding respecti vely. Besides, the combined analyses suggest that the presence of blockholders negates the impact of managerial ownership on capital structure. This implies that the presence of large and dominant shareholders in Pakistani fi rms may have caused a bias for debt fi nancing to protect their voti ng power and returns.

  2. Oligohydramnios in a pregnant Pakistani woman with Plasmodium vivax malaria.

    Science.gov (United States)

    Binello, Nicolò; Brunetti, Enrico; Cattaneo, Federico; Lissandrin, Raffaella; Malfitano, Antonello

    2014-04-23

    In the Western world, the diagnosis and management of Plasmodium vivax malaria in pregnant women can be challenging, and the pathogenesis of adverse outcomes for both the mother and the foetus is still poorly known. The authors describe the case of a 29-year-old Pakistani woman at the 29th week of her second pregnancy, who was admitted to the Hospital following the abrupt onset of fever. At the time of admission, she had been living in Italy without travelling to any malaria-endemic areas for eight months. She was diagnosed with vivax malaria after a thin blood smear revealed the presence of plasmodial trophozoites and gametocytes and treated accordingly. Due to the onset of oligohydramnios, she underwent caesarian section at the 31st week of pregnancy with no further complications. Histological examination of the placenta showed no evidence of plasmodial infection, but was inconclusive. It is unclear whether oligohydramnios is a complication of pregnancy-related Plasmodium vivax malaria. Given the long latency of hypnozoites, every febrile pregnant patient with a previous stay in an endemic area should be screened for malaria with a thick and a thin blood smear.

  3. Genotype and phenotype relationships in 10 Pakistani unrelated patients with inherited factor VII deficiency.

    Science.gov (United States)

    Borhany, M; Boijout, H; Pellequer, J-L; Shamsi, T; Moulis, G; Aguilar-Martinez, P; Schved, J-F; Giansily-Blaizot, M

    2013-11-01

    Inherited factor VII (FVII) deficiency is one of the commonest rare bleeding disorders. It is characterized by a wide molecular and clinical heterogeneity and an autosomal recessive pattern of inheritance. Factor VII-deficient patients are still scarcely explored in Pakistan although rare bleeding disorders became quite common as a result of traditional consanguineous marriages. The aim of the study was to give a first insight of F7 gene mutations in Pakistani population. Ten unrelated FVII-deficient patients living in Pakistan were investigated (median FVII:C = 2%; range = 2-37%). A clinical questionnaire was filled out for each patient and direct sequencing was performed on the coding regions, intron/exon boundaries and 5' and 3' untranslated regions of the F7 gene. Nine different mutations (eight missense mutations and one located within the F7 promoter) were identified on the F7 gene. Five of them were novel (p.Cys82Tyr, p.Cys322Ser, p.Leu357Phe, p.Thr410Ala, c-57C>T, the last being predicted to alter the binding site of transcription factor HNF-4). Half of the patients had single mutations in Cys residues involved in disulfide bridges. The p.Cys82Arg mutation was the most frequent in our series. Six of seven patients with FVII:C levels below 10% were homozygous in connection with the high percentage of consanguinity in our series. In addition, we graded the 10 patients according to three previously published classifications for rare bleeding disorders. The use of the bleeding score proposed by Tosetto and co-workers in 2006 appears to well qualify the bleeding tendency in our series. © 2013 John Wiley & Sons Ltd.

  4. CONSANGUINITY, GENETICS AND DEFINITIONS OF KINSHIP IN THE UK PAKISTANI POPULATION.

    Science.gov (United States)

    Bittles, A H; Small, N A

    2016-11-01

    Consanguineous marriage is a controversial topic in many Western societies, with attention mainly focused on the health of immigrant communities from Asia and Africa. In the UK consanguinity is especially prevalent in the Pakistani community, which now numbers over 1.1 million. Less attention has been paid to the influence of hereditary population stratification within Pakistani communities, in particular biraderi (literally brotherhood) membership, which denotes male lineages that largely govern marriage partner choice and hence the transmission of disease genes. The various roles played by biraderi and their relationship to other socio-occupational and kinship terms, such as caste, quom and zat, are often overlooked in health-based studies. The interchangeable use of these different kinship terms without rigorous definition can create identity uncertainty and hinders inter-study comparisons. Where feasible, standardization of terminology would be both desirable and beneficial, with biraderi the preferred default term to identify specific social and genetic relationships within the Pakistani diaspora.

  5. Relationship of Life Satisfaction and Job Satisfaction among Pakistani Army Soldiers

    Directory of Open Access Journals (Sweden)

    Summaira Naz

    2015-03-01

    Full Text Available The present study had two main objectives; first, to discover the relationships between job satisfaction and life satisfaction in Pakistani army soldiers, second, to find out the age, salary, marital status, and education differences on job satisfaction and life satisfaction in Pakistani army soldiers. In the present study two questionnaires; Job Satisfaction Scale JSS (Macdonald & Maclntyre, 1997 and Satisfaction With Life Scale (Diener, et al., 1985; were administered to a sample (N=400 along with a demographic sheet. The results of the study revealed a significant positive correlation between job satisfaction and life satisfaction of Pakistani army soldiers. The findings of the study also showed a significant age, education, salary, and marital status differences in job satisfaction and life satisfaction. Age, marital status, and salary variables had positive correlation with job satisfaction and life satisfaction but education had a negative association with job satisfaction and life satisfaction

  6. Supporting Pakistani and Chinese families with young children: perspectives of mothers and health visitors.

    Science.gov (United States)

    Hogg, R; de Kok, B; Netto, G; Hanley, J; Haycock-Stuart, E

    2015-05-01

    In the UK, public health nurses (health visitors) provide support and advice to families with young children, including those from minority ethnic communities. While the need for cultural sensitivity is being increasingly recognized, the factors which contribute to this sensitivity are poorly understood. The Pakistani and Chinese communities constitute the two largest minority ethnic groups in Scotland. This study explored Pakistani and Chinese women's experience of motherhood and of the health visiting service and public health nurses' experiences of working with Chinese and Pakistani mothers. Semi-structured individual interviews were carried out with 16 Pakistani and 15 Chinese mothers. Eight health visitors took part in two focus groups. The study was undertaken in an urban area of Scotland. Data were analysed thematically. Chinese and Pakistani mothers negotiate complex processes in order to ensure that their children maintain their own ethnic identity while fitting in with their peers in their adopted country. Health visitors were seen as supportive, although sometimes advice and information given was culturally inappropriate, and their role was often poorly understood. Health visitors were anxious to be sensitive to families' religious and cultural beliefs. Cultural sensitivity is an important factor in providing appropriate advice and help to Pakistani and Chinese families, and involves health visitors in considering views and practices on parenting which may differ across cultures, including their own. Family characteristics need to be understood on an individual basis, rather than making assumptions about clients' cultural norms and lifestyles. This is best achieved by exploring with mothers if they understand the advice and information they are being offered and also if it is appropriate to their cultural and religious beliefs. © 2014 John Wiley & Sons Ltd.

  7. Stories of pain and health by elderly Pakistani women in Norway.

    Science.gov (United States)

    Sverre, Beate Lie; Solbrække, Kari Nyheim; Eilertsen, Grethe

    2014-11-01

    This ethnographic study investigates the stories of elderly Pakistani women living in Norway. Migration studies indicate that elderly migrant women are passive, ill victims caught in a marginalized position due to age, ethnicity and gender, and thus have little access to opposition and agency. To broaden the picture it is necessary to develop an innovative approach to understand what is implicated in the process of migration. The importance of considering life conditions that surrounds potential health promotion behaviors of immigrants is stressed by several researchers. However, up to now limited research guided by this perspective has been done in Norway. Therefore, this study explored how elderly Pakistani women in Norway promote their health and well-being through some distinct social interactions. The intention is to bring awareness to how health, even by so-called disadvantaged social groups, may take place. These practices are important to take into consideration when developing health-promoting policies for elderly immigrants. An ethnographic study of 15 Pakistani women, aged 53-75, was carried out in a multisided fieldwork in Oslo using participant observation and ethnographic interviews. The analytical approach was inspired by the constructivist theoretical framework of narrative ethnography. The elderly Pakistani women in Norway construct stories of living in-between cultures and experiences of acculturative stress caused by being elderly, immigrants and women. However, this analysis also suggests that through distinct social relationships, primarily in the context of a voluntary organization, elderly Pakistani women do health by the way they interact and construct a repertoire of social identities. The healing practices taking place among elderly Pakistani women may counteract the negative health outcomes associated with age, migration and gender implications for immigrant health-promoting policy in Norway may be to increase the establishment and

  8. Domestic heating - the biomass challenge

    International Nuclear Information System (INIS)

    Rakos, C.

    1999-01-01

    This article highlights currently available efficient, low emission technical concepts for the combustion of wood, log-burning boilers, woodchip boilers, and the use of wood pellets. The economics of domestic heating with wood, the higher costs incurred with modern efficient wood burners as compared with fuelwood costs, and the proposed European Commission's campaign to implement more wood heated dwellings are discussed, and the transition from traditional to modern wood heating, and options for stimulating growth in renewable energy are considered

  9. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  10. Evaluation of genetic diversity in different Pakistani wheat land races

    International Nuclear Information System (INIS)

    Mahmood, T.; Siddiqua, A.; Rasheed, A.; Nazar, N.

    2011-01-01

    Wheat is one of the main sources of nutrition worldwide. Genetic improvement of the seed makes wheat a source of high quality flour for human consumption and for other industrial uses. With the help of molecular markers, the available germplasm of wheat can be assessed for future breeding programs. Therefore, the aim of the present work was to analyze the genetic diversity among 15 Pakistani wheat land races based on Random Amplified Polymorphism DNA (RAPD) markers. A total of 284 DNA fragments were amplified, ranging in size from 200bp to 1100bp by using six primers. The number of DNA fragments for each primer varied from 2 (OPC-6) to 9 (OPC-8) with an average of 6 fragments per primer. Out of 284 amplified products, 120 were monomorphic and 137 were polymorphic showing an average of 7.8% polymorphism per primer. One specific marker was detected both for OPC-1 and OPC-8, two for OPC-5, while no RAPD specific marker was detected for the remaining primers. The genetic similarity index values ranged from 0.36 to 0.93, with an average of 0.64. Maximum genetic similarity (91%) was observed between Sur bej and Khushkawa. On the contrary, minimum genetic similarity (32%) was observed in Khushkaba-1 and Khushkawa. The dendrogram resulting from the NTSYS cluster analysis showed that the studied genotypes are divided into two main clusters from the same node. The first cluster contained 13 land races, while the second cluster contained only 2 land races. The dendrogram clustered the genotypes into 5 groups and showed efficiency in identifying genetic variability. These results indicated the usefulness of RAPD technique in estimating the genetic diversity among wheat genetic resources. (author)

  11. Cultural perceptions and the productive roles of rural Pakistani women.

    Science.gov (United States)

    Ibraz, T S

    1992-01-01

    The roles of rural Pakistani women in agricultural production are described with numerous examples from a village study by Anwar and Bilquees, and the author's research in a Punjabi village (Rajpur) to show cultural perceptions of women and their work, and the nature of productive activities inside the house and outside on the farm. The cultural perceptions are related to the image of women as dependent/private wives and mothers. A broad definition of production is used to include activities, such as churning milk which generates income and saves expenditures and making butter which fulfills household needs and is sold in the market for cash. Rajpur is a village engaged in social change. Men seek work outside the villages, and women take on work previously assumed by men. Women contribute considerably to the year-round production and processing of major crops. The productive labor of women by major crop type and activity type are described and charted. Tending livestock is performed exclusively by men. Handicraft activity at home reduces expenditure for buying these items in the local markets. Most women were unaware of the savings and "indirect" income their work contributed to the household. Work for wages is viewed as men's work. Women's mobility beyond the fields and home is still limited; market activity must be conducted with a male present and women do not earn cash. The division of labor is conceived by men for women because of women's cultural identity. Women are perceived as "chase daughters/sisters, fertile wives, and nurturing mothers." There are punishments or social rewards for proper behavior. Women in their private domain are expected to "look good within the house," which is viewed as a feminine world. The outside world is masculine. Women are also seen as lacking reasoning ability and their motherhood roles limit their capability to cope with external affairs. There is great value attached to the invisibility of women physically, socially, and

  12. Pakistani medical students' specialty preference and the influencing factors.

    Science.gov (United States)

    Rehman, Anis; Rehman, Tariq; Shaikh, Muhammad Ateeb; Yasmin, Haleema; Asif, Ammara; Kafil, Hina

    2011-07-01

    To elucidate the specialty preferences of Pakistani medical students and the factors which influence medical students to make the decision regarding which specialty to pursue. Both basic sciences and clinical students from four medical colleges of Pakistan, i.e., Dow Medical College, Sindh Medical College, Liaquat National Medical College and Muhammad Medical College, were included in the cross-sectional survey during the period of July 2008 to Jan' 2009. After ethical acceptance, data was collected using convenient sampling technique. The questionnaire covered the following demographic details: 13 common specialties and 15 influencing factors. Questionnaires included in the analysis were 771. Most students gave preference to surgery and its associated sub-specialties (50.3%) followed by internal medicine (26.8%), paediatrics (23.2%), dermatology (16.7%), gynaecology and obstetrics (16.7%), psychiatry (13.1%), radiology (10.8%), ENT (8.8%), anaesthesiology (8.7%), administrative medicine (8.6%), orthopaedics (8.2%), ophthalmology (7.5%), and laboratory medicine (6.1%). The highly considered factors (regarding specialties) chosen by 70% of the medical students were: applicable to respective personalities of the individuals, prestige and respect, international opportunities, and time commitment. Surgical-skills, job availability, financial rating, academic performance, and a role model were moderately influencing factors. Hospital environment, parents, general practice, peer-pressure and personal health were the least influential. This trend suggests competition in surgery and its sub-specialties along with internal medicine, paediatrics, dermatology, gynaecology and obstetrics. Specialty suited to personality, time commitment, prestige/respect and international opportunity, influenced more than 70% of the students.

  13. Working of Ideology in the TV Commercials of Cold Drinks in Pakistani Media

    Science.gov (United States)

    Ahmad, Madiha; Ahmad, Sofia; Ijaz, Nida; Batool, Sumera; Abid, Maratab

    2015-01-01

    The article aims at the analysis of the TV commercials of three carbonated cold drinks from Pakistani media. The analysis will be carried out using the three dimensional framework presented by Fairclough. Through the analysis, the ideological framing of the commercials will be brought to light. To achieve this purpose different techniques used by…

  14. Pakistani English Newspaper Paid Obituary Announcements: A Descriptive Analysis of the Transliterated Vocabulary

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2016-01-01

    The study, qualitative and descriptive in nature, examines the use of transliteration in the paid Pakistani obituary announcements authored in the English language. Primarily, it identifies the frequently used transliterated vocabulary in these linguistic messages and reconnoiters the functional relationship that emerges in and between the textual…

  15. Obesity and Minority--Changing Meanings of Big Bodies among Young Pakistani Obesity Patients in Norway

    Science.gov (United States)

    Wathne, Kjetil; Mburu, Christina Brux; Middelthon, Anne-Lise

    2015-01-01

    Globally, paediatric obesity causes widespread concern, and the role of ethnicity is an important focus. Investigating how culture can mediate health-related behaviour through ideas about bodies, food and physical activity, while addressing a notion that the Pakistani community in Norway is particularly conservative and slow to change, this…

  16. Inequalities in health: a comparative study between ethnic Norwegians and Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Claussen Bjorgulf

    2006-06-01

    Full Text Available Abstract Background The objective of the study was to observe the inequality in health from the perspective of socio-economic factors in relation to ethnic Pakistanis and ethnic Norwegians in Oslo, Norway. Method Data was collected by using an open and structured questionnaire, as a part of the Oslo Health Study 2000–2001. Accordingly 13581 ethnic Norwegians (45% of the eligible participated as against 339 ethnic Pakistanis (38% of the eligible. Results The ethnic Pakistanis reported a higher prevalence of poor self-rated health 54.7% as opposed to 22.1% (p Conclusion There is a large diversity of self-rated health, prevalence of diabetes and distress among the ethnic Pakistanis and Norwegians. Socio-economic status may partly explain the observed inequalities in health. Uncontrolled variables like genetics, lifestyle factors and psychosocial factors related to migration such as social support, community participation, discrimination, and integration may have contributed to the observed phenomenon. This may underline the importance of a multidisciplinary approach in future studies.

  17. Pakistanis käib võitlus islamiriigi nimel / Karin Volmer

    Index Scriptorium Estoniae

    Volmer, Karin

    2007-01-01

    Pakistani pealinna Islamabadi Punase mošee ümber kestva, vähemalt 16 ohvrit nõudnud vastasseisu taga on islamiäärmuslaste soov kangutada ametist Ameerika-meelne president Pervez Musharraf. Vt. samas: Sündmused; Pakistan: kaart

  18. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  19. Relation of Home Chaos to Cognitive Performance and Behavioral Adjustment of Pakistani Primary School Children

    Science.gov (United States)

    Shamama-tus-Sabah, Syeda; Gilani, Nighat; Wachs, Theodore D.

    2011-01-01

    Recent findings from Western developed countries have linked home chaos to children's cognitive performance and behavioral problems. In the present paper we test whether the same pattern of associations can be replicated in a non-Western developing country. Our sample was 203 Pakistani primary school children. To assess home chaos the Confusion,…

  20. Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

    African Journals Online (AJOL)

    Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

  1. Continuing Bonds in Bereaved Pakistani Muslims: Effects of Culture and Religion

    Science.gov (United States)

    Suhail, Kausar; Jamil, Naila; Oyebode, Jan; Ajmal, Mohammad Asir

    2011-01-01

    This study explores the bereavement process and continuing bond in Pakistani Muslims with the focus on how culture and religion influence these processes. Ten participants were interviewed and their transcribed interviews were analyzed using a grounded theory approach. Three main domains were identified from the narratives expressed by the…

  2. Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation

    OpenAIRE

    Shakari, Yasmine

    2013-01-01

    Summary Author s name: Yasmine Shakari Title: Family, Socialization and Migration in Norwegian-Pakistani Families: A Study of the First and the Second Generation Supervisor: Øystein Gullvåg Holter Co-supervisor: Thomas Walle Aim of study: This thesis seeks to obtain knowledge about 1) how the first generation of Norwegian-Pakistanis were raised in Pakistan in terms of socialization of gender roles, 2) how the second generation of Norwegian-Pakistanis have been raised here in Norway, and 3) if...

  3. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway.

    Science.gov (United States)

    Syed, Hammad Raza; Dalgard, Odd Steffen; Dalen, Ingvild; Claussen, Bjørgulf; Hussain, Akthar; Selmer, Randi; Ahlberg, Nora

    2006-07-10

    In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Data was collected from questionnaires as a part of the Oslo Health Study 2000-2001. 13581 Norwegian born (attendance rate 46%) and 339 ethnic Pakistanis (attendance rate 38%) in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL) was used as a measure of psychological distress. Pakistanis reported less education and lower employment rate than Norwegians (p < 0.005). The Pakistani immigrants also reported higher distress, mean HSCL score 1.53(1.48-1.59), compared to the ethnic Norwegians, HSCL score 1.30(1.29-1.30). The groups differed significantly (p < 0.005) with respect to social support and feeling of powerlessness, the Pakistanis reporting less support and more powerlessness. The expected difference in mean distress was reduced from 0.23 (0.19-0.29) to 0.07 (0.01-0.12) and 0.12 (0.07-0.18) when adjusted for socioeconomic and social support variables respectively. Adjusting for all these variables simultaneously, the difference in the distress level between the two groups was eliminated Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions

  4. British-Pakistani women's perspectives of diabetes self-management: the role of identity.

    Science.gov (United States)

    Majeed-Ariss, Rabiya; Jackson, Cath; Knapp, Peter; Cheater, Francine M

    2015-09-01

    To explore the effects of type 2 diabetes on British-Pakistani women's identity and its relationship with self-management. Type 2 diabetes is more prevalent and has worse outcomes among some ethnic minority groups. This may be due to poorer self-management and an inadequate match of health services to patient needs. The influence that type 2 diabetes has on British-Pakistani women's identity and subsequent self-management has received limited attention. An explorative qualitative study. Face-to-face semi-structured English and Urdu language interviews were conducted with a purposively selected heterogeneous sample of 15 British-Pakistani women with type 2 diabetes. Transcripts were analysed thematically. Four themes emerged: Perceived change in self emphasised how British-Pakistani women underwent a conscious adaptation of identity following diagnosis; Familiarity with ill health reflected women's adjustment to their changed identity over time; Diagnosis improves social support enabled women to accept changes within themselves and Supporting family is a barrier to self-management demonstrated how family roles were an aspect of women's identities that was resilient to change. The over-arching theme Role re-alignment enables successful self-management encapsulated how self-management was a continuous process where achievements needed to be sustained. Inter-generational differences were also noted: first generation women talked about challenges associated with ageing and co-morbidities; second generation women talked about familial and work roles competing with self-management. The complex nature of British-Pakistani women's self-identification requires consideration when planning and delivering healthcare. Culturally competent practice should recognise how generational status influences self-identity and diabetes self-management in ethnically diverse women. Health professionals should remain mindful of effective self-management occurring alongside, and being

  5. Domestic Violence - Multiple Languages

    Science.gov (United States)

    ... Are Here: Home → Multiple Languages → All Health Topics → Domestic Violence URL of this page: https://medlineplus.gov/languages/ ... V W XYZ List of All Topics All Domestic Violence - Multiple Languages To use the sharing features on ...

  6. Access to Power: Governance and Development in the Pakistani Electrical Power Sector

    Science.gov (United States)

    Naqvi, Ijlal

    This dissertation explores governance in Pakistan through a study of the state-run electrical power sector. At both the micro and macro level, the Pakistani power sector provides a lens into the heart of the Pakistani state and its governance institutions. This ethnographic and historical study offers an in-depth look at state operations in a developing country, situates the current Pakistani power crisis in a larger context of continuity through periods of dictatorship and democracy, and suggests how efforts to make state service delivery more responsive to citizens might be reconceived. A historical review of the Pakistani power sector establishes first and foremost that the current crisis is the product of longer-term processes for which the policy solutions currently being proposed (with the support of international donors and multilateral lenders) are inadequate. Depoliticized attempts at power sector reform have little to offer in light of the pervasively informal and negotiated nature of the fragmented Pakistani state. The institutions of power sector governance are mutually constituted by the formal rules and the informal---personal relationships, language, violence, money, and power. These rules of the game are as relevant to relations within and between public sector organizations as they are to the engagement of citizens with their state. The same rules apply at the margins of the state---informal squatter settlements---as at the core, though the resources brought to bear and the resultant outcomes are different. The internal incoherence of this state underscores the limitations of formal rules in determining outcomes, and the poor prospects for reform efforts that focus exclusively on the formal aspects of governance. To proactively engage with the question of political will leads away from top-down policy perspectives and counter to the depoliticizing tendencies that currently shape policy reforms. Instead, an energized and informed local participation

  7. Reframing domestic violence as torture or terrorism

    Directory of Open Access Journals (Sweden)

    Marcus Isabel

    2014-01-01

    Full Text Available This paper focuses on the analysis of the phenomenon of domestic violence and the distinctive features for which is it may be recognized as a specific form of torture and/or terrorism at home. The author provides an overview of the scientific debate among feminist authors on this conception which has given rise to an innovative approach to understanding the concept of domestic violence. Underscoring the substantive similarity of domestic violence with the acts of torture and/or terrorism, the author urges for state action arguing that domestic violence as a form of gender-based violence should be approached by applying the same logic and strategies which are employed in response to traditional torture and terrorism.

  8. Training for Internationalization through Domestic Geographical Dispersion

    DEFF Research Database (Denmark)

    Santangelo, Grazia D.; Stucchi, Tamara

    Traditionally created to deal with the unfriendly domestic environment, business groups (BGs) are increasingly internationalizing. However, how BGs can reconcile their strictly domestic orientation with an international dimension still remains an open question. Drawing on arguments from...... organizational learning, we seek to solve this puzzle in relation to the internationalization of Indian BGs. In particular, we argue that in heterogeneous domestic emerging markets BG’s geographical dispersion across sub-national states provides training for internationalization. To internationalize successfully......, BGs need to develop the capability of managing geographically dispersed units in institutional heterogeneous contexts. Domestic geographical dispersion would indeed help the BG dealing with different regulations, customers and infrastructures. However, there is less scope for such training as BGs...

  9. Socio-Demographic Predictors of Domestic Outsourcing among ...

    African Journals Online (AJOL)

    Paid labour, for women, affects the traditional roles typical in a patriarchal society like Nigeria. This study examined the socio-demographic factors predisposing working women to outsource domestic tasks. The paper engages the factors highlighted by 140 of the 528 sampled working women who engaged domestic ...

  10. Women and Domestic Violence: Implication for Counselling ...

    African Journals Online (AJOL)

    Domestic violence against women or girl child has been an old phenomenon women were compared as weak, vulnerable, and in position to be exploited. The traditional norms has made them subject of violence where men were given the outright domination over the issue that affect their lines. They are assaulted ...

  11. Testing the Week Form Efficiency of Pakistani Stock Market (2000-2010

    Directory of Open Access Journals (Sweden)

    Abdul Haque

    2011-01-01

    Full Text Available This empirical paper tests out the weak form efficiency of Pakistani stock market by examining the weekly index over the period . Return series has a leptokurtic and negatively skewed distribution, which is away from normal distribution as reflected by significant Jarque-Bera statistic. Estimated results of ADF (1979, PP (1988 and KPSS (1992 tests, Ljung-Box Q-Statistic of autocorrelations and runs test of randomness reject the Random Walk Hypothesis (RWH for the returns series. Moreover the results of variance ratio test (Lo and MacKinlay (1988 also reject the RWH and prove the robustness of other estimated results. The rejection of RWH reveals that the Pakistani stock prices are not Weak Form Efficient.

  12. The Effects of Immigration and Media Influence on Body Image Among Pakistani Men.

    Science.gov (United States)

    Saghir, Sheeba; Hyland, Lynda

    2017-07-01

    This study examined the role of media influence and immigration on body image among Pakistani men. Attitudes toward the body were compared between those living in Pakistan ( n = 56) and those who had immigrated to the United Arab Emirates ( n = 58). Results of a factorial analysis of variance demonstrated a significant main effect of immigrant status. Pakistani men living in the United Arab Emirates displayed poorer body image than those in the Pakistan sample. Results also indicated a second main effect of media influence.Those highly influenced by the media displayed poorer body image. No interaction effect was observed between immigrant status and media influence on body image. These findings suggest that media influence and immigration are among important risk factors for the development of negative body image among non-Western men. Interventions designed to address the negative effects of the media and immigration may be effective at reducing body image disorders and other related health problems in this population.

  13. Genetic analysis of basmati and non-basmati Pakistani rice (oryza sativa l.) cultivars using microsatellite markers

    International Nuclear Information System (INIS)

    Rabbani, M.A.; Masood, M.A.; Shinwari, Z.K.

    2010-01-01

    Information of genetic variability and relatedness among rice genotypes is essential for future breeding programmes and derivation of superior cultivars. The objective of the present study was to evaluate the genetic relationship among traditional and improved cultivars of Pakistani rice and to determine differences in the patterns of variation between two indica rice groups: basmati and nonbasmati. Forty-one cultivars were evaluated by means of 30 microsatellite markers distributed over the whole rice genome. A total of 104 alleles were detected by 30 markers, all of them (100%) were polymorphic. The number of alleles generated by each marker ranged from 2 to 6 with an average of 3.5 alleles marker-1. Polymorphism information content (PIC) varied from 0.259 to 0.782 with an average of 0.571. A significant positive correlation (r = 0.71) was found between the number of alleles at SSR locus and the PIC values. Pair-wise Nei and Li's similarity coefficients ranged from 0.10 to 0.99. A dendrogram based on cluster analysis by microsatellite polymorphism grouped 41 rice cultivars into 2 major groups effectively differentiating the late maturing, tall and slender-grain basmati and other aromatic rice cultivars from the early, short statured, short bold and long bold grain non-aromatic cultivars. Higher level of genetic diversity between basmati and non-basmati support the concept that former had a long history of independent evolution and diverged from nonbasmati rice a long time ago through human selection and patronage. Present investigation further indicated that genetically basmati rice is different from that of coarse indica and japonica type. The results suggested that microsatellite markers could efficiently be utilized for diversity analysis, and differentiation of basmati and non-basmati rice cultivars. In addition, marker-based identification of traditional basmati rice may help in maintaining the integrity of this high quality product to the benefit of both

  14. Social and cultural construction of obesity among Pakistani Muslim women in North West England.

    Science.gov (United States)

    Ludwig, Alison F; Cox, Peter; Ellahi, Basma

    2011-10-01

    The present qualitative study explored health perceptions, diet and the social construction of obesity and how this relates to the initiation and maintenance of a healthier diet in UK Pakistani women. Pakistani women in Greater Manchester participated in focus group and one-to-one discussions. Semi-structured interviews employing fictional vignettes and body shape images were used to explore the participants' beliefs and practices regarding diet, overweight/obesity and the risk of type 2 diabetes. Transcripts were analysed using phenomenological and sociological approaches. Interviews took place either in local community and Pakistani resource centres or in private homes. First- and second-generation women who were both active in the community and housebound. The women spoke English and/or Urdu. The fifty-five participants lacked the motivation to address weight gain and were unsure how to do so. There was a limited awareness of the link between weight gain and type 2 diabetes. Other barriers included the influence of Islam, culture and familial expectations on home cooking, perceptions that weight gain is inevitable (owing to ageing, childbirth or divine predestination) and the prioritisation of family concerns over individual lifestyle changes. As the findings of the present research did not correspond to existing educational and behaviour change models, a new Health Action Transition conceptual model is proposed. Health education programmes that aim to address obesity and its associated risks in the South Asian community must take into account the complex beliefs and practices and the multiple dimensions of religion, ethnic and social identity within this population. The present study provides further insight into these factors and proposes a novel model for use in designing and implementing education interventions for British Pakistani women.

  15. A Quantitative Study of Empathy in Pakistani Medical Students: A Multicentered Approach.

    Science.gov (United States)

    Tariq, Nabia; Rasheed, Tariq; Tavakol, Mohsen

    2017-10-01

    To examine the empathy level of undergraduate medical students in Pakistan. Three hypotheses are developed based on the literature review. (1) Female medical students have a higher level of empathy than do male students. (2) Empathy scores vary during the medical school years in Pakistani students. (3) Medical students interested in people-oriented specialties would score higher than the students interested in technology-oriented specialties. This is a quantitative inquiry approach using a cross-sectional design of 1453 students from 8 Pakistani medical schools, both private and state. The sample consists of 41.1% (n = 597) male students and 58.9% (n = 856) female students. Empirical data are collected using the Jefferson Scale of Physician Empathy (JSPE), a well-validated self-administered questionnaire. The mean empathy score among students is 4.77 with a standard deviation of 0.72. The results show that there is no statistically significant association between the empathy scores and gender, t(1342.36) = -0.053, P = .95). There is a statistically significant difference between the empathy scores and the years of medical school, F(14, 1448) = 4.95, P = .01. Concerning the specialty interests, there is no statistically significant difference between the empathy score and specialty interests. The findings of this study showed that in Western countries, medical students performed better than Pakistani medical students on the empathy scale. This finding has important implications for Pakistani medical educators to improve the interpersonal skills of medical students in the context of patient care. Inconsistent with our expectations and experiences, our findings do not support that female medical students scored better than their male counterparts on the empathy scale. Because of the nature of a cross-sectional study, it is impossible to argue the decline of empathy during medical school training.

  16. HLA Dr beta 1 alleles in Pakistani patients with rheumatoid arthritis

    International Nuclear Information System (INIS)

    Naqi, N.; Ahmed, T.A.; Bashir, M.M.

    2011-01-01

    Objective: To determine frequencies of HLA DR beta 1 alleles in rheumatoid arthritis in Pakistani patients. Study Design: Cross sectional / analytical study. Place and Duration of Study: Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Rheumatology departments of Military Hospital, Rawalpindi and Fauji Foundation Hospital, Rawalpindi, from January 2009 to January 2010. Methodology: HLA DR beta 1 genotyping of one hundred Pakistani patients, diagnosed as having RA as per American College of Rheumatology revised criteria 1987, was done. HLA DR beta 1 genotyping was carried out at allele group level (DR beta 1*01-DR beta 1*16) by sequence specific primers in RA patients. Comparison of HLA DR beta 1 allele frequencies between patients and control groups was made using Pearson's chi-square test to find possible association of HLA DR?1 alleles with RA in Pakistani rheumatoid patients. Results: HLA DR beta 1*04 was expressed with significantly increased frequency in patients with rheumatoid arthritis (p <0.05). HLA DR?1*11 was expressed statistically significantly more in control group as compared to rheumatoid patients indicating a possible protective effect. There was no statistically significant difference observed in frequencies of HLA DR beta 1 allele *01, DR beta 1 allele *03, DR beta 1 allele *07, DR beta 1 allele *08, DR beta 1 allele *09, DR beta 1 allele *10, DR beta 1 allele *12, DR beta 1 allele *13, DR beta 1 allele *14, DR?1 allele *15 and DR beta 1 allele *16 between patients and control groups. Conclusion: The identification of susceptible HLA DR beta 1 alleles in Pakistani RA patients may help physicians to make early decisions regarding initiation of early intensive therapy with disease modifying anti rheumatic medicines and biological agents decreasing disability in RA patients. (author)

  17. Experiences of outreach workers in promoting smoking cessation to Bangladeshi and Pakistani men: longitudinal qualitative evaluation

    Directory of Open Access Journals (Sweden)

    Barton Pelham M

    2011-06-01

    Full Text Available Abstract Background Despite having high smoking rates, there have been few tailored cessation programmes for male Bangladeshi and Pakistani smokers in the UK. We report on a qualitative evaluation of a community-based, outreach worker delivered, intervention that aimed to increase uptake of NHS smoking cessation services and tailor services to meet the needs of Bangladeshi and Pakistani men. Methods This was a longitudinal, qualitative study, nested within a phase II cluster randomised controlled trial of a complex intervention. We explored the perspectives and experiences of five outreach workers, two stop smoking service managers and a specialist stop smoking advisor. Data were collected through focus group discussions, weekly diaries, observations of management meetings, shadowing of outreach workers, and one-to-one interviews with outreach workers and their managers. Analysis was undertaken using a modified Framework approach. Results Outreach workers promoted cessation services by word of mouth on the streets, in health service premises, in local businesses and at a wide range of community events. They emphasised the reasons for cessation, especially health effects, financial implications, and the impact of smoking on the family. Many smokers agreed to be referred to cessation services, but few attended, this in part being explained by concerns about the relative inflexibility of existing service provision. Although outreach workers successfully expanded service reach, they faced the challenges of perceived lack of awareness of the health risks associated with smoking in older smokers and apathy in younger smokers. These were compounded by perceptions of "lip service" being given to their role by community organisations and tensions both amongst the outreach workers and with the wider management team. Conclusions Outreach workers expanded reach of the service through taking it to diverse locations of relevance to Pakistani and Bangladeshi

  18. Use of Information Technology in Business Processes In Pakistani and Multinational Pharmaceutical Companies in Korangi.

    Directory of Open Access Journals (Sweden)

    IRFAN UL HASAN

    Full Text Available This study presents an analysis of IT use and Business Processes (BP in Korangi pharmas. Information system usage and manufacturing performance are moderately associated within the sample. There is little difference in the utilization of IT between the multinational and Pakistani firms. The main deficiency of utilization are in decision support systems and external integration functions. Suggestions are presented for increasing effectiveness of IT use in business process

  19. Epidemiology, major risk factors and genetic predisposition for breast cancer in the Pakistani population.

    Science.gov (United States)

    Shaukat, Uzma; Ismail, Muhammad; Mehmood, Nasir

    2013-01-01

    Occurrence of breast cancer is related to genetic as well as cultural, environmental and life-style factors. Variations in diversity of these factors among different ethnic groups and geographical areas emphasize the immense need for studies in all racial-ethnic populations. The incidence of breast cancer in Pakistan is highest in Asians after Jews in Israel and 2.5 times higher than that in neighboring countries like Iran and India, accounting for 34.6% of female cancers. The Pakistani population is deficient in information regarding breast cancer etiology and epidemiology, but efforts done so far had suggested consanguinity as a major risk factor for frequent mutations leading to breast cancer and has also shed light on genetic origins in different ethnic groups within Pakistan. World-wide research efforts on different ethnicities have enhanced our understanding of genetic predisposition to breast cancer but despite these discoveries, 75% of the familial risk of breast cancer remains unexplained, highlighting the fact that the majority of breast cancer susceptibility genes remain unidentified. For this purpose Pakistani population provides a strong genetic pool to elucidate the genetic etiology of breast cancer because of cousin marriages. In this review, we describe the known breast cancer predisposition factors found in the local Pakistani population and the epidemiological research work done to emphasize the importance of exploring factors/variants contributing to breast cance, in order to prevent, cure and decrease its incidence in our country.

  20. Psychosocial factors and distress: a comparison between ethnic Norwegians and ethnic Pakistanis in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Hussain Akthar

    2006-07-01

    Full Text Available Abstract Background In the Norwegian context, higher mental distress has been reported for the non-Western immigrants compared to the ethnic Norwegians and Western immigrants. This high level of distress is often related to different socio-economic conditions in this group. No efforts have been made earlier to observe the impact of changed psychosocial conditions on the state of mental distress of these immigrant communities due to the migration process. Therefore, the objective of the study was to investigate the association between psychological distress and psychosocial factors among Pakistani immigrants and ethnic Norwegians in Oslo, and to investigate to what extent differences in mental health could be explained by psychosocial and socioeconomic conditions. Method Data was collected from questionnaires as a part of the Oslo Health Study 2000–2001. 13581 Norwegian born (attendance rate 46% and 339 ethnic Pakistanis (attendance rate 38% in the selected age groups participated. A 10-item version of Hopkins Symptom Checklist (HSCL was used as a measure of psychological distress. Results Pakistanis reported less education and lower employment rate than Norwegians (p Conclusion Poor social support and economic conditions are important mediators of mental health among immigrants. The public health recommendations/interventions should deal with both the economic conditions and social support system of immigrant communities simultaneously.

  1. Identities in the third space? Solidity, elasticity and resilience amongst young British Pakistani Muslims.

    Science.gov (United States)

    Mythen, Gabe

    2012-09-01

    Over the last decade the issue of identity has been prevalent in discussions about British Muslims, with the events of 9/11 serving as a touchstone for media debates about religious, national and cultural affiliations. The 7/7 terrorist attacks in the UK led to young British Pakistanis being subjected to intense public and institutional scrutiny and wider political concerns being expressed about the failure of multiculturalism. Young British Pakistanis have thus had to negotiate and maintain their identities in an environment in which they have been defined as a threat to national security whilst simultaneously being pressurized to align with 'core British values'. Within this context, we convey the findings of a qualitative study involving British Pakistanis living in the North-west of England. In presenting the experiences and perspectives of participants, three interconnected processes salient to the maintenance of identity are delineated: solidity, elasticity and resilience. Having unpacked these processes, we draw upon Bhabha's third space thesis to explore the political potentiality of and the limits to hybridic identities. © London School of Economics and Political Science 2012.

  2. Keeping Tradition

    NARCIS (Netherlands)

    Zenhong, C.; Buwalda, P.L.

    2011-01-01

    Chinese dumplings such as Jiao Zi and Bao Zi are two of the popular traditional foods in Asia. They are usually made from wheat flour dough (rice flour or starch is sometimes used) that contains fillings. They can be steamed, boiled and fried and are consumed either as a main meal or dessert. As

  3. Criminal aspects domestic violence

    OpenAIRE

    Smetanová, Kristina

    2013-01-01

    Smetanová, Kristina. Criminal aspects of domestic violence The topic of this thesis is the criminal aspects of domestic violence. The aim of the thesis is to describe this dangerous and complicated social problem and focus on outlining the possibilities of protection under Czech criminal law. The thesis consists of eight chapters. The first chapter explains what the domestic violence is and which sources, types and characters does it have.The second chapter shows who can be the violent person...

  4. Domestic violence : evidence review.

    OpenAIRE

    Westmarland, Nicole; Thorlby, Katie; Wistow, Jane; Gadd, David

    2014-01-01

    While domestic violence is high on the public policy agenda in the UK, successive reviews have highlighted policing problems. A recent HMIC report found domestic violence is not policed at the same level as other offences and identified a catalogue of policing failures that have a long history of recurrence. With domestic violence accounting for around a large proportion of violent crime incidents reported to the police, and the majority of all female homicides (Office for National Statistics...

  5. Physicians and domestic violence

    OpenAIRE

    Joslin, Jonathan

    1994-01-01

    Domestic violence, spouse abuse, and battering all refer to the victimization of a person with whom the abuser has or has had an intimate relationship. Domestic violence may take the form of physical, sexual and psychological abuse, is generally repeated, and often escalates within relationships. Most evidence indicates that domestic violence is predominantly perpetrated by men against women. Some evidence suggests that women are just as likely to use violence against male partners as men are...

  6. Domestic violence against children

    OpenAIRE

    Mihić Biljana D.

    2002-01-01

    In this paper the author is analysing definitions and basic notions related to domestic violence against children, as one of the most serious forms of violence. The special chapter deals with effects of violence against children and causes of domestic violence against them. Also, the author is analysing different forms of social reaction and considering the problem of legal regulation of mandatory reporting domestic violence against children.

  7. De-domestication

    DEFF Research Database (Denmark)

    Gamborg, Christian; Gemmen, Bart; Christiansen, Stine Billeschou

    2010-01-01

    as wild or non-wild and the effect this has on questions about how they should be treated. It also concerns the value of nature, and the kind and degree of nature management considered appropriate. The paper first describes actual de-domestication practices and considers the character of human duties...... to animals in process of de-domestication. Secondly, the paper explores the implications of de-domestication for nature management, focusing on notions of naturalness and wildness. Finally, because the current division of ethical topics, with its dependence upon whether animals and nature are domesticated...

  8. Different sex ratios of children born to Indian and Pakistani immigrants in Norway

    Directory of Open Access Journals (Sweden)

    Brekke Torkel

    2010-08-01

    Full Text Available Abstract Background A low female-to-male ratio has been observed in different Asian countries, but this phenomenon has not been well studied among immigrants living in Western societies. In this study, we investigated whether a low female-to-male ratio exists among Indian and Pakistani immigrants living in Norway. In particular, we investigated whether the determination of sex via ultrasound examination, a common obstetric procedure that has been used in Norway since the early 1980 s, has influenced the female-to-male ratio among children born to parents of Indian or Pakistani origin. Methods We performed a retrospective cohort study of live births in mothers of Indian (n = 1597 and Pakistani (n = 5617 origin. Data were obtained from "Statistics Norway" and the female-to-male (F/M sex ratio was evaluated among 21,325 children born, in increasing birth order, during three stratified periods (i.e., 1969-1986, 1987-1996, and 1997-2005. Results A significant low female-to-male sex ratio was observed among children in the third and fourth birth order (sex ratio 65; 95% CI 51-80 from mothers of Indian origin who gave birth after 1987. Sex ratios did not deviate from the expected natural variation in the Indian cohort from 1969 to 1986, and remained stable in the Pakistani cohort during the entire study period. However, the female-to-male sex ratio seemed less skewed in recent years (i.e., 1997-2005. Conclusion Significant differences were observed in the sex ratio of children born to mothers of Indian origin compared with children born to mothers of Pakistani origin. A skewed number of female births among higher birth orders (i.e., third or later may partly reflect an increase in sex-selective abortion among mothers of Indian origin, although the numbers are too small to draw firm conclusions. Further research is needed to explain the observed differences in the female-to-male ratio among members of these ethnic groups who reside in Norway.

  9. [Mycoses in domestic animals].

    Science.gov (United States)

    García, M E; Blanco, J L

    2000-03-01

    In the present paper we will present a general view of the main mycoses affecting domestic animals. In the dog, we show the importance of the dermatophytoses, increased by its zoonosic character and the problem of the false negatives in the traditional microbiological culture. Under the general term of systemic mycoses we include a series of conditions considered usually as aspergillosis, bat with more and more fungal species implicated as possible etiological agents. In addition, fungi, especially yeasts, are being implicated in canine otitis; in our laboratory 86 % of canine chronic otitis involve a yeast etiology, alone or in collaboration with bacteria. In the cat, dermatophytes are more common than in the dog, and are the main source of infection in man, with the description of a high percentage of healthy carrier animals. Cryptococcosis is a severe disease, usually secondary to other process, especially feline immunodeficiency. In cows we refer to fungal abortion, with three main fungi implicated: Aspergillus, Candida and Zygomycetes. In some areas of our country the percentage of fungal abortion is around 10 %. A consequence of the multiple use of antibiotics in mastitis is selection of yeasts, especially those included in the genera Candida and Cryptococcus. Bovine dermatophytoses is an extensively disseminated disease in our country, with a commercial specific vaccine available. In small ruminants, Cryptococcus causes severe pneumonic processes that could be confused clinically with other conditions. An additional important question is the description of isolation of this fungus from tree leaves. In poultry, aspergillosis is a known and controlled disease, but with more importance in captive wild birds with an ecological value. In horses, we emphasize the lung infections by different fungi, specially Pneumocystis carinii, and arthritis by yeasts as consequence of wound contamination or surgery.

  10. VAT on domestic energy

    International Nuclear Information System (INIS)

    Crawford, Ian; Smith, Stephen; Webb, Steven.

    1993-01-01

    This publication traces the background to the imposition of VAT on domestic energy, and considers the current patterns of spending. Results of a simulation of the effects of imposition of 17.5% VAT on domestic fuels are presented, and policy measures to offset the impact on poorer households are considered. (UK)

  11. A prospective study of social difficulties, acculturation and persistent depression in Pakistani women living in the UK.

    Science.gov (United States)

    Chaudhry, N; Husain, N; Tomenson, B; Creed, F

    2012-06-01

    The reasons for the high prevalence of depressive disorders in women of Pakistani origin living in the UK are not clear. The aim of this study was to determine the relative importance of life events, chronic social difficulties and acculturation in a population-based sample of British Pakistani women. A cross-sectional and prospective cohort study of 18- to 65-year-old Pakistani women in UK was carried out. The Schedule for Clinical Assessment in Neuropsychiatry for diagnosis, the Life Events and Difficulties Schedule for social stress and an acculturation questionnaire were used. Depressive disorder at baseline was associated with older age, social isolation and marked difficulties involving health and close relationships. Depressive disorder at follow-up was associated with severity of depression at baseline, difficulties in close relationships and two aspects of acculturation, especially less acculturation in relation to use of the English language. Lack of acculturation, especially less familiarity with the English language, is an independent predictor of persistence of depression in Pakistani women in UK. This needs to be taken into consideration when planning treatment, which also needs to address the personal difficulties associated with persistent depression. The implication of this work is that women of Pakistani origin with depression should be encouraged to receive help in the use of English as one part of treatment that may prevent relapse.

