Alterations of the TP53 Gene in Gastric and Esophageal Carcinogenesis
Directory of Open Access Journals (Sweden)
Marilanda Ferreira Bellini
2012-01-01
Full Text Available TP53 genes is one of more important tumor suppressor gene, which acts as a potent transcription factor with fundamental role in the maintenance of genetic stability. The development of esophageal and gastric cancers is a multistep process resulting in successive accumulation of genetic alterations that culminates in the malignant transformation. Thus, this study highlights the participation of the main genetic alterations of the TP53 gene in esophageal and gastric carcinogenesis. Among these changes, high frequency of TP53 mutations, loss of heterozygosity (LOH, overexpression of the p53 protein, and consequently loss of p53 function, which would be early events in esophageal and gastric cancers, as well as an important biomarker of the prognosis and treatment response. Furthermore, Single Nucleotide Polymorphisms (SNPs of TP53 have been implicated in the development and prognosis of several cancers, mainly TP53 codon 72 polymorphism whose role has been extensively studied in relation to susceptibility for esophageal and gastric cancer development.
Sonkin, Dmitriy
2015-01-01
eLife digest Damaged cells in the human body can develop into tumors if left unchecked. TP53 (also called p53) is a protein that normally helps to repair or eliminate these damaged cells and prevent tumors from forming. About half of all cancerous tumors have mutations that prevent TP53 from working. In tumors with normal TP53 (called TP53 wild type tumors), another protein that acts to keep TP53 in check is often overly active. This overactive protein (called MDM2) prevents TP53 from suppres...
Directory of Open Access Journals (Sweden)
Tao Lu
2017-01-01
Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.
Phylogenetic analysis of human Tp53 gene using computational ...
African Journals Online (AJOL)
The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...
Gaining insights into the codon usage patterns of TP53 gene across eight mammalian species.
Directory of Open Access Journals (Sweden)
Tarikul Huda Mazumder
Full Text Available TP53 gene is known as the "guardian of the genome" as it plays a vital role in regulating cell cycle, cell proliferation, DNA damage repair, initiation of programmed cell death and suppressing tumor growth. Non uniform usage of synonymous codons for a specific amino acid during translation of protein known as codon usage bias (CUB is a unique property of the genome and shows species specific deviation. Analysis of codon usage bias with compositional dynamics of coding sequences has contributed to the better understanding of the molecular mechanism and the evolution of a particular gene. In this study, the complete nucleotide coding sequences of TP53 gene from eight different mammalian species were used for CUB analysis. Our results showed that the codon usage patterns in TP53 gene across different mammalian species has been influenced by GC bias particularly GC3 and a moderate bias exists in the codon usage of TP53 gene. Moreover, we observed that nature has highly favored the most over represented codon CTG for leucine amino acid but selected against the ATA codon for isoleucine in TP53 gene across all mammalian species during the course of evolution.
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Kashofer, Karl; Regauer, Sigrid
2017-08-01
This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.
DEFF Research Database (Denmark)
Silveira, Cássia G T; Oliveira, Fábio M; Valera, Elvis T
2009-01-01
Myelodysplastic syndrome (MDS) is a rare hematological malignancy in children. It was performed FISH analysis in 19 pediatric MDS patients to investigate deletions involving the PPARgamma and TP53 genes. Significant losses in the PPARgamma gene and deletions in the tumor suppressor gene TP53 were...
TP53 Mutations in Nonsmall Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Akira Mogi
2011-01-01
Full Text Available The tumor suppressor gene TP53 is frequently mutated in human cancers. Abnormality of the TP53 gene is one of the most significant events in lung cancers and plays an important role in the tumorigenesis of lung epithelial cells. Human lung cancers are classified into two major types, small cell lung cancer (SCLC and nonsmall cell lung cancer (NSCLC. The latter accounts for approximately 80% of all primary lung cancers, and the incidence of NSCLC is increasing yearly. Most clinical studies suggest that NSCLC with TP53 alterations carries a worse prognosis and may be relatively more resistant to chemotherapy and radiation. A deep understanding of the role of TP53 in lung carcinogenesis may lead to a more reasonably targeted clinical approach, which should be exploited to enhance the survival rates of patients with lung cancer. This paper will focus on the role of TP53 in the molecular pathogenesis, epidemiology, and therapeutic strategies of TP53 mutation in NSCLC.
Fischer, Martin; Grossmann, Patrick; Padi, Megha; DeCaprio, James A
2016-07-27
Cell cycle (CC) and TP53 regulatory networks are frequently deregulated in cancer. While numerous genome-wide studies of TP53 and CC-regulated genes have been performed, significant variation between studies has made it difficult to assess regulation of any given gene of interest. To overcome the limitation of individual studies, we developed a meta-analysis approach to identify high confidence target genes that reflect their frequency of identification in independent datasets. Gene regulatory networks were generated by comparing differential expression of TP53 and CC-regulated genes with chromatin immunoprecipitation studies for TP53, RB1, E2F, DREAM, B-MYB, FOXM1 and MuvB. RNA-seq data from p21-null cells revealed that gene downregulation by TP53 generally requires p21 (CDKN1A). Genes downregulated by TP53 were also identified as CC genes bound by the DREAM complex. The transcription factors RB, E2F1 and E2F7 bind to a subset of DREAM target genes that function in G1/S of the CC while B-MYB, FOXM1 and MuvB control G2/M gene expression. Our approach yields high confidence ranked target gene maps for TP53, DREAM, MMB-FOXM1 and RB-E2F and enables prediction and distinction of CC regulation. A web-based atlas at www.targetgenereg.org enables assessing the regulation of any human gene of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo
2010-01-01
The causal role of work-related exposure to wood dust in the development of sinonasal cancer has long been established by numerous epidemiologic studies. To study molecular changes in these tumors, we analyzed TP53 gene mutations in 358 sinonasal cancer cases with or without occupational exposure...... affected the ORs only slightly. Smoking did not influence the occurrence of TP53 mutation; however, it was associated with multiple mutations (p = 0.03). As far as we are aware, this is the first study to demonstrate a high prevalence of TP53 mutation-positive cases in a large collection of sinonasal...... cancers with data on occupational exposure. Our results indicate that mutational mechanisms, in particular TP53 mutations, are associated with work-related exposure to wood dust in sinonasal cancer....
TP53 gene status affects survival in advanced mycosis fungoides
Directory of Open Access Journals (Sweden)
Gitte Wooler
2016-11-01
Full Text Available TP53 is frequently mutated in different types of neoplasms including leukemia and lymphomas. Mutations of TP53 have also been reported in mycosis fungoides (MF, the most common type of cutaneous lymphoma. However, little is known about the frequency, spectrum of mutations and their prognostic significance in MF. In this study we have optimized the protocol for Sanger sequencing of TP53 using DNA extracted from archival paraffin-embedded biopsies. Of 19 samples from patients with stage IIB MF or higher, 31% harboured mutations in TP53. Overall survival of the patients with mutated TP53 was significantly shorter than median survival in the age- and stage-matched patients treated in our Institution. Distribution of mutations was heterogenous in TP53 exons, however C>T transitions were common suggesting the causal role of ultraviolet radiation. We propose that TP53 mutation status would be useful for risk stratification of patients with advanced MF.
A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.
Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado
2017-11-01
Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.
Apsalikov, Bakytbek; Manambaeva, Zukhra; Ospanov, Erlan; Massabayeva, Meruyert; Zhabagin, Kuantkan; Zhagiparova, Zhanar; Maximov, Vladymir; Voropaeva, Elena; Apsalikov, Kazbek; Belikhina, Tatiana; Abdrahmanov, Ramil; Cherepkova, Elena; Tanatarov, Sayat; Massadykov, Adilzhan; Urazalina, Naylia
2016-01-01
Frequencies of polymorphisms of genes BRCA1 and TP53 in breast cancer (BC) patients with a BC family history and radiation history were assessed and compared in the Semey region of Kazakhstan. The study included 60 women directly irradiated by the activities of the Semipalatinsk test site with a calculated effective equivalent dose of 500 mSv and their first generation descendants (group BC+Her+Exp); 65 women with family BC and absence of radiological history - the effective equivalent dose due to anthropogenic sources not exceeding 50 mSv (group BC+Her-Exp). The comparison group consisted of 65 women patients with breast cancer without family and radiological history (BC-Her-Exp). The control group comprised 60 women without breast cancer and without family and radiological history (nonBC). We carried out the genotyping of the polymorphisms c.2311T>C, c.4308T>C and 5382insC of the BRCA1 gene and rs1042522 of the TP53 gene. The frequency of the polymorphism c.2311T>C was significantly higher in patients of the group BC+Her+Exp than in healthy women, and of the polymorphism 5382insC in BC+Her+Exp compared to all other groups. The frequency of the rs1042522 polymorphism of TP53 was significantly higher in all groups of patients with breast cancer compared with the control group. Differences between groups of women with breast cancer were significant only in BC+Her+Exp vs. BC+Her-Exp. Combinations of polymorphisms of the genes BRCA1 and TP53 predominated in women with a family and radiological history.
Directory of Open Access Journals (Sweden)
Momoko Ishimine
2018-01-01
Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.
Dong, Zhiyong; Zheng, Longzhi; Liu, Weimin; Wang, Cunchuan
2018-01-01
The relationship between TP53 codon 72 Pro/Arg gene polymorphism and colorectal cancer risk in Asians is still controversial, and this bioinformatics analysis and meta-analysis was performed to assess the associations. The association studies were identified from PubMed, and eligible reports were included. RevMan 5.3.1 software, Oncolnc, cBioPortal, and Oncomine online tools were used for statistical analysis. A random/fixed effects model was used in meta-analysis. The data were reported as risk ratios or mean differences with corresponding 95% CI. We confirmed that TP53 was associated with colorectal cancer, the alteration frequency of TP53 was 53% mutation and 7% deep deletion, and TP53 mRNA expression was different in different types of colorectal cancer based on The Cancer Genome Atlas database. Then, 18 studies were included that examine the association of TP53 codon 72 gene polymorphism with colorectal cancer risk in Asians. The meta-analysis indicated that TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asian population, but Arg/Arg genotype was not (Pro allele: odds ratios [OR]=1.20, 95% CI: 1.06 to 1.35, P =0.003; Pro/Pro genotype: OR=1.39, 95% CI: 1.15 to 1.69, P =0.0007; Arg/Arg genotype: OR=0.86, 95% CI: 0.74 to 1.00, P =0.05). Interestingly, in the meta-analysis of the controls from the population-based studies, we found that TP53 codon 72 Pro/Arg gene polymorphism was associated with colorectal cancer risk (Pro allele: OR=1.33, 95% CI: 1.15 to 1.55, P =0.0002; Pro/Pro genotype: OR=1.61, 95% CI: 1.28 to 2.02, P colorectal cancer, but the different value levels of mRNA expression were not associated with survival rate of colon and rectal cancer. TP53 Pro allele and Pro/Pro genotype were associated with colorectal cancer risk in Asians.
Clinical Impact of TP53 Gene Mutations in Diffuse Large B-Cell Lymphoma (DLBCL)
DEFF Research Database (Denmark)
Young, Ken H; Patten, Nancy; Truong, Sim
2009-01-01
Mutations of the TP53 tumor suppressor gene are associated with a poor clinical outcome in DLBCL patients treated with CHOP. The impact of TP53 mutations on clinical outcome of DLBCL patients treated with Rituxan-CHOP has not been comprehensively analyzed. The purpose of this study was to analyze...
Directory of Open Access Journals (Sweden)
Magali Olivier
2007-02-01
Full Text Available
The tumor suppressor gene TP53 is frequently inactivated by gene mutations in many types of human sporadic cancers, and inherited TP53 mutations predispose to a wide spectrum of early-onset tumors (Li-Fraumeni et Li-Fraumenilike Syndromes. All TP53 gene variations (somatic and germline mutations, as well as polymorphisms that are reported in the scientific literature or in SNP databases are compiled in the IARC TP53 Database. This database provides structured data and analysis tools to study mutation patterns in human cancers and cell-lines and to investigate the clinical impact of mutations. It contains annotations related to the clinical and pathological characteristics of tumors, as well as the demographics and carcinogen exposure of patients. The IARC TP53 web site (53.iarc.fr/">http://www-p53.iarc.fr/ provides a search interface for the core database and includes a comprehensive user guide, a slideshow on TP53 mutations in human cancer, protocols and references for sequencing TP53 gene, and links to relevant publications and bioinformatics databases. The database interface allows download of entire data sets and propose various tools for the selection, analysis and downloads of specific sets of data according to user's query.
Recently, new annotations on the functional properties of mutant p53 proteins have been integrated in this database. Indeed, the most frequent TP53 alterations observed in cancers (75% are missense mutations that result in the production of a mutant protein that differ from the wildtype by one single amino-acid. The characterization of the biological activities of these mutant proteins is thus very important. Over the last ten years, a great amount of systematic data has been generated from experimental assays performed in
Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba
2016-02-01
Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Kucab, Jill E; Zwart, Edwin P; van Steeg, Harry; Luijten, Mirjam; Schmeiser, Heinz H; Phillips, David H; Arlt, Volker M
2016-03-01
3-Nitrobenzanthrone (3-NBA) is a highly mutagenic compound and possible human carcinogen found in diesel exhaust. 3-NBA forms bulky DNA adducts following metabolic activation and induces predominantly G:CT:A transversions in a variety of experimental systems. Here we investigated the influence of nucleotide excision repair (NER) on 3-NBA-induced mutagenesis of the human tumour suppressor gene TP53 and the reporter gene lacZ. To this end we utilised Xpa -knockout (Xpa-Null) human TP53 knock-in (Hupki) embryo fibroblasts (HUFs). As Xpa is essential for NER of bulky DNA adducts, we hypothesized that DNA adducts induced by 3-NBA would persist in the genomes of Xpa-Null cells and lead to an increased frequency of mutation. The HUF immortalisation assay was used to select for cells harbouring TP53 mutations following mutagen exposure. We found that Xpa-Null Hupki mice and HUFs were more sensitive to 3-NBA treatment than their wild-type (Xpa-WT) counterparts. However, following 3-NBA treatment and immortalisation, a similar frequency of TP53-mutant clones arose from Xpa-WT and Xpa-Null HUF cultures. In cells from both Xpa genotypes G:CT:A transversion was the predominant TP53 mutation type and mutations exhibited bias towards the non-transcribed strand. Thirty-two percent of 3-NBA-induced TP53 mutations occurred at CpG sites, all of which are hotspots for mutation in smokers' lung cancer (codons 157, 158, 175, 245, 248, 273, 282). We also examined 3-NBA-induced mutagenesis of an integrated lacZ reporter gene in HUFs, where we again observed a similar mutant frequency in Xpa-WT and Xpa-Null cells. Our findings suggest that 3-NBA-DNA adducts may evade removal by global genomic NER; the persistence of 3-NBA adducts in DNA may be an important factor in its mutagenicity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Molecular Characterization of TP53 Gene in Human Populations Exposed to Low-Dose Ionizing Radiation
Directory of Open Access Journals (Sweden)
Igor Brasil-Costa
2013-01-01
Full Text Available Ionizing radiation, such as that emitted by uranium, may cause mutations and consequently lead to neoplasia in human cells. The TP53 gene acts to maintain genomic integrity and constitutes an important biomarker of susceptibility. The present study investigated the main alterations observed in exons 4, 5, 6, 7, and 8 of the TP53 gene and adjacent introns in Amazonian populations exposed to radioactivity. Samples were collected from 163 individuals. Occurrence of the following alterations was observed: (i a missense exchange in exon 4 (Arg72Pro; (ii 2 synonymous exchanges, 1 in exon 5 (His179His, and another in exon 6 (Arg213Arg; (iii 4 intronic exchanges, 3 in intron 7 (C → T at position 13.436; C → T at position 13.491; T → G at position 13.511 and 1 in intron 8 (T → G at position 13.958. Alteration of codon 72 was found to be an important risk factor for cancer development (P=0.024; OR=6.48; CI: 1.29–32.64 when adjusted for age and smoking. Thus, TP53 gene may be an important biomarker for carcinogenesis susceptibility in human populations exposed to ionizing radiation.
Low Prevalence of TP53 Mutations and MDM2 Amplifications in Pediatric Rhabdomyosarcoma
Directory of Open Access Journals (Sweden)
Simona Ognjanovic
2012-01-01
Full Text Available The tumor suppressor gene TP53 is the most commonly mutated gene in human cancer. The reported prevalence of mutations in rhabdomyosarcoma (RMS varies widely, with recent larger studies suggesting that TP53 mutations in pediatric RMS may be extremely rare. Overexpression of MDM2 also attenuates p53 function. We have performed TP53 mutation/MDM2 amplification analyses in the largest series analyzed thus far, including DNA isolated from 37 alveolar and 38 embryonal RMS tumor samples obtained from the Cooperative Human Tissue Network (CHTN. Available samples were frozen tumor tissues (N=48 and histopathology slides. TP53 mutations in exons 4–9 were analyzed by direct sequencing in all samples, and MDM2 amplification analysis was performed by differential PCR on a subset of 22 samples. We found only one sample (1/75, 1.3% carrying a TP53 mutation at codon 259 (p.D259Y and no MDM2 amplification. Two SNPs in the TP53 pathway, associated with accelerated tumor onset in germline TP53 mutation carriers, (TP53 SNP72 (rs no. 1042522 and MDM2 SNP309 (rs no. 2279744, were not found to confer earlier tumor onset. In conclusion, we confirm the extremely low prevalence of TP53 mutations/MDM2 amplifications in pediatric RMS (1.33% and 0%, respectively. The possible inactivation of p53 function by other mechanisms thus remains to be elucidated.
TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells
Directory of Open Access Journals (Sweden)
Nikolett Sándor
2015-10-01
Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.
Directory of Open Access Journals (Sweden)
Camila S. Hamú
2007-12-01
Full Text Available A leucemia mielóide crônica (LMC é uma doença proliferativa do sistema hematopoiético, caracterizada pela expansão clonal de uma célula-tronco primitiva e pluripotente denominada stem cell. Este tipo de leucemia está associado, em 90% dos casos, à translocação t(9;22(q34;q11. Essa alteração cromossômica estrutural codifica para uma proteína quimérica BCR-ABL, que confere às células leucêmicas uma alta resistência à morte, independente do agente indutor desse processo. A proteína p53 é uma reguladora transcricional induzida por danos no DNA, fato que resulta na parada do ciclo celular com conseqüente ativação de mecanismos de reparo ou mesmo na indução à apoptose. As mutações no gene TP53 são as alterações genéticas mais comuns em tumores malignos humanos. O presente estudo teve como objetivo genotipar e determinar a freqüência alélica do polimorfismo do TP53 no códon 72 (arginina - Arg e prolina - Pro, em pacientes com suspeita de LMC, pela Reação em Cadeia da Polimerase. Desta forma, os resultados indicaram que 73,4% (23/30 dos pacientes apresentaram homozigose para arginina (Arg/Arg e 26,6% (7/30 heterozigose (Arg/Pro. Não foi encontrado nenhum paciente homozigoto para prolina (Pro/Pro. Os resultados obtidos sugerem que o polimorfismo do gene TP53 no códon 72 não é um fator de risco importante para a iniciação, promoção e progressão da LMC.Chronic myeloid leukemia (CML is a proliferative disorder of the hematopoietic system characterized by clonal expansion of a primitive and pluripotent stem cell. In this type of leukemia, up to 90% of all cases is associated to a specific chromosomal translocation, t(9;22(q34;q11. The genomic alteration results in a chimeric protein, BCR-ABL, that confers a high resistance leukemia cells to death, independent of the induction mechanism of this process. Protein p53 is a transcriptional factor expressed after DNA damage which ceases cell cycle progression and
Energy Technology Data Exchange (ETDEWEB)
Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)
2015-04-28
Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.
CNPY2 promoted the proliferation of renal cell carcinoma cells and increased the expression of TP53
International Nuclear Information System (INIS)
Taniguchi, Hidefumi; Ito, Saya; Ueda, Takashi; Morioka, Yukako; Kayukawa, Naruhiro; Ueno, Akihisa; Nakagawa, Hideo; Fujihara, Atsuko; Ushijima, So; Kanazawa, Motohiro; Hongo, Fumiya; Ukimura, Osamu
2017-01-01
Renal cell carcinoma (RCC) is the most common type of kidney cancer. However, the mechanisms underlying the progression of the disease are not well understood. The data in this report suggest that canopy FGF signaling regulator 2 (CNPY2) is a promoter of RCC progression. We found that CNPY2 significantly promoted growth of RCC cells and upregulated TP53 gene expression. Although TP53 is widely known as a tumor suppressor, in RCC TP53 promoted tumor cell growth. A typical p53 target gene, CDKN1A, was upregulated by both p53 and CNPY2 in RCC cells, suggesting that CNPY2 increased the expression level of TP53. Consistent with these results, CNPY2 and TP53 expression levels were positively correlated in RCC patients. These findings suggested that CNPY2 promoted cancer cell growth in RCC through regulating TP53 gene expression. - Highlights: • CNPY2 promoted growth of renal cell carcinoma (RCC) cells. • TP53 expression levels were increased by CNPY2 in RCC cells. • Growth of RCC cells was promoted by TP53. • CNPY2 expression positively correlated with TP53 expression in RCC patients.
Badal, Brateil; Solovyov, Alexander; Di Cecilia, Serena; Chan, Joseph Minhow; Chang, Li-Wei; Iqbal, Ramiz; Aydin, Iraz T.; Rajan, Geena S.; Chen, Chen; Abbate, Franco; Arora, Kshitij S.; Tanne, Antoine; Gruber, Stephen B.; Johnson, Timothy M.; Fullen, Douglas R.; Phelps, Robert; Bhardwaj, Nina; Bernstein, Emily; Ting, David T.; Brunner, Georg; Schadt, Eric E.; Greenbaum, Benjamin D.; Celebi, Julide Tok
2017-01-01
BACKGROUND. Melanoma is a heterogeneous malignancy. We set out to identify the molecular underpinnings of high-risk melanomas, those that are likely to progress rapidly, metastasize, and result in poor outcomes. METHODS. We examined transcriptome changes from benign states to early-, intermediate-, and late-stage tumors using a set of 78 treatment-naive melanocytic tumors consisting of primary melanomas of the skin and benign melanocytic lesions. We utilized a next-generation sequencing platform that enabled a comprehensive analysis of protein-coding and -noncoding RNA transcripts. RESULTS. Gene expression changes unequivocally discriminated between benign and malignant states, and a dual epigenetic and immune signature emerged defining this transition. To our knowledge, we discovered previously unrecognized melanoma subtypes. A high-risk primary melanoma subset was distinguished by a 122-epigenetic gene signature (“epigenetic” cluster) and TP53 family gene deregulation (TP53, TP63, and TP73). This subtype associated with poor overall survival and showed enrichment of cell cycle genes. Noncoding repetitive element transcripts (LINEs, SINEs, and ERVs) that can result in immunostimulatory signals recapitulating a state of “viral mimicry” were significantly repressed. The high-risk subtype and its poor predictive characteristics were validated in several independent cohorts. Additionally, primary melanomas distinguished by specific immune signatures (“immune” clusters) were identified. CONCLUSION. The TP53 family of genes and genes regulating the epigenetic machinery demonstrate strong prognostic and biological relevance during progression of early disease. Gene expression profiling of protein-coding and -noncoding RNA transcripts may be a better predictor for disease course in melanoma. This study outlines the transcriptional interplay of the cancer cell’s epigenome with the immune milieu with potential for future therapeutic targeting. FUNDING
Directory of Open Access Journals (Sweden)
Selda Aydin
Full Text Available In the Balkan and Taiwan, the relationship between exposure to aristolochic acid and risk of urothelial neoplasms was inferred from the A>T genetic hallmark in TP53 gene from malignant cells. This study aimed to characterize the TP53 mutational spectrum in urothelial cancers consecutive to Aristolochic Acid Nephropathy in Belgium. Serial frozen tumor sections from female patients (n=5 exposed to aristolochic acid during weight-loss regimen were alternatively used either for p53 immunostaining or laser microdissection. Tissue areas with at least 60% p53-positive nuclei were selected for microdissecting sections according to p53-positive matching areas. All areas appeared to be carcinoma in situ. After DNA extraction, mutations in the TP53 hot spot region (exons 5-8 were identified using nested-PCR and sequencing. False-negative controls consisted in microdissecting fresh-frozen tumor tissues both from a patient with a Li-Fraumeni syndrome who carried a p53 constitutional mutation, and from KRas mutated adenocarcinomas. To rule out false-positive results potentially generated by microdissection and nested-PCR, a phenacetin-associated urothelial carcinoma and normal fresh ureteral tissues (n=4 were processed with high laser power. No unexpected results being identified, molecular analysis was pursued on malignant tissues, showing at least one mutation in all (six different mutations in two patients, with 13/16 exonic (nonsense, 2; missense, 11 and 3/16 intronic (one splice site mutations. They were distributed as transitions (n=7 or transversions (n=9, with an equal prevalence of A>T and G>T (3/16 each. While current results are in line with A>T prevalence previously reported in Balkan and Taiwan studies, they also demonstrate that multiple mutations in the TP53 hot spot region and a high frequency of G>T transversion appear as a complementary signature reflecting the toxicity of a cumulative dose of aristolochic acid ingested over a short period
DEFF Research Database (Denmark)
Schildkraut, Joellen M; Goode, Ellen L; Clyde, Merlise A
2009-01-01
The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829...
IDH1/IDH2 but Not TP53 Mutations Predict Prognosis in Bulgarian Glioblastoma Patients
Directory of Open Access Journals (Sweden)
Gergana Stancheva
2014-01-01
Full Text Available Mutations in genes encoding isocitrate dehydrogenase isoforms 1 (IDH1 and 2 (IDH2 have been associated with good prognosis for patients with brain neoplasias and have been commonly found together with mutated TP53 gene. To determine the prevalence of IDH1, IDH2, and TP53 mutations and their impact on overall survival 106 glioblastoma patients were analysed. IDH1 mutations were detected in 13 and IDH2 mutation in one patient. Two homozygous samples with R132H mutation in IDH1 gene and a novel aberration K129R in IDH2 gene were found. Sixty-four percent of IDH1/IDH2 mutated tumours harboured also a mutation in TP53 gene. Genetic aberrations in TP53 were present in 37 patients. Statistical analysis of the impact of the studied factors on the overall survival showed that the mutations in IDH1/IDH2, but not the ones in TP53, were associated with longer survival. Also, the impact of age on prognosis was confirmed. This is the first comprehensive study on glioblastomas in Bulgaria. Our results suggest that IDH1/IDH2 but not TP53 mutations together with other prognostic factors such as age might be applied in clinical practice for prediction of outcome in patients with glioblastomas.
Limited importance of the dominant-negative effect of TP53 missense mutations
International Nuclear Information System (INIS)
Stoczynska-Fidelus, Ewelina; Liberski, Pawel P; Rieske, Piotr; Szybka, Malgorzata; Piaskowski, Sylwester; Bienkowski, Michal; Hulas-Bigoszewska, Krystyna; Banaszczyk, Mateusz; Zawlik, Izabela; Jesionek-Kupnicka, Dorota; Kordek, Radzislaw
2011-01-01
Heterozygosity of TP53 missense mutations is related to the phenomenon of the dominant-negative effect (DNE). To estimate the importance of the DNE of TP53 mutations, we analysed the percentage of cancer cases showing a single heterozygous mutation of TP53 and searched for a cell line with a single heterozygous mutation of this gene. This approach was based on the knowledge that genes with evident DNE, such as EGFR and IDH1, represent nearly 100% of single heterozygous mutations in tumour specimens and cell lines. Genetic analyses (LOH and sequencing) performed for early and late passages of several cell lines originally described as showing single heterozygous TP53 mutations (H-318, G-16, PF-382, MOLT-13, ST-486 and LS-123). Statistical analysis of IARC TP53 and SANGER databases. Genetic analyses of N-RAS, FBXW7, PTEN and STR markers to test cross-contamination and cell line identity. Cell cloning, fluorescence-activated cell sorting and SSCP performed for the PF-382 cell line. A database study revealed TP53 single heterozygous mutations in 35% of in vivo (surgical and biopsy) samples and only 10% of cultured cells (in vitro), although those numbers appeared to be overestimated. We deem that published in vivo TP53 mutation analyses are not as rigorous as studies in vitro, and we did not find any cell line showing a stable, single heterozygous mutation. G16, PF-382 and MOLT-13 cells harboured single heterozygous mutations temporarily. ST-486, H-318 and LS-123 cell lines were misclassified. Specific mutations, such as R175H, R273H, R273L or R273P, which are reported in the literature to exert a DNE, showed the lowest percentage of single heterozygous mutations in vitro (about 5%). We suggest that the currently reported percentage of TP53 single heterozygous mutations in tumour samples and cancer cell lines is overestimated. Thus, the magnitude of the DNE of TP53 mutations is questionable. This scepticism is supported by database investigations showing that retention
TP53 mutations in clinically normal mucosa adjacent to oral carcinomas
DEFF Research Database (Denmark)
Thode, Christenze; Bilde, Anders; von Buchwald, Christian
2010-01-01
BACKGROUND: The tumour-suppressor protein p53 often accumulates in histologically normal epithelium adjacent to oral squamous cell carcinomas (OSCC). We investigated whether this was associated with mutations in TP53, the gene for p53, and might implicate impending malignancy. METHODS: Specimens...... products were separated by denatured gradient gel electrophoresis. Fragments with a deviant DGEE pattern were sequenced. RESULTS: TP53 mutations were found in six of 18 tumours. Fourteen specimens contained histologically normal mucosa adjacent to the tumour; 13 of these showed small clusters of p53...
TP53 codon 72 polymorphism in pigmentary phenotypes
Indian Academy of Sciences (India)
2012-01-20
Jan 20, 2012 ... pigmentation by acting as a transcription factor for other genes that are ... skin phototype I-II, burns after exposure to UVR and the development of .... morphisms of TP53 codon 72 with breast carcinoma risk: evidence from ...
International Nuclear Information System (INIS)
Shao Guoguang; Liu Linlin; Xu Chuanjie
2005-01-01
Objective: To study the association of polymorphism in TP53 gene with the susceptibility and radiation sensitivity of non-small-cell-lung cancer (NSCLC) of the population in the North of China. Methods: Using RFLP-PCR assays, TP53 genotypes were detected by amplifying DNA fragments with sequence specific primers and digested by FnuD II enzyme in 88 patients with NSCLC as well as 112 healthy controls. Results: The C/C allele frequency was significantly higher in NSCLC patients than that in the healthy controls (χ 2 =5.65, P=0.017). The C/C genotype frequency was significantly higher in NSCLC patients than that of the healthy controls (χ 2 =9.33, P=0.0023). The risk of C/C homozygotes in NSCLC patients was about 2.7 times against G/G homozygotes with odds ratio of 2.43(95% CI=1.32-4.51). Conclusion: In the population in the North of China, TP53 C/C genotype is closely associated with the susceptibility of NSCLC. There is no significant relationship between the polymorphism in TP53 gene and radiation sensitivity in NSCLC. (authors)
Suda, Tetsuji; Yoshihara, Mitsuyo; Nakamura, Yoshiyasu; Sekiguchi, Hironobu; Godai, Ten-I; Sugano, Nobuhiro; Tsuchida, Kazuhito; Shiozawa, Manabu; Sakuma, Yuji; Tsuchiya, Eiju; Kameda, Yoichi; Akaike, Makoto; Matsukuma, Shoichi; Miyagi, Yohei
2011-07-01
MDM4, a homolog of MDM2, is considered a key negative regulator of p53. Gene amplification of MDM4 has been identified in a variety of tumors. MDM2 or MDM4 gene amplification is only associated with the wild-type TP53 gene in retinoblastomas, thus the amplification of the two genes is mutually exclusive. Previously, we demonstrated that MDM2 amplification and TP53 alteration were not mutually exclusive in colorectal cancer, and we identified a subset of colorectal cancer patients without alterations in either the TP53 or the MDM2 gene. In this study, we investigated the gene amplification status of MDM4 in the same set of colorectal cancer cases. Unexpectedly, MDM4 amplification was rare, detected in only 1.4% (3 out of 211) of colorectal cancer cases. All the three gene-amplified tumors also harbored TP53-inactivating mutations. This contradicts the simple mutually exclusive relationship observed in retinoblastomas. Surprisingly, two of the three MDM4-amplified tumors also demonstrated MDM2 amplification. Paradoxically, the MDM4 protein levels were decreased in the tumor tissue of the gene-amplified cases compared with levels in the matched normal mucosa. We speculate that MDM4 might play a role in colorectal carcinogenesis that is not limited to negative regulation of p53 in combination with MDM2. The functional significance of MDM4 is still unclear and further studies are needed.