  12. Pakistanis living in Oslo have lower serum 1,25-dihydroxyvitamin D levels but higher serum ionized calcium levels compared with ethnic Norwegians. The Oslo Health Study

    Science.gov (United States)

    Holvik, Kristin; Meyer, Haakon E; Søgaard, Anne Johanne; Haug, Egil; Falch, Jan A

    2007-01-01

    Background Persons of Pakistani origin living in Oslo have a much higher prevalence of vitamin D deficiency and secondary hyperparathyroidism but similar bone mineral density compared with ethnic Norwegians. Our objective was to investigate whether Pakistani immigrants living in Oslo have an altered vitamin D metabolism by means of compensatory higher serum levels of 1,25-dihydroxyvitamin D (s-1,25(OH)2D) compared with ethnic Norwegians; and whether serum levels of ionized calcium (s-Ca2+) differ between Pakistanis and Norwegians. Methods In a cross-sectional, population-based study venous serum samples were drawn from 94 Pakistani men and 67 Pakistani women aged 30–60 years, and 290 Norwegian men and 270 Norwegian women aged 45–60 years; in total 721 subjects. Results Pakistanis had lower s-1,25(OH)2D compared with Norwegians (p Oslo with low vitamin D status and secondary hyperparathyroidism have lower s-1,25(OH)2D compared with ethnic Norwegians. However, the Pakistanis have higher s-Ca2+. The cause of the higher s-Ca2+ in Pakistanis in spite of their higher iPTH remains unclear. PMID:17945003

  13. A comparison of antenatal classifications of 'overweight' and 'obesity' prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-04-11

    Maternal obesity increases women's risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled) in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS), between 2008 and 2013. Mothers (n = 15,205) whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British) who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as 'obese' compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  14. Gender Discrimination in Death Reportage: Reconnoitering Disparities through a Comparative Analysis of Male and Female Paid Obituaries of Pakistani English Newspapers

    Science.gov (United States)

    Chaudhry, Sajid M.; Christopher, Anne A.; Krishnasamy, Hariharan A/L N.

    2014-01-01

    The study examines the issue of gender discrimination in the post death scenario of obituarial discourse. It aims to identify the way Pakistani newspaper obituaries recognize and project males and females after their deaths. A total of 601 paid obituaries published in a year's time span in Pakistani English newspapers were evaluated for the…

  15. Narratives of Domestic Violence

    OpenAIRE

    Hunter, Rosemary

    2006-01-01

    Second wave feminists in Australia brought the social issue of domestic violence out of the suburban shadows and into the activist and policy spotlight in the 1970s. Subsequent feminist-inspired law reforms around domestic violence included the introduction of state domestic violence order regimes in the 1980s, and amendments to the Family Law Act 1975 (Cth) in 1995 to specify family violence as one of the matters to be taken into account by the Family Court in\\ud determining the best interes...

  16. Electric wiring domestic

    CERN Document Server

    Coker, A J

    1992-01-01

    Electric Wiring: Domestic, Tenth Edition, is a clear and reliable guide to the practical aspects of domestic electric wiring. Intended for electrical contractors, installation engineers, wiremen and students, its aim is to provide essential up to date information on modern methods and materials in a simple, clear, and concise manner. The main changes in this edition are those necessary to bring the work into line with the 16th Edition of the Regulations for Electrical Installations issued by the Institution of Electrical Engineers. The book begins by introducing the basic features of domestic

  17. BRCA1 status in Pakistani breast cancer patients with moderate family history

    International Nuclear Information System (INIS)

    Moatter, T.; Pervez, S.; Khan, S.; Azam, I.

    2011-01-01

    Objective: To determine BRCA1 status in breast carcinoma patients of Pakistani origin. Study Design: Observational study. Place and Duration of Study: The Oncology Clinics of the Aga Khan University Hospital, Karachi, between May 2005 and December 2009. Methodology: Fifty three breast cancer patients based on clinical and laboratory diagnosis were recruited for this study. Moderate family history was defined as having a close relative (mother, daughter, sister) diagnosed with breast cancer under 45 years. Peripheral blood samples were collected from each patient in a 5 ml tube containing EDTA as anticoagulant. Subsequent to DNA extraction, mutational analysis of BRCA1 exons 2, 5, 6, 16, 20 and 22 was carried out using single strand conformation polymorphism (SSCP) assay while protein truncation test (PTT) was used to examine mutations in exon 11. All BRCA1 sequence variants were confirmed by DNA sequencing. Results: Twenty-three patients were diagnosed with early onset breast cancer, 30 patients had moderate family history. At the time of diagnosis, the median age of enrolled patients was 39 years (range 24-65 years). Out of 53 patients, analyzed by SSCP assay, mobility shift was detected in exon 6, 16 and 20 of three patients, whereas one patient was tested positive for mutation in exon 11 by PTT assays. All patients with BRCA1 mutations were further confirmed by DNA sequencing analysis. In exon 16 c.4837A > G was confirmed, which is a common polymorphism reported in several populations including Asians. Moreover, mutations in exon 6 (c.271T > G), exon 20 (c.5231 del G) and exon 11 (c.1123 T > G) were reported first time in the Pakistani population. Several BRCA1 mutations were observed in Pakistani breast cancer patients with moderate family history. Therefore, mutation-based genetic counselling for patients with moderate family history can facilitate management, if one first or second degree relative or early onset disease is apparent. (author)

  18. Domestic Communication Satellites

    Science.gov (United States)

    Horowitz, Andrew

    1974-01-01

    A discussion of the Federal Communications Commission's new policy on domestic satellites in light of our 1) military and economic history; 2) corporate interests; 3) citizen surveillance; and 4) media control. (HB)

  19. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    OpenAIRE

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively....

  20. Evaluating Domestic Violence Initiatives

    OpenAIRE

    Parmar, Alpa; Sampson, Alice

    2006-01-01

    This paper critiques the approach of identifying ‘best practice’ projects and discusses the problem with simply transferring projects into different contexts. The argument is illustrated by explaining the evaluation process of three domestic violence projects which all had the same aim, which was to reduce domestic violence. The evaluated projects all delivered advocacy programmes and were located in disadvantaged areas in the United Kingdom. A more suitable evaluation approach is proposed wh...

  1. Domestic abuse and the duties of physicians: a case report.

    Science.gov (United States)

    Hossain, Nazli; Khan, Sharmeen

    2015-01-01

    Domestic violence against women is a global issue. An earlier report from the Centers for Disease Control and Prevention (CDC), USA, reported that injury caused by domestic violence was the second most common cause of death during pregnancy and in the postpartum period (1). The pregnancy-associated homicide ratio was found to be 1.7 per 100,000 deliveries and firearms were identified as the main source of injury. Domestic violence is more common in developing countries than in the developed world, and rural areas are worse affected than urban ones. The risk factors associated with intimate partner violence include husbands being unemloyed, belonging to a lower socioeconomic group, poor educational status, and alcohol and substance abuse. In a hospital-based study of 500 women, around 12.6% reported physical abuse by their spouses in index pregnancy (2). In another hospital-based study in which women were interviewed during the postpartum period, 23% reported physical abuse during index pregnancy (3). Death as a result of violence is not a new phenomenon. In 1994 the Human Rights Commission of Pakistan reported 372 cases of domestic violence, due to which around 274 women died during an 8-month period. According to a report for the year 2012-13 around 389 cases of domestic violence were reported in the Pakistani media that year. The same report states that in 2013, more than 800 women committed suicide due to domestic violence. In 2013, the Provincial Assembly of Sindh, Pakistan, passed The Domestic Violence (Prevention and Protection) Bill, 2013, which imposes a fine of Rs 20,000 for violent offences against women. Such bills have not been passed in other provincial assemblies of the country. Other countries in South Asia (India, Nepal, Bangladesh, the Maldives, Sri Lanka and Afghanistan) have national laws which make provision for extending medical assistance to women who have suffered domestic violence (4). However, a lot remains to be done to translate these

  2. Domestic violence in Ghana: an initial step.

    Science.gov (United States)

    Ofei-aboagye, R O

    1994-01-01

    This article aims to expose the anxiety of abused women in Ghana by defining domestic violence within their culture. A survey conducted among 50 women clients of the Legal Aid Clinic of the International Federation of Women Lawyers in Ghana revealed that wife beating, to some extent, is an acceptable norm of the society. These battered women are more likely to define their experiences as a form of discipline at the hands of their husbands rather than domestic violence or wife battering. An examination of their social practices demonstrates that tradition is the most important reason why Ghanaian women accept the obvious disparity between their lifestyles and that of their male counterparts. Their traditional folk tales narrates stories about a man beating his wife to maintain law and order; while Ghanaian folk and highlife songs revolve around themes that encourage this mastery of wives and male superiority. The existence of domestic violence in all Ghanaian communities highlights the need for social reforms and substantive equality for Ghanaian women. Initial solutions include emphasis on public education, which fosters awareness and social change through women's organizations that work within communities. Once educational efforts have been established, long-term solutions such as adopting legislation to help battered women, as well as educating the police and the judiciary about domestic violence can then be integrated into Ghanaian society.

  3. Domestic violence in Iranian infertile women

    Science.gov (United States)

    Sheikhan, Zohre; Ozgoli, Giti; Azar, Mahyar; Alavimajd, Hamid

    2014-01-01

    Background: Millions of men and women suffer from infertility worldwide. In many cultures, infertile women are at risk of social and emotional problems. Infertility may affect the public health in many countries. Domestic violence is the intentional use of physical force, power or threat against oneself, another person or another group or community which leads to injury, death, mental harm, lack of development or deprivation. This study aimed to assess the prevalence of domestic violence against infertile women who referred to the infertility centres of Tehran, Iran in 2011. Methods: This was cross- sectional descriptive study conducted on 400 infertile women who were selected through convenient sampling method. The questionnaire used in this study included two sections: a demographic section with questions about demographic characteristics of the infertile women and their husbands; and the domestic violence questionnaire with questions about physical, emotional and sexual violence. Data were analysed by SPSS16; descriptive statistics, Spearman’s test, t- test, one-way analysis of variance (ANOVA) and logistic regression were used for data analysis. Results: Four hundred women with the average age of 30.50 ± 6.16 years participated in the study; of whom, 34.7% experienced domestic violence physical violence (5.3%), emotional violence (74.3%) and sexual violence (47.3%). Domestic violence was significantly associated with unwanted marriage, number of IVFs, drug abuse, emotional status of the women, smoking and addiction or drug abuse of the spouse, mental and physical diseases of the husband (p< 0.05). Conclusion: Many of the current problems in this society, particularly in families are due to the transition of the society from a traditional model to a modern one. The majority of the infertile women experience violence in Iran. Domestic violence against infertile women is a problem that should not be ignored. Clinicians should identify abused women. Providing

  4. Storytelling and story testing in domestication.

    Science.gov (United States)

    Gerbault, Pascale; Allaby, Robin G; Boivin, Nicole; Rudzinski, Anna; Grimaldi, Ilaria M; Pires, J Chris; Climer Vigueira, Cynthia; Dobney, Keith; Gremillion, Kristen J; Barton, Loukas; Arroyo-Kalin, Manuel; Purugganan, Michael D; Rubio de Casas, Rafael; Bollongino, Ruth; Burger, Joachim; Fuller, Dorian Q; Bradley, Daniel G; Balding, David J; Richerson, Peter J; Gilbert, M Thomas P; Larson, Greger; Thomas, Mark G

    2014-04-29

    The domestication of plants and animals marks one of the most significant transitions in human, and indeed global, history. Traditionally, study of the domestication process was the exclusive domain of archaeologists and agricultural scientists; today it is an increasingly multidisciplinary enterprise that has come to involve the skills of evolutionary biologists and geneticists. Although the application of new information sources and methodologies has dramatically transformed our ability to study and understand domestication, it has also generated increasingly large and complex datasets, the interpretation of which is not straightforward. In particular, challenges of equifinality, evolutionary variance, and emergence of unexpected or counter-intuitive patterns all face researchers attempting to infer past processes directly from patterns in data. We argue that explicit modeling approaches, drawing upon emerging methodologies in statistics and population genetics, provide a powerful means of addressing these limitations. Modeling also offers an approach to analyzing datasets that avoids conclusions steered by implicit biases, and makes possible the formal integration of different data types. Here we outline some of the modeling approaches most relevant to current problems in domestication research, and demonstrate the ways in which simulation modeling is beginning to reshape our understanding of the domestication process.

  5. MARKETING OF TRADITIONAL PRODUCT IN TRANSYLVANIA

    OpenAIRE

    M. MATIUTI; A. T. BOGDAN

    2009-01-01

    Transylvania and the Banat are two historical regions that gave birth to several domestic animal breeds. Over the last 15 years, number have sunken dramatically, because these local breeds have been greatly replaced by imported ones. Although very many so- called agrotouristic pensions are now on the market, only about 1% of them promote real traditional food products obtained from local animal breeds. Only few people, especially old people, know traditional recipes older than two or three hu...

  6. Know Your Rights: Domestic Violence

    Science.gov (United States)

    ... 3224 TTD You CAN do something about domestic violence Domestic violence is a pattern of many behaviors directed ... violence. Look in the Yellow Pages under “domestic violence help,” “domestic violence shelters,” “human services organizations,” or “crisis intervention” ...

  7. Anti-Rheumatic Potential of Pakistani Medicinal Plants: A Review

    International Nuclear Information System (INIS)

    Kamal, M.; Adnan, M.; Murad, W.; Tariq, A.; Bibi, H.; Rahman, H.; Shinwari, Z. K.

    2016-01-01

    Present review aimed to provide a comprehensive documentation of plants used as anti-rheumatic ethnomedicines in Pakistan and to suggest future recommendations. Data on anti-rheumatic plants was collected from published scientific papers, reports and thesis using online searching engines such as Google Scholar PubMed and Science Direct. Five distinct zones in the country were classified on the basis of geography, humidity and rainfall. We used Sorenson similarity index for plants and their parts used between different zones. A total of 137 anti-rheumatic plant species representing 55 families and 104 genera are used in Pakistan. Herbs (87 plants) were the primary source of anti-rheumatic medicinal plants, while leaves (22 % plant species) were the most frequently used part in the preparation of ethnomedicinal recipes. Highest number of 52 medicinal plant species were found in Zone A having high mountains and cold climate where the prevalence of rheumatism was more common. Solanum surattense was found with highest conservation concerns as it was using in 13 different areas against rheumatism. Results of Sorenson index revealed that there is a similarity of plants and its parts uses between different zones. In conclusions, geography and climate have an important role in causing rheumatic disease. Pakistan has a number of anti-rheumatic plants that are used by the local populations through their traditional knowledge. Moreover, inter zonal similarities among plants and its part uses indicate higher pharmacological potency of these medicinal plants. Further, the review will also provide an insight regarding the conservation status of reported plants. (author)

  8. Domestic work count! Characteristics and transformations of the domestic service in Spain

    Directory of Open Access Journals (Sweden)

    Raquel Martínez Buján

    2015-03-01

    Full Text Available This paper explores the characteristics of and transformations that Spanish domestic service has undergone in the since 2000. The paper also analyzes the domestic service’s contribution to the Spanish economy since the beginning of the country’s economic crisis. Relying on quantitative analysis of the domestic work data from the Active Population Survey, the most relevant changes identified are the increase of its demand and the consolidation of migrants workers in it. The paper also looks at the tasks carried out in the households of employers. The recent conversion of the domestic services in a nonprofessional care sector seems to mitigate the burden of personal care work that Spanish families aim to provide to their older relatives. This transformation of domestic work into care work has changed some traditional features of this occupation: the outcomes of qualitative data show changes in the intensification of the tasks carried out, a tendency to higher male workers, a reappearance of live-in workers, and key modifications in the relationship between employer families and employees. Finally, this paper incorporates a short assessment of Real Royal Decree 1620/2011 (which regulates domestic service and Law 39/2006 (Law on the Promotion of Personal Autonomy and Care for Dependent Persons to analyze which is the legal space delegate to the labor category related with the non-professional caregivers in private homes.

  9. Molecular and Clinical Studies of X-linked Deafness Among Pakistani Families

    Science.gov (United States)

    Waryah, Ali M.; Ahmed, Zubair M.; Choo, Daniel I.; Sisk, Robert A.; Binder, Munir A.; Shahzad, Mohsin; Khan, Shaheen N.; Friedman, Thomas B.; Riazuddin, Sheikh; Riazuddin, Saima

    2011-01-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132, PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild to profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling, and molecular epidemiology of hearing loss among Pakistanis. PMID:21633365

  10. Molecular genetic analysis of consanguineous Pakistani families with autosomal recessive hypohidrotic ectodermal dysplasia.

    Science.gov (United States)

    Bibi, Nosheen; Ahmad, Saeed; Ahmad, Wasim; Naeem, Muhammad

    2011-02-01

    Hypohidrotic ectodermal dysplasia is an inherited disorder characterized by defective development of teeth, hairs and sweat glands. X-linked hypohidrotic ectodermal dysplasia is caused by mutations in the EDA gene, and autosomal forms of hypohidrotic ectodermal dysplasia are caused by mutations in either the EDAR or the EDARADD genes. To study the molecular genetic cause of autosomal recessive hypohidrotic ectodermal dysplasia in three consanguineous Pakistani families (A, B and C), genotyping of 13 individuals was carried out by using polymorphic microsatellite markers that are closely linked to the EDAR gene on chromosome 2q11-q13 and the EDARADD gene on chromosome 1q42.2-q43. The results revealed linkage in the three families to the EDAR locus. Sequence analysis of the coding exons and splice junctions of the EDAR gene revealed two mutations: a novel non-sense mutation (p.E124X) in the probands of families A and B and a missense mutation (p.G382S) in the proband of family C. In addition, two synonymous single-nucleotide polymorphisms were also identified. The finding of mutations in Pakistani families extends the body of evidence that supports the importance of EDAR for the development of hypohidrotic ectodermal dysplasia. © 2010 The Authors. Australasian Journal of Dermatology © 2010 The Australasian College of Dermatologists.

  11. Feminism and Society: Solidarity Amongst Pakistani Women Still a Distant Dream

    Directory of Open Access Journals (Sweden)

    Dr. Farhat Jabeen

    2013-06-01

    Full Text Available This paper envisages feminism in a south Asian gender development particularly in Pakistan. Law is the manifestation of principles of justice, equity and good conscience. As’ Gender’ has been taken up in development policy and practices, have been created that have emphasized some aspects of feminist agendas, and pushed others out of the frame. Research paper gives an overview of women in Pakistan are victimized of gender biases begin from the very first institution home. They are facing challenges in claiming their rights of inheritance owing to customary practices, lacunae in the prevailing legal framework and procedure. Patriarchal structure of society, socio-customary practices and discrimination against women are very serious concerns/issues which need to be understood as multidimensional problem. This paper examines the role of feminism on gender development in south Asian perspective especially in Pakistan. Pakistani women seem to have been circumscribed in bounds of religious, cultural and national ideologies as envisioned by the patriarchy of Pakistan. Due to certain cultural, male domination state of affairs the solidarity amongst Pakistani women still distant dream. Current research paper would draw attention to issue mentioned above.

  12. Molecular and clinical studies of X-linked deafness among Pakistani families.

    Science.gov (United States)

    Waryah, Ali M; Ahmed, Zubair M; Bhinder, Munir A; Binder, Munir A; Choo, Daniel I; Sisk, Robert A; Shahzad, Mohsin; Khan, Shaheen N; Friedman, Thomas B; Riazuddin, Sheikh; Riazuddin, Saima

    2011-07-01

    There are 68 sex-linked syndromes that include hearing loss as one feature and five sex-linked nonsyndromic deafness loci listed in the OMIM database. The possibility of additional such sex-linked loci was explored by ascertaining three unrelated Pakistani families (PKDF536, PKDF1132 and PKDF740) segregating X-linked recessive deafness. Sequence analysis of POU3F4 (DFN3) in affected members of families PKDF536 and PKDF1132 revealed two novel nonsense mutations, p.Q136X and p.W114X, respectively. Family PKDF740 is segregating congenital blindness, mild-to-profound progressive hearing loss that is characteristic of Norrie disease (MIM#310600). Sequence analysis of NDP among affected members of this family revealed a novel single nucleotide deletion c.49delG causing a frameshift and premature truncation (p.V17fsX1) of the encoded protein. These mutations were not found in 150 normal DNA samples. Identification of pathogenic alleles causing X-linked recessive deafness will improve molecular diagnosis, genetic counseling and molecular epidemiology of hearing loss among Pakistanis.

  13. Estimating the risk of cardio vascular diseases among pakistani diabetics using uk pds risk engine

    International Nuclear Information System (INIS)

    Moazzam, A.; Amer, J.

    2015-01-01

    The concept of risk estimation of Coronary Heart Disease (CHD) is helpful for clinician to identifying high risk populations for their effective treatment. Latest studies recommended only initiating cardio-protective treatment in diabetic patients based on personalized CHD risk estimates so as to reduce undue harm from overly aggressive risk factor modification. The United Kingdom Prospective Diabetes Study (UK PDS) Risk Engine is a widely used tool to assess the risk of Cardio Vascular diseases (CVD) in diabetics. The literature search so far did not reveal any study of risk assessment among Pakistani Diabetics. Methods: This descriptive study is based on the data of 470 type-2 diabetics seen in Department of Endocrinology and Metabolism, Services Institute of Medical Sciences, Lahore during 2011. The data of these 470 patients was analyzed through UKPDS Risk Engine. CHD risk was calculated. Results: The 10 years risk of CHD, fatal CHD, stroke and fatal stroke was 9.4%, 4.4%, 1.7% and 0.2% respectively. Conclusions: The present study show a lower risk of CVD occurring among Pakistani diabetics as compared to studies from western countries. (author)

  14. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    Energy Technology Data Exchange (ETDEWEB)

    Tabasum, A; Iqbal, N; Hameed, A; Arshad, R [Nuclear Institute for Agriculture and Biology, Faisalabad (Pakistan)

    2011-06-15

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  15. Evaluation of Pakistani wheat germplasm for bread quality based on allelic variation in HMW glutenin subunits

    International Nuclear Information System (INIS)

    Tabasum, A.; Iqbal, N.; Hameed, A.; Arshad, R.

    2011-01-01

    Seventy six Pakistani wheat genotypes including land races were investigated for Bread quality (BQ) based on allelic variation in HMW glutenin subunits at the Glu-1 loci through SDS- polyacrylamide gel electropherosis. Twenty five different allelic combinations were detected with a total of 14 Glu-1 loci. Highest polymorphism was revealed by Glu-B locus and some single/ rare sub units were also screened out. The frequencies of dominant subunits were 50% for 2*, 42.11% for subunit pair 17+18 and 48.68% for 5+10 and 2+12 respectively. The quality scores displayed a range from 4 to 10, however generally good quality score of eight was more frequent (39. 47%). The highest quality scores of 10 and 9 were observed in 22.36% and 19.74% of genotypes respectively. The UPGMA analysis grouped genotypes into three major with two additional sub clusters for each. The cluster 'a' 'b' and 'C' were separated at 73% genetic distance which was further differentiated at a genetic distance of 50% into their sub clusters. Pakistani wheat varieties/land races exhibited large variation in term of HMW-GS. The generated information will lead to the pyrimiding of sub units for high BQ through mission oriented marker assisted breeding programmes for quality improvement of wheat. (author)

  16. Validation Study of the Mini-Mental State Examination in Urdu Language for Pakistani Population.

    Science.gov (United States)

    Awan, Safia; Shahbaz, Naila; Akhtar, Syed Wasim; Ahmad, Arsalan; Iqbal, Sadaf; Ahmed, Sellal; Naqvi, Haider; Wasay, Mohammad

    2015-01-01

    Validation study of the Mini-Mental State Examination in Urdu language for Pakistani population. This study was conducted primarily to validate and determine the optimal cutoff score in the diagnosis of dementia among Pakistani's and study the effects of gender and education on the MMSE performance in our population. Four hundred participants took part in the study. Patient with dementia recruited from five major hospitals from Pakistan. The MMSE was translated into Urdu. There were 61 men and 39 women in dementia group and 225 men and 75 women in the control group. The mean score of Urdu MMSE were lower in patients with dementia 18.5 ± 5.6 (range 0-30) as compared to the controls 26.8 ± 2.6 (range 7-30). This difference between groups was statistically significant (p<0.001). Educational based MMSE score below 15 yielded perfect sensitivity and specificity for the diagnosis of dementia. These finding confirm the influence of level of education on MMSE score and education stratified cutoff scores should be used while screening for cognitive impairment in this population.

  17. Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

    Directory of Open Access Journals (Sweden)

    Maryam Mukhtar

    2017-01-01

    Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

  18. Barriers to healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Telle Hjellset, Victoria; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2010-11-01

    To explore barriers to healthy dietary changes experienced by Pakistani immigrant women participating in a culturally adapted intervention, and whether these barriers were associated with intentions to change dietary behaviours. Participants were randomly assigned to control and intervention group. The 7-month intervention consisted of six educational group sessions on diet and physical activity, based on knowledge about Pakistani lifestyle and focusing on blood glucose control. Data on barriers for and intentions to healthy dietary changes were collected through an interview with help of a questionnaire. The article is based on data from follow-up assessments in the intervention group, comprising 82 women, aged 28-62 years, without a history of type 2 diabetes. The most important barriers to healthy dietary changes were preferences of children and other family members and perceived expectations during social gatherings. The perceived pressure from other family members was especially strong when the women were trying to change to more vegetables, lentils, and fish and to use less oil in food preparation. The barriers were inversely related to intentions to change. The women encountered various types of barriers when trying to change to healthier food habits, the most prominent being those related to the social dimensions of food consumption, as well as to awareness of the amount of oil used for cooking.

  19. Pakistani women's use of mental health services and the role of social networks: a systematic review of quantitative and qualitative research.

    Science.gov (United States)

    Kapadia, Dharmi; Brooks, Helen Louise; Nazroo, James; Tranmer, Mark

    2017-07-01

    Pakistani women in the UK are an at-risk group with high levels of mental health problems, but low levels of mental health service use. However, the rates of service use for Pakistani women are unclear, partly because research with South Asian women has been incorrectly generalised to Pakistani women. Further, this research has been largely undertaken within an individualistic paradigm, with little consideration of patients' social networks, and how these may drive decisions to seek help. This systematic review aimed to clarify usage rates, and describe the nature of Pakistani women's social networks and how they may influence mental health service use. Ten journal databases (ASSIA, CINAHL Plus, EMBASE, HMIC, IBSS, MEDLINE, PsycINFO, Social Sciences Abstracts, Social Science Citation Index and Sociological Abstracts) and six sources of grey literature were searched for studies published between 1960 and the end of March 2014. Twenty-one studies met inclusion criteria. Ten studies (quantitative) reported on inpatient or outpatient service use between ethnic groups. Seven studies (four quantitative, three qualitative) investigated the nature of social networks, and four studies (qualitative) commented on how social networks were involved in accessing mental health services. Pakistani women were less likely than white (British) women to use most specialist mental health services. No difference was found between Pakistani and white women for the consultation of general practitioners for mental health problems. Pakistani women's networks displayed high levels of stigmatising attitudes towards mental health problems and mental health services, which acted as a deterrent to seeking help. No studies were found which compared stigma in networks between Pakistani women and women of other ethnic groups. Pakistani women are at a considerable disadvantage in gaining access to and using statutory mental health services, compared with white women; this, in part, is due to

  20. Invalid Cookery, Nursing and Domestic Medicine in Ireland, c. 1900.

    Science.gov (United States)

    Adelman, Juliana

    2018-04-01

    This article uses a 1903 text by the Irish cookery instructress Kathleen Ferguson to examine the intersections between food, medicine and domestic work. Sick Room Cookery, and numerous texts like it, drew on traditions of domestic medicine and Anglo-Irish gastronomy while also seeking to establish female expertise informed by modern science and medicine. Placing the text in its broader cultural context, the article examines how it fit into the tradition of domestic medicine and the emerging profession of domestic science. Giving equal weight to the history of food and of medicine, and seeing each as shaped by historical context, help us to see the practice of feeding the sick in a different way.

  1. Molecular genetic studies and delineation of the oculocutaneous albinism phenotype in the Pakistani population

    Directory of Open Access Journals (Sweden)

    Jaworek Thomas J

    2012-06-01

    Full Text Available Abstract Background Oculocutaneous albinism (OCA is caused by a group of genetically heterogeneous inherited defects that result in the loss of pigmentation in the eyes, skin and hair. Mutations in the TYR, OCA2, TYRP1 and SLC45A2 genes have been shown to cause isolated OCA. No comprehensive analysis has been conducted to study the spectrum of OCA alleles prevailing in Pakistani albino populations. Methods We enrolled 40 large Pakistani families and screened them for OCA genes and a candidate gene, SLC24A5. Protein function effects were evaluated using in silico prediction algorithms and ex vivo studies in human melanocytes. The effects of splice-site mutations were determined using an exon-trapping assay. Results Screening of the TYR gene revealed four known (p.Arg299His, p.Pro406Leu, p.Gly419Arg, p.Arg278* and three novel mutations (p.Pro21Leu, p.Cys35Arg, p.Tyr411His in ten families. Ex vivo studies revealed the retention of an EGFP-tagged mutant (p.Pro21Leu, p.Cys35Arg or p.Tyr411His tyrosinase in the endoplasmic reticulum (ER at 37°C, but a significant fraction of p.Cys35Arg and p.Tyr411His left the ER in cells grown at a permissive temperature (31°C. Three novel (p.Asp486Tyr, p.Leu527Arg, c.1045-15 T > G and two known mutations (p.Pro743Leu, p.Ala787Thr of OCA2 were found in fourteen families. Exon-trapping assays with a construct containing a novel c.1045-15 T > G mutation revealed an error in splicing. No mutation in TYRP1, SLC45A2, and SLC24A5 was found in the remaining 16 families. Clinical evaluation of the families segregating either TYR or OCA2 mutations showed nystagmus, photophobia, and loss of pigmentation in the skin or hair follicles. Most of the affected individuals had grayish-blue colored eyes. Conclusions Our results show that ten and fourteen families harbored mutations in the TYR and OCA2 genes, respectively. Our findings, along with the results of previous studies, indicate that the p.Cys35Arg, p.Arg278

  2. Scholars' Satisfaction with Digital Library Collection and Gaps in the Provision of Effective Information Resources and Services: A Pakistani Perspective

    Science.gov (United States)

    Khan, Amjid; Ahmed, Shamshad; Masrek, Mohamad Noorman

    2014-01-01

    The study aims to explore the researchers' satisfaction with digital library resources and services and how they improved the research culture in Pakistani universities. A descriptive survey method was employed to achieve objectives of this study. Using stratified random sampling, for this survey we selected 14 public sector universities of Khyber…

  3. "Narrow-Minded and Oppressive" or a "Superior Culture"? Implications of Divergent Representations of Islam for Pakistani-American Youth

    Science.gov (United States)

    Ghaffar-Kucher, Ameena

    2015-01-01

    Drawing on ethnographic data, this article examines the complex terrain that working-class Pakistani-American youth must negotiate in their daily lives. Specifically, the article illustrates how particular views of Islam and Americanization manifest in particular sites and within educational discourses, and the resulting dissonance that youth…

  4. Effects of malnutrition on the erythrocyte fatty acid composition and plasma vitamin E levels of Pakistani children

    NARCIS (Netherlands)

    Smit, EN; Dijkstra, JM; Schnater, TA; Seerat, E; Muskiet, FAJ; Boersma, ER

    Erythrocyte fatty acids and plasma vitamin E concentrations were determined in 47 grade 2, and 21 grade 3 malnourished Pakistani children (ages 4-56 months). Data were compared with those of 26 age- and sex-matched apparently healthy controls. Evaluation with three statistical approaches revealed

  5. Association of tumor necrosis factor alpha gene polymorphism G-308A with pseudoexfoliative glaucoma in the Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Rana, N.; Akhtar, F.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2009-01-01

    PURPOSE: The purpose of the present study was to determine the role of the tumor necrosis factor alpha (TNF-alpha) gene polymorphism G-308A and total serum immunoglobulin E (TsIgE) levels in the onset of pseudoexfoliation glaucoma (PEXG) in Pakistani patients. METHODS: The TNF-alpha polymorphism

  6. A canonical splice site mutation in GIPC3 causes sensorineural hearing loss in a large Pakistani family

    NARCIS (Netherlands)

    Siddiqi, S.; Ismail, M.; Oostrik, J.; Munawar, S.; Mansoor, A.; Kremer, H.; Qamar, R.; Schraders, M.

    2014-01-01

    With homozygosity mapping we have identified two large homozygous regions on chromosome 3q13.11-q13.31 and chromosome 19p13.3-q31.32 in a large Pakistani family suffering from autosomal recessive nonsyndromic hearing impairment (arNSHI). The region on chromosome 19 overlaps with the previously

  7. Provision of Human Capital by Business Schools of Pakistan: A Need for the Sustainability of the Pakistani Banking Sector

    Science.gov (United States)

    Nauman, Sarwat; Hussain, Nasreen

    2017-01-01

    Economic growth of Pakistan through the banking sector relies heavily on the human capital dispensed to them by the Pakistani business schools. A conceptual model of the continuous improvement cycle for building human capital is developed through a literature review, with the aim of helping to generate human capital. Six semistructured interviews…

  8. A Transnational Community of Pakistani Muslim Women: Narratives of Rights, Honor, and Wisdom in a Women's Education Project

    Science.gov (United States)

    Khurshid, Ayesha

    2012-01-01

    Using ethnographic data, this article explores how Muslim women teachers from low-income Pakistani communities employ the notion of "wisdom" to construct and perform their educated subjectivity in a transnational women's education project. Through Butler's performativity framework, I demonstrate how local and global discourses overlap to…

  9. When I raised my head again : feminism and the female body in Bapsi Sidhwa’s novels The Pakistani bride and Cracking India

    OpenAIRE

    Marwah, Ane Frislid Sveinhaug

    2008-01-01

    This thesis sets out to do close readings of the Pakistani author Bapsi Sidhwa’s novels The Pakistani Bride and Cracking India. It sheds light on the ways in which the image of the female body is used in the two novels and in what ways this image represents the novels’ feminist message. The close readings reveal many similarities between the novels’ treatment of the female body, but also interesting developments that take place in Sidhwa’s feminism from The Pakistani Bride of the 1970s to Cra...

  10. The burden of domestication

    DEFF Research Database (Denmark)

    Sandøe, Peter; Nørspang, Annika Patursson; Forkman, Björn

    2017-01-01

    The way in which domestic cats are kept and bred has changed dramatically over the last two centuries. Notably, a significant number of cats are kept indoors, most of them are neutered and many are selectively bred. This likely has consequences for their welfare. A few studies link housing, neuter......; that a smaller proportion of the free-roaming cats suffered from the behavioural problems investigated; and that entire cats had significantly more behavioural problems than neutered cats. Finally, significantly more purebred cats than domestic shorthair cats were found to have diseases. Being confined, being...

  11. Oil palm: domestication achieved?

    NARCIS (Netherlands)

    Gerritsma, W.; Wessel, M.

    1997-01-01

    The natural habitat of the oil palm comprises very wet and relatively dry niches in the lowland rain forest in West and Central Africa. The domestication of the oil palm started with the extraction of fruits from wild forest resources. When forests were cleared for shifting cultivation, oil palms

  12. Dominance in domestic dogs

    NARCIS (Netherlands)

    Borg, Van Der J.A.M.; Schilder, M.B.H.; Vinke, C.M.; Vries, De Han; Petit, Odile

    2015-01-01

    A dominance hierarchy is an important feature of the social organisation of group living animals. Although formal and/or agonistic dominance has been found in captive wolves and free-ranging dogs, applicability of the dominance concept in domestic dogs is highly debated, and quantitative data are

  13. Signs of domestic abuse.

    Science.gov (United States)

    Pearce, Lynne

    2017-07-13

    Essential facts The government's definition of domestic violence and abuse, published in 2016 by the Home Office, is: 'Any incident or pattern of incidents of controlling, coercive, threatening behaviour, violence or abuse between those 16 years or over who are, or have been, intimate partners or family members, regardless of gender or sexuality.'

  14. Unemployment and domestic violence

    OpenAIRE

    Dan Anderberg; Helmut Rainer; Jonathan Wadsworth; Tanya Wilson

    2014-01-01

    Contrary to popular belief, the incidence of domestic violence in Britain does not seem to have risen during the recession. But according to research by Jonathan Wadsworth and colleagues, men and women have experienced different risks of unemployment - and these have had contrasting effects on the level of physical abuse.

  15. A novel mutation in CDK5RAP2 gene causes primary microcephaly with speech impairment and sparse eyebrows in a consanguineous Pakistani family

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Mang, Yuan

    2017-01-01

    2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing...

  16. Maternity services in multi-cultural Britain: using Q methodology to explore the views of first- and second-generation women of Pakistani origin.

    Science.gov (United States)

    Cross-Sudworth, Fiona; Williams, Amanda; Herron-Marx, Sandy

    2011-08-01

    to explore first- and second-generation Pakistani women's experiences of maternity services and the inter generational differences/comparisons. a retrospective Q methodology study of Pakistani women following childbirth. two Children's Centres in an inner city in the West Midlands. women self-identified following distribution of information leaflets at Children's Centres. Fifteen women took part in interviews (Stage one) using a semi-structured design and 16 women participated in the completion of the Q grid sorting (Stage four). a standard five-stage Q methodology process took place: (1) initial data were gathered using a combination of individual face-to-face and focus group semi-structured community-based interviews (developing the concourse); (2) transcribed interviews were analysed for 'themes'; (3) the themes were reduced to 'statements' that reflected the overall content of the concourse using an unstructured evolving approach (giving the Q set); (4) participants were asked to sort the statements (Q sorting) according to a pre-designed distribution grid providing individual participant response grids; and (5) the response grids were factor analysed using PQ Method (V2.11), which generates clusters of participants rather than clusters of variables. Factor loadings were calculated using factor analysis by principal components with varimax rotation. This produced a list of factors, each of which represents a 'story' of women's experiences of maternity services. Throughout the process, an Urdu interpreter was involved. six factors were identified: (1) confidence and empowerment of women who had attended higher education and had family support; (2) isolation of some women from both family and maternity services; (3) women who had poor experiences of maternity services but good family support, and wanted opportunities to be involved in service development; (4) women with positive experiences of maternity care and influenced by traditional cultural practices; (5

  17. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    OpenAIRE

    Shamim Saleha; Muhammad Ajmal; Muhammad Jamil

    2016-01-01

    AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype...

  18. Heuristics and stock buying decision: Evidence from Malaysian and Pakistani stock markets

    Directory of Open Access Journals (Sweden)

    Habib Hussain Khan

    2017-06-01

    Full Text Available Applying both qualitative and quantitative approaches, we examine whether or not investors fall prey to three heuristics; namely, anchoring and adjustment, representativeness, and availability, while investing in stocks. We also compare investors' vulnerability to these heuristics based on their economic association, their type and demographic factors such as income, education and experience. For the data collection, a self-constructed questionnaire was administered to investors in the Malaysian and Pakistani stock exchanges. Data has been analyzed through description, correlation and regression analysis. The results indicate that all three heuristics are likely to affect the investors' stock buying decisions. The effect of heuristics is similar across the sample countries, the type of investors, and the income groups. However, the investors with a higher level of education and more experience are less likely to be affected by the heuristics.

  19. STRATEGIC PLANNING AND HIGH PERFORMANCE HUMAN RESOURCE MANAGEMENT PRACTICES IN PAKISTANI SMES

    Directory of Open Access Journals (Sweden)

    Abdul RAZIQ

    2014-10-01

    Full Text Available This study is concerned with the relationship between Strategic Planning and High Performance Human Resource Management Practices (HPHRMP. The study was conducted in the context of Small & Medium-size Enterprises (SMEs in the service and manufacturing sector in Pakistani. The primary data was collected through a survey of HPHRMP and as such the study is quantitative in nature. The target population of the study consisted of SMEs operating in the city of Karachi, Pakistan. Stratified random sampling method was applied to collect data from 357 SMEs. An independent-sample t-test test was employed to see whether group means of Strategic Planning are significantly different in relation to prevalence of HPHRMP. The overall results were mixed and partially supportive of a positive relationship between Strategic Planning and the adoption of HPHRMP.

  20. Cultural adaptation of preschool PATHS (Promoting Alternative Thinking Strategies) curriculum for Pakistani children.

    Science.gov (United States)

    Inam, Ayesha; Tariq, Pervaiz N; Zaman, Sahira

    2015-06-01

    Cultural adaptation of evidence-based programmes has gained importance primarily owing to its perceived impact on the established effectiveness of a programme. To date, many researchers have proposed different frameworks for systematic adaptation process. This article presents the cultural adaptation of preschool Promoting Alternative Thinking Strategies (PATHS) curriculum for Pakistani children using the heuristic framework of adaptation (Barrera & Castro, 2006). The study was completed in four steps: information gathering, preliminary adaptation design, preliminary adaptation test and adaptation refinement. Feedbacks on programme content suggested universality of the core programme components. Suggested changes were mostly surface structure: language, presentation of materials, conceptual equivalence of concepts, training needs of implementation staff and frequency of programme delivery. In-depth analysis was done to acquire cultural equivalence. Pilot testing of the outcome measures showed strong internal consistency. The results were further discussed with reference to similar work undertaken in other cultures. © 2014 International Union of Psychological Science.

  1. Students and Libraries: The Perspectives of Faculty in a Pakistani University

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2011-06-01

    Full Text Available The purpose of this study is to explore student library use from the perspective of the faculty. An already developed instrument was used to collect data from full-time faculty members working in a private university located in the province of Punjab, Pakistan. The faculty strongly supported the idea of library based learning, student library use, assigning library-based tasks, and the crucial role of librarians in promoting a library culture. The respondents were not satisfied with the students’ library use skills, availability of relevant and current data or the promotion of library use by the institution’s top management. The current research is first of its kind in Pakistan and is based on data collected from a single university. Future research might be extended to other universities in the Pakistani or South Asian higher education sector. The study could be helpful to higher education policy to design customerdriven marketing strategies while marketing libraries to stakeholders.

  2. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

    Science.gov (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

    2017-04-05

    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  3. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    International Nuclear Information System (INIS)

    Siddiqui, M.F.; Iqbal, S.; Naz, N.; Khan, S.; Erum, S.

    2010-01-01

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  4. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  5. DNA landmarks for genetic relatedness and diversity assessment in Pakistani wheat genotypes using RAPD markers

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, M F; Iqbal, S; Naz, N; Khan, S [Federal Seed Certification and Registration Dept., Islamabad (Pakistan); Erum, S [National Agricultural Research Centre, Islamabad (Pakistan). Plant Genetic Resources Inst.

    2010-04-15

    DNA profiles from 10 Pakistani wheat genotypes were evaluated for diversity assessment based on RAPD markers. A total of 79 DNA fragments were generated by 10 RAPD primers, with an average of 7.9 bands primer-1. Of these, 64 fragments (81%) were polymorphic among 10 genotypes. Genetic diversity was evaluated via UPGMA cluster analysis by constructing dendrogram, which were used for the calculation of similarity coefficients between these genotypes. The greatest similarity (95%) was observed between PR-94 and PR-95, whereas PR-96 with PR-90 showed the lowest similarity (60%). Adoption of this technology would be useful to the plant protection regulatory systems, especially for plant variety identification and registration of new plant varieties, breeding programs and protection purposes. (author)

  6. Visual representation of gender in flood coverage of Pakistani print media

    Directory of Open Access Journals (Sweden)

    Zarqa S. Ali

    2014-08-01

    Full Text Available This paper studies gender representation in the visual coverage of the 2010 floods in Pakistan. The data were collected from flood visuals published in the most circulated mainstream English newspapers in Pakistan, Dawn and The News. This study analyses how gender has been framed in the flood visuals. It is argued that visual representation of gender reinforces the gender stereotypes and cultural norms of Pakistani society. The gender-oriented flood coverage in both newspapers frequently seemed to take a reductionist approach while confining the representation of women to gender, and gender-specific roles. Though the gender-sensitive coverage displayed has been typical, showing women as helpless victims of flood, it has aroused sentiments of sympathy among readers and donors, inspiring them to give immediate moral and material help to the affected people. This agenda set by media might be to exploit the politics of sympathy but it has the effect of endorsing gender stereotypes.

  7. Patient perspectives on type 2 diabetes and medicine use during Ramadan among Pakistanis in Denmark

    DEFF Research Database (Denmark)

    Mygind, Anna; Kristiansen, Maria; Wittrup, Inge

    2013-01-01

    of Ramadan without adequate counselling on how to adjust their medicines. Objective To explore patient perspectives on medicine use during Ramadan, reasons for fasting and experiences with counselling on medicine use during Ramadan among people of Pakistani background with type 2 diabetes and at least one...... (six interviewers). Results All interviewees pointed out that Islam allows ill people to refrain from fasting during Ramadan. However, all had fasted during Ramadan despite being diagnosed with type 2 diabetes. While fasting, they adapted their use of medicines in different ways, e.g. by changing...... the time of intake or by skipping morning medicines. Fasting during Ramadan meant a feeling of improvement in well-being for all interviewees. Reasons for this improvement included physiological, social and religious aspects. Healthcare professionals were rarely included in the decision-making process...

  8. Vitamin D supplementation does not affect serum lipids and lipoproteins in Pakistani immigrants

    DEFF Research Database (Denmark)

    Andersen, Rikke; Brot, Christine; Mejborn, Heddie

    2009-01-01

    Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo-controlled interve......Potential long-term negative effects of increased vitamin D consumption are not thoroughly examined. The aim of this study was to investigate possible negative effects of vitamin D supplementation on serum lipids and lipoproteins. A 1-year long randomised double-blinded placebo......-cholesterol/HDL-cholesterol ratio, VLDL-cholesterol and triacylglycerol after daily supplementation with 10 or 20 g vitamin D for 1 year. In conclusion, increasing the vitamin D intake by 10–20 g per day for 1 year is safe for Pakistani immigrants with regards to serum lipids and lipoproteins....

  9. Usher syndrome in four siblings from a consanguineous family of Pakistani origin.

    Science.gov (United States)

    Trop, I; Schloss, M D; Polomeno, R; Der Kaloustian, V

    1995-04-01

    Usher syndrome is a heterogeneous group of disorders of autosomal recessive inheritance characterized by retinitis pigmentosa and congenital sensorineural hearing loss. Two types are accepted clinically: type I is associated with profound congenital deafness with progressive pigmentary retinopathy and total loss of vestibular function. Type II is a milder form, with moderate-to-profound hearing loss and a milder form of retinitis pigmentosa. Vestibular function is preserved. A total of five loci have been identified as accounting for the two distinct phenotypic presentations. We describe a consanguineous family of Pakistani origin whose four children all are affected with Usher syndrome type I. DNA analysis showed non-linkage to any of the loci already identified as tightly linked to the Usher syndrome type I.

  10. Criminal aspects of domestic violence

    OpenAIRE

    Váňová, Radka

    2013-01-01

    Criminal aspects of domestic violence SUMMARY Domestic violence is a serious social concern with high level of latency. The domestic violence victims protection is ensured by legal standarts of Civil, Administrative and Criminal Law and other legal standarts. Criminal Law is one of the important instruments for tackling of serious forms of domestic violence. However Criminal Law is an instrument "ultima ratio" which needs claiming of subsidiarity principal of the crime repression. The purpose...

  11. An encyclopedia on domestic electricity

    International Nuclear Information System (INIS)

    1982-12-01

    This book describes the footprint of domestic electrification with domestic energy and the role of electrification, basic knowledge on domestic electrification, the basic things electric equipment in domestic, materials, part and making, demand of electricity, electrification and life, various electric equipment in the kitchen, rationalization of house chore, environment and hygiene like electric iron, electric stove, electric mat and dining wagon, beauty treatment and health, refinement and entertainment and lighting in houses.

  12. Prevalence and socioeconomic correlates of overweight and obesity among Pakistani primary school children

    Directory of Open Access Journals (Sweden)

    Shahid Ubeera

    2011-09-01

    Full Text Available Abstract Background Childhood obesity is becoming an equally challenging, yet under-recognized, problem in developing countries including Pakistan. Children and adolescents are worst affected with an estimated 10% of the world's school-going children being overweight and one quarter of these being obese. The study aimed to assess prevalence and socioeconomic correlates of overweight and obesity, and trend in prevalence statistics, among Pakistani primary school children. Methods A population-based cross-sectional study was conducted with a representative multistage cluster sample of 1860 children aged 5-12 years in Lahore, Pakistan. Overweight (> + 1SD and obesity (> + 2SD were defined using the World Health Organization child growth reference 2007. Chi-square test was used as the test of trend. Linear regression was used to examine the predictive power of independent variables in relation to BMI. Logistic regression was used to quantify the independent predictors for overweight and adjusted odds ratios (aOR with 95% confidence intervals (CI were obtained. All regression analyses were controlled for age and gender and statistical significance was considered at P Results Seventeen percent (95% CI 15.4-18.8 children were overweight and 7.5% (95% CI 6.5-8.7 were obese. Higher prevalence of obesity was observed among boys than girls (P = 0.028, however, there was no gender disparity in overweight prevalence. Prevalence of overweight showed a significantly increasing trend with grade (P Conclusion Alarmingly rapid rise in overweight and obesity among Pakistani primary school children was observed, especially among the affluent urban population. The findings support the urgent need for National preventive strategy for childhood obesity and targeted interventions tailored to local circumstances with meaningful involvement of communities.

  13. Frequency of metabolic syndrome and its components in 300 Pakistani obese patients

    International Nuclear Information System (INIS)

    Khattak, I.; Ishaq, T.; Fida, Z.; Rehman, F.U.

    2017-01-01

    To assess the frequency of metabolic syndrome (MS) and its constituents in a sample of Pakistani obese patients. Methodology: In this descriptive and cross-sectional study, we used a sample of 300 patients from Khyber Teaching Hospital, Peshawar, Pakistan from April 2016 to November 2016. They were randomly selected and their mean age was between 15 and 25 years. The variables obtained included BMI, both systolic and diastolic blood pressure, cholesterol, fasting blood glucose, triglyceride levels, LDL- cholesterol, HDL-cholesterol, waist to hip ratio, waist circumference and insulin resistance. Results: Of the 300 patients, the frequency of MS was 20%. There were no significant differences in the frequency of developing MS between the genders. The order of frequency of the components as observed was as follows; abdominal obesity was 88%, high triglyceride level was 85%, males were 40%, 40% of the sampled population resided in the urban area. Meanwhile, 35% of the patients had hypertension while only 5% had hyperglycemia. The frequency of developing MS was 70 times higher in patients with high triglyceride levels in their when compared to those with normal levels. Conclusion: The frequency of MS and its components in Pakistani adolescent patients is high. The high levels of triglyceride and a sedentary lifestyle profoundly contributed to MS. Moreover, the findings signify the importance of early treatment and prevention of obesity in working toward reducing the rate of diabetes mellitus type 2; as glucose intolerance had a strong relationship with the components of MS, and cardiovascular diseases such coronary artery disease. (author)

  14. Immunohistochemical expression of alpha methylacyl-coa racemase (amacr) in carcinoma prostate in pakistani population

    International Nuclear Information System (INIS)

    Tariq, H.; Ahmed, R.; Muhammad, I.; Afzal, M.S.; Hashmi, S.N.; Hamdani, S.N.R.; Shahid, A.

    2017-01-01

    Objective: To determine the frequency of expression of positive diagnostic marker alpha methylacyl-COA RACEMES (AMACR) in the examination of prostate needle biopsy specimens from patients of adenocarcinoma prostate from a subset of Pakistani population. Study design: Cross-sectional study. Place and Duration of Study: Department of Histopathology, Armed Forces Institute of Pathology, Rawalpindi from Apr 2015 to Oct 2015. Material and Methods: All specimens of adenocarcinoma prostate diagnosed at Armed forces institute of pathology on the basis of immunohistochemistry and routine histopathology irrespective of age of patient, histological type or grade of the tumor were analyzed. Mean and Standard deviation were calculated for quantitative variables like patient's age and frequencies along with percentages were calculated for qualitative variables like AMACR expression. Results: Out of the total 80 cases, 68 (85%) were positive for AMACR while 12 (15%) were negative. Among the cases that were negative 9 (11.3%) showed 1 +- staining (Weak, non-circumferential) and 3 cases (3.8%) displayed 0 staining (No cytoplasmic staining). Conclusion: Positive staining for AMACR can be used to support a diagnosis of cancer on prostate needle core biopsies when the focus in question is <1mm in maximum dimension. The results of AMACR expression in a subset of Pakistani population are comparable to the western studies. AMACR staining must be interpreted in the context of basic haematoxylin and eosin criteria for malignancy along with the results expansion of other supportive markers, such as a basal cell specific marker like p63 or 34 beta E12. (author)

  15. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.)

    Science.gov (United States)

    Zubair, Muhammad; Anwar, Farooq; Ashraf, Muhammad; Uddin, Md. Kamal

    2012-01-01

    The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L). Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice) ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg) linoleic (5453–7874 mg/kg) and palmitic acid (3613–5489 mg/kg). The amounts of total phytosterols (GC and GC-MS analysis), with main contribution from β-sitosterol (445–656 mg/kg), campesterol (116–242 mg/kg), Δ5-avenasterol (89–178 mg/kg) and stigmasterol (75–180 mg/kg) were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data), identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods. PMID:22605998

  16. Characterization of High-Value Bioactives in Some Selected Varieties of Pakistani Rice (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Md. Kamal Uddin

    2012-04-01

    Full Text Available The present study reports the composition and variation of fatty acids, sterols, tocopherols and γ-oryzanol among selected varieties namely Basmati Super, Basmati 515, Basmati 198, Basmati 385, Basmati 2000, Basmati 370, Basmati Pak, KSK-139, KS-282 and Irri-6 of Pakistani rice (Oryza sativa L. Oil content extracted with n-hexane from different varieties of brown rice seed (unpolished rice ranged from 1.92% to 2.72%. Total fatty acid contents among rice varieties tested varied between 18240 and 25840 mg/kg brown rice seed. The rice tested mainly contained oleic (6841–10952 mg/kg linoleic (5453–7874 mg/kg and palmitic acid (3613–5489 mg/kg. The amounts of total phytosterols (GC and GC-MS analysis, with main contribution from β-sitosterol (445–656 mg/kg, campesterol (116–242 mg/kg, ∆5-avenasterol (89–178 mg/kg and stigmasterol (75–180 mg/kg were established to be 739.4 to 1330.4 mg/kg rice seed. The content of α-, γ- and δ-tocopherols as analyzed by HPLC varied from 39.0–76.1, 21.6–28.1 and 6.5–16.5 mg/kg rice seed, respectively. The amounts of different γ-oryzanol components (HPLC data, identified as cycloartenyl ferulate, 24-methylene cycloartanyl ferulate, campesteryl ferulate and β-sitosteryl ferulate, were in the range of 65.5–103.6, 140.2–183.1, 29.8–45.5 and 8.6–10.4 mg/kg rice seed, respectively. Overall, the concentration of these bioactives was higher in the Basmati rice cultivars showing their functional food superiority. In conclusion, the tested varieties of Pakistani rice, especially the Basmati cultivars, can provide best ingredients for functional foods.

  17. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Directory of Open Access Journals (Sweden)

    Ahmed Waqas

    2014-12-01

    Full Text Available Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan.Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences.Results. Response rate was 81% (527/650 respondents. Mean age was 20.98 years. Most of the students (331, 62.8% had an urban background and studied Social Sciences (238, 45.2%. Four hundred and eighteen respondents (79.3% considered religion very important and most respondents considered psychiatrists (334, 63.4% and spiritual leaders (72, 13.7% to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1% considered black magic to be a cause of mental illness. Only 215 (41% respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p < .05.Conclusion. Although low awareness and exposure were found in this sample of Pakistani university students, their attitude towards mental illnesses was generally positive. Most respondents gave supernatural explanations for mental illnesses but only a few believed that spiritual leaders can

  18. Domestic wastes: assault course

    International Nuclear Information System (INIS)

    Durand, C.; Bergey, J.L.

    1997-01-01

    In the management of domestic waste, some incoherencies persist. The tax on waste is always 20.6% instead of 5.5% for water or transport. The price of buying back electric power by Electricite de France is too low according to the appreciation of the cogeneration club. Regarding to the sell of stream to industrial, stream buyers are not always reliable, no enough guarantee are given by them to allow to cogeneration club to invest. (N.C.)

  19. Deconstructing domestic violence policy

    OpenAIRE

    Branney, PE

    2006-01-01

    The primary objectives of this thesis are to, circularly, deconstruct contemporary domestic violence policy while developing and evaluating methods for deconstructing policy. Policy is theorised as a discursive practice, which allows a variety of policies to be compared and critiqued by how they position the people they affect. These are known as subject positions, or subjectivities, and throughout this thesis I attempt to critique policy by examining the (re)construction of subjectivity. In ...

  20. Health-Related Quality of Life, Subjective Health Complaints, Psychological Distress and Coping in Pakistani Immigrant Women With and Without the Metabolic Syndrome : The InnvaDiab-DEPLAN Study on Pakistani Immigrant Women Living in Oslo, Norway.

    Science.gov (United States)

    Hjellset, Victoria Telle; Ihlebæk, Camilla M; Bjørge, Benedikte; Eriksen, Hege R; Høstmark, Arne T

    2011-08-01

    The increasingly high number of immigrants from South-East Asia with The Metabolic Syndrome (MetS) is an important challenge for the public health sector. Impaired glucose is essential in MetS. The blood glucose concentration is not only governed by diet and physical activity, but also by psychological distress which could contribute to the development of MetS. The aim of this study is to describe health-related quality of life, subjective health complaints (SHC), psychological distress, and coping in Pakistani immigrant women, with and without MetS. As a part of an randomized controlled intervention study in Oslo, Norway, female Pakistani immigrants (n = 198) answered questionnaires regarding health related quality of life, SHC, psychological distress, and coping. Blood variables were determined and a standardized oral glucose tolerance test was performed. The participants had a high score on SHC and psychological distress. About 40% of the participants had MetS, and this group showed significantly lower general health, lower physical function, and more bodily pain, than those without MetS. Those with MetS also had more SHC, depressive symptoms, higher levels of somatisation, and scored significantly lower on the coping strategy of active problem solving. Pakistani immigrant women seem to have a high prevalence of SHC and psychological distress, especially those with MetS.

  1. Modernism and Postmodernism: A Study of the Islamic Teachings with Special Reference to the Related Issues of Pakistani Society

    Directory of Open Access Journals (Sweden)

    Dr. Abdul Muhaimin

    2017-02-01

    Full Text Available Abstract This study elaborates the difference and connection between modernism and postmodernism eras while highlighting their backgrounds. The research highlights the teachings of Islam in terms of modernism and postmodernism. The research brings to light the influence of modernism and postmodernism on Muslim societies. What are the far reaching impacts of the modernism and postmodernism eras of Muslim societies and how well a common Muslim is equipped to address the issues related to postmodernism. The study primarily focuses on the related issues in Pakistani society and explains the role and the influence of religious scholars of their understanding of the terms modernism and postmodernism. The study focuses on the awareness of the ’Ulamā in addressing these global challenges and subsequently the future of Pakistani society. The study has an element of quantitative research and it indicates towards the on ground realities on the issue with the help of a latest survey on modernism and postmodernism.

  2. The relationship between domestic space and gender identity: Some signs of emergence of alternative domestic femininity and masculinity

    Directory of Open Access Journals (Sweden)

    Cătălina-Ionela Rezeanu

    2015-12-01

    Full Text Available The premise of this article is that, by introducing domestic space in the analysis of gender identity, one might gain a more nuanced understanding of how gender and power are co-constitutive. The research question is what one could learn from the conclusions of recent studies about the relationship between gender identity and domestic space, by analyzing it as a way of “doing and undoing gender” through spatial practices. We conducted an interpretive synthesis, focusing on 20 articles published in the last ten years on the topics of domestic space, masculinity, and femininity. We show the traditional normative model of gender identity is still strong, but there are some signs, of the emergence of alternative domestic masculinity and femininity, based on the tendency to reconsider the value of domesticity, and to transgress traditional gender oppositions (mind and body, rational and emotional, public and private, work and domesticity. We discuss the implications of the findings for understanding and refining the concepts of doing and doing gender, and gendered space.

  3. Development of Growth Charts of Pakistani Children Aged 4-15 Years Using Quantile Regression: A Cross-sectional Study.

    Science.gov (United States)

    Iftikhar, Sundus; Khan, Nazeer; Siddiqui, Junaid S; Baig-Ansari, Naila

    2018-02-02

    Background Growth charts are essential tools used by pediatricians as well as public health researchers in assessing and monitoring the well-being of pediatric populations. Development of these growth charts, especially for children above five years of age, is challenging and requires current anthropometric data and advanced statistical analysis. These growth charts are generally presented as a series of smooth centile curves. A number of modeling approaches are available for generating growth charts and applying these on national datasets is important for generating country-specific reference growth charts. Objective To demonstrate that quantile regression (QR) as a viable statistical approach to construct growth reference charts and to assess the applicability of the World Health Organization (WHO) 2007 growth standards to a large Pakistani population of school-going children. Methodology This is a secondary data analysis using anthropometric data of 9,515 students from a Pakistani survey conducted between 2007 and 2014 in four cities of Pakistan. Growth reference charts were created using QR as well as the LMS (Box-Cox transformation (L), the median (M), and the generalized coefficient of variation (S)) method and then compared with WHO 2007 growth standards. Results Centile values estimated by the LMS method and QR procedure had few differences. The centile values attained from QR procedure of BMI-for-age, weight-for-age, and height-for-age of Pakistani children were lower than the standard WHO 2007 centile. Conclusion QR should be considered as an alternative method to develop growth charts for its simplicity and lack of necessity to transform data. WHO 2007 standards are not suitable for Pakistani children.

  4. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    OpenAIRE

    Mushtaq, Muhammad Umair; Gull, Sibgha; Mushtaq, Komal; Abdullah, Hussain Muhammad; Khurshid, Usman; Shahid, Ubeera; Shad, Mushtaq Ahmad; Akram, Javed

    2012-01-01

    Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed heigh...

  5. Foreign Delisting and Domestic Stock Value

    DEFF Research Database (Denmark)

    Uderche-Rangau, Loredana; Carugati, Andrea

    2008-01-01

    of the delisting decision on the domestic stock price by observing the link between the pure value impact and the reasons for delisting. Our results show that, contrary to previous results, firms delisting from Tokyo can gain value depending on the reaction of the market operators to the content of the information...... provided in the delisting announcements. i.e. delisting can be presented either as the result of the not fulfilment of the benefits of cross-listing or as a part of a more general strategy of the company. Highlighting significant clusters, content analysis provides a valuable addition to traditional event...

  6. Social gradients in health for Pakistani and White British women and infants in two UK birth cohorts.

    Science.gov (United States)

    Uphoff, Eleonora P; Pickett, Kate E; Wright, John

    2016-10-01

    This study aims to examine social gradients in low birth weight (LBW), preterm birth, smoking during pregnancy and maternal health for women and infants of Pakistani origin and White British women and infants in the UK. The sample included women and singleton infants from the Born in Bradford (BiB) study (n = 8181) and the first sweep of the Millennium Cohort Study (MCS) (n = 8980). Social gradients in health for four measures of socioeconomic status (SES): maternal education, means-tested benefits, financial situation, and occupation of the father were analysed in multivariate regression models adjusting for maternal age and parity. For White British mothers and infants in the MCS sample, social gradients in health were observed for at least three out of four measures of SES for each health outcome (p for trend social gradient in health for Pakistani women was demonstrated with the self-reported measure of financial situation, in relation to mental health (p for trend social gradients in health for Pakistani women and infants and discusses potential explanations for this finding.

  7. Domestic energy fact file

    Energy Technology Data Exchange (ETDEWEB)

    Shorrock, L D; Henderson, G [Building Research Establishment, Watford (United Kingdom); Bown, J H.F. [NBA Tectonics, London (United Kingdom)

    1992-01-01

    The purpose of this publication to gather together in one volume some of the more important United Kingdom data on domestic energy and the measures that have been taken to improve the efficiency with which it is used. The introductory section discusses the main underlying trends affecting domestic energy use. It is followed by six main sections: Section 1 deals with fuel prices and household expenditure on energy. Section 2 is concerned with basic statistics on population, households and the housing stock (age, tenure, dwelling type and regional distribution). Section 3 presents information on the uptake of insulation measures in the housing stock. Section 4 presents information on changes to the housing stock heat loss, heating systems, temperatures and energy use. This section looks at what would have happened to the energy use of the housing stock if energy efficiency improvements had not been introduced. Section 4 contains the main conclusions on the effectiveness of insulation, improvements in efficiency and the rising standards of service achieved within the housing stock. Section 5 draws together the topics discussed in section 4 to illustrate the individual effects of rising levels of service, external temperature variations, improved insulation and improved heating efficiency, and how these combine to determine domestic section energy consumption. Section 6 considers the fuels used to meet the energy demand of the housing stock and the carbon dioxide emissions which result from this fuel use. The primary energy consumption associated with the energy delivered to the housing stock is also addressed in this section. A final energy balance diagram draws together the various topics discussed in the report by showing the main energy flows related to the housing stock. (author)

  8. Przemoc domowa = Domestic violence

    OpenAIRE

    Łepecka-Klusek, Celina; Pawłowska-Muc, Agnieszka Konstancja; Pilewska-Kozak, Anna Bogusława; Stadnicka, Grażyna; Pałucka, Klaudia

    2015-01-01

    Łepecka-Klusek Celina, Pawłowska-Muc Agnieszka Konstancja, Pilewska‑Kozak Anna Bogusława, Stadnicka Grażyna, Pałucka Klaudia. Przemoc domowa = Domestic violence. Journal of Education, Health and Sport. 2015;5(6):169-182. ISSN 2391-8306. DOI 10.5281/zenodo.18420 http://ojs.ukw.edu.pl/index.php/johs/article/view/2015%3B5%286%29%3A169-182 https://pbn.nauka.gov.pl/works/564476 http://dx.doi.org/10.5281/zenodo.18420 Formerly Journal of Health Sciences. ISSN 1429-9623 / 2300-665X. A...

  9. Methylated spirit burns following traditional hair dressing practice.

    Science.gov (United States)

    Michael, Afieharo I; Iyun, Ayodele O

    2018-02-01

    Methylated spirit burns have been reported following domestic uses such as igniting fondues. It has also been used as an accelerant for self-immolation. We report the first documented case of severe methylated spirit burns sustained during traditional hair dressing. Increased awareness on the dangers of methylated spirit as well as making it less readily available for domestic use is warranted. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  10. Selection signature in domesticated animals.

    Science.gov (United States)

    Pan, Zhang-yuan; He, Xiao-yun; Wang, Xiang-yu; Guo, Xiao-fei; Cao, Xiao-han; Hu, Wen-ping; Di, Ran; Liu, Qiu-yue; Chu, Ming-xing

    2016-12-20

    Domesticated animals play an important role in the life of humanity. All these domesticated animals undergo same process, first domesticated from wild animals, then after long time natural and artificial selection, formed various breeds that adapted to the local environment and human needs. In this process, domestication, natural and artificial selection will leave the selection signal in the genome. The research on these selection signals can find functional genes directly, is one of the most important strategies in screening functional genes. The current studies of selection signal have been performed in pigs, chickens, cattle, sheep, goats, dogs and other domestic animals, and found a great deal of functional genes. This paper provided an overview of the types and the detected methods of selection signal, and outlined researches of selection signal in domestic animals, and discussed the key issues in selection signal analysis and its prospects.

  11. MARKETING OF TRADITIONAL PRODUCT IN TRANSYLVANIA

    Directory of Open Access Journals (Sweden)

    M. MATIUTI

    2009-05-01

    Full Text Available Transylvania and the Banat are two historical regions that gave birth to several domestic animal breeds. Over the last 15 years, number have sunken dramatically, because these local breeds have been greatly replaced by imported ones. Although very many so- called agrotouristic pensions are now on the market, only about 1% of them promote real traditional food products obtained from local animal breeds. Only few people, especially old people, know traditional recipes older than two or three hundred years and the youth totally ignore them. On the one hand, a large variety of names for different products have appeared on the market, but they are manufactured by big firms and do not have the quality of the traditional products. On the other hand, small producers often have hygiene problems. The reinforcement of traditional products can only occur if people know the quality and the value of the products obtained from the local animal breeds, many of them being endangered species.

  12. Assessment of potential toxicity of a smokeless tobacco product (naswar) available on the Pakistani market.

    Science.gov (United States)

    Zakiullah; Saeed, Muhammad; Muhammad, Naveed; Khan, Saeed Ahmad; Gul, Farah; Khuda, Fazli; Humayun, Muhammad; Khan, Hamayun

    2012-07-01

    'Naswar' is a smokeless tobacco product (STP) widely used in Pakistan. It has been correlated with oral and oesophageal cancer in recent clinical studies. The toxic effects associated with STPs have been associated with trace level contaminants present in these products. The toxin levels of Pakistani naswar are reported for the first time in this study. A total of 30 Pakistani brands of naswar were tested for a variety of toxic constituents and carcinogens such as cadmium, arsenic, lead and other carcinogenic metals, nitrite and nitrate, and nicotine and pH. The average values of all the toxins studied were well above their allowable limits, making the product a health risk for consumers. Calculated lifetime cancer risk from cadmium and lead was 1 lac (100,000) to 10 lac (1,000,000) times higher than the minimum 10E-4 (0.00001) to 10E-6 (0.000001), which is the 'target range' for potentially hazardous substances, according to the US Environmental Protection Agency. Similarly, the level of arsenic was in the range of 0.15 to 14.04 μg/g, the average being 1.25 μg/g. The estimated average bioavailable concentration of arsenic is 0.125-0.25 μg/g, which is higher than the allowable standard of 0.01 μg/g. Similarly, the average minimum daily intake of chromium and nickel was 126.97 μg and 122.01 μg, as compared to allowable 30-35 μg and 35 μg, respectively; a 4-5 times higher exposure. However, beryllium was not detected in any of the brands studied. The pH was highly basic, averaging 8.56, which favours the formation of tobacco specific amines thus making the product potentially toxic. This study validates clinical studies correlating incidence of cancer with naswar use in Pakistan. This study shows that the production, packaging, sale and consumption of naswar should be regulated so as to protect the public from the health hazards associated with its consumption.

  13. Medicolegal characteristics of domestic violence

    OpenAIRE

    Antović Aleksandra R.; Stojanović Jovan

    2017-01-01

    Introduction/Objective. Domestic violence is a phenomenon as old as the history of human civilization, present in all cultures, epochs and social systems. Despite the fact that domestic violence represents a dangerous and unacceptable social phenomenon, as well as a significant medical problem, there are still no precise data on the prevalence of this phenomenon in our country. This study aims to determine the elementary forensic characteristics of domestic violence that would represented the...

  14. Transnational Journeys and Domestic Histories

    OpenAIRE

    Webster, Wendy

    2006-01-01

    This essay considers the potential of histories of transnational movements of people, and the erosion of boundaries between British domestic and imperial history, to expand and revise the history of nineteenth- and twentieth-century British domestic life and work. Literatures on migration demonstrate how far the history of home involves transnational themes, including the recruitment of migrants and refugees who crossed national borders to do domestic work—in Britain and empire—and their deve...

  15. Plant domestication and gene banks

    International Nuclear Information System (INIS)

    Perrino, P.

    1989-01-01

    At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

  16. Quantitative study of medicinal plants used by the communities residing in Koh-e-Safaid Range, northern Pakistani-Afghan borders.

    Science.gov (United States)

    Hussain, Wahid; Badshah, Lal; Ullah, Manzoor; Ali, Maroof; Ali, Asghar; Hussain, Farrukh

    2018-04-25

    The residents of remote areas mostly depend on folk knowledge of medicinal plants to cure different ailments. The present study was carried out to document and analyze traditional use regarding the medicinal plants among communities residing in Koh-e-Safaid Range northern Pakistani-Afghan border. A purposive sampling method was used for the selection of informants, and information regarding the ethnomedicinal use of plants was collected through semi-structured interviews. The collected data was analyzed through quantitative indices viz. relative frequency citation, use value, and family use value. The conservation status of medicinal plants was enumerated with the help of International Union for Conservation of Nature Red List Categories and Criteria (2001). Plant samples were deposited at the Herbarium of Botany Department, University of Peshawar for future reference. One hundred eight informants including 72 male and 36 female were interviewed. The informants provided information about 92 plants species used in the treatment of 53 ailments. The informant reported maximum number of species used for the treatment of diabetes (16 species), followed by carminatives (12 species), laxatives (11 species), antiseptics (11 species), for cough (10 species), to treat hepatitis (9 species), for curing diarrhea (7 species), and to cure ulcers (7 species), etc. Decoction (37 species, i.e., 40%) was the common method of recipe preparation. Most familiar medicinal plants were Withania coagulans, Caralluma tuberculata, and Artemisia absinthium with relative frequency (0.96), (0.90), and (0.86), respectively. The relative importance of Withania coagulans was highest (1.63) followed by Artemisia absinthium (1.34), Caralluma tuberculata (1.20), Cassia fistula (1.10), Thymus linearis (1.06), etc. This study allows identification of novel uses of plants. Abies pindrow, Artemisia scoparia, Nannorrhops ritchiana, Salvia reflexa, and Vincetoxicum cardiostephanum have not been reported

  17. Comparison of general health status, myocardial infarction, obesity, diabetes, and fruit and vegetable intake between immigrant Pakistani population in the Netherlands and the local Amsterdam population.

    Science.gov (United States)

    Raza, Qaisar; Nicolaou, Mary; Dijkshoorn, Henriëtte; Seidell, Jacob C

    2017-12-01

    South Asians living in Western countries have shown higher prevalence of cardiovascular disease and related non-communicable diseases as compared to the local populations. The aim of this study was to compare the general health status and prevalence of myocardial infarction (MI), diabetes, high blood pressure, overweight, obesity, and fruit and vegetable intake between Pakistani immigrants in the Netherlands and local Amsterdam population. A health survey was conducted in 2012-2013 among Pakistanis in the Netherlands. Results were compared with a health survey conducted among inhabitants of Amsterdam in 2012. One hundred and fifty-four Pakistanis from four big cities of the Netherlands and 7218 inhabitants of Amsterdam participated. The data for Amsterdam population were weighed on the basis of age, gender, city district, marital status, ethnicity and income level while the data for Pakistanis were weighed on the basis of age and gender to make both data-sets representative of their general population. Pakistanis reported a high prevalence of MI (3.3%), diabetes (11.4%), high blood pressure (14.4%), overweight (35.5%) and obesity (18.5%) while Amsterdam population reported the prevalence as 2.5% for MI, 6.8% for diabetes, 15.3% for high blood pressure, 28.1% for overweight and 11.1% for obesity. Pakistanis had a significantly higher level of MI (OR = 2.71; 95% CI: 1.19-6.14), diabetes (OR = 4.41; 95% CI: 2.66-7.33) and obesity (OR = 2.51; 95% CI: 1.53-4.12) after controlling for age, sex and educational level with Amsterdam population as the reference group. Pakistanis showed a higher intake of fruit and fruit juice as compared to Amsterdam population though the latter showed a higher intake of cooked vegetables. Higher prevalence of MI, diabetes and obesity among Pakistanis than Amsterdam population indicates the need for health scientists and policy-makers to develop interventions for tackling non-communicable diseases and its determinants among

  18. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI).

    Science.gov (United States)

    Naqvi, Atta Abbas; Zehra, Fatima; Ahmad, Rizwan; Ahmad, Niyaz

    2016-12-09

    There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, "breast cancer inventory (BCI)" by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO) measure and Bartlett's test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA) were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  19. Developing a Research Instrument to Document Awareness, Knowledge, and Attitudes Regarding Breast Cancer and Early Detection Techniques for Pakistani Women: The Breast Cancer Inventory (BCI

    Directory of Open Access Journals (Sweden)

    Atta Abbas Naqvi

    2016-12-01

    Full Text Available There is a general hesitation in participation among Pakistani women when it comes to giving their responses in surveys related to breast cancer which may be due to the associated stigma and conservatism in society. We felt that no research instrument was able to extract information from the respondents to the extent it was needed for the successful execution of our study. The need to develop a research instrument tailored for Pakistani women was based upon the fact that most Pakistani women come from a conservative background and sometimes view this topic as provocative and believe discussing publicly about it as inappropriate. Existing research instruments exhibited a number of weaknesses during literature review. Therefore, using them may not be able to extract information concretely. A research instrument was, thus, developed exclusively. It was coined as, “breast cancer inventory (BCI” by a panel of experts for executing a study aimed at documenting awareness, knowledge, and attitudes of Pakistani women regarding breast cancer and early detection techniques. The study is still in the data collection phase. The statistical analysis involved the Kaiser-Meyer-Olkin (KMO measure and Bartlett’s test for sampling adequacy. In addition, reliability analysis and exploratory factor analysis (EFA were, also employed. This concept paper focuses on the development, piloting and validation of the BCI. It is the first research instrument which has high acceptability among Pakistani women and is able to extract adequate information from the respondents without causing embarrassment or unease.

  20. Measuring domestic water use

    DEFF Research Database (Denmark)

    Tamason, Charlotte C.; Bessias, Sophia; Villada, Adriana

    2016-01-01

    Objective: To present a systematic review of methods for measuring domestic water use in settings where water meters cannot be used. Methods: We systematically searched EMBASE, PubMed, Water Intelligence Online, Water Engineering and Development Center, IEEExplore, Scielo, and Science Direct...... databases for articles that reported methodologies for measuring water use at the household level where water metering infrastructure was absent or incomplete. A narrative review explored similarities and differences between the included studies and provide recommendations for future research in water use....... Results: A total of 21 studies were included in the review. Methods ranged from single-day to 14-consecutive-day visits, and water use recall ranged from 12 h to 7 days. Data were collected using questionnaires, observations or both. Many studies only collected information on water that was carried...

  1. Foreign Firms, Domestic Wages

    DEFF Research Database (Denmark)

    Malchow-Møller, Nikolaj; Markusen, James R.; Schjerning, Bertel

    to the firm?s productivity. Foreign-owned firms have, on average, higher productivity in equilibrium due to entry costs, which means that low-productivity foreign firms cannot enter. Foreign firms have higher wage growth and, with some exceptions, pay higher average wages, but not when compared to similarly...... large domestic firms. The empirical implications of the model are tested on matched employer-employee data from Denmark. Consistent with the theory, we find considerable evidence of higher wages and wage growth in large and/or foreign-owned firms. These effects survive controlling for individual...... characteristics, but, as expected, are reduced significantly when controlling for unobservable firm heterogeneity. Furthermore, acquired skills in foreign-owned and large firms appear to be transferable to both subsequent wage work and self-employment...

  2. Correlation of bone mineral density with biochemical markers in different menopausal statuses of Pakistani women

    International Nuclear Information System (INIS)

    Maqsood, A.; Nadia, N.; Farzana, A.; Bashir, A.

    2005-01-01

    Aim: The present study is aimed to use bone mineral density (BMD) and various biochemical markers to predict the fracture risk at different menopausal statuses in Pakistani women. Method: Seventy women aged between 28-80 years at various menopausal statuses participated in this study. BMD (T score) of right calcaneus was determined using SAHARA ultrasound bone densitometer that measures the transmission of high frequency from heel. Various biochemical markers such as alkaline phosphates, calcium and inorganic phosphorus were measured from the serum of venous blood using standard kits of Randox. Results: Alkaline phosphates was raised in per menopausal, postmenopausal and postmenopausal with hysterectomy and ligation groups of women as compared to premenopausal women but did not achieve significance (P>0.05). Serum calcium level was significantly lower in postmenopausal women than premenopausal women and inorganic phosphorus decrease significantly when compared with premenopausal and postmenopausal with ligation and hysterectomy. BMD (T score) values of postmenopausal osteopenic and postmenopausal osteoprotic women were significantly lower than those of premenopausal women. BMD values of women under study have negative correlation with age, alkaline phosphates and calcium. Conclusion: Our study conclude that in addition to BMD, serum levels of alkaline phosphate, calcium and inorganic phosphorus can be valuable biochemical markers in predicting bone fracture risk at different menopausal states. (author)

  3. Toxic metals distribution in different components of Pakistani and imported cigarettes by electrothermal atomic absorption spectrometer

    International Nuclear Information System (INIS)

    Kazi, T.G.; Jalbani, N.; Arain, M.B.; Jamali, M.K.; Afridi, H.I.; Sarfraz, R.A.; Shah, A.Q.

    2009-01-01

    It was extensively investigated that a significant flux of toxic metals, along with other toxins, reaches the lungs through smoking. In present study toxic metals (TMs) (Al, Cd, Ni and Pb) were determined in different components of Pakistani local branded and imported cigarettes, including filler tobacco (FT), filter (before and after normal smoking by a single volunteer) and ash by electrothermal atomic absorption spectrometer (ETAAS). Microwave-assisted digestion method was employed. The validity and accuracy of methodology were checked by using certified sample of Virginia tobacco leaves (ICHTJ-cta-VTL-2). The percentages (%) of TMs in different components of cigarette were calculated with respect to their total contents in FT of all branded cigarettes before smoking, while smoke concentration has been calculated by subtracting the filter and ash contents from the filler tobacco content of each branded cigarette. The highest percentage (%) of Al was observed in ash of all cigarettes, with range 97.3-99.0%, while in the case of Cd, a reverse behaviour was observed, as a range of 15.0-31.3% of total contents were left in the ash of all branded cigarettes understudy

  4. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  5. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  6. Construct validation of emotional labor scale for a sample of Pakistani corporate employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-02-01

    To translate, adapt and validate emotional labour scale for Pakistani corporate employees. This study was conducted in locale of Rawalpindi and Islamabad from October 2014 to December 2015, and comprised customer service employees of commercial banks and telecommunication companies. It comprised of two independent parts. Part one had two steps. Step one involved translation and adaptation of the instrument. In the second step psychometric properties of the translated scale were established by administering it to customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of emotional labour. Part two comprised the main study. Commercial bank employees were included in the sample by using convenient sampling technique. SPSS 20 was used for data analysis. There were 145 participants in the first study and 495 in the second study . Exploratory factor analysis initially generated three-factor model of emotional labour which was further confirmed by confirmatory factor analysis suggesting that emotional labour had three distinct dimensions, i.e. surface acting, deep acting and genuine expressions of emotions. The emotional labour scale was found to be a valid and reliable measure.

  7. Concept of Best Practices in English Language Teaching to Pakistani ELT Fraternity

    Directory of Open Access Journals (Sweden)

    Muhammad Arif Soomro

    2016-08-01

    Full Text Available Teaching industry of English as a second or foreign language has grown massively in recent times in Pakistan. There are many public sectors universities and English academies established all over Pakistan offering English language proficiency courses. Therefore, this wave led to conduct this research. The purpose of conducting this study was to investigate contemporary pedagogical techniques used for teaching and learning English and to introduce the concept of ESL /EFL Best Practices for effective language teaching in Pakistan. Purposive Sampling method was used to collect the information from respondents regarding their contemporary-used teaching techniques in ESL/EFL class. The questionnaire was implied as the main tool for data collection among twenty English language teachers from two public sector universities. The results of the study indicated that teachers were attached  with some outdated techniques and activities secondly, they also faced problems applying new techniques while teaching in a large multilevel classrooms, thirdly, teachers’ had willingness to adopt and employ innovative techniques in classrooms and lastly, the notion of ESL best practices was uncommon among them. Most of the teaching strategies do not create better learning environment, and learners do not interestingly participate due outdated activities. Therefore, the suggested solution was utilizing best practices that are based on modern techniques, approaches considerable for multiple levels depending upon the needs and developmental state of the individual learners. Keywords: pedagogical strategies, ESL/EFL Best Practices, Pakistani teachers, English teaching/learning

  8. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  9. Assessment of dietary intake of trace elements through Pakistani integrated diets

    International Nuclear Information System (INIS)

    Qureshi, I.H.; Mannan, A.; Waheed, S.; Rehman, S.; Ahmad, S.

    1994-01-01

    A research study related to the determination and assessment of essential and potentially toxic trace elements in Pakistani integrated diets was undertaken at PINSTECH from 1986-90 under the International Atomic Energy Agency (IAEA) Co-ordinated Research Programme (CRP). During this period eight different integrated human diets of the residents of the Islamabad and Gujranwala were prepared by taking into consideration their respective food habits in summer and winter seasons. Instrumental as well as radiochemical neutron activation analyses in combination with the atomic absorption spectrometry were utilized for the precise and accurate determination of up to 23 elements in the diet samples. This work has helped us obtain the base line values for studying trace elements nutrition, inadequacy, imbalances and toxicity. Further, this would help, in future, to monitor the degree of contamination from foreign chemicals. The weekly dietary intake values were calculated which showed that our foods contain fairly adequate quantity of essential trace elements. The diet samples analyzed showed no contamination level to an extent to cause an adverse impact on human health. (author). 23 refs, 5 figs, 21 tabs

  10. Research Output of the Pakistani Library and Information Science Authors: A Bibliometric Evaluation of Their Impact

    Directory of Open Access Journals (Sweden)

    Anwar, Mumtaz Ali

    2017-06-01

    Full Text Available This paper uses 601 cited papers of Pakistani LIS researchers with the purpose to examine the individual performance of these Library and Information Science (LIS researchers in terms of their research output and its impact on the LIS (national/international literature by using various bibliometric indicators. A list of 139 authors was compiled with the help of the Library, Information Science, and Technology Abstracts (LISTA and some other sources. Data were collected from Google Scholar and SPSS version 20 was utilized in order to identify the relationship between self-citations and various performance indices of the authors. The average citations received per paper vary from 1.80 to 10.08. About half of the papers were single-authored whereas less than one-fifth were by three or more authors. The authors who worked in collaboration produced more papers and received more citations. The h-index, g-index, hI-index, hI-norm, and e-index were used to determine the rank for each author. The intra-group citations grid revealed the volume of self-citations and a small group who cite each other more due to close academic and social relationships. The correlations between self-citations and the impact indices used revealed significant differences. Findings are useful for concerned institutions regarding award, promotions, etc. Further, future research should seriously consider the self-citations and social networking of authors while examining their citations-based research performance.

  11. Pakistani Immigrant Children and Adults in Denmark Have Severely Low Vitamin D Status

    DEFF Research Database (Denmark)

    Andersen, Rikke; Mølgaard, C.; Skovgaard, L. T.

    2008-01-01

    association with S-25OHD for men (P = 0.04) and women (P = 0.0008). Twenty-one per cent of the women and 34% of the men had osteopenia. Neither S-25OHD nor S-iPTH was associated with lumbar spine or whole body bone mineral content. Conclusions: Severely low vitamin D status and elevated S-iPTH is common among......, Copenhagen (55 degrees N), January- November. Serum 25-hydroxyvitamin D (S-25OHD), serum intact parathyroid hormone (S-iPTH), bone turnover markers and whole body and lumbar spine bone mineral density were measured. Sun, smoking and clothing habits, age, body mass index (BMI), and vitamin D and calcium from......Objective: To determine vitamin D and bone status in adolescent girls, pre-menopausal women and men of Pakistani origin, to single out determinants of vitamin D status and to determine the association between vitamin D status, bone metabolism and bone status. Subjects/Methods: Cross-sectional study...

  12. Viral Etiologies of Acute Dehydrating Gastroenteritis in Pakistani Children: Confounding Role of Parechoviruses

    Directory of Open Access Journals (Sweden)

    Muhammad Masroor Alam

    2015-01-01

    Full Text Available Despite substantial interventions in the understanding and case management of acute gastroenteritis, diarrheal diseases are still responsible for a notable amount of childhood deaths. Although the rotavirus is known to cause a considerable burden of pediatric diarrheal cases, the roles of other viruses remain undefined for the Pakistani population. This study was based on tertiary care hospital surveillance, from January 2009 to December 2010, including the detection of rotavirus, norovirus, astrovirus, and human parechovirus in children under the age of five using serological or molecular assays. Rotavirus, human parechovirus, norovirus, and astrovirus were detected in 66%, 21%, 19.5%, and 8.5% subjects, respectively. Human parechovirus genotypes, determined through analysis of VP1 gene sequences, showed a great diversity among co-circulating strains. Eighty percent of hospitalized children had dual or multiple viral infections, while 98% parechovirus positive cases were co-infected with rotavirus. The remarkable diversity of viruses associated with the childhood diarrhea in Pakistan calls for large-scale epidemiological surveys, coupled with case control studies, to ascertain their role in clinical manifestations. In addition, these findings also highlight the need for the implementation of up-to-date health interventions, such as the inclusion of a rotavirus vaccine in routine immunization programs for the improvement of quality in child health care.

  13. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  14. Validation of a Food Frequency Questionnaire for Assessing Macronutrient and Calcium Intake in Adult Pakistani Population

    International Nuclear Information System (INIS)

    Iqbal, R.; Bano, G.; Dar, F. J.; Khan, A. H.; Bilgirami, M.

    2014-01-01

    Objective: To develop and validate a food frequency table (FFQ) for use in urban Pakistani population. Study Design: A validation study. Place and Duration of Study: The Aga Khan University, Karachi, from June to November 2008. Methodology: Healthy adult females, aged A 18 years who consented to be included in the study were inducted, while males, unhealthy females, aged below 18 years or who did not consent were excluded. The FFQ was administered once while 4, 24 hours recalls spread over a period of one year were administered as the reference method. Daily intakes for energy, protein, fat, and calcium intake were estimated for both the tools. Crude and energy adjusted correlations for nutrient intakes were computed for the FFQ and mean of 4, 24 hours recalls and serum N-telopeptide of type-I collagen (NTx). Results: The correlation coefficients for the FFQ with mean of 4, 24 hours recall ranged from 0.21 for protein to 0.36 for calcium, while the correlation for nutrient estimates from the FFQ with NTx ranged from -0.07 for calcium to 0.01 for energy. Conclusion: Highly significant correlations were found for nutrient intakes estimated from the FFQ vs. those estimated from the mean of 4, 24 hours recalls but no correlations was found between nutrient estimates from the FFQ and serum NTx levels. FFQ was concluded to be a valid tool for assessing dietary intake of adult females in Pakistan. (author)

  15. Experience of dietary advice among Pakistani-born persons with type 2 diabetes in Oslo.

    Science.gov (United States)

    Fagerli, Rønnaug Aa; Lien, Marianne E; Wandel, Margareta

    2005-12-01

    Experience and implementation of dietary advice are influenced by various factors including ethnic, cultural and religious background. The aim is to explore how ethnic minority persons with diabetes experience dietary advice given by Norwegian health-workers, which strategies they have in response to the advice and how they explain their actions. In-depth interviews were performed with 15 Pakistani-born persons with type 2 diabetes living in Oslo. The analyses are based on the principles of Giorgi's interpretation of phenomenology. The participants expressed great concern to follow the advice. However, narratives about constraints were numerous. These concerned different life-situational factors, but more importantly they were related to communication problems arising from discontinuities between universalising medical knowledge and lay knowledge, as well as between different types of culturally defined lay knowledge. As a consequence, advice was generally experienced as inadequately based on the participant's food-cultural background, leaving the person with diabetes to do the translation between different levels of knowledge. In general health-workers would benefit from expanding their knowledge of the many positive aspects of their patients' cultural background, and apply their knowledge thereafter, whether it concerns (food)-culture or the impact of religion in everyday life.

  16. Lenses on metacognition: Teachers’ perceptions toward strategies in reading in a Pakistani context

    Directory of Open Access Journals (Sweden)

    Channa, Mansoor A.