Directory of Open Access Journals (Sweden)
Mariana Maschietto
Full Text Available The presence of diffuse anaplasia in Wilms tumours (DAWT is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information.We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32 and gene expression (n = 36 arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling.From the 40 cases, 22 (55% had TP53 mutations (2 detected only after deep-sequencing, 20 of which also had 17p loss (91%; 18 (45% cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25 had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR, 3.89; 95% confidence interval (CI, 1.26-16.0 and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7 compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03. These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes.This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.
Maschietto, Mariana; Williams, Richard D; Chagtai, Tasnim; Popov, Sergey D; Sebire, Neil J; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R; Grundy, Paul; Dome, Jeffrey S; Pritchard-Jones, Kathy
2014-01-01
The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26-16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.
TP53 dysfunction in CLL: Implications for prognosis and treatment.
Te Raa, Gera D; Kater, Arnon P
2016-03-01
Despite the availability of novel targeted agents, TP53 defects remain the most important adverse prognostic factor in chronic lymphocytic leukemia (CLL). Detection of deletion of TP53 locus (17p deletion) by fluorescent in situ hybridization (FISH) has become standard and performed prior to every line of treatment as the incidence dramatically increases as relapses occur. As monoallelic mutations of TP53 equally affect outcome, novel methods are being developed to improve detection of TP53 defects and include next-generation sequencing (NGS) and functional assays. TP53 defects highly affect outcome of immunochemotherapy but also alter response durations of tyrosine kinase inhibitors. Although BCR-targeting agents and Bcl-2-inhibitos have achieved durable responses in some patients with TP53 defects, long-term follow-up is currently lacking. In this review biological and clinical consequences of TP53 dysfunction as well as applicability of currently available methods to detect TP53 defects are described. In addition, proposed novel therapeutic strategies specifically for patients with TP53 dysfunction are discussed. In summary, the only curative treatment option for TP53-defective CLL is still allogeneic hematopoietic stem cell transplantation. Other treatment strategies such as rationale combinations of agents with different (TP53 independent) targets, including kinase inhibitors and inhibitors of anti-apoptotic molecules but also immunomodulatory agents need to be further explored. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pediatric oncologist willingness to offer germline TP53 testing in osteosarcoma.
Shaul, Eliana; Roth, Michael; Lo, Yungtai; Geller, David S; Hoang, Bang; Yang, Rui; Malkin, David; Gorlick, Richard; Gill, Jonathan
2018-03-15
Li-Fraumeni syndrome (LFS) is a cancer predisposition syndrome caused by mutations in the tumor-suppressor gene TP53. Osteosarcoma is a sentinel cancer in LFS. Prior studies using Sanger sequencing platforms have demonstrated that 3% of individuals with osteosarcoma harbor a mutation in TP53. New data from next-generation sequencing have demonstrated that 3.8% of patients with osteosarcoma have a known pathogenic variant, and an additional 5.7% carry exonic variants of unknown significance in TP53. Pediatric oncologists were e-mailed an anonymous 18-question survey assessing their willingness to offer TP53 germline testing to a child with osteosarcoma with or without a family history, and they were evaluated for changes in their choices with the prior data and the new data. One hundred seventy-seven pediatric oncologists (22%) responded to the survey. Respondents were more likely to offer TP53 testing to a patient with a positive family history (77.4% vs 12.4%; P offer TP53 testing once they were provided with the new data (25.4% vs 12.4%; P = .0038). The proportion of providers who responded that they were unsure increased significantly when they were presented with the new data (25.4% vs 10.2%; P = .0002). Potential implications for other family members and the possibility that surveillance imaging would detect new malignancies at an earlier stage were important factors influencing a provider's decision to offer TP53 testing. Recent data increase the proportion of providers willing to offer testing, and this suggests concern on the part of pediatric oncologists that variants of unknown significance may be disease-defining in rare cancers. Cancer 2018;124:1242-50. © 2018 American Cancer Society. © 2018 American Cancer Society.
Knockdown of HSPA9 induces TP53-dependent apoptosis in human hematopoietic progenitor cells.
Directory of Open Access Journals (Sweden)
Tuoen Liu
Full Text Available Myelodysplastic syndromes (MDS are the most common adult myeloid blood cancers in the US. Patients have increased apoptosis in their bone marrow cells leading to low peripheral blood counts. The full complement of gene mutations that contribute to increased apoptosis in MDS remains unknown. Up to 25% of MDS patients harbor and acquired interstitial deletion on the long arm of chromosome 5 [del(5q], creating haploinsufficiency for a large set of genes including HSPA9. Knockdown of HSPA9 in primary human CD34+ hematopoietic progenitor cells significantly inhibits growth and increases apoptosis. We show here that HSPA9 knockdown is associated with increased TP53 expression and activity, resulting in increased expression of target genes BAX and p21. HSPA9 protein interacts with TP53 in CD34+ cells and knockdown of HSPA9 increases nuclear TP53 levels, providing a possible mechanism for regulation of TP53 by HSPA9 haploinsufficiency in hematopoietic cells. Concurrent knockdown of TP53 and HSPA9 rescued the increased apoptosis observed in CD34+ cells following knockdown of HSPA9. Reduction of HSPA9 below 50% results in severe inhibition of cell growth, suggesting that del(5q cells may be preferentially sensitive to further reductions of HSPA9 below 50%, thus providing a genetic vulnerability to del(5q cells. Treatment of bone marrow cells with MKT-077, an HSPA9 inhibitor, induced apoptosis in a higher percentage of cells from MDS patients with del(5q compared to non-del(5q MDS patients and normal donor cells. Collectively, these findings indicate that reduced levels of HSPA9 may contribute to TP53 activation and increased apoptosis observed in del(5q-associated MDS.
Genetic variation in the TP53 pathway and bladder cancer risk. a comprehensive analysis.
Directory of Open Access Journals (Sweden)
Silvia Pineda
Full Text Available Germline variants in TP63 have been consistently associated with several tumors, including bladder cancer, indicating the importance of TP53 pathway in cancer genetic susceptibility. However, variants in other related genes, including TP53 rs1042522 (Arg72Pro, still present controversial results. We carried out an in depth assessment of associations between common germline variants in the TP53 pathway and bladder cancer risk.We investigated 184 tagSNPs from 18 genes in 1,058 cases and 1,138 controls from the Spanish Bladder Cancer/EPICURO Study. Cases were newly-diagnosed bladder cancer patients during 1998-2001. Hospital controls were age-gender, and area matched to cases. SNPs were genotyped in blood DNA using Illumina Golden Gate and TaqMan assays. Cases were subphenotyped according to stage/grade and tumor p53 expression. We applied classical tests to assess individual SNP associations and the Least Absolute Shrinkage and Selection Operator (LASSO-penalized logistic regression analysis to assess multiple SNPs simultaneously.Based on classical analyses, SNPs in BAK1 (1, IGF1R (5, P53AIP1 (1, PMAIP1 (2, SERINPB5 (3, TP63 (3, and TP73 (1 showed significant associations at p-value≤0.05. However, no evidence of association, either with overall risk or with specific disease subtypes, was observed after correction for multiple testing (p-value≥0.8. LASSO selected the SNP rs6567355 in SERPINB5 with 83% of reproducibility. This SNP provided an OR = 1.21, 95%CI 1.05-1.38, p-value = 0.006, and a corrected p-value = 0.5 when controlling for over-estimation.We found no strong evidence that common variants in the TP53 pathway are associated with bladder cancer susceptibility. Our study suggests that it is unlikely that TP53 Arg72Pro is implicated in the UCB in white Europeans. SERPINB5 and TP63 variation deserve further exploration in extended studies.
Directory of Open Access Journals (Sweden)
Shadia Muhammad Ihlaseh
2007-02-01
Full Text Available INTRODUÇÃO: Microdissecção e captura a laser (MCL é uma técnica de desenvolvimento recente que permite a coleta de células individuais ou pequeno conjunto de células para análise molecular. Atualmente, no Brasil, há raros microscópios para MCL, de modo que a divulgação dos procedimentos inerentes a essa técnica é oportuna para destacar seu amplo potencial para diagnóstico e investigação. OBJETIVO: Este trabalho descreve a padronização dos procedimentos de MCL e de extração de DNA de material fixado em formalina e incluído em parafina. MATERIAL E MÉTODOS: Foram estudados o éxon 8 do gene TP53 e o gene da ciclofilina em amostras de tecido normal e de neoplasias de fígado e rim provenientes de modelo de carcinogênese química induzida em rato. A extração do DNA foi comprovada por reação em cadeia da polimerase (nested-PCR. RESULTADOS: Foram padronizados os procedimentos de preparo dos cortes histológicos, de microdissecção e captura a laser e de obtenção de seqüências gênicas pela reação de nested-PCR para tecidos incluídos em parafina. Obtivemos amplificação de 48,3% das amostras para o éxon 8 do gene TP53 e 51,7% para o gene da ciclofilina. Considerando pelo menos um dos dois segmentos gênicos, foram amplificadas 79,3% das amostras. DISCUSSÃO E CONCLUSÃO: A extração de DNA de tecidos fixados em formalina e incluídos em parafina e a técnica de nested-PCR foram adequadamente padronizadas para produtos gênicos de interesse, obtidos de material coletado por MCL. Esses procedimentos podem ser úteis para a obtenção de seqüências de DNA de arquivos para análise molecular.BACKGORUND: Laser-capture micro-dissection (LCM is a recently developed procedure that provides single cells or specific cell groups for molecular analysis. Currently, there are few LCM systems in Brazil, in such a way that it is necessary to disseminate the technical procedures inherent to the methodology, and also to
Paget, Vincent; Lechevrel, Mathilde; André, Véronique; Le Goff, Jérémie; Pottier, Didier; Billet, Sylvain; Garçon, Guillaume; Shirali, Pirouz; Sichel, François
2012-01-01
Mutations in the TP53 gene are the most common alterations in human tumours. TP53 mutational patterns have sometimes been linked to carcinogen exposure. In hepatocellular carcinoma, a specific G>T transversion on codon 249 is classically described as a fingerprint of aflatoxin B1 exposure. Likewise G>T transversions in codons 157 and 158 have been related to tobacco exposure in human lung cancers. However, controversies remain about the interpretation of TP53 mutational pattern in tumours as the fingerprint of genotoxin exposure. By using a functional assay, the Functional Analysis of Separated Alleles in Yeast (FASAY), the present study depicts the mutational pattern of TP53 in normal human fibroblasts after in vitro exposure to well-known carcinogens: benzo[a]pyrene, aflatoxin B1 and acetaldehyde. These in vitro patterns of mutations were then compared to those found in human tumours by using the IARC database of TP53 mutations. The results show that the TP53 mutational patterns found in human tumours can be only partly ascribed to genotoxin exposure. A complex interplay between the functional impact of the mutations on p53 phenotype and the cancer natural history may affect these patterns. However, our results strongly support that genotoxins exposure plays a major role in the aetiology of the considered cancers. PMID:22319594
Bilateral wilms tumor with TP53-related anaplasia.
Popov, Sergey D; Vujanic, Gordan M; Sebire, Neil J; Chagtai, Tasnim; Williams, Richard; Vaidya, Sucheta; Pritchard-Jones, Kathy
2013-01-01
Wilms tumor (WT) with diffuse anaplasia has an unfavorable prognosis and is often (>70%) associated with mutations in the TP53 gene. Although most WTs are unilateral, 5-10% are bilateral, and they are almost always present with nephrogenic rests. The latter are considered a precursor of WT. Two cases of bilateral WTs with nephroblastomatosis, in which anaplastic changes were detected over a period of time, were analyzed using clinical, radiological, histopathological, and molecular-genetic data. TP53 was analyzed by direct sequencing of its full coding sequence and intron-exon boundaries in 11 fragments. DNA was extracted from paraffin-embedded or frozen specimens. High-resolution genomic copy number profiling was carried out by UCL Genomics on the Affymetrix Human Mapping 250K Nsp or Genome-Wide Human SNP Array 6.0 platform. Both cases demonstrated a strong association between the appearance of anaplastic clones and TP53 mutations. Synchronous ganglioneuroma was diagnosed in one case. Our cases are unique as they represent a long disease history and demonstrate the difficulties in managing rare cases of bilateral WT with anaplasia. These cases also emphasize the practical importance of modern molecular-genetic techniques and their clinical application. Moreover, they highlight the issue of the adequate sampling needed in order to gather comprehensive, efficient, and sufficient information about genetic events in a single tumor.
Bioinformatics and phylogenetic analysis of human Tp73 gene ...
African Journals Online (AJOL)
The Tp73 gene encoding p73 protein belongs to the Tp53 gene family and it functions in the initiation of cell-cycle arrest or apoptosis and also involves in regulating a series of pathways including breast cancer, neuroblastoma and cholorectal cancer. New discoveries about the control and function of p73 are still in progress ...
Siddamalla, Swapna; Reddy, Tumu Venkat; Govatati, Suresh; Guruvaiah, Praveen; Deenadayal, Mamata; Shivaji, Sisinthy; Bhanoori, Manjula
2018-05-24
Polycystic Ovary Syndrome (PCOS) is a heterogeneous multifactorial endocrine metabolic disorder. In addition to hyperandrogenism, acne, hirsutism, obesity, oligoanovulation and infertility, insulin resistance is also a common feature in women of PCOS. Tumor suppressor genes (TSGs) perform essential function in the maintenance of genomic stability and regulatory pathways influencing the activity of several replication and transcription factors. The main aim of this study was to investigate the association of Single Nucleotide Polymorphisms of TP53, BRCA1and BRCA2 genes with the susceptibility to PCOS in South Indian women. Present study investigated association between TP53 gene (rs1042522 G/C), BRCA1 (rs71361504 -/GTT, rs3092986 T/C) and BRCA2 (rs206118 A/G) and, SNPs and PCOS risk. Genotyping of TSGs was carried out on DNA from PCOS patients (n = 110) and controls (n = 130) of South Indian origin by polymerase chain reaction (PCR) and confirmed by sequencing analysis. The genotype frequency and allele distributions of cases and controls were analyzed using Fisher's exact test. Haplotype frequencies for multiple loci and the standardized disequilibrium coefficient (D') for pair wise linkage disequilibrium (LD) were assessed by Haploview Software. Significant increase in frequencies ofTP53 (rs1042522 G/C), BRCA1 (rs71361504 -/GTT, rs3092986 T/C) genotypes and alleles in patients compared to controls. In addition, the frequency of the C/T (P = 0.002) and A/C (P = 0.012) haplotype was also significantly elevated in patients. But BRCA2 (rs206118 A/G) did not show significant association with PCOS. The TP53 and BRCA1 may constitute an inheritable risk factor for PCOS in South Indian women. Copyright © 2018 Elsevier B.V. All rights reserved.
Mutation screening of the TP53 gene by temporal temperature gradient gel electrophoresis.
Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise
2005-01-01
A protocol for detection of mutations in the TP53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques denaturing gradient gel electrophoresis (DGGE) and constant denaturant gel electrophoresis (CDGE) and eliminates some of the problems. The result is a rapid and sensitive screening technique that is robust and easily set up in smaller laboratory environments.
Mutation screening of the TP53 gene by temporal temperature gel electrophoresis (TTGE).
Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise
2014-01-01
A protocol for detection of mutations in the TP53 gene using temporal temperature gradient electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques, denaturing gradient gel electrophoresis and constant denaturant gel electrophoresis, and eliminates some of the problems. The result is a rapid and sensitive screening technique which is robust and easily set up in smaller laboratory environments.
DEFF Research Database (Denmark)
Stecher, Chalotte Willemann; Grønbaek, Kirsten; Hasle, Henrik
2008-01-01
A 20-month-old boy presented with precocious puberty due to a Leydig cell tumor, and at the age of 6 years with a primitive neuroectodermal brain-tumor (PNET). A novel splice site mutation of the TP53-gene, likely to be associated with a nonfunctional protein, was found in the proband, his father...
Mutations and polymorphisms in TP53 gene--an overview on the role in colorectal cancer
Czech Academy of Sciences Publication Activity Database
Naccarati, Alessio; Poláková, Veronika; Pardini, Barbara; Vodičková, Ludmila; Hemminki, K.; Kumar, R.; Vodička, Pavel (ed.)
2012-01-01
Roč. 27, č. 2 (2012), s. 211-218 ISSN 0267-8357 R&D Projects: GA ČR GP305/09/P194; GA ČR GAP304/10/1286 Grant - others:GA UK(CZ) GA96908/B/2008 Institutional research plan: CEZ:AV0Z50390512 Keywords : TP53 mutations * TP53 polymorphisms * cancer risk Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.500, year: 2012
Directory of Open Access Journals (Sweden)
Pamela Valva
2009-02-01
Full Text Available Mutations in the gene TP53, which codifies the tumor suppressor protein p53, are found in about 50% of tumors. These mutations can occur not only at somatic level, but also in germline. Pediatric cancer patients, mostly with additional family history of malignancy, should be considered as potential TP53 germline mutation carriers. Germline TP53 mutations and polymorphisms have been widely studied to determine their relation with different tumors' pathogenesis. Our aim was to analyze the occurrence frequency of germline TP53 mutations and polymorphisms and to relate these to tumor development in a pediatric series. Peripheral blood mononuclear cell samples from 26 children with solid tumors [PST] and 21 pediatric healthy donors [HD] were analyzed for germline mutations and polymorphisms in TP53 gene spanning from exon 5 to 8 including introns 5 and 7. These PCR amplified fragments were sequenced to determine variations. A heterozygous mutation at codon 245 was found in 1/26 PST and 0/21 HD. Comparative polymorphisms distribution, at position 14181 and 14201(intron 7, between HD and PST revealed a trend of association (p= 0.07 with cancer risk. HD group disclosed a similar polymorphism distribution as published data for Caucasian and Central/South American populations. This is the first study about TP53 variant frequency and distribution in healthy individuals and cancer patients in Argentina.El gen que codifica para la proteína supresora de tumor p53 (TP53 se encuentra mutado en aproximadamente el 50% de los tumores. Estas mutaciones pueden presentarse como somáticas o en línea germinal. Los niños con tumores, sobre todo aquellos con historia familiar de enfermedad oncológica, deben considerarse potenciales portadores de mutaciones en línea germinal. Las mutaciones de TP53 y los polimorfismos son estudiados para determinar su relación con la patogénesis de diferentes tumores. El objetivo del trabajo fue analizar la frecuencia de
Ooms, Ariadne H A G; Gadd, Samantha; Gerhard, Daniela S; Smith, Malcolm A; Guidry Auvil, Jaime M; Meerzaman, Daoud; Chen, Qing-Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J; Moore, Richard A; Marra, Marco A; Huff, Vicki; Dome, Jeffrey S; Chi, Yueh-Yun; Tian, Jing; Geller, James I; Mullighan, Charles G; Ma, Jing; Wheeler, David A; Hampton, Oliver A; Walz, Amy L; van den Heuvel-Eibrink, Marry M; de Krijger, Ronald R; Ross, Nicole; Gastier-Foster, Julie M; Perlman, Elizabeth J
2016-11-15
To investigate the role and significance of TP53 mutation in diffusely anaplastic Wilms tumors (DAWTs). All DAWTs registered on National Wilms Tumor Study-5 (n = 118) with available samples were analyzed for TP53 mutations and copy loss. Integrative genomic analysis was performed on 39 selected DAWTs. Following analysis of a single random sample, 57 DAWTs (48%) demonstrated TP53 mutations, 13 (11%) copy loss without mutation, and 48 (41%) lacked both [defined as TP53-wild-type (wt)]. Patients with stage III/IV TP53-wt DAWTs (but not those with stage I/II disease) had significantly lower relapse and death rates than those with TP53 abnormalities. In-depth analysis of a subset of 39 DAWTs showed seven (18%) to be TP53-wt: These demonstrated gene expression evidence of an active p53 pathway. Retrospective pathology review of TP53-wt DAWT revealed no or very low volume of anaplasia in six of seven tumors. When samples from TP53-wt tumors known to contain anaplasia histologically were available, abnormal p53 protein accumulation was observed by immunohistochemistry. These data support the key role of TP53 loss in the development of anaplasia in WT, and support its significant clinical impact in patients with residual anaplastic tumor following surgery. These data also suggest that most DAWTs will show evidence of TP53 mutation when samples selected for the presence of anaplasia are analyzed. This suggests that modifications of the current criteria to also consider volume of anaplasia and documentation of TP53 aberrations may better reflect the risk of relapse and death and enable optimization of therapeutic stratification. Clin Cancer Res; 22(22); 5582-91. ©2016 AACR. ©2016 American Association for Cancer Research.
Valproic acid treatment response in vitro is determined by TP53 status in medulloblastoma.
Mascaro-Cordeiro, Bruna; Oliveira, Indhira Dias; Tesser-Gamba, Francine; Pavon, Lorena Favaro; Saba-Silva, Nasjla; Cavalheiro, Sergio; Dastoli, Patrícia; Toledo, Silvia Regina Caminada
2018-05-22
Histone deacetylate inhibitors (HDACi), as valproic acid (VA), have been reported to enhance efficacy and to prevent drug resistance in some tumors, including medulloblastoma (MB). In the present study, we investigated VA role, combined to cisplatin (CDDP) in cell viability and gene expression of MB cell lines. Dose-response curve determined IC 50 values for each treatment: (1) VA single, (2) CDDP single, and (3) VA and CDDP combined. Cytotoxicity and flow cytometry evaluated cell viability after exposure to treatments. Quantitative PCR evaluated gene expression levels of AKT, CTNNB1, GLI1, KDM6A, KDM6B, NOTCH2, PTCH1, and TERT, before and after treatment. Besides, we performed next-generation sequencing (NGS) for PTCH1, TERT, and TP53 genes. The most effective treatment to reduce viability was combined for D283MED and ONS-76; and CDDP single for DAOY cells (p AKT genes were overexpressed after treatments with VA. D283MED and ONS-76 cells presented variants in TERT and PTCH1, respectively and DAOY cell line presented a TP53 mutation. MB tumors belonging to SHH molecular subgroup, with TP53 MUT , would be the ones that present high risk in relation to VA use during the treatment, while TP53 WT MBs can benefit from VA therapy, both SHH and groups 3 and 4. Our study shows a new perspective about VA action in medulloblastoma cells, raising the possibility that VA may act in different patterns. According to the genetic background of MB cell, VA can stimulate cell cycle arrest and apoptosis or induce resistance to treatment via signaling pathways activation.
Identification of TP53 as an Acute Lymphocytic Leukemia Susceptibility Gene Through Exome Sequencing
Powell, Bradford C.; Jiang, Lichun; Muzny, Donna M.; Treviño, Lisa R.; Dreyer, ZoAnn E.; Strong, Louise C.; Wheeler, David A.; Gibbs, Richard A.; Plon, Sharon E.
2014-01-01
Although acute lymphocytic leukemia (ALL) is the most common childhood cancer, genetic predisposition to ALL remains poorly understood. Whole-exome sequencing was performed in an extended kindred in which five individuals had been diagnosed with leukemia. Analysis revealed a nonsense variant of TP53 which has been previously reported in families with sarcomas and other typical Li Fraumeni syndrome-associated cancers but never in a familial leukemia kindred. This unexpected finding enabled identification of an appropriate sibling bone marrow donor and illustrates that exome sequencing will reveal atypical clinical presentations of even well-studied genes. PMID:23255406
Ooms, Ariadne H.A.G.; Gadd, Samantha; Gerhard, Daniela S.; Smith, Malcolm A.; Guidry Auvil, Jaime M.; Meerzaman, Daoud; Chen, Qing-Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Huff, Vicki; Dome, Jeffrey S.; Chi, Yueh-Yun; Tian, Jing; Geller, James I.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Walz, Amy L.; van den Heuvel-Eibrink, Marry M.; de Krijger, Ronald R.; Ross, Nicole; Gastier-Foster, Julie M.; Perlman, Elizabeth J.
2016-01-01
Purpose To investigate the role and significance of TP53 mutation in diffusely anaplastic Wilms tumor (DAWT). Experimental Design All DAWTs registered on National Wilms Tumor Study-5 (n=118) with available samples were analyzed for TP53 mutations and copy loss. Integrative genomic analysis was performed on 39 selected DAWTs. Results Following analysis of a single random sample, 57 DAWT (48%) demonstrated TP53 mutations, 13(11%) copy loss without mutation, and 48(41%) lacked both (defined as TP53-wildtype (wt)). Patients with Stage III/IV TP53-wt DAWTs (but not those with Stage I/II disease) had significantly lower relapse and death rates than those with TP53 abnormalities. In-depth analysis of a subset of 39 DAWT showed 7(18%) to be TP53-wt: these demonstrated gene expression evidence of an active p53 pathway. Retrospective pathology review of TP53-wt DAWT revealed no or very low volume of anaplasia in 6/7 tumors. When samples from TP53-wt tumors known to contain anaplasia histologically were available, abnormal p53 protein accumulation was observed by immunohistochemistry. Conclusion These data support the key role of TP53 loss in the development of anaplasia in WT, and support its significant clinical impact in patients with residual anaplastic tumor following surgery. These data also suggest that most DAWTs will show evidence of TP53 mutation when samples selected for the presence of anaplasia are analyzed. This suggests that modifications of the current criteria to also consider volume of anaplasia and documentation of TP53 aberrations may better reflect the risk of relapse and death and enable optimization of therapeutic stratification. PMID:27702824
RITA displays anti-tumor activity in medulloblastomas independent of TP53 status.
Gottlieb, Aline; Althoff, Kristina; Grunewald, Laura; Thor, Theresa; Odersky, Andrea; Schulte, Marc; Deubzer, Hedwig E; Heukamp, Lukas; Eggert, Angelika; Schramm, Alexander; Schulte, Johannes H; Künkele, Annette
2017-04-25
Current therapy of medulloblastoma, the most common malignant brain tumor of childhood, achieves 40-70% survival. Secondary chemotherapy resistance contributes to treatment failure, where TP53 pathway dysfunction plays a key role. MDM2 interaction with TP53 leads to its degradation. Reactivating TP53 functionality using small-molecule inhibitors, such as RITA, to disrupt TP53-MDM2 binding may have therapeutic potential. We show here that RITA decreased viability of all 4 analyzed medulloblastoma cell lines, regardless of TP53 functional status. The decrease in cell viability was accompanied in 3 of the 4 medulloblastoma cell lines by accumulation of TP53 protein in the cells and increased CDKN1A expression. RITA treatment in mouse models inhibited medulloblastoma xenograft tumor growth. These data demonstrate that RITA treatment reduces medulloblastoma cell viability in both in vitro and in vivo models, and acts independently of cellular TP53 status, identifying RITA as a potential therapeutic agent to treat medulloblastoma.
Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie
2012-07-01
Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
Directory of Open Access Journals (Sweden)
Shao Yan Lau
2017-12-01
Full Text Available Background: Li-Fraumeni Syndrome (LFS is caused by a mutation in the TP53 tumour suppressor gene. This rare hereditary condition predisposes individuals to an increased risk of cancers including breast cancer in women at a relatively young age, which accounts for nearly 25%–30% of all LFS‑associated cancers. Studies have shown that breast tumours in women with a germline TP53 deleterious variants are associated with a human epidermal growth factor receptor 2 (HER2-positive phenotype. Taken together, this study aimed to investigate the contribution of germline TP53 variants and its association with tumour HER-2 status in a cohort of young women with breast cancer. Methods: From 2002 to 2017, 4048 women with breast cancer treated at University Malaya Medical Centre or Sime Darby Medical Centre participated in the Malaysian Breast Cancer Genetics Study. Of which, 87 patients were diagnosed before 30 years of age. All patients were analysed for germline TP53 single nucleotide variants, small insertions or deletions by amplicon‑based targeted sequencing and validated by Sanger sequencing. DNA from patients who tested negative for sequencing were subsequently evaluated for the presence of TP53 exon deletions or duplications by multiplex ligation‑dependent probe amplification. HER-2 status of breast tumours was defined by immunohistochemistry, fluorescence in situ hybridisation and/or silver in situ hybridisation. Results: 5 distinct TP53 variants were detected in 5 individuals. 3 out of 5 TP53 variants were classified as frameshift mutations, one nonsense mutation and one in-frame duplication. Variants in other genes were detected in 17 individuals. No large genomic rearrangements were detected in the remaining 65 sequencing-negative patients. The assessment of HER-2 status will be presented. Conclusions: Our results suggest that alterations in TP53 gene were identified in approximately 5.7% (5/87 of this cohort of young women with breast
Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri
2014-12-24
TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.
TP53 mutation spectrum in smokers and never smoking lung cancer patients
Directory of Open Access Journals (Sweden)
Ann Rita Halvorsen
2016-05-01
Full Text Available AbstractBackground: TP53 mutations are among the most common mutations found in lung cancers, identified as an independent prognostic factor in many types of cancers. The purpose of this study was to investigate the frequency and prognostic impact of TP53 mutations in never-smokers and in different histological subtypes of lung cancer.Methods: We analysed tumour tissue from 394 non-small cell carcinomas including adenocarcinomas (n=229, squamous cell carcinomas (n=112, large cell carcinomas (n=30 and others (n=23 for mutations in TP53 by the use of Sanger sequencing (n=394 and next generation sequencing (n=100. Results: TP53 mutations were identified in 47.2% of the samples, with the highest frequency (65% of mutations among squamous cell carcinomas. Among never-smokers, 36% carried a TP53 mutation, identified as a significant independent negative prognostic factor in this subgroup. For large cell carcinomas, a significantly prolonged progression free survival was found for those carrying a TP53 mutation. In addition, the frequency of frameshift mutations was doubled in squamous cell carcinomas (20.3% compared to adenocarcinomas (9.1%.Conclusion: TP53 mutation patterns differ between the histological subgroups of lung cancers, as also influenced by smoking history. This indicates that the histological subtypes in lung cancer are genetically different, and that smoking-induced TP53 mutations may have a different biological impact than TP53 mutations occurring in never-smokers.
Directory of Open Access Journals (Sweden)
Sarah A. Hansen
2016-10-01
Full Text Available Somatic mutations in the Tp53 tumor suppressor gene are the most commonly seen genetic alterations in cancer, and germline mutations in Tp53 predispose individuals to a variety of early-onset cancers. Development of appropriate translational animal models that carry mutations in Tp53 and recapitulate human disease are important for drug discovery, biomarker development and disease modeling. Current Tp53 mouse and rat models have significant phenotypic and genetic limitations, and often do not recapitulate certain aspects of human disease. We used a marker-assisted speed congenic approach to transfer a well-characterized Tp53-mutant allele from an outbred rat to the genetically inbred Fischer-344 (F344 rat to create the F344-Tp53tm1(EGFP-PacQly/Rrrc (F344-Tp53 strain. On the F344 genetic background, the tumor spectrum shifted, with the primary tumor types being osteosarcomas and meningeal sarcomas, compared to the hepatic hemangiosarcoma and lymphoma identified in the original outbred stock model. The Fischer model is more consistent with the early onset of bone and central nervous system sarcomas found in humans with germline Tp53 mutations. The frequency of osteosarcomas in F344-Tp53 homozygous and heterozygous animals was 57% and 36%, respectively. Tumors were highly representative of human disease radiographically and histologically, with tumors found primarily on long bones with frequent pulmonary metastases. Importantly, the rapid onset of osteosarcomas in this promising new model fills a current void in animal models that recapitulate human pediatric osteosarcomas and could facilitate studies to identify therapeutic targets.
Defects in mitophagy promote redox-driven metabolic syndrome in the absence of TP53INP1.
Seillier, Marion; Pouyet, Laurent; N'Guessan, Prudence; Nollet, Marie; Capo, Florence; Guillaumond, Fabienne; Peyta, Laure; Dumas, Jean-François; Varrault, Annie; Bertrand, Gyslaine; Bonnafous, Stéphanie; Tran, Albert; Meur, Gargi; Marchetti, Piero; Ravier, Magalie A; Dalle, Stéphane; Gual, Philippe; Muller, Dany; Rutter, Guy A; Servais, Stéphane; Iovanna, Juan L; Carrier, Alice
2015-06-01
The metabolic syndrome covers metabolic abnormalities including obesity and type 2 diabetes (T2D). T2D is characterized by insulin resistance resulting from both environmental and genetic factors. A genome-wide association study (GWAS) published in 2010 identified TP53INP1 as a new T2D susceptibility locus, but a pathological mechanism was not identified. In this work, we show that mice lacking TP53INP1 are prone to redox-driven obesity and insulin resistance. Furthermore, we demonstrate that the reactive oxygen species increase in TP53INP1-deficient cells results from accumulation of defective mitochondria associated with impaired PINK/PARKIN mitophagy. This chronic oxidative stress also favors accumulation of lipid droplets. Taken together, our data provide evidence that the GWAS-identified TP53INP1 gene prevents metabolic syndrome, through a mechanism involving prevention of oxidative stress by mitochondrial homeostasis regulation. In conclusion, this study highlights TP53INP1 as a molecular regulator of redox-driven metabolic syndrome and provides a new preclinical mouse model for metabolic syndrome clinical research. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.