    2017-03-01

    Full Text Available The research in the field of metacognition for developing reading is not new; metacognition has been used for many years to identify ways to develop students’ reading comprehension. Most previous research has addressed either primary or secondary level students. However, notably few studies have been conducted at the undergraduate level. This study has attempted to initiate strategies to assist first-year engineering students in developing their reading abilities within a Pakistani context. The primary objective of this research was to identify what strategies first-year engineering students use in developing their reading at Quaid-e-Awam University of engineering science and technology in Pakistan. This study used qualitative instruments that included semi-structured interviews with teachers and classroom observations during read-aloud sessions. The data were organized through NVivo version 8 for obtaining nodes, codes, and main themes for interpreting the results. The results of this study demonstrated that teachers should use metacognitive strategies for developing students’ reading abilities. Findings also revealed that reading strategies, such as text scanning, guesses from contextual clues, drawing on prior knowledge, and using a dictionary, are the most important strategies to use for developing the reading skills and comprehension of engineering students. This study has suggested metacognitive strategies be used for promoting students’ reading abilities and that teachers should design and develop more courses using these strategies to enhance the reading and listening skills of engineering students.

  17. Depressive disorder and social stress in Pakistan compared to people of Pakistani origin in the UK.

    Science.gov (United States)

    Husain, Nusrat; Chaudhry, Nasim; Tomenson, Barbara; Jackson, Judy; Gater, Richard; Creed, Francis

    2011-11-01

    Depressive disorder is more common in low to middle than high-income countries, but the reasons for this have not been explicitly defined. We compared the results of two population-based studies of people of Pakistani origin: one living in rural Pakistan and one in UK. Both samples were screened with the self-reporting questionnaire followed by research interview to determine depressive disorders and social stress. Logistic regression was used to compare the prevalence of depressive disorder in the two countries after adjustment for socio-demographic characteristics and social stress. The estimated prevalence of depression for men was 35.8% (95% CI 16.1-55.5) in Pakistan and 9% (5.0-13.0) in Manchester (pstress (both sexes). 35% of women in Pakistan and 71% of those in UK had received 8 years or more of education. Extremely poor housing and marked poverty were experienced by 36.1% of women in Pakistan and 0.6% of those in Manchester. In Pakistan, housing and poverty predominated as correlates of depression, whereas in Manchester it was marked difficulties in physical health and close relationships. The results suggest that the higher rate of depressive disorder amongst women in Pakistan compared to UK can be attributed to less education and frequent severe social difficulties. These differences have implications for treatment.

  18. Attitudes towards euthanasia and physician-assisted suicide among Pakistani and Indian doctors: A survey

    Directory of Open Access Journals (Sweden)

    Syed Qamar Abbas

    2008-01-01

    Full Text Available Aim: This study attempts to assess the attitude of Pakistani and Indian doctors to euthanasia and physician-assisted suicide. Methods: We used a questionnaire survey that included one case history of a patient with cancer and another of one suffering from motor neurone disease (MND. Results: Fifty-two of 100 doctors from Pakistan returned the completed questionnaires. Eight of the 52 (15.3% doctors agreed with the concept of euthanasia being an acceptable option for the patient with MND. Six of the 52 (11.5% supported a similar approach for the cancer patient. From India, 60/100 doctors returned the completed questionnaires. Sixteen of the 60 (26.6% doctors supported euthanasia as an option for the patient with MND whereas 15 (25% supported a similar option for the cancer patient. Conclusion: We conclude that only a minority of the doctors support euthanasia. This group belongs to a younger age group. In Pakistan, they were more likely to be males. The religion of the doctors did not appear to be a determining factor.

  19. Characterizing bread wheat genotypes of Pakistani origin for grain zinc biofortification potential.

    Science.gov (United States)

    Rehman, Abdul; Farooq, Muhammad; Nawaz, Ahmad; Al-Sadi, Abdullah M; Al-Hashmi, Khalid S; Nadeem, Faisal; Ullah, Aman

    2018-03-15

    Zinc (Zn) is essential for all life forms and its deficiency is a major issue of malnutrition in humans. This study was carried out to characterize 28 wheat genotypes of Pakistani origin for grain zinc biofortification potential, genetic diversity and relatedness. There was low genetic differentiation among the tested genotypes. However, they differed greatly in yield-related traits, grain mineral (Zn, calcium (Ca) and protein) concentrations and Zn bioavailability. Zinc application increased the concentration of Zn in wheat grain (32.1%), embryo (19.8%), aleurone (47%) and endosperm (23.7%), with an increase in bioavailable Zn (22.2%) and a reduction in phytate concentration (6.8%). Application of Zn also enhanced grain protein and Ca concentrations. Among wheat genotypes, Blue Silver had the highest concentration of Zn in grain, embryo, aleurone and endosperm, with high bioavailable Zn, while Kohinoor-83 had low phytate concentration. Wheat genotypes of Pakistan are genetically less diverse owing to continuous focus on the development of high-yielding varieties only. Therefore genetically diverse wheat genotypes with high endospermic Zn concentration and better grain yield should be used in breeding programs approaches, aiming at improving Zn bioavailability. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  20. Prevalence and risk factors of helicobacter pylori infection among Pakistani population

    International Nuclear Information System (INIS)

    Rasheed, F.; Ahmad, T.; Bilal, B.

    2012-01-01

    Objective: Prevalence of H. pylori infection is higher in developing countries including Pakistan. The basic purpose of this study was to investigate the prevalence of H. pylori infection and determination of possible risk factors. Methodology: A prospective epidemiologic survey of H. pylori infection was accomplished in 2008 and 2009 involving 516 asymptomatic individuals of Barakaho, Islamabad, Pakistan. Data 13 were obtained by questionnaire and H. pylori positivity was checked by C UBT. Results: A total of 516 individuals participated in the study of which 384 (74.4%) were positive for H. pylori infection. The prevalence was 73.5% in males and 75.4% in females (p = 0.622) and increased with increasing age (p < 0.001). Presence of household animals (p = 0.004) and more family members (p H. pylori prevalence while no association was seen with other risk factors such as education level, drinking water source, number of rooms in house and monthly family income. Conclusions: High prevalence of H. pylori infection in Pakistani population is comparable to the data of developing countries. H. pylori household animals and more family member. (author)

  1. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    Science.gov (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  2. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    International Nuclear Information System (INIS)

    Bhatti, S.M.; Dhakam, S.; Khan, M.A.

    2009-01-01

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P 100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  3. Understanding traditional African healing

    OpenAIRE

    MOKGOBI, M.G.

    2014-01-01

    Traditional African healing has been in existence for many centuries yet many people still seem not to understand how it relates to God and religion/spirituality. Some people seem to believe that traditional healers worship the ancestors and not God. It is therefore the aim of this paper to clarify this relationship by discussing a chain of communication between the worshipers and the Almighty God. Other aspects of traditional healing namely types of traditional healers, training of tradition...

  4. Vitamin A content of traditional leafy vegetables consumed by the Luo people of western Kenya

    DEFF Research Database (Denmark)

    Orech, Francis O.; Jensen, Søren Krogh; Friis, H.

    2011-01-01

    and analyse traditional, leafy vegetables for pro-vitamin A carotenoids and tocopherols. A total of 15 domesticated and 36 wild traditional leafy vegetable species were collected and analysed. The species that contained the highest amounts of -carotene, lutein and -tocopherol was Erythrococca bongensis Pax (5.......3, 60.7 and 220.7 mg/kg DM, respectively). The results showed that wild plant species generally contained higher levels of pro-vitamin A carotenoids than the domesticated vegetable species and varieties. The study concluded that traditional, leafy vegetables (domesticated and wild) have the potential...

  5. Exploring Asian Indian and Pakistani views about cancer and participation in cancer genetics research: toward the development of a community genetics intervention.

    Science.gov (United States)

    Leader, Amy E; Mohanty, Salini; Selvan, Preethi; Lum, Ray; Giri, Veda N

    2018-01-01

    Cancer is a leading cause of mortality among the three million Asian Indian/Pakistanis (AIPs) in the USA. AIPs have traditionally been underrepresented in cancer-related research, although reasons remain largely unexplored. We sought to understand AIP's awareness and perceptions of cancer to improve their participation in risk assessment and cancer genetics research. Four focus groups, stratified by gender and birthplace (US-born vs. foreign-born), were held at an AIP cultural center. Discussions focused on knowledge and awareness of cancer risk; how AIP culture influences cancer perceptions; access to health care services for cancer screening, diagnosis, or treatment; and willingness to or experiences with participating in cancer genetics research. Sessions were audio-recorded, transcribed verbatim, and content analyzed using NVivo ® 11 for dominant themes. Thirty-two AIP adults participated in a focus group. Information on family cancer history is challenging to obtain due to the desire for privacy, cancer stigma, and loss of medical records. Interest in genetic testing for cancer risk was mixed: some were in favor of knowing their personal risk, yet many noted that future generations in their family would benefit more by knowing their risk. Participants felt that the AIP community has largely been overlooked in recruitment efforts for research studies. Recommendations for improving recruitment efforts included partnering with community events and festivities, posting culturally and linguistically relevant recruitment materials, and focusing on population-wide health improvement. Understanding the culture and perceptions of AIPs, separate from Asian Americans at large, will allow for more tailored approaches for including this population in cancer genetics research.

  6. [Healthcare aspects of domestic abuse].

    Science.gov (United States)

    Kórász, Krisztián

    2015-03-08

    The paper reviews the forms of domestic abuse, its causes, prevalence and possible consequences. British and Hungarian Law, guidelines and the roles and responsibilities of healthcare professionals in relation to dealing with domestic abuse in their practice is also addressed within the paper.

  7. Domestic violence screening in pregnancy.

    Science.gov (United States)

    Bunn, Mikiko Yazawa; Higa, Nicole A; Parker, Willie J; Kaneshiro, Bliss

    2009-11-01

    Domestic violence is an important health concern that has been shown to have adverse effects on maternal and neonatal outcomes. The objectives of this study were to compare the prevalence of prenatal screening for domestic violence in a hospital-based resident clinic setting with screening practices in private obstetric offices in Honolulu, Hawai'i and to explore physician attitudes towards domestic violence screening during pregnancy. A retrospective chart review was conducted at Queen's Medical Center in Honolulu, Hawai'i in women who delivered between 2003 and 2004. A 6 item written survey was also given to all attending and resident physicians with obstetric privileges. Descriptive statistics including frequency measures were generated and chi square tests were used to compare categorical variables. A total of 270 charts were reviewed. There was a statistically significant difference (p obstetric practices (39.3 percent) that were screened for domestic violence. While the majority of respondents (77.6%) to the domestic violence survey were aware that the American College of Obstetricians and Gynecologists recommends domestic violence screening in pregnancy most respondents (69.0 percent) indicated that they "never or rarely" screened their patients for domestic violence. Despite professional recommendations and an awareness of these recommendations, between 2003 and 2004, routine prenatal screening for domestic violence was markedly lacking for patients in this study population.

  8. Domestic Violence as Everyday Terrorism

    DEFF Research Database (Denmark)

    Cooper-Cunningham, Dean

    2016-01-01

    Seeing bride kidnapping and domestic violence as everyday terrorism unpacks the political nature of so-called “private” phenomena and how they reify patriarchal society.......Seeing bride kidnapping and domestic violence as everyday terrorism unpacks the political nature of so-called “private” phenomena and how they reify patriarchal society....

  9. Domestic Politics and Nuclear Proliferation

    International Nuclear Information System (INIS)

    Kim, Chul Min; Yim, Man Sung

    2016-01-01

    The external security threat is known as the most important factor of nuclear weapons program, the domestic politics situation can also affect the nuclear proliferation decision of a country. For example, when a leader wants nuclear weapons as an ultimate weapon, the domestic politics situation can determine the effectiveness of the weapons program of a country. This study analyzes the current knowledge of the relationship between domestic politics and nuclear proliferation and suggests the main challenges of the quantitative models trying to calculate nuclear proliferation risk of countries. The domestic politics status is one of the most important indicators of nuclear program. However, some variables have never been used in quantitative analyses; for example, number of veto players and the public opinion on nuclear weapons; despite they are considered to be important in various qualitative studies. Future studies should focus on how should they be coded and how can they be linked with existing domestic politics variables

  10. Domestic Politics and Nuclear Proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chul Min; Yim, Man Sung [KAIST, Daejeon (Korea, Republic of)

    2016-05-15

    The external security threat is known as the most important factor of nuclear weapons program, the domestic politics situation can also affect the nuclear proliferation decision of a country. For example, when a leader wants nuclear weapons as an ultimate weapon, the domestic politics situation can determine the effectiveness of the weapons program of a country. This study analyzes the current knowledge of the relationship between domestic politics and nuclear proliferation and suggests the main challenges of the quantitative models trying to calculate nuclear proliferation risk of countries. The domestic politics status is one of the most important indicators of nuclear program. However, some variables have never been used in quantitative analyses; for example, number of veto players and the public opinion on nuclear weapons; despite they are considered to be important in various qualitative studies. Future studies should focus on how should they be coded and how can they be linked with existing domestic politics variables.

  11. Understanding traditional African healing.

    Science.gov (United States)

    Mokgobi, M G

    2014-09-01

    Traditional African healing has been in existence for many centuries yet many people still seem not to understand how it relates to God and religion/spirituality. Some people seem to believe that traditional healers worship the ancestors and not God. It is therefore the aim of this paper to clarify this relationship by discussing a chain of communication between the worshipers and the Almighty God. Other aspects of traditional healing namely types of traditional healers, training of traditional healers as well as the role of traditional healers in their communities are discussed. In conclusion, the services of traditional healers go far beyond the uses of herbs for physical illnesses. Traditional healers serve many roles which include but not limited to custodians of the traditional African religion and customs, educators about culture, counselors, social workers and psychologists.

  12. Breast cancer histology and receptor status characterization in Asian Indian and Pakistani women in the U.S. - a SEER analysis

    International Nuclear Information System (INIS)

    Kakarala, Madhuri; Rozek, Laura; Cote, Michele; Liyanage, Samadhi; Brenner, Dean E

    2010-01-01

    Recent reports suggest increase in estrogen receptor (ER), progesterone receptor (PR) negative breast cancer yet little is known about histology or receptor status of breast cancer in Indian/Pakistani women.in the U.S. We examined the United States National Cancer Institute's Surveillance Epidemiology and End Results (SEER) Cancer program to assess: a) frequency of breast cancer by age, b) histologic subtypes, c) receptor status of breast cancer and, d) survival in Indians/Pakistanis compared to Caucasians. There were 360,933 breast cancer cases diagnosed 1988-2006. Chi-Square analyses and Cox proportional hazards models, to estimate relative risks for breast cancer mortality after adjusting for confounders, were performed using Statistical Analysis Software 9.2. Among Asian Indian/Pakistani breast cancer patients, 16.2% were < 40 yrs. old compared to 6.23% in Caucasians (p < 0.0001). Asian Indian women had more invasive ductal carcinoma (69.1 vs. 65.7%, p < 0.0001), inflammatory cancer (1.4% vs. 0.8, p < 0.0001) and less invasive lobular carcinoma (4.2% vs. 8.1%, p < 0.0001) than Caucasians. Asian Indian/Pakistani women had more ER/PR negative breast cancer (30.6% vs. 21.8%, p = 0.0095) than Caucasians. Adjusting for stage at diagnosis, age, tumor grade, nodal status, and histology, Asian Indian/Pakistani women's survival was similar to Caucasians, while African Americans' was worse. Asian Indian/Pakistani women have higher frequency of breast cancer (particularly in age < 40), ER/PR negative invasive ductal and inflammatory cancer than Caucasians

  13. Behaviour Of Saline Irrigation Water Components In Pakistani Barley And Calcareous Soil Under Scheduling Irrigation Using Neutron Scattering Technique

    International Nuclear Information System (INIS)

    RIZK, M.A.

    2010-01-01

    This study aims to investigate the behaviour of cation uptake by Pakistani barley (genotype PK-30163) as affected by saline irrigation water, as well as cation distribution within the soil profile. This experiment was carried out at Soil and Water Research Department, Nuclear Research Centre, Atomic Energy Authority, Inshas, Egypt. The soil was transferred from Wadi Sudr (South Sinai, Egypt). It is salted affected soil (calcareous soil, EC = 4.3 dS/m) and was irrigated using ground water irrigation (12.5 dS/m). Nine used lysimeters were irrigated with three artificial saline water (0.3, 4 and 8 dS/m) using drip irrigation system. The irrigation schedule was carried out using neutron scattering technique according to the hydro physical properties of the soil. Pakistani barley (halophytic plant) was used to remove salts from the soil especially sodium cations. The cation uptake and cation distribution (Na, K, Ca, Mg) within the soil profile were studied.The data indicated that roots of barley collected within 0-15 cm layer showed high cation uptake that made the salt concentrations in this layer low. Sodium uptake ratio was 43, 37 and 47% from total cation uptake by using fresh water (0.3 dS/m), 4 and 8 dS/m, respectively. The maximum uptake for Na, K, Ca and Mg was 20.51, 19.13, 3.98 and 12.81 g/lys at 5.69, 3.05, 6.56 and 4.15 dS/m, respectively. It was found that Pakistani barley preferred Mg uptake rather than Ca uptake.

  14. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey.

    Science.gov (United States)

    Mir, Mohammed Umer; Khan, Imran; Ahmed, Bilal; Abdul Razzak, Junaid

    2012-02-27

    A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law enforcement.

  15. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study.

    Science.gov (United States)

    Gele, Abdi A; Qureshi, Samera A; Kour, Prabhjot; Kumar, Bernadette; Diaz, Esperanza

    2017-01-01

    Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali) women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women's participation in cervical cancer screening: 1) in-person communication and information material at health centers; 2) verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3) the initiation of better recall through SMS and letters written in native languages. Finally, an intervention study that compares the aforementioned strategies and proves their effectiveness in increasing immigrant women's participation in cervical cancer screening is recommended.

  16. The midwife-woman relationship in a South Wales community: Experiences of midwives and migrant Pakistani women in early pregnancy.

    Science.gov (United States)

    Goodwin, Laura; Hunter, Billie; Jones, Aled

    2018-02-01

    In 2015, 27.5% of births in England and Wales were to mothers born outside of the UK. Compared to their White British peers, minority ethnic and migrant women are at a significantly higher risk of maternal and perinatal mortality, along with lower maternity care satisfaction. Existing literature highlights the importance of midwife-woman relationships in care satisfaction and pregnancy outcomes; however, little research has explored midwife-woman relationships for migrant and minority ethnic women in the UK. A focused ethnography was conducted in South Wales, UK, including semi-structured interviews with 9 migrant Pakistani participants and 11 practising midwives, fieldwork in the local migrant Pakistani community and local maternity services, observations of antenatal appointments, and reviews of relevant media. Thematic data analysis was undertaken concurrently with data collection. The midwife-woman relationship was important for participants' experiences of care. Numerous social and ecological factors influenced this relationship, including family relationships, culture and religion, differing health-care systems, authoritative knowledge and communication of information. Marked differences were seen between midwives and women in the perceived importance of these factors. Findings provide new theoretical insights into the complex factors contributing to the health-care expectations of pregnant migrant Pakistani women in the UK. These findings may be used to create meaningful dialogue between women and midwives, encourage women's involvement in decisions about their health care and facilitate future midwifery education and research. Conclusions are relevant to a broad international audience, as achieving better outcomes for migrant and ethnic minority communities is of global concern. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  17. Alcohol and marijuana use while driving--an unexpected crash risk in Pakistani commercial drivers: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Mir Mohammed

    2012-02-01

    Full Text Available Abstract Background A significant proportion of road traffic crashes are attributable to alcohol and marijuana use while driving globally. Sale and use of both substances is illegal in Pakistan and is not considered a threat for road traffic injuries. However literature hints that this may not be the case. We did this study to assess usage of alcohol and marijuana in Pakistani commercial drivers. Methods A sample of 857 commercial bus and truck drivers was interviewed in October 2008 at the largest commercial vehicle station in Rawalpindi and Islamabad, Pakistan. Time location cluster sampling was used to select the subjects and a structured questionnaire was used to assess the basic demographic profile, substance abuse habits of the drivers while on the road, and reasons for usage of illicit substances while driving were recorded. Self reported information was collected after obtaining informed consent. Chi square and fisher exact tests were used to assess differences between groups and logistic regression was used to identify significant associations between driver characteristics and alcohol and marijuana use. Results Almost 10% of truck drivers use alcohol while driving on Pakistani roads. Marijuana use is almost 30% in some groups. Statistically different patterns of usage are seen between population subgroups based on age, ethnicity, education, and marital status. Regression analysis shows association of alcohol and marijuana use with road rage and error behaviours, and also with an increased risk of being involved in road crashes. The reported reasons for using alcohol or marijuana show a general lack of awareness of the hazardous nature of this practice among the commercial driver population. Conclusion Alcohol and marijuana use is highly prevalent in Pakistani commercial drivers. The issue needs to be recognized by concerned authorities and methods such as random breath tests and sobriety check points need to be employed for proper law

  18. Dietary education must fit into everyday life: a qualitative study of people with a Pakistani background and type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Hempler NF

    2015-02-01

    Full Text Available Nana F Hempler,1 Sara Nicic,1 Bettina Ewers,2 Ingrid Willaing1 1Health Promotion Research, Steno Diabetes Center, Gentofte, Denmark; 2Nutrition and Food Services Department, Steno Diabetes Center, Gentofte, Denmark Background: The high prevalence of diabetes among South Asian populations in European countries partially derives from unhealthy changes in dietary patterns. Limited studies address perspectives of South Asian populations with respect to utility of diabetes education in everyday life. This study explores perspectives on dietary diabetes education and healthy food choices of people living in Denmark who have a Pakistani background and type 2 diabetes. Methods: In-depth interviews were conducted between October 2012 and December 2013 with 12 participants with type 2 diabetes who had received dietary diabetes education. Data analysis was systematic and was based on grounded theory principles. Results: Participants described the process of integrating and utilizing dietary education in everyday life as challenging. Perceived barriers of the integration and utilization included a lack of a connection between the content of the education and life conditions, a lack of support from their social networks for dietary change, difficulty integrating the education into everyday life, and failure to include the participants’ taste preferences in the educational setting. Conclusion: Dietary education that is sensitive to the attitudes, wishes, and preferences of the participants and that aims at establishing a connection to the everyday life of the participants might facilitate successful changes in dietary practices among people with a Pakistani background and type 2 diabetes. The findings suggest that more focus should be placed on collaborative processes in the dietary educational setting in order to achieve appropriate education and to improve communication between this population and health care professionals. Keywords: dietary diabetes

  19. Height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children

    Directory of Open Access Journals (Sweden)

    Mushtaq Muhammad Umair

    2012-03-01

    Full Text Available Abstract Background Child growth is internationally recognized as an important indicator of nutritional status and health in populations. This study was aimed to compare age- and gender-specific height, weight and BMI percentiles and nutritional status relative to the international growth references among Pakistani school-aged children. Methods A population-based study was conducted with a multistage cluster sample of 1860 children aged five to twelve years in Lahore, Pakistan. Smoothed height, weight and BMI percentile curves were obtained and comparison was made with the World Health Organization 2007 (WHO and United States' Centers for Disease Control and Prevention 2000 (USCDC references. Over- and under-nutrition were defined according to the WHO and USCDC references, and the International Obesity Task Force (IOTF cut-offs. Simple descriptive statistics were used and statistical significance was considered at P Results Height, weight and BMI percentiles increased with age among both boys and girls, and both had approximately the same height and a lower weight and BMI as compared to the WHO and USCDC references. Mean differences from zero for height-, weight- and BMI-for-age z score values relative to the WHO and USCDC references were significant (P Conclusion Pakistani school-aged children significantly differed from the WHO and USCDC references. However, z score means relative to the WHO reference were closer to zero and the present study as compared to the USCDC reference. Overweight and obesity were significantly higher while underweight and thinness/wasting were significantly lower relative to the WHO reference as compared to the USCDC reference and the IOTF cut-offs. New growth charts for Pakistani children based on a nationally representative sample should be developed. Nevertheless, shifting to use of the 2007 WHO child growth reference might have important implications for child health programs and primary care pediatric clinics.

  20. Domestic uranium exploration activities

    International Nuclear Information System (INIS)

    Chenoweth, W.L.

    1980-01-01

    Uranium exploration in the United States reached its alltime high in 1978 when the chief exploration indicator, surface drilling, totaled 47 million feet. In 1979, however, total drilling declined to 41 million feet, and during the first 8 months of 1980 the trend continued, as surface drilling was 27% less than for the same period in 1979. The total drilling for 1980 now is expected to be below 30 million feet, far less than the 39.4 million feet planned by industry at the beginning of the year. Falling uranium prices, the uncertainties of future uranium demand, rising costs, and the possibility of stiff foreign competition are the prime causes for the current reduction in domestic uranium exploration. Uranium exploration in the United States continues to be concentrated in the vicinity of major producing areas such as the San Juan Basin, Wyoming Basins, Texas Coastal Plain, Paradox Basin, and northeastern Washington, and in areas of recent discoveries including the Henry Mountains, Utah, the McDermitt caldera in Nevada and Oregon, and central Colorado. The distributions, by location, of total surface drilling for 1979 and the first half of 1980 are presented

  1. Barriers and facilitators to cervical cancer screening among Pakistani and Somali immigrant women in Oslo: a qualitative study

    Directory of Open Access Journals (Sweden)

    Gele AA

    2017-07-01

    Full Text Available Abdi A Gele,1,2 Samera A Qureshi,1 Prabhjot Kour,1 Bernadette Kumar,1 Esperanza Diaz1,3 1Norwegian Center for Minority Health Research, 2Department of Health, Institute of Nursing and Health Promotion, Oslo and Akershus University College, Oslo; 3Department of Global Public Health and Primary Care, University of Bergen, Bergen, Norway Abstract: Norway has a low incidence and mortality rate of cervical cancer, which is mainly due to the high participation rate of women in cervical cancer screening. However, the attendance of cervical cancer screening was reported to be low among immigrant women. For this reason, we conducted a qualitative study to obtain better insight into perceived barriers and challenges to cervical cancer screening among Somali and Pakistani women in the Oslo region. A convenient sample of 35 (18 Pakistani, 17 Somali women were recruited for the study in collaboration with Somali and Pakistani community partners. Focus group discussions were used to explore barriers and facilitators to cervical cancer screening, whereas the Ecological Model was used as the framework for the study. The study found three levels of barriers to cervical cancer screening. The individual level included a lack of understanding of the benefits of the screening. The sociocultural level included the stigma attached to the disease and the belief that women who are unmarried are sexually inactive. The system-related level included a lack of trust toward the health care system. Based on the study results, and using a common denominator approach for the immigrant groups included, the study recommends three communication strategies with the potential to improve women’s participation in cervical cancer screening: 1 in-person communication and information material at health centers; 2 verbal communication with women through seminars and workshops to educate them about their risk of cancer and the importance of screening and 3 the initiation of better recall

  2. [Systematic economic assessment and quality evaluation for traditional Chinese medicines].

    Science.gov (United States)

    Sun, Xiao; Guo, Li-ping; Shang, Hong-cai; Ren, Ming; Lei, Xiang

    2015-05-01

    To learn about the economic studies on traditional Chinese medicines in domestic literatures, in order to analyze the current economic assessment of traditional Chinese medicines and explore the existing problems. Efforts were made to search CNKI, VIP, Wanfang database and CBM by computer and include all literatures about economic assessment of traditional Chinese medicines published on professional domestic journals in the systematic assessment and quality evaluation. Finally, 50 articles were included in the study, and the systematic assessment and quality evaluation were made for them in terms of titles, year, authors' identity, expense source, disease type, study perspective, study design type, study target, study target source, time limit, cost calculation, effect indicator, analytical technique and sensitivity analysis. The finally quality score was 0.74, which is very low. The results of the study showed insufficient studies on economics of traditional Chinese medicines, short study duration and simple evaluation methods, which will be solved through unremitting efforts in the future.

  3. Estimated percentage of typhoid fever in adult pakistani population (TAP) study

    International Nuclear Information System (INIS)

    Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S.

    2013-01-01

    Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

  4. Estimated percentage of typhoid fever in adult pakistani population (TAP) study

    Energy Technology Data Exchange (ETDEWEB)

    Mehboob, F.; Arshad, A.; Firdous, S.; Ahmed, S.; Rehma, S. [Mayo Hospital, Lahore (Pakistan). Dept. of Medicine

    2013-01-15

    Typhoid fever is a serious infection with high morbidity and mortality in untreated cases. It is one of the very common infections in developing countries due to various factors involving hygiene and sanitation. Objective: To determine the estimated percentage of typhoid fever in Pakistani population and to find the commonly prescribed antibiotics for the disease. Material and Methods: This cross sectional study was conducted on 1036 patients, selected from forty five general practitioner clinics, between June to October 2010. Patients of > 18 years of age with > 3 days history of fever (> 100 degree F) and high index of suspicion for typhoid fever were tested for typhoid fever using Typhidot kits and positive cases were recruited for monitoring response to treatment. The febrile patients with clear cut history of urinary or respiratory infect-ion, hypovolemic shock or hepatobiliary disease were excluded and not tested by typhidot kit. The antibiotics prescribed to study population by various general practitioners were noted. Data was analysed on SPSS. Results were expressed in percentages and proportions. Results: Total 1036 patients were recruited. Typhoidot test was negative in 63.9% and positive in 36.1% patients with highest percentages of positive cases in Karachi, Rawalpindi and Hyderabad. The maximum number of cases were reported in summer season especially from June to August. Most of the patients were between ages of 19 - 39 years. The commonest anti-biotics prescribed were Ofloxacin, Ciprofloxacin and Levofloxacin. Conclusion: Typhoid fever is very common infection in Pakistan caused by Salmonella typhi which is transmitted among humans through faecooral route. Disease can be controlled not only by antibiotics like fluoroquinolones but by patient education, improvement in hygiene and sanitation, safe supply of clean drinking water and prophylactic vaccination as well. However, timely diagnosis and appropriate management with proper antibiotics is the key

  5. Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya.

    Science.gov (United States)

    Adnan, Muhammad; Hölscher, Dirk

    2012-12-01

    Diversity of Medicinal Plants among Different Forest-use Types of the Pakistani Himalaya Medicinal plants collected in Himalayan forests play a vital role in the livelihoods of regional rural societies and are also increasingly recognized at the international level. However, these forests are being heavily transformed by logging. Here we ask how forest transformation influences the diversity and composition of medicinal plants in northwestern Pakistan, where we studied old-growth forests, forests degraded by logging, and regrowth forests. First, an approximate map indicating these forest types was established and then 15 study plots per forest type were randomly selected. We found a total of 59 medicinal plant species consisting of herbs and ferns, most of which occurred in the old-growth forest. Species number was lowest in forest degraded by logging and intermediate in regrowth forest. The most valuable economic species, including six Himalayan endemics, occurred almost exclusively in old-growth forest. Species composition and abundance of forest degraded by logging differed markedly from that of old-growth forest, while regrowth forest was more similar to old-growth forest. The density of medicinal plants positively correlated with tree canopy cover in old-growth forest and negatively in degraded forest, which indicates that species adapted to open conditions dominate in logged forest. Thus, old-growth forests are important as refuge for vulnerable endemics. Forest degraded by logging has the lowest diversity of relatively common medicinal plants. Forest regrowth may foster the reappearance of certain medicinal species valuable to local livelihoods and as such promote acceptance of forest expansion and medicinal plants conservation in the region. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s12231-012-9213-4) contains supplementary material, which is available to authorized users.

  6. Evidence based workplace interventions to promote breastfeeding practices among Pakistani working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina

    2013-03-01

    Breastfeeding is an essential source of nutrition for young babies; however, it is challenging for employed mothers to continue breastfeeding with employment, especially if workplace support is minimal or missing. In Pakistan, from 1983 to 2008, the prevalence of breastfeeding at 6 months has decreased from 96% to 31%. In this region, workplace barriers have been reported as one of the reasons that result in early cessation of breastfeeding among working mothers. This paper aims at reviewing global literature to explore workplace interventions that can promote the breastfeeding practices among working mothers in Pakistan. A literature search of peer reviewed databases, including CINHAL (1980-2009), MEDLINE (1980-2009), Pub Med (1980-2009), Springer Link (1980-2008), and Cochrane Database of Systematic Reviews (3rd quarter, 2008), was undertaken. Considering the pre-set inclusion and exclusion criteria, out of more than 500 literature sources, 50 were shortlisted and reviewed. A review of global literature revealed that in order to promote breastfeeding practices among employed mothers, the most powerful workplace interventions include: educating working mothers about management of breastfeeding with employment; enhancing employers' awareness about benefits of breastfeeding accommodation at workplace; arranging physical facilities for lactating mothers (including privacy, childcare facilities, breast pumps, and breast milk storage facilities); providing job-flexibility to working mothers; and initiating mother friendly policies at workplace that support breastfeeding. In Pakistani workplace settings, where little attention is paid to sustain breastfeeding practices among working mothers, there is a need to initiate lactation support programmes. These programmes can be made effective by implementing composite interventions at the level of breastfeeding working mothers, employers, and workplace. Copyright © 2012 Australian College of Midwives. Published by Elsevier

  7. A case - control study of risk factors for coronary artery disease in Pakistani females

    International Nuclear Information System (INIS)

    Nazeer, M.; Naveed, T.; Ullah, A.

    2010-01-01

    Objectives: To establish the strength of association of conventional risk factors for coronary artery disease in native Pakistani females. Methods: We conducted a case - control hospital based study on 198 females (age 30 - 80 years) scheduled for their first coronary angiography at Punjab Institute of Cardiology, Lahore. Patients were divided into pre-menopausal group (age: 45.1 +- 6.3) and post-menopausal group (62.1 +- 9.1). For each risk factor, patients with significant CAD (= 50% luminal diameter stenosis) were regarded as cases an those without significant CAD were taken as controls. Odds Ratios (OR) and their 95% confidence intervals (CI) were calculated by univariate analysis. Results: In total study cohort, Diabetes mellitus (OR 3.65 95% CI 2.0 - 6.5), Family history of premature coronary artery disease (OR 2.3, 95% CI 1.2 - 4.4), and increased waist circumference (OR 2.11, 95% CI 1.2 - 3.8) were strongly associated with significant CAD. In post menopausal age group, diabetes mellitus (OR 2.66 CI 1.3 - 5.1), hyperlipidaemia (OR 2.25 CI 1.2 - 2.3) and increased waist circumference (OR 2.16 CI 1.1 - 4.2) reached statistical significance. In pre-menopausal females only diabetes was strongly associated with significant coronary artery disease (OR 10 CI 2.6 - 37.4). Association of hypertension was not significant in any of subgroups studied. Very few cases of smoking (6 / 198) were found in our study to merit any further statistical analysis. Conclusions: Diabetes mellitus was the only risk factor in pre-menopausal females associated with coronary artery disease While diabetes, hyperlipidaemia and increased waist circumference were significantly associated with CAD in post menopausal females. (author)

  8. Body Dysmorphic Disorder: Gender differences and prevalence in a Pakistani medical student population

    Directory of Open Access Journals (Sweden)

    Vaqar Talha

    2008-04-01

    Full Text Available Abstract Background Body dysmorphic disorder (BDD is a psychiatric disorder characterized by a preoccupation with an imagined or slight defect which causes significant distress or impairment in functioning. Few studies have assessed gender differences in BDD in a non clinical population. Also no study assessed BDD in medical students. This study was designed to determine the point prevalence of BDD in Pakistani medical students and the gender differences in prevalence of BDD, body foci of concern and symptoms of BDD. Methods The medical students enrolled in a medical university in Karachi, Pakistan filled out a self-report questionnaire which assessed clinical features of BDD. BDD was diagnosed according to the DSM-IV criteria. Results Out of the 156 students, 57.1% were female. A total of 78.8% of the students reported dissatisfaction with some aspect of their appearance and 5.8% met the DSM-IV criteria for BDD. The male to female ratio for BDD was 1.7. Regarding gender differences in body foci of concern, the top three reported foci of concern in male students were head hair (34.3%, being fat (32.8%, skin (14.9% and nose(14.9%, whereas in females they were being fat (40.4%, skin (24.7% and teeth (18%. Females were significantly more concerned about being fat (p = 0.005. Male students were significantly more concerned about being thin (p = 0.01 and about head hair (p = 0.012. Conclusion BDD is fairly common in our medical student population, with a higher prevalence in males. Important gender differences in BDD symptomatology and reported body foci of concern were identified which reflected the influence of media on body image perception. The impact of cultural factors on the prevalence as well as gender differences in BDD symptomatology was also established.

  9. Nucleic acid amplification test for detection of west nile virus infection in pakistani blood donors

    International Nuclear Information System (INIS)

    Niazi, S.K.; Alam, M.

    2017-01-01

    Background: The study was planned to determine the presence of West Nile Virus (WNV) infection in Pakistani blood donors, using Nucleic Acid Amplification Test (NAT). Methods: The blood donors for study were selected on the basis of the standard questionnaire and routine screening results. Six donors were pooled using an automated pipettor and NAT for WNV was performed on Roche Cobas s 201 NAT system. The reactive pools were resolved in Individual Donation-NAT (ID-NAT) format and a sample from FFP bags of reactive donations was retrieved. NAT was again performed on retrieved plasma bag (RPB) sample to confirm the reactive donations. The donors were also recalled and interviewed about history of illness related to recent WNV infection. Results: After serological screening of 1929 donors during the study period, 1860 donors were selected for NAT test for WNV detection. The mean age of the donors was 28±8.77 (range: 18–57 years). 1847 (99.3%) donors were male and 13 (0.7%) were female. NAT for WNV identified six initially reactive pools (0.32%). On follow-up testing with RPB samples, 4 donors (0.21%) were found confirmed reactive for WNV RNA (NAT yield of 1 in 465 blood donors). Conclusion: WNV is a threat to safety of blood products in Pakistan. A screening strategy can be implemented after a large-scale study and financial considerations. One of the reduced cost screening strategies is seasonal screening of blood donors for WNV, with pooling of samples. (author)

  10. Postoperative pain assessment using four behavioral scales in Pakistani children undergoing elective surgery

    Directory of Open Access Journals (Sweden)

    Faisal Shamim

    2015-01-01

    Full Text Available Background: Several measurement tools have been used for assessment of postoperative pain in pediatric patients. Self-report methods have limitations in younger children and parent, nurse or physician assessment can be used as a surrogate measure. These tools should be tested in different cultures as pain can be influenced by sociocultural factors. The objective was to assess the inter-rater agreement on four different behavioral pain assessment scales in our local population. Materials and Methods: This prospective, descriptive, observational study was conducted in Pakistan. American Society of Anesthesiologists I and II children, 3-7 years of age, undergoing elective surgery were enrolled. Four pain assessment scales were used, Children′s Hospital of Eastern Ontario Pain Scale (CHEOPS, Toddler Preschool Postoperative Pain Scale (TPPPS, objective pain scale (OPS, and Face, Legs, Activity, Cry, Consolability (FLACC. After 15 and 60 min of arrival in the postanesthesia care unit (PACU, each child evaluated his/her postoperative pain by self-reporting and was also independently assessed by the PACU nurse, PACU anesthetist and the parent. The sensitivity and specificity of the responses of the four pain assessment scales were compared to the response of the child. Results: At 15 min, sensitivity and specificity were >60% for doctors and nurses on FLACC, OPS, and CHEOPS scales and for FLACC and CHEOPS scale for the parents. Parents showed poor agreement on OPS and TPPS. At 60 min, sensitivity was poor on the OPS scale by all three observers. Nurses showed a lower specificity on FLACC tool. Parents had poor specificity on CHEOPS and rate of false negatives was high with TPPS. Conclusions: We recommend the use of FLACC scale for assessment by parents, nurses, and doctors in Pakistani children aged between 3 and 7.

  11. Perceived Stress, Sources and Severity of Stress among medical undergraduates in a Pakistani Medical School

    Directory of Open Access Journals (Sweden)

    Malik Samina

    2010-01-01

    Full Text Available Abstract Background Recently there is a growing concern about stress during undergraduate medical training. However, studies about the same are lacking from Pakistani medical schools. The objectives of our study were to assess perceived stress, sources of stress and their severity and to assess the determinants of stressed cases. Methods A cross-sectional, questionnaire-based survey was carried out among undergraduate medical students of CMH Lahore Medical College, Pakistan during January to March 2009. Perceived stress was assessed using the perceived stress scale. A 33-item questionnaire was used to assess sources of stress and their severity. Results The overall response rate was 80.5% (161 out of 200 students. The overall mean perceived stress was 30.84 (SD = 7.01 and was significantly higher among female students. By logistic regression analysis, stressed cases were associated with occurrence of psychosocial (OR 5.01, 95% CI 2.44-10.29 and academic related stressors (OR 3.17 95% CI 1.52-6.68. The most common sources of stress were related to academic and psychosocial concerns. 'High parental expectations', 'frequency of examinations', 'vastness of academic curriculum', 'sleeping difficulties', 'worrying about the future', 'loneliness', 'becoming a doctor', 'performance in periodic examinations' were the most frequently and severely occurring sources of stress. There was a negative but insignificant correlation between perceived stress and academic performance (r = -0.099, p > 0.05. Conclusion A higher level of perceived stress was reported by the students. The main stressors were related to academic and psychosocial domains. Further studies are required to test the association between stressed cases and gender, academic stressors and psychosocial stressors.

  12. Genetic analysis of fructose-1,6-bisphosphatase (FBPase) deficiency in nine consanguineous Pakistani families.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Ramzan, Khushnooda; Bhinder, Munir Ahmad; Shakeel, Hussain; Iqbal, Muhammad; Aslam, Asim; Shehzad, Wasim; Cheema, Huma Arshad; Rehman, Habib

    2017-10-26

    Fructose-1,6-bisphosphatase (FBPase) deficiency is a rare inherited metabolic disorder characterized by recurrent episodes of hypoglycemia, ketosis and lactic acidosis. FBPase is encoded by FBP1 gene and catalyzes the hydrolysis of fructose-1,6-bisphosphate to fructose-6-phosphate in the last step of gluconeogenesis. We report here FBP1 mutations in nine consanguineous Pakistani families affected with FBPase deficiency. Nine families having one or two individuals affected with FBPase deficiency were enrolled over a period of 3 years. All FBP1 exonic regions including splicing sites were PCR-amplified and sequenced bidirectionally. Familial cosegregation of mutations with disease was confirmed by direct sequencing and PCR-RFLP analysis. Three different FBP1 mutations were identified. Each of two previously reported mutations (c.472C>T (p.Arg158Trp) and c.841G>A (p.Glu281Lys)) was carried by four different families. The ninth family carried a novel 4-bp deletion (c.609_612delAAAA), which is predicted to result in frameshift (p.Lys204Argfs*72) and loss of FBPase function. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. FBPase deficiency is often fatal in the infancy and early childhood. Early diagnosis and prompt treatment is therefore crucial to preventing early mortality. We recommend the use of c.472C>T and c.841G>A mutations as first choice genetic markers for molecular diagnosis of FBPase deficiency in Pakistan.

  13. Direct sequencing of FAH gene in Pakistani tyrosinemia type 1 families reveals a novel mutation.

    Science.gov (United States)

    Ijaz, Sadaqat; Zahoor, Muhammad Yasir; Imran, Muhammad; Afzal, Sibtain; Bhinder, Munir A; Ullah, Ihsan; Cheema, Huma Arshad; Ramzan, Khushnooda; Shehzad, Wasim

    2016-03-01

    Hereditary tyrosinemia type 1 (HT1) is a rare inborn error of tyrosine catabolism with a worldwide prevalence of one out of 100,000 live births. HT1 is clinically characterized by hepatic and renal dysfunction resulting from the deficiency of fumarylacetoacetate hydrolase (FAH) enzyme, caused by recessive mutations in the FAH gene. We present here the first report on identification of FAH mutations in HT1 patients from Pakistan with a novel one. Three Pakistani families, each having one child affected with HT1, were enrolled over a period of 1.5 years. Two of the affected children had died as they were presented late with acute form. All regions of the FAH gene spanning exons and splicing sites were amplified by polymerase chain reaction (PCR) and mutation analysis was carried out by direct sequencing. Results of sequencing were confirmed by restriction fragment length polymorphism (PCR-RFLP) analysis. Three different FAH mutations, one in each family, were found to co-segregate with the disease phenotype. Two of these FAH mutations have been known (c.192G>T and c.1062+5G>A [IVS12+5G>A]), while c.67T>C (p.Ser23Pro) was a novel mutation. The novel variant was not detected in any of 120 chromosomes from normal ethnically matched individuals. Most of the HT1 patients die before they present to hospitals in Pakistan, as is indicated by enrollment of only three families in 1.5 years. Most of those with late clinical presentation do not survive due to delayed diagnosis followed by untimely treatment. This tragic condition advocates the establishment of expanded newborn screening program for HT1 within Pakistan.

  14. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  15. Relationship of thyroid-stimulating hormone with metabolic syndrome in a sample of euthyroid Pakistani population

    International Nuclear Information System (INIS)

    Saleem, M.S.; Khan, K.A.

    2011-01-01

    Metabolic Syndrome is a group of factors that predispose to cardiovascular diseases. The prevalence of metabolic syndrome is rising rapidly. Recently, a few studies have suggested that lower thyroid function in the reference range may be associated with metabolic syndrome, but the issue remains unsettled. We aimed to elucidate the relationship between thyroid function and components of metabolic syndrome in a sample of euthyroid Pakistani population. Methods: This analytical, cross-sectional study was conducted at the Department of Physiology, University of Health Sciences, Lahore, Pakistan, and extended over a period of 12 months. It included 100 subjects with metabolic syndrome in the study group and thirty subjects without metabolic syndrome in the control group with age ranging 45-55 years. Both groups had normal thyroid function. After a detailed history and clinical examination, fasting blood was analysed for glucose, triglycerides, high density lipoprotein-cholesterol along with thyroid-stimulating hormone (TSH) and free thyroxine. Results: Serum TSH was significantly higher in study group than in control group (p=0.040). Serum free thyroxine values of study group were slightly but not significantly lower than those of control group. Serum TSH correlated significantly and positively with serum triglycerides in all subjects and with waist circumference and diastolic blood pressure in men. Serum TSH showed a positive and linear relationship with the number of components of metabolic syndrome (p=0.016) in all subjects. Conclusion: High-normal TSH is associated with metabolic syndrome and its components. There may be increased risk of cardiovascular diseases with high-normal TSH levels. (author)

  16. Public stigma associated with mental illnesses in Pakistani university students: a cross sectional survey

    Science.gov (United States)

    Zubair, Muhammad; Ghulam, Hamzah; Wajih Ullah, Muhammad; Zubair Tariq, Muhammad

    2014-01-01

    Background. The objectives of the study were to explore the knowledge and attitudes of Pakistani university students toward mental illnesses. People with mental illnesses are challenged not only by their symptoms but also by the prejudices associated with their illness. Acknowledging the stigma of mental illness should be the first essential step toward devising an appropriate treatment plan. Methods. A cross-sectional survey was conducted at the University of Punjab, Lahore, CMH Lahore Medical and Dental College, Lahore, and University of Sargodha, Sub-campus Lahore, from February to May 2014. The self-administered questionnaire consisted of three sections: demographics, general knowledge of psychiatric illnesses, and Community Attitudes towards Mental Illnesses (CAMI) Scale. The questionnaire was distributed to 650 participants enrolled in different disciplines (Social Sciences, Medicine and Formal Sciences). Results. Response rate was 81% (527/650 respondents). Mean age was 20.98 years. Most of the students (331, 62.8%) had an urban background and studied Social Sciences (238, 45.2%). Four hundred and eighteen respondents (79.3%) considered religion very important and most respondents considered psychiatrists (334, 63.4%) and spiritual leaders (72, 13.7%) to be best able to treat mental illnesses. One hundred and sixty nine respondents (32.1%) considered black magic to be a cause of mental illness. Only 215 (41%) respondents had ever read an article on mental illnesses. Multiple regression analysis revealed study discipline, exposure, perceived causes of mental illnesses and superstitions to be significantly associated with attitudes towards mental illnesses (p supernatural explanations for mental illnesses but only a few believed that spiritual leaders can play a role in treatment. PMID:25548734

  17. Trends of lipid abnormalities in Pakistani type-2 diabetes mellitus patients: a tertiary care centre data

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, S M; Dhakam, S; Khan, M.A., E-mail: drsehran@yahoo.co

    2009-10-15

    Objective: To ascertain trends of lipid abnormalities in Pakistani Type-2 Diabetes Mellitus patients. Methodology: Fasting lipid profiles of 328 outpatient adult type 2 diabetes mellitus patients visiting the Aga Khan University Hospital, from January 2005 to January 2006 were prospectively reviewed and abstracted on a pre-specified proforma. Demographic features, different patterns of dyslipidemia in accordance with specified risk categories, and the proportion of patients with none, one, two, or three lipid values outside clinical targets were noted. The influence of sex on dyslipidemia pattern was also assessed Results: Our patients had higher average HbA1c levels and higher total cholesterol, LDL and lower HDL levels. The triglycerides levels in our female patients were higher. The percentage of our patients with a high-, borderline-, or low-risk LDL cholesterol were 54, 29, and 16%, respectively (P = 0.51). On a percentage basis, 73% were in the high-risk HDL cholesterol group, 18% were in the borderline-risk group and 9% in the low-risk group, respectively (P< 0.0001). Regarding triglyceride concentrations, 16% had high-risk triglyceride levels, 34% were in the borderline-risk category, whereas 50% had a low-risk triglyceride levels (P< 0.0001). Patient proportion with None, One, Two, or Three Values outside clinical targets on percentage basis were 2, 16, 48, and 34%, respectively (P< 0.0001). Women were found to have greater odds of having LDL cholesterol above the target level i.e. >100mg/dl. Conclusion: Combination of high LDL and a low HDL cholesterol level was the commonest pattern of dyslipidemia found. Second was unfavorable levels of all three lipoproteins combined and the third was an isolated increase in LDL cholesterol. A greater proportion of women were found dyslipidemic. (author)

  18. Blueprint for domestic uranium enrichment

    International Nuclear Information System (INIS)

    1981-01-01

    The AEC advisory committee on domestic production of uranium enrichment has studied for more than a year how to achieve the domestic enrichment of uranium by the construction and operation of a commercial enriching plant using centrifugal separation method, and the report was submitted to the Atomic Energy Commission on August 18, 1980. Japan has depended wholly on overseas services for her uranium enrichment needs, but the development of domestic enrichment has been carried on in parallel. The AEC decided to construct a uranium enrichment pilot plant using centrifuges, and it has been forwarded as a national project. The plant is operated by the Power Reactor and Nuclear Fuel Development Corp. since 1979. The capacity of the plant will be raised to approximately 75 ton SWU a year. The centrifuges already operated have provided the first delivery of fuel of about 1 ton for the ATR ''Fugen''. The demand-supply balance of uranium enrichment service, the significance of the domestic enrichment of uranium, the evaluation of uranium enrichment technology, the target for domestic enrichment plan, the measures to promote domestic uranium enrichment, and the promotion of the construction of a demonstration plant are reported. (Kako, I.)

  19. Food perceptions in terms of health among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-10-01

    To explore food perceptions in terms of health among Pakistani immigrant women, and if such perceptions could be altered through a culturally adapted intervention. The study is a culturally adapted lifestyle intervention aiming at reducing diabetes risk among Pakistani women, Oslo, Norway. There were 198 participants (25-62 years) recruited through a multi-recruitment strategy and randomly assigned into intervention and control groups. Data were collected through interviews with the help of a structured questionnaire with open-ended questions. Baseline data showed that many women emphasised vegetables (87%) and fish (52%) as important in a healthy diet, and perceived that the consumption of sugar (66%), oil (60%) and hard fat (39%) should be limited. After intervention, there was an increased proportion of women in the intervention group who perceived that consumption of sugar (p = 0.021) and white flour (p = 0.010) should be limited, in line with the emphasis of the intervention. Food perceptions in terms of health were generally in line with public dietary advice, however, with large variation among the women. A culturally adapted intervention had the potential to alter such perceptions.

  20. Perceptions of risk factors for diabetes among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Råberg Kjøllesdal, Marte K; Hjellset, Victoria T; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2011-06-01

    To explore perceptions of diabetes risk factors among Pakistani immigrant women, as part of their explanatory model of the disease, and the changes in these perceptions after a culturally adapted intervention. Intervention study, carried out in Oslo, Norway, comprising 198 women. At baseline, about 75% of the women perceived sugar to be a risk factor for diabetes, about 30% mentioned physical inactivity and stress and close to 20% mentioned overweight. Twelve per cent could not identify any risk factors. When asked about foods to include in a diet to prevent diabetes, vegetables were mentioned by 45%, while 33% did not know any foods to include. Among those attending ≥60% of the educational sessions, the proportions mentioning little physical activity (pfood to include was reduced to 10% (p=0.004). Except for little physical activity, similar changes in responses were not registered in the control group. There is a need for improved knowledge about diabetes prevention among Pakistani immigrant women, and a culturally adapted intervention may contribute to this.

  1. Molecular analysis of lipoid proteinosis: identification of a novel nonsense mutation in the ECM1 gene in a Pakistani family

    Directory of Open Access Journals (Sweden)

    Naeem Muhammad

    2011-07-01

    Full Text Available Abstract Lipoid proteinosis is a rare autosomal recessive disease characterized by cutaneous and mucosal lesions and hoarseness appearing in early childhood that is caused by homozygous or compound heterozygous mutations in the ECM1 gene located on chromosome 1q21. The aim of the study was to investigate the molecular genetic defect underlying lipoid proteinosis in a consanguineous Pakistani family. Methods Genotyping of seven members of the family was performed by amplifying microsatellite markers, tightly linked to the ECM1 gene. To screen for mutations in the ECM1 gene, all of its exons and splice junctions were PCR amplified from genomic DNA and analyzed by SSCP and sequenced directly in an ABI 3130 genetic analyzer. Results The results revealed linkage of the LP family to the ECM1 locus. Sequence analysis of the coding exons and splice junctions of the ECM1 gene revealed a novel homozygous mutation (c.616C > T in exon 6, predicted to replace glutamine with stop codon (p.Q206X at amino acid position 206. Conclusions The finding of a novel mutation in Pakistani family extends the body of evidence that supports the importance of ECM1 gene for the development of lipoid proteinosis.

  2. Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

    Energy Technology Data Exchange (ETDEWEB)

    Kamal, N.

    1999-01-01

    The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

  3. Domestic parking estimation using remotely sensed data

    Science.gov (United States)

    Ramzi, Ahmed

    2012-10-01

    Parking is an integral part of the traffic system everywhere. Provision of parking facilities to meet peak of demands parking in cities of millions is always a real challenge for traffic and transport experts. Parking demand is a function of population and car ownership which is obtained from traffic statistics. Parking supply in an area is the number of legal parking stalls available in that area. The traditional treatment of the parking studies utilizes data collected either directly from on street counting and inquiries or indirectly from local and national traffic censuses. Both methods consume time, efforts, and funds. Alternatively, it is reasonable to make use of the eventually available data based on remotely sensed data which might be flown for other purposes. The objective of this work is to develop a new approach based on utilization of integration of remotely sensed data, field measurements, censuses and traffic records of the studied area for studying domestic parking problems in residential areas especially in informal areas. Expected outcomes from the research project establish a methodology to manage the issue and to find the reasons caused the shortage in domestics and the solutions to overcome this problems.

  4. RODOS - The domestic counterpart

    International Nuclear Information System (INIS)

    Vamanu, Dan V.

    1999-01-01

    One term of reference for validly teaming up with Project RODOS (Real-Time-On-Line Decision Support System for Nuclear Emergencies in Europe) is to institutionally - contribute research initiatives geared towards emulating the RODOS functions on novel conceptual pathways, expand system's coverage of issues that are relevant in a nuclear crisis management and bring in a domestic perspective on how the system may best perform in each and every national - i.e. legal, managerial, logistic and cultural environment. On this line, one reviews the approach taken in the IFIN-HH RODOS Group to address the challenge, as well a number of representative outputs. These include: i) A phase-one, pre-RODOS, period (1990 - 1994), involving topical field orientation, feasibility demonstrations and expertise acquisition by hands-on training in environmental radiology modeling and DSS code development, the resulting products - codes in the 'APUD' and 'ACA-IFA' family, including custom versions developed by appointment of the IAEA Safety Section and AECL-Research, Ontario, Canada - being favourably reviewed by the NEA/OECD Data Bank; ii) A phase-two, upgrading and consolidation period (1994 -1996), assisted by the IAEA fellowship system and the US Government via the Nuclear Regulatory Commission in Washington, D.C, having on record an effective participation in the development of the US NRC, EPA, and DOE's 'FRMAC Assessment Manual - The Federal manual for Assessing Environmental Data during a Radiological Emergency', and the 'RTM-95 International Technical Response Manual', and the research initiative of developing a software support for the manuals' implementation - the codes 'ROBOT' (Rule-Oriented Basic Operational Tool); iii) A phase-three period (1996 - ), evolving within the RODOS framework and featuring, inter alia: (a) the application of the ROBOT concept in the development of a standalone software platform, code-named NOTEPAD for DSS support in field operations, nuclear accident

  5. Research of factors of marketing pricing at domestic industrial enterprises

    OpenAIRE

    V.V. Bozhkova; I.M. Ryabchenko

    2013-01-01

    The aim of the article. The purpose of the article is research and systematization of factors of marketing pricing, which affect on realization of products of industrial enterprises.Works of domestic and foreign scientists on this issue were analysed. Traditionally pricing factors are classified into two groups: internal (controlled) and external (uncontrolled). Such division of factors is the first stage of pricing system analysis. On the second stage of analysis each of these groups is divi...

  6. Parenting and Infant Temperament amongst Pakistani Women Living in the UK According to Country of Birth: Results from the Born in Bradford Cohort Study

    Science.gov (United States)

    Prady, Stephanie L.; Kiernan, Kathleen; Fairley, Lesley; Wright, John

    2013-01-01

    Some parenting behaviours and child characteristics can result in future behavioural problems. Relatively little is known about parenting behaviours in Pakistani-origin women, and how the timing of migration to the United Kingdom might affect such behaviours. We analysed differences in parenting behaviours and six-month infant temperament by…

  7. Is Pakistani Equity Market Integrated to the Equity Markets of Group of Eight (G8 Countries? An Empirical Analysis of Karachi Stock Exchange

    Directory of Open Access Journals (Sweden)

    Syed Muhammad Aamir Shah

    2012-09-01

    Full Text Available This study looks at the dynamic relationship between the Pakistani equity market and equity markets of Group of Eight countries (G8 which includes Canada, France, Germany, Italy, Japan, Russia, UK and USA by using weekly time series data starting from June 2004 to May 2009. Multivariate Co-integration approach by Johnson and Julius (1990 shows there exists no long-term relationship between the G8 and Pakistani equity market. Vector error correction (VECM model suggests that 100% of the lag periods disequilibrium has been corrected in the current period. Pairwise Granger Causality test shows that there exist a unidirectional causality between the equity market of Pakistan and the markets of France, Germany, Italy, Japan and United Kingdom. Impulse response analysis and variance decomposition analysis reveal that most of the shocks in Pakistani equity market are due to its own innovation and behave like exogenous. However, the markets of France, Japan, Germany and United Kingdom are exerting a little pressure on Pakistani equity markets. Therefore, by investing in Karachi Stock Exchange (KSE the fund manager of G8 countries especially Canada, Italy, Russia and USA is capable of getting the advantage of portfolio diversification.

  8. A complex microcephaly syndrome in a Pakistani family associated with a novel missense mutation in RBBP8 and a heterozygous deletion in NRXN1

    NARCIS (Netherlands)

    Agha, Z.; Iqbal, Z.; Azam, M.; Siddique, M.; Willemsen, M.H.; Kleefstra, T.; Zweier, C.; Leeuw, N. de; Qamar, R.; Bokhoven, H. van

    2014-01-01

    We report on a consanguineous Pakistani family with a severe congenital microcephaly syndrome resembling the Seckel syndrome and Jawad syndrome. The affected individuals in this family were born to consanguineous parents of whom the mother presented with mild intellectual disability (ID), epilepsy

  9. The association of glutathione S-transferase GSTT1 and GSTM1 gene polymorphism with pseudoexfoliative glaucoma in a Pakistani population.

    NARCIS (Netherlands)

    Khan, M.I.; Micheal, S.; Akhtar, F.; Ahmed, W.; Ijaz, B.; Ahmed, A.; Qamar, R.

    2010-01-01

    PURPOSE: The aim of the present study was to investigate the association of glutathione S-transferase GSTT1 and GSTM1 genotypes with pseudoexfoliative glaucoma (PEXG) in a group of Pakistani patients. METHODS: Multiplex polymerase chain reaction was used to study the GSTT1 and GSTM1 polymorphisms in

  10. Professorial Views of the Use of Diversity Experiences to Develop Students' Critical Thinking Skills in the Pakistani College Context

    Science.gov (United States)

    Tahir, Khazima

    2017-01-01

    This study explored the interplay of diversity experiences and critical thinking of Pakistani college students and determined how the classroom experience supported and exposed students to diversity and critical thinking. The researcher conducted teachers' interviews to gather data in a college in Pakistan. Teachers were asked to respond to a…

  11. Use of smokeless tobacco among groups of Pakistani medical students – a cross sectional study

    Directory of Open Access Journals (Sweden)

    Ilyas Mahwish

    2007-09-01

    Full Text Available Abstract Background Use of smokeless tobacco is common in South Asia. Tobacco is a major preventable cause of morbidity and mortality. Doctors make one of the best avenues to influence patients' tobacco use. However, medical students addicted to tobacco are likely to retain this habit as physicians and are unlikely to counsel patients against using tobacco. With this background, this study was conducted with the objective of determining the prevalence of smokeless tobacco among Pakistani medical students. Methods A cross sectional study was carried out in three medical colleges of Pakistan – one from the north and two from the southern region. 1025 students selected by convenient sampling completed a peer reviewed, pre-tested, self-administered questionnaire. Questions were asked regarding lifetime use (at least once or twice in their life, current use (at least once is the last 30 days, and established use (more than 100 times in their life of smokeless tobacco. Chi square and logistic regression analyses were used. Results Two hundred and twenty (21.5% students had used tobacco in some form (smoked or smokeless in their lifetime. Sixty six (6.4% students were lifetime users of smokeless tobacco. Thirteen (1.3% were daily users while 18 (1.8% fulfilled the criterion for established users. Niswar was the most commonly used form of smokeless tobacco followed by paan and nass. Most naswar users belonged to NWFP while most paan users studied in Karachi. On univariate analysis, lifetime use of smokeless tobacco showed significant associations with the use of cigarettes, student gender (M > F, student residence (boarders > day scholars and location of the College (NWFP > Karachi. Multivariate analysis showed independent association of lifetime use of smokeless tobacco with concomitant cigarette smoking, student gender and location of the medical college. Conclusion The use of smokeless tobacco among medical students cannot be ignored. The

  12. Pharmacokinetic study of atorvastain after single dose administration among pakistani population

    International Nuclear Information System (INIS)

    Maqsood, I.; Najmi, M. H.; Mazhar, W.; Janjua, A.; Tayyaba, B.; Sabah, S.; Bader, Z.

    2017-01-01

    Objective: To obtain pharmacokinetic data of Orvastin, a newly launched formulation of atorvastatin, in healthy males of Pakistan. Study Design: It was quasi-experimental design. Place and Duration of Study: Study was conducted at Centre for Research in Experimental and Applied Medicine (CREAM) Army Medical College, Rawalpindi and duration of study was about ten months. Material and Methods: Twenty-four healthy male subjects were taken conveniently from Pakistani population. Two tablets of Orvastin, each containing atorvastatin 40mg, were administered orally as a single dose. Multiple blood samples were taken with small gaps in between up to the period of 48hrs. High Performance Liquid Chromatography (HPLC) with UV-detector was used for quantification of atorvastatin in plasma; wavelength of UV-detector was adjusted at 247nm. Mobile phase was made up of 60 percent acetonitrile and 40 percent 0.05M sodium phosphate buffer. Flow rate of mobile phase was maintained at 1.5ml/min with 5.5 pH. Progesterone was used as an internal standard. Stock solutions of atorvastatin were made by dissolving it into methanol and acetonitrile was used for making stock solution of progesterone. Calibration curves were made for atorvastatin and internal standard from oncentration time data, values for time to achieve maximum plasma concentration. (Tmax) and maximum plasma concentration (Cmax) were directly calculated. Computer program (APO, MW PHARM, and Ver. 3.60) was used for calculation of pharmacokinetic profile of atorvastatin. Results: Atorvastatin was detected in plasma samples of all volunteers. The absorption rate constant (Ka) was 0.41 l/hr. Cmax was 26.69 ± 6.67 µg/l and Tmax was 3.33 ± 0.41 hrs. Apparent volume of distribution (Vd), of atorvastatin, was 3244.84 ± 1237.36 liters. The elimination rate constant was 0.15 l/hr. Elimination half-life of atorvastatin was 6.14 hours. Trapezoidal rule was used for calculation of AUC /sub 0-48/ and AUC /sub 0-∞/ and it was found

  13. Selective Screening for Organic Acidurias and Amino Acidopathies in Pakistani Children

    International Nuclear Information System (INIS)

    Sherazi, N. A.; Khan, A. H.; Jafri, L.; Jamil, A.; Khan, N. A.; Afroze, B.

    2017-01-01

    (dihydropyrimidine) deficiency, GA-2, NKH (non-ketotic hyperglycinemia), AADC (aromatic amino acid decarboxylase) deficiency. Conclusion: This study presents frequency of OA and AA in the high-risk Pakistani pediatric population analyzed locally. (author)

  14. Genetic spectrum of autosomal recessive non-syndromic hearing loss in Pakistani families.

    Directory of Open Access Journals (Sweden)

    Sobia Shafique

    Full Text Available The frequency of inherited bilateral autosomal recessive non-syndromic hearing loss (ARNSHL in Pakistan is 1.6/1000 individuals. More than 50% of the families carry mutations in GJB2 while mutations in MYO15A account for about 5% of recessive deafness. In the present study a cohort of 30 ARNSHL families was initially screened for mutations in GJB2 and MYO15A. Homozygosity mapping was performed by employing whole genome single nucleotide polymorphism (SNP genotyping in the families that did not carry mutations in GJB2 or MYO15A. Mutation analysis was performed for the known ARNSHL genes present in the homozygous regions to determine the causative mutations. This allowed the identification of a causative mutation in all the 30 families including 9 novel mutations, which were identified in 9 different families (GJB2 (c.598G>A, p.Gly200Arg; MYO15A (c.9948G>A, p.Gln3316Gln; c.3866+1G>A; c.8767C>T, p.Arg2923* and c.8222T>C, p.Phe2741Ser, TMC1 (c.362+18A>G, BSND (c.97G>C, p.Val33Leu, TMPRSS3 (c.726C>G, p.Cys242Trp and MSRB3 (c.20T>G, p.Leu7Arg. Furthermore, 12 recurrent mutations were detected in 21 other families. The 21 identified mutations included 10 (48% missense changes, 4 (19% nonsense mutations, 3 (14% intronic mutations, 2 (9% splice site mutations and 2 (9% frameshift mutations. GJB2 accounted for 53% of the families, while mutations in MYO15A were the second most frequent (13% cause of ARNSHL in these 30 families. The identification of novel as well as recurrent mutations in the present study increases the spectrum of mutations in known deafness genes which could lead to the identification of novel founder mutations and population specific mutated deafness genes causative of ARNSHL. These results provide detailed genetic information that has potential diagnostic implication in the establishment of cost-efficient allele-specific analysis of frequently occurring variants in combination with other reported mutations in Pakistani populations.

  15. Multi-perpetrator domestic violence.

    Science.gov (United States)

    Salter, Michael

    2014-04-01

    A significant proportion of reports of domestic violence against women involve multiple perpetrators. Although the number of perpetrators has been consistently identified as a measure of abuse severity, only a minority of studies of domestic violence examine the role of multiple offenders. Data on multi-perpetrator domestic violence (MDV) is frequently removed from analysis in domestic violence studies, or multi-perpetrator incidents are treated as single-perpetrator incidents. However, the available research links MDV to negative mental and physical health outcomes, intimate partner homicide, homelessness among women, and severe mental illness and suicidality. This article reviews the available prevalence data on MDV and draws together research on the contexts in which MDV takes place. It highlights two groups that are particularly vulnerable to MDV: (1) girls and women partnered to members of gangs and organized crime groups and (2) girls and women in some ethnic minority communities. While discussions of honor in relation to domestic violence are often racialized in Western media, this article highlights the cross-cultural role of masculine honor in collective violence against women in the working class and impoverished communities of majority cultures as well as in migrant and ethnic minority communities. It is clear that such complex forms of violence present a range of challenges for intervention and treatment and the article emphasizes the need for specialized and coordinated modes of investigation, support, and care.

  16. Domestic Violence Among Pregnant Women.

    Science.gov (United States)

    Habib, Sadia; Abbasi, Nasreen; Khan, Bushra; Danish, Nargis; Nazir, Quratulain

    2018-01-01

    Domestic violence during pregnancy is an important social & health issue in all societies. In Muslim world and particularly underdeveloped countries, domestic violence is often under reported. It is the need of hour to encourage reporting of such events & implementation of research-based policies for prevention of women abuse & support of the victims of domestic violence (DV). The objective of this study was to highlight this neglected social problem of our society & to identify at risk population. This is a cross sectional study conducted at Ayub Teaching Hospital & Benazir Bhutto Shaheed Teaching Hospital, Abbottabad (January 2014 to December. 2016). Pregnant women were inquired regarding history of abuse by husband and sociodemographic characteristics were noted in a Performa to analyse the risk factors for domestic violence. The overall prevalence was found to be 35%. Out of 1000 pregnant women, 270 (27%) suffered from simple violence and 60 (6%) were victims of grievous assault. Violence among pregnant women is found to be more prevalent among residents of urban areas, women of older age being uneducated & belonging to poor socioeconomic status. Domestic violence during pregnancy is a common & often neglected psychosocial health problem. High risk population needs to be identified so that preventive strategies can be planned & implemented.

  17. Plant domestication slows pest evolution.

    Science.gov (United States)

    Turcotte, Martin M; Lochab, Amaneet K; Turley, Nash E; Johnson, Marc T J

    2015-09-01

    Agricultural practices such as breeding resistant varieties and pesticide use can cause rapid evolution of pest species, but it remains unknown how plant domestication itself impacts pest contemporary evolution. Using experimental evolution on a comparative phylogenetic scale, we compared the evolutionary dynamics of a globally important economic pest - the green peach aphid (Myzus persicae) - growing on 34 plant taxa, represented by 17 crop species and their wild relatives. Domestication slowed aphid evolution by 13.5%, maintained 10.4% greater aphid genotypic diversity and 5.6% higher genotypic richness. The direction of evolution (i.e. which genotypes increased in frequency) differed among independent domestication events but was correlated with specific plant traits. Individual-based simulation models suggested that domestication affects aphid evolution directly by reducing the strength of selection and indirectly by increasing aphid density and thus weakening genetic drift. Our results suggest that phenotypic changes during domestication can alter pest evolutionary dynamics. © 2015 John Wiley & Sons Ltd/CNRS.

  18. Tsu'ngyam Tradition

    DEFF Research Database (Denmark)

    Geertz, Armin W

    2007-01-01

    This contribution explores the relationships between men, women and snakes in Hopi Indian theology. Through an analysis of Snake Clan mythology and ritual, the contribution demonstrates the dynamics of the domestication of the male through initiation and marriage whereby young men gain knowledge ...... about the world, esoteric knowledge about the cosmos and social place in terms of wealth and status. Furthermore, the analysis describes an extraordinary motif which emphasizes female liminality and danger during the birthing process, marriage ritual and female lifecycle....

  19. TRADITIONAL CHINESE HERBAL MEDICINE

    NARCIS (Netherlands)

    ZHU, YP; WOERDENBAG, HJ

    1995-01-01

    Herbal medicine, acupuncture and moxibustion, and massage and the three major constituent parts of traditional Chinese medicine. Although acupuncture is well known in many Western countries, Chinese herbal medicine, the mos important part of traditional Chinese medicine, is less well known in the

  20. Traditional timber frames

    NARCIS (Netherlands)

    Jorissen, A.J.M.; Hamer, den J.; Leijten, A.J.M.; Salenikovich, A.

    2014-01-01

    Due to new possibilities traditional timber framing has become increasingly popular since the beginning of the 21e century. Although traditional timber framing has been used for centuries, the expected mechanical behaviour is not dealt with in great detail in building codes, guidelines or text

  1. Perceived Breastfeeding Support Assessment Tool (PBSAT): development and testing of psychometric properties with Pakistani urban working mothers.

    Science.gov (United States)

    Hirani, Shela Akbar Ali; Karmaliani, Rozina; Christie, Thomas; Parpio, Yasmin; Rafique, Ghazala

    2013-06-01

    breast feeding is an essential source of nutrition among young babies; however, in Pakistan a gradual decline in prevalence of breast feeding, especially among urban working mothers, has been reported. Previous studies among Pakistani urban working mothers have revealed that ensuring exclusivity and continuation of breast feeding is challenging if social and/or workplace environmental support is minimal or absent. This problem indicated a crucial need to assess availability of breast-feeding support for Pakistani urban working mothers by using a comprehensive, reliable, and validated tool in their national language (Urdu). to develop and test the psychometric properties of the 'Perceived Breastfeeding Support Assessment Tool' (PBSAT) that can gauge Pakistani urban working mothers' perceptions about breast-feeding support. this methodological research was undertaken in five phases. During phase I, a preliminary draft of the PBSAT was developed by using the Socio-ecological model, reviewing literature, and referring to two United States based tools. In Phase II, the instrument was evaluated by seven different experts, and, in Phase III, the instrument was revised, translated, and back translated. In Phase IV, the tool was pilot tested among 20 participants and then modified on the basis of statistical analysis. In Phase V, the refined instrument was tested on 200 breast-feeding working mothers recruited through purposive sampling from the government and private health-care settings in Karachi, Pakistan. Approvals were received from the Ethical Review Committees of the identified settings. the 29-item based PBSAT revealed an acceptable inter-rater reliability of 0.95, and an internal consistency reliability coefficient (Cronbach's alpha) of 0.85. A construct validity assessment through Exploratory Factor Analysis revealed that the PBSAT has two dimensions, 'workplace environmental support' (12 items; α=0.86) and 'social environmental support' (17 items; α=0.77). the

  2. Traditional medicine and genomics

    Directory of Open Access Journals (Sweden)

    Kalpana Joshi

    2010-01-01

    Full Text Available ′Omics′ developments in the form of genomics, proteomics and metabolomics have increased the impetus of traditional medicine research. Studies exploring the genomic, proteomic and metabolomic basis of human constitutional types based on Ayurveda and other systems of oriental medicine are becoming popular. Such studies remain important to developing better understanding of human variations and individual differences. Countries like India, Korea, China and Japan are investing in research on evidence-based traditional medicines and scientific validation of fundamental principles. This review provides an account of studies addressing relationships between traditional medicine and genomics.

  3. Traditional medicine and genomics.

    Science.gov (United States)

    Joshi, Kalpana; Ghodke, Yogita; Shintre, Pooja

    2010-01-01

    'Omics' developments in the form of genomics, proteomics and metabolomics have increased the impetus of traditional medicine research. Studies exploring the genomic, proteomic and metabolomic basis of human constitutional types based on Ayurveda and other systems of oriental medicine are becoming popular. Such studies remain important to developing better understanding of human variations and individual differences. Countries like India, Korea, China and Japan are investing in research on evidence-based traditional medicines and scientific validation of fundamental principles. This review provides an account of studies addressing relationships between traditional medicine and genomics.

  4. New Insights on Water Buffalo Genomic Diversity and Post-Domestication Migration Routes From Medium Density SNP Chip Data

    Directory of Open Access Journals (Sweden)

    Licia Colli

    2018-03-01

    Full Text Available The domestic water buffalo is native to the Asian continent but through historical migrations and recent importations, nowadays has a worldwide distribution. The two types of water buffalo, i.e., river and swamp, display distinct morphological and behavioral traits, different karyotypes and also have different purposes and geographical distributions. River buffaloes from Pakistan, Iran, Turkey, Egypt, Romania, Bulgaria, Italy, Mozambique, Brazil and Colombia, and swamp buffaloes from China, Thailand, Philippines, Indonesia and Brazil were genotyped with a species-specific medium-density 90K SNP panel. We estimated the levels of molecular diversity and described population structure, which revealed historical relationships between populations and migration events. Three distinct gene pools were identified in pure river as well as in pure swamp buffalo populations. Genomic admixture was seen in the Philippines and in Brazil, resulting from importations of animals for breed improvement. Our results were largely consistent with previous archeological, historical and molecular-based evidence for two independent domestication events for river- and swamp-type buffaloes, which occurred in the Indo-Pakistani region and close to the China/Indochina border, respectively. Based on a geographical analysis of the distribution of diversity, our evidence also indicated that the water buffalo spread out of the domestication centers followed two major divergent migration directions: river buffaloes migrated west from the Indian sub-continent while swamp buffaloes migrated from northern Indochina via an east-south-eastern route. These data suggest that the current distribution of water buffalo diversity has been shaped by the combined effects of multiple migration events occurred at different stages of the post-domestication history of the species.

  5. A comparison of antenatal classifications of ‘overweight’ and ‘obesity’ prevalence between white British, Indian, Pakistani and Bangladeshi pregnant women in England; analysis of retrospective data

    Directory of Open Access Journals (Sweden)

    Rebecca Garcia

    2017-04-01

    Full Text Available Abstract Background Maternal obesity increases women’s risk of poor birth outcomes, and statistics show that Pakistani and Bangladeshi women (who are born or settled in the UK experience higher rates of perinatal mortality and congenital anomalies than white British or white Other women. This study compares the prevalence of maternal obesity in Indian, Pakistani, Bangladeshi and white British women using standard and Asian-specific BMI metrics. Method Retrospective cross-sectional analysis using routinely recorded secondary data in Ciconia Maternity information System (CMiS, between 2008 and 2013. Mothers (n = 15,205 whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian. Adjusted standardised residuals and Pearson Chi-square. Main outcome measures: Percentage of mothers stratified by ethnicity (Indian, Pakistani, Bangladeshi and white British who are classified as overweight or obese using standard and revised World Health Organisation BMI thresholds. Results Compared to standard BMI thresholds, using the revised BMI threshold resulted in a higher prevalence of obesity: 22.8% of Indian and 24.3% of Bangladeshi and 32.3% of Pakistani women. Pearson Chi-square confirmed that significantly more Pakistani women were classified as ‘obese’ compared with white British, Indian or Bangladeshi women (χ 2  = 499,88 df = 9, p < 0.001. Conclusions There are differences in the prevalence of obese and overweight women stratified by maternal ethnicity of white British, Indian, Pakistani and Bangladeshi. Using revised anthropometric measures in Indian, Pakistani and Bangladeshi women has clinical implications for identifying risks associated with obesity and increased complications in pregnancy.

  6. Mineralization and volatilization of 14C-ring labelled 2,4-dichlorophenoxy acetic acid in Pakistani soils

    International Nuclear Information System (INIS)

    Hussain, Altaf; Iqbal, Zafar; Asi, Muhammad Rafique; Chaudhry, Jamil Anwar

    2001-01-01

    The mineralization and volatilization of [U-ring 14 C] 2,4-D in three Pakistani soils was investigated under laboratory conditions using 50 g of soil and uniform distribution of 1.345 μg/g of 2,4-D. Maximum losses of 14 CO 2 and volatile organic compounds occurred at day 7 and losses gradually slowed down after 21 days of incubation. The relative distribution of 14 C losses differed with soil type. Volatilization was higher in control soil as compared to test and treated soil in both the study seasons. The contribution of volatile material to the total loss in 1997 was highest in test soil (24.4%), and lowest in farm soil (19.8%) but in 1998 was highest in control soil (26%) and lowest in test and farm soils (7%) during 1998. (author)

  7. Design in Domestic Wastewater Irrigation

    NARCIS (Netherlands)

    Huibers, F.P.; Raschid-Sally, L.

    2005-01-01

    When looking at the domestic wastewater streams, from freshwater source to destination in an agricultural field, we are confronted with a complexity of issues that need careful attention. Social and economic realities arise, along with technical, biological and institutional issues. Local realities

  8. Lead poisoning in domestic ducks

    Energy Technology Data Exchange (ETDEWEB)

    Rac, R; Crisp, C S

    1954-05-01

    The death of wild ducks, due to the ingestion of lead shop, occurs frequently and is well documented. This paper discusses the death of domestic ducks due to the ingestion of lead. It describes the symptoms, and pathology of the lead poisoning of a clutch of 11 ducklings which were being raised on a farm in Australia. 3 references, 1 table.

  9. How People Domesticated Amazonian Forests

    NARCIS (Netherlands)

    Levis, C.; Flores, Bernardo; Moreira, Priscilla; Luize, Bruno G.; Alves, Rubana; Franco-Moraes, Juliano; Lins, Juliana; Konings, Evelien; Pena Claros, M.; Bongers, F.; Costa, Flavia; Clement, Charles

    2018-01-01

    For millennia, Amazonian peoples have managed forest resources, modifying the natural environment in subtle and persistent ways. Legacies of past human occupation are striking near archaeological sites, yet we still lack a clear picture of how human management practices resulted in the domestication

  10. Energy optimisation of domestic refrigerators

    DEFF Research Database (Denmark)

    Jakobsen, Arne; Rasmussen, Bjarne D.

    1998-01-01

    This paper describes the main results of a research project with the objective of reducing the energy consumption of domestic refrigerators by increasing the efficiency of the refrigeration system. The improvement of the system efficiency was to be obtained by:1) Introducing continuous operation ...

  11. The Normalization of Cannabis Use Among Bangladeshi and Pakistani Youth: A New Frontier for the Normalization Thesis?

    Science.gov (United States)

    Williams, Lisa; Ralphs, Rob; Gray, Paul

    2017-03-21

    The Asian population in Britain has grown, representing the second largest ethnic group; Bangladeshi, Pakistani, and Indian nationalities are prevalent (Jivraj, 2012 ; Office for National Statistics, 2013 ). Yet, we know relatively little about the nature and extent of their substance use. Jayakody et al. ( 2006 ) argue ethnic minority groups may be influenced by the norms and values of the dominant culture. Given recreational drug use has undergone a process of normalization in Britain (Aldridge et al., 2011 ; Parker et al., 1998 , 2002 ), we explore the degree to which this is occurring in a Bangladeshi and Pakistani community of Muslim faith in Northern England; a group typically assumed to reject substance use because of robust religious and cultural values. To examine the extent, frequency, and nature of substance use, and associated attitudes. A cross-sectional study collecting qualitative data from a sample (N = 43) of adolescents accessing a drug service and a range of professionals working with them during 2014. We also present analyses of routinely collected quantitative client data. Adolescent interviewees reported extensive personal experience smoking skunk cannabis, and professionals working in the community confirmed many young Asians smoked it. Its consumption appeared to be accommodated into the daily lives of young people and the supply of it also showed signs of acceptance. Skunk cannabis may be undergoing a process of normalization within some Asian communities in Britain. Our study has significant implications for the normalization thesis, finding evidence for normalization within a subpopulation that is typically perceived to resist this trend.

  12. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  13. Effect of domestic violence training

    Science.gov (United States)

    Zaher, Eman; Keogh, Kelly; Ratnapalan, Savithiri

    2014-01-01

    Abstract Objective To describe and evaluate the effectiveness of domestic violence education in improving physicians’ knowledge, recognition, and management of abused women. Data sources The Cochrane Database of Systematic Reviews, MEDLINE, PubMed, PsycINFO, ERIC, and EMBASE were searched for articles published between January 1, 2000, and November 1, 2012. This search was supplemented by manual searches for relevant articles using a combined text-word and MeSH-heading search strategy. Study selection Randomized controlled trials were selected that used educational interventions among physicians and provided data on the effects of the interventions. Synthesis Nine randomized controlled trials were included that described different educational approaches with various outcome measures. Three studies examined the effects of educational interventions among postgraduate trainee physicians and found an increase in knowledge but no change in behaviour with regard to identifying victims of domestic violence. Six studies examined educational interventions for practising physicians. Three of these studies used multifaceted physician training that combined education with system support interventions to change physician behaviour, such as increasing general awareness of domestic violence with brochures and posters, providing aids to remind physicians how to identify victims, facilitating physician access to victim support services, and providing audits and feedback. Multifaceted educational interventions included interactive workshops, Web-based learning, and experiential training. Another study used focus-group discussions and training, and showed improved domestic violence reporting among physicians. The remaining 2 studies showed improved perceptions of practising physicians’ self-efficacy using problem-based online learning. Conclusion It was difficult to determine the most effective educational strategy, as the educational interventions and the outcome measures varied

  14. Differences between U.S. substance abuse treatment facilities that do and do not offer domestic violence services.

    Science.gov (United States)

    Cohn, Amy; Najavits, Lisa M

    2014-04-01

    Victimization by and perpetration of domestic violence are associated with co-occurring mental and substance use disorders. This study used data from the National Survey of Substance Abuse Treatment Services to examine differences in organizational factors, treatment approaches offered, and client-level factors among 13,342 substance abuse treatment facilities by whether or not they offered domestic violence services. Only 36% of the facilities offered domestic violence services. Those that offered such services were more likely than those that did not to treat clients with co-occurring disorders. Principal-components analysis reduced eight treatment approaches to two factors: psychosocial services and traditional substance abuse services. Regression models indicated that the frequency with which psychosocial services were offered depended on the percentage of clients with co-occurring disorders who were being treated in the facility and whether or not that facility offered domestic violence services. Specifically, facilities that did not offer domestic violence services and that had a high percentage of clients with co-occurring disorders were more likely to offer psychosocial services than facilities that offered domestic violence services. A larger proportion of facilities offering domestic violence services offered traditional substance abuse treatment services, compared with facilities not offering domestic violence services, but this relationship was not contingent on the percentage of clients with co-occurring disorders at each facility. Improved efforts should be made to tailor treatments to accommodate the links between domestic violence, mental disorders, and substance abuse.

  15. Promoting smoking cessation in Pakistani and Bangladeshi men in the UK: pilot cluster randomised controlled trial of trained community outreach workers

    Directory of Open Access Journals (Sweden)

    Barton Pelham

    2011-08-01

    Full Text Available Abstract Background Smoking prevalence is high among Pakistani and Bangladeshi men in the UK, but there are few tailored smoking cessation programmes for Pakistani and Bangladeshi communities. The aim of this study was to pilot a cluster randomised controlled trial comparing the effectiveness of Pakistani and Bangladeshi smoking cessation outreach workers with standard care to improve access to and the success of English smoking cessation services. Methods A pilot cluster randomised controlled trial was conducted in Birmingham, UK. Geographical lower layer super output areas were used to identify natural communities where more than 10% of the population were of Pakistani and Bangladeshi origin. 16 agglomerations of super output areas were randomised to normal care controls vs. outreach intervention. The number of people setting quit dates using NHS services, validated abstinence from smoking at four weeks, and stated abstinence at three and six months were assessed. The impact of the intervention on choice and adherence to treatments, attendance at clinic appointments and patient satisfaction were also assessed. Results We were able to randomise geographical areas and deliver the outreach worker-based services. More Pakistani and Bangladeshi men made quit attempts with NHS services in intervention areas compared with control areas, rate ratio (RR 1.32 (95%CI: 1.03-1.69. There was a small increase in the number of 4-week abstinent smokers in intervention areas (RR 1.30, 95%CI: 0.82-2.06. The proportion of service users attending weekly appointments was lower in intervention areas than control areas. No difference was found between intervention and control areas in choice and adherence to treatments or patient satisfaction with the service. The total cost of the intervention was £124,000; an estimated cost per quality-adjusted life year (QALY gained of £8,500. Conclusions The intervention proved feasible and acceptable. Outreach workers expanded

  16. Absorbed zinc and exchangeable zinc pool size are significantly greater in Pakistani infants receiving traditional complementary foods with zinc fortified micronutrient powder

    International Nuclear Information System (INIS)

    Ariff, Shabina; Soofi, Sajid; Bhutta, Zulfiqar; Krebs, Nancy; Westcott, Jamie

    2014-01-01

    Full text: Adequacy of zinc intake from breast milk alone becomes marginal in relation to infant requirements by around six months of age. Simple and cost effective strategies are needed at population level to ensure adequate intakes of zinc in infants and toddlers in populations at risk of zinc deficiency. We determined the amount of absorbed zinc (AZ) from a micronutrient powder (MNP) without and with 10 mg of zinc (MNP, MNP+Zn, respectively) added to local complementary foods used in Pakistan, and the impact on the exchangeable zinc pool (EZP) size. As a nested study within a large prospective cluster randomized trial, 6 month old infants were randomized to receive MNP or MNP+Zn. Stable isotope methodology was applied after ~ 3 and 9 months of use to measure AZ from MNP-fortified test meals of rice-lentils (khitchri) and EZP. Nineteen infants per group completed the first metabolic studies; 14 and 17 infants in MNP and MNP+Zn groups, completed the follow-up studies. Mean (±SD) AZs were 0.1± 0.1 and 1.2±0.5 mg at the first point for the MNP and MNP+Zn groups, respectively (p <0.001); results were nearly identical at the follow-up measurement. EZP did not differ between groups at the first measurement but was less in the MNP group (3.7±0.6 mg/kg) than in the MNP+Zn group (4.5±1.0 mg/kg) at the second measurement (P = 0.01). These data confirm that the MNP+Zn in khitchri were well absorbed, and after a year of home fortification, zinc status assessed by EZP was significantly better for the MNP+Zn group. Additional field studies may be necessary to ascertain the adequacy of this dose for infants at high risk of deficiency. (author)

  17. Bacterial growth in solar heating prepared and traditional tanks

    International Nuclear Information System (INIS)

    Bagh, L.K.

    2000-01-01

    In Denmark it has been put forward that the introduction of solar heating prepared tanks into the building regulation can cause increased nuisance with respect to bacterial growth in hot water for domestic use. The reason is that solar heating prepared tanks have a larger volume and another form of operation than traditional tanks. In this investigation the difference between bacterial growth in solar heating prepared and traditional tanks was measured by heterotrophic plate counts as a general parameter for microbiological growth. There was no significant difference between the bacterial number in the solar heating prepared tanks and in the traditional tanks, either for bacteria determined at 37 deg. C, 44 deg. C, 55 deg. C or at 65 deg. C. The hot water for domestic use from the solar heating prepared tanks and the traditional tanks had in most cases a bacterial number below 1.000 CFU/ml, and all tests had a bacterial number below 10.000 CFU/ml. The number of bacteria must be considered low seen in relation to the other measurements of bacteria in hot water for domestic use, particularly in larger block of flats. (au)

  18. Helping Children Exposed to Domestic Violence

    Science.gov (United States)

    ... for Families - Vietnamese Spanish Facts for Families Guide Domestic Violence and Children No. 109; Updated April 2013 As ... each year. This kind of violence is called domestic violence or intimate partner violence. The US Department of ...

  19. Smart solar tanks for small solar domestic hot water systems

    DEFF Research Database (Denmark)

    Furbo, Simon; Andersen, Elsa; Knudsen, Søren

    2005-01-01

    Investigation of small SDHW systems based on smart solar tanks are presented. The domestic water in a smart solar tank can be heated both by solar collectors and by means of an auxiliary energy supply system. The auxiliary energy supply system – in this study electric heating elements – heats up...... systems, based on differently designed smart solar tanks and a traditional SDHW system were investigated by means of laboratory experiments and theoretical calculations. The investigations showed that the yearly thermal performance of SDHW systems with smart solar tanks is 5-35% higher than the thermal...... performance of traditional SDHW systems. Estimates indicate that the performance/cost ratio can be improved by up to 25% by using a smart solar tank instead of a traditional tank when the backup energy system is electric heating elements. Further, smart solar tanks are suitable for unknown, variable, large...

  20. Protecting traditional knowledge of Chinese medicine: concepts and proposals.

    Science.gov (United States)

    Liu, Changhua; Gu, Man

    2011-06-01

    With the development of the knowledge economy, knowledge has become one of the most important resources for social progress and economic development. Some countries have proposed measures for the protection of their own traditional knowledge. Traditional Chinese medicine belongs to the category of intangible cultural heritage because it is an important part of Chinese cultural heritage. Today the value of traditional knowledge of Chinese medicine has been widely recognized by the domestic and international public. This paper discusses the definition of traditional knowledge of Chinese medicine and its protection, and evaluates research on its classification. We review the present status of the protection of traditional knowledge of Chinese medicine and tentatively put forward some possible ideas and methods for the protection of traditional knowledge of Chinese medicine. Our goal is to find a way to strengthen the vitality of traditional Chinese medicine and consolidate its foundation. We believe that if we could establish a suitable sui generis(sui generis is a Latin term meaning "of its own kind" and is often used in discussions about protecting the rights of indigenous peoples. Here we use it to emphasize the fact that protection of traditional knowledge of Chinese medicine cannot be achieved through existing legal means of protection alone due to its unique characteristics) system for traditional knowledge, a more favorable environment for the preservation and development of traditional Chinese medicine will ultimately be created.