Vang, Russell; Levine, Douglas A; Soslow, Robert A; Zaloudek, Charles; Shih, Ie-Ming; Kurman, Robert J
2016-01-01
The Cancer Genome Atlas has reported that 96% of ovarian high-grade serous carcinomas (HGSCs) have TP53 somatic mutations suggesting that mutation of this gene is a defining feature of this neoplasm. In the current study, 5 gynecologic pathologists independently evaluated hematoxylin and eosin slides of 14 available cases from The Cancer Genome Atlas classified as HGSC that lacked a TP53 mutation. The histologic diagnoses rendered by these pathologists and the accompanying molecular genetic data are the subject of this report. Only 1 case (Case 5), which contained a homozygous deletion of TP53, had unanimous interobserver agreement for a diagnosis of pure HGSC. In 1 case (Case 3), all 5 observers (100%) rendered a diagnosis of HGSC; however, 3 observers (60%) noted that the histologic features were not classic for HGSC and suggested this case may have arisen from a low-grade serous carcinoma (arisen from an alternate pathway compared with the usual HGSC). In 2 cases (Cases 4 and 12), only 3 observers (60%) in each case, respectively, interpreted it as having a component of HGSC. In the remaining 10 (71%) of tumors (Cases 1, 2, 6-11, 13, and 14), the consensus diagnosis was not HGSC, with individual diagnoses including low-grade serous carcinoma, high-grade endometrioid carcinoma, HGSC, metastatic carcinoma, clear cell carcinoma, atypical proliferative (borderline) serous tumor, and adenocarcinoma, not otherwise specified. Therefore, 13 (93%) of the tumors (Cases 1-4 and 6-14) were either not a pure HGSC or represented a diagnosis other than HGSC, all with molecular results not characteristic of HGSC. Accordingly, our review of the TP53 wild-type HGSCs reported in The Cancer Genome Atlas suggests that 100% of de novo HGSCs contain TP53 somatic mutations or deletions, with the exception of the rare HGSCs that develop from a low-grade serous tumor precursor. We, therefore, propose that lack of molecular alterations of TP53 are essentially inconsistent with the
Directory of Open Access Journals (Sweden)
Zahra Shajani-Yi
2018-03-01
Full Text Available The tumor suppressor gene TP53 is the most frequently mutated gene in human cancer. It encodes p53, a DNA-binding transcription factor that regulates multiple genes involved in DNA repair, metabolism, cell cycle arrest, apoptosis, and senescence. TP53 is associated with human cancer by mutations that lead to a loss of wild-type p53 function as well as mutations that confer alternate oncogenic functions that enable them to promote invasion, metastasis, proliferation, and cell survival. Identifying the discrete TP53 mutations in tumor cells may help direct therapies that are more effective. In this study, we identified the frequency of individual TP53 mutations in patients with colon adenocarcinoma (48%, non–small cell lung carcinoma (NSCLC (36%, and glioma/glioblastoma (28% at our institution using next-generation sequencing. We also identified the occurrence of somatic mutations in numerous actionable genes including BRAF, EGFR, KRAS, IDH1, and PIK3CA that occurred concurrently with these TP53 mutations. Of the 480 tumors examined that contained one or more mutations in the TP53 gene, 219 were colon adenocarcinomas, 215 were NSCLCs, and 46 were gliomas/glioblastomas. Among the patients positive for TP53 mutations diagnosed with colon adenocarcinoma, 50% also showed at least one mutation in pathogenic genes of which 14% were BRAF, 33% were KRAS, and 3% were NRAS. Forty-seven percent of NSCLC patients harboring TP53 mutations also had a mutation in at least one actionable pathogenic variant with the following frequencies: BRAF: 4%, EGFR: 10%, KRAS: 28%, and PIK3CA: 4%. Fifty-two percent of patients diagnosed with glioma/glioblastoma with a positive TP53 mutation had at least one concurrent mutation in a known pathogenic gene of which 9% were CDKN2A, 41% were IDH1, and 11% were PIK3CA.
International Nuclear Information System (INIS)
Giacomazzi, Juliana; Hainaut, Pierre; Ashton-Prolla, Patricia; Selistre, Simone; Duarte, Juliana; Ribeiro, Jorge Pinto; Vieira, Paulo JC; Souza Macedo, Gabriel de; Rossi, Cristina; Czepielewski, Mauro; Netto, Cristina Brinkmann Oliveira
2013-01-01
Adrenocortical carcinomas (ACCs) are among the most common childhood cancers occurring in infants affected with the Li-Fraumeni and Li- Fraumeni-like (LFS/LFL) syndromes, which are caused by dominant germline mutations in the TP53 gene. In Brazil, a particular mutation, occurring in the tetramerisation domain of the gene, p.R337H, is exceedingly common due to a founder effect and is strongly associated with ACC. In this report, we describe the phenotype and long-term clinical follow-up of a female child diagnosed with ACC and homozygous for the TP53 p.R337H founder mutation. At age 11 months, the patient was diagnosed with a virilising anaplastic adrenal cortical tumour, which was completely excised without disturbing the adrenal capsule. Family history was consistent with an LFL tumour pattern, and genotyping identified the TP53 p.R337H mutation in both alleles in genomic DNA from lymphocytes and fibroblasts. Haplotype analysis confirmed the occurrence of the mutation in the same founder haplotype previously described in other Brazilian patients. No other germline or somatic TP53 mutations or rearrangements were identified. At age 9 years, the child was asymptomatic and had no evidence of endocrine derangements. Full body and brain magnetic resonance imaging (MRI) failed to detect any suspicious proliferative lesions, and cardiopulmonary exercise testing results were within the normal reference for the child’s age, ruling out a major exercise capacity deficiency. This is the first clinical and aerobic functional capacity documentation of a patient who carries two mutant TP53 alleles and no wild-type allele. Our results support the hypothesis that TP53 p.R337H, the most common TP53 mutation ever described in any population, is a conditional mutant. Furthermore, our observations over a long period of clinical follow-up suggest that TP53 p.R337H homozygotes do not have a more severe disease phenotype than do heterozygote carriers of the same mutation. Patients with
Gleber-Netto, Frederico O; Zhao, Mei; Trivedi, Sanchit; Wang, Jiping; Jasser, Samar; McDowell, Christina; Kadara, Humam; Zhang, Jiexin; Wang, Jing; William, William N; Lee, J Jack; Nguyen, Minh Ly; Pai, Sara I; Walline, Heather M; Shin, Dong M; Ferris, Robert L; Carey, Thomas E; Myers, Jeffrey N; Pickering, Curtis R
2018-01-01
Human immunodeficiency virus-infected individuals (HIVIIs) have a higher incidence of head and neck squamous cell carcinoma (HNSCC), and clinical and histopathological differences have been observed in their tumors in comparison with those of HNSCC patients without a human immunodeficiency virus (HIV) infection. The reasons for these differences are not clear, and molecular differences between HIV-related HNSCC and non-HIV-related HNSCC may exist. This study compared the mutational patterns of HIV-related HNSCC and non-HIV-related HNSCC. The DNA of 20 samples of HIV-related HNSCCs and 32 samples of non-HIV-related HNSCCs was sequenced. DNA libraries covering exons of 18 genes frequently mutated in HNSCC (AJUBA, CASP8, CCND1, CDKN2A, EGFR, FAT1, FBXW7, HLA-A, HRAS, KEAP1, NFE2L2, NOTCH1, NOTCH2, NSD1, PIK3CA, TGFBR2, TP53, and TP63) were prepared and sequenced on an Ion Personal Genome Machine sequencer. DNA sequencing data were analyzed with Ion Reporter software. The human papillomavirus (HPV) status of the tumor samples was assessed with in situ hybridization, the MassARRAY HPV multiplex polymerase chain reaction assay, and p16 immunostaining. Mutation calls were compared among the studied groups. HIV-related HNSCC revealed a distinct pattern of mutations in comparison with non-HIV-related HNSCC. TP53 mutation frequencies were significantly lower in HIV-related HNSCC. Mutations in HIV+ patients tended to be TpC>T nucleotide changes for all mutated genes but especially for TP53. HNSCC in HIVIIs presents a distinct pattern of genetic mutations, particularly in the TP53 gene. HIV-related HNSCC may have a distinct biology, and an effect of the HIV virus on the pathogenesis of these tumors should not be ruled out. Cancer 2018;124:84-94. © 2017 American Cancer Society. © 2017 American Cancer Society.
Sequential mutations in Notch1, Fbxw7, and Tp53 in radiation-induced mouse thymic lymphomas.
Jen, Kuang-Yu; Song, Ihn Young; Banta, Karl Luke; Wu, Di; Mao, Jian-Hua; Balmain, Allan
2012-01-19
T-cell acute lymphoblastic lymphomas commonly demonstrate activating Notch1 mutations as well as mutations or deletions in Fbxw7. However, because Fbxw7 targets Notch1 for degradation, genetic alterations in these genes are expected to be mutually exclusive events in lymphomagenesis. Previously, by using a radiation-induced Tp53-deficient mouse model for T-cell acute lymphoblastic lymphoma, we reported that loss of heterozygosity at the Fbxw7 locus occurs frequently in a Tp53-dependent manner. In the current study, we show that these thymic lymphomas also commonly exhibit activating Notch1 mutations in the proline-glutamic acid-serine-threonine (PEST) domain. Moreover, concurrent activating Notch1 PEST domain mutations and single-copy deletions at the Fbxw7 locus occur with high frequency in the same individual tumors, indicating that these changes are not mutually exclusive events. We further demonstrate that although Notch1 PEST domain mutations are independent of Tp53 status, they are completely abolished in mice with germline Fbxw7 haploinsufficiency. Therefore, Notch1 PEST domain mutations only occur when Fbxw7 expression levels are intact. These data suggest a temporal sequence of mutational events involving these important cancer-related genes, with Notch1 PEST domain mutations occurring first, followed by Fbxw7 deletion, and eventually by complete loss of Tp53.
TP53 dysfunction in CLL: Implications for prognosis and treatment
te Raa, Gera D.; Kater, Arnon P.
2016-01-01
Despite the availability of novel targeted agents, TP53 defects remain the most important adverse prognostic factor in chronic lymphocytic leukemia (CLL). Detection of deletion of TP53 locus (17p deletion) by fluorescent in situ hybridization (FISH) has become standard and performed prior to every
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Association of the germline TP53 R337H mutation with breast cancer in southern Brazil
International Nuclear Information System (INIS)
Assumpção, Juliana G; Zeferino, Luiz Carlos; Dufloth, Rozany M; Brandalise, Silvia Regina; Yunes, José Andres; Seidinger, Ana Luíza; Mastellaro, Maria José; Ribeiro, Raul C; Zambetti, Gerard P; Ganti, Ramapriya; Srivastava, Kumar; Shurtleff, Sheila; Pei, Deqing
2008-01-01
The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT) in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. The R337H mutation was found in three patients but in none of the controls (p = 0.0442). Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16) and MDM2 (SNP309) genes that may further diminish TP53 tumor suppressor activity. These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility
International Nuclear Information System (INIS)
Kuo, Kung-Kai; Chen, Yi-Ling; Chen, Lih-Ren; Li, Chien-Feng; Lan, Yu-Hsuan; Chang, Fang-Rong; Wu, Yang-Chang; Shiue, Yow-Ling
2011-01-01
The objective was to investigate the upstream apoptotic mechanisms that were triggered by a styrylpyrone derivative, goniothalamin (GTN), in tumor protein p53 (TP53)-positive and -negative hepatocellular carcinoma (HCC)-derived cells. Effects of GTN were evaluated by the flow cytometry, alkaline comet assay, immunocytochemistry, small-hairpin RNA interference, mitochondria/cytosol fractionation, quantitative reverse transcription-polymerase chain reaction, immunoblotting analysis and caspase 3 activity assays in two HCC-derived cell lines. Results indicated that GTN triggered phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, also known as NOXA)-mediated apoptosis via TP53-dependent and -independent pathways. In TP53-positive SK-Hep1 cells, GTN furthermore induced TP53 transcription-dependent and -independent apoptosis. After GTN treatment, accumulation of reactive oxygen species, formation of DNA double-strand breaks, transactivation of TP53 and/or PMAIP1 gene, translocation of TP53 and/or PMAIP1 proteins to mitochondria, release of cytochrome c from mitochondria, cleavage of caspases and induction of apoptosis in both cell lines were sustained. GTN might represent a novel class of anticancer drug that induces apoptosis in HCC-derived cells through PMAIP1 transactivation regardless of the status of TP53 gene. - Highlights: → Goniothalamin (GTN) induced apoptosis in hepatocellular carcinomas-derived cells. → The apoptosis induced by GTN is PMAIP1-dependent, regardless of TP53 status. → The apoptosis induced by GTN might be TP53 transcription-dependent or -independent. → GTN-induced apoptosis is mitochondria- and caspases-mediated.
Kulasekararaj, Austin G; Smith, Alexander E; Mian, Syed A; Mohamedali, Azim M; Krishnamurthy, Pramila; Lea, Nicholas C; Gäken, Joop; Pennaneach, Coralie; Ireland, Robin; Czepulkowski, Barbara; Pomplun, Sabine; Marsh, Judith C; Mufti, Ghulam J
2013-03-01
This study aimed to determine the incidence/prognostic impact of TP53 mutation in 318 myelodysplastic syndrome (MDS) patients, and to correlate the changes to cytogenetics, single nucleotide polymorphism array karyotyping and clinical outcome. The median age was 65 years (17-89 years) and median follow-up was 45 months [95% confidence interval (CI) 27-62 months]. TP53 mutations occurred in 30 (9.4%) patients, exclusively in isolated del5q (19%) and complex karyotype (CK) with -5/5q-(72%), correlated with International Prognostic Scoring System intermediate-2/high, TP53 protein expression, higher blast count and leukaemic progression. Patients with mutant TP53 had a paucity of mutations in other genes implicated in myeloid malignancies. Median overall survival of patients with TP53 mutation was shorter than wild-type (9 versus 66 months, P disappearance of the mutant clone or emergence of new clones, suggesting an early occurrence of TP53 mutations. A reduction in mutant clone correlated with response to 5-azacitidine, however clones increased in non-responders and persisted at relapse. The adverse impact of TP53 persists after adjustment for cytogenetic risk and is of practical importance in evaluating prognosis. The relatively common occurrence of these mutations in two different prognostic spectrums of MDS, i.e. isolated 5q- and CK with -5/5q-, possibly implies two different mechanistic roles for TP53 protein. © 2013 Crown copyright. This article is published with the permission of the Controller of HMSO and the Queen's Printer for Scotland.
van den Broek, Alexandra J.; Broeks, Annegien; Horlings, Hugo M.; Canisius, Sander V. M.; Braaf, Linde M.; Langerød, Anita; van't Veer, Laura J.; Schmidt, Marjanka K.
2011-01-01
The tumor suppressor gene TP53 and its regulator MDM2 are both important players in the DNA-damage repair "TP53 response pathway". Common germline polymorphisms in these genes may affect outcome in patients with tumors characterized by additional somatic changes in the same or a related pathway. To
Association of the germline TP53 R337H mutation with breast cancer in southern Brazil
Directory of Open Access Journals (Sweden)
Srivastava Kumar
2008-12-01
Full Text Available Abstract Background The germline TP53-R337H mutation is strongly associated with pediatric adrenocortical tumors (ACT in southern Brazil; it has low penetrance and limited tissue specificity in most families and therefore is not associated with Li-Fraumeni syndrome. However, other tumor types, mainly breast cancer, have been observed in carriers of several unrelated kindreds, raising the possibility that the R337H mutation may also contribute to breast tumorigenesis in a genetic background-specific context. Methods We conducted a case-control study to determine the prevalence of the R337H mutation by sequencing TP53 exon 10 in 123 women with breast cancer and 223 age- and sex-matched control subjects from southern Brazil. Fisher's test was used to compare the prevalence of the R337H. Results The R337H mutation was found in three patients but in none of the controls (p = 0.0442. Among the carriers, two had familial history of cancer meeting the Li-Fraumeni-like criteria. Remarkably, tumors in each of these three cases underwent loss of heterozygosity by eliminating the mutant TP53 allele rather than the wild-type allele. Polymorphisms were identified within the TP53 (R72P and Ins16 and MDM2 (SNP309 genes that may further diminish TP53 tumor suppressor activity. Conclusion These results demonstrate that the R337H mutation can significantly increase the risk of breast cancer in carriers, which likely depends on additional cooperating genetic factors. These findings are also important for understanding how low-penetrant mutant TP53 alleles can differentially influence tumor susceptibility.
Martzoukos, Yannis; Papavlasopoulos, Sozon; Poulos, Marios; Syrrou, Maria
2017-01-01
In recent years there has been an increasingly amount of data stored in biomedical Databases due to the breakthroughs in biology and bioinformatics, biomedical information is growing exponentially making efficient information retrieval from scientist more and more challenging. New Scientific fields as Bioinformatics seem to be the tool needed to extract scientifically important data based on experimental results and information provided by papers and journals. In this paper we are going to implement a custom made IT system in order to find connections between genes in the breast cancer pathways such the BRCA1 with the electrical energy in the human brain with UGDH gene via the TP53 tumor gene. The proposed system will be able to identify the appearance of each gene ID and compare the coexistence of two genes in PubMed articles/papers. The final system could become a useful tool against the struggle of scientists and medical professionals in the near future.
High resolution melting for mutation scanning of TP53 exons 5–8
International Nuclear Information System (INIS)
Krypuy, Michael; Dobrovic, Alexander; Ahmed, Ahmed Ashour; Etemadmoghadam, Dariush; Hyland, Sarah J; Australian Ovarian Cancer Study Group; Fazio, Anna de; Fox, Stephen B; Brenton, James D; Bowtell, David D
2007-01-01
p53 is commonly inactivated by mutations in the DNA-binding domain in a wide range of cancers. As mutant p53 often influences response to therapy, effective and rapid methods to scan for mutations in TP53 are likely to be of clinical value. We therefore evaluated the use of high resolution melting (HRM) as a rapid mutation scanning tool for TP53 in tumour samples. We designed PCR amplicons for HRM mutation scanning of TP53 exons 5 to 8 and tested them with DNA from cell lines hemizygous or homozygous for known mutations. We assessed the sensitivity of each PCR amplicon using dilutions of cell line DNA in normal wild-type DNA. We then performed a blinded assessment on ovarian tumour DNA samples that had been previously sequenced for mutations in TP53 to assess the sensitivity and positive predictive value of the HRM technique. We also performed HRM analysis on breast tumour DNA samples with unknown TP53 mutation status. One cell line mutation was not readily observed when exon 5 was amplified. As exon 5 contained multiple melting domains, we divided the exon into two amplicons for further screening. Sequence changes were also introduced into some of the primers to improve the melting characteristics of the amplicon. Aberrant HRM curves indicative of TP53 mutations were observed for each of the samples in the ovarian tumour DNA panel. Comparison of the HRM results with the sequencing results revealed that each mutation was detected by HRM in the correct exon. For the breast tumour panel, we detected seven aberrant melt profiles by HRM and subsequent sequencing confirmed the presence of these and no other mutations in the predicted exons. HRM is an effective technique for simple and rapid scanning of TP53 mutations that can markedly reduce the amount of sequencing required in mutational studies of TP53
TP53 codon 72 polymorphism as a risk factor for cardiovascular disease in a Brazilian population
Directory of Open Access Journals (Sweden)
M.A.C. Smith
2007-11-01
Full Text Available TP53, a tumor suppressor gene, has a critical role in cell cycle, apoptosis and cell senescence and participates in many crucial physiological and pathological processes. Identification of TP53 polymorphism in older people and age-related diseases may provide an understanding of its physiology and pathophysiological role as well as risk factors for complex diseases. TP53 codon 72 (TP53:72 polymorphism was investigated in 383 individuals aged 66 to 97 years in a cohort from a Brazilian Elderly Longitudinal Study. We investigated allele frequency, genotype distribution and allele association with morbidities such as cardiovascular disease, type II diabetes, obesity, neoplasia, low cognitive level (dementia, and depression. We also determined the association of this polymorphism with serum lipid fractions and urea, creatinine, albumin, fasting glucose, and glycated hemoglobin levels. DNA was isolated from blood cells, amplified by PCR using sense 5'-TTGCCGTCCCAAGCAATGGATGA-3' and antisense 5'-TCTGGGAAGGGACAGAAGATGAC-3' primers and digested with the BstUI enzyme. This polymorphism is within exon 4 at nucleotide residue 347. Descriptive statistics, logistic regression analysis and Student t-test using the multiple comparison test were used. Allele frequencies, R (Arg = 0.69 and P (Pro = 0.31, were similar to other populations. Genotype distributions were within Hardy-Weinberg equilibrium. This polymorphism did not show significant association with any age-related disease or serum variables. However, R allele carriers showed lower HDL levels and a higher frequency of cardiovascular disease than P allele subjects. These findings may help to elucidate the physiopathological role of TP53:72 polymorphism in Brazilian elderly people.
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth.
Haricharan, Svasti; Brown, Powel
2015-06-23
Breast cancer is a leading cause of cancer-related death, and it is important to understand pathways that drive the disease to devise effective therapeutic strategies. Our results show that Toll-like receptor 4 (TLR4) drives breast cancer cell growth differentially based on the presence of TP53, a tumor suppressor. TP53 is mutationally inactivated in most types of cancer and is mutated in 30-50% of diagnosed breast tumors. We demonstrate that TLR4 activation inhibits growth of TP53 wild-type cells, but promotes growth of TP53 mutant breast cancer cells by regulating proliferation. This differential effect is mediated by changes in tumor cell cytokine secretion. Whereas TLR4 activation in TP53 mutant breast cancer cells increases secretion of progrowth cytokines, TLR4 activation in TP53 wild-type breast cancer cells increases type I IFN (IFN-γ) secretion, which is both necessary and sufficient for mediating TLR4-induced growth inhibition. This study identifies a novel dichotomous role for TLR4 as a growth regulator and a modulator of tumor microenvironment in breast tumors. These results have translational relevance, demonstrating that TP53 mutant breast tumor growth can be suppressed by pharmacologic TLR4 inhibition, whereas TLR4 inhibitors may in fact promote growth of TP53 wild-type tumors. Furthermore, using data generated by The Cancer Genome Atlas consortium, we demonstrate that the effect of TP53 mutational status on TLR4 activity may extend to ovarian, colon, and lung cancers, among others, suggesting that the viability of TLR4 as a therapeutic target depends on TP53 status in many different tumor types.
Radiosensitivity and TP 53, EGFR amplification and LOH10 analysis of primary glioma cell cultures
International Nuclear Information System (INIS)
Gerlach, B.; Harder, A.H.; Slotman, B.J.; Sminia, P.; Hulsebos, T.J.M.; Leenstra, S.; Peter Vandertop, W.; Hartmann, K.A.
2002-01-01
Aim: Determination of in-vitro radiosensitivity and genetic alterations of cell cultures derived from human glioma biopsy tissue and established glioma cell lines. Material and Methods: Fresh brain tumor specimens of six patients were processed to early passage cell cultures. In addition the cell lines D 384 and Gli 6 were used. Cell cultures were irradiated with doses from 2 to 10 Gy. Following irradiation, cell survival was determined by clonogenic assay and survival curves were generated. The surviving fractions after 2 Gy (SF2) and 4 Gy (SF4) were used as radiosensitivity parameters. Genetic analysis included determination of the mutational and loss of heterozygosity (LOH) status of TP 53 (exons 5-8), the LOH 10- and epidermal growth factor receptor gene (EGFR) amplification status. Results: The SF2 and SF4 values ranged from 0.54 to 0.88 (mean: 0.70) and from 0.13 to 0.52 (mean: 0.32), respectively. Genetic alterations were found in the Gli 6 cell line and in two primary cell cultures. The genetic profile of Gli 6 showed LOH but no TP 53 mutation, complete LOH 10 and no EGFR amplification. The VU 15 cell culture showed TP 53 mutation but no LOH 10 or EGFR amplification, while VU 24 showed incomplete LOH 10, EGFR amplification and no TP 53 mutation. In the other four cell cultures and D 384 cell line no genetic alterations were diagnosed. Histopathological classification of glioblastoma multiforme and/or genetic alterations resulted in lower radiosensitivity. Conclusion: In this small series of early passage glioma cell cultures low radiosensitivity and alterations in cell regulatory genes were seen. Further testing of biological behavior in larger series of patient-derived material is ongoing. (orig.)
Ardighieri, Laura; Mori, Luigi; Conzadori, Sara; Bugatti, Mattia; Falchetti, Marcella; Donzelli, Carla Maria; Ravaggi, Antonella; Odicino, Franco E; Facchetti, Fabio
2016-07-01
Pelvic carcinosarcomas (PCSs) are rare aggressive biphasic tumors that localize in the ovary, fallopian tube, or peritoneum and present frequently as bilateral disease. We undertook a morphological, p53 immunohistochemical and TP53 gene mutational analysis study in a single institution cohort of 16 PCSs in order to investigate the nature of bilateral tumors and to shed light on their origin and pathogenesis. Of the 16 patients, 10 presented with bilateral disease, 6 with a carcinosarcoma in both adnexa, and the remaining cases with a carcinosarcoma in one adnexum and a carcinoma in the opposite. The carcinoma component showed high-grade serous features in 13/16 of cases (81 %). In 10 patients (63 %), a serous tubal intraepithelial carcinoma (STIC) was found, in one case bilateral, making a total of 11 STICs. STIC was found only in cases with a carcinoma component with high-grade serous features. All 10 bilateral tumors and all 11 PCS-associated STICs showed a similar p53 immunostaining pattern. At mutation analysis of the TP53 gene, all five bilateral PCS contained an identical mutation in both localizations. Furthermore, a TP53 mutation was found in 8 of 10 STICs, with an identical mutation in the associated PCS. The finding of similar p53 immunostaining in all bilateral cases and identical TP53 mutations in most PCS-associated STIC provides evidence for a clonal relation between these neoplastic lesions, supporting a metastatic nature of bilateral PCS and suggesting that they have an extraovarian origin in a STIC.
Fayazfar, H; Afshar, A; Dolati, M; Dolati, A
2014-07-11
For the first time, a new platform based on electrochemical growth of Au nanoparticles on aligned multi-walled carbon nanotubes (A-MWCNT) was developed for sensitive lable-free DNA detection of the TP53 gene mutation, one of the most popular genes in cancer research. Electrochemical impedance spectroscopy (EIS) was used to monitor the sequence-specific DNA hybridization events related to TP53 gene. Compared to the bare Ta or MWCNT/Ta electrodes, the synergistic interactions of vertically aligned MWCNT array and gold nanoparticles at modified electrode could improve the density of the probe DNA attachment and resulting the sensitivity of the DNA sensor greatly. Using EIS, over the extended DNA concentration range, the change of charge transfer resistance was found to have a linear relationship in respect to the logarithm of the complementary oligonucleotides sequence concentrations in the wide range of 1.0×10(-15)-1.0×10(-7)M, with a detection limit of 1.0×10(-17)M (S/N=3). The prepared sensor also showed good stability (14 days), reproducibility (RSD=2.1%) and could be conveniently regenerated via dehybridization in hot water. The significant improvement in sensitivity illustrates that combining gold nanoparticles with the on-site fabricated aligned MWCNT array represents a promising platform for achieving sensitive biosensor for fast mutation screening related to most human cancer types. Copyright © 2014. Published by Elsevier B.V.
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
TLR4 has a TP53-dependent dual role in regulating breast cancer cell growth
Haricharan, Svasti; Brown, Powel
2015-01-01
This study fundamentally alters our understanding of how TLR4 drives breast cancer. Although TLR4 was previously considered a tumor promoter, we demonstrate a complex, TP53-dependent role for TLR4 in regulating tumor growth. TP53 is a tumor suppressor commonly inactivated across cancer types. In TP53 wild-type cancer cells, TLR4 activation causes secretion of IFN-γ into the microenvironment, resulting in induction of p21 and inhibition of cell growth. Conversely, TLR4 activation in TP53 mutan...
TP53 and ATM mRNA expression in skin and skeletal muscle after low-level laser exposure.
Guedes de Almeida, Luciana; Sergio, Luiz Philippe da Silva; de Paoli, Flavia; Mencalha, Andre Luiz; da Fonseca, Adenilson de Souza
2017-08-01
Low-level lasers are widespread in regenerative medicine, but the molecular mechanisms involved in their biological effects are not fully understood, particularly those on DNA stability. Therefore, this study aimed to investigate mRNA expression of genes related to DNA genomic stability in skin and skeletal muscle tissue from Wistar rats exposed to low-level red and infrared lasers. For this, TP53 (Tumor Protein 53) and ATM (Ataxia Telangiectasia Mutated gene) mRNA expressions were evaluated by real-time quantitative PCR (RT-qPCR) technique 24 hours after low-level red and infrared laser exposure. Our data showed that relative TP53 mRNA expression was not significantly altered in both tissues exposed to lasers. For ATM, relative mRNA expression in skin tissue was not significantly altered, but in muscle tissue, laser exposure increased relative ATM mRNA expression. Low-level red and infrared laser radiations alter ATM mRNA expression related to DNA stability in skeletal muscle tissue.
International Nuclear Information System (INIS)
Shinohara, Asano; Sakano, Shigeru; Hinoda, Yuji; Nishijima, Jun; Kawai, Yoshihisa; Misumi, Taku; Nagao, Kazuhiro; Hara, Takahiko; Matsuyama, Hideyasu
2009-01-01
Platinum-based chemoradiotherapy (CRT) as bladder conservation therapy has shown promising results for muscle-invasive bladder cancer. However, CRT might diminish survival as a result of the delay in cystectomy for some patients with non-responding bladder tumors. Because the p53 tumor suppression pathway, including its MDM2 counterpart, is important in chemotherapy- and radiotherapy-associated effects, functional polymorphisms in the TP53 and MDM2 genes could influence the response to treatment and the prognosis following CRT. We investigated associations between two such polymorphisms, and p53 overexpression, and response or survival in bladder cancer patients treated with CRT. The study group comprised 96 patients who underwent CRT for transitional cell carcinoma of the bladder. Single nucleotide polymorphisms (SNPs) in TP53 (codon 72, arginine>proline) and MDM2 (SNP3O9, T>G) were genotyped using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP), and nuclear expression levels of p53 were examined using immunohistochemistry. None of the genotypes or p53 overexpression was significantly associated with response to CRT. However, patients with MDM2 T/G+G/G genotypes had improved cancer-specific survival rates after CRT (P=0.009). In multivariate analysis, the MDM2 T/G+G/G genotypes, and more than two of total variant alleles in TP53 and MDM2, were independently associated with improved cancer-specific survival (P=0.031 and P=0.015, respectively). In addition, MDM2 genotypes were significantly associated with cystectomy-free survival (P=0.030). These results suggest that the TP53 and MDM2 genotypes might be useful prognostic factors following CRT in bladder cancer, helping patient selection for bladder conservation therapy. (author)
Directory of Open Access Journals (Sweden)
Markowska Janina
2008-01-01
Full Text Available Abstract Background Taxane-platinum therapy (TP has replaced platinum-based therapy (PC or PAC, DNA damaging chemotherapy in the postoperative treatment of ovarian cancer patients; however, it is not always effective. TP53 protein plays a differential role in response to DNA-damaging agents and taxanes. We sought to define profiles of patients who benefit the most from TP and also of those who can be treated with PC. Methods We compared the effectiveness of PC/PAC (n = 253 and TP (n = 199 with respect to tumor TP53 accumulation in ovarian cancer patients with FIGO stage IIB-IV disease; this was a non-randomized retrospective study. Immunohistochemical analysis was performed on 452 archival tumors; univariate and multivariate analysis by the Cox's and logistic regression models was performed in all patients and in subgroups with [TP53(+] and without TP53 accumulation [TP53(-]. Results The advantage of taxane-platinum therapy over platinum-based therapy was seen in the TP53(+, and not in the TP53(- group. In the TP53(+ group taxane-platinum therapy enhanced the probability of complete remission (p = .018, platinum sensitivity (p = .014, platinum highly sensitive response (p = .038 and longer survival (OS, p = .008. Poor tumor differentiation diminished the advantage from taxane-platinum therapy in the TP53(+ group. In the TP53(- group PC/PAC was at least equally efficient as taxane-platinum therapy and it enhanced the chance of platinum highly sensitive response (p = .010. However, in the TP53(- group taxane-platinum therapy possibly diminished the risk of death in patients over 53 yrs (p = .077. Among factors that positively interacted with taxane-platinum therapy in some analyses were endometrioid and clear cell type, FIGO III stage, bulky residual tumor, more advanced age of patient and moderate tumor differentiation. Conclusion Our results suggest that taxane-platinum therapy is particularly justified in patients with TP53(+ tumors or older
Arnhold, Viktor; Schmelz, Karin; Proba, Jutta; Winkler, Annika; Wünschel, Jasmin; Toedling, Joern; Deubzer, Hedwig E.; Künkele, Annette; Eggert, Angelika; Schulte, Johannes H.; Hundsdoerfer, Patrick
2018-01-01
Fewer than 50% of patients with high-risk neuroblastoma survive five years after diagnosis with current treatment protocols. Molecular targeted therapies are expected to improve survival. Although MDM2 has been validated as a promising target in preclinical models, no MDM2 inhibitors have yet entered clinical trials for neuroblastoma patients. Toxic side effects, poor bioavailability and low efficacy of the available MDM2 inhibitors that have entered phase I/II trials drive the development of novel MDM2 inhibitors with an improved risk-benefit profile. We investigated the effect of the novel MDM2 small molecular inhibitor, DS-3032b, on viability, proliferation, senescence, migration, cell cycle arrest and apoptosis in a panel of six neuroblastoma cell lines with different TP53 and MYCN genetic backgrounds, and assessed efficacy in a murine subcutaneous model for high-risk neuroblastoma. Re-analysis of existing expression data from 476 primary neuroblastomas showed that high-level MDM2 expression correlated with poor patient survival. DS-3032b treatment enhanced TP53 target gene expression and induced G1 cell cycle arrest, senescence and apoptosis. CRISPR-mediated MDM2 knockout in neuroblastoma cells mimicked DS-3032b treatment. TP53 signaling was selectively activated by DS-3032b in neuroblastoma cells with wildtype TP53, regardless of the presence of MYCN amplification, but was significantly reduced by TP53 mutations or expression of a dominant-negative TP53 mutant. Oral DS-3032b administration inhibited xenograft tumor growth and prolonged mouse survival. Our in vitro and in vivo data demonstrate that DS-3032b reactivates TP53 signaling even in the presence of MYCN amplification in neuroblastoma cells, to reduce proliferative capacity and cause cytotoxicity. PMID:29416773
International Nuclear Information System (INIS)
Soto, José Luis; Cabrera, Carmen M; Serrano, Salvio; López-Nevot, Miguel Ángel
2005-01-01
The role of genes involved in the control of progression from the G1 to the S phase of the cell cycle in melanoma tumors in not fully known. The aim of our study was to analyse mutations in TP53, CDKN1A, CDKN2A, and CDKN2B genes in melanoma tumors and melanoma cell lines We analysed 39 primary and metastatic melanomas and 9 melanoma cell lines by single-stranded conformational polymorphism (SSCP). The single-stranded technique showed heterozygous defects in the TP53 gene in 8 of 39 (20.5%) melanoma tumors: three new single point mutations in intronic sequences (introns 1 and 2) and exon 10, and three new single nucleotide polymorphisms located in introns 1 and 2 (C to T transition at position 11701 in intron 1; C insertion at position 11818 in intron 2; and C insertion at position 11875 in intron 2). One melanoma tumor exhibited two heterozygous alterations in the CDKN2A exon 1 one of which was novel (stop codon, and missense mutation). No defects were found in the remaining genes. These results suggest that these genes are involved in melanoma tumorigenesis, although they may be not the major targets. Other suppressor genes that may be informative of the mechanism of tumorigenesis in skin melanomas should be studied
Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis.