  1. Problems and perspectives of domestic violence prevention

    OpenAIRE

    Kasperskis, Darius

    2009-01-01

    This paper will analyze the domestic violence prevention problems and perspectives. The goal of this work is to discuss the main domestic violence characteristics, analyze Lithuanian and international prevention means and offer suggestions to improve Lithuanian domestic violence prevention. This work consentrates on mens violence over women. The conseption of violence is analyzed – the general violence features in criminology and law literature are discussed, the main domestic violence forms ...

  2. KASTAMONU TRADITIONAL WOMEN CLOTHES

    Directory of Open Access Journals (Sweden)

    E.Elhan ÖZUS

    2015-08-01

    Full Text Available Clothing is a unique dressing style of a community, a period or a profession. In clothing there is social status and difference principle rather than fashion. In this context, the society created a clothing style in line with its own customs, traditions and social structure. One of the features separating societies from each other and indicating their cultural and social classes is the clothing style. As it is known, traditional Turkish clothes reflecting the characteristics of Turkish society is our most beautiful heritage from past to present. From this heritage there are several examples of women's clothes c arried to present. When these examples are examined, it is possible to see the taste, the way of understanding art, joy and the lifestyle of the history. These garments are also the documents outlining the taste and grace of Turkish people. In the present study, traditional Kastamonu women's clothing, that has an important place in traditional cultural clothes of Anatolia, is investigated . The method of the present research is primarily defined as the examination of the written sources. The study is complet ed with the observations and examinations made in Kastamonu. According to the findings of the study, traditional Kastamonu women's clothing are examined and adapted to todays’ clothing.

  3. Domestic competitiveness in secondary wood industries

    Science.gov (United States)

    Matthew Bumgardner; Urs Buehlmann; Albert Schuler; Rich Christianson

    2004-01-01

    As imports capture a substantial portion of the domestic wood furniture market, there is much speculation and concern as to the future of this and related industries. This study sought to obtain an industry perspective of trends in domestic manufacturing and importing, and to identify factors that might enhance domestic competitiveness. A mail survey was conducted...

  4. Risk Factors for Domestic Violence in Curacao

    Science.gov (United States)

    van Wijk, N. Ph. L.; de Bruijn, J. G. M.

    2012-01-01

    One out of three people (25% of men, 38% of women) in Curacao have experienced some form of domestic violence at some point in their adult lives. The most significant risk factors for domestic violence in Curacao are the female gender, a young age, low education, and experiencing domestic violence victimization in childhood. Divorce, single…

  5. Domestic Violence against Men: Know the Signs

    Science.gov (United States)

    Healthy Lifestyle Adult health Domestic violence against men isn't always easy to identify, but it can be a serious threat. Know how to recognize if ... Staff Women aren't the only victims of domestic violence. Understand the signs of domestic violence against men, ...

  6. 31 CFR 535.320 - Domestic bank.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Domestic bank. 535.320 Section 535... § 535.320 Domestic bank. (a) The term domestic bank shall mean any branch or office within the United States of any of the following which is not Iran or an Iranian entity: any bank or trust company...

  7. 31 CFR 515.320 - Domestic bank.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Domestic bank. 515.320 Section 515... § 515.320 Domestic bank. The term domestic bank shall mean any branch or office within the United States of any of the following which is not a national of a designated foreign country; any bank or trust...

  8. 31 CFR 500.320 - Domestic bank.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Domestic bank. 500.320 Section 500... § 500.320 Domestic bank. The term domestic bank shall mean any branch or office within the United States of any of the following which is not a national of any designated foreign country: Any bank or trust...

  9. Risk factors for domestic violence in Curacao

    NARCIS (Netherlands)

    van Wijk, N.Ph.L.; de Bruijn, J.G.M.

    2012-01-01

    One out of three people (25% of men, 38% of women) in Curacao have experienced some form of domestic violence at some point in their adult lives. The most significant risk factors for domestic violence in Curacao are the female gender, a young age, low education, and experiencing domestic violence

  10. Traditional Chinese Biotechnology

    Science.gov (United States)

    Xu, Yan; Wang, Dong; Fan, Wen Lai; Mu, Xiao Qing; Chen, Jian

    The earliest industrial biotechnology originated in ancient China and developed into a vibrant industry in traditional Chinese liquor, rice wine, soy sauce, and vinegar. It is now a significant component of the Chinese economy valued annually at about 150 billion RMB. Although the production methods had existed and remained basically unchanged for centuries, modern developments in biotechnology and related fields in the last decades have greatly impacted on these industries and led to numerous technological innovations. In this chapter, the main biochemical processes and related technological innovations in traditional Chinese biotechnology are illustrated with recent advances in functional microbiology, microbial ecology, solid-state fermentation, enzymology, chemistry of impact flavor compounds, and improvements made to relevant traditional industrial facilities. Recent biotechnological advances in making Chinese liquor, rice wine, soy sauce, and vinegar are reviewed.

  11. Maintenance of changes in food intake and motivation for healthy eating among Norwegian-Pakistani women participating in a culturally adapted intervention.

    Science.gov (United States)

    Helland-Kigen, Kaja Marie; Råberg Kjøllesdal, Marte Karoline; Hjellset, Victoria Telle; Bjørge, Benedikte; Holmboe-Ottesen, Gerd; Wandel, Margareta

    2013-01-01

    To investigate maintenance of changes in food intake and motivation for healthy eating at follow-up 2 data collection after a lifestyle intervention among Pakistani immigrant women. A culturally adapted lifestyle intervention, aiming at reducing the risk of type 2 diabetes mellitus. Data collection including FFQ and questions on intentions to change dietary behaviour was completed at baseline, right after the 7 ± 1 month intervention (follow-up 1) and 2-3 years after baseline (follow-up 2). Oslo, Norway. Pakistani women (n =198), aged 25-60 years, randomized into control and intervention groups. From follow-up 1 to follow-up 2 there was a shift from action to maintenance stages for intention to reduce fat intake (P diet.

  12. Healthier Traditional Food

    OpenAIRE

    Edward F. Millen

    2017-01-01

    The study of traditional food and healthy eating habits has been one of the fast growing areas. All humans, both men and women, require food for their survival. However, both men and women indulge in food as if it were their sole purpose of existence. Hence, eating disorders are common among men and women. Then media has played an effective role not only in establishing faulty standards for traditional healthy food but also it has highlighted the importance of healthy eating. It has brought t...

  13. Domestic kraudfandinh: problems and prospects

    Directory of Open Access Journals (Sweden)

    L.V. Mihalchuk

    2015-03-01

    Full Text Available The description kraudfandinh as an innovative tool to attract private investment in promising business projects as a special type of financing over the Internet. Powered its classification and kraud lists of successful projects, clearly illustrated by comparison of the normal business process to create a product and a similar process using kraudfandinh, given the differences between them and the main advantages. Based on the summaries of the literature and current practices of foreign companies and kraud platforms, defined the prospects of its application by domestic enterprises in various industries, proved its positive impact on the economy of Ukraine. The main problem of the use of this instrument in the domestic business, according to national circumstances, given their explanations. Described the prospects for its implementation at Ukrainian enterprises in terms of economic instability. The characteristic of the first Ukrainian kraudfandinh platforms by their future prospects in this direction

  14. Changes in food habits and motivation for healthy eating among Pakistani women living in Norway: results from the InnvaDiab-DEPLAN study.

    Science.gov (United States)

    Johansen, Karianne S; Bjørge, Benedikte; Hjellset, Victoria Telle; Holmboe-Ottesen, Gerd; Råberg, Marte; Wandel, Margareta

    2010-06-01

    Pakistani women in Oslo have high risk of overweight and type 2 diabetes. The objective is to present the effect of an intervention study on Pakistani women's intentions to change dietary behaviour and changes made in dietary intake. The intervention group received culturally adapted lifestyle education, including diet and physical activity. The questionnaire, applied before and after the 7-month intervention, included FFQ and questions on intentions to change. Oslo, Norway. A total of 198 Pakistani women, aged 25-63 years, randomised into control and intervention groups. There was a shift in distribution of intentions to change the intake of selected foods in the intervention group after the intervention, resulting in significant differences between the groups. The daily intake of vegetables, fruits and fruit juice had increased (P = 0.043), and the intake of red meats (P = 0.001), full fat milk/yoghurt (P = 0.027) and sugar-rich drinks (P Pakistani women;s intentions to make their diet healthier, and also to induce some beneficial, however modest, self-reported changes in diet.

  15. Isolation, identification, screening of toxicity and oligopeptides of some marine and brackish cyanobacteria from Norwegian and Pakistani waters, in the search for bioactive natural compounds

    OpenAIRE

    Hameed, Shaista

    2009-01-01

    Cyanobacteria produce a number of bioactive compounds, most of them are oligopeptides. Almost all are known from freshwater species. The aim of this study was to search for marine and brackish water species producing bioactive compounds. To reach this goal, new strains were isolated from Norwegian and Pakistani coastal waters. These and additional strains from NIVA, UiO and UiB culture collections (24 in total), belonging to Chroococcales and Oscillatoriales, were identified based on morpholo...

  16. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  17. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  18. Abused domestic workers in Europe

    DEFF Research Database (Denmark)

    Stenum, Helle

    This study analyses au pair arrangements in six EU Member States (Denmark, Germany, Ireland, the Netherlands, Poland and Spain) through descriptions of national and international legal frameworks and practices of au pairing. The findings show different patterns of au pair migration and different ...... situations of au pairing as well as different strategies to protect the au pairs. The overall recommendation is to separate current au pair immigration into two programmes: one of cultural exchange and one of domestic and care work....

  19. Children's experiences of domestic violence

    OpenAIRE

    Callaghan, Jane

    2016-01-01

    This paper describes the key findings of a two year project focused on children's experiences of domestic violence. It draws on 107 interviews with children in Greece, Italy, Spain and the UK. The paper explores children's capacity to articulate their experiences, and highlights that they are not 'witnesses' to intimate partner violence, but experience it directly and make meaning of it, as members of a family affected by violence. I argue that children need to be recognised as direct victims...

  20. Reconsidering Our Domestic Violence System.

    Science.gov (United States)

    Starsoneck, Leslie; Ake, George

    2018-01-01

    Children's exposure to domestic violence is well established as an adverse childhood experience (ACE). Much is known about the impact of this exposure, but efforts to ameliorate its effects are too often unsuccessful. Reconsidering our response requires a candid assessment of whether convening large and disparate systems leads to the best outcome. ©2018 by the North Carolina Institute of Medicine and The Duke Endowment. All rights reserved.

  1. State Support of Domestic Production

    Energy Technology Data Exchange (ETDEWEB)

    Amy Wright

    2007-12-30

    This project was developed in response to a cooperative agreement offering by the U.S. Department of Energy (DOE) and the National Energy Technology Laboratory (NETL) under the State Support of Domestic Production DE-FC26-04NT15456. The Interstate Oil and Gas Compact Commission (IOGCC) performed efforts in support of State programs related to the security, reliability and growth if our nation's domestic production of oil and natural gas. The project objectives were to improve the States ability to monitor the security of oil and gas operations; to maximize the production of domestic oil and natural gas thereby minimizing the threat to national security posed by interruptions in energy imports; to assist States in developing and maintaining high standards of environmental protection; to assist in addressing issues that limit the capacity of the industry; to promote the deployment of the appropriate application of technology for regulatory efficiency; and to inform the public about emerging energy issues.

  2. Artificial cloning of domestic animals.

    Science.gov (United States)

    Keefer, Carol L

    2015-07-21

    Domestic animals can be cloned using techniques such as embryo splitting and nuclear transfer to produce genetically identical individuals. Although embryo splitting is limited to the production of only a few identical individuals, nuclear transfer of donor nuclei into recipient oocytes, whose own nuclear DNA has been removed, can result in large numbers of identical individuals. Moreover, clones can be produced using donor cells from sterile animals, such as steers and geldings, and, unlike their genetic source, these clones are fertile. In reality, due to low efficiencies and the high costs of cloning domestic species, only a limited number of identical individuals are generally produced, and these clones are primarily used as breed stock. In addition to providing a means of rescuing and propagating valuable genetics, somatic cell nuclear transfer (SCNT) research has contributed knowledge that has led to the direct reprogramming of cells (e.g., to induce pluripotent stem cells) and a better understanding of epigenetic regulation during embryonic development. In this review, I provide a broad overview of the historical development of cloning in domestic animals, of its application to the propagation of livestock and transgenic animal production, and of its scientific promise for advancing basic research.

  3. Low level of objectively measured physical activity and cardiorespiratory fitness, and high prevalence of metabolic syndrome among Pakistani male immigrants in Oslo, Norway

    Directory of Open Access Journals (Sweden)

    Eivind Andersen

    2011-08-01

    Full Text Available Background: The level of physical fitness in south Asian immigrants living in Norway is largely unknown, but the level of physical activity seems to be low, possibly in part explaining their high prevalence of diabetes and cardiovascular diseases. However, previous studies have used self-reported measures of physical activity, and it might be questioned whether the previous data reflect the true physical activity level.Aim: To describe objectively measured physical activity level, cardiorespiratory fitness and diabetes risk in a group of Pakistani immigrant men living in Oslo, Norway.Methods: One hundred and fifty Pakistani immigrant men in the age group 25-60 years were included. Physical activity level was assessed with an accelerometer. Cardiorespiratory fitness was measured until exhaustion on a treadmill, and diabetes risk was evaluated with an oral glucose tolerance test.Results: Mean age was 37.3 years (SD=7.7. Total physical activity level was 308 counts/min (SD=131, and peak oxygen uptake was 34.2 ml·kg-1·min-1 (SD=5.6. Fifty percent of the participants had the metabolic syndrome, and 76% were obese. Physical activity level and cardiorespiratory fitness level were lower, and prevalence of the metabolic syndrome higher in a subgroup of taxi drivers as compared with those inother occupations (P<0.05.Conclusions: Physical activity and cardiorespiratory fitness levels are low and diabetes risk high among Pakistani immigrant men living in Oslo, especially in taxi drivers

  4. Genome-Wide Supported Risk Variants in MIR137, CACNA1C, CSMD1, DRD2, and GRM3 Contribute to Schizophrenia Susceptibility in Pakistani Population.

    Science.gov (United States)

    Fatima, Ambrin; Farooq, Muhammad; Abdullah, Uzma; Tariq, Muhammad; Mustafa, Tanveer; Iqbal, Muhammad; Tommerup, Niels; Mahmood Baig, Shahid

    2017-09-01

    Schizophrenia is a chronic neuropsychiatric disease afflicting around 1.1% of the population worldwide. Recently, MIR137 , CACNA1C , CSMD1 , DRD2 , and GRM3 have been reported as the most robustly emerging candidates involved in the etiology of schizophrenia. In this case control study, we performed an association analysis of rs1625579 ( MIR137 ), rs1006737, rs4765905 ( CACNA1C ), rs10503253 ( CSMD1 ), rs1076560 ( DRD2 ), rs12704290, rs6465084, and rs148754219 ( GRM3 ) in Pakistani population. Schizophrenia was diagnosed on the basis of the Diagnostic and Statistical Manual of Mental Disorders 4th ed (DSM-IV). Detailed clinical information, family history of all patients and healthy controls were collected. RFLP based case control association study was performed in a Pakistani cohort of 508 schizophrenia patients and 300 healthy control subjects. Alleles and genotype frequencies were calculated using SPSS. A significant difference in the genotype and allele frequencies for rs4765905, rs1076560 and rs6465084 were found between the patients and controls (p=0.000). This study provides substantial evidence supporting the role of CACNA1C , GRM3 and DRD2 as schizophrenia susceptibility genes in Pakistani population.

  5. Noodles, traditionally and today

    Directory of Open Access Journals (Sweden)

    Na Zhang

    2016-09-01

    Full Text Available Chinese noodles originated in the Han dynasty, which has more than 4,000 years of history. There are many stories about the origin of noodles. To a certain extent, noodles also reflect the cultural traditions and customs of China, which essentially means “human nature” and “worldly common sense”. There are thousands of varieties of noodles in China, according to the classification of the shape of noodles, seasoning gravy, cooking craft, and so on. Many noodles have local characteristics. Noodles are accepted by people from all over the world. The industrial revolution and the development of the food industry realized the transition from a traditional handicraft industry to mass production using machinery. In addition, the invention of instant noodles and their mass production also greatly changed the noodle industry. In essence, noodles are a kind of cereal food, which is the main body of the traditional Chinese diet. It is the main source of energy for Chinese people and the most economical energy food. Adhering to the principle of “making cereal food the main food”, is to maintain our Chinese good diet tradition, which can avoid the disadvantages of a high energy, high fat, and low carbohydrate diet, and promote health. The importance of the status of noodles in the dietary structure of residents in our country and the health impact should not be ignored.

  6. Traditional Cherokee Food.

    Science.gov (United States)

    Hendrix, Janey B.

    A collection for children and teachers of traditional Cherokee recipes emphasizes the art, rather than the science, of cooking. The hand-printed, illustrated format is designed to communicate the feeling of Cherokee history and culture and to encourage readers to collect and add family recipes. The cookbook could be used as a starting point for…

  7. Modern vs. Traditional.

    Science.gov (United States)

    Zhenhui, Rao

    1999-01-01

    This article discusses traditional methods, such as the grammar-translation, and modern methods, the communicative approach, for teaching English-as-a-foreign-language in China. The relationship between linguistic accuracy and communicative competence, student-centered orientation, and the role of the teacher are highlighted. (Author/VWL)

  8. Non-Traditional Wraps

    Science.gov (United States)

    Owens, Buffy

    2009-01-01

    This article presents a recipe for non-traditional wraps. In this article, the author describes how adults and children can help with the recipe and the skills involved with this recipe. The bigger role that children can play in the making of the item the more they are apt to try new things and appreciate the texture and taste.

  9. Making Tradition Healthy

    Centers for Disease Control (CDC) Podcasts

    2007-11-01

    In this podcast, a Latina nutrition educator shows how a community worked with local farmers to grow produce traditionally enjoyed by Hispanic/Latinos.  Created: 11/1/2007 by National Diabetes Education Program (NDEP), a joint program of the Centers for Disease Control and Prevention and the National Institutes of Health.   Date Released: 11/10/2007.

  10. Spatial Resilience of Outdoor Domestic Space in Mozambique

    Directory of Open Access Journals (Sweden)

    Céline Felicio Veríssimo

    2012-07-01

    Full Text Available Historically, the people of Mozambique have faced oppression and social spatial segregation and responded in a way that has reinforced rather than dismantled their traditional values. Since pre-colonial times, the population’s strategy for escaping from environmental and foreign political disruption has been to reinvent tradition, based on the principles of resilience, resistance and self-reliance. The development of decentralised human settlements, involving the appropriation of land for domestic space and the self-organisation of neighbourhoods, were strategies to protect communities from adversity and secure collective self-reliance. Following Mozambique’s conversion to globalization, the post-colonial ‘cement city’ is now the core of neo-liberalism, as a node of the global economy, where foreign donors and international market economy control national political economy, exacerbating the premise of the negation of self-sufficiency that continues to evolve resiliently at its margins. The adoption of a neo-liberal model of development during the 1990s, completely bypasses the realities of Mozambican society. This paper argues that the strategy of self-production of space regarding the household/Outdoor Domestic Space unit, which existed previously as a resistance strategy, first of all against colonialism and secondly, against the statist definition of socialism, thirdly, has become a successful strategy for survival, as the building block of the decentralised Agrocity, in the face of a global economy which totally neglects both the people and the land. Outdoor Domestic Space is a multifaceted space that refers to the external space surrounding the built house and which, in the case of Mozambique, is where daily life takes place, involving strong social, ecological and productive functions. Under successive periods of political economy oppression and environmental adversity, the Outdoor Domestic Space has been adapted and refined to

  11. Challenging tradition in Nigeria.

    Science.gov (United States)

    Supriya, K E

    1991-01-01

    In Nigeria since 1987, the National Association of Nigeria Nurses and Midwives (NSNNM) has used traditional medial and traditional health care workers to curtail the practice of female circumcision. Other harmful traditions are being changed also, such as early marriage, taboos of pregnancy and childbirth, and scarification. 30,000 member of NANNM are involved in this effort to halt the harmful practices themselves and to change community opinion. The program involved national and state level workshops on harmful health consequences of traditional practices and instruction on how to conduct focus group discussions to assess women's beliefs and practices. The focus groups were found to be a particularly successful method of opening up discussion of taboo topics and expressing deep emotions. The response to the knowledge that circumcision was not necessary was rage and anger, which was channeled into advocacy roles or change in the practice. The result was the channeled into advocacy roles for change in the practice. The result was the development of books, leaflets and videos. One community group designed a dress with a decorative motif of tatoos and bodily cuts to symbolize circumcision and scarring. Plays and songs were written and performed. Artists provided models of female genitalia both before and after circumcision. The campaign has been successful in bringing this issue to the public attention in prominent ways, such a national television, health talk shows, and women;s magazines. One of the most important results of the effort has been the demonstration that culture and tradition can be changed from within, rather than from outside imposition of values and beliefs.

  12. Strategies for Corporate Global Expansion of Pakistani Companies in the Age of Technology

    Directory of Open Access Journals (Sweden)

    Jawaid Ahmed Qureshi

    2015-04-01

    Full Text Available This study intends to meticulously probe about the applications of cutting-edge strategies of globally expanding companies operative in several industrial sectors of Pakistan. Many companies craft and execute various strategies to globalize their operations and networks in several continents, which can not only benefit them but add value in the domestic cum global economy. Many researchers expounded that along with many other factors, capacity-building and competitive edges of business provide these companies the competitive strengths to excel in their global operations. Regarding such strengths, advancement in technology inclusive of research in business R&D (Research & Development, and marketing and business research, process design, automation, and e-commerce play a decisive role in providing them the core competitive edges that they leverage to advance their growth and expansion in the global market. This paper employs hybrid research techniques including qualitative and quantitative research. Semi-structured interviews have been taken for qualitative enquiry and structured survey has been undertaken for quantitative enquiry. The samples are drawn from multiple populations pertaining top-five export sectors of Pakistan by applying convenience sampling procedures for interviews and proportionate stratified sampling articulated with systematic sampling for survey. The findings uncover that after turning as retrenched domestic entities, many of the companies in Pakistan prefer global expansion. They usually resume from export operations in various countries especially where they develop a network of business associates, and then gradually move to open subsidiaries abroad. They avail technological edges to upgrade their processes, plants, products

  13. A review on the elemental contents of Pakistani medicinal plants: Implications for folk medicines.

    Science.gov (United States)

    Aziz, Muhammad Abdul; Adnan, Muhammad; Begum, Shaheen; Azizullah, Azizullah; Nazir, Ruqia; Iram, Shazia

    2016-07-21

    Substantially, plants produce chemicals such as primary and secondary metabolites, which have significant applications in modern therapy. Indigenous people mostly rely on traditional medicines derived from medicinal plants. These plants have the capacity to absorb a variety of toxic elements. The ingestion of such plants for medicinal purpose can have imperative side effects. Hence, with regard to the toxicological consideration of medicinal plants, an effort has been made to review the elemental contents of ethno medicinally important plants of Pakistan and to highlight the existing gaps in knowledge of the safety and efficacy of traditional herbal medications. Literature related to the elemental contents of ethno medicinal plants was acquired by utilizing electronic databases. We reviewed only macro-elemental and trace elemental contents of 69 medicinal plant taxa, which are traditionally used in Pakistan for the treatment of sundry ailments, including anemia, jaundice, cancer, piles, diarrhea, dysentery, headache, diabetes, asthma, blood purification, sedative and ulcer. A majority of plants showed elemental contents above the permissible levels as recommended by the World health organization (WHO). As an example, the concentrations of Cadmium (Cd) and Lead (Pb) were reportedly found higher than the WHO permissible levels in 43 and 42 medicinal plants, respectively. More specifically, the concentrations of Pb (54ppm: Silybum marianum) and Cd (5.25ppm: Artemisia herba-alba) were found highest in the Asteraceae family. The reported medicinal plants contain a higher amount of trace and toxic elements. Intake of these plants as traditional medicines may trigger the accumulation of trace and toxic elements in human bodies, which can cause different types of diseases. Thus, a clear understanding about the nature of toxic substances and factors affecting their concentrations in traditional medicines are essential prerequisites for efficacious herbal therapeutics with

  14. Mineral content of traditional leafy vegetables from western Kenya

    DEFF Research Database (Denmark)

    Orech, F.O.; Christensen, Dirk Lund; Larsen, T.

    2007-01-01

    and diseases. This paper describes the mineral (calcium, iron and zinc) contents in some 54 traditional vegetable species collected from Nyang'oma area of Bondo district, western Kenya. Atomic absorption spectroscopy was used to determine the mineral content. We found that most traditional leafy vegetables......, domesticated and wild, generally contain higher levels of calcium, iron and zinc compared with the introduced varieties such as spinach (Spanacia oleracea), kale (Brassica oleracea var. acephala) and cabbage (Brassica oleracea var. capitata). The results of this study could contribute towards identification...

  15. Domestic policy 1982-1986 - a performance review

    International Nuclear Information System (INIS)

    1986-05-01

    The report reviews the achievements of domestic policy of the last four years, i.e. work performed by the various departments of the German Federal Ministry of the Interior. The activities are widespread, including besides the traditional ones such as public safety, civil defence and disaster control, some new services in the field of pollution control, reactor safety, and many others. The common goal is to maintain peace and public safety, to ensure freedom and the natural bases of existence, and to thus create the basic conditions for public well-being and pursuit of happiness for every citizen. (orig./HSCH) [de

  16. Frequency of different disorders requiring warfarin therapy and its outcome in terms of dosage and inr value in pakistani population

    International Nuclear Information System (INIS)

    Qayyum, A.; Najmi, M.H.

    2014-01-01

    To determine the frequency of different disorders requiring warfarin therapy and to see the target INR and warfarin dose requirement in Pakistani population. Study Design:Descriptive study. Setting and Duration of Study: The study was carried out at Armed Forces Institut e of Cardiology (AFIC) Rawalpindi, Military Hospital Rawalpindi and National Institute of Cardiovascular Diseases (NICVD), Karachi, Pakistan from October 2010 to March 2012. Patients and Methods: Stable patients taking warfarin therapy were recruited after detailed medical history, physical examination and laboratory tests. The demographic and clinical data of individuals were entered in a pre-structured proforma. Patients suffering from hepatic and renal disease, any co-morbid disease or taking any concurrent medication or diet which would have affected warfarin therapy, were excluded. Data was analyzed using PSS version 20.0. Results: A total of 607 stable patients fulfilling the eligibility criteria, participated in the study. There were 297 (48.9%) male and 310 (51.1%) female patients. The mean age was 37.93 +- 12.23 years (range 18-65 years). The most common indication for warfarin therapy was valvular heart diseases (93.4%) followed by atrial fibrillation (2.3%) whereas other indications for warfarin use are less commonly seen in our study population. Patients had mean international normalized ratio (INR) value of 2.3 +9- 0.8 (range 1.5-3.5). Mean daily dose of warfarin calculated in 607 patients was 5.62 and 1.98 mg with the range of 0.36-15 g whereas mean weekly dose was 39.36 +- 13.8 mg with the range of 2.5-105 mg. Conclusion: In Pakistani population the most common indications for warfarin use are valvular heart diseases followed by atrial fibrillation. The mean INR values were within recommended range of 2-3. The mean daily dose observed in long-term therapy is comparable to the empirical dose of 5 mg routinely started in clinical practice. (author)

  17. Pharmacy Student’s Perceptions of Learning Experience with Traditional and Power Point Presentations

    Directory of Open Access Journals (Sweden)

    Faaiza Qazi

    2014-04-01

    Full Text Available The aim of this study was to determine the effect of multimedia used as a teaching tool, to compare the effect of two different instructional methods on students’ academic achievements and Pakistani Pharmacy student’s perceptions of methods of lecture delivery. A self-constructed, prevalidated questionnaire with close and open ended items was administered on the Pharmacy students of three different institutes of Karachi, Pakistan (January 2012 to June 2012. Students were enrolled following informed consent and knowledge of the purpose of the study. Traditional method was the dominant lecture delivery method among Pharmacy students. They preferred power point presentations as compare to traditional method, but the difference was not significant. However, they welcomed the opportunity to have more interactive sections during lectures. Comparative effectiveness of multimedia instructional method to traditional methods on student’s academic achievements was equal. Overall no difference attitude towards multimedia based lectures was observed among pharmacy students. In the present form of the e-learning program interactive space for students is not fully developed. To improve the overall learning experience of the students, constant source of electricity/power, teaching aids/equipment, a good environment for learning should be provided and lecturers should be trained in the use of modern teaching aids and technology.

  18. Sadum: Traditional and Contemporary

    Directory of Open Access Journals (Sweden)

    Ratna Panggabean

    2009-07-01

    Full Text Available Sadum is one of the traditional cloths of the Batak people in North Sumatra. It is woven on a back strap loom with supplementary weft technique. Sadum is a warp faced weaving made of cotton and beads woven into the cloth. Ritually it is used as a shoulder cloth, gifts exchanges, and in dances. It also bears the symbol of good tidings and blessings for the receiver. The cloth has change during times in technique, color, patterns, as well as in functions. But the use as a ritual cloth stays the same. The basic weaving techniques and equipments used to create it hasn’t change, but its material and added techniques has made this cloth become more rich in color, pattern, and texture. Most changes began when the Europeans came to Indonesia and introduced new material such as synthetic fibers and colors. In the 70s traditional cloth of Indonesia got its boost when the government declared batik as Indonesian national attire. This encourages other traditional weavings to develop into contemporary clothing. Later, new techniques and material were introduced to the Sadum weavings including embroidery, silk and golden threads which were never used before.

  19. Towards sustainable and robust on-site domestic wastewater treatment for all citizens

    NARCIS (Netherlands)

    Mgana, S.

    2003-01-01

    In most developing countries commonly practiced domestic wastewater treatment systems predominantly constitute anaerobic treatment process. The anaerobic treatment units mostly installed are on-site at residential dwellings.

    However the commonly installed units, viz., traditional pit

  20. Ius Humanitatis and the Right to Reparation for Crimes in Foreign Domestic Courts

    NARCIS (Netherlands)

    Brus, Marcellinus

    2014-01-01

    This article focuses on the possibilities for victims of international crimes to obtain reparation in a foreign domestic court. The chances of success for such claims are small under traditional international law. The article questions whether the development of human rights and humanitarian ethics

  1. Understanding Gender and Domestic Violence from a Sample of Married Women in Urban Thailand

    Science.gov (United States)

    Xu, Xiaohe; Kerley, Kent R.; Sirisunyaluck, Bangon

    2011-01-01

    There is a widespread agreement among gender and family violence investigators that gender and socioeconomic inequalities play key roles in domestic violence against women (DVAW). By integrating the concepts of gender traditionalism and decision-making power into a variety of resource-based theories, this study develops a gender perspective to…

  2. Pakistanis in Spain: a study based on the community living in the city of Barcelona

    Directory of Open Access Journals (Sweden)

    Montserrat Solé Aubia

    2005-01-01

    Full Text Available One of the characteristics of Spain becoming a country of immigration is the greater protagonism that some countries have acquired which had not traditionally been a major source of migration movements towards Spain. Such is the case of Pakistan, whose nationals living in Spain have considerably increased in recent years, mainly in the area of Barcelona. This study seeks to undertake a research line in order to get to know more deeply the reality of this community.

  3. The Canarian Camel: A Traditional Dromedary Population

    Directory of Open Access Journals (Sweden)

    Ursula Schulz

    2010-04-01

    Full Text Available The domestic camel (dromedary is the most important livestock species in the Canary Islands and the most important autochthonous European camel population. After six centuries of a successful adaptation process to the particular environment of the Canary Islands, the abandonment of traditional agriculture has led this population to a major bottleneck. Along with a lack of foreign genetic interchanges, this could lead the population to the brink of extinction. Genetic analysis using 13 microsatellites showed the closest genetic proximity to the North African (Tindouf, Algeria camel population and a certain degree of sub-division, with significant genetic differences among breeders. An important level of genetic differentiation among the different populations analyzed was found with a global FST value of 0.116.

  4. Endothermic technology for domestic houses

    International Nuclear Information System (INIS)

    Virk, G.S.

    2005-01-01

    The paper introduces the endothermic energy systems being developed for buildings. These use the concept of solar assisted heat pumps where thermal energy is harvested using large integrated solar collectors connected to energy stores. The low grade energy is upgraded using heat pumps to provide thermal energy effectively to a wide variety of applications for space heating and cooling and hot water. The domestic housing sector is focused upon here and a current EC funded project aimed at assessing the potential of the endothermic technology for providing the thermal energy for space heating and cooling and hot water is presented. (author)

  5. THE DOMESTIC VIOLENCE ON CHILDREN

    Directory of Open Access Journals (Sweden)

    SAVCA Lucia

    2017-11-01

    Full Text Available Any form of domestic violence leaves its mark on minority's personality forma¬tion and generates dysfunctions in the behavioral, cognitive and emotional sphere. The study found that in the modern family up to 30% of children suffer from physical violence and up to 45% by psychological violence. Sexual violence, unlike other forms of violence, is more difficult to discover. It has more dramatic consequences and re¬quires a longer time for psychological recovery. In this study, are described a few cases of sexual violence in the family literally

  6. [Atopic dermatitis and domestic animals].

    Science.gov (United States)

    Song, M

    2000-09-01

    Several arguments are raised attributing to aeroallergens an important role in atopic dermatitis. The aeroallergens that penetrate the epidermis could be fixed by IgE on the Langerhans cells and then induce a cellular mediator reaction comparable to that of allergic contact eczema. Patch tests have been developed to evaluate the role of aeroallergens (dust mites, animal dander, etc.). Preventive anti-dust mites measures in the home of atopic patients are recommended. Eviction of domestic animals (cat, dog, etc.) or avoidance measures for animal dander in the home can produce improvement in atopic dermatitis. Oral specific immunotherapy is being validated as a treatment for this disease.

  7. Reptiles sold as traditional medicine in Xipamanine and Xiquelene Markets (Maputo, Mozambique

    Directory of Open Access Journals (Sweden)

    Vivienne L. Williams

    2016-07-01

    Full Text Available Zootherapy plays a role in healing practices in Mozambican society. Although several studies have focused on ethnobotany and traditional medicine in the country, little research has been conducted on the use of reptiles in zootherapy. The aim of this study was therefore to fill this gap by assessing the reptile species traded for traditional medicine in the Xipamanine and Xiquelene Markets in Maputo, Mozambique. We found that few reptile species are traded domestically for traditional medicine and that their use appears to be in decline in Mozambique. Our findings also suggest that the domestic trade of reptiles for traditional medicines in Maputo markets is unlikely to have a significant impact on the conservation of reptiles in Mozambique. However, we suggest that international trade with South Africa is likely having a larger impact, given observations of Mozambican nationals selling a diverse range of fauna in urban traditional medicine markets in Johannesburg and Durban.

  8. DOMESTIC DEVELOPMENT IN THE LABYRINTH

    Directory of Open Access Journals (Sweden)

    Arnoldo Oscar, Delgado

    2010-01-01

    Full Text Available Since its installation in our country, domestic development theory and practice have been object of diverse assimilation that, at times, contributed to dilute an essential feature of those clusters of Small and Medium Enterprises (SMEs that founded the domestic interest in 1970’s: the continuous innovation of products and production processes, possible only by the imprint of cultural factors in the establishment of a socio-institutional environment self-regulated to benefit it. The stage begun in 2003 seems to be at a similar risk: in order to reverse the terrible consequences of the previous decade and achieving a growth with an inclusion, now it assimilates into the social economy trying to go beyond mere social welfares and form a socio/productive mesh based on solidarity and cooperation ties. Beyond the legitimacy of the pose, the precariousness of the underlying setting demonstrates a gap that still separates us from the ideal model, requiring from us to agree seriously with the medium and long term state policy to promote the territorial development according to the contemporary society requirements.

  9. Bilateral Moyamoya Disease in a 2-Year-Old Pakistani Male Treated with Bilateral Encephaloduroarteriosynangiosis: A Positive Outcome

    Directory of Open Access Journals (Sweden)

    Shahvaiz Magsi

    2016-01-01

    Full Text Available Background. We present a rare case of bilateral moyamoya disease presenting as multiple strokes and neurological deficits, treated with the neurosurgical procedure, encephaloduroarteriosynangiosis (EDAS, in a 2-year-old male Pakistani minor. A positive outcome was achieved and the patient recovered fully. Case Summary. Our patient presented with a history of seizures and multiple episodes of hemiparesis (on and off weakness at the age of 2 years. He had a delayed speech development and could not speak more than a few words. He had a slight slurring of speech too. He was diagnosed with bilateral moyamoya disease on Computed Tomography Angiography (CTA. Bilateral EDAS was done in the same year, after which his symptoms improved and patient had moderate functional recovery. Conclusion. A rare disease, moyamoya has been left unexplored in Pakistan; physicians and surgeons when dealing with cases in the pediatric population presenting with symptoms of stroke, signs of generalized weakness, and seizures should consider moyamoya disease as a possibility. Furthermore, this case demonstrates the effectiveness of EDAS procedure for the treatment of moyamoya disease.

  10. TNF-alpha-308G>A polymorphism and the risk of familial CAD in a Pakistani population.

    Science.gov (United States)

    Hussain, Sabir; Iqbal, Tahir; Javed, Qamar

    2015-01-01

    A case-control and trio-families study was performed to establish a potential association between TNF-alpha gene promoter SNPs at -308 and -238, and occurrence of CAD in a Pakistani population. In the first phase, 150 patients and 150 controls were enrolled in the case-control association study. In the second phase, heritability of susceptible alleles was investigated from 88 trio-families with CAD affected offspring. Biochemical analysis of lipids and hs-CRP was carried out spectrophotometrically, while serum TNF-alpha concentrations were determined by enzyme-linked immunosorbent assay. Genotyping of the TNF-alpha SNPs were determined by PCR-RFLP method. Elevated serum TNF-alpha and hs-CRP were observed from CAD vs. controls (PA polymorphism in case-control study revealed that the said SNP was significantly associated with the increased risk of CAD. The findings demonstrated a significant link between the TNF-alpha variant allele A at -308 and CAD (P=0.0035), whereas the -238 SNP was not associated with the disease. Haplotype A-G of the TNF-alpha gene at -308G>A and -238G>A showed higher frequency in the patient group compared with controls (PA polymorphism is associated with CAD in the study population. Furthermore, for the first time, we showed that the TNF-alpha-308A allele was significantly associated with the familial CAD in our high risk population. Copyright © 2014. Published by Elsevier Inc.

  11. Influences of religion and culture on continuing bonds in a sample of British Muslims of Pakistani origin.

    Science.gov (United States)

    Hussein, Hanan; Oyebode, Jan R

    2009-11-01

    This study considered the nature of continuing bonds with deceased relatives in a sample of Pakistani Muslims living in the United Kingdom. Ten participants were interviewed following a cultural psychology approach and transcripts were analyzed using grounded theory methodology. Dreaming, talking with others about the deceased, following the deceased's example, keeping memories and mementos, and doing actions thought to help the deceased were forms of continued relationship found. These were intertwined with the process of grieving and were influenced by the family, culture, and religion. Religion was a strong influence on the prominence given by participants to finishing well and on the notion of doing actions thought to help the deceased. Cultural mores, such as the community, and collectivist ethos and the expectation that emotion would be expressed around the time of death, were found to be supportive for some but sources of tension for other participants. Expressing a continuing bond through following the deceased's example so as to make them proud or happy seemed to be reinforced by cultural roots in respect for elders. Participants gave instances of tensions in areas such as expression of emotion and communality versus individualism that arose as a result of their position between two cultural frameworks, some illustrating how assimilation into the host culture set up conflict with the expected norms of their family/ancestral culture. The study highlights how understanding different cultural and religious influences may enrich the concept of continuing bonds.

  12. The Effect of Perceiving a Calling on Pakistani Nurses' Organizational Commitment, Organizational Citizenship Behavior, and Job Stress.

    Science.gov (United States)

    Afsar, Bilal; Shahjehan, Asad; Cheema, Sadia; Javed, Farheen

    2018-03-01

    People differ considerably in the way in which they express and experience their nursing careers. The positive effects associated with having a calling may differ substantially based on individuals' abilities to live out their callings. In a working world where many individuals have little to no choice in their type of employment and thus are unable to live out a calling even if they have one, the current study examined how perceiving a calling and living a calling interacted to predict organizational commitment, organizational citizenship behavior, and job stress with career commitment mediating the effect of the interactions on the three outcome variables. The purpose of the study is to investigate the mediating effect of career commitment between the relationships of calling and (a) nurses' attitudes (organizational commitment), (b) behaviors (organizational citizenship behavior), and (c) subjective experiences regarding work (job stress). Using a descriptive exploratory design, data were collected from 332 registered nurses working in Pakistani hospitals. Descriptive analysis and hierarchical regression analysis were used for data analysis. Living a calling moderated the effect of calling on career commitment, organizational citizenship behavior, and job stress, and career commitment fully mediated the effect of calling on organizational commitment, organizational citizenship behavior, and job stress. Increasing the understanding of calling, living a calling, and career commitment may increase nurses' organizational commitment and organizational citizenship behavior and decrease job stress. The study provided evidence to help nursing managers and health policy makers integrate knowledge and skills related to calling into career interventions and help nurses discover their calling.

  13. "What is this genetics, anyway?" Understandings of genetics, illness causality and inheritance among British Pakistani users of genetic services.

    Science.gov (United States)

    Shaw, Alison; Hurst, Jane A

    2008-08-01

    Misconceptions about basic genetic concepts and inheritance patterns may be widespread in the general population. This paper investigates understandings of genetics, illness causality and inheritance among British Pakistanis referred to a UK genetics clinic. During participant observation of genetics clinic consultations and semi-structured interviews in Urdu or English in respondents' homes, we identified an array of environmental, behavioral and spiritual understandings of the causes of medical and intellectual problems. Misconceptions about the location of genetic information in the body and of genetic mechanisms of inheritance were common, reflected the range of everyday theories observed for White British patients and included the belief that a child receives more genetic material from the father than the mother. Despite some participants' conversational use of genetic terminology, some patients had assimilated genetic information in ways that conflict with genetic theory with potentially serious clinical consequences. Additionally, skepticism of genetic theories of illness reflected a rejection of a dominant discourse of genetic risk that stigmatizes cousin marriages. Patients referred to genetics clinics may not easily surrender their lay or personal theories about the causes of their own or their child's condition and their understandings of genetic risk. Genetic counselors may need to identify, work with and at times challenge patients' understandings of illness causality and inheritance.

  14. Frameshift mutation in the APOA5 gene causing hypertriglyceridemia in a Pakistani family: Management and considerations for cardiovascular risk.

    Science.gov (United States)

    Thériault, Sébastien; Don-Wauchope, Andrew; Chong, Michael; Lali, Ricky; Morrison, Katherine M; Paré, Guillaume

    2016-01-01

    We report a novel homozygous apolipoprotein A5 (APOA5) frameshift mutation (c.G425del-C, p.Arg143AlafsTer57) identified in a 12-year-old boy of Pakistani origin with severe hypertriglyceridemia (up to 35 mmol/L) and type V hyperlipoproteinemia. The patient did not respond to fibrate therapy, but his condition improved under a very low fat diet, although compliance was suboptimal. Heterozygous status was detected in both parents (consanguineous union) and one sibling, all showing moderate hypertriglyceridemia (between 5 and 10 mmol/L). There was a significant family history of premature cardiovascular disease. The index case was also diagnosed with a coronary artery anomaly. Considering the recently reported association of rare mutations in APOA5 with the risk of early myocardial infarction, we discuss the implications of these findings for the young man and his family. Copyright © 2016 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  15. Urdu translation and validation of shorter version of Positive Affect and Negative Affect Schedule (PANAS) on Pakistani bank employees.

    Science.gov (United States)

    Akhter, Noreen

    2017-10-01

    To translate, adapt and validate shorter version of positive affect and negative affect scale on Pakistani corporate employees. This cross-sectional study was conducted in the twin cities of Islamabad and Rawalpindi from October 2014 to December 2015. The study was completed into two independent parts. In part one, the scale was translated by forward translation. Then it was pilot-tested and administered on customer services employees from commercial banks and the telecommunication sector. Data of the pilot study was analysed by using exploratory factor analysis to extract the initial factor of positive affect and negative affect scale. Part two comprised the main study. Commercial bank employees were included in the sample using convenient sampling technique. Data of the main study was analysed using confirmatory factor analysis in order to establish construct validity of positive affect and negative affect scale. There were145 participants in the first part of the study and 495 in the second. Results of confirmatory factor analysis confirmed the two-factor structure of positive affect and negative affect scale suggesting that the scale has two distinct domains, i.e. positive affect and negative affect. The shorter version of positive affect and negative affect scale was found to be a valid and reliable measure.

  16. Study of Biochemical Changes and Elevated Levels of Enzymes in Salmonella typhi Infected Patients in Pakistani Population

    Directory of Open Access Journals (Sweden)

    Ayesha Shamim

    2012-04-01

    Full Text Available Typhoid fever causes significant biochemical changes and hepatic complications. As many studies have indicated several biochemical parameters that are involved in developing the risk of typhoid fever. The current study was designed to evaluate these risk factors in general Pakistani population. Serum biochemistry and liver enzymes were studied to investigate the relationship of these risk factors to Typhoid fever. Total 100 subjects were studied, 50 healthy individuals and 50 typhoid patients. Blood samples were collected from Allied and National Hospital, Faisalabad, Pakistan. In this study, Nested PCR was used to test the samples. Elevated level of ALT (P<0.0001 and AST (P<0.0001 were observed in typhoid patients. Typhoid patients had significantly higher concentrations of Triglyceride (P=0.0044, Globulin (P=0.0004 and Total protein (P=0.0978 while LDL (P=0.0197, Albumin (P<0.0001, Glucose (P=0.0006, HDL-cholesterol (P<0.0001 and Cholesterol (P=0.04 were significantly lower than those of healthy individuals. This study appears to be ample evidence based on the physiological and biochemical parameters in typhoid patients to explain influence of typhoid morbidity. Extensive research in this field would enable us to make modern drugs to treat typhoid fever patients.

  17. Evaluation of a cross-cultural training program for Pakistani educators: Lessons learned and implications for program planning.