Directory of Open Access Journals (Sweden)
Adriana Rodríguez-Marí
2010-07-01
Full Text Available The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafish fancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafish fancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53 mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA-repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination.
Energy Technology Data Exchange (ETDEWEB)
Billet, Sylvain; Paget, Vincent [Universite Lille Nord de France, Lille (France); Unite de Chimie Environnementale et Interactions sur le Vivant, Maison de la Recherche en Environnement Industriel, Universite du Littoral Cote d' Opale, Dunkerque (France); GRECAN, Universite de Caen Basse-Normandie et Centre Regional de Lutte Contre le Cancer Francois Baclesse, Caen (France); Garcon, Guillaume; Verdin, Anthony; Shirali, Pirouz [Universite Lille Nord de France, Lille (France); Unite de Chimie Environnementale et Interactions sur le Vivant, Maison de la Recherche en Environnement Industriel, Universite du Littoral Cote d' Opale, Dunkerque (France); Andre, Veronique; Heutte, Natacha; Sichel, Francois [GRECAN, Universite de Caen Basse-Normandie et Centre Regional de Lutte Contre le Cancer Francois Baclesse, Caen (France)
2012-01-15
Environmental exposure to fine airborne particulate matter (PM 2.5) is thought to be responsible for cardiopulmonary diseases, including lung cancer. However, the mechanisms of action potentially involved in PM{sub 2.5} toxicity are not yet fully described. Mutations in the TP53 gene are the most common alterations in human solid tumors. TP53 mutational patterns have sometimes been linked to carcinogen exposure. The purpose of this study was to determine the mutations that alter the functionality of this transcription factor in a model of human epithelial lung cells (A549) exposed to the fine particulate fraction (PM{sub 2.5}) of an atmospheric aerosol sampled under urban and industrial influences. PM{sub 2.5} was collected in Dunkerque City by cascade impaction. Its physicochemical characterization revealed the presence of many inorganic and organic compounds, including some that are known for their toxicity. The search for mutations altering the functionality of the P53 protein was performed 72 h after exposure of A549 cells to PM{sub 2.5} at its lethal concentration at 50% (LC{sub 50}, 118.60 {mu}g/mL = 31.63 {mu}g/cm{sup 2}), using the Functional Analysis of Separated Alleles in Yeast (FASAY). Sixteen mutations altering P53 function were detected after A549 cells exposure to the collected PM{sub 2.5}: eight deletions of one or two nucleotides and eight nucleotide substitutions, mainly transitions A > G and G > A. These mutations are described in the literature as possibly caused by endogenous mechanisms, such as oxidative stress. This kind of alteration can be induced by metal content of the PM{sub 2.5}, as well as by metabolic activation of the organic compounds coated onto its surface. Involvement of oxidative stress in TP53 mutations was confirmed by the detection of an oxidative DNA adduct, 8-hydroxy-2'-deoxyguanosine (8-OHdG), in A549 cells exposed to the collected PM. (authors)
Klug, Stefanie J.; Ressing, Meike; Koenig, Jochem; Abba, Martin C.; Agorastos, Theodoros; Brenna, Sylvia M. F.; Ciotti, Marco; Das, B. R.; Del Mistro, Annarosa; Dybikowska, Aleksandra; Giuliano, Anna R.; Gudleviciene, Zivile; Gyllensten, Ulf; Haws, Andrea L. F.; Helland, Aslaug; Herrington, C. Simon; Hildesheim, Alan; Humbey, Olivier; Jee, Sun H.; Kim, Jae Weon; Madeleine, Margaret M.; Menczer, Joseph; Ngan, Hextan Y. S.; Nishikawa, Akira; Niwa, Yoshimitsu; Pegoraro, Rosemary; Pillai, M. R.; Ranzani, Gulielmina; Rezza, Giovanni; Rosenthal, Adam N.; Roychoudhury, Susanta; Saranath, Dhananjaya; Schmitt, Virginia M.; Sengupta, Sharmila; Settheetham-Ishida, Wannapa; Shirasawa, Hiroshi; Snijders, Peter J. F.; Stoler, Mark H.; Suarez-Rincon, Angel E.; Szarka, Krisztina; Tachezy, Ruth; Ueda, Masatsugu; van der Zee, Ate G. J.; Doeberitz, Magnus von Knebel; Wu, Ming-Tsang; Yamashita, Tsuyoshi; Zehbe, Ingeborg; Blettner, Maria
Background Cervical cancer is caused primarily by human papillomaviruses (HPV). The polymorphism rs1042522 at codon 72 of the TP53 tumour-suppressor gene has been investigated as a genetic cofactor. More than 80 studies were done between 1998 and 2006, after it was initially reported that women who
DEFF Research Database (Denmark)
Farooqui, Mohammed Z H; Valdez, Janet; Martyr, Sabrina
2015-01-01
BACKGROUND: Patients with chronic lymphocytic leukaemia (CLL) with TP53 aberrations respond poorly to first-line chemoimmunotherapy, resulting in early relapse and short survival. We investigated the safety and activity of ibrutinib in previously untreated and relapsed or refractory CLL with TP53...... aberrations. METHODS: In this investigator-initiated, single-arm phase 2 study, we enrolled eligible adult patients with active CLL with TP53 aberrations at the National Institutes of Health Clinical Center (Bethesda, MD, USA). Patients received 28-day cycles of ibrutinib 420 mg orally once daily until...... in one (2%) patient. INTERPRETATION: The activity and safety profile of single-agent ibrutinib in CLL with TP53 aberrations is encouraging and supports its consideration as a novel treatment option for patients with this high-risk disease in both first-line and second-line settings. FUNDING: Intramural...
Diffuse large B-cell lymphoma with combined TP53 mutation and MIR34A> methylation
DEFF Research Database (Denmark)
Asmar, Fazila; Hother, Christoffer; Kulosman, Gorjan
2014-01-01
and MIR34A methylation ("double hit") and these patients have an exceedingly poor prognosis with a median survival of 9.4 months (Phit") influence on survival. The TP53/MIR34A "double-hit" is an independent...... negative prognostic factor for survival (P=0.0002). In 2 DLBCL-cell lines with both TP53 mutation and promoter methylation of MIR34A, miR34A-5p is upregulated by 5-aza-2'deoxycytidine. Thus, the TP53/MIR34A "double hit" characterizes a very aggressive subgroup of DLBCL, which may be treatable...
International Nuclear Information System (INIS)
Olafsen, Tove; Bruland, Oeyvind S.; Zalutsky, Michael R.; Sandlie, Inger
1995-01-01
Monoclonal antibodies TP-1 and TP-3 are of potential utility for the radioimmunodiagnosis of osteosarcoma in both human and canine patients. The V genes of these antibodies were cloned and sequenced and to facilitate radiolabeling of these proteins, the location of the lysine residues within these sequences have been determined. The V-domains of TP-1 contain a total of 12 lysines, 10 in the framework region and 2 in the CDR region, while the V-domains of TP-3 contain a total of 14 lysines, 11 in the framework region and 3 in the CDR regions. Using space-filling models, the availability of each lysine residue for radiolabeling, and potential interference with antigen binding was predicted
Energy Technology Data Exchange (ETDEWEB)
Olafsen, Tove; Bruland, Oeyvind S.; Zalutsky, Michael R.; Sandlie, Inger
1995-08-01
Monoclonal antibodies TP-1 and TP-3 are of potential utility for the radioimmunodiagnosis of osteosarcoma in both human and canine patients. The V genes of these antibodies were cloned and sequenced and to facilitate radiolabeling of these proteins, the location of the lysine residues within these sequences have been determined. The V-domains of TP-1 contain a total of 12 lysines, 10 in the framework region and 2 in the CDR region, while the V-domains of TP-3 contain a total of 14 lysines, 11 in the framework region and 3 in the CDR regions. Using space-filling models, the availability of each lysine residue for radiolabeling, and potential interference with antigen binding was predicted.
Munne, Pauliina M.; Gu, Yuexi; Tumiati, Manuela; Gao, Ping; Koopal, Sonja; Uusivirta, Sanna; Sawicki, Janet; Wei, Gong-Hong; Kuznetsov, Sergey G.
2014-04-01
Multiple observations suggest a cell type-specific role for TP53 in mammary epithelia. We developed an in vitro assay, in which primary mouse mammary epithelial cells (mMECs) progressed from lumenal to basal-like phenotypes based on expression of Krt18 or ΔNp63, respectively. Such transition was markedly delayed in Trp53-/- mMECs suggesting that Trp53 is required for specification of the basal, but not lumenal cells. Evidence from human basal-like cell lines suggests that TP53 may support the activity of ΔNp63 by preventing its translocation from nucleoplasm into nucleoli. In human lumenal cells, activation of TP53 by inhibiting MDM2 or BRCA1 restored the nucleoplasmic expression of ΔNp63. Trp53-/- mMECs eventually lost epithelial features resulting in upregulation of MDM2 and translocation of ΔNp63 into nucleoli. We propose that TP63 may contribute to TP53-mediated oncogenic transformation of epithelial cells and shed light on tissue- and cell type-specific biases observed for TP53-related cancers.
A meta-analysis of the relationship between FGFR3 and TP53 mutations in bladder cancer.
Neuzillet, Yann; Paoletti, Xavier; Ouerhani, Slah; Mongiat-Artus, Pierre; Soliman, Hany; de The, Hugues; Sibony, Mathilde; Denoux, Yves; Molinie, Vincent; Herault, Aurélie; Lepage, May-Linda; Maille, Pascale; Renou, Audrey; Vordos, Dimitri; Abbou, Claude-Clément; Bakkar, Ashraf; Asselain, Bernard; Kourda, Nadia; El Gaaied, Amel; Leroy, Karen; Laplanche, Agnès; Benhamou, Simone; Lebret, Thierry; Allory, Yves; Radvanyi, François
2012-01-01
TP53 and FGFR3 mutations are the most common mutations in bladder cancers. FGFR3 mutations are most frequent in low-grade low-stage tumours, whereas TP53 mutations are most frequent in high-grade high-stage tumours. Several studies have reported FGFR3 and TP53 mutations to be mutually exclusive events, whereas others have reported them to be independent. We carried out a meta-analysis of published findings for FGFR3 and TP53 mutations in bladder cancer (535 tumours, 6 publications) and additional unpublished data for 382 tumours. TP53 and FGFR3 mutations were not independent events for all tumours considered together (OR = 0.25 [0.18-0.37], p = 0.0001) or for pT1 tumours alone (OR = 0.47 [0.28-0.79], p = 0.0009). However, if the analysis was restricted to pTa tumours or to muscle-invasive tumours alone, FGFR3 and TP53 mutations were independent events (OR = 0.56 [0.23-1.36] (p = 0.12) and OR = 0.99 [0.37-2.7] (p = 0.35), respectively). After stratification of the tumours by stage and grade, no dependence was detected in the five tumour groups considered (pTaG1 and pTaG2 together, pTaG3, pT1G2, pT1G3, pT2-4). These differences in findings can be attributed to the putative existence of two different pathways of tumour progression in bladder cancer: the CIS pathway, in which FGFR3 mutations are rare, and the Ta pathway, in which FGFR3 mutations are frequent. TP53 mutations occur at the earliest stage of the CIS pathway, whereas they occur would much later in the Ta pathway, at the T1G3 or muscle-invasive stage.
Fetal colon cell line FHC exhibits tumorigenic phenotype, complex karyotype, and TP53 gene mutation
Czech Academy of Sciences Publication Activity Database
Souček, Karel; Jirsová, Pavla; Brázdová, Marie; Hýžďalová, Martina; Kočí, Lenka; Vydra, D.; Trojanec, R.; Pernicová, Zuzana; Lentvorská, L.; Hajdúch, M.; Hofmanová, Jiřina; Kozubík, Alois
2010-01-01
Roč. 197, č. 2 (2010), s. 107-116 ISSN 0165-4608 R&D Projects: GA MŠk ME 919; GA ČR(CZ) GA204/07/0834; GA ČR(CZ) GA204/08/1560; GA AV ČR(CZ) 1QS500040507; GA MZd NS9600 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : colon epithelial cells * TP53 * MYC Subject RIV: BO - Biophysics Impact factor: 1.551, year: 2010
International Nuclear Information System (INIS)
Li, Yanli; Su, Jia; Cai, Lin; Yu, Shunzhang; Zhang, Zuo-Feng; Mu, Lina; Chang, Shen-Chih; Niu, Rungui; Liu, Li; Crabtree-Ide, Christina R; Zhao, Baoxing; Shi, Jianping; Han, Xiaoyou; Li, Jiawei
2013-01-01
A pathway-based genotyping analysis suggested rs2078486 was a novel TP53 SNP, but very few studies replicate this association. TP53 rs1042522 is the most commonly studied SNP, but very few studies examined its potential interaction with environmental factors in relation to lung cancer risk. This study aims to examine associations between two TP53 single-nucleotide polymorphisms (SNPs) (rs2078486, rs1042522), their potential interaction with environmental factors and risk of lung cancer. A case–control study was conducted in Taiyuan, China. Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (95% CIs). Multiplicative and additive interactions between TP53 SNPs and lifestyle factors were evaluated. Variant TP53 rs2078486 SNP was significantly associated with elevated lung cancer risk among smokers (OR: 1.70, 95% CI: 1.08 - 2.67) and individuals with high indoor air pollution exposure (OR: 1.51, 95% CI: 1.00-2.30). Significant or borderline significant multiplicative and additive interactions were found between TP53 rs2078486 polymorphism with smoking and indoor air pollution exposure. The variant genotype of TP53 SNP rs1042522 significantly increased lung cancer risk in the total population (OR: 1.57, 95% CI: 1.11-2.21), but there was no evidence of heterogeneity among individuals with different lifestyle factors. This study confirmed that TP53 rs2078486 SNP is potentially a novel TP53 SNP that may affect lung cancer risk. Our study also suggested potential synergetic effects of TP53 rs2078486 SNP with smoking and indoor air pollution exposure on lung cancer risk
Extremely high Tp53 mutation load in esophageal squamous cell carcinoma in Golestan Province, Iran.
Directory of Open Access Journals (Sweden)
Behnoush Abedi-Ardekani
Full Text Available BACKGROUND: Golestan Province in northeastern Iran has one of the highest incidences of esophageal squamous cell carcinoma (ESCC in the world with rates over 50 per 100,000 person-years in both sexes. We have analyzed TP53 mutation patterns in tumors from this high-risk geographic area in search of clues to the mutagenic processes involved in causing ESCC. METHODOLOGY/PRINCIPAL FINDINGS: Biopsies of 119 confirmed ESCC tumor tissue from subjects enrolled in a case-control study conducted in Golestan Province were analyzed by direct sequencing of TP53 exons 2 through 11. Immunohistochemical staining for p53 was carried out using two monoclonal antibodies, DO7 and 1801. A total of 120 TP53 mutations were detected in 107/119 cases (89.9%, including 11 patients with double or triple mutations. The mutation pattern was heterogeneous with infrequent mutations at common TP53 "hotspots" but frequent transversions potentially attributable to environmental carcinogens forming bulky DNA adducts, including 40% at bases known as site of mutagenesis by polycyclic aromatic hydrocarbons (PAHs. Mutations showed different patterns according to the reported temperature of tea consumption, but no variation was observed in relation to ethnicity, tobacco or opium use, and alcoholic beverage consumption or urban versus rural residence. CONCLUSION/SIGNIFICANCE: ESCC tumors in people from Golestan Province show the highest rate of TP53 mutations ever reported in any cancer anywhere. The heterogeneous mutation pattern is highly suggestive of a causative role for multiple environmental carcinogens, including PAHs. The temperature and composition of tea may also influence mutagenesis.
A meta-analysis of the relationship between FGFR3 and TP53 mutations in bladder cancer.
Directory of Open Access Journals (Sweden)
Yann Neuzillet
Full Text Available TP53 and FGFR3 mutations are the most common mutations in bladder cancers. FGFR3 mutations are most frequent in low-grade low-stage tumours, whereas TP53 mutations are most frequent in high-grade high-stage tumours. Several studies have reported FGFR3 and TP53 mutations to be mutually exclusive events, whereas others have reported them to be independent. We carried out a meta-analysis of published findings for FGFR3 and TP53 mutations in bladder cancer (535 tumours, 6 publications and additional unpublished data for 382 tumours. TP53 and FGFR3 mutations were not independent events for all tumours considered together (OR = 0.25 [0.18-0.37], p = 0.0001 or for pT1 tumours alone (OR = 0.47 [0.28-0.79], p = 0.0009. However, if the analysis was restricted to pTa tumours or to muscle-invasive tumours alone, FGFR3 and TP53 mutations were independent events (OR = 0.56 [0.23-1.36] (p = 0.12 and OR = 0.99 [0.37-2.7] (p = 0.35, respectively. After stratification of the tumours by stage and grade, no dependence was detected in the five tumour groups considered (pTaG1 and pTaG2 together, pTaG3, pT1G2, pT1G3, pT2-4. These differences in findings can be attributed to the putative existence of two different pathways of tumour progression in bladder cancer: the CIS pathway, in which FGFR3 mutations are rare, and the Ta pathway, in which FGFR3 mutations are frequent. TP53 mutations occur at the earliest stage of the CIS pathway, whereas they occur would much later in the Ta pathway, at the T1G3 or muscle-invasive stage.
Directory of Open Access Journals (Sweden)
Zhen Wang
Full Text Available To investigate the clinicopathological characteristics, human papillomavirus (HPV infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC and determine their utility as prognostic predictors in a primarily eastern Chinese population.The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH in 188 OPSCC samples. p53 expression levels and TP53 gene mutations were assessed through immunohistochemistry and sequencing, respectively. Clinicopathological characteristics and follow-up information were collected. Overall survival was estimated using the Log-rank test.Overall, 22 of the 188 OPSCC samples were associated with HPV infection. HPV16 was identified in all 22 samples, whereas no samples were positive for HPV18. All 22 HPV-associated OPSCC samples were p53 negative and lacked TP53 mutations. HPV16 positivity, female patients, non-smokers, and patients with histological grade I and stage N0 diseases showed better overall survival (p = 0.009, 0.003, 0.048, 0.009, and 0.004, respectively. No significant differences in overall survival between smoking and non-smoking patients were observed in the HPV-associated OPSCC group. Patients without mutations in TP53 exons 5-8 had better prognoses (p = 0.031 among the 43 sequenced specimens. Multivariate analysis indicated that HPV16 infection status (p = 0.011, histological grade (p = 0.017, and N stage (p = 0.019 were independent prognostic factors for patients with OPSCC.Distinct from the situation in Europe and America, for the patients with OPSCC in this study, HPV16 infection was relatively low, although it was still the most important independent prognostic predictor for the disease. In addition to the high smoking and drinking rate in this population, HPV16 infection and TP53 dysfunction appear to be two distinct pathogens for OPSCC patients in the eastern Chinese
Wang, Zhen; Xia, Rong-Hui; Ye, Dong-Xia; Li, Jiang
2016-01-01
To investigate the clinicopathological characteristics, human papillomavirus (HPV) infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC) and determine their utility as prognostic predictors in a primarily eastern Chinese population. The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH) in 188 OPSCC samples. p53 expression levels and TP53 gene mutations were assessed through immunohistochemistry and sequencing, respectively. Clinicopathological characteristics and follow-up information were collected. Overall survival was estimated using the Log-rank test. Overall, 22 of the 188 OPSCC samples were associated with HPV infection. HPV16 was identified in all 22 samples, whereas no samples were positive for HPV18. All 22 HPV-associated OPSCC samples were p53 negative and lacked TP53 mutations. HPV16 positivity, female patients, non-smokers, and patients with histological grade I and stage N0 diseases showed better overall survival (p = 0.009, 0.003, 0.048, 0.009, and 0.004, respectively). No significant differences in overall survival between smoking and non-smoking patients were observed in the HPV-associated OPSCC group. Patients without mutations in TP53 exons 5-8 had better prognoses (p = 0.031) among the 43 sequenced specimens. Multivariate analysis indicated that HPV16 infection status (p = 0.011), histological grade (p = 0.017), and N stage (p = 0.019) were independent prognostic factors for patients with OPSCC. Distinct from the situation in Europe and America, for the patients with OPSCC in this study, HPV16 infection was relatively low, although it was still the most important independent prognostic predictor for the disease. In addition to the high smoking and drinking rate in this population, HPV16 infection and TP53 dysfunction appear to be two distinct pathogens for OPSCC patients in the eastern Chinese population.
Directory of Open Access Journals (Sweden)
Andrzej Wincewicz
2017-02-01
Full Text Available Here we review prognostic and predictive aspects of mutated TP53 in Wilms’ tumor biology on the basis of the morphological report and molecular analysis of adult nephroblastoma (diffuse blastemal pattern of a 37-year-old man. Among quite different proteins, TP53 affects expression of several genes such as hypoxia inducible proteins GLUT1 and EPO as well as multidrug resistance (MDR mediated by P-glycoprotein (Pgp/MDR1 and multidrug-resistant related protein (MRP1, with certain clinical implications. TP53 mutation was found both in our primary tumor (c.746G>T p.R249M frequency 92% and in nodal metastasis (c.746G>T p.R249M frequency 90%, and the common polymorphism p.P72R in the same gene was revealed with frequency of about 97% in both primary tumor and metastatic disease with appliance of NGS technology (IonTorrent – LifeTechnology using Ion AmpliSeq Cancer Hotspot Panel v2.
International Nuclear Information System (INIS)
Godai, Ten-i; Sakuma, Yuji; Tsuchiya, Eiju; Kameda, Yoichi; Akaike, Makoto; Miyagi, Yohei; Suda, Tetsuji; Sugano, Nobuhiro; Tsuchida, Kazuhito; Shiozawa, Manabu; Sekiguchi, Hironobu; Sekiyama, Akiko; Yoshihara, Mitsuyo; Matsukuma, Shoichi
2009-01-01
Although postoperative chemotherapy is widely accepted as the standard modality for Dukes' stage C or earlier stage colorectal cancer (CRC) patients, biomarkers to predict those who may benefit from the therapy have not been identified. Previous in vitro and clinical investigations reported that CRC patients with wild-type p53 gene (TP53)-tumors benefit from 5-fluorouracil (5-FU) based chemotherapy, while those with mutated TP53-tumors do not. However, these studies evaluated the mutation-status of TP53 by immunohistochemistry with or without single-strand conformation polymorphism, and the mutation frequency was different from study to study. In addition, the polymorphic status at p53 codon 72, which results in arginine or proline residues (R72P) and is thought to influence the function of the protein significantly, was not examined. To evaluate the significance of the TP53 mutation as a molecular marker to predict the prognosis of CRC patients, especially those who received postoperative chemotherapy, we examined the mutation by direct sequencing from fresh CRC tumors and evaluated the R72P polymorphism of the mutated TP53 by a combined mutant allele- and polymorphic allele-specific polymerase chain reaction (PCR). The TP53 mutation occurred in 147 (70%) of 211 Japanese CRC tumors. The mutation was observed in 93 (63%) tumors on the R72 allele and in 54 (37%) tumors on the P72 allele. Although the alterations to TP53 have no prognostic significance for CRC patients overall, we found that Dukes' stage C CRC patients who did not receive postoperative chemotherapy and carried the mutated TP53-R72 showed significantly longer survival times than those with the mutated TP53-P72 when evaluated by overall survival (p = 0.012). Using a combined mutant allele- and polymorphic allele-specific PCR, we defined the codon 72 polymorphic status of the TP53 mutated allele in Japanese CRC patients. We raised a possibility that Dukes' stage C colorectal cancer
The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.
Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria
2018-04-23
Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.
Rhabdomyosarcoma-associated renal cell carcinoma: a link with constitutional Tp53 mutation.
LENUS (Irish Health Repository)
Curry, Sarah
2012-02-01
The 2004 World Health Organization classification includes the new entity "neuroblastoma-associated renal cell carcinoma." The pathogenetic link between these entities is unknown as yet. The patient reported herein developed renal cell carcinoma after anaplastic embryonal rhabdomyosarcoma, a previously unknown association. The 2nd malignancy developed very soon after the 1st one, prompting concern for inherent cancer predisposition rather than a therapy-induced 2nd malignancy. A variety of features raised suspicion for Tp53 mutation, and indeed a pathogenic germline Tp53 mutation was identified in this child, despite a negative family history for Li-Fraumeni syndrome. Consideration of underlying predisposition is advocated in the context of rapid evolution of 2nd childhood malignancy.
Braakhuis, B.J.M.; Rietbergen, M.M.; Buijze, M.; Snijders, P.J.F.; Bloemena, E.; Brakenhoff, R.H.; Leemans, C.R.
2014-01-01
Objective Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. Methods TP53 mutations
International Nuclear Information System (INIS)
Michel, Pierre; Magois, Karine; Robert, Valerie; Chiron, Anne; Lepessot, Florence; Bodenant, Corinne; Roque, Isabelle; Seng, Sok H.; Frebourg, Thierry; Paillot, Bernard
2002-01-01
Purpose: The aim of this study was to evaluate biologic factors on survival and clinical response after definitive concomitant chemoradiotherapy (CRT) in patients with esophageal squamous cell carcinoma (ESCC). Methods and Materials: TP53 protein hyperexpression (immunochemistry [IHC]) and functional assay (FA) of TP53, measuring the ability of TP53 to transactivate p21 and bax reporter systems, were performed in patients with ESCC treated by CRT. The impact of parameters studied on survival and clinical response to CRT was assessed. Results: Thirty-eight patients with ESCC were included. TP53 alterations were detected in 84.2% of cases with FA. All TP53 mutations abolished the transactivation of p21 and bax reporter systems. After CRT, complete response rate was 55.3%. The median survival of the population was 17.5 months. Serum albumin (p=0.002), weight loss <10% (p=0.005), and response to treatment (p<0.001) were significantly linked with survival. TP53 alteration in FA was not significantly predictive of response to CRT (p=0.132) nor survival (p=0.154). Conclusions: Our results suggest that wild-type TP53 in ESCC could be associated with good response to definitive CRT. However, the small rate of ESCC with wild-type TP53 suggests that systematic determination of TP53 status is not appropriate for the management of the ESCC population
Li, Yanli; Chang, Shen-Chih; Niu, Rungui; Liu, Li; Crabtree-Ide, Christina R; Zhao, Baoxing; Shi, Jianping; Han, Xiaoyou; Li, Jiawei; Su, Jia; Cai, Lin; Yu, Shunzhang; Zhang, Zuo-Feng; Mu, Lina
2013-01-01
Abstract Background A pathway-based genotyping analysis suggested rs2078486 was a novel TP53 SNP, but very few studies replicate this association. TP53 rs1042522 is the most commonly studied SNP, but very few studies examined its potential interaction with environmental factors in relation to lung cancer risk. This study aims to examine associations between two TP53 single-nucleotide polymorphisms (SNPs) (rs2078486, rs1042522), their potential interac...
Wegert, Jenny; Vokuh, Christian; Ziegler, Barbara; Ernestus, Karen; Leuschner, Ivo; Furtwängler, Rhoikos; Graf, Norbert; Gessler, Manfred
2018-01-01
TP53 mutations have been associated with anaplasia in Wilms tumour, which conveys a high risk for relapse and fatal outcome. Nevertheless, TP53 alterations have been reported in no more than 60% of anaplastic tumours, and recent data have suggested their presence in tumours that do not fulfil the criteria for anaplasia, questioning the clinical utility of TP53 analysis. Therefore, we characterized the TP53 status in 84 fatal cases of Wilms tumour, irrespective of histological subtype. We iden...
Wegert, Jenny; Vokuhl, Christian; Ziegler, Barbara; Ernestus, Karen; Leuschner, Ivo; Furtwängler, Rhoikos; Graf, Norbert; Gessler, Manfred
2017-01-01
Abstract TP53 mutations have been associated with anaplasia in Wilms tumour, which conveys a high risk for relapse and fatal outcome. Nevertheless, TP53 alterations have been reported in no more than 60% of anaplastic tumours, and recent data have suggested their presence in tumours that do not fulfil the criteria for anaplasia, questioning the clinical utility of TP53 analysis. Therefore, we characterized the TP53 status in 84 fatal cases of Wilms tumour, irrespective of histological subtype...
Ooms, Ariadne H A G; Gadd, Samantha; Gerhard, Daniela S.; Smith, Malcolm A.; Guidry Auvil, Jaime M.; Meerzaman, Daoud; Chen, Qing Rong; Hsu, Chih Hao; Yan, Chunhua; Nguyen, Cu; Hu, Ying; Ma, Yussanne; Zong, Zusheng; Mungall, Andrew J.; Moore, Richard A.; Marra, Marco A.; Huff, Vicki; Dome, Jeffrey S.; Chi, Yueh Yun; Tian, Jing; Geller, James I.; Mullighan, Charles G.; Ma, Jing; Wheeler, David A.; Hampton, Oliver A.; Walz, Amy L.; Van Den Heuvel-Eibrink, Marry M.; De Krijger, Ronald R.; Ross, Nicole; Gastier-Foster, Julie M.; Perlman, Elizabeth J.