    Science.gov (United States)

    Mazur, Rebecca; Woodland, Rebecca H

    2017-06-01

    In this paper, we share the results of a summative evaluation of PEILI, a US-based adult professional development/training program for secondary school Pakistani teachers. The evaluation was guided by the theories of cultural competence (American Psychological Association, 2003; Bamberger, 1999; Wadsworth, 2001) and established frameworks for the evaluation of professional development/training and instructional design (Bennett, 1975; Guskey, 2002; King, 2014; Kirkpatrick, 1967). The explicit and implicit stakeholder assumptions about the connections between program resources, activities, outputs, and outcomes are described. Participant knowledge and skills were measured via scores on a pre/posttest of professional knowledge, and a standards-based performance assessment rubric. In addition to measuring short-term program outcomes, we also sought to incorporate theory-driven thinking into the evaluation design. Hence, we examined participant self-efficacy and access to social capital, two evidenced-based determinants or "levers" that theoretically explain the transformative space between an intervention and its outcomes (Chen, 2012). Data about program determinants were collected and analyzed through a pre/posttest of self-efficacy and social network analysis. Key evaluation findings include participant acquisition of new instructional skills, increased self-efficacy, and the formation of a nascent professional support network. Lessons learned and implications for the design and evaluation of cross-cultural teacher professional development programs are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Investigation of total seed storage proteins of pakistani and japanese maize (zea mays l.) through sds-page markers

    International Nuclear Information System (INIS)

    Shinwari, Z.K.

    2014-01-01

    The assessment of genetic diversity among the members of a species is of vital importance for successful breeding and adaptability. In the present study 83 genotypes of maize of Pakistani and Japanese origin were evaluated for the total seed storage proteins using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) through vertical slab unit. The total protein subunits were separated on 12% polyacrylamide gel using standard protocols. A total of 18 protein subunits were noted out of which 7 (39%) were monomorphic and 11 (61%) were polymorphic, with molecular weight ranging from 10 to 122 kDa. Coefficients of similarity among the accessions ranged between 0.89 and 1.00. The dendrogram obtained through UPGMA clustering method showed two main clusters: 1 and 2. First cluster comprised of 9 genotypes including Sahiwal-2002, while second cluster contained 74 genotypes including Aaiti-2002 and Sadaf. Over all a low level of polymorphism was observed in total seed storage protein patterns of maize genotypes from Pakistan as well as Japan. It is inferred from the present study that more genotypes of maize could be brought under study and more advanced biochemical techniques with more reliable results could be followed to bring assessment of genetic diversity of maize for planning breeding programs. (author)

  19. Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

    Directory of Open Access Journals (Sweden)

    Muhammad Tahir Khalily

    2011-10-01

    Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector. Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy. Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

  20. Angiotensin Converting Enzyme Gene I/D Polymorphism in Pakistani Rheumatic Heart Disease Patients and Healthy Controls

    Directory of Open Access Journals (Sweden)

    Sadia Rehman

    2015-09-01

    Full Text Available Background: Valve scarring and collagen deposition are crucial in pathogenesis of Rheumatic Heart Disease (RHD, an autoimmune disorder of the heart. Angiotensin I-Converting Enzyme (ACE plays a major role in fibrous tissue formation. Objectives: The present research work aimed to assess the role of ACE Insertion/Deletion (I/D polymorphism in progress of RHD. Patients and Methods: DNA was pre pared from blood samples from 156 RHD patients (156 and 204 healthy ethnically-matched controls. Then, it was screened using sequence-specific Primers. Polymerase chain reaction and Agarose gel electrophoresis. The data were analyzed using Vassar stats (http://faculty.vassar.edu/lowry/VassarStats.html. Results: I allele (P = 0.024, OR = 1.42 and II genotype (P = 0.001, OR = 3.07 were significantly higher in Pakistani RHD patients compared to the healthy controls. Also, a significant difference was found between the female, but not male, patients and the controls regarding I allele and II genotype. Conclusions: The study results provided information about involvement of ACE I/D polymorphism in molecular mechanism of RHD. Thus, it can become one of the useful tools in risk assessment and help with designing strategies to combat the disease.

  1. Mental health problems in Pakistani society as a consequence of violence and trauma: a case for better integration of care

    Directory of Open Access Journals (Sweden)

    Muhammad Tahir Khalily

    2011-10-01

    Full Text Available Objectives: This paper discusses the increasing incidence of mental health problems in Pakistan, and specifically in the Swat valley, in relation to the growing insurgency and current violence in Pakistani society. The paper argues that the health care system's response in Pakistan is not adequate to meet the current challenges and that changes in policy are needed to build mental health care services as an important component of the basic health package at primary care level in the public sector.Method: This paper reviews the existing mental health situation in Pakistan with reference to the findings of a case study in the Swat valley in Khyber Pukhtoonkhwa Pakistan. The figures presented in the case study are used to support the need for an integrated national mental health policy.Conclusion: Mental health care needs to be incorporated as a core service in primary care and supported by specialist services. There is a strong need to provide adequate training for general practitioners and postgraduate training for mental health professionals to meet the current demands. A collaborative network between stakeholders in the public and private sector, as well as non-governmental organisations are required that promotes mental health care and advocates for changes in mental health policy.

  2. Investigating Social Commerce as an Alternate Model for Online Commerce in Developing Countries: a case of Pakistani Economy

    Directory of Open Access Journals (Sweden)

    Amina Talat

    2013-05-01

    Full Text Available The study is an empirical quantitative research. In light of intense literature review it proposes a new model for effectiveness of social commerce in Pakistan. It has three objectives. It firstly investigates the relationship between perceived risk, social networking focus, and perceived value effect trust. It secondly investigates the relationship between affective influence, word of mouth, affective influence, advertising influence, purchasing experience and viral reach on social commerce. Lastly it investigates how consumer value (adoption and purchase intention is affected by social commerce focus and trust. The software used is SPSS 15.0. Multiple regression equation has been employed to verify the hypotheses. Results show and validate the literature that positive or favorable views of users trigger positive attitude. However, there are two variables and dimensions that do not affect the attitude of users on social networks from the perspective of shopping i.e. social commerce; these are viral reach and previous purchasing experience on different websites. The results show that Pakistani users will welcome social commerce even if they have no previous experience for purchasing goods and services online.

  3. Impact of leadership styles on employees’ attitude towards their leader and performance: Empirical evidence from Pakistani banks

    Directory of Open Access Journals (Sweden)

    Muhammad Asrar-ul-Haq

    2016-06-01

    Full Text Available This paper reports the findings of a study examining the impact of managers’ leadership styles on subordinates’ performance. The impact of leadership styles on employee performance outcomes is explored theoretically and tested empirically in the Pakistani banking sector. The sample of the study consisted of 224 full-time employees in the banking sector of Pakistan. Findings of this study reveal that there exists a significant relationship between transformational leadership and employee performance outcomes. However, laissez-faire leadership style showed negative relationship with employee performance outcomes in terms of effectiveness, and employee satisfaction. Banking industry in Pakistan is prone to numerous challenges including employee turnover. Model presented in the study will be helpful for the human resource managers and top management to design effective leadership development programs. HRD department can be established and HRD professionals can be hired to assist the managers in organizing training and development programs. Further, it may help to design strategies to satisfy, retain and motivate the employees. Also, it will help the managers decide, which leadership style they should choose in terms of outcomes.

  4. Victims' barriers to discussing domestic violence in clinical consultations: a qualitative enquiry.

    Science.gov (United States)

    Othman, Sajaratulnisah; Goddard, Chris; Piterman, Leon

    2014-05-01

    Victims of domestic violence frequently attend health care facilities. In many cases, their abusive experience is neither disclosed nor discussed during clinical consultations. This study examined the barriers faced by women when discussing abuse with health care providers, specifically in cases involving Malaysian women with a history of domestic violence. A qualitative study using in-depth interviews was conducted with 10 women with a history of domestic violence residing at a shelter. Purposive sampling was conducted until data saturation. Using the grounded theory approach of analysis, themes that emerged from these interviews were then further analyzed to examine the barriers faced by these women. Women who experienced domestic violence faced multiple barriers while discussing their accounts of abuse with others. Values placed on the privacy of domestic violence; upholding the traditional gender roles; preserving the family unity; minimizing the abuse, the feeling of shame, self-blame; and fearing their abuser generally create internal barriers when discussing their encounters of abuse with health care providers. The perceived unknown role of health care professionals when dealing with patients experiencing domestic violence as well as the previous negative experiences in clinical consultations acted as external barriers for discussing abuse with health care providers. Women with domestic violence experiences faced internal and external barriers to discussing their abuse during clinical consultations. Physicians and health care providers must consider domestic violence in consultations with female patients. A good doctor-patient relationship that encompasses empathy, confidence, trust, support, assurance, confidentiality, and guidance can help patients with abusive backgrounds overcome these barriers, leading to the disclosure and discussion of their abusive encounters. Proper education, guidelines, and support for health care providers are required to help

  5. Traditional sorghum beer "ikigage"

    OpenAIRE

    Lyumugabe Loshima, François

    2010-01-01

    Samples of traditional sorghum beer Ikigage was collected in the southern province of Rwanda and analyzed for microbiological and physico-chemical contents. Ikigage contained total aerobic mesophilic bacteria (33.55 x 106 cfu/ml), yeast (10.15 x 106 cfu/ml), lactic acid bacteria (35.35 x 104 cfu/ml), moulds (4.12 x 104 cfu/ml), E. coli (21.90 x 103 cfu/ml), fecal streptococci (22.50 x 103 cfu/ml), Staphylococcus aureus (16.02 x 103 cfu/ml), total coliform (32.30 x 103 cfu/ml), eth...

  6. In the Dirac tradition

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1988-04-15

    It was Paul Dirac who cast quantum mechanics into the form we now use, and many generations of theoreticians openly acknowledge his influence on their thinking. When Dirac died in 1984, St. John's College, Cambridge, his base for most of his lifetime, instituted an annual lecture in his memory at Cambridge. The first lecture, in 1986, attracted two heavyweights - Richard Feynman and Steven Weinberg. Far from using the lectures as a platform for their own work, in the Dirac tradition they presented stimulating material on deep underlying questions.

  7. In the Dirac tradition

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    It was Paul Dirac who cast quantum mechanics into the form we now use, and many generations of theoreticians openly acknowledge his influence on their thinking. When Dirac died in 1984, St. John's College, Cambridge, his base for most of his lifetime, instituted an annual lecture in his memory at Cambridge. The first lecture, in 1986, attracted two heavyweights - Richard Feynman and Steven Weinberg. Far from using the lectures as a platform for their own work, in the Dirac tradition they presented stimulating material on deep underlying questions

  8. Designating Domestic Terrorist Individuals or Groups

    Science.gov (United States)

    2010-09-01

    These individuals and groups include the Black Panther Party, Weather Underground, Covenant Sword and the Arm of the Lord, Ku Klux Klan, Earth...based and left wing and right wing groups such as the Covenant Sword and the Arm of the Lord, Ku Klux Klan, Black Panther Party, and the Weather...TERMS Watch list, domestic terrorism, validation, designation, domestic terrorism organization, material support, domestic surveillance, SHAC, animal

  9. Fuel for domestic and metallurgical uses

    Energy Technology Data Exchange (ETDEWEB)

    Basu, D.; Chakrabarti, R.K.

    1981-02-01

    To meet the energy requirements in the domestic and metallurgical sectors CMPDI have taken in hand some developmental projects using coal as a feedback. 4 projects are described - mechanized conversion of coal to domestic coke, formed coke making by Didier-Keihan-Sumitomo process, domestic briquette making based on non-copking coal resources, and smokeless coal blocks utilising inferior grade raw coal and washery by-products.

  10. 25 CFR 11.454 - Domestic violence.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Domestic violence. 11.454 Section 11.454 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAW AND ORDER COURTS OF INDIAN OFFENSES AND LAW AND ORDER CODE Criminal Offenses § 11.454 Domestic violence. (a) A person who commits domestic violence by inflicting physical harm, bodily injury, or sexua...

  11. USSR Report: Consumer Goods and Domestic Trade

    National Research Council Canada - National Science Library

    1985-01-01

    .... This document contains articles on consumer goods and domestic trade issues within the USSR. Topics include: production, distribution, economics, housing and personal services, policies, personal income and savings.

  12. Domestic demand for petroleum in OPEC countries

    International Nuclear Information System (INIS)

    Chakravorty, U.; Fesharaki, F.; Zhou, S.

    2000-01-01

    The literature on OPEC energy policy has focused primarily on its production and export potential. The rapidly increasing domestic demand for petroleum products in OPEC countries has often been ignored. This study estimates domestic demand for petroleum products by the major OPEC economies and forecasts consumption trends under alternative assumptions regarding economic growth and price deregulation. It concludes that product demand is generally price and income inelastic and thus domestic consumption in OPEC will continue to grow rapidly, even if domestic prices are raised closer to world levels in the near future

  13. Wild genius - domestic fool? Spatial learning abilities of wild and domestic guinea pigs

    OpenAIRE

    Sachser Norbert; Pickel Thorsten; Lewejohann Lars; Kaiser Sylvia

    2010-01-01

    Abstract Background Domestic animals and their wild relatives differ in a wide variety of aspects. The process of domestication of the domestic guinea pig (Cavia aperea f. porcellus), starting at least 4500 years ago, led to changes in the anatomy, physiology, and behaviour compared with their wild relative, the wild cavy, Cavia aperea. Although domestic guinea pigs are widely used as a laboratory animal, learning and memory capabilities are often disregarded as being very scarce. Even less i...

  14. Cash transfers and domestic violence.

    Science.gov (United States)

    Hidrobo, Melissa; Fernald, Lia

    2013-01-01

    Violence against women is a major health and human rights problem yet there is little rigorous evidence as to how to reduce it. We take advantage of the randomized roll-out of Ecuador's cash transfer program to mothers to investigate how an exogenous increase in a woman's income affects domestic violence. We find that the effect of a cash transfer depends on a woman's education and on her education relative to her partner's. Our results show that for women with greater than primary school education a cash transfer significantly decreases psychological violence from her partner. For women with primary school education or less, however, the effect of a cash transfer depends on her education relative to her partner's. Specifically, the cash transfer significantly increases emotional violence in households where the woman's education is equal to or more than her partner's. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Non-traditional inheritance

    International Nuclear Information System (INIS)

    Hall, J.G.

    1992-01-01

    In the last few years, several non-traditional forms of inheritance have been recognized. These include mosaicism, cytoplasmic inheritance, uniparental disomy, imprinting, amplification/anticipation, and somatic recombination. Genomic imprinting (GI) is the dependence of the phenotype on the sex of the transmitting parent. GI in humans seems to involve growth, behaviour, and survival in utero. The detailed mechanism of genomic imprinting is not known, but it seems that some process is involved in turning a gene off; this probably involves two genes, one of which produces a product that turns a gene off, and the gene that is itself turned off. The process of imprinting (turning off) may be associated with methylation. Erasure of imprinting can occur, and seems to be associated with meiosis. 10 refs

  16. Medicinal perceptions of vegetables traditionally consumed by South-Asian migrants living in Bradford, Northern England.

    Science.gov (United States)

    Pieroni, Andrea; Houlihan, Laura; Ansari, Nafeesa; Hussain, Bushra; Aslam, Saiqa

    2007-08-15

    Dietary habits change rapidly amongst migrant communities in Western countries, and these changes can cause major concerns for public-health policymakers because they frequently lead to increases in diet-related diseases like diabetes. Such is the case in most South-Asian communities in the UK. In this study, we carried out an ethnobiological survey of the vegetables traditionally consumed among the Indian and Pakistani communities of Bradford, in Western Yorkshire, UK. Our purpose was to analyse in depth details of the traditional culinary use of vegetables within these households, and to assess the health perceptions of them. Semi-structured interviews with a total of 150 South-Asian women were carried out. Twenty-five vegetables were recorded, as well as their traditional culinary use and their frequency of use. We found that a few of these vegetables, particularly those presenting bitter or aromatic tastes, were perceived to have remarkable medicinal value particularly against diabetes. Our study also found important generational differences in the women's knowledge of the culinary processes related to these foods, confirming that the consumption of traditional vegetables is inextricably embedded in cultural heritage and the representation of identity among migrants. Our findings may offer evidence of a link between the choice of food and the foods' perceived medicinal value among South-Asian migrants. It may also provide important information for health care professionals when designing strategies for improving health care counteracting type 2 diabetes. We strongly believe such strategies should take into account socio-cultural components and emic health beliefs, as well as patients' views of traditional dietary ingredients.

  17. A Benchmarking System for Domestic Water Use

    Directory of Open Access Journals (Sweden)

    Dexter V. L. Hunt

    2014-05-01

    Full Text Available The national demand for water in the UK is predicted to increase, exacerbated by a growing UK population, and home-grown demands for energy and food. When set against the context of overstretched existing supply sources vulnerable to droughts, particularly in increasingly dense city centres, the delicate balance of matching minimal demands with resource secure supplies becomes critical. When making changes to "internal" demands the role of technological efficiency and user behaviour cannot be ignored, yet existing benchmarking systems traditionally do not consider the latter. This paper investigates the practicalities of adopting a domestic benchmarking system (using a band rating that allows individual users to assess their current water use performance against what is possible. The benchmarking system allows users to achieve higher benchmarks through any approach that reduces water consumption. The sensitivity of water use benchmarks are investigated by making changes to user behaviour and technology. The impact of adopting localised supplies (i.e., Rainwater harvesting—RWH and Grey water—GW and including "external" gardening demands are investigated. This includes the impacts (in isolation and combination of the following: occupancy rates (1 to 4; roof size (12.5 m2 to 100 m2; garden size (25 m2 to 100 m2 and geographical location (North West, Midlands and South East, UK with yearly temporal effects (i.e., rainfall and temperature. Lessons learnt from analysis of the proposed benchmarking system are made throughout this paper, in particular its compatibility with the existing Code for Sustainable Homes (CSH accreditation system. Conclusions are subsequently drawn for the robustness of the proposed system.

  18. Benchmarking set for domestic smart grid management

    NARCIS (Netherlands)

    Bosman, M.G.C.; Bakker, Vincent; Molderink, Albert; Hurink, Johann L.; Smit, Gerardus Johannes Maria

    2010-01-01

    In this paper we propose a benchmark for domestic smart grid management. It consists of an in-depth description of a domestic smart grid, in which local energy consumers, producers and buffers can be controlled. First, from this description a general benchmark framework is derived, which can be used

  19. Child-Visiting and Domestic Abuse.

    Science.gov (United States)

    Shepard, Melanie

    1992-01-01

    Explains problems with child visiting in cases of domestic abuse. Data on domestic abuse, child care concerns, and child adjustment problems were collected from 25 mothers and 22 fathers at a child visiting program serving separated and abusive families. Psychological abuse of mothers correlated with child adjustment problems. (BB)

  20. Processing Food for the Domestic Market

    DEFF Research Database (Denmark)

    Thomsen, Lotte; McCormick, Dorothy; Kamau, Paul

    This paper addresses the domestically owned food-processing industry in Kenya and explores thesale of processed food products to the domestic ‘modern’ retail sector. Food processing represents astep up in the value chain compared to fresh food production and may thus, at least potentially, leadto...

  1. Mozambican Aggregate Consumption and Domestic Saving ...

    African Journals Online (AJOL)

    It was an unprecedented decade for its break with the previous trend; but so far, the new trend does not correspond to a substantial change in growth strategy to ensure that foreign savings become complementary rather than a substitute for domestic savings. Keywords: consumption, economic growth strategy, domestic ...

  2. Domestic Waste: Sources, Effects, and Management

    International Nuclear Information System (INIS)

    Saad, A.; Hegazi, N.

    1999-01-01

    Waste is any discarded material. Domestic wastes are those produced by individual activities. In common with other living organisms, humans discharge waste substances to the environment that in turn re-energize the endless cycle of nature. Human activities are closely associated with ambient environment (soil , water, or air) through accumulation of domestic waste. Such household hazardous waste deposit arise from the discharge of domestic activities in the form of municipal solid waste (household, commercial and public street wastes), night soil (human and animal body wastes, excreta, or excrement). In rural areas, night soil is one of several components of the refuse that pollute the land. The surface water may be also directly polluted by domestic wastes or agricultural wastes. But in urbanized areas, household wastes, bathroom and laundry are conveniently flushed away by water as domestic wastewater through sewerage system, and disposed onto land or into receiving water, or in some countries it is treated and re-discharged for domestic usage. Solid waste in the form of kitchen garbage and other household refuse is collected for landfill disposal or for re-industrialization. Many domestic waste influence indoor air quality in urban and rural areas as for example the fuel used for cooking, smoke from cooking and from smoking habits, modern building materials, insulation, fabrics and furniture, cleaning materials, solvents, pesticides, personal care products, organic material or vegetable origin and dander from domestic life

  3. Domestic violence: recognition, intervention, and prevention.

    Science.gov (United States)

    Smith, M; Martin, F

    1995-02-01

    Domestic violence is a significant social and health problem that has received intensive recent publicity in the lay media. Nurses should play a major role in primary, secondary, and tertiary prevention interventions. Intensified health promotion and public policy initiatives can reduce the incidence of domestic violence in the future.

  4. Domestic Temporalities: Sensual Patterning in Persian Migratory ...

    African Journals Online (AJOL)

    In this paper, we argue that these intimate practices have references beyond their domestic dimensions, for they point to a worldly movement of life writ domestically small. It is via a sensory network that the spatially and temporally disparate worlds of homeland and new homes are remembered and forgotten, and where ...

  5. Toxoplasmosis in wild and domestic animals

    Science.gov (United States)

    Toxoplasma gondii is widely distributed in wild and domestic animals. The present chapter reviews toxoplasmosis in wild and domestic animals. Coverage in wild animal species is limited to confirmed cases of toxoplasmosis, cases with parasite isolation, cases with parasite detection by PCR, and exper...

  6. Children's Witnessing of Adult Domestic Violence.

    Science.gov (United States)

    Edleson, Jeffrey L.

    1999-01-01

    Expands common definitions of how children witness adult domestic violence through a review of 31 research articles. A variety of behavioral, emotional, and cognitive-functioning problems among children were found to be associated with exposure to domestic violence. Factors that appear to moderate the impact of witnessing violence (child abuse,…

  7. Teaching about Domestic Violence: Strategies for Empowerment.

    Science.gov (United States)

    Gardner, Saundra

    1993-01-01

    Offers the author's experiences in teaching a college-level domestic violence sociology course, presenting specific strategies and a description of the syllabus. The course presents a feminist analysis of domestic violence and examines how the patriarchal structure and ideology of society create and perpetuate violence. (SLD)

  8. Domestic hygienic legislation concerning population radiation protection

    International Nuclear Information System (INIS)

    Marej, A.N.

    1984-01-01

    Problems and principles of domestic sanitary legislation, concerning population radiation protection, are considered. The legislation envisages preventive measures, directed to contamination preventation of the main environmental objects, it regulates their content in the objects, their human intake and ionizing radiation doses, which might affect population. Existing domestic hygienic guides and safety standards for personnel and population are enumerated and characterized

  9. Domestic Violence during Pregnancy in India

    Science.gov (United States)

    Mahapatro, Meerambika; Gupta, R. N.; Gupta, Vinay; Kundu, A. S.

    2011-01-01

    Domestic violence can result in many negative health consequences for women's health and well-being. Studies on domestic violence illustrate that abused women in various settings had increased health problems such as injury, chronic pain, gastrointestinal, and gynecological signs including sexually transmitted diseases, depression, and…

  10. Empowering Women with Domestic Violence Experience

    Science.gov (United States)

    Anczewska, Marta; Roszczynska-Michta, Joanna; Waszkiewicz, Justyna; Charzynska, Katarzyna; Czabala, Czeslaw

    2012-01-01

    It is generally held that it has been only recently that domestic violence gained appropriate attention as a major social problem. However several approaches, drawn from different theories are applicable in explaining the origin of this negative phenomenon. It is well recognized that trauma of domestic violence has destructive impact on somatic…

  11. Domestic Violence and Poverty: Some Women's Experiences

    Science.gov (United States)

    Slabbert, Ilze

    2017-01-01

    Purpose: Domestic violence poses a major challenge to social workers. Low-income families are significantly more likely to have to contend with domestic violence, as poverty can act as a fuelling factor in this type of conflict. The objective of this study was to explore and describe the experiences of low-income abused women. Method: A…

  12. Domestic Violence against Married Women in Edirne

    Science.gov (United States)

    Tokuc, Burcu; Ekuklu, Galip; Avcioglu, Serap

    2010-01-01

    The aim of this study is to assess the prevalence and risk factors of domestic violence against married women in Edirne, Turkey. This is a cross-sectional study which included a representative sample of the married women living in the Provincial Center of Edirne. The total past year prevalence of some forms of physical domestic violence is 34% in…

  13. Domestic violence on pregnant women in Turkey.

    Science.gov (United States)

    Ergönen, Akça Toprak; Ozdemir, M Hakan; Can, Ismail Ozgür; Sönmez, Ersel; Salaçin, Serpil; Berberoğlu, Evrim; Demir, Namik

    2009-04-01

    Domestic violence is accepted worldwide as an important health problem. Besides diagnosis and treatment process, there are difficulties when considering of medico-legal evaluation of pregnant women subjected to domestic violence. As a signatory of the ''Convention on the Elimination of All Forms of Discrimination Against Women (CEDAW)'' Turkey has certain commitments regarding domestic violence and made regulations on national law. The purpose of the present study is to demonstrate the prevalence of domestic violence during pregnancy among the women who applied to obstetrics clinics and evaluating of the participants' knowledge level about the legal legislation concerning domestic violence. Pregnant women attending for antenatal care to department of Gynecology and Obstetrics were interviewed using an anonymous and confidential questionnaire. The questionnaire used was a version of Abuse Assessment Screen with guidance of references. 28 (13.4%) women stated that they had been subjected to violence before pregnancy. Only 10 (4.67%) women had stated experience of violence during pregnancy. 148 (69.2%) of them had stated that they had no knowledge about any legislation concerning domestic violence in our country. We believe that society awareness should be increased and the health workers should be informed about their ethical and legal responsibilities concerning domestic violence during pregnancy. The knowledge and sensitivity of health care personnel in Prenatal Clinics and Family Planning Services should be increased and examination protocols should be provided about domestic violence against pregnant women.

  14. WILDLIFE-BASED DOMESTIC TOURISM IN TANZANIA ...

    African Journals Online (AJOL)

    Dr Osondu

    WILDLIFE-BASED DOMESTIC TOURISM IN TANZANIA: EXPERIENCES FROM. NORTHERN ... affecting domestic tourism was carried out in northern Tanzania tourist circuit. .... Serengeti Plains are shared by NCA and the SNP. Normally, in .... communication network) and social services .... motivation to conserve nature.

  15. Perspectives of UK Pakistani women on their behaviour change to prevent type 2 diabetes: qualitative study using the theory domain framework.

    Science.gov (United States)

    Penn, Linda; Dombrowski, Stephan U; Sniehotta, Falko F; White, Martin

    2014-07-08

    Type 2 diabetes (T2D) is a debilitating disease, highly prevalent in UK South Asians, and preventable by lifestyle intervention. The 'New life, New you' (NLNY) physical activity (PA) and dietary intervention for T2D prevention was culturally adapted to better engage minority ethnic populations and tested for feasibility. To investigate Pakistani female participants' perspectives of their behaviour change and of salient intervention features. A community-based 8-week programme of group delivered PA sessions with behavioural counselling and dietary advice, culturally adapted for ethnic minority populations, in an area of socioeconomic deprivation. Participants to NLNY were recruited through screening events in community venues across the town. Interviews were conducted with 20 Pakistani female NLNY participants, aged 26-45 (mean 33.5) years, from different parts of town. Within the a priori Theoretical Domains Framework (intentions and goals, reinforcement, knowledge, nature of the activity, social role and identity, social influences, capabilities and skills, regulation and decision, emotion and environment), we identified the importance of social factors relating to participants' own PA and dietary behaviour change. We also identified cross-cutting themes as collateral benefits of the intervention including participants' 'psychological health'; 'responsibility' (for others' health, especially family members included in the new PA and diet regimes) and 'inclusion' (an ethos of accommodating differences). Our findings suggest that culturally adapted interventions for Pakistani women at risk of T2D, delivered via group PA sessions with counselling and dietary advice, may encourage their PA and dietary behaviour change, and have collateral health and social benefits. The NLNY intervention appeared to be acceptable. We plan to evaluate recruitment, retention and likely effect of the intervention on participant behaviour prior to definitive evaluation. Published by the

  16. Promoting smoking cessation in Bangladeshi and Pakistani male adults: design of a pilot cluster randomised controlled trial of trained community smoking cessation workers

    Directory of Open Access Journals (Sweden)

    Gill Paramjit

    2009-08-01

    Full Text Available Abstract Background The prevalence of smoking is higher among Pakistani and Bangladeshi males than among the general population. Smokers who receive behavioural support and medication quadruple their chances of stopping smoking, but evidence suggests that these populations do not use National Health Service run stop smoking clinics as frequently as would be expected given their high prevalence of smoking. This study aims to tackle some of the main barriers to use of stop smoking services and adherence to treatment programmes by redesigning service delivery to be more acceptable to these adult male populations. The study compares the effectiveness of trained Pakistani and Bangladeshi smoking cessation workers operating in an outreach capacity ('clinic + outreach' with standard care ('clinic only' to improve access to and success of National Health Service smoking cessation services. Methods/design This is a pilot cluster randomised controlled trial based in Birmingham, UK. Super output areas of Birmingham will be identified in which more than 10% of the population are of Pakistani and/or Bangladeshi origin. From these areas, 'natural geographical communities' will be identified. Sixteen aggregated agglomerations of super output areas will be identified, separating areas from each other using buffer regions in order to reduce potential contamination. These natural communities will be randomised to 'clinic + outreach' (intervention or 'clinic only' (control arms. The use of stop smoking services and the numbers of people quitting smoking (defined as prolonged self-reported abstinence at four weeks, three months and six months will be assessed in each area. In addition, we will assess the impact of the intervention on adherence to smoking cessation treatments and patient satisfaction. Trial registration Current Controlled Trials ISRCTN 82127540.

  17. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  18. Autozygosity mapping of a large consanguineous Pakistani family reveals a novel non-syndromic autosomal recessive mental retardation locus on 11p15-tel

    DEFF Research Database (Denmark)

    Rehman, Shoaib ur; Baig, Shahid Mahmood; Eiberg, Hans

    2011-01-01

    done in all sampled individuals in the family. The nuclear central loop in the five generation family showed homozygosity for a 6-Mb telomeric region on 11p15, whereas all other linkage regions were excluded by calculation of logarithm of odds (LOD) for the SNP microarray data. A maximum LOD score of Z......Autosomal recessive inherited mental retardation is an extremely heterogeneous disease and accounts for approximately 25% of all non-syndromic mental retardation cases. Autozygosity mapping of a large consanguineous Pakistani family revealed a novel locus for non-syndromic autosomal recessive...

  19. Domestication and Genetics of Papaya: A Review

    Directory of Open Access Journals (Sweden)

    Mariana Chávez-Pesqueira

    2017-12-01

    Full Text Available A wealth of plant species used by humans for different purposes, but mainly as food, originated and domesticated in the Mesoamerican region. Papaya (Carica papaya is the third most cultivated tropical crop worldwide, and it has been hypothesized that Mesoamerica is the most likely center of its origin and domestication. In support of it, many wild populations of papaya occur throughout Mesoamerica and hence represent the gene pool of genetic variability for further evolution and future crop management. Despite its importance, a dearth of information exists regarding the status of wild populations of papaya, as compared to the extent of knowledge, and interest, on domesticated varieties. We review the evidence on the extant wild populations of papaya, as well as its origin and distribution. Also, we synthetize what is known on the domestication history of the species, including the domestication syndrome that distinguishes wild and domesticated papayas. Moreover, we make an account of the use of genetic markers to assess genetic diversity of wild and domesticated papaya, and discuss the importance of papaya as the first species with a transgenic cultivar to be released for human consumption, and one that has its complete genome sequenced. Evidence from different disciplines strongly suggest that papaya originated and was domesticated in Mesoamerica, and that wild populations in the region possess, still, high genetic diversity compared to the domesticated papaya. Finally, we outline papaya as an excellent model species for genomic studies that will help gain insight into the domestication process and improvement of papaya and other tropical crops.

  20. Effective heart disease prevention: lessons from a qualitative study of user perspectives in Bangladeshi, Indian and Pakistani communities.

    Science.gov (United States)

    Netto, G; McCloughan, L; Bhatnagar, A

    2007-03-01

    Coronary heart disease (CHD) has a high mortality, incidence and prevalence among Indian, Pakistani and Bangladeshi communities in the UK, indicating the need for effective heart disease prevention initiatives for these communities. This paper considers how service user perspectives can be used to develop effective, culturally focused CHD prevention interventions for these target groups by addressing identified barriers, including deeply held cultural beliefs. A qualitative research study, using a longitudinal action research approach. This was a community-based study in Edinburgh. Six focus group discussions--two for each community--were organized with participants from these communities at the beginning of the project. A further six focus group discussions for the same communities were organized six months later. Over the period examined, participants reported varying changes in levels of knowledge relating to the nature, causes and symptoms of CHD. Some participants reported taking slight to significant steps to reduce or prevent heart disease, while others did not. The project was viewed as helpful in increasing knowledge about CHD and preventive measures and encouraging healthier lifestyles. However, persistent barriers to change were also identified, requiring changes to the project that involved not only matching intervention materials and messages to observable, superficial characteristics of the target population, but more fundamental changes that address the cultural, social, historical, environmental and psychological forces that influence health behaviour. CHD prevention initiatives need to identify and respond to deep-rooted influences on health-behaviour in 'at-risk' groups, in addition to superficial characteristics of the target populations. It is important for specific prevention initiatives to be linked into wider CHD frameworks to ensure transferability of learning and integration within wider service provision.

  1. Clinical safety and parameters of maximum oxygen uptake (Vo/sub 2/ max) testing in pakistani patients with heart failure

    International Nuclear Information System (INIS)

    Hussain, S.; Kayani, A.M.

    2015-01-01

    To determine the parameters of maximum oxygen uptake (VO2 max) in a Pakistani systolic heart failure cohort and its safety in a clinical setting. Study Design: Descriptive study. Place and Duration of Study: Armed Forces Institute of Cardiology, National Institute of Heart Diseases, Rawalpindi, from June 2011 to January 2013. Methodology: Maximum oxygen uptake test was performed in patients with severe heart failure, who could perform the VO2 max treadmill test. Age, Body Mass Index (BMI) ejection fraction, VO2 max and respiratory exchange ratios and their correlations were determined. Results: Out of 135 patients, 77% (n=104) were males, with a mean age of 45.9 ± 15.7 years. Weight of patients ranged from 30 kg to 107 kg (mean 63.29 ± 13.6 kg); mean BMI was 23.16 ± 4.56 kg/m2. All patients presented with either NYHA class of III (50.3%; n=68) or IV (49.7%; n=67); mean ejection fraction was 22.54 ± 5.7% (10 - 35%, IQ:20 - 25). The VO2 max of the patients ranged from 3 to 32 ml/kg/minute (mean 12.85 ± 4.49 ml/kg/minute). Respiratory exchange ratio was over 1 for all patients (1.12 - 1.96, mean = 1.36 ± 0.187). There was a negative correlation with age (r = -0.204; p = 0.028) whereas a positive correlation was found with exercise time (r = 0.684; p = 0.000), hemoglobin (r = 0.190; p = 0.047) and ejection fraction (r = 0.187 ; p = 0.044). Conclusion: Cardiopulmonary exercise testing in a high-risk heart failure cohort is safe and provides information beyond the routine clinical evaluation of heart failure patients. (author)

  2. Initiation and adherence to TB treatment in a Pakistani community influenced more by perceptions than by knowledge of tuberculosis

    Directory of Open Access Journals (Sweden)

    Mubashir Zafar

    2013-01-01

    Full Text Available Background: The tuberculosis (TB literature is written almost entirely from a biomedical perspective, while recent studies show that it is imperative to understand lay perception to determine why people seek treatment and may stop taking treatment. Aims: To investigate knowledge about TB, perceptions of (access to TB treatment, and adherence to treatment among a Pakistani population. Setting and Design: Descriptive cross-sectional study. Materials and Methods: A total of 175 participants were selected nonrandomly, 100 were TB patient and 75 were non-TB patient in proportion to the total number of participants in each ward of hospital. Statistical Analysis: Analysis of attitudes and perceptions toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types done by frequency counts and percentages. Regression analysis and logistic regression analysis were performed to test whether differences in age, gender, and education level led to different knowledge scores and different attitudes and preferences toward TB, adherence to TB treatment, health seeking behavior, and TB treatment types. All statistical analyses were performed using Statistical Package for Social Sciences (SPSS 16.0. Result: TB knowledge can be considered fairly well among this community. Respondents′ perceptions suggest that stigma may influence TB patients′ decision in health seeking behavior and adherence to TB treatment. A full 95% of those interviewed believe people with TB tend to hide their TB status out of fear of what others may say. Conclusion: Most of the subjects were unaware of TB that seems to be due to their illiteracy and those who knew had got the knowledge from media, but the majority of the patients who were on directly observed treatment, short-course (DOTS were found to be satisfied.

  3. Traditional Medicine in Developing Countries

    DEFF Research Database (Denmark)

    Thorsen, Rikke Stamp

    or spiritual healer and self-treatment with herbal medicine or medicinal plants. Reliance on traditional medicine varies between countries and rural and urban areas, but is reported to be as high as 80% in some developing countries. Increased realization of the continued importance of traditional medicine has......People use traditional medicine to meet their health care needs in developing countries and medical pluralism persists worldwide despite increased access to allopathic medicine. Traditional medicine includes a variety of treatment opportunities, among others, consultation with a traditional healer...... led to the formulation of policies on the integration of traditional medicine into public health care. Local level integration is already taking place as people use multiple treatments when experiencing illness. Research on local level use of traditional medicine for health care, in particular the use...

  4. Status of domestic uranium industry

    International Nuclear Information System (INIS)

    Chenoweth, W.L.

    1989-01-01

    The domestic uranium industry continues to operate at a reduced level, due to low prices and increased foreign competition. For four years (1984-1987) the Secretary of Energy declared the industry to be nonviable. A similar declaration is expected for 1988. Exploration and development drilling, at the rate of 2 million ft/year, continue in areas of producing mines and recent discoveries, especially in northwestern Arizona, northwestern Nebraska, south Texas, Wyoming, and the Paradox basin of Colorado and Utah. Production of uranium concentrate continues at a rate of 13 to 15 million lb of uranium oxide (U 3 O 8 ) per year. Conventional mining in New Mexico, Arizona, Utah, Colorado, Wyoming, and Texas accounts for approximately 55% of the production. The remaining 45% comes from solution (in situ) mining, from mine water recovery, and as by-products from copper production and the manufacture of phosphoric acid. Solution mining is an important technique in Wyoming, Nebraska, and Texas. By-product production comes from phosphate plants in Florida and Louisiana and a copper mine in Utah. Unmined deposits in areas such as the Grants, New Mexico, district are being investigated for their application to solution mining technology. The discovered uranium resources in the US are quite large, and the potential to discover additional resources is excellent. However, higher prices and a strong market will be necessary for their exploitation

  5. Origin and Domestication of Native Amazonian Crops

    Directory of Open Access Journals (Sweden)

    Doriane Picanço-Rodrigues

    2010-01-01

    Full Text Available Molecular analyses are providing new elements to decipher the origin, domestication and dispersal of native Amazonian crops in an expanding archaeological context. Solid molecular data are available for manioc (Manihot esculenta, cacao (Theobroma cacao, pineapple (Ananas comosus, peach palm (Bactris gasipaes and guaraná (Paullinia cupana, while hot peppers (Capsicum spp., inga (Inga edulis, Brazil nut (Bertholletia excelsa and cupuassu (Theobroma grandiflorum are being studied. Emergent patterns include the relationships among domestication, antiquity (terminal Pleistocene to early Holocene, origin in the periphery, ample pre-Columbian dispersal and clear phylogeographic population structure for manioc, pineapple, peach palm and, perhaps, Capsicum peppers. Cacao represents the special case of an Amazonian species possibly brought into domestication in Mesoamerica, but close scrutiny of molecular data suggests that it may also have some incipiently domesticated populations in Amazonia. Another pattern includes the relationships among species with incipiently domesticated populations or very recently domesticated populations, rapid pre- or post-conquest dispersal and lack of phylogeographic population structure, e.g., Brazil nut, cupuassu and guaraná. These patterns contrast the peripheral origin of most species with domesticated populations with the subsequent concentration of their genetic resources in the center of the basin, along the major white water rivers where high pre-conquest population densities developed. Additional molecular genetic analyses on these and other species will allow better examination of these processes and will enable us to relate them to other historical ecological patterns in Amazonia.

  6. Resilience in Women who Experience Domestic Violence.

    Science.gov (United States)

    Tsirigotis, Konstantinos; Łuczak, Joanna

    2018-03-01

    Violence in the family constitutes a serious social and psychological problem with harmful consequences leading, among others, to changes in the psychological functioning of the victim and, secondarily, also the perpetrator. The aim of this study was to examine resilience in women experiencing domestic violence. The "Ego Resiliency Scale" (ERS) was used to study the group of women suffering domestic violence. The study group included 52 women aged 30-65 years (mean age: 40.15) using assistance of the Crisis Intervention Centre due to experienced domestic violence. They most often reported suffering psychological and physical violence, with the husband or intimate partner being the most common perpetrator. Study women experiencing domestic violence obtained significantly lower scores on the ERS. The lowest scores on the ERS were achieved by women suffering paternal violence, while the highest - by women experiencing violence on the part of the intimate partner. Resilience of study women suffering domestic violence was lower than resilience of the general population, i.e. individuals not experiencing domestic violence. Suffered violence inflicted by the father exerted the greatest adverse impact on resilience. It seems advisable to consider resilience in the process of providing women experiencing domestic violence with psychosocial help.

  7. Major gene mutations in fruit tree domestication

    International Nuclear Information System (INIS)

    Spiegel-Roy, P.

    1989-01-01

    Though fruit gathering from the wild began long before domestication, fruit tree domestication started only after the establishment of grain agriculture. Banana, fig, date, grape and olive were among the first fruit trees domesticated. Most fruit trees are outbreeders, highly heterozygous and vegetatively propagated. Knowledge of genetics and economic traits controlled by major genes is limited. Ease of vegetative propagation has played a prominent part in domestication; advances in propagation technology will play a role in domestication of new crops. Changes toward domestication affected by major genes include self-fertility in peach, apricot and sour cherry, while the emergence of self-fertile almond populations is more recent and due probably to introgression from Amygdalus webbii. Self-compatibility in the sweet cherry has been attained only by pollen irradiation. A single gene controls sex in Vitis. Wild grapes are dioecious, with most domesticated cultivars hermaphrodite, and only a few females. In the papaya changes from dioecism to hermaphroditism have also occurred. Self-compatible systems have also been selected during domestication in Rubus. Changes towards parthenocarpy and seedlessness during domestication occurred in the banana, citrus, grape, fig and pineapple. In the banana, parthenocarpy is due to three complementary dominant genes; stenospermocarpy in the grape depends on two complementary recessive genes; parthenocarpy and sterility in citrus seems more complicated; however, it can be induced in genetic material of suitable background with ease by irradiation. Presence of persistent syconia in the fig is controlled by a mutant allele P dominant to wild +. Thornlessness in blackberry is recessive, while in the pineapple spineless forms are dominant. Changes affecting fruit composition owing to major genes include the disappearance of amygdalin present in bitter almonds (bitter kernel recessive to sweet), shell hardness in almond, and a recessive

  8. Control challenges in domestic heating systems

    DEFF Research Database (Denmark)

    Thybo, Honglian; Larsen, Lars F. S.; Weitzmann, Peter

    2007-01-01

    The objective of this paper is to analyze domestic heating applications and identify unfavorable building constructions and control challenges to be addressed by high performance heating control systems. Heating of domestic houses use a large amount of the total energy consumption in Scandinavia....... Hence the potential of reducing energy consumption by applying high performance control is vast. Indoor climate issues are becoming more in focus, which also leads to a demand for high performance heating systems. The paper presents an analysis of how the building elements of today's domestic houses...... with water based floor heating affect the control challenge. The analysis is documented with simulation results....

  9. Domestication and Breeding of Jatropha curcas L.

    Science.gov (United States)

    Montes, Juan M; Melchinger, Albrecht E

    2016-12-01

    Jatropha curcas L. (jatropha) has a high, untapped potential to contribute towards sustainable production of food and bioenergy, rehabilitation of degraded land, and reduction of atmospheric carbon dioxide. Tremendous progress in jatropha domestication and breeding has been achieved during the past decade. This review: (i) summarizes current knowledge about the domestication and breeding of jatropha; (ii) identifies and prioritizes areas for further research; and (iii) proposes strategies to exploit the full genetic potential of this plant species. Altogether, the outlook is promising for accelerating the domestication of jatropha by applying modern scientific methods and novel technologies developed in plant breeding. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Characteristics and consequences of psychopathic domestic violence

    Directory of Open Access Journals (Sweden)

    Radulović Danka M.

    2005-01-01

    Full Text Available Domestic violence is a problem to which more attention is paid today. However, in its theoretical consideration, as well as in practical reaction, one must not lose sight of characteristics of domestic violence of one, rather numerous category of perpetrators who have psychopathic structure of personality. Domestic violence which offenders are psychopaths must be treated very carefully, because each mistake in intervention can cause much bigger damage to the victim than absence of reaction at all. Due to that, before any intervention, it would be necessary to make a diagnosis on whether the perpetrator has psychopathic structure of personality or not.

  11. EU agricultural domestic support in GTAP

    DEFF Research Database (Denmark)

    Boulanger, Pierre; Philippidis, George; Jensen, Hans Grinsted

    The engagement of JRC IPTS in the GTAP contributing team to the EU domestic support has opened up the opportunity to use the CATS database when compiling EU domestic support payments by member state, which are subsequently calibrated into the GTAP database. To maintain consistency, the GTAP version...... 9 includes EU domestic support which follows the approach adopted in the previous releases (Jensen, 2009, 2010). The difference is for pillar 1 support for which the CATS data are used (in previous GTAP database releases, pillar 1 support was based on EAGF financial reports). All together EU...