2016-01-01
Purpose: To investigate the role and significance of TP53 mutation in diffusely anaplastic Wilms tumors (DAWTs). Experimental Design: All DAWTs registered on National Wilms Tumor Study-5 (n = 118) with available samples were analyzed for TP53 mutations and copy loss. Integrative genomic analysis was
Wegert, Jenny; Vokuhl, Christian; Ziegler, Barbara; Ernestus, Karen; Leuschner, Ivo; Furtwängler, Rhoikos; Graf, Norbert; Gessler, Manfred
2017-10-01
TP53 mutations have been associated with anaplasia in Wilms tumour, which conveys a high risk for relapse and fatal outcome. Nevertheless, TP53 alterations have been reported in no more than 60% of anaplastic tumours, and recent data have suggested their presence in tumours that do not fulfil the criteria for anaplasia, questioning the clinical utility of TP53 analysis. Therefore, we characterized the TP53 status in 84 fatal cases of Wilms tumour, irrespective of histological subtype. We identified TP53 alterations in at least 90% of fatal cases of anaplastic Wilms tumour, and even more when diffuse anaplasia was present, indicating a very strong if not absolute coupling between anaplasia and deregulation of p53 function. Unfortunately, TP53 mutations do not provide additional predictive value in anaplastic tumours since the same mutation rate was found in a cohort of non-fatal anaplastic tumours. When classified according to tumour stage, patients with stage I diffuse anaplastic tumours still had a high chance of survival (87%), but this rate dropped to 26% for stages II-IV. Thus, volume of anaplasia or possible spread may turn out to be critical parameters. Importantly, among non-anaplastic fatal tumours, 26% had TP53 alterations, indicating that TP53 screening may identify additional cases at risk. Several of these non-anaplastic tumours fulfilled some criteria for anaplasia, for example nuclear unrest, suggesting that such partial phenotypes should be under special scrutiny to enhance detection of high-risk tumours via TP53 screening. A major drawback is that these alterations are secondary changes that occur only later in tumour development, leading to striking intratumour heterogeneity that requires multiple biopsies and analysis guided by histological criteria. In conclusion, we found a very close correlation between histological signs of anaplasia and TP53 alterations. The latter may precede development of anaplasia and thereby provide diagnostic value
Directory of Open Access Journals (Sweden)
Jian Chen
Full Text Available Retinoblastoma binding protein 6 (RBBP6 plays an important role in chaperone-mediated ubiquitination and interacts with TP53 in carcinogenesis. However, the clinicopathologic significance of RBBP6 expression in colon cancer is unknown; in particular, the prognostic value of RBBP6 combined with TP53 expression has not been explored. Therefore, quantitative real-time PCR and western blot analyses were performed to detect RBBP6 expression in colon cancer tissues. RBBP6 and TP53 expression were assessed by immunohistochemistry in a tissue microarray format, in which the primary colon cancer tissue was paired with noncancerous tissue. Tissue specimens were obtained from 203 patients. We found that RBBP6 was overexpressed in colon tumorous tissues and was significantly associated with clinical stage, depth of tumor invasion, lymph node metastasis (LNM, distant metastasis, and histologic grade. Further studies revealed that a corresponding correlation between RBBP6 overexpression and mutant TP53 was evident in colon cancer (r = 0.450; P<0.001. RBBP6 expression was an independent prognostic factor for overall survival (OS and disease free survival (DFS. Interestingly, patients with tumors that had both RBBP6 overexpression and mutant TP53 protein accumulation relapsed and died within a significantly short period after surgery (P<0.001. Multivariate analysis showed that patients with LNM and patients with both RBBP6- and TP53-positive tumors had extremely poor OS (HR 6.75; 95% CI 2.63-17.35; P<0.001 and DFS (HR 8.08; 95% CI 2.80-23.30; P<0.001. These clinical findings indicate that the assessment of both RBBP6 and mutant TP53 expression will be helpful in predicting colon cancer prognosis.
DEFF Research Database (Denmark)
Munch-Petersen, Helga D; Asmar, Fazila; Dimopoulos, Konstantinos
2016-01-01
regimens (high-dose methotrexate/whole brain radiation therapy, 6.0 months, or no therapy, 0.83 months), P hotspot/direct DNA contact mutations. CCT-treated patients with PCNSL harboring a hotspot/direct DNA contact MUT......-TP53 (n = 9) had a significantly worse OS and progression free survival (PFS) compared to patients with non-hotspot/non-direct DNA contact MUT-TP53 or wild-type TP53 (median PFS 4.6 versus 18.2 or 45.7 months), P = 0.041 and P = 0.00076, respectively. Multivariate Cox regression analysis confirmed...... that hotspot/direct DNA contact MUT-TP53 was predictive of poor outcome in CCT-treated PCNSL patients, P = 0.012 and P = 0.008; HR: 1.86 and 1.95, for OS and PFS, respectively. MIR34A, MIR34B/C, and DAPK promoter methylation were detected in 53/93 (57.0 %), 80/84 (95.2 %), and 70/75 (93.3 %) of the PCNSL...
Directory of Open Access Journals (Sweden)
Dirce Maria Carraro
Full Text Available Germline mutations in BRCA1, BRCA2 and TP53 genes have been identified as one of the most important disease-causing issues in young breast cancer patients worldwide. The specific defective biological processes that trigger germline mutation-associated and -negative tumors remain unclear. To delineate an initial portrait of Brazilian early-onset breast cancer, we performed an investigation combining both germline and tumor analysis. Germline screening of the BRCA1, BRCA2, CHEK2 (c.1100delC and TP53 genes was performed in 54 unrelated patients <35 y; their tumors were investigated with respect to transcriptional and genomic profiles as well as hormonal receptors and HER2 expression/amplification. Germline mutations were detected in 12 out of 54 patients (22% [7 in BRCA1 (13%, 4 in BRCA2 (7% and one in TP53 (2% gene]. A cancer familial history was present in 31.4% of the unrelated patients, from them 43.7% were carriers for germline mutation (37.5% in BRCA1 and in 6.2% in the BRCA2 genes. Fifty percent of the unrelated patients with hormone receptor-negative tumors carried BRCA1 mutations, percentage increasing to 83% in cases with familial history of cancer. Over-representation of DNA damage-, cellular and cell cycle-related processes was detected in the up-regulated genes of BRCA1/2-associated tumors, whereas cell and embryo development-related processes were over-represented in the up-regulated genes of BRCA1/2-negative tumors, suggesting distinct mechanisms driving the tumorigenesis. An initial portrait of the early-onset breast cancer patients in Brazil was generated pointing out that hormone receptor-negative tumors and positive familial history are two major risk factors for detection of a BRCA1 germline mutation. Additionally, the data revealed molecular factors that potentially trigger the tumor development in young patients.
International Nuclear Information System (INIS)
Kringen, Pedro; Wang, Yun; Dumeaux, Vanessa; Kristensen, Gunnar; Borresen-Dale, Anne-Lise; Dorum, Anne
2005-01-01
Ovarian carcinomas from 30 BRCA1 germ-line carriers of two distinct high penetrant founder mutations, 20 carrying the 1675delA and 10 the 1135insA, and 100 sporadic cases were characterized for somatic mutations in the TP53 gene. We analyzed differences in relation to BRCA1 germline status, TP53 status, survival and age at diagnosis, as previous studies have not been conclusive. DNA was extracted from paraffin embedded formalin fixed tissues for the familial cases, and from fresh frozen specimen from the sporadic cases. All cases were treated at our hospital according to protocol. Mutation analyses of exon 2 – 11 were performed using TTGE, followed by sequencing. Survival rates for BRCA1-familial cases with TP53 mutations were not significantly lower than for familial cases without TP53 mutations (p = 0.25, RR = 1.64, 95% CI [0.71–3.78]). Median age at diagnosis for sporadic (59 years) and familial (49 years) cases differed significantly (p < 0.001) with or without TP53 mutations. Age at diagnosis between the two types of familial carriers were not significantly different, with median age of 47 for 1675delA and 52.5 for 1135insA carriers (p = 0.245). For cases ≥50 years at diagnosis, a trend toward longer survival for sporadic over familial cases was observed (p = 0.08). The opposite trend was observed for cases <50 years at diagnosis. There do not seem to be a protective advantage for familial BRCA1 carriers without TP53 mutations over familial cases with TP53 mutations. However, there seem to be a trend towards initial advantage in survival for familial cases compared to sporadic cases diagnosed before the age of 50 both with and without TP53 mutations. However, this trend diminishes over time and for cases diagnosed ≥50 years the sporadic cases show a trend towards an advantage in survival over familial cases. Although this data set is small, if confirmed, this may be a link in the evidence that the differences in ovarian cancer survival reported, are
DEFF Research Database (Denmark)
Dufour, Annika; Palermo, Giuseppe; Zellmeier, Evelyn
2013-01-01
In chronic lymphocytic leukemia (CLL) patients, disruptions of the TP53 tumor suppressor pathway by 17p13 deletion (del17p), somatic TP53 mutations, or downregulation of microRNA-34a have been associated with a poor prognosis. So far, the impact of the various TP53 defects has not been evaluated ...
Directory of Open Access Journals (Sweden)
Ranjan Chrisanthar
Full Text Available BACKGROUND: TP53 mutations have been associated with resistance to anthracyclines but not to taxanes in breast cancer patients. The MDM2 promoter single nucleotide polymorphism (SNP T309G increases MDM2 activity and may reduce wild-type p53 protein activity. Here, we explored the predictive and prognostic value of TP53 and CHEK2 mutation status together with MDM2 SNP309 genotype in stage III breast cancer patients receiving paclitaxel or epirubicin monotherapy. EXPERIMENTAL DESIGN: Each patient was randomly assigned to treatment with epirubicin 90 mg/m(2 (n = 109 or paclitaxel 200 mg/m(2 (n = 114 every 3rd week as monotherapy for 4-6 cycles. Patients obtaining a suboptimal response on first-line treatment requiring further chemotherapy received the opposite regimen. Time from last patient inclusion to follow-up censoring was 69 months. Each patient had snap-frozen tumor tissue specimens collected prior to commencing chemotherapy. PRINCIPAL FINDINGS: While TP53 and CHEK2 mutations predicted resistance to epirubicin, MDM2 status did not. Neither TP53/CHEK2 mutations nor MDM2 status was associated with paclitaxel response. Remarkably, TP53 mutations (p = 0.007 but also MDM2 309TG/GG genotype status (p = 0.012 were associated with a poor disease-specific survival among patients having paclitaxel but not patients having epirubicin first-line. The effect of MDM2 status was observed among individuals harbouring wild-type TP53 (p = 0.039 but not among individuals with TP53 mutated tumors (p>0.5. CONCLUSION: TP53 and CHEK2 mutations were associated with lack of response to epirubicin monotherapy. In contrast, TP53 mutations and MDM2 309G allele status conferred poor disease-specific survival among patients treated with primary paclitaxel but not epirubicin monotherapy.
Svobodova, Karla; Zemanova, Zuzana; Lhotska, Halka; Novakova, Milena; Podskalska, Lucie; Belickova, Monika; Brezinova, Jana; Sarova, Iveta; Izakova, Silvia; Lizcova, Libuse; Berkova, Adela; Siskova, Magda; Jonasova, Anna; Cermak, Jaroslav; Michalova, Kyra
2016-03-01
Complex karyotypes are seen in approximately 20% of patients with myelodysplastic syndromes (MDS) and are associated with a high risk of transformation to acute myeloid leukemia and poor outcomes in patients. Copy number neutral loss of heterozygosity (CN-LOH, i.e., both copies of a chromosomal pair or their parts originate from one parent) might contribute to increased genomic instability in the bone-marrow cells of patients with MDS. The pathological potential of CN-LOH, which arises as a clonal aberration in a proportion of somatic cells, consists of tumor suppressor gene and oncogene homozygous mutations. The aim of our study was to evaluate the frequency of CN-LOH at 17p in bone-marrow cells of newly diagnosed MDS patients with complex chromosomal aberrations and to assess its correlation with mutations in the TP53 gene (17p13.1). CN-LOH was detected in 40 chromosomal regions in 21 (29%) of 72 patients analyzed. The changes in 27 of the 40 regions identified were sporadic. The most common finding was CN-LOH of the short arm of chromosome 17, which was detected in 13 (18%) of 72 patients. A mutational analysis confirmed the homozygous mutation of TP53 in all CN-LOH 17p patients, among which two frameshift mutations are not registered in the International Agency for Research on Cancer TP53 Database. CN-LOH 17p correlated with aggressive disease (median overall survival 4 months) and was strongly associated with a complex karyotype in the cohort studied, which might cause rapid disease progression in high-risk MDS. No other CN-LOH region previously recorded in MDS or AML patients (1p, 4q, 7q, 11q, 13q, 19q, 21q) was detected in our cohort of patients with complex karyotype examined at the diagnosis of MDS. The LOH region appeared to be balanced (i.e., with no DNA copy number change) when examined with conventional and molecular cytogenetic methods. Therefore, a microarray that detects single-nucleotide polymorphisms is an ideal method with which to identify and
National Research Council Canada - National Science Library
Blackburn, Anneke
2002-01-01
The TP53 tumor suppressor gene is defective in the majority of sporadic breast cancers, and breast cancer is the most frequent tumor type in women with Li-Fraumeni syndrome who inherit germline mutations in TP53...
National Research Council Canada - National Science Library
Smith, Sallie
2004-01-01
The TP53 tumor suppressor gene is defective in the majority of sporadic breast cancers, and breast cancer is the most frequent tumor type in women with Li-Fraumeni syndrome and bear germline mutations in TP53...
International Nuclear Information System (INIS)
Fallai, Carlo; Perrone, Federica; Licitra, Lisa; Pilotti, Silvana; Locati, Laura; Bossi, Paolo; Orlandi, Ester; Palazzi, Mauro; Olmi, Patrizia
2009-01-01
Purpose: To study the prognostic value of the TP53 mutation and human papilloma virus (HPV) status in oropharyngeal squamous cell carcinoma (OPSCC). Methods and materials: The TP53 mutation and HPV status were analyzed in 78 cases of locoregionally advanced OPSCC. The possible correlation of these factors with locoregiownal control, relapse-free survival, disease-specific survival, and overall survival (OS) was also investigated. Results: Of these 78 cases, 22 had disruptive and 22 had non-disruptive (silent) TP53 mutations; the remaining 34 cases had wild-type (WT) TP53. HPV 16 DNA was found in 9 cases (11%), but all HPV-positive (HPV+) cases carried a functional p53 protein, except for 1 case that had a silent mutation. HPV+ patients fared better than HPV-negative (HPV-) patients in terms of all survival parameters, with highly statistically significant differences between the groups. Specifically, no distant metastases were observed in the HPV+ patients, whereas they occurred in 17% of the HPV- patients. However, no difference was observed between the WT TP53 and mutation group, even when this was analyzed in terms of disruptive and non-disruptive mutations. Regardless, treatment with chemotherapy nearly doubled the 5-year OS rates, both in the mutation (42% vs. 22%) and WT (30 vs. 16%) group, but only the mutation group showed improvement in all survival parameters. In addition, the second tumor-free 5-year survival rate was 72% in HPV- cases, but no second tumors were observed in HPV+ and WT p53 cases. Conclusions: Patients with HPV+ OPSCC have an excellent prognosis after radiochemotherapy, but cisplatin-based chemotherapy may not confer a satisfactory outcome, especially in WT cases, thereby justifying the additional or alternative use of taxanes and epidermal growth factor receptors inhibitors. Uncommon distant metastases and second tumors in the HPV+ group may be cause for clinicians to review the follow-up policies in these patients.
Directory of Open Access Journals (Sweden)
Xin Cai
Full Text Available Lung cancer is the most common malignancy and the leading cause of cancer deaths worldwide. While smoking is by far the leading cause of lung cancer, other environmental and genetic factors influence the development and progression of the cancer. Since unique mutations patterns have been observed in individual cancer samples, identification and characterization of the distinctive lung cancer molecular profile is essential for developing more effective, tailored therapies. Until recently, personalized DNA sequencing to identify genetic mutations in cancer was impractical and expensive. The recent technological advancements in next-generation DNA sequencing, such as the semiconductor-based Ion Torrent sequencing platform, has made DNA sequencing cost and time effective with more reliable results. Using the Ion Torrent Ampliseq Cancer Panel, we sequenced 737 loci from 45 cancer-related genes to identify genetic mutations in 76 human lung cancer samples. The sequencing analysis revealed missense mutations in KRAS, EGFR, and TP53 genes in the breast cancer samples of various histologic types. Thus, this study demonstrates the necessity of sequencing individual human cancers in order to develop personalized drugs or combination therapies to effectively target individual, breast cancer-specific mutations.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Saya, Sibel; Killick, Emma; Thomas, Sarah; Taylor, Natalie; Bancroft, Elizabeth K; Rothwell, Jeanette; Benafif, Sarah; Dias, Alexander; Mikropoulos, Christos; Pope, Jenny; Chamberlain, Anthony; Gunapala, Ranga; Izatt, Louise; Side, Lucy; Walker, Lisa; Tomkins, Susan; Cook, Jackie; Barwell, Julian; Wiles, Vicki; Limb, Lauren; Eccles, Diana; Leach, Martin O; Shanley, Susan; Gilbert, Fiona J; Hanson, Helen; Gallagher, David; Rajashanker, Bala; Whitehouse, Richard W; Koh, Dow-Mu; Sohaib, S Aslam; Evans, D Gareth; Eeles, Rosalind A
2017-07-01
In the United Kingdom, current screening guidelines for TP53 germline mutation carriers solely recommends annual breast MRI, despite the wide spectrum of malignancies typically seen in this group. This study sought to investigate the role of one-off non-contrast whole-body MRI (WB MRI) in the screening of asymptomatic TP53 mutation carriers. 44 TP53 mutation carriers and 44 population controls were recruited. Scans were read by radiologists blinded to participant carrier status. The incidence of malignancies diagnosed in TP53 mutation carriers against general population controls was calculated. The incidences of non-malignant relevant disease and irrelevant disease were measured, as well as the number of investigations required to determine relevance of findings. In TP53 mutation carriers, 6 of 44 (13.6, 95% CI 5.2-27.4%) participants were diagnosed with cancer during the study, all of which would be considered life threatening if untreated. Two were found to have two primary cancers. Two participants with cancer had abnormalities on the MRI which were initially thought to be benign (a pericardial cyst and a uterine fibroid) but transpired to be sarcomas. No controls were diagnosed with cancer. Fifteen carriers (34.1, 95% CI 20.5-49.9%) and seven controls (15.9, 95% CI 6.7-30.1%) underwent further investigations following the WB MRI for abnormalities that transpired to be benign (p = 0.049). The cancer detection rate in this group justifies a minimum baseline non-contrast WB MRI in germline TP53 mutation carriers. This should be adopted into national guidelines for management of adult TP53 mutation carriers in addition to the current practice of contrast enhanced breast MRI imaging.
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
Kazakov, Dmitry V; Ivan, Doina; Kutzner, Heinz; Spagnolo, Dominic V; Grossmann, Petr; Vanecek, Tomas; Sima, Radek; Kacerovska, Denisa; Shelekhova, Ksenia V; Denisjuk, Natalja; Hillen, Uwe; Kuroda, Naoto; Mukensnabl, Petr; Danis, Dusan; Michal, Michal
2009-05-01
, in 2 cases, a minority of the neoplastic cells (10%-20%) demonstrated nuclear staining, whereas the remaining 4 cases were negative. Of 9 specimens of hidradenocarcinoma studied for TP53 mutations, 2 harbored mutations, whereas the remaining 7 specimens showed the wild-type sequence. Of 11 specimens studied for translocation t(11;19), 2 cases harbored the translocation. It is concluded that cutaneous hidradenocarcinomas show some microscopic heterogeneity and comprise both low- and high-grade lesions that cytologically are similar to their benign counterpart, the hidradenoma. Within the spectrum of low-grade lesions, there seem to exist tumors almost indistinguishable from hidradenomas but still being capable of regional or distant metastasis. Similar to hidradenomas, hidradenocarcinomas show a t(11;19) translocation, but it is a significantly rarer event. Even rarer is the amplification of the Her2/neu gene. Of note is the relatively low frequency of TP53 mutations despite a high rate of p53 protein expression at the immunohistochemical level.
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
Braakhuis, B J M; Rietbergen, M M; Buijze, M; Snijders, P J F; Bloemena, E; Brakenhoff, R H; Leemans, C R
2014-09-01
Little is known about the molecular carcinogenesis of oral squamous cell carcinoma (OSCC) in young adult patients. The aim of this study was to investigate the detailed TP53 mutation and human papilloma virus (HPV) status of OSCC in patients, younger than 45 years. TP53 mutations were determined with direct sequencing on paraffin-embedded carcinoma tissue from 31 young patients and compared with two older age OSCC reference groups: one from the same institute (N = 87) and an independent one (N = 675). Biologically active tumour HPV was detected by p16-immunohistochemistry followed by a HPV-DNA GP5 + /6 + -PCR. HPV16 was present in one OSCC (3%). TP53 mutations were found in 14 (45%) OSCC: five were missense and nine resulted in a truncated protein. Six of these latter were insertions or deletions of one or more nucleotides leading to frameshift, one was at a splice site and two resulted in a stop codon. The percentage of truncating mutations (64% of all mutations) was higher than that observed in the institute's reference group (44%, P = 0.23) and in the independent reference group (24%, P = 0.002). This study shows that TP53 mutations are common in OSCC of young adult patients; infection with biologically active HPV is rare. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Lisa K. Mullany
2015-10-01
Full Text Available Evolutionary Action analyses of The Cancer Gene Atlas data sets show that many specific p53 missense and gain-of-function mutations are selectively overrepresented and functional in high-grade serous ovarian cancer (HGSC. As homozygous alleles, p53 mutants are differentially associated with specific loss of heterozygosity (R273; chromosome 17; copy number variation (R175H; chromosome 9; and up-stream, cancer-related regulatory pathways. The expression of immune-related cytokines was selectively related to p53 status, showing for the first time that specific p53 mutants impact, and are related to, the immune subtype of ovarian cancer. Although the majority (31% of HGSCs exhibit loss of heterozygosity, a significant number (24% maintain a wild-type (WT allele and represent another HGSC subtype that is not well defined. Using human and mouse cell lines, we show that specific p53 mutants differentially alter endogenous WT p53 activity; target gene expression; and responses to nutlin-3a, a small molecular that activates WT p53 leading to apoptosis, providing “proof of principle” that ovarian cancer cells expressing WT and mutant alleles represent a distinct ovarian cancer subtype. We also show that siRNA knock down of endogenous p53 in cells expressing homozygous mutant alleles causes apoptosis, whereas cells expressing WT p53 (or are heterozygous for WT and mutant p53 alleles are highly resistant. Therefore, despite different gene regulatory pathways associated with specific p53 mutants, silencing mutant p53 might be a suitable, powerful, global strategy for blocking ovarian cancer growth in those tumors that rely on mutant p53 functions for survival. Knowing p53 mutational status in HGSC should permit new strategies tailored to control this disease.
Lin, Jiaying; Lu, Jiaqi; Wang, Chao; Xue, Xiaohong
2017-01-01
Epithelial-mesenchymal transition (EMT), TP53, and Podoplanin have been implicated in the tumorigenesis and metastasis of human cancers. Nevertheless, the clinical significance of these markers in cancer patients is still not clear. In this study, we sought to determine the prognostic values of Vimentin, TP53, and Podoplanin in patients with cervical cancer. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot analysis were performed to determine the messenger RNA and protein expression levels of Vimentin, TP53, and Podoplanin, respectively, in cervical squamous cell carcinoma and adjacent normal cervical tissues. Additionally, the expression levels of Podoplanin were also measured in 130 cervical cancer patients (FIGO stages Ib1-IIa2) using immunohistochemistry (IHC) staining. The mRNA expression levels of Vimentin, TP53, and Podoplanin were considerably elevated in cervical cancer tissues, compared with those in the adjacent normal cervical tissues. Additionally, the protein expression levels of Vimentin were closely correlated with the age of onset (P = 0.007), lymph node metastasis (P = 0.007), lymphatic invasion (P = 0.024), disease recurrence (P < 0.001), and the clinical prognosis of patients with cervical cancer (P < 0.001). Our multivariate analysis also suggests that Vimentin is an independent marker for survival in cervical cancer patients. Furthermore, the expression levels of Vimentin are negatively correlated with the proliferation marker Ki67 expression. Our data show that Vimentin can serve as an independent prognostic marker for cervical cancer patients with primary surgery. Registration number ChiCTR-TRC-06000236 Registered 15 December 2006.
Al-Shamsi, Humaid O.; Jones, Jeremy; Fahmawi, Yazan; Dahbour, Ibrahim; Tabash, Aziz; Abdel-Wahab, Reham; Abousamra, Ahmed O. S.; Shaw, Kenna R.; Xiao, Lianchun; Hassan, Manal M.; Kipp, Benjamin R.; Kopetz, Scott; Soliman, Amr S.; McWilliams, Robert R.; Wolff, Robert A.
2016-01-01
Background The frequency rates of mutations such as KRAS, NRAS, BRAF, and PIK3CA in colorectal cancer (CRC) differ among populations. The aim of this study was to assess mutation frequencies in the Arab population and determine their correlations with certain clinicopathological features. Methods Arab patients from the Arab Gulf region and a population of age- and sex-matched Western patients with CRC whose tumors were evaluated with next-generation sequencing (NGS) were identified and retrospectively reviewed. The mutation rates of KRAS, NRAS, BRAF, PIK3CA, TP53, and APC were recorded, along with clinicopathological features. Other somatic mutation and their rates were also identified. Fisher’s exact test was used to determine the association between mutation status and clinical features. Results A total of 198 cases were identified; 99 Arab patients and 99 Western patients. Fifty-two point seven percent of Arab patients had stage IV disease at initial presentation, 74.2% had left-sided tumors. Eighty-nine point two percent had tubular adenocarcinoma and 10.8% had mucinous adenocarcinoma. The prevalence rates of KRAS, NRAS, BRAF, PIK3CA, TP53, APC, SMAD, FBXW7 mutations in Arab population were 44.4%, 4%, 4%, 13.1%, 52.5%, 27.3%, 2% and 3% respectively. Compared to 48.4%, 4%, 4%, 12.1%, 47.5%, 24.2%, 11.1% and 0% respectively in matched Western population. Associations between these mutations and patient clinicopathological features were not statistically significant. Conclusions This is the first study to report comprehensive hotspot mutations using NGS in Arab patients with CRC. The frequency of KRAS, NRAS, BRAF, TP53, APC and PIK3CA mutations were similar to reported frequencies in Western population except SMAD4 that had a lower frequency and higher frequency of FBXW7 mutation. PMID:28078112
Wang, Zhen; Xia, Rong-Hui; Ye, Dong-Xia; Li, Jiang
2016-01-01
Objectives To investigate the clinicopathological characteristics, human papillomavirus (HPV) infection, p53 expression, and TP53 mutations in oropharyngeal squamous cell carcinoma (OPSCC) and determine their utility as prognostic predictors in a primarily eastern Chinese population. Methods The HPV infection status was tested via p16INK4A immunohistochemistry and validated using PCR, reverse blot hybridization and in situ hybridization (ISH) in 188 OPSCC samples. p53 expression levels and TP...
Preclinical efficacy of the MDM2 inhibitor RG7112 in MDM2 amplified and TP53 wild-type glioblastomas
Verreault, Maite; Schmitt, Charlotte; Goldwirt, Lauriane; Pelton, Kristine; Haidar, Samer; Levasseur, Camille; Guehennec, Jeremy; Knoff, David; Labussiere, Marianne; Marie, Yannick; Ligon, Azra H.; Mokhtari, Karima; Hoang-Xuan, Khe; Sanson, Marc; Alexander, Brian M; Wen, Patrick Y.; Delattre, Jean-Yves; Ligon, Keith L.; Idbaih, Ahmed
2016-01-01
Rationale p53 pathway alterations are key molecular events in glioblastoma (GBM). MDM2 inhibitors increase expression and stability of p53 and are presumed to be most efficacious in patients with TP53 wild-type and MDM2-amplified cancers. However, this biomarker hypothesis has not been tested in patients or patient-derived models for GBM. Methods We performed a preclinical evaluation of RG7112 MDM2 inhibitor, across a panel of 36 patient-derived GBM cell lines (PDCLs), each genetically characterized according to their P53 pathway status. We then performed a pharmacokinetic (PK) profiling of RG7112 distribution in mice and evaluated the therapeutic activity of RG7112 in orthotopic and subcutaneous GBM models. Results MDM2-amplified PDCLs were 44 times more sensitive than TP53 mutated lines that showed complete resistance at therapeutically attainable concentrations (avg. IC50 of 0.52 μM vs 21.9 μM). MDM4 amplified PDCLs were highly sensitive but showed intermediate response (avg. IC50 of 1.2 μM), whereas response was heterogeneous in TP53 wild-type PDCLs with normal MDM2/4 levels (avg. IC50 of 7.7 μM). In MDM2-amplified lines, RG7112 restored p53 activity inducing robust p21 expression and apoptosis. PK profiling of RG7112-treated PDCL intracranial xenografts demonstrated that the compound significantly crosses the blood-brain and the blood-tumor barriers. Most importantly, treatment of MDM2-amplified/TP53 wild-type PDCL-derived model (subcutaneous and orthotopic) reduced tumor growth, was cytotoxic, and significantly increased survival. Conclusion These data strongly support development of MDM2 inhibitors for clinical testing in MDM2-amplified GBM patients. Moreover, significant efficacy in a subset of non-MDM2 amplified models suggests that additional markers of response to MDM2 inhibitors must be identified. PMID:26482041
Energy Technology Data Exchange (ETDEWEB)
Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.; Parcels, Leslie A.; Parcels, Joshua; Karnak, David; Ryan, Caila; Liu, Na; Maybaum, Jonathan; Lawrence, Theodore S.
2016-06-01
Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3 antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.
Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming
2016-01-01
Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and ‘primary peritoneal’ (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. PMID:21990067
International Nuclear Information System (INIS)
Wang, Quan; Wei, Feng; Lv, Guoyue; Li, Chunsheng; Liu, Tongjun; Hadjipanayis, Costas G; Zhang, Guikai; Hao, Chunhai; Bellail, Anita C
2013-01-01
There is growing evidence indicating the insulin-like growth factor 1 receptor (IGF-1R) plays a critical role in the progression of human colorectal carcinomas. IGF-1R is an attractive drug target for the treatment of colon cancer. Picropodophyllin (PPP), of the cyclolignan family, has recently been identified as an IGF-1R inhibitor. The aim of this study is to determine the therapeutic response and mechanism after colorectal carcinoma treatment with PPP. Seven colorectal carcinoma cell lines were treated with PPP. Following treatment, cells were analyzed for growth by a cell viability assay, sub-G1 apoptosis by flow cytometry, caspase cleavage and activation of AKT and extracellular signal-regulated kinase (ERK) by western blot analysis. To examine the in vivo therapeutic efficacy of PPP, mice implanted with human colorectal carcinoma xenografts underwent PPP treatment. PPP treatment blocked the phosphorylation of IGF-1R, AKT and ERK and inhibited the growth of TP53 wild-type but not mutated colorectal carcinoma cell lines. The treatment of PPP also induced apoptosis in TP53 wild-type cells as evident by the presence of sub-G1 cells and the cleavage of caspase-9, caspase-3, DNA fragmentation factor-45 (DFF45), poly (ADP-ribose) polymerase (PARP), and X-linked inhibitor of apoptosis protein (XIAP). The loss of BAD phosphorylation in the PPP-treated TP53 wild type cells further suggested that the treatment induced apoptosis through the BAD-mediated mitochondrial pathway. In contrast, PPP treatment failed to induce the phosphorylation of AKT and ERK and caspase cleavage in TP53 mutated colorectal carcinoma cell lines. Finally, PPP treatment suppressed the growth of xenografts derived from TP53 wild type but not mutated colorectal carcinoma cells. We report the association of TP53 mutations with the resistance of treatment of colorectal carcinoma cells in culture and in a xenograft mouse model with the IGF-1R inhibitor PPP. TP53 mutations often occur in colorectal
van Oosterwijk, J G; van Ruler, M A J H; Briaire-de Bruijn, I H; Herpers, B; Gelderblom, H; van de Water, B; Bovée, J V M G
2013-01-01
Background: Chondrosarcomas are malignant cartilage-forming tumours of bone. Because of their resistance to conventional chemotherapy and radiotherapy, currently no treatment strategies exist for unresectable and metastatic chondrosarcoma. Previously, PI3K/AKT/GSK3β and Src kinase pathways were shown to be activated in chondrosarcoma cell lines. Our aim was to investigate the role of these kinases in chemoresistance and migration in chondrosarcoma in relation to TP53 mutation status. Methods: We used five conventional and three dedifferentiated chondrosarcoma cell lines and investigated the effect of PI3K/AKT/GSK3β pathway inhibition (enzastaurin) and Src pathway inhibition (dasatinib) in chemoresistance using WST assay and live cell imaging with AnnexinV staining. Immunohistochemistry on tissue microarrays (TMAs) containing 157 cartilaginous tumours was performed for Src family members. Migration assays were performed with the RTCA xCelligence System. Results: Src inhibition was found to overcome chemoresistance, to induce apoptosis and to inhibit migration. Cell lines with TP53 mutations responded better to combination therapy than wild-type cell lines (P=0.002). Tissue microarray immunohistochemistry confirmed active Src (pSrc) signalling, with Fyn being most abundantly expressed (76.1%). Conclusion: These results strongly indicate Src family kinases, in particular Fyn, as a potential target for the treatment of inoperable and metastatic chondrosarcomas, and to sensitise for doxorubicin especially in the presence of TP53 mutations. PMID:23922104
Reiling, Erwin; Speksnijder, Ewoud N; Pronk, Amanda C M; van den Berg, Sjoerd A A; Neggers, Silvia J W; Rietbroek, Ilma; van Steeg, Harry; Dollé, Martijn E T
2014-02-13
Variation in TP53 has been associated with cancer. The pro-allele of a TP53 polymorphism in codon 72 (rs1042522) has been associated with longevity. Recently, we showed that the same allele might be involved in preservation of glucose metabolism, body composition and blood pressure during ageing. Here, we assessed glucose tolerance and body composition in mice carrying the human polymorphism. Our data do not support the previous findings in humans, suggesting that this polymorphism does not play a major role in development of glucose metabolism and body composition during ageing. Alternatively, the mouse model may not be suitable to validate these rs1042522-associated traits up to the age tested.
Kuhn, Elisabetta; Kurman, Robert J; Vang, Russell; Sehdev, Ann Smith; Han, Guangming; Soslow, Robert; Wang, Tian-Li; Shih, Ie-Ming
2012-02-01
Serous tubal intraepithelial carcinomas (STICs) have been proposed to be the most likely precursor of ovarian, tubal and 'primary peritoneal' (pelvic) high-grade serous carcinoma (HGSC). As somatic mutation of TP53 is the most common molecular genetic change of ovarian HGSC, occurring in more than 95% of cases, we undertook a mutational analysis of 29 pelvic HGSCs that had concurrent STICs to demonstrate the clonal relationship of STICs and HGSCs. In addition, we correlated the mutational data with p53 immunostaining to determine the role of p53 immunoreactivity as a surrogate for TP53 mutations in histological diagnosis. Somatic TP53 mutations were detected in all 29 HGSCs analysed and the identical mutations were detected in 27 of 29 pairs of STICs and concurrent HGSCs. Missense mutations were observed in 61% of STICs and frameshift/splicing junction/nonsense mutations in 39%. Interestingly, there were two HGSCs with two distinctly different TP53 mutations each, but only one of the mutations was detected in the concurrent STICs. Missense mutations were associated with intense and diffuse (≥ 60%) p53 nuclear immunoreactivity, while most of the null mutations were associated with complete loss of p53 staining (p STIC and pelvic HGSC and demonstrate the utility of p53 immunostaining as a surrogate for TP53 mutation in the histological diagnosis of STIC. In this regard, it is important to appreciate the significance of different staining patterns. Specifically, strong diffuse staining correlates with a missense mutation, whereas complete absence of staining correlates with null mutations. Copyright © 2012 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
L’Abbate, Alberto; Tagliafico, Enrico; Minoia, Carla; De Tullio, Giacoma; Guarini, Attilio; Testoni, Nicoletta; Agostinelli, Claudio; Storlazzi, Clelia Tiziana; Lo Cunsolo, Crocifissa; Macrì, Ettore; Iuzzolino, Paolo; Mecucci, Cristina; Doglioni, Claudio; Coco, Michelina; Muscarella, Lucia Anna; Salati, Simona
2014-01-01
The progression of low-risk del(5q) myelodysplastic syndrome to acute myeloid leukemia is increased when associated with mutations of TP53, or with additional chromosomal abnormalities. However, to date the prognostic impact and molecular consequences of these rearrangements were poorly investigated. Single additional alterations to del(5q) by balanced chromosome rearrangements were rarely found in myelodysplasia. In particular, balanced alterations involving TP63 and FOXP1 genes were never reported in the literature. Here we report on a 79-year woman with an aggressive form of myelodysplastic syndrome with del(5q), no TP53 mutation, and a novel complex rearrangement of chromosome 3 in bone marrow cells. Our results revealed that the FOXP1 and TP63 genes were both relocated along chromosome 3. Strikingly, immunohistochemistry analysis showed altered protein levels, disclosing that this rearrangement triggered the expression of FOXP1 and TP63 genes. FOXP1 was also found activated in other patients with myelodysplasia and acute myeloid leukemia, showing that it is an important, recurrent event. We document an apparent role of FOXP1 and TP63, up to now poorly documented, in the progression of MDS in our patient who is lacking mutations in the TP53 tumor suppressor gene normally associated with poor outcome in myelodysplastic syndrome with 5q-. Finally, our results may suggest a possible broader role of FOXP1 in the pathogenesis and progression of myelodysplasia and acute myeloid leukemia
Le Bris, Yannick; Struski, Stéphanie; Guièze, Romain; Rouvellat, Caroline; Prade, Naïs; Troussard, Xavier; Tournilhac, Olivier; Béné, Marie C; Delabesse, Eric; Ysebaert, Loïc
2017-12-01
Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disorder of remarkable heterogeneity as demonstrated by cytogenetics and molecular analyses. Complex karyotype (CK), TP53 deletions and/or mutations (TP53 disruption), IGVH mutational status, and, more recently, recurrent somatic mutations have been identified as prognostic markers in CLL. On a cohort of 110 patients with CLL treated with first-line fludarabin, cyclophosphamide, and rituximab treatment compared with 33 untreated (watch and wait) patients with CLL, we report more frequent complex karyotypes (34 vs 15%; P = .05), unmutated IGHV (70 vs 21%; P < .0001), ATM deletion (25 vs 6%, P = .02), and NOTCH mutation (3 vs 17%, P = .04). Among treated patients, 39 relapsed during the follow-up period. These patients were characterized before treatment by a higher incidence of trisomy 12 (38 vs 11%, P < .001) and TP53 disruption (31 vs 4%, P = .0002). A significantly shorter 5-year overall survival was found for treated patients with CK (72.4 vs 85.8%; P = .007), unmutated IGHV (70 vs 100%; P = .04), or TP53 disruption (55.7 vs 82.7%; P < .0001). Three risk groups were defined based on the status of TP53 disruption or unmutated IGVH, which differed significantly in terms of 5-year overall survival. Moreover, the presence of CK impacted pejoratively 5-year overall survival and progression-free survival in all these 3 groups. Conventional karyotyping therefore appears to be of value, CK being an additional factor, undetectable in classical FISH, in patients with CLL at the stage when therapy becomes required. Copyright © 2016 John Wiley & Sons, Ltd.
Franken, N. A. P.; van Bree, C.; ten Cate, R.; van Oven, C. H.; Haveman, J.
2002-01-01
Repair of potentially lethal damage (PLD) was investigated in cells with functional G(1)-phase arrest with wild-type TP53 and wild-type RB and in cells in which G(1)-phase arrest was abrogated by inactivation of TP53 or RB. Confluent cultures of cells were plated for clonogenic survival assay either
Yan, Yulan; Wu, Renzheng; Li, Shaojing; He, Jinlong
2015-06-01
In the light of the relationship between the TP53 Arg72Pro (rs1042522) polymorphism and the risk of endometriosis remains inclusive or controversial. For better understanding of the effect of TP53 Arg72Pro polymorphism on endometriosis risk, we performed a meta-analysis. The relevant studies were identified through a search of PubMed, Web of Science, EMBASE, Ovid, Springer, China National Knowledge Infrastructure (CNKI), cqvip, Wanfang database, and Chinese Biomedical Literature (CBM) databases up to December, 2014. The association between the TP53 Arg72Pro polymorphism and endometriosis risk was pooled by conducted by odds ratios and 95% confidence intervals. A total of fifteen case-control studies with 2683 cases and 3335 controls were eventually identified. There was significant association between Arg72Pro polymorphism and endometriosis risk in all of the five models in overall populations (C vs. G: OR=1.32, 95%CI=1.14-1.53, p=0.00; CC vs. GG: OR=1.80, 95%CI=1.28-2.53, p=0.001; GC vs. GG: OR=1.52, 95%CI=1.22-1.88, p=0.00; CC vs. OR=1.32, 95%CI=1.05-1.66, p=0.016; CC/GC vs. GG: OR=1.59, 95%CI=1.26-2.00, p=0.00). In the sub-group analysis according to ethnicity, the results suggested that TP53 Arg72Pro polymorphism was not associated with endometriosis risk in Caucasians. However, the significant association was found in Asians and Mixed race (MIX) under the five models. The results of this meta-analysis suggest that the TP53 Arg72Pro polymorphism can increase the risk of endometriosis, especially among Asians and MIX populations. Considering the limited sample size and ethnicities included in the meta-analysis, further larger scaled and well-designed studies are needed to confirm our results. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DEFF Research Database (Denmark)
Madsen, Hans Peter Lynge; Hammer, Karin
1998-01-01
to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...
Ruijs, M.W.G.; Verhoef, S.; Rookus, M.A.; Pruntel, R.; van der Hout, A.H.; Hogervorst, F.B.L.; Kluijt, I.; Sijmons, R.H.; Aalfs, C.M.; Wagner, A.; Ausems, M.G.E.M.; Hoogerbrugge, N.; van Asperen, C.J.; Gómez García, E.B.; Meijers-Heijboer, H.; ten Kate, L.P.; Menko, F.H.; van 't Veer, L.J.
2010-01-01
Background Li-Fraumeni syndrome (LFS) is a rare autosomal dominant cancer predisposition syndrome. Most families fulfilling the classical diagnostic criteria harbour TP53 germline mutations. However, TP53 germline mutations may also occur in less obvious phenotypes. As a result, different criteria
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
Biton, Jerome; Mansuet-Lupo, Audrey; Pécuchet, Nicolas; Alifano, Marco; Ouakrim, Hanane; Arrondeau, Jennifer; Boudou-Rouquette, Pascaline; Goldwasser, Francois; Leroy, Karen; Goc, Jeremy; Wislez, Marie; Germain, Claire; Laurent-Puig, Pierre; Dieu-Nosjean, Marie-Caroline; Cremer, Isabelle; Herbst, Ronald; Blons, Hélène F; Damotte, Diane
2018-05-15
By unlocking anti-tumor immunity, antibodies targeting programmed cell death 1 (PD-1) exhibit impressive clinical results in non-small cell lung cancer, underlining the strong interactions between tumor and immune cells. However, factors that can robustly predict long-lasting responses are still needed. We performed in depth immune profiling of lung adenocarcinoma using an integrative analysis based on immunohistochemistry, flow-cytometry and transcriptomic data. Tumor mutational status was investigated using next-generation sequencing. The response to PD-1 blockers was analyzed from a prospective cohort according to tumor mutational profiles and to PD-L1 expression, and a public clinical database was used to validate the results obtained. We showed that distinct combinations of STK11 , EGFR and TP53 mutations, were major determinants of the tumor immune profile (TIP) and of the expression of PD-L1 by malignant cells. Indeed, the presence of TP53 mutations without co-occurring STK11 or EGFR alterations ( TP53 -mut/ STK11 - EGFR -WT), independently of KRAS mutations, identified the group of tumors with the highest CD8 T cell density and PD-L1 expression. In this tumor subtype, pathways related to T cell chemotaxis, immune cell cytotoxicity, and antigen processing were up-regulated. Finally, a prolonged progression-free survival (PFS: HR=0.32; 95% CI, 0.16-0.63, p <0.001) was observed in anti-PD-1 treated patients harboring TP53 -mut/ STK11 - EGFR -WT tumors. This clinical benefit was even more remarkable in patients with associated strong PD-L1 expression. Our study reveals that different combinations of TP53 , EGFR and STK11 mutations , together with PD-L1 expression by tumor cells, represent robust parameters to identify best responders to PD-1 blockade. Copyright ©2018, American Association for Cancer Research.
Alsbeih, Ghazi A; Al-Harbi, Najla M; Bin Judia, Sara S; Khoja, Hatim A; Shoukri, Mohamed M; Tulbah, Asma M
2017-07-01
Cervical cancer is a predominantly human papillomavirus (HPV)-driven disease worldwide. However, its incidence is unexplainably low in western Asia, including Saudi Arabia. Using this paradigm, we investigated the role of HPV infection rate and host genetic predisposition in TP53 G72C single nucleotide polymorphism (SNP) presumed to affect cancer incidence. Patients treated between 1990 and 2012 were reviewed, and a series of 232 invasive cervical cancer cases were studied and compared with 313 matched controls without cancer. SNP was genotyped by way of direct sequencing. HPV linear array analysis was used to detect and genotype HPV in tumor samples. The incidence of cervical cancer revealed bimodal peaks at 42.5 years, with a slighter rebound at 60.8 years. Among all cases, 77% were HPV-positive and 16 HPV genotypes were detected-mostly genotypes 16 (75%) and 18 (9%)-with no difference by age, histology, or geographical region. Although the TP53 G72C genotype was not associated with overall cervical cancer risk, it was significantly associated with HPV positivity (odds ratio, 0.57; 95% confidence interval, 0.36-0.90; P = .016). Furthermore, the variant C allele was significantly overtransmitted in the population (P Cervical cancer incidence displays bimodal curve peaking at a young age with secondary rebound at older age. The combination of relative low HPV infection and variant TP53 72C allele overtransmission provide a plausible explanation for the low incidence of cervical cancer in our population. Therefore, HPV screening and host SNP genotyping may provide more relevant biomarkers to gauge the risk of developing cervical cancer. Cancer 2017;123:2459-66. © 2017 American Cancer Society. © 2017 The Authors. Cancer published by Wiley Periodicals, Inc. on behalf of American Cancer Society.
Overexpressed TP73 induces apoptosis in medulloblastoma
International Nuclear Information System (INIS)
Castellino, Robert C; De Bortoli, Massimiliano; Lin, Linda L; Skapura, Darlene G; Rajan, Jessen A; Adesina, Adekunle M; Perlaky, Laszlo; Irwin, Meredith S; Kim, John YH
2007-01-01
Medulloblastoma is the most common malignant brain tumor of childhood. Children who relapse usually die of their disease, which reflects resistance to radiation and/or chemotherapy. Improvements in outcome require a better understanding of the molecular basis of medulloblastoma growth and treatment response. TP73 is a member of the TP53 tumor suppressor gene family that has been found to be overexpressed in a variety of tumors and mediates apoptotic responses to genotoxic stress. In this study, we assessed expression of TP73 RNA species in patient tumor specimens and in medulloblastoma cell lines, and manipulated expression of full-length TAp73 and amino-terminal truncated ΔNp73 to assess their effects on growth. We analyzed medulloblastoma samples from thirty-four pediatric patients and the established medulloblastoma cell lines, Daoy and D283MED, for expression of TP73 RNA including the full-length transcript and the 5'-terminal variants that encode the ΔNp73 isoform, as well as TP53 RNA using quantitative real time-RTPCR. Protein expression of TAp73 and ΔNp73 was quantitated with immunoblotting methods. Clinical outcome was analyzed based on TP73 RNA and p53 protein expression. To determine effects of overexpression or knock-down of TAp73 and ΔNp73 on cell cycle and apoptosis, we analyzed transiently transfected medulloblastoma cell lines with flow cytometric and TUNEL methods. Patient medulloblastoma samples and cell lines expressed full-length and 5'-terminal variant TP73 RNA species in 100-fold excess compared to non-neoplastic brain controls. Western immunoblot analysis confirmed their elevated levels of TAp73 and amino-terminal truncated ΔNp73 proteins. Kaplan-Meier analysis revealed trends toward favorable overall and progression-free survival of patients whose tumors display TAp73 RNA overexpression. Overexpression of TAp73 or ΔNp73 induced apoptosis under basal growth conditions in vitro and sensitized them to cell death in response to
Overexpressed TP73 induces apoptosis in medulloblastoma
Directory of Open Access Journals (Sweden)
Perlaky Laszlo
2007-07-01
Full Text Available Abstract Background Medulloblastoma is the most common malignant brain tumor of childhood. Children who relapse usually die of their disease, which reflects resistance to radiation and/or chemotherapy. Improvements in outcome require a better understanding of the molecular basis of medulloblastoma growth and treatment response. TP73 is a member of the TP53 tumor suppressor gene family that has been found to be overexpressed in a variety of tumors and mediates apoptotic responses to genotoxic stress. In this study, we assessed expression of TP73 RNA species in patient tumor specimens and in medulloblastoma cell lines, and manipulated expression of full-length TAp73 and amino-terminal truncated ΔNp73 to assess their effects on growth. Methods We analyzed medulloblastoma samples from thirty-four pediatric patients and the established medulloblastoma cell lines, Daoy and D283MED, for expression of TP73 RNA including the full-length transcript and the 5'-terminal variants that encode the ΔNp73 isoform, as well as TP53 RNA using quantitative real time-RTPCR. Protein expression of TAp73 and ΔNp73 was quantitated with immunoblotting methods. Clinical outcome was analyzed based on TP73 RNA and p53 protein expression. To determine effects of overexpression or knock-down of TAp73 and ΔNp73 on cell cycle and apoptosis, we analyzed transiently transfected medulloblastoma cell lines with flow cytometric and TUNEL methods. Results Patient medulloblastoma samples and cell lines expressed full-length and 5'-terminal variant TP73 RNA species in 100-fold excess compared to non-neoplastic brain controls. Western immunoblot analysis confirmed their elevated levels of TAp73 and amino-terminal truncated ΔNp73 proteins. Kaplan-Meier analysis revealed trends toward favorable overall and progression-free survival of patients whose tumors display TAp73 RNA overexpression. Overexpression of TAp73 or ΔNp73 induced apoptosis under basal growth conditions in vitro and
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Sánchez-Castro, Judit; Marco-Betés, Víctor; Gómez-Arbonés, Xavier; García-Cerecedo, Tomás; López, Ricard; Talavera, Elisabeth; Fernández-Ruiz, Sara; Ademà, Vera; Marugan, Isabel; Luño, Elisa; Sanzo, Carmen; Vallespí, Teresa; Arenillas, Leonor; Marco Buades, Josefa; Batlle, Ana; Buño, Ismael; Martín Ramos, María Luisa; Blázquez Rios, Beatriz; Collado Nieto, Rosa; Vargas, Ma Teresa; González Martínez, Teresa; Sanz, Guillermo; Solé, Francesc
2015-01-01
Conventional G-banding cytogenetics (CC) detects chromosome 17 (chr17) abnormalities in 2% of patients with de novo myelodysplastic syndromes (MDS). We used CC and fluorescence in situ hybridization (FISH) (LSI p53/17p13.1) to assess deletion of 17p in 531 patients with de novo MDS from the Spanish Group of Hematological Cytogenetics. FISH detected - 17 or 17p abnormalities in 13 cases (2.6%) in whom no 17p abnormalities were revealed by CC: 0.9% of patients with a normal karyotype, 0% in non-informative cytogenetics, 50% of patients with a chr17 abnormality without loss of 17p and 4.7% of cases with an abnormal karyotype not involving chr17. Our results suggest that applying FISH of 17p13 to identify the number of copies of the TP53 gene could be beneficial in patients with a complex karyotype. We recommend using FISH of 17p13 in young patients with a normal karyotype or non-informative cytogenetics, and always in isolated del(17p).
Bogusz, Agata M
2017-01-01
Posttransplant lymphoproliferative disorders (PTLDs) are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV). EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL) 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL) with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1), and EBV-encoded RNA (EBER). Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH) were negative for cMYC , BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS) revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53 (x2) genes and 30 variants of unknown significance (VOUS) in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.
Directory of Open Access Journals (Sweden)
Agata M. Bogusz
2017-01-01
Full Text Available Posttransplant lymphoproliferative disorders (PTLDs are a diverse group of lymphoid or plasmacytic proliferations frequently driven by Epstein-Barr virus (EBV. EBV-negative PTLDs appear to represent a distinct entity. This report describes an unusual case of a 33-year-old woman that developed a monomorphic EBV-negative PTLD consistent with diffuse large B-cell lymphoma (DLBCL 13 years after heart-lung transplant. Histological examination revealed marked pleomorphism of the malignant cells including nodular areas reminiscent of classical Hodgkin lymphoma (cHL with abundant large, bizarre Hodgkin-like cells. By immunostaining, the malignant cells were immunoreactive for CD45, CD20, CD79a, PAX5, BCL6, MUM1, and p53 and negative for CD15, CD30, latent membrane protein 1 (LMP1, and EBV-encoded RNA (EBER. Flow cytometry demonstrated lambda light chain restricted CD5 and CD10 negative B-cells. Fluorescence in situ hybridization studies (FISH were negative for cMYC, BCL2, and BCL6 rearrangements but showed deletion of TP53 and monosomy of chromosome 17. Next-generation sequencing studies (NGS revealed numerous genetic alterations including 6 pathogenic mutations in ASXL1, BCOR, CDKN2A, NF1, and TP53(x2 genes and 30 variants of unknown significance (VOUS in ABL1, ASXL1, ATM, BCOR, BCORL1, BRNIP3, CDH2, CDKN2A, DNMT3A, ETV6, EZH2, FBXW7, KIT, NF1, RUNX1, SETPB1, SF1, SMC1A, STAG2, TET2, TP53, and U2AF2.
Análisis genético en APC, KRAS y TP53 en pacientes con cáncer de estómago y colon
Directory of Open Access Journals (Sweden)
K.A. Palacio-Rúa
2014-04-01
Conclusión: Las mutaciones en los genes APC, KRAS y TP53 fueron más comunes en el CCR que en el CE; nuestros resultados indican la existencia de diferentes vías genéticas en la carcinogénesis del CE y del CCR, y revelan una frecuencia de mutaciones particular en los pacientes colombianos estudiados, que podría estar influida por factores ambientales y étnicos, y el estilo de vida de esta población.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Cavallone, Luca; Arcand, Suzanna L; Maugard, Christine; Ghadirian, Parviz; Mes-Masson, Anne-Marie; Provencher, Diane; Tonin, Patricia N
2008-01-01
The TP53 polymorphisms Arg72Pro (Ex4+199 G>C) and Ins16 (IVS3+24 ins16) have been proposed to modify risk of breast cancer associated with germline BRCA1 and BRCA2 mutations. Allele frequencies of these polymorphisms were investigated to determine if they modify risk in BRCA mutation carriers in breast cancer cases drawn from French Canadian cancer families, a population shown to exhibit strong founder effects. The frequencies of the TP53 alleles, genotypes and haplotypes of 157 index breast cancer cases comprised of 42 BRCA1 mutation carriers, 57 BRCA2 mutation carriers, and 58 BRCA mutation-negative cases, where each case was drawn from independently ascertained families were compared. The effect of TP53 variants on the age of diagnosis was also investigated for these groups. The TP53 polymorphisms were also investigated in 112 women of French Canadian descent with no personal history of cancer. The BRCA mutation-positive groups had the highest frequency of homozygous carriers of the 72Pro allele compared with mutation-negative group. The TP53 polymorphisms exhibited linkage disequilibrium (p < 0.001), where the 72Arg and Ins16minus alleles occurred in strong disequilibrium. The highest frequency of carriers of Ins16minus-72Arg haplotype occurred in the BRCA mutation-negative groups. The BRCA1 mutation carriers homozygous for the 72Pro allele had the youngest ages of diagnosis of breast cancer. However none of these observations were statistically significant. In contrast, the BRCA2 mutation carriers homozygous for the 72Pro allele had a significantly older age of diagnosis of breast cancer (p = 0.018). Moreover, in this group, the mean age of diagnosis of breast cancer in carriers of the Ins16minus-72Arg haplotype was significantly younger than that of the individuals who did not this carry this haplotype (p = 0.009). We observed no significant association of breast cancer risk with TP53 genetic variants based on BRCA1/2 mutation carrier status. Although the
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
Directory of Open Access Journals (Sweden)
Edenir Inêz Palmero
2016-01-01
Full Text Available Abstract In Brazil, breast cancer is a public health care problem due to its high incidence and mortality rates. In this study, we investigated the prevalence of hereditary breast cancer syndromes (HBCS in a population-based cohort in Brazils southernmost capital, Porto Alegre. All participants answered a questionnaire about family history (FH of breast, ovarian and colorectal cancer and those with a positive FH were invited for genetic cancer risk assessment (GCRA. If pedigree analysis was suggestive of HBCS, genetic testing of the BRCA1, BRCA2, TP53, and CHEK2 genes was offered. Of 902 women submitted to GCRA, 214 had pedigrees suggestive of HBCS. Fifty of them underwent genetic testing: 18 and 40 for BRCA1/BRCA2 and TP53 mutation screening, respectively, and 7 for CHEK2 1100delC testing. A deleterious BRCA2 mutation was identified in one of the HBOC probands and the CHEK2 1100delC mutation occurred in one of the HBCC families. No deleterious germline alterations were identified in BRCA1 or TP53. Although strict inclusion criteria and a comprehensive testing approach were used, the suspected genetic risk in these families remains unexplained. Further studies in a larger cohort are necessary to better understand the genetic component of hereditary breast cancer in Southern Brazil.
Prisecaru, V I
2004-01-01
A new approach to the integration of results from a modular, complex biological systems analysis of nonlinear dynamics in cell cycling network transformations that are leading to carcinogenesis is proposed. Carcinogenesis is a complex process that involves dynamically inter-connected biomolecules in the intercellular, membrane, cytosolic, nuclear and nucleolar compartments that form numerous inter-related pathways referred to as networks. One such network module contains the cell cyclins whose functions are essential to cell cycling and division. Cyclins are proteins that also link to several critical pro-apoptotic and other cell cycling/division components, such as: c-Myc, p27, the tumor suppressor gene TP53 and its product-- the p53 protein with key roles in controlling DNA repair, inducing apoptosis and activating p21 (which can depress cell cyclins if activated), mdm2(with its biosynthesis activated by p53 and also, in its turn, inhibiting p53), p21, the Thomsen-Friedenreich antigen(T- antigen),Rb,Bax, Ba...
Abstract We determined the TP53 and codon 12 KRAS mutations in lung tumors from 24 nonsmokers whose tumors were associated with exposure to smoky coal. Among any tumors studied previously, these showed the highest percentage of mutations that (a) were G -+ T transver...
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
DEFF Research Database (Denmark)
Wu, Kui; Zhang, Xin; Li, Fuqiang
2015-01-01
significantly mutated genes are identified, including the most commonly mutated gene TP53 and novel mutation targets such as RHPN2, GLI3 and MRC2. TP53 mutations are furthermore significantly enriched in tumours from patients harbouring metastases. Genes regulating cytoskeleton remodelling processes are also...
Davelaar, Akueni L.; Calpe, Silvia; Lau, Liana; Timmer, Margriet R.; Visser, Mike; ten Kate, Fiebo J.; Parikh, Kaushal B.; Meijer, Sybren L.; Bergman, Jacques J.; Fockens, Paul; Krishnadath, Kausilia K.
2015-01-01
Barrett's esophagus (BE) goes through a sequence of low grade dysplasia (LGD) and high grade dysplasia (HGD) to esophageal adenocarcinoma (EAC). The current gold standard for BE outcome prediction, histopathological staging, can be unreliable. TP53 abnormalities may serve as prognostic biomarkers.
Davelaar, Akueni L.; Calpe, Silvia; Lau, Liana; Timmer, Margriet R.; Visser, Mike; ten Kate, Fiebo J.; Parikh, Kaushal B.; Meijer, Sybren L.; Bergman, Jacques J.; Fockens, Paul; Krishnadath, Kausilia K.
2015-01-01
Barrett's esophagus (BE) goes through a sequence of low grade dysplasia (LGD) and high grade dysplasia (HGD) to esophageal adenocarcinoma (EAC). The current gold standard for BE outcome prediction, histopathological staging, can be unreliable. TP53 abnormalities may serve as prognostic biomarkers.
Liu, Dongjing; Schwender, Holger; Wang, Mengying; Wang, Hong; Wang, Ping; Zhu, Hongping; Zhou, Zhibo; Li, Jing; Wu, Tao; Beaty, Terri H
2018-03-01
Small ubiquitin-like modification, also known as sumoylation, is a crucial post-translational regulatory mechanisms involved in development of the lip and palate. Recent studies reported two sumoylation target genes, MSX1 and TP63, to have achieved genome-wide level significance in tests of association with nonsyndromic clefts. Here, we performed a candidate gene analysis considering gene-gene and gene-environment interaction for SUMO1, MSX1, and TP63 to further explore the etiology of nonsyndromic cleft lip with or without cleft palate (NSCL/P). A total of 130 single-nucleotide polymorphisms (SNPs) in or near SUMO1, MSX1, and TP63 was analyzed among 1,038 Asian NSCL/P trios ascertained through an international consortium. Conditional logistic regression models were used to explore gene-gene (G × G) and gene-environment (G × E) interaction involving maternal environmental tobacco smoke and multivitamin supplementation. Bonferroni correction was used for G × E analysis and permutation tests were used for G × G analysis. While transmission disequilibrium tests and gene-environment interaction analysis showed no significant results, we did find signals of gene-gene interaction between SNPs near MSX1 and TP63. Three pairwise interactions yielded significant p values in permutation tests (rs884690 and rs9290890 with p = 9.34 × 10 -5 and empirical p = 1.00 × 10 -4 , rs1022136 and rs4687098 with p = 2.41 × 10 -4 and empirical p = 2.95 × 10 -4 , rs6819546 and rs9681004 with p = 5.15 × 10 -4 and empirical p = 3.02 × 10 -4 ). Gene-gene interaction between MSX1 and TP63 may influence the risk of NSCL/P in Asian populations. Our study provided additional understanding of the genetic etiology of NSCL/P and underlined the importance of considering gene-gene interaction in the etiology of this common craniofacial malformation. © 2018 Wiley Periodicals, Inc.
NSAIDs modulate CDKN2A, TP53, and DNA content risk for progression to esophageal adenocarcinoma.
Directory of Open Access Journals (Sweden)
Patricia C Galipeau
2007-02-01
Full Text Available Somatic genetic CDKN2A, TP53, and DNA content abnormalities are common in many human cancers and their precursors, including esophageal adenocarcinoma (EA and Barrett's esophagus (BE, conditions for which aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs have been proposed as possible chemopreventive agents; however, little is known about the ability of a biomarker panel to predict progression to cancer nor how NSAID use may modulate progression. We aimed to evaluate somatic genetic abnormalities with NSAIDs as predictors of EA in a prospective cohort study of patients with BE.Esophageal biopsies from 243 patients with BE were evaluated at baseline for TP53 and CDKN2A (p16 alterations, tetraploidy, and aneuploidy using sequencing; loss of heterozygosity (LOH; methylation-specific PCR; and flow cytometry. At 10 y, all abnormalities, except CDKN2A mutation and methylation, contributed to EA risk significantly by univariate analysis, ranging from 17p LOH (relative risk [RR] = 10.6; 95% confidence interval [CI] 5.2-21.3, p < 0.001 to 9p LOH (RR = 2.6; 95% CI 1.1-6.0, p = 0.03. A panel of abnormalities including 17p LOH, DNA content tetraploidy and aneuploidy, and 9p LOH was the best predictor of EA (RR = 38.7; 95% CI 10.8-138.5, p < 0.001. Patients with no baseline abnormality had a 12% 10-y cumulative EA incidence, whereas patients with 17p LOH, DNA content abnormalities, and 9p LOH had at least a 79.1% 10-y EA incidence. In patients with zero, one, two, or three baseline panel abnormalities, there was a significant trend toward EA risk reduction among NSAID users compared to nonusers (p = 0.01. The strongest protective effect was seen in participants with multiple genetic abnormalities, with NSAID nonusers having an observed 10-y EA risk of 79%, compared to 30% for NSAID users (p < 0.001.A combination of 17p LOH, 9p LOH, and DNA content abnormalities provided better EA risk prediction than any single TP53, CDKN2A, or DNA content
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
Hede, Sanna-Maria; Hansson, Inga; Afink, Gijs B.; Eriksson, Anna; Nazarenko, Inga; Andrae, Johanna; Genove, Guillem; Westermark, Bengt; Nistér, Monica
2009-01-01
Glioblastomas are the most common and malignant astrocytic brain tumors in human adults. The tumor suppressor gene TP53 is commonly mutated and/or lost in astrocytic brain tumors and the TP53 alterations are often found in combination with excessive growth factor signaling via PDGF/PDGFRalpha. Here,
Rivu, Sanzana Fareen; Apu, Mohd Nazmul Hasan; Shabnaz, Samia; Nahid, Noor Ahmed; Islam, Md Reazul; Al-Mamun, Mir Md Abdullah; Nahar, Zabun; Rabbi, Sikder Nahidul Islam; Ahmed, Maizbha Uddin; Islam, Mohammad Safiqul; Hasnat, Abul
2017-08-01
Till now no pharmacogenetic study of TP53 codon 72 (Arg72Pro) and CDH1 rs16260 (-160Ccolorectal cancer. So the aim of the study is to determine whether there is an elevated risk of colorectal cancer development with TP53 codon 72 and CDH1 rs16260 genetic polymorphism in Bangladeshi population for the first time. To investigate the association of these two SNPs, we conducted a case-control study with 288 colorectal cancer patients and 295 healthy volunteers by using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) method. We found an increased risk of association between Arg/Pro heterozygosity (adjusted OR=2.58, 95% CI=1.77-3.77, pcolorectal cancer predisposition. In case of CDH1 rs16260 polymorphism, C/A heterozygous and A/A mutant homozygous are significantly (pcolorectal cancer risk with adjusted OR of 1.94 and 2.63, respectively. The combined genotype of C/A and A/A was also found to be strongly associated with colorectal cancer risk compared to C/C genotype (adjusted OR=2.02, 95% CI=1.42-2.87, pcolorectal cancer development in Bangladeshi population. Copyright © 2017 Elsevier Ltd. All rights reserved.
Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1
DEFF Research Database (Denmark)
Brøndsted, Lone; Hammer, Karin
1999-01-01
Previously we showed that only one phage-expressed protein (Orf1), a 425-bp region upstream of the orf1 gene (presumably encoding a promoter), and the attP region are necessary and also sufficient for integration of the bacteriophage TP901-1 genome into the chromosome of Lactococcus lactis subsp......P region seem to be necessary for site-specific integration of the temperate bacteriophage TP901-1. By use of the integrative elements (attP and orf1) expressed by the temperate lactococcal bacteriophage TP901-1, a system for obtaining stable chromosomal single-copy transcriptional fusions in L. lactis...
Directory of Open Access Journals (Sweden)
Walter Arancio
2015-01-01
Full Text Available It has been suggested that cancer stem cells (CSC may play a central role in oncogenesis, especially in undifferentiated tumours. Anaplastic thyroid carcinoma (ATC has characteristics suggestive of a tumour enriched in CSC. Previous studies suggested that the stem cell factor SOX2 has a preeminent hierarchical role in determining the characteristics of stem cells in SW1736 ATC cell line. In detail, silencing SOX2 in SW1736 is able to suppress the expression of the stem markers analysed, strongly sensitizing the line to treatment with chemotherapeutic agents. Therefore, in order to further investigate the role of SOX2 in ATC, a competing endogenous RNA (ceRNA analysis was conducted in order to isolate new functional partners of SOX2. Among the interactors, of particular interest are genes involved in the biogenesis of miRNAs (DICER1, RNASEN, and EIF2C2, in the control cell cycle (TP53, CCND1, and in mitochondrial activity (COX8A. The data suggest that stemness, microRNA biogenesis and functions, p53 regulatory network, cyclin D1, and cell cycle control, together with mitochondrial activity, might be coregulated.
Mastellaro, Maria J; Seidinger, Ana L; Kang, Guolian; Abrahão, Renata; Miranda, Eliana C M; Pounds, Stanley B; Cardinalli, Izilda A; Aguiar, Simone S; Figueiredo, Bonald C; Rodriguez-Galindo, Carlos; Brandalise, Silvia R; Yunes, José A; Barros-Filho, Antônio de A; Ribeiro, Raul C
2017-08-15
The tumor protein p53 (TP53) arginine-to-histidine mutation at codon 337 (R337H) predisposes children to adrenocortical tumors (ACTs) and, rarely, to other childhood tumors, but its impact on adult cancer remains undetermined. The objective of this study was to investigate the frequency and types of cancer in relatives of children with ACT who carry the TP53 R337H mutation. TP53 R337H testing was offered to relatives of probands with ACT. The parental lineage segregating the R337H mutation was identified in all families. The frequency and distribution of cancer types were compared according to R337H status. The authors' data also were compared with those publicly available for children with TP53 mutations other than R337H. The mean and median follow-up times for the probands with ACT were 11.2 years and 9.7 years (range, 3-32 years), respectively. During this time, cancer was diagnosed in 12 of 81 first-degree relatives (14.8%) carrying the R337H mutation but in only 1 of 94 noncarriers (1.1%; P = .0022). At age 45 years, the cumulative risk of cancer was 21% (95% confidence interval, 5%-33%) in carriers and 2% (95% confidence interval, 0%-4%) in noncarriers (P = .008). The frequency of cancer was higher in the R337H segregating lineages than in the nonsegregating lineages (249 of 1410 vs 66 of 984 individuals; P cancer were the most common types. TP53 R337H carriers have a lifelong predisposition to cancer with a bimodal age distribution: 1 peak, represented by ACT, occurs in the first decade of life, and another peak of diverse cancer types occurs in the fifth decade. The current findings have implications for genetic counseling and surveillance of R337H carriers. Cancer 2017;123:3150-58. © 2017 American Cancer Society. © 2017 American Cancer Society.
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Wu, Lin; Visco, Carlo
2012-01-01
TP53 mutation is an independent marker of poor prognosis in patients with diffuse large B-cell lymphoma (DLBCL) treated with cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (CHOP) therapy. However, its prognostic value in the rituximab immunochemotherapy era remains undefined. ...... for stratifying R-CHOP-treated patients into distinct prognostic subsets and has significant value in the design of future therapeutic strategies....
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Yang, Guan-Jun; Zhong, Hai-Jing; Ko, Chung-Nga; Wong, Suk-Yu; Vellaisamy, Kasipandi; Ye, Min; Ma, Dik-Lung; Leung, Chung-Hang
2018-03-06
The rhodium(iii) complex 1 was identified as a potent Wee1 inhibitor in vitro and in cellulo. It decreased Wee1 activity and unscheduled mitotic entry, and induced cell damage and death in TP53-mutated triple-negative breast cancer cells. 1 represents a promising scaffold for further development of more potent metal-based Wee1 antagonists.
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-08-01
Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0-8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at lower doses whereas wild type cells only at higher doses. Secretion of IL-8 by TP53-/- control cells was many times lower than that by TP53+/+ but increased significantly after irradiation. Transcription of the NFκBIA was induced in irradiated TP53+/+ mainly, but in bystanders a higher level was observed in TP53-/- cells, suggesting that TP53 is required for induction of NFκB pathway after irradiation but another mechanism of activation must operate in
Gonzalez, Francisco; Loidi, Lourdes; Abalo-Lojo, Jose M
2017-01-01
Ankyloblepharon-ectodermal dysplasia-cleft lip/palate (AEC) syndrome is a disorder resulting from anomalous embryonic development of ectodermal tissues. There is evidence that AEC syndrome is caused by mutations in the TP63 gene, which encodes the p63 protein. This is an important regulatory protein involved in epidermal proliferation and differentiation. Genome sequencing was performed in DNA from peripheral blood leukocytes of a newborn with AEC syndrome and her parents. Variants were searched in all coding exons and intron-exon boundaries of the TP63 gene. A heterozygous missense variant (NM_003722.4:c.1063G>C (p.Asp355His) was found in the newborn patient. No variants were found in either of the parents. We identified a previously unreported variant in TP63 gene which seems to be involved in the somatic malformations found in the AEC syndrome. The absence of this variant in both parents suggests that the variant appeared de novo.
Directory of Open Access Journals (Sweden)
Fatma Ashour
2018-06-01
Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors
International Nuclear Information System (INIS)
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-01-01
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
Energy Technology Data Exchange (ETDEWEB)
Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)
2015-08-15
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
Directory of Open Access Journals (Sweden)
Brett M. Lowenthal
2017-01-01
Full Text Available Medullary carcinoma has long been recognized as a subtype of colorectal cancer associated with microsatellite instability and Lynch syndrome. Gastric medullary carcinoma is a very rare neoplasm. We report a 67-year-old male who presented with a solitary gastric mass. Total gastrectomy revealed a well-demarcated, poorly differentiated carcinoma with an organoid growth pattern, pushing borders, and abundant peritumoral lymphocytic response. The prior cytology was cellular with immunohistochemical panel consistent with upper gastrointestinal/pancreaticobiliary origin. Overall, the histopathologic findings were consistent with gastric medullary carcinoma. A mismatch repair panel revealed a mismatch repair protein deficient tumor with loss of MLH1 and PMS2 expression. BRAF V600E immunostain (VE1 and BRAF molecular testing were negative, indicating a wild-type gene. Tumor sequencing of MLH1 demonstrated a wild-type gene, while our molecular panel identified TP53 c.817C>T (p.R273C mutation. These findings were compatible with a sporadic tumor. Given that morphologically identical medullary tumors often occur in Lynch syndrome, it is possible that mismatch repair loss is an early event in sporadic tumors with p53 mutation being a late event. Despite having wild-type BRAF, this tumor is sporadic and unrelated to Lynch syndrome. This case report demonstrates that coordinate ancillary studies are needed to resolve sporadic versus hereditary rare tumors.
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
Ikegaki, Naohiko; Hicks, Sakeenah L; Regan, Paul L; Jacobs, Joshua; Jumbo, Amina S; Leonhardt, Payton; Rappaport, Eric F; Tang, Xao X
2014-01-01
Neuroblastoma is a common pediatric solid tumor that exhibits a striking clinical bipolarity: favorable and unfavorable. The survival rate of children with unfavorable neuroblastoma remains low among all childhood cancers. MYCN and MYC play a crucial role in determining the malignancy of unfavorable neuroblastomas, whereas high-level expression of the favorable neuroblastoma genes is associated with a good disease outcome and confers growth suppression of neuroblastoma cells. A small fraction of neuroblastomas harbors TP53 mutations at diagnosis, but a higher proportion of the relapse cases acquire TP53 mutations. In this study, we investigated the effect of S(+)-ibuprofen on neuroblastoma cell lines, focusing on the expression of the MYCN, MYC, AKT, p53 proteins and the favorable neuroblastoma genes in vitro as biomarkers of malignancy. Treatment of neuroblastoma cell lines with S(+)-ibuprofen resulted in a significant growth suppression. This growth effect was accompanied by a marked decrease in the expression of MYC, MYCN, AKT and an increase in p53 expression in neuroblastoma cell lines without TP53 mutation. In addition, S(+)-ibuprofen enhanced the expression of some favorable neuroblastoma genes (EPHB6, CD44) and genes involved in growth suppression and differentiation (EGR1, EPHA2, NRG1 and SEL1L). Gene expression profile and Ingenuity pathway analyses using TP53-mutated SKNAS cells further revealed that S(+)-ibuprofen suppressed molecular pathways associated with cell growth and conversely enhanced those of cell cycle arrest and the unfolded protein response. Collectively, these results suggest that S(+)-ibuprofen or its related compounds may have the potential for therapeutic and/or palliative use for unfavorable neuroblastoma.
Caceres, Gisela; McGraw, Kathy; Yip, Bon Ham; Pellagatti, Andrea; Johnson, Joseph; Zhang, Ling; Liu, Kenian; Zhang, Lan Min; Fulp, William J.; Lee, Ji-Hyun; Al Ali, Najla H.; Basiorka, Ashley; Smith, Larry J.; Daugherty, F. Joseph; Littleton, Neil; Wells, Richard A.; Sokol, Lubomir; Wei, Sheng; Komrokji, Rami S.; Boultwood, Jacqueline; List, Alan F.
2013-01-01
Stabilization of p53 in erythroid precursors in response to nucleosomal stress underlies the hypoplastic anemia in myelodysplastic syndromes (MDS) with chromosome 5q deletion [del(5q)]. We investigated whether cenersen, a clinically active 20-mer antisense oligonucleotide complementary to TP53 exon10, could suppress p53 expression and restore erythropoiesis in del(5q) MDS. Cenersen treatment of ribosomal protein S-14-deficient erythroblasts significantly reduced cellular p53 and p53-up-regulated modulator of apoptosis expression compared with controls, accompanied by a significant reduction in apoptosis and increased cell proliferation. In a two-stage erythroid differentiation assay, cenersen significantly suppressed nuclear p53 in bone marrow CD34+ cells isolated from patients with del(5q) MDS, whereas erythroid burst recovery increased proportionally to the magnitude of p53 suppression without evidence of del(5q) clonal suppression (r = −0.6; P = 0.005). To explore the effect of p53 suppression on erythropoiesis in vivo, dexamethasone, a glucocorticoid receptor-dependent p53 antagonist, was added to lenalidomide treatment in eight lower-risk, transfusion-dependent, del(5q) MDS patients with acquired drug resistance. Transfusion independence was restored in five patients accompanied by expansion of erythroid precursors and decreased cellular p53 expression. We conclude that targeted suppression of p53 could support effective erythropoiesis in lenalidomide-resistant del(5q) MDS. PMID:24043769
Van den Bossche, Jolien; Deben, Christophe; Op de Beeck, Ken; Deschoolmeester, Vanessa; Hermans, Christophe; De Pauw, Ines; Jacobs, Julie; Van Schil, Paul; Vermorken, Jan Baptist; Pauwels, Patrick; Peeters, Marc; Lardon, Filip; Wouters, An
2017-01-01
Background: Currently, prognosis of non-small cell lung cancer (NSCLC) patients is based on clinicopathological factors, including TNM stage. However, there are considerable differences in patient outcome within a similar staging group, even when patients received identical treatments. In order to improve prognostic predictions and to guide treatment options, additional parameters influencing outcome are required. Polo-like kinase 1 (Plk1), a master regulator of mitotic cell division and the DNA damage response, is considered as a new potential biomarker in this research area. While several studies reported Plk1 overexpression in a broad range of human malignancies, inconsistent results were published regarding the clinical significance hereof. A prognostic panel, consisting of Plk1 and additional biomarkers that are related to the Plk1 pathway, might further improve prediction of patient prognosis. Methods: In this study, we evaluated for the first time the prognostic value of Plk1 mRNA and protein expression in combination with the TP53 mutation status (next generation sequencing), induction of apoptotic cell death (immunohistochemistry for cleaved caspase 3) and hypoxia (immunohistochemistry for carbonic anhydrase IX (CA IX)) in 98 NSCLC adenocarcinoma patients. Results: Both Plk1 mRNA and protein expression and CA IX protein levels were upregulated in the majority of tumor samples. Plk1 mRNA and protein expression levels were higher in TP53 mutant samples, suggesting that Plk1 overexpression is, at least partially, the result of loss of functional p53 (<0.05). Interestingly, the outcome of patients with both Plk1 mRNA and CA IX protein overexpression, who also harbored a TP53 mutation, was much worse than that of patients with aberrant expression of only one of the three markers (p=0.001). Conclusion: The combined evaluation of Plk1 mRNA expression, CA IX protein expression and TP53 mutations shows promise as a prognostic panel in NSCLC patients. Moreover
International Nuclear Information System (INIS)
Haffty, Bruce G.; Goyal, Sharad; Kulkarni, Diptee; Green, Camille; Vazquez, Alexi; Schiff, Devora; Moran, Meena S.; Yang Qifeng; Ganesan, Shridar; Hirsfield, Kim M.
2011-01-01
Purpose: TP53BP1 is a key component of radiation-induced deoxyribonucleic acid damage repair. The purpose of this study was to evaluate the significance of a known common single nucleotide polymorphism in this gene (rs560191) in patients treated with breast-conserving surgery and whole-breast irradiation (BCS + RT). Methods and Materials: The population consisted of 176 premenopausal women treated with BCS + RT (median follow-up, 12 years). Genomic deoxyribonucleic acid was processed by use of TaqMan assays. Each allele for rs560191 was either C or G, so each patient was therefore classified as CC, CG, or GG. Patients were grouped as GG if they were homozygous for the variant G allele or CC-CG if they carried at least one copy of the common C allele (CC or CG). Results: Of the 176 women, 124 (71%) were CC-CG and 52 (29%) were GG. The mean age was 44 years for GG vs. 38 years for CC-CG (p < 0.001). GG was more common in African-American women than white women (69% vs. 13%, p < 0.001) and more commonly estrogen receptor negative (70% vs. 49%, p = 0.02). There were no significant correlations of rs560191 with other critical variables. Despite the fact that GG patients were older, the 10-year rate of local relapses was higher (22% for GG vs. 12% for CC-CG, p = 0.04). Conclusions: This novel avenue of investigation of polymorphisms in radiation repair/response genes in patients treated with BCS + RT suggests a correlation to local relapse. Additional evaluation is needed to assess the biological and functional significance of these single nucleotide polymorphisms, and larger confirmatory validation studies will be required to determine the clinical implications.
Daher, Tamas; Tur, Mehmet Kemal; Brobeil, Alexander; Etschmann, Benjamin; Witte, Biruta; Engenhart-Cabillic, Rita; Krombach, Gabriele; Blau, Wolfgang; Grimminger, Friedrich; Seeger, Werner; Klussmann, Jens Peter; Bräuninger, Andreas; Gattenlöhner, Stefan
2018-06-01
In head and neck squamous cell carcinoma (HNSCC), the occurrence of concurrent lung malignancies poses a significant diagnostic challenge because metastatic HNSCC is difficult to discern from second primary lung squamous cell carcinoma (SCC). However, this differentiation is crucial because the recommended treatments for metastatic HNSCC and second primary lung SCC differ profoundly. We analyzed the origin of lung tumors in 32 patients with HNSCC using human papillomavirus (HPV) typing and targeted next generation sequencing of all coding exons of tumor protein 53 (TP53). Lung tumors were clearly identified as HNSCC metastases or second primary tumors in 29 patients, thus revealing that 16 patients had received incorrect diagnoses based on clinical and morphological data alone. The HPV typing and mutation analysis of all TP53 coding exons is a valuable diagnostic tool in patients with HNSCC and concurrent lung SCC, which can help to ensure that patients receive the most suitable treatment. © 2018 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
International Nuclear Information System (INIS)
Petkova, Rumena; Chelenkova, Pavlina; Yemendzhiev, Husein; Tsekov, Iliya; Kalvatchev, Zlatko; Chakarov, Stoyan
2013-01-01
HPV infection is a major pathogenetic factor in cervical carcinoma as well as in many of the squamous cancers of head and neck and other epithelial cancers. Persistence of HPV DNA detectable by routine methods is considered to be a risk factor for advanced CIN and, in patients treated by surgery or non-surgical treatment modalities (radiotherapy, chemotherapy), HPV persistence is believed to be associated with increased risk for local recurrence. In terms of survival, however, it has been repeatedly proven that patients with cervical cancer and other HPV-associated cancers with detectable HPV DNA tend to have better outcomes than patients with HPV-negative tumours. The P72R polymorphism in the human TP53 gene has been contemplated as an independent phenotype modifier in cancers, especially the R allele which has been shown to confer higher pro-apoptotic properties to the resultant p53 protein. It has been demonstrated, however, that RR homozygotes were much more common in study groups with HPV-associated tumours than the other two genotypes and that the P allele in P/R heterozygotes was preferentially lost while the R allele was preferentially retained and mutated. It is possible that HPV-dependent carcinogenesis strictly relies on the presence of HPV and the expression of the E6 and E7 onco proteins only in the initial phases of transformation of infected cells (e.g. CIN). It may be associated with activation of latent HPV that would create a background of decreased control over the integrity of the genome of the host cell. The process can develop further by mechanisms independent of the presence of HPV and if the virus clears at some later point, that would not halt the already ongoing neoplastic transformation. Absence of HPV DNA in cervical tumours, whether before or after treatment, is not a reason to decrease vigilant monitoring and rule out the need for further treatment, as it may be quite possible that the TP53 gene of the infected cells has already been
The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Andrew Fesler
2016-04-01
Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Martel-Planche Ghislaine
2011-10-01
Full Text Available Abstract Background Squamous Cell Carcinoma of Esophagus is one of the most common malignancies in both men and women in eastern and south-eastern Africa. In Kenya, clinical observations suggest that this cancer is frequent in the Rift Valley area. However, so far, there has been no report on the molecular characteristics of esophageal squamous cell carcinoma (ESCC in this area. Results We have analyzed TP53 mutations, the presence of human papilloma virus (HPV DNA and expression of inflammation markers Cyclooxygenase 2 (Cox-2 and Nitrotyrosine (NTyR in 28 cases (13 males and 15 females of archived ESCC tissues collected at the Moi Teaching and Referral Hospital in Eldoret, Kenya. Eleven mutations were detected in TP53 exons 5 to 8 (39%. All ESCC samples were negative for HPV 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82. Immunohistochemical analysis of Cox-2 and NTyR showed a low proportion of positive cases (17.4% and 39.1%, respectively. No association between the above markers and suspected risk factors (alcohol or tobacco use, hot tea drinking, use of charcoal for cooking was found. Conclusion Our findings suggest that mechanisms of esophageal carcinogenesis in eastern Africa might be different from other parts of the world. Low prevalence of TP53 mutation compared with other intermediate or high incidence areas of the world highlights this hypothesis. Our data did not support a possible ole of HPV in this series of cases. Further studies are needed to assess and compare the molecular patterns of ESCC from Kenya with those of high-incidence areas such as China or Central Asia.
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
Directory of Open Access Journals (Sweden)
Terry L. Levin, MD
2015-01-01
Full Text Available A 20-month-old female presented with respiratory distress and a right adrenal mass extending into the inferior vena cava and right atrium. The mass was initially thought to be neuroblastoma. Pathology later revealed adrenocortical carcinoma. Inferior vena cava extension is far more common in adrenocortical carcinoma than neuroblastoma, and its presence should prompt clinical and laboratory evaluation for an adrenocortical tumor. The genetic findings in TP53 associated with this disease are discussed.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.
Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M
2015-12-01
Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.
Nongenotoxic p53 activation protects cells against S-phase-specific chemotherapy
DEFF Research Database (Denmark)
Kranz, Dominique; Dobbelstein, Matthias
2006-01-01
Mutations in the tumor suppressor gene TP53 represent the most frequent genetic difference between tumor cells and normal cells. Here, we have attempted to turn this difference into an advantage for normal cells during therapy. Using the Mdm2 antagonist nutlin-3, we first activated p53 in U2OS an...... a killer to a protector of cells, with the potential to reduce unwanted side effects of chemotherapy....
Directory of Open Access Journals (Sweden)
Yamaguchi Toshikazu
2005-01-01
Full Text Available Abstract Background Although the gastric well-differentiated adenocarcinoma in the distal stomach has been thought to develop via a intestinal metaplasia-carcinoma sequence, there are some disproofs from new mucin examinations for minute-size lesions in same type carcinoma. The current study was performed and pointed out the new findings for the solution to the problem according to the point described above. Methods 12 super-minute lesions (less than 1 mm in maximum diameter of well-differentiated adenocarcinoma in distal stomach (SMCa, which were detected from the pathological examinations of 210 surgically resected stomach specimens, and the mucosa adjacent to these carcinoma lesions, were examined by immunohistochemical mucin stainings (MUC2 and CD-10: intestinal phenotype, 45M1 and MUC6: gastric phenotype and p53-overexpression. And the analyses of the replication error of the microsatellites in chromosome 17 related p53 gene (TP53 and D17S786 (RER-p53MS were performed in SMCa lesions, adjacent mucosa to each lesion and other gastric mucosa with intestinal metaplasia, because all SMCa lesions showed p53-overexpression immunohistochemically, decribed below. Results 1. The carcinoma cells in all SMCa lesions were positive for 45M1 and p53. On the other hand, no positive carcinoma cells for MUC6 were seen although the pyloric glands and the remnant pyloric gland in the SMCa lesions in the same slides were positive for MUC6. Ten lesions (83% had intestinal phenotypic mucin (10 lesions: MUC2 (+, 4 lesions: CD10 (+. Two lesions (17% were positive for only 45M1 (gastric phenotypic mucin. 2. All of the mucosa adjacent to SMCa showed intestinal metaplasia (complete type: 7 regions, incomplete type: 5 regions. 3. RER-p53MS was confirmed in 42% (5/12 regions of SMCa, in 42% (5/12 regions of the mucosa adjacent to SMCa and 14% (6/42 regions of the other intestinal metaplasia mucosa. Conclusion Most of the super-minute well-differentiated adenocarcinoma
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja
2016-01-01
The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089
Directory of Open Access Journals (Sweden)
Thais Fernanda de Almeida Galatro
Full Text Available Inhibitor of DNA Binding 4 (ID4 is a member of the helix-loop-helix ID family of transcription factors, mostly present in the central nervous system during embryonic development, that has been associated with TP53 mutation and activation of SOX2. Along with other transcription factors, ID4 has been implicated in the tumorigenic process of astrocytomas, contributing to cell dedifferentiation, proliferation and chemoresistance. In this study, we aimed to characterize the ID4 expression pattern in human diffusely infiltrative astrocytomas of World Health Organization (WHO grades II to IV of malignancy (AGII-AGIV; to correlate its expression level to that of SOX2, SOX4, OCT-4 and NANOG, along with TP53 mutational status; and to correlate the results with the clinical end-point of overall survival among glioblastoma patients. Quantitative real time PCR (qRT-PCR was performed in 130 samples of astrocytomas for relative expression, showing up-regulation of all transcription factors in tumor cases. Positive correlation was found when comparing ID4 relative expression of infiltrative astrocytomas with SOX2 (r = 0.50; p<0.005, SOX4 (r = 0.43; p<0.005 and OCT-4 (r = 0.39; p<0.05. The results from TP53 coding exon analysis allowed comparisons between wild-type and mutated status only in AGII cases, demonstrating significantly higher levels of ID4, SOX2 and SOX4 in mutated cases (p<0.05. This pattern was maintained in secondary GBM and further confirmed by immunohistochemistry, suggesting a role for ID4, SOX2 and SOX4 in early astrocytoma tumorigenesis. Combined hyperexpression of ID4, SOX4 and OCT-4 conferred a much lower (6 months median survival than did hypoexpression (18 months. Because both ID4 alone and a complex of SOX4 and OCT-4 activate SOX2 transcription, it is possible that multiple activation of SOX2 impair the prognosis of GBM patients. These observational results of associated expression of ID4 with SOX4 and OCT-4 may be used as a
Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri
2011-07-01
There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
International Nuclear Information System (INIS)
Hurtado, A M; Chen-Liang, T-H; Przychodzen, B; Hamedi, C; Muñoz-Ballester, J; Dienes, B; García-Malo, M D; Antón, A I; Arriba, F de; Teruel-Montoya, R; Ortuño, F J; Vicente, V; Maciejewski, J P; Jerez, A
2015-01-01
An increasing numbers of patients are being diagnosed with asymptomatic early-stage chronic lymphocytic leukemia (CLL), with no treatment indication at baseline. We applied a high-throughput deep-targeted analysis, especially designed for covering widely TP53 and ATM genes, in 180 patients with inactive disease at diagnosis, to test the independent prognostic value of CLL somatic recurrent mutations. We found that 40/180 patients harbored at least one acquired variant with ATM (n=17, 9.4%), NOTCH1 (n=14, 7.7%), TP53 (n=14, 7.7%) and SF3B1 (n=10, 5.5%) as most prevalent mutated genes. Harboring one ‘sub-Sanger' TP53 mutation granted an independent 3.5-fold increase of probability of needing treatment. Those patients with a double-hit ATM lesion (mutation+11q deletion) had the shorter median time to first treatment (17 months). We found that a genomic variable: TP53 mutations, most of them under the sensitivity of conventional techniques; a cell phenotypic factor: CD38-positive expression; and a classical marker as β2-microglobulin, remained as the unique independent predictors of outcome. The high-throughput determination of TP53 status, particularly in this set of patients frequently lacking high-risk chromosomal aberrations, emerges as a key step, not only for prediction modeling, but also for exploring mutation-specific therapeutic approaches and minimal residual disease monitoring
Directory of Open Access Journals (Sweden)
Al-achkar Walid
2012-08-01
Full Text Available Abstract Background The so-called Philadelphia (Ph chromosome is present in more than 90% of chronic myeloid leukemia (CML cases. It results in juxtaposition of the 5′ part of the BCR gene on chromosome 22 to the 3′ part of the ABL gene on chromosome 9. Since the majority of CML cases are currently treated with Imatinib, variant rearrangements in general have no specific prognostic significance, although the mechanisms involved in resistance to therapy have yet to be investigated. The T315I mutation within the abl-gene is the most frequent one associated with resistance to tyrosine kinase inhibitors. Results This study evaluated a Ph chromosome positive CML case resistant to imatinib mesylate. A dic(17;18, loss of TP53 gene, co-expression of b2a2 and b3a2 fusions transcript and a T315I mutation were found. Conclusions We reported here a novel case of a Ph chromosome positive CML with a secondary abnormality [dic(17;18], resulting to Glivec resistance but good response to nilotinib. The dic(17;18 might be a marker for poor prognosis in CML. Our finding indicated for an aggressive progression of the disease. The patient died under the treatment due to unknown reasons.
Directory of Open Access Journals (Sweden)
Jorge Azofeifa
2004-09-01
Full Text Available The STR (AAAATn within intron 1 of the TP53 locus was screened in 17 populations from 3 main ethnic groups: Europeans, Asiatics, and Africans, and from the hybrid population of Costa Rica (1968 samples. Three alleles, 126/7 (bp/copies of the repeat, 131/8 and 136/9 were the most prevalent in all populations. Other alleles rarely reached frequencies of 10% or higher. Observed heterozygosities ranged between 0.351 and 0.829. Patterns of diversity fit well with both the geographic origin of the samples and the history of the populations screened. A statistical test suggests that single-step mutational events have been the main mechanism producing new alleles at this locus. Fixation indexes (R ST for this marker showed an effect of population subdivision on divergence only within the Asiatic group; they were insensitive at the level of major ethnic groups as well as within Africans and within Europeans. Rev. Biol. Trop. 52(3: 645-657. Epub 2004 Dic 15.Se estudió el polimorfismo del microsatélite (AAAATn del intrón 1 del gene TP53 en 17 poblaciones de 3 grupos étnicos: europeos, asiáticos, y africanos subsaharianos, así como de la población híbrida de Costa Rica (en total 1968 muestras. Tres alelos, 126/7 (pares de bases/ copias de la repetición, 131/8 y 136/9 fueron los más frecuentes en todas las poblaciones, aunque se observaron otros alelos usualmente a frecuencias menores al 10%. Las heterocigosis observadas variaron de 0.351 a 0.829. La distribución de la diversidad parece concordar con el origen geográfico de las muestras y con la historia de las poblaciones estudiadas. Una prueba estadística indica que el evento mutacional que más alelos nuevos produce en este marcador es el de un solo paso (expansión o contracción de una sola copia de la repetición. El índice de fijación R ST mostró los efectos de la subdivision de poblaciones sólo dentro del grupo de los asiáticos y mostró falta de sensibilidad cuando los grupos
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Directory of Open Access Journals (Sweden)
Cameron M Scott
Full Text Available DNA methylation can mimic the effects of both germline and somatic mutations for cancer predisposition genes such as BRCA1 and p16INK4a. Constitutional DNA methylation of the BRCA1 promoter has been well described and is associated with an increased risk of early-onset breast cancers that have BRCA1-mutation associated histological features. The role of methylation in the context of other breast cancer predisposition genes has been less well studied and often with conflicting or ambiguous outcomes. We examined the role of methylation in known breast cancer susceptibility genes in breast cancer predisposition and tumor development. We applied the Infinium HumanMethylation450 Beadchip (HM450K array to blood and tumor-derived DNA from 43 women diagnosed with breast cancer before the age of 40 years and measured the methylation profiles across promoter regions of BRCA1, BRCA2, ATM, PALB2, CDH1, TP53, FANCM, CHEK2, MLH1, MSH2, MSH6 and PMS2. Prior genetic testing had demonstrated that these women did not carry a germline mutation in BRCA1, ATM, CHEK2, PALB2, TP53, BRCA2, CDH1 or FANCM. In addition to the BRCA1 promoter region, this work identified regions with variable methylation at multiple breast cancer susceptibility genes including PALB2 and MLH1. Methylation at the region of MLH1 in these breast cancers was not associated with microsatellite instability. This work informs future studies of the role of methylation in breast cancer susceptibility gene silencing.
Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly.
Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2017-10-01
Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS complex, in 37 individuals from 32 families with GAMOS. CRISPR-Cas9 knockout in zebrafish and mice recapitulated the human phenotype of primary microcephaly and resulted in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibited cell proliferation, which human mutations did not rescue. Furthermore, knockdown of these genes impaired protein translation, caused endoplasmic reticulum stress, activated DNA-damage-response signaling, and ultimately induced apoptosis. Knockdown of OSGEP or TP53RK induced defects in the actin cytoskeleton and decreased the migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identified four new monogenic causes of GAMOS, describe a link between KEOPS function and human disease, and delineate potential pathogenic mechanisms.
Dysfunctional p53 deletion mutants in cell lines derived from Hodgkin's lymphoma
DEFF Research Database (Denmark)
Feuerborn, Alexander; Moritz, Constanze; von Bonin, Frederike
2006-01-01
Classical Hodgkin's lymphoma (cHL) is a distinct malignancy of the immune system. Despite the progress made in the understanding of the pathology of cHL, the transforming events remain to be elucidated. It has been proposed that mutations in the TP53 gene in biopsy material as well as cell lines ...
Nagam, Srivani L S S; Katta, Saritha; Prasad, Vidudala V T S
2017-03-01
Reports on the association of TP53 polymorphisms with oral cancer are not only limited but also not specific to site and/or gender. Hence, we examined the effect of TP53 polymorphisms (EX4 215G>C, IVS3+40-41ins16 and IVS6+62G>A) on buccal mucosa cancer (BMC) and tongue cancer (TC) risk, survival of patients in relation to risk and clinical factors, gender wise (excepting for estimating hazards ratio [HR]), using Fisher's Exact Test, Kaplan-Meier analysis, and Cox-proportional hazards models. The exonic polymorphism increased BMC and TC risk in males by 2-4-fold. The IVS3+40-41ins16 was protective against BMC and TC in both genders, whereas IVS6+62G>A protected only males against TC. Genotype combinations and haplotypes which altered the risk of cancers in males and females were different. TC males, aged 40-44 years and females, aged 55-59 years survived better than BMC patients. The IVS3+40-41ins16 polymorphism differentially impacted survival of female patients exposed to tobacco. TC patients with EX4 215GC with lymphovascular spread (LVS) and metastasis exhibited higher HR while, patients with EX4 215CC and perineural invasion (PNI) showed lower HR. Impact of the intronic variants along with clinical parameters on survival and HR estimates varied between BMC and TC. Our bioinformatics analysis revealed the presence of CTCF binding site within TP53 gene. In conclusion, the polymorphisms altered risk and survival of BMC and TC in a gender specific manner, which varied with mode of tobacco and/or alcohol use. The current study, therefore underscores strong need for research, stratified by tumor site and gender. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Nyiraneza Christine
2012-06-01
Full Text Available Abstract Background It has been suggested that inactivation of p14ARF, a tumor suppressor central to regulating p53 protein stability through interaction with the MDM2 oncoprotein, abrogates p53 activity in human tumors retaining the wild-type TP53 gene. Differences in expression of tumor suppressor genes are frequently associated with cancer. We previously reported on a pattern of restricted p53 immunohistochemical overexpression significantly associated with microsatellite instability (MSI, low TP53 mutation frequency, and MDM2 overexpression in colorectal cancers (CRCs. In this study, we investigated whether p14ARF alterations could be a mechanism for disabling the p53 pathway in this subgroup of CRCs. Results Detailed maps of the alterations in the p14ARF gene were determined in a cohort of 98 CRCs to detect both nucleotide and copy-number changes. Methylation-specific PCR combined with bisulfite sequencing was used to evaluate the prevalence and distribution of p14ARF methylation. p14ARF alterations were then correlated with MSI status, TP53 mutations, and immunohistochemical expression of p53 and MDM2. The frequency of p14ARF mutations was extremely low (1/98; 1%, whereas coexistence of methylated and unmethylated alleles in both tumors and normal colon mucosa was common (91/98; 93%. Only seven of ninety-eight tumors (7% had a distinct pattern of methylation compared with normal colon mucosa. Evaluation of the prevalence and distribution of p14ARF promoter methylation in a region containing 27 CpG sites in 35 patients showed a range of methylated CpG sites in tumors (0 to 25 (95% CI 1 to 13 versus 0 to 17 (95% CI 0 to 2 in adjacent colon mucosa (P = 0.004. Hypermethylation of the p14ARF promoter was significantly correlated with the restricted p53 overexpression pattern (P = 0.03, and MDM2 overexpression (P = 0.02, independently of MSI phenotype. Although no significant correlation between p14ARF methylation and TP53 mutational
Wang, Zhaoming; Rajaraman, Preetha; Melin, Beatrice S.; Chung, Charles C.; Zhang, Weijia; McKean-Cowdin, Roberta; Michaud, Dominique; Yeager, Meredith; Ahlbom, Anders; Albanes, Demetrius; Andersson, Ulrika; Beane Freeman, Laura E.; Buring, Julie E.; Butler, Mary Ann; Carreón, Tania; Feychting, Maria; Gapstur, Susan M.; Gaziano, J. Michael; Giles, Graham G.; Hallmans, Goran; Henriksson, Roger; Hoffman-Bolton, Judith; Inskip, Peter D.; Kitahara, Cari M.; Le Marchand, Loic; Linet, Martha S.; Li, Shengchao; Peters, Ulrike; Purdue, Mark P.; Rothman, Nathaniel; Ruder, Avima M.; Sesso, Howard D.; Severi, Gianluca; Stampfer, Meir; Stevens, Victoria L.; Visvanathan, Kala; Wang, Sophia S.; White, Emily; Zeleniuch-Jacquotte, Anne; Hoover, Robert; Fraumeni, Joseph F.; Chatterjee, Nilanjan; Hartge, Patricia; Chanock, Stephen J.
2016-01-01
We confirmed strong association of rs78378222:A>C (per allele odds ratio [OR] = 3.14; P = 6.48 × 10−11), a germline rare single-nucleotide polymorphism (SNP) in TP53, via imputation of a genome-wide association study of glioma (1,856 cases and 4,955 controls). We subsequently performed integrative analyses on the Cancer Genome Atlas (TCGA) data for GBM (glioblastoma multiforme) and LUAD (lung adenocarcinoma). Based on SNP data, we imputed genotypes for rs78378222 and selected individuals carrying rare risk allele (C). Using RNA sequencing data, we observed aberrant transcripts with ~3 kb longer than normal for those individuals. Using exome sequencing data, we further showed that loss of haplotype carrying common protective allele (A) occurred somatically in GBM but not in LUAD. Our bioinformatic analysis suggests rare risk allele (C) disrupts mRNA termination, and an allelic loss of a genomic region harboring common protective allele (A) occurs during tumor initiation or progression for glioma. PMID:25907361
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
DEFF Research Database (Denmark)
Offersen, Birgitte Vrou; Alsner, Jan; Olsen, Karen Ege
2008-01-01
: Tumour sections were stained for HER2, CD34, and MIB-1. HER2 scores were based on staining intensity, 3+ being considered HER2+. Angiogenesis was scored by the Chalkley method. MIB-1 was evaluated using systematic random sampling. PAI-1 was measured by ELISA. TP53 mutations were evaluated by DGGE...
Stodden, G R; Lindberg, M E; King, M L; Paquet, M; MacLean, J A; Mann, J L; DeMayo, F J; Lydon, J P; Hayashi, K
2015-05-07
Type II endometrial carcinomas (ECs) are estrogen independent, poorly differentiated tumors that behave in an aggressive manner. As TP53 mutation and CDH1 inactivation occur in 80% of human endometrial type II carcinomas, we hypothesized that mouse uteri lacking both Trp53 and Cdh1 would exhibit a phenotype indicative of neoplastic transformation. Mice with conditional ablation of Cdh1 and Trp53 (Cdh1(d/d)Trp53(d/d)) clearly demonstrate architectural features characteristic of type II ECs, including focal areas of papillary differentiation, protruding cytoplasm into the lumen (hobnailing) and severe nuclear atypia at 6 months of age. Further, Cdh1(d/d)Trp53(d/d) tumors in 12-month-old mice were highly aggressive, and metastasized to nearby and distant organs within the peritoneal cavity, such as abdominal lymph nodes, mesentery and peri-intestinal adipose tissues, demonstrating that tumorigenesis in this model proceeds through the universally recognized morphological intermediates associated with type II endometrial neoplasia. We also observed abundant cell proliferation and complex angiogenesis in the uteri of Cdh1(d/d)Trp53(d/d) mice. Our microarray analysis found that most of the genes differentially regulated in the uteri of Cdh1(d/d)Trp53(d/d) mice were involved in inflammatory responses. CD163 and Arg1, markers for tumor-associated macrophages, were also detected and increased in the uteri of Cdh1(d/d)Trp53(d/d) mice, suggesting that an inflammatory tumor microenvironment with immune cell recruitment is augmenting tumor development in Cdh1(d/d)Trp53(d/d) uteri. Further, inflammatory mediators secreted from CDH1-negative, TP53 mutant endometrial cancer cells induced normal macrophages to express inflammatory-related genes through activation of nuclear factor-κB signaling. These results indicate that absence of CDH1 and TP53 in endometrial cells initiates chronic inflammation, promotes tumor microenvironment development following the recruitment of macrophages
Perez, Rodney H; Ishibashi, Naoki; Inoue, Tomoko; Himeno, Kohei; Masuda, Yoshimitsu; Sawa, Narukiko; Zendo, Takeshi; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji
2016-01-15
A putative biosynthetic gene cluster of the enterocin NKR-5-3B (Ent53B), a novel circular bacteriocin, was analyzed by sequencing the flanking regions around enkB, the Ent53B structural gene, using a fosmid library. A region approximately 9 kb in length was obtained, and the enkB1, enkB2, enkB3, and enkB4 genes, encoding putative biosynthetic proteins involved in the production, maturation, and secretion of Ent53B, were identified. We also determined the identity of proteins mediating self-immunity against the effects of Ent53B. Heterologous expression systems in various heterologous hosts, such as Enterococcus faecalis and Lactococcus lactis strains, were successfully established. The production and secretion of the mature Ent53B required the cooperative functions of five genes. Ent53B was produced only by those heterologous hosts that expressed protein products of the enkB, enkB1, enkB2, enkB3, and enkB4 genes. Moreover, self-immunity against the antimicrobial action of Ent53B was conferred by at least two independent mechanisms. Heterologous hosts harboring the intact enkB4 gene and/or a combination of intact enkB1 and enkB3 genes were immune to the inhibitory action of Ent53B. In addition to their potential application as food preservatives, circular bacteriocins are now considered possible alternatives to therapeutic antibiotics due to the exceptional stability conferred by their circular structure. The successful practical application of circular bacteriocins will become possible only if the molecular details of their biosynthesis are fully understood. The results of the present study offer a new perspective on the possible mechanism of circular bacteriocin biosynthesis. In addition, since some enterococcal strains are associated with pathogenicity, virulence, and drug resistance, the establishment of the first multigenus host heterologous production of Ent53B has very high practical significance, as it widens the scope of possible Ent53B applications
Eisenkraft, Arik; Pode-Shakked, Ben; Goldstein, Nurit; Shpirer, Zvi; van Bokhoven, Hans; Anikster, Yair
2015-01-01
Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish descent, in which the index patient presented with a persistent scalp skin lesion, dystrophic nails and light thin hair. Further evaluation revealed over 10 affected individuals in the kindred, over four generations, exhibiting varying degrees of ectodermal involvement. Analysis of the TP63 gene from four of the patients and from two healthy individuals of the same family was performed. Gene sequencing of the patients revealed a nonsense mutation leading to a premature termination codon (PTC) (p.Gln16X). The same mutation was found in all tested affected individuals in the family, but gave rise to marked phenotypic variability with minor clinical manifestations in some individuals, underscoring the clinical heterogeneity associated with the recently described PTC-causing mutations.
Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R
2013-02-01
Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.
Malapelle, Umberto; Pisapia, Pasquale; Sgariglia, Roberta; Vigliar, Elena; Biglietto, Maria; Carlomagno, Chiara; Giuffrè, Giuseppe; Bellevicine, Claudio; Troncone, Giancarlo
2016-09-01
The incidence of RAS/RAF/PI3KA and TP53 gene mutations in colorectal cancer (CRC) is well established. Less information, however, is available on other components of the CRC genomic landscape, which are potential CRC prognostic/predictive markers. Following a previous validation study, ion-semiconductor next-generation sequencing (NGS) was employed to process 653 routine CRC samples by a multiplex PCR targeting 91 hotspot regions in 22 CRC significant genes. A total of 796 somatic mutations in 499 (76.4%) tumours were detected. Besides RAS/RAF/PI3KA and TP53, other 12 genes showed at least one mutation including FBXW7 (6%), PTEN (2.8%), SMAD4 (2.1%), EGFR (1.2%), CTNNB1 (1.1%), AKT1 (0.9%), STK11 (0.8%), ERBB2 (0.6%), ERBB4 (0.6%), ALK (0.2%), MAP2K1 (0.2%) and NOTCH1 (0.2%). In a routine diagnostic setting, NGS had the potential to generate robust and comprehensive genetic information also including less frequently mutated genes potentially relevant for prognostic assessments or for actionable treatments. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
Czech Academy of Sciences Publication Activity Database
Suchánková, Jana; Legartová, Soňa; Růčková, E.; Vojtešek, B.; Kozubek, Stanislav; Bártová, Eva
2017-01-01
Roč. 148, č. 3 (2017), s. 239-255 ISSN 0948-6143 R&D Projects: GA ČR GBP302/12/G157; GA MŠk 7F14369 Institutional support: RVO:68081707 Keywords : p53 tumor-suppressor * double-strand breaks * nuclear topography Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 2.553, year: 2016
Eisenkraft, A.; Pode-Shakked, B.; Goldstein, N.; Shpirer, Z.; Bokhoven, H. van; Anikster, Y.
2015-01-01
Mutations in the TP63 gene have been associated with a variety of ectodermal dysplasia syndromes, among which the clinically overlapping Ankyloblepharon-Ectodermal defects-Cleft lip/palate (AEC) and the Rapp-Hodgkin syndromes. We report a multiplex nonconsanguineous family of Ashkenazi-Jewish
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
DEFF Research Database (Denmark)
Mansouri, Larry; Grabowski, Pawel; Degerman, Sofie
2013-01-01
Most previous studies on telomere length (TL) in chronic lymphocytic leukemia (CLL) are based on referral cohorts including a high proportion of aggressive cases. Here, the impact of TL was analyzed in a population-based cohort of newly diagnosed CLL (n = 265) and in relation to other prognostic ...... markers. Short telomeres were particularly associated with high-risk genetic markers, such as NOTCH1, SF3B1, or TP53 aberrations, and predicted a short time to treatment (TTT) and overall survival (OS) (both P...
Prolonged Tp-e Interval, Tp-e/QT Ratio and Tp-e/QTc Ratio in Patients with Type 2 Diabetes Mellitus
Directory of Open Access Journals (Sweden)
Alptug Tokatli
2016-03-01
Full Text Available BackgroundType 2 diabetes mellitus (T2DM is associated with increased risk of malignant ventricular arrhythmias. Cardiac electrical inhomogeneity may be the leading cause of the increased arrhythmic risk in patients with T2DM. The peak and the end of the T wave (Tp-e interval and associated Tp-e/QT ratio are promising measures of ventricular repolarization indicating transmural dispersion of repolarization. The aim of this study was to assess ventricular repolarization in patients with T2DM by using Tp-e interval, Tp-e/QT ratio and Tp-e/corrected QT interval (QTc ratio.MethodsForty-three patients with T2DM and 43 healthy control subjects, matched by gender and age, were studied. All participants underwent electrocardiography (ECG recording. PR, RR and QT intervals represents the ECG intervals. These are not abbreviations. In all literature these ECG intervals are written like in this text. Tp-e intervals were measured from 12-lead ECG. Rate QTc was calculated by using the Bazett's formula. Tp-e/QT ratio and Tp-e/QTc ratio were also calculated.ResultsMean Tp-e interval was significantly prolonged in patients with T2DM compared to controls (79.4±10.3, 66.4±8.1 ms, respectively; P<0.001. We also found significantly higher values of Tp-e/QT ratio and Tp-e/QTc ratio in patients with diabetes than controls (0.21±0.03, 0.17±0.02 and 0.19±0.02, 0.16±0.02, respectively; P<0.001. There was no difference in terms of the other ECG parameters between the groups.ConclusionTp-e interval, Tp-e/QT ratio and Tp-e/QTc ratio were prolonged in patients with T2DM. We concluded that T2DM leads to augmentation of transmural dispersion of repolarization suggesting increased risk for ventricular arrhythmogenesis.
MDM2 and CDK4 amplifications are rare events in salivary duct carcinomas.
Grünewald, Inga; Trautmann, Marcel; Busch, Alina; Bauer, Larissa; Huss, Sebastian; Schweinshaupt, Petra; Vollbrecht, Claudia; Odenthal, Margarete; Quaas, Alexander; Büttner, Reinhard; Meyer, Moritz F; Beutner, Dirk; Hüttenbrink, Karl-Bernd; Wardelmann, Eva; Stenner, Markus; Hartmann, Wolfgang
2016-11-15
Salivary duct carcinoma (SDC) is an aggressive adenocarcinoma of the salivary glands associated with poor clinical outcome. SDCs are known to carry TP53 mutations in about 50%, however, only little is known about alternative pathogenic mechanisms within the p53 regulatory network. Particularly, data on alterations of the oncogenes MDM2 and CDK4 located in the chromosomal region 12q13-15 are limited in SDC, while genomic rearrangements of the adjacent HMGA2 gene locus are well documented in subsets of SDCs. We here analyzed the mutational status of the TP53 gene, genomic amplification of MDM2, CDK4 and HMGA2 rearrangement/amplification as well as protein expression of TP53 (p53), MDM2 and CDK4 in 51 de novo and ex pleomorphic adenoma SDCs.25 of 51 cases were found to carry TP53 mutations, associated with extreme positive immunohistochemical p53 staining levels in 13 cases. Three out of 51 tumors had an MDM2 amplification, one of them coinciding with a CDK4 amplification and two with a HMGA2 rearrangement/amplification. Two of the MDM2 amplifications occurred in the setting of a TP53 mutation. Two out of 51 cases showed a CDK4 amplification, one synchronously being MDM2 amplified and the other one displaying concurrent low copy number increases of both, MDM2 and HMGA2.In summary, we here show that subgroups of SDCs display genomic amplifications of MDM2 and/or CDK4, partly in association with TP53 mutations and rearrangement/amplification of HMGA2. Further research is necessary to clarify the role of chromosomal region 12q13-15 alterations in SDC tumorigenesis and their potential prognostic and therapeutic relevance.
Directory of Open Access Journals (Sweden)
Napapat Amornwichet
Full Text Available BACKGROUND AND PURPOSE: To understand the mechanisms involved in the strong killing effect of carbon-ion beam irradiation on cancer cells with TP53 tumor suppressor gene deficiencies. MATERIALS AND METHODS: DNA damage responses after carbon-ion beam or X-ray irradiation in isogenic HCT116 colorectal cancer cell lines with and without TP53 (p53+/+ and p53-/-, respectively were analyzed as follows: cell survival by clonogenic assay, cell death modes by morphologic observation of DAPI-stained nuclei, DNA double-strand breaks (DSBs by immunostaining of phosphorylated H2AX (γH2AX, and cell cycle by flow cytometry and immunostaining of Ser10-phosphorylated histone H3. RESULTS: The p53-/- cells were more resistant than the p53+/+ cells to X-ray irradiation, while the sensitivities of the p53+/+ and p53-/- cells to carbon-ion beam irradiation were comparable. X-ray and carbon-ion beam irradiations predominantly induced apoptosis of the p53+/+ cells but not the p53-/- cells. In the p53-/- cells, carbon-ion beam irradiation, but not X-ray irradiation, markedly induced mitotic catastrophe that was associated with premature mitotic entry with harboring long-retained DSBs at 24 h post-irradiation. CONCLUSIONS: Efficient induction of mitotic catastrophe in apoptosis-resistant p53-deficient cells implies a strong cancer cell-killing effect of carbon-ion beam irradiation that is independent of the p53 status, suggesting its biological advantage over X-ray treatment.
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
An activator of transcription regulates phage TP901-1 late gene expression
DEFF Research Database (Denmark)
Brøndsted, Lone; Pedersen, Margit; Hammer, Karin
2001-01-01
bp contains both the promoter and the region necessary for activation by ORF29. The transcriptional start site of the promoter was identified by primer extension to position 13073 on the TP901-1 genome, thus located 87 bp downstream of orf29 in a 580-bp intergenic region between orf29 and orf30....... Furthermore, the region located -85 to -61 bp upstream of the start site was shown to be necessary for promoter activity. During infection, the transcript arising from the late promoter is fully induced at 40 min postinfection, and our results suggest that a certain level of ORF29 must he reached in order...... to activate transcription of the promoter. Several lactococcal bacteriophages encode ORF29 homologous proteins, indicating that late transcription may be controlled by a similar mechanism in these phages. With the identification of this novel regulator, our results suggest that within the P335 group...
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Evaluation of Tp-E Interval and Tp-E/QT Ratio in Patients with Aortic Stenosis.
Yayla, Çağrı; Bilgin, Murat; Akboğa, Mehmet Kadri; Gayretli Yayla, Kadriye; Canpolat, Uğur; Dinç Asarcikli, Lale; Doğan, Mehmet; Turak, Osman; Çay, Serkan; Özeke, Özcan; Akyel, Ahmet; Yeter, Ekrem; Aydoğdu, Sinan
2016-05-01
The risk of syncope and sudden cardiac death due to ventricular arrhythmias increased in patients with aortic stenosis (AS). Recently, it was shown that Tp-e interval, Tp-e/QT, and Tp-e/QTc ratio can be novel indicators for prediction of ventricular arrhythmias and mortality. We aimed to investigate the association between AS and ventricular repolarization using Tp-e interval and Tp-e/QT ratio. Totally, 105 patients with AS and 60 control subjects were enrolled to this study. The severity of AS was defined by transthoracic echocardiographic examination. Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were measured from the 12-lead electrocardiogram. Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were significantly increased in parallel to the severity of AS (P ratio had significant positive correlation with mean aortic gradient (r = 0.192, P = 0.049). In multivariate logistic regression analysis, Tp-e/QTc ratio and left ventricular mass were found to be independent predictors of severe AS (P = 0.03 and P = 0.04, respectively). Our study showed that Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were increased in patients with severe AS. Tp-e/QTc ratio and left ventricular mass were found as independent predictors of severe AS. © 2015 Wiley Periodicals, Inc.
Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun
2018-05-12
Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Directory of Open Access Journals (Sweden)
Lina Wati Durani
2017-01-01
Full Text Available Piper betle (PB is a traditional medicine that is widely used to treat different diseases around Asian region. The leaf extracts contain various bioactive compounds, which were reported to have antidiabetic, antibacterial, anti-inflammatory, antioxidant, and anticancer effects. In this study, the effect of PB aqueous extracts on replicative senescent human diploid fibroblasts (HDFs was investigated by determining the expressions of senescence-associated genes using quantitative PCR. Our results showed that PB extracts at 0.4 mg/ml can improve cell proliferation of young (143%, presenescent (127.3%, and senescent (157.3% HDFs. Increased expressions of PRDX6, TP53, CDKN2A, PAK2, and MAPK14 were observed in senescent HDFs compared to young and/or presenescent HDFs. Treatment with PB extracts modulates the transcriptional profile changes in senescent HDFs. By contrast, expressions of SOD1 increased, whereas GPX1, PRDX6, TP53, CDKN2A, PAK2, and MAPK14 were decreased in PB-treated senescent HDFs compared to untreated senescent HDFs. In conclusion, this study indicates the modulation of PB extracts on senescence-associated genes expression of replicative senescent HDFs. Further studies warrant determining the mechanism of PB in modulating replicative senescence of HDFs through these signaling pathways.
Durani, Lina Wati; Khor, Shy Cian; Tan, Jen Kit; Chua, Kien Hui; Mohd Yusof, Yasmin Anum; Makpol, Suzana
2017-01-01
Piper betle (PB) is a traditional medicine that is widely used to treat different diseases around Asian region. The leaf extracts contain various bioactive compounds, which were reported to have antidiabetic, antibacterial, anti-inflammatory, antioxidant, and anticancer effects. In this study, the effect of PB aqueous extracts on replicative senescent human diploid fibroblasts (HDFs) was investigated by determining the expressions of senescence-associated genes using quantitative PCR. Our results showed that PB extracts at 0.4 mg/ml can improve cell proliferation of young (143%), presenescent (127.3%), and senescent (157.3%) HDFs. Increased expressions of PRDX6 , TP53 , CDKN2A , PAK2 , and MAPK14 were observed in senescent HDFs compared to young and/or presenescent HDFs. Treatment with PB extracts modulates the transcriptional profile changes in senescent HDFs. By contrast, expressions of SOD1 increased, whereas GPX1 , PRDX6 , TP53 , CDKN2A , PAK2 , and MAPK14 were decreased in PB-treated senescent HDFs compared to untreated senescent HDFs. In conclusion, this study indicates the modulation of PB extracts on senescence-associated genes expression of replicative senescent HDFs. Further studies warrant determining the mechanism of PB in modulating replicative senescence of HDFs through these signaling pathways.
Radiotherapy modulates expression of EGFR, ERCC1 and p53 in cervical cancer
Energy Technology Data Exchange (ETDEWEB)
Almeida, V.H. de; Melo, A.C. de; Nogueira-Rodrigues, A.; Pimenta-Inada, H.K.; Alves, F.G.; Moralez, G.; Thiago, L.S.; Ferreira, C.G.; Sternberg, C., E-mail: diretoriaexecutiva@sboc.org.br [Instituto Nacional de Câncer (INCA), Rio de Janeiro, RJ (Brazil); Meira, D.D. [Universidade Federal do Espírito Santo (UFES), Vitória, ES (Brazil); Pires, A.C. [Fonte Medicina Diagnóstica, Niterói, RJ (Brazil)
2018-02-01
Cervical cancer is a public health problem and the molecular mechanisms underlying radioresistance are still poorly understood. Here, we evaluated the modulation of key molecules involved in cell proliferation, cell cycle and DNA repair in cervical cancer cell lines (CASKI and C33A) and in malignant tissues biopsied from 10 patients before and after radiotherapy. The expression patterns of epidermal growth factor receptor (EGFR), excision repair cross-complementation group 1 (ERCC1) and p53 were evaluated in cancer cell lines by quantitative PCR and western blotting, and in human malignant tissues by immunohistochemistry. The mutation status of TP53 gene was evaluated by direct sequencing. Among cell lines, absent or weak modulations of EGFR, ERCC1 and p53 were observed after exposure to 1.8 Gy. Conversely, increased expressions of p53 (5/10 patients; P=0.0239), ERCC1 (5/10 patients; P=0.0294) and EGFR (4/10 patients; P=0.1773) were observed in malignant tissues after radiotherapy with the same radiation dose. TP53 mutations were found only in one patient. Here we show that a single dose of radiotherapy induced EGFR, ERCC1 and p53 expression in malignant tissues from cervical cancer patients but not in cancer cell lines, highlighting the gap between in vitro and in vivo experimental models. Studies on larger patient cohorts are needed to allow an interpretation that an up regulation of p53, EGFR and ERCC1 may be part of a radioresistance mechanism. (author)
International Nuclear Information System (INIS)
Metges, J.P.; Giroux, M.A.; Volant, A.; Morin, J.F.; Malhaire, J.P.; Gouerou, H.; Ferec, C.; Robaskiewicz, M.; Labat, J.P.
1997-01-01
The mutations of the TP 53 and MTS1 (p16) gene have been described in numerous neoplasms but their relation with a response to the treatment is still little described. The aim of this work was to evaluate the value of the p53 status(serology, immunohistochemistry and molecular biology) and of the MTS1 gene( protein p16) for the response to the pre surgery radio chemotherapy in a troop of patients suffering from esophagus epidermoid cancer. The p53 serology is positive in 40% of cases and is statistically associated to a bad response. The lost of alleles for MTS1 has been found in 20% of cases but non predictive to the response. A prospective study would be interesting. (N.C.)
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Braun, Daniela A.; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A.; Schanze, Denny; Ashraf, Shazia; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I. Chiara; Sanchez-Ferras, Oraly; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E.; Pabst, Werner L.; Warejko, Jillian; Daga, Ankana; LeBerre, Tamara Basta; Matejas, Verena; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T.; Gipson, Patrick E.; Hsu, Chyong-Hsin; Kari, Jameela A.; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okasha; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth; Rump, Patrick; Schnur, Rhonda E.; Shiihara, Takashi; Sinha, Manish; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A.; Tsai, Wen-Hui; Tsai, Jeng-Daw; Vester, Udo; Viskochil, David H.; Vatanavicharn, Nithiwat; Waxler, Jessica L.; Wolf, Matthias T.F.; Wong, Sik-Nin; Poduri, Annapurna; Truglio, Gessica; Mane, Shrikant; Lifton, Richard P.; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Calleweart, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2018-01-01
Galloway-Mowat syndrome (GAMOS) is a severe autosomal-recessive disease characterized by the combination of early-onset steroid-resistant nephrotic syndrome (SRNS) and microcephaly with brain anomalies. To date, mutations of WDR73 are the only known monogenic cause of GAMOS and in most affected individuals the molecular diagnosis remains elusive. We here identify recessive mutations of OSGEP, TP53RK, TPRKB, or LAGE3, encoding the 4 subunits of the KEOPS complex in 33 individuals of 30 families with GAMOS. CRISPR/Cas9 knockout in zebrafish and mice recapitulates the human phenotype of microcephaly and results in early lethality. Knockdown of OSGEP, TP53RK, or TPRKB inhibits cell proliferation, which human mutations fail to rescue, and knockdown of either gene activates DNA damage response signaling and induces apoptosis. OSGEP and TP53RK molecularly interact and co-localize with the actin-regulating ARP2/3 complex. Furthermore, knockdown of OSGEP and TP53RK induces defects of the actin cytoskeleton and reduces migration rate of human podocytes, an established intermediate phenotype of SRNS. We thus identify 4 novel monogenic causes of GAMOS, describe the first link between KEOPS function and human disease, and delineate potential pathogenic mechanisms. PMID:28805828
Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer
Directory of Open Access Journals (Sweden)
Wen-Cheng Chung
2017-11-01
Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.
Allelic imbalance and fine mapping of the 17p13.3 subregion in sporadic breast carcinomas
DEFF Research Database (Denmark)
Hoff, C; Mollenhauer, J; Waldau, B
2001-01-01
Chromosome arm 17p is frequently altered in a variety of human cancers, especially in breast cancer, and allelic imbalances (AIs) in the region 17p13.1 do not always coincide with mutations in the TP53 gene. A second interval that frequently shows AIs at 17p is the chromosomal band 17p13.3. This ......Chromosome arm 17p is frequently altered in a variety of human cancers, especially in breast cancer, and allelic imbalances (AIs) in the region 17p13.1 do not always coincide with mutations in the TP53 gene. A second interval that frequently shows AIs at 17p is the chromosomal band 17p13...
Shchetynsky, Klementy; Diaz-Gallo, Lina-Marcella; Folkersen, Lasse; Hensvold, Aase Haj; Catrina, Anca Irinel; Berg, Louise; Klareskog, Lars; Padyukov, Leonid
2017-02-02
Here we integrate verified signals from previous genetic association studies with gene expression and pathway analysis for discovery of new candidate genes and signaling networks, relevant for rheumatoid arthritis (RA). RNA-sequencing-(RNA-seq)-based expression analysis of 377 genes from previously verified RA-associated loci was performed in blood cells from 5 newly diagnosed, non-treated patients with RA, 7 patients with treated RA and 12 healthy controls. Differentially expressed genes sharing a similar expression pattern in treated and untreated RA sub-groups were selected for pathway analysis. A set of "connector" genes derived from pathway analysis was tested for differential expression in the initial discovery cohort and validated in blood cells from 73 patients with RA and in 35 healthy controls. There were 11 qualifying genes selected for pathway analysis and these were grouped into two evidence-based functional networks, containing 29 and 27 additional connector molecules. The expression of genes, corresponding to connector molecules was then tested in the initial RNA-seq data. Differences in the expression of ERBB2, TP53 and THOP1 were similar in both treated and non-treated patients with RA and an additional nine genes were differentially expressed in at least one group of patients compared to healthy controls. The ERBB2, TP53. THOP1 expression profile was successfully replicated in RNA-seq data from peripheral blood mononuclear cells from healthy controls and non-treated patients with RA, in an independent collection of samples. Integration of RNA-seq data with findings from association studies, and consequent pathway analysis implicate new candidate genes, ERBB2, TP53 and THOP1 in the pathogenesis of RA.
International Nuclear Information System (INIS)
Brautigam, Chad A.; Deka, Ranjit K.; Norgard, Michael V.
2013-01-01
The soluble portion of TP0435, a putative periplasmic lipoprotein from the syphilis spirochete T. pallidum, has been purified and crystallized in a rhombohedral space group. A complete native data set has been collected to 2.4 Å resolution. Syphilis, caused by the bacterial spirochete Treponema pallidum, remains a prominent sexually transmitted infection worldwide. Despite sequencing of the genome of this obligate human pathogen 15 years ago, the functions of a large number of the gene products of T. pallidum are still unknown, particularly with respect to those of the organism’s periplasmic lipoproteins. To better understand their functions, a structural biology approach has been pursued. To this end, the soluble portion of the T. pallidum TP0435 lipoprotein (also known as Tp17) was cloned, hyper-expressed in Escherichia coli and purified to apparent homogeneity. The protein crystals obtained from this preparation diffracted to 2.4 Å resolution and had the symmetry of space group R3. In the hexagonal setting, the unit-cell parameters were a = b = 85.7, c = 85.4 Å
Directory of Open Access Journals (Sweden)
Alfredo Maurício Batista De-Paula
2006-08-01
vias moleculares independentes.BACKGROUND: Oral carcinogenesis is a multistep process in which genetic events lead to the disruption of the normal regulatory pathways that control basic cellular functions. Epidermoid carcinoma of oral cavity (ECOC appears as a consequence of multiple molecular events induced by the effects of several carcinogens influenced by environmental factors against a background of genetic resistance or susceptibility. Consequent genetic damage affects many chromosomes and genes, and the accumulation of these changes seems to lead to ECOC. OBJECTIVES: The aim of the present study was to assess the clinical and morphological value of p53 and p16 immunolocalization at the invasive tumor front in a representative series of 35 routinely processed ECOC. MATERIAL AND METHODS: Samples of ECOC were investigated in this study. TNM system was employed for clinical staging and the invasive front grading system was employed for morphological grading of the lesions. Immunohistochemical