  12. Association Between Old Firm Football Matches and Reported Domestic (Violence Incidents in Strathclyde, Scotland

    Directory of Open Access Journals (Sweden)

    Damien J. Williams

    2013-09-01

    Full Text Available Media reports have suggested that the number of reports of domestic violence may increase when Scotland’s two largest, Glasgow-based football (soccer clubs, Rangers and Celtic (traditionally referred to as the “Old Firm” play one another. This study considers the number of domestic (violence incidents reported to Strathclyde Police between 2008 and 2011 in the 24 hours following these matches, and compares it with the number reported during two appropriate comparator periods. There is a statistically significant increase in the number of reports following Old Firm matches compared with the comparator periods. This preliminary analysis confirms previous speculation concerning the association between Old Firm matches and reports of domestic violence, and highlights the need to better understand the factors leading to such violence to inform preventive interventions.

  13. Modern Architecture, Spatial Precarity and the Female Body in the Domestic Spaces in Iran

    Directory of Open Access Journals (Sweden)

    Ladan Rahbari

    2016-12-01

    Full Text Available Iranian home is used as private, semi-private and public spaces. It has kept its traditional functions despite alterations in its structure and is a space for women to engage in caretaking and housekeeping activities. In this paper, I will discuss how modern architecture and its consequences such as the deletion of women-only spaces called Andarooni, has not acknowledged women's appropriation of the domestic space as it is not conformed to the Iranian lifestyle and patterns of social relations. Using ethnography, participant observation and informal conversations with Iranian women, I investigate the characteristics of the contemporary home which reveal how disappearing privateness of the domestic space has contributed to women's precarious bodily freedom in domestic spaces.

  14. Meaning of 9/11 for two Pakistani communities: from external intruders to the internalisation of a negative self-image.

    Science.gov (United States)

    Rousseau, Cécile; Jamil, Uzma

    2008-12-01

    Since September 11, the increase in international tensions and the subsequent wars in Afghanistan and Iraq have created turmoil and fears in immigrant communities, fanned by the media in the context of the war against terrorism. This paper aims to compare the meaning systems evoked around 9/11 within two Pakistani groups-an immigrant community in Montreal and a group in Karachi. It also intends to examine the representation of themselves and of the 'Other' within these two groups. Results suggest that both Karachi and Montreal Pakistani respondents favour a conspiracy scenario which protects the Muslim community from the responsibility of 9/11 events. They refer to an argumentation process based on 'proofs', thus mirroring the political rhetoric used by the US government and its allies to justify the military intervention in Iraq. In the Montreal group, the pervasive feeling of fear and the bleak image that the community has of itself support the hypothesis of an immigrant internalisation of the negative representations of Muslim and South Asian identities in the North American context. The negative self-image observed in these minority groups indicates that more effort than ever should be dedicated to understanding the impact of the present international context on minority-majority relations in multi-ethnic societies. It is as if America is sitting right here in the living room with us … We have to ask them permission to breathe. (Parveen, Karachi).

  15. The Hausa Lexicographic Tradition

    Directory of Open Access Journals (Sweden)

    Roxana Ma Newman

    2011-10-01

    Full Text Available

    Abstract: Hausa, a major language of West Africa, is one of the most widely studied languagesof Sub-Saharan Africa. It has a rich lexicographic tradition dating back some two centuries. Sincethe first major vocabulary published in 1843 up to the present time, almost 60 lexicographic works— dictionaries, vocabularies, glossaries — have been published, in a range of metalanguages, fromEnglish to Hausa itself. This article traces the historical development of the major studies accordingto their type and function as general reference works, specialized works, pedagogical works, andterminological works. For each work, there is a general discussion of its size, accuracy of the phonological,lexical, and grammatical information, and the adequacy of its definitions and illustrativematerial. A complete list of the lexicographic works is included.

    Keywords: ARABIC, BILINGUAL LEXICOGRAPHY, DIALECTAL VARIANTS, DICTIONARIES,ENGLISH, ETYMOLOGIES, FRENCH, GERMAN, GLOSSARIES, GRAMMATICALCATEGORIES, HAUSA, LANGUAGE LEARNING, LOANWORDS, NEOLOGISMS, NIGER,NIGERIA, ORTHOGRAPHY, PHONETIC TRANSCRIPTION, PHONOLOGY, RUSSIAN, STANDARDDIALECT, STANDARDIZATION, TERMINOLOGY, VOCABULARIES, WEST AFRICA.

    Opsomming: Die leksikografiese tradisie in Hausa. Hausa, 'n belangrike taal vanWes-Afrika, is een van die tale van Afrika suid van die Sahara wat die wydste bestudeer word. Dithet 'n ryk leksikografiese tradisie wat ongeveer twee eeue oud is. Van die eerste groot woordeboekwat in 1843 gepubliseer is tot die hede is ongeveer 60 leksikografiese werke — woordeboeke,naamlyste, woordelyste — gepubliseer in 'n reeks metatale van Engels tot Hausa self. Hierdie artikelgaan die historiese ontwikkeling van die groter studies aan die hand van hulle tipe en funksieas algemene naslaanwerke, gespesialiseerde werke, opvoedkundige werke, en terminologiesewerke na. Vir elke werk is daar 'n algemene bespreking oor sy grootte, akkuraatheid van die fonologiese,leksikale en

  16. ‘Elastic band strategy’: women's lived experiences of coping with domestic violence in rural Indonesia

    Science.gov (United States)

    Hayati, Elli Nur; Eriksson, Malin; Hakimi, Mohammad; Högberg, Ulf; Emmelin, Maria

    2013-01-01

    Background Experiencing domestic violence is considered a chronic and stressful life event. A theoretical framework of coping strategies can be used to understand how women deal with domestic violence. Traditional values strongly influenced by religious teachings that interpret men as the leaders of women play an important role in the lives of Javanese women, where women are obliged to obey their husbands. Little is known about how sociocultural and psychosocial contexts influence the ways in which women cope with domestic violence. Objective Our study aimed to deepen our understanding of how rural Javanese women cope with domestic violence. Our objective was to explore how the sociocultural context influences coping dynamics of women survivors of domestic violence in rural Purworejo. Design A phenomenological approach was used to transform lived experiences into textual expressions of the coping dynamics of women survivors of domestic violence. Results Experiencing chronic violence ruined the women's personal lives because of the associated physical, mental, psychosocial, and financial impairments. These chronic stressors led women to access external and internal resources to form coping strategies. Both external and internal factors prompted conflicting impulses to seek support, that is, to escape versus remain in the relationship. This strong tension led to a coping strategy that implied a long-term process of moving between actively opposing the violence and surrendering or tolerating the situation, resembling an elastic band that stretches in and out. Conclusions Women survivors in Purworejo face a lack of institutional support and tend to have traditional beliefs that hamper their potential to stop the abuse. Although the women in this study were educated and economically independent, they still had difficulty mobilizing internal and external support to end the abuse, partly due to internalized gender norms. PMID:23336615

  17. Differences in the pregnancy gestation period and mean birth weights in infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK: a retrospective analysis of routinely collected data.

    Science.gov (United States)

    Garcia, Rebecca; Ali, Nasreen; Guppy, Andy; Griffiths, Malcolm; Randhawa, Gurch

    2017-08-11

    To compare mean birth weights and gestational age at delivery of infants born to Indian, Pakistani, Bangladeshi and white British mothers in Luton, UK. Retrospective analysis using routinely recorded secondary data in Ciconia Maternity information System, between 2008 and 2013. Luton, UK. Mothers whose ethnicity was recorded as white British, Bangladeshi, Pakistani or Indian and living in Luton, aged over 16, who had a live singleton birth over 24 weeks of gestation were included in the analysis (n=14 871). Primary outcome measures were mean birth weight and gestational age at delivery. After controlling for maternal age, smoking, diabetes, gestation age, parity and maternal height and body mass index at booking, a significant difference in infants' mean birth weight was found between white British and Indian, Pakistani and Bangladeshi infants, F(3, 12 287)=300.32, pmothers, compared with Indian mothers (Wald=8.192, df 1, pmothers and preterm delivery, when compared with Pakistani, Bangladeshi and white British women. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  18. USSR Report: Consumer Goods and Domestic Trade

    National Research Council Canada - National Science Library

    1985-01-01

    .... This document contains articles on consumer goods and domestic trade within the USSR. Topics include: consumer goods production and distribution, housing and personal services, and consumer sector policy and economics.

  19. Molecular mechanisms involved in convergent crop domestication.

    Science.gov (United States)

    Lenser, Teresa; Theißen, Günter

    2013-12-01

    Domestication has helped to understand evolution. We argue that, vice versa, novel insights into evolutionary principles could provide deeper insights into domestication. Molecular analyses have demonstrated that convergent phenotypic evolution is often based on molecular changes in orthologous genes or pathways. Recent studies have revealed that during plant domestication the causal mutations for convergent changes in key traits are likely to be located in particular genes. These insights may contribute to defining candidate genes for genetic improvement during the domestication of new plant species. Such efforts may help to increase the range of arable crops available, thus increasing crop biodiversity and food security to help meet the predicted demands of the continually growing global population under rapidly changing environmental conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Deciphering groundwater quality for irrigation and domestic

    Indian Academy of Sciences (India)

    Groundwater quality; irrigation and domestic suitability; ionic balance, Suri I and II ... is important for groundwater planning and management in the study area. ... total hardness (TH), Piper's trilinear diagram and water quality index study.

  1. WILDLIFE-BASED DOMESTIC TOURISM IN TANZANIA ...

    African Journals Online (AJOL)

    Dr Osondu

    industry in Tanzania economy, it has been shown repeatedly ... What factors restrain faster growth of domestic .... needs (i.e. food, clothing and shelter) is no longer ... communication network) and social services ..... Advertising, Promotion and.

  2. presence of cryptococcus species in domestic chicken

    African Journals Online (AJOL)

    2009-05-25

    May 25, 2009 ... POSSIBLE RISK IT POSED TO HUMANS IN KABIGERIET VILLAGE, NAKURU COUNTY, KENYA. E.K. Kemoi, BSc, MSc, ... tree in the Brazilian Amazon rainforest (7). ... Sample collection: Environmental collection of domestic ...

  3. Policy paradigms, transnationalism, and domestic politics

    National Research Council Canada - National Science Library

    Skogstad, Grace Darlene

    2011-01-01

    Policy Paradigms, Transnationalism, and Domestic Politics offers a variety of perspectives on the development of policy paradigms -- the ideas that structure thinking about what can and should be done in a policy domain...

  4. Domestic wastewater treated for agricultural reuse

    African Journals Online (AJOL)

    *

    Four post-treatment systems of an upflow anaerobic sludge blanket (UASB) reactor were ... efficiency in organic matter removal, exception made for polishing ponds (PP) (155 mg.L-1) due ... ption and the domestic sewage discharge into water.

  5. Origin and domestication of Lactuca sativa L.

    NARCIS (Netherlands)

    Vries, de I.M.

    1997-01-01

    The domestication of lettuce, Lactuca sativa L. is described on the basis of literature study. The centre of origin is discussed. A historical survey is made of the distribution of the groups of Lactuca cultivars over the world.

  6. Ending domestic violence against women: assessment of ...

    African Journals Online (AJOL)

    Ending domestic violence against women: assessment of knowledge and ... Methods: A descriptive cross-sectional design was utilized for this study. ... study documented poor knowledge and perception of DV among the studied population.

  7. Eighteen polymorphic microsatellites for domestic pigeon Columba ...

    Indian Academy of Sciences (India)

    certain parasites which cause health problems in humans and domestic animals ... The genomic DNA was isolated using standard protocol as described by ..... panel of polymorphic microsatellite markers in Himalayan monal. Lophophorus ...

  8. Congenital and Genetic Disease in Domestic Animals

    Science.gov (United States)

    Mulvihill, John J.

    1972-01-01

    Reviews observations on domestic animals that have led to the identification of environmental teratogens, and have provided insight into the pathogenesis of congenital defects and genetic diseases in man." (Author/AL)

  9. Origin and Dispersal of Domesticated Peach Palm

    Directory of Open Access Journals (Sweden)

    Charles R. Clement

    2017-11-01

    Full Text Available Peach palm (Bactris gasipaes Kunth is a Neotropical palm domesticated by Native Americans. Its domestication resulted in a set of landraces (var. gasipaes, some with very starchy fruit used for fermentation, others with an equilibrium of starch and oil used as snacks. Which of the three wild types (var. chichagui was involved and where the domestication process began are unclear, with three hypotheses under discussion: an origin in southwestern Amazonia; or in northwestern South America; or multiple origins. We reevaluate one of the wild types, defining it as the incipient domesticate, and then evaluate these hypotheses using the Brazilian peach palm Core Collection and selected herbaria samples to: (1 model the potential distributions of wild and domesticated populations; (2 identify the probable origin of domestication with a phylogeographic analysis of chloroplast DNA sequences; and (3 determine the dispersal routes after domestication using spatial analysis of genetic diversity based on 17 nuclear microsatellite loci. The two very small-fruited wild types have distinct distributions in the northern Andes region and across southern Amazonia, both under moderately humid climates, while the incipient domesticate, partly sympatric with the southern wild type, is also found along the Equatorial Andes, in a more humid climatic envelope, more similar to that of the domesticated landraces. Two distribution models for Last Glacial Maximum conditions (CCSM4, MIROC also suggest distinct distributions for the two wild populations. The chloroplast DNA phylogeographic network confirms the area of sympatry of the incipient domesticate and the southern wild type in southwestern Amazonia as the origin of domestication. The spatial patterns of genetic diversity confirm the proposal of two dispersals, one along the Ucayali River, into western Amazonia, northwestern South America and finally Central America; the other along the Madeira River into central and

  10. Domestication and Genetics of Papaya: A Review

    OpenAIRE

    Mariana Chávez-Pesqueira; Juan Núñez-Farfán

    2017-01-01

    A wealth of plant species used by humans for different purposes, but mainly as food, originated and domesticated in the Mesoamerican region. Papaya (Carica papaya) is the third most cultivated tropical crop worldwide, and it has been hypothesized that Mesoamerica is the most likely center of its origin and domestication. In support of it, many wild populations of papaya occur throughout Mesoamerica and hence represent the gene pool of genetic variability for further evolution and future crop ...

  11. Domestic Hypermedia: Mixed Media in the Home

    DEFF Research Database (Denmark)

    Grønbæk, Kaj; Petersen, Marianne Graves

    2004-01-01

    , domestic materials, such as photos, music, messages. become digitized. Based on the analyses we propose a Domestic Hypermedia infrastructure combining spatial, context-aware and physical hypermedia to support collaborative structuring and ambient presentation of materials in homes.......This paper analyses the potentials for use of hypermedia in homes based on empirical studies. The use of physical materials is characterized by collaborative spatial organization and persistent visual awareness. Qualities that are currently not well supported for digital materials. However...

  12. DOMESTIC VIOLENCE: WHO’S PROBLEM?

    OpenAIRE

    Krizsan, Andrea; Paantjens, Marjolein

    2016-01-01

    This article juxtaposes shifts in prevailing frames on domestic violence in the Netherlands, Hungary and the EU. Domestic violence, first brought on the political agenda by women’s rights proponents as a problem related to gender inequalities, has been framed and re-framed under the influence of mainstream policy makers. The analysis of these frames shows how shifts in the gender of governance, particularly the marginalization of feminist NGO voices, have led to shifts in the governance of ge...

  13. DEFINITION OF DOMESTIC VIOLENCE: CONTENT AND INTERPRETATION

    OpenAIRE

    Kaļiņina, Jeļena

    2017-01-01

    Domestic violence continues to be a global problem that kills and maims – physically, psychologically, sexually and economically. This problem is present in every country, cutting across boundaries of culture, class, education, income, ethnicity and age. Domestic Violence occurs in all kinds of intimate relationships, including married couples, people who are dating, couples who live together, parents, same-sex partners, people who were formerly in a relationship and teen dating relationships...

  14. Whole mitochondrial genome sequencing of domestic horses reveals incorporation of extensive wild horse diversity during domestication

    Directory of Open Access Journals (Sweden)

    Lippold Sebastian

    2011-11-01

    Full Text Available Abstract Background DNA target enrichment by micro-array capture combined with high throughput sequencing technologies provides the possibility to obtain large amounts of sequence data (e.g. whole mitochondrial DNA genomes from multiple individuals at relatively low costs. Previously, whole mitochondrial genome data for domestic horses (Equus caballus were limited to only a few specimens and only short parts of the mtDNA genome (especially the hypervariable region were investigated for larger sample sets. Results In this study we investigated whole mitochondrial genomes of 59 domestic horses from 44 breeds and a single Przewalski horse (Equus przewalski using a recently described multiplex micro-array capture approach. We found 473 variable positions within the domestic horses, 292 of which are parsimony-informative, providing a well resolved phylogenetic tree. Our divergence time estimate suggests that the mitochondrial genomes of modern horse breeds shared a common ancestor around 93,000 years ago and no later than 38,000 years ago. A Bayesian skyline plot (BSP reveals a significant population expansion beginning 6,000-8,000 years ago with an ongoing exponential growth until the present, similar to other domestic animal species. Our data further suggest that a large sample of wild horse diversity was incorporated into the domestic population; specifically, at least 46 of the mtDNA lineages observed in domestic horses (73% already existed before the beginning of domestication about 5,000 years ago. Conclusions Our study provides a window into the maternal origins of extant domestic horses and confirms that modern domestic breeds present a wide sample of the mtDNA diversity found in ancestral, now extinct, wild horse populations. The data obtained allow us to detect a population expansion event coinciding with the beginning of domestication and to estimate both the minimum number of female horses incorporated into the domestic gene pool and the

  15. Reception of the Istrian musical tradition(s

    Directory of Open Access Journals (Sweden)

    Marušić Dario

    2007-01-01

    Full Text Available The successive colonization of Istria with culturally differentiated populations, and peripheral position of the peninsula regarding both the Latin and Slav worlds, has conditioned interesting phenomena which defines the traditional life of the province. On the spiritual level it is primarily reflected in two cultural dimensions: the language and traditional music.

  16. The Spanish reforms on domestic work regulation

    Directory of Open Access Journals (Sweden)

    Elena Desdentado Daroca

    2016-06-01

    Full Text Available This paper analyses the latest Spanish reforms regarding domestic work. The Spanish legislator, doubtlessly influenced by the ILO Domestic Work Convention nº 189 – which, however, was not later ratified in Spain- made a deep reform on domestic work in 2011. This legal reform implied a striking change that affected both working conditions and social security of employees in the family home. The aim of this reform has been to bring the regulation in domestic work closer to the general regulation for other workers, although maintaining certain specialties. Regarding working conditions, their setting as “particular employment relationship” has been held. However, the differences between this relationship and the common ones have been reduced. As for social security, domestic employees have been incorporated into the General Social Security System, but with important specialties, thus erasing the Special Domestic Employees System. The paper also examines the legal changes that have taken place in this field after the new Government arose.

  17. The domestication of Amazonia before European conquest.

    Science.gov (United States)

    Clement, Charles R; Denevan, William M; Heckenberger, Michael J; Junqueira, André Braga; Neves, Eduardo G; Teixeira, Wenceslau G; Woods, William I

    2015-08-07

    During the twentieth century, Amazonia was widely regarded as relatively pristine nature, little impacted by human history. This view remains popular despite mounting evidence of substantial human influence over millennial scales across the region. Here, we review the evidence of an anthropogenic Amazonia in response to claims of sparse populations across broad portions of the region. Amazonia was a major centre of crop domestication, with at least 83 native species containing populations domesticated to some degree. Plant domestication occurs in domesticated landscapes, including highly modified Amazonian dark earths (ADEs) associated with large settled populations and that may cover greater than 0.1% of the region. Populations and food production expanded rapidly within land management systems in the mid-Holocene, and complex societies expanded in resource-rich areas creating domesticated landscapes with profound impacts on local and regional ecology. ADE food production projections support estimates of at least eight million people in 1492. By this time, highly diverse regional systems had developed across Amazonia where subsistence resources were created with plant and landscape domestication, including earthworks. This review argues that the Amazonian anthrome was no less socio-culturally diverse or populous than other tropical forested areas of the world prior to European conquest. © 2015 The Author(s).

  18. A systematic review of treatment response rates in Pakistani hepatitis C virus patients; current prospects and future challenges

    Science.gov (United States)

    Ali, Muhammad; Afzal, Samia; Zia, Asad; Hassan, Ahmed; Khalil, Ali Talha; Ovais, Muhammad; Shinwari, Zabta Khan; Idrees, Muhammad

    2016-01-01

    Abstract Background: The estimated hepatitis C virus (HCV) carriers are approximately 10 million in Pakistan which usually progresses to chronic hepatitis, with rare cases of spontaneous viral eradication. The present article reviews the treatment status of HCV infection in Pakistani population and various factors associated with the treatment response rates. Methods: Literature on anti-HCV therapy was searched in PubMed, Google Scholar and PakMediNet. Thirty three different studies representing different geographic regions of Pakistan published from 2002 to 2016 were included in the present review. Weighted mean, standard error estimates (SE) and standard deviation (SD) were determined for each population group. Results: Mean value for sustained virological response (SVR) for standard IFN plus ribavirin (RBV) combination therapy was 68.38% ± 14.13% (range 33.8%–87.10%; SE 3.08) and pegylated-IFN plus RBV combination therapy 64.38% ± 8.68% (range 55.0%–76.00%; SE 3.88). The lowest value for SVR has been reported to be 24.3% (for genotype 1; administering INF-α 2b 3MU 3 times/week and RBV 1000–1200 mg/day for 48 weeks) while highest of 87.5% (genotype 3a; INF-α 2a 3MU 3 times/week and RBV 1000–1200 mg/day for 24 weeks). The mean value for rapid virological response (RVR) was found to be 48.18% ± 29.20% (SE 9.73). As PEG-interferon and direct acting antivirals (DAAs) are relatively expensive, interferon-alfa (IFN-α) and RBV combination therapy have been used widely to treat HCV infected patients in Pakistan for the last one and half decade. On average, 2.45% of the patients discontinued treatment due to severe side effects. Conclusion: We encourage further studies on understanding host and viral factors associated with specific focus on harder to treat viral variants (relapsers and nonresponders). These variants are currently rising in the country. PMID:27977575

  19. Inclusive Branding Strategies for Domestic Violence Agencies: Embracing Opportunities to Reach and Better Serve Male-Identified Survivors.

    Science.gov (United States)

    Dewey, Morgan; Heiss, Sarah N

    2018-05-01

    Successful strategies for branding that are inclusive of male-identified survivors were identified in this qualitative study through semi-structured interviews with leaders from six domestic violence agencies across the United States: four represented traditional domestic violence agencies and two represented specialized agencies with expertise in providing services to nontraditional survivors. The strategic implementation of (a) inclusive language, (b) visual diversity, (c) community outreach, and (d) communication channels emerged as successful strategies in branding in an inclusive way for male-identified survivors. The implementation of these successful strategies provides the opportunity for domestic violence agencies to create an inclusive environment for male-identified survivors and would contribute to a paradigm shift in how domestic violence is viewed.

  20. Anaerobia Treatments of the domestic residual waters. Limitations potentialities

    International Nuclear Information System (INIS)

    Giraldo Gomez, Eugenio

    1993-01-01

    The quick growth of the Latin American cities has prevented that an appropriate covering of public services is achieved for the whole population, One of the undesirable consequences of this situation is the indiscriminate discharge from the domestic and industrial residual waters to the nearest bodies of water with its consequent deterioration and with disastrous consequences about the ecology and the public health. The developed countries have controlled this situation using systems of purification of the residual waters previously to their discharge in the receptor source. The same as the technology of the evacuation of the served waters, they have become numerous efforts for the application of the purification systems used in the countries developed to the socioeconomic, climatic and cultural conditions of our means. One of the results obtained in these efforts is the economic inability of the municipalities to pay the high investment costs and of operation of the traditional systems for the treatment of the residual waters. Contrary to another type of public services, the treatment of the residual waters needs of appropriate technological solutions for the Climatic and socioeconomic means of the developing countries, One of the technological alternatives for the purification of the residual waters that has had a great development in the last decades has been that of the biological treatments in t anaerobia ambient. The objective of this contribution is to present, to author's trial, the limitations and potentialities of this technology type with special emphasis in the case of the domestic residual waters

  1. FOREIGNIZATION AND DOMESTICATION STRATEGIES IN CULTURAL TERM TRANSLATION OF TOURISM BROCHURES

    Directory of Open Access Journals (Sweden)

    Choirul Fuadi

    2016-09-01

    Full Text Available In translating brochure, a translator has to make a decision on the basis of the message and purpose. The translator is faced by two strategies of translation – foreignization and domestication. The purpose of the study is to examine how the interrelationship between cultural term translation and foreignization or domestication strategy in the cultural term translation of tourism brochure from Indonesian into English. This study used qualitative descriptive with discourse analysis strategy. The note-taking technique is used to identify and classify the data. The objects of the study are tourism brochures from Province of Special Region of Yogyakarta and Central Java in 2015. The findings show that the translation strategies used depend on the translation process. When the cultural terms are familiar, translator tends to use domestication strategy and consider the target text. Translator chooses domestication strategy because try to make tourist understand the text and produce communicative and natural translation. On the other hand, when cultural terms are foreign, translator using foreignization strategy and consider source text. Using foreignization strategy, translator tends to introduce traditional cultural term.Keywords: discourse analysis, foreignization, domestication, cultural category, tourism brochure

  2. How 'Digital' is Traditional Crime?

    NARCIS (Netherlands)

    Montoya, L.; Junger, Marianne; Hartel, Pieter H.

    Measuring how much cybercrime exists is typically done by first defining cybercrime and then quantifying how many cases fit that definition. The drawback is that definitions vary across countries and many cybercrimes are recorded as traditional crimes. An alternative is to keep traditional

  3. University Transition Challenges for First Year Domestic CALD Students from Refugee Backgrounds: A Case Study from an Australian Regional University

    Science.gov (United States)

    Kong, Eric; Harmsworth, Sarah; Rajaeian, Mohammad Mehdi; Parkes, Geoffrey; Bishop, Sue; AlMansouri, Bassim; Lawrence, Jill

    2016-01-01

    Culturally and linguistically diverse (CALD) is used broadly and inclusively to describe communities with diverse language, ethnic background, nationality, dress, traditions, food, societal structures, art and religion characteristics. Domestic CALD people are either refugees or voluntary migrants and have obtained permanent residency or…

  4. Hopeful Thinking: Conceptualizing a Future beyond Domestic Abuse

    Science.gov (United States)

    Zombil, Henri

    2017-01-01

    Domestic violence is a continuing public health problem. Immigrant women facing domestic violence have additional challenges in dealing with domestic violence and accessing services. Hopeful thinking has been identified as a strategy for intervening and surviving beyond domestic violence. The purpose of this multiple descriptive case study was to…

  5. Palm fruit in traditional African food culture.

    Science.gov (United States)

    Atinmo, Tola; Bakre, Aishat Taiwo

    2003-01-01

    The centre of origin of the oil palm is the tropical rain forest region of West Africa. It is considered to be the 200-300 kilometre wide coastal belt between Liberia and Mayumbe. The oil palm tree has remained the 'tree of life' of Yoruba land as well as of other parts of southern West Africa to which it is indigenous. The Yoruba are adept at spinning philosophical and poetical proverbs around such ordinary things as hills, rivers, birds, animals and domestic tools. Hundreds of the traditional proverbs are still with us, and through them one can see the picture of the environment that contributed to the moulding of the thoughts of the people. Yoruba riddles or puzzles were also couched in terms of the environment and the solutions to them were also environmental items. They have a popular saying: A je eran je eran a kan egungun, a je egungun je egungun a tun kan eran: 'A piece of meat has an outer layer of flesh, an intermediate layer of bone and an inner layer of flesh'. What is it? A palm fruit: it has an outer edible layer, the mesocarp; then a layer of shell, inedible, and the kernel inside, edible. The solution to this puzzle summarises the botanical and cultural characteristics of the palm fruit.

  6. Wild genius - domestic fool? Spatial learning abilities of wild and domestic guinea pigs

    Directory of Open Access Journals (Sweden)

    Sachser Norbert

    2010-03-01

    Full Text Available Abstract Background Domestic animals and their wild relatives differ in a wide variety of aspects. The process of domestication of the domestic guinea pig (Cavia aperea f. porcellus, starting at least 4500 years ago, led to changes in the anatomy, physiology, and behaviour compared with their wild relative, the wild cavy, Cavia aperea. Although domestic guinea pigs are widely used as a laboratory animal, learning and memory capabilities are often disregarded as being very scarce. Even less is known about learning and memory of wild cavies. In this regard, one striking domestic trait is a reduction in relative brain size, which in the domesticated form of the guinea pig amounts to 13%. However, the common belief, that such a reduction of brain size in the course of domestication of different species is accomplished by less learning capabilities is not at all very well established in the literature. Indeed, domestic animals might also even outperform their wild conspecifics taking advantage of their adaptation to a man-made environment. In our study we compared the spatial learning abilities of wild and domestic guinea pigs. We expected that the two forms are different regarding their learning performance possibly related to the process of domestication. Therefore wild cavies as well as domestic guinea pigs of both sexes, aged 35 to 45 days, were tested in the Morris water maze to investigate their ability of spatial learning. Results Both, wild cavies and domestic guinea pigs were able to learn the task, proving the water maze to be a suitable test also for wild cavies. Regarding the speed of learning, male as well as female domestic guinea pigs outperformed their wild conspecifics significantly. Interestingly, only domestic guinea pigs showed a significant spatial association of the platform position, while other effective search strategies were used by wild cavies. Conclusion The results demonstrate that domestic guinea pigs do not at all

  7. Wild genius - domestic fool? Spatial learning abilities of wild and domestic guinea pigs.

    Science.gov (United States)

    Lewejohann, Lars; Pickel, Thorsten; Sachser, Norbert; Kaiser, Sylvia

    2010-03-25

    Domestic animals and their wild relatives differ in a wide variety of aspects. The process of domestication of the domestic guinea pig (Cavia aperea f. porcellus), starting at least 4500 years ago, led to changes in the anatomy, physiology, and behaviour compared with their wild relative, the wild cavy, Cavia aperea. Although domestic guinea pigs are widely used as a laboratory animal, learning and memory capabilities are often disregarded as being very scarce. Even less is known about learning and memory of wild cavies. In this regard, one striking domestic trait is a reduction in relative brain size, which in the domesticated form of the guinea pig amounts to 13%. However, the common belief, that such a reduction of brain size in the course of domestication of different species is accomplished by less learning capabilities is not at all very well established in the literature. Indeed, domestic animals might also even outperform their wild conspecifics taking advantage of their adaptation to a man-made environment.In our study we compared the spatial learning abilities of wild and domestic guinea pigs. We expected that the two forms are different regarding their learning performance possibly related to the process of domestication. Therefore wild cavies as well as domestic guinea pigs of both sexes, aged 35 to 45 days, were tested in the Morris water maze to investigate their ability of spatial learning. Both, wild cavies and domestic guinea pigs were able to learn the task, proving the water maze to be a suitable test also for wild cavies. Regarding the speed of learning, male as well as female domestic guinea pigs outperformed their wild conspecifics significantly. Interestingly, only domestic guinea pigs showed a significant spatial association of the platform position, while other effective search strategies were used by wild cavies. The results demonstrate that domestic guinea pigs do not at all perform worse than their wild relatives in tests of spatial

  8. Traditional products: Base for the sustainable development of Serbian animal origin products

    Directory of Open Access Journals (Sweden)

    Stevanović Jasna Lj.

    2016-01-01

    Full Text Available Research results on the diversity of traditional products of animal origin from certain areas of the Republic of Serbia, provides an opportunity to become part of the sustainable quality development, which would be based on their promotion and protection of local resources. Traditional products of animal origin are different and inseparable from the local identity, typical for nation and its food culture. Through confidence-building, and protection from oblivion, the value of domestic products, had preserved trough centuries-old tradition. Nowadays, each domestic product has its own recognisable taste, representing climate of the Republic of Serbia, from which it comes. Universally accepted model of rural institutional structure does not exist. Instead it accommodates and develops in accordance to needs, possibilities and area specific characteristics. By the efficient protection rural models becomes an investment incentives and contribute to general economic and industrial prosperity of the society.

  9. Evolutionary Genomics of Peach and Almond Domestication

    Directory of Open Access Journals (Sweden)

    Dianne Velasco

    2016-12-01

    Full Text Available The domesticated almond [Prunus dulcis (L. Batsch] and peach [P. persica (Mill. D. A. Webb] originated on opposite sides of Asia and were independently domesticated ∼5000 yr ago. While interfertile, they possess alternate mating systems and differ in a number of morphological and physiological traits. Here, we evaluated patterns of genome-wide diversity in both almond and peach to better understand the impacts of mating system, adaptation, and domestication on the evolution of these taxa. Almond has around seven times the genetic diversity of peach, and high genome-wide FST values support their status as separate species. We estimated a divergence time of ∼8 MYA (million years ago, coinciding with an active period of uplift in the northeast Tibetan Plateau and subsequent Asian climate change. We see no evidence of a bottleneck during domestication of either species, but identify a number of regions showing signatures of selection during domestication and a significant overlap in candidate regions between peach and almond. While we expected gene expression in fruit to overlap with candidate selected regions, instead we find enrichment for loci highly differentiated between the species, consistent with recent fossil evidence suggesting fruit divergence long preceded domestication. Taken together, this study tells us how closely related tree species evolve and are domesticated, the impact of these events on their genomes, and the utility of genomic information for long-lived species. Further exploration of this data will contribute to the genetic knowledge of these species and provide information regarding targets of selection for breeding application, and further the understanding of evolution in these species.

  10. Evolutionary Genomics of Peach and Almond Domestication.

    Science.gov (United States)

    Velasco, Dianne; Hough, Josh; Aradhya, Mallikarjuna; Ross-Ibarra, Jeffrey

    2016-12-07

    The domesticated almond [Prunus dulcis (L.) Batsch] and peach [P. persica (Mill.) D. A. Webb] originated on opposite sides of Asia and were independently domesticated ∼5000 yr ago. While interfertile, they possess alternate mating systems and differ in a number of morphological and physiological traits. Here, we evaluated patterns of genome-wide diversity in both almond and peach to better understand the impacts of mating system, adaptation, and domestication on the evolution of these taxa. Almond has around seven times the genetic diversity of peach, and high genome-wide [Formula: see text] values support their status as separate species. We estimated a divergence time of ∼8 MYA (million years ago), coinciding with an active period of uplift in the northeast Tibetan Plateau and subsequent Asian climate change. We see no evidence of a bottleneck during domestication of either species, but identify a number of regions showing signatures of selection during domestication and a significant overlap in candidate regions between peach and almond. While we expected gene expression in fruit to overlap with candidate selected regions, instead we find enrichment for loci highly differentiated between the species, consistent with recent fossil evidence suggesting fruit divergence long preceded domestication. Taken together, this study tells us how closely related tree species evolve and are domesticated, the impact of these events on their genomes, and the utility of genomic information for long-lived species. Further exploration of this data will contribute to the genetic knowledge of these species and provide information regarding targets of selection for breeding application, and further the understanding of evolution in these species. Copyright © 2016 Velasco et al.

  11. Evolutionary Genomics of Peach and Almond Domestication

    Science.gov (United States)

    Velasco, Dianne; Hough, Josh; Aradhya, Mallikarjuna; Ross-Ibarra, Jeffrey

    2016-01-01

    The domesticated almond [Prunus dulcis (L.) Batsch] and peach [P. persica (Mill.) D. A. Webb] originated on opposite sides of Asia and were independently domesticated ∼5000 yr ago. While interfertile, they possess alternate mating systems and differ in a number of morphological and physiological traits. Here, we evaluated patterns of genome-wide diversity in both almond and peach to better understand the impacts of mating system, adaptation, and domestication on the evolution of these taxa. Almond has around seven times the genetic diversity of peach, and high genome-wide FST values support their status as separate species. We estimated a divergence time of ∼8 MYA (million years ago), coinciding with an active period of uplift in the northeast Tibetan Plateau and subsequent Asian climate change. We see no evidence of a bottleneck during domestication of either species, but identify a number of regions showing signatures of selection during domestication and a significant overlap in candidate regions between peach and almond. While we expected gene expression in fruit to overlap with candidate selected regions, instead we find enrichment for loci highly differentiated between the species, consistent with recent fossil evidence suggesting fruit divergence long preceded domestication. Taken together, this study tells us how closely related tree species evolve and are domesticated, the impact of these events on their genomes, and the utility of genomic information for long-lived species. Further exploration of this data will contribute to the genetic knowledge of these species and provide information regarding targets of selection for breeding application, and further the understanding of evolution in these species. PMID:27707802

  12. Association of food security status with overweight and dietary intake: exploration of White British and Pakistani-origin families in the Born in Bradford cohort.

    Science.gov (United States)

    Yang, T C; Sahota, P; Pickett, K E; Bryant, M

    2018-04-24

    Food insecurity has been associated with dietary intake and weight status in UK adults and children although results have been mixed and ethnicity has not been explored. We aimed to compare prevalence and trajectories of weight and dietary intakes among food secure and insecure White British and Pakistani-origin families. At 12 months postpartum, mothers in the Born in Bradford cohort completed a questionnaire on food security status and a food frequency questionnaire (FFQ) assessing their child's intake in the previous month; at 18 months postpartum, mothers completed a short-form FFQ assessing dietary intake in the previous 12 months. Weights and heights of mothers and infants were assessed at 12-, 24-, and 36-months postpartum, with an additional measurement of children taken at 4-5 years. Associations between food security status and dietary intakes were assessed using Wilcoxon-Mann-Whitney for continuous variables and χ 2 or Fisher's exact tests for categorical variables. Quantile and logistic regression were used to determine dietary intakes adjusting for mother's age. Linear mixed effects models were used to assess longitudinal changes in body mass index (BMI) in mothers and BMI z-scores in children. At 12 months postpartum, White British mothers reported more food insecurity than Pakistani-origin mothers (11% vs 7%; p secure (β = 0.44 units, 95% CI: 0.33, 0.55). This was also found in Pakistani-origin children (BMI z-score: food insecure β = 0.40 units, 95% CI: 0.22, 0.59; food secure β = 0.25 units, 95% CI: 0.20, 0.29). No significant increases in BMI were observed for food secure or insecure White British mothers while BMI z-score increased by 0.17 (95% CI: 0.13, 0.21) for food secure White British children. Food insecure mothers and children had dietary intakes of poorer quality, with fewer vegetables and higher consumption of sugar-sweetened drinks. Food security status is associated with body weight and dietary intakes

  13. Dynamic Relationship between Gross Domestic Product and Domestic Investment in Rwanda

    Science.gov (United States)

    Ocaya, Bruno; Ruranga, Charles; Kaberuka, William

    2012-01-01

    This study uses a VAR model to analyse the dynamic relationship between gross domestic product (GDP) and domestic investment (DI) in Rwanda for the period 1970 to 2011. Several selection lag criteria chose a maximum lag of one, and a bivariate VAR(1) model specification in levels was adopted. Unit root tests show that both GDP and DI series are…

  14. Helminthiasis of the domestic-fowl ( Gallus gallus domestics ) and its ...

    African Journals Online (AJOL)

    Helminthiasis of the domestic-fowl ( Gallus gallus domestics ) and its adverse effects on sustainable poultry-meat production in Nigeria. ... This study is a reflection of the case across Nigeria and perhaps the tropical world, where the losses maybe higher because helminthiasis has been reported to be ubitiquous by earlier ...

  15. Human tuberculosis predates domestication in ancient Syria.

    Science.gov (United States)

    Baker, Oussama; Lee, Oona Y-C; Wu, Houdini H T; Besra, Gurdyal S; Minnikin, David E; Llewellyn, Gareth; Williams, Christopher M; Maixner, Frank; O'Sullivan, Niall; Zink, Albert; Chamel, Bérénice; Khawam, Rima; Coqueugniot, Eric; Helmer, Daniel; Le Mort, Françoise; Perrin, Pascale; Gourichon, Lionel; Dutailly, Bruno; Pálfi, György; Coqueugniot, Hélène; Dutour, Olivier

    2015-06-01

    The question of pre-neolithic tuberculosis is still open in paleopathological perspective. One of the major interests is to explore what type of infection could have existed around the early stage of animal domestication. Paleopathological lesions evoking skeletal TB were observed on five human skeletons coming from two PPNB sites in Syria, which belongs to the geographical cradle of agriculture. These sites represent respectively pre-domestication phase (Dja'de el Mughara, Northern Syria, 8800-8300 BCE cal.) and early domestication phase (Tell Aswad, Southern Syria, 8200-7600 BCE cal.). MicroCT scan analyses were performed on two specimens (one per site) and revealed microscopic changes in favor of TB infection. Detection of lipid biomarkers is positive for two specimens (one per site). Initial molecular analysis further indicates the presence of TB in one individual from Dja'de. Interestingly, no morphological evidence of TB was observed on animal remains of wild and newly domesticated species, discovered in these sites. These observations strongly suggest the presence of human tuberculosis before domestication and at its early stages. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Domestic utility attitudes toward foreign uranium supply

    International Nuclear Information System (INIS)

    1981-06-01

    The current embargo on the enrichment of foreign-origin uranium for use in domestic utilization facilities is scheduled to be removed in 1984. The pending removal of this embargo, complicated by a depressed worldwide market for uranium, has prompted consideration of a new or extended embargo within the US Government. As part of its on-going data collection activities, Nuclear Resources International (NRI) has surveyed 50 domestic utility/utility holding companies (representing 60 lead operator-utilities) on their foreign uranium purchase strategies and intentions. The most recent survey was conducted in early May 1981. A number of qualitative observations were made during the course of the survey. The major observations are: domestic utility views toward foreign uranium purchase are dynamic; all but three utilities had some considered foreign purchase strategy; some utilities have problems with buying foreign uranium from particular countries; an inducement is often required by some utilities to buy foreign uranium; opinions varied among utilities concerning the viability of the domestic uranium industry; and many utilities could have foreign uranium fed through their domestic uranium contracts (indirect purchases). The above observations are expanded in the final section of the report. However, it should be noted that two of the observations are particularly important and should be seriously considered in formulation of foreign uranium import restrictions. These important observations are the dynamic nature of the subject matter and the potentially large and imbalanced effect the indirect purchases could have on utility foreign uranium procurement

  17. Unveiling Cebuano Traditional Healing Practices

    Directory of Open Access Journals (Sweden)

    ZachiaRaiza Joy S. Berdon

    2016-02-01

    Full Text Available This study aims to identify the features of Cebuano’s traditional healing practices. Specifically, it also answers the following objectives: analyze traditional healing in Cebuano’s perspectives, explain the traditional healing process practiced in terms of the traditional healers’ belief, and extrapolate perceptions of medical practitioners toward traditional healing. This study made use of qualitative approach, among five traditional healers who performed healing for not less than ten years, in the mountain barangays of Cebu City. These healers served as the primary informants who were selected because of their popularity in healing. The use of open-ended interview in local dialect and naturalistic observation provided a free listing of their verbatim accounts were noted and as primary narratives. Participation in the study was voluntary and participants were interviewed privately after obtaining their consent. The Cebuano traditional healing practices or “panambal” comprise the use of “himolso” (pulse-checking, “palakaw” (petition, “pasubay” (determining what causes the sickness and its possible means of healing, “pangalap” (searching of medicinal plants for “palina” (fumigation, “tayhop” (gentle-blowing, “tutho” (saliva-blowing,“tuob” (boiling, “orasyon” (mystical prayers, “hilot” (massage, and “barang” (sorcery. Though traditional with medical science disapproval, it contributes to a mystical identity of Cebuano healers, as a manifestation of folk Catholicism belief, in order to do a good legacy to the community that needs help. For further study, researchers may conduct further the studies on the: curative effects of medicinal plants in Cebu, psychological effect pulsechecking healed persons by the mananambal, and unmasking the other features of traditional healing.

  18. Aurorae in Australian Aboriginal Traditions

    Science.gov (United States)

    Hamacher, Duane W.

    2013-07-01

    Transient celestial phenomena feature prominently in the astronomical knowledge and traditions of Aboriginal Australians. In this paper, I collect accounts of the Aurora Australis from the literature regarding Aboriginal culture. Using previous studies of meteors, eclipses, and comets in Aboriginal traditions, I anticipate that the physical properties of aurora, such as their generally red colour as seen from southern Australia, will be associated with fire, death, blood, and evil spirits. The survey reveals this to be the case and also explores historical auroral events in Aboriginal cultures, aurorae in rock art, and briefly compares Aboriginal auroral traditions with other global indigenous groups, including the Maori of New Zealand.

  19. Estimating risk of atherosclerotic cardiovascular diseases in non-atherosclerotic Pakistani patients: Study conducted at National Institute of Cardiovascular Diseases, Karachi, Pakistan

    International Nuclear Information System (INIS)

    Ashraf, T.; Achakzai, A.S.; Farooq, F.; Memon, M.A.

    2017-01-01

    This cross-sectional study was carried out at the National Institute of Cardiovascular Disease, Karachi, from July 2014 to March 2015, and comprised male and female subjects with multi-ethnic background, aged 20-79 years and having non-atherosclerotic disease. SPSS 22 was used for data analysis. Results: Of the 437 participants, 174(39.8%) were men and 263(60.2%) were women. The overall mean age was 42.65+-11.45 years. The mean age of men was 43.3+-12.1 years and that of women was 42.2+-10.8 years. Moreover, ten-year and lifetime risk assessment rates were higher in men (50[28.2%] and 86[49.4%] respectively) compared to women (28[10.6%] and 84[31.9%], respectively). Conclusion: Urdu-speaking Pakistanis were found to be at higher risk from atherosclerotic cardiovascular disease.

  20. Association of body fat and vitamin D status and the effect of body fat on the response to vitamin D supplementation in Pakistani immigrants in Denmark

    DEFF Research Database (Denmark)

    Grønborg, Ida Marie; Lundby, M.; Mølgaard, C.

    2015-01-01

    Vitamin D deficiency and obesity are both prevalent conditions in the northern countries, especially among immigrants. The aims were to assess the possible relationship between body fat and vitamin D status, and to investigate the effect of body fat on the response to oral vitamin D supplementation...... in Pakistani immigrants in Denmark. Data were obtained from a 1-year double-blind randomised controlled trial with oral vitamin D supplementation. A total of 122 women and men received either vitamin D3 supplementation (10 or 20 μg/day) or placebo. No association was found between body fat percentage...... and vitamin D status in a multiple linear regression model (Passociation between body fat percentage and vitamin D status, and body fat percentage had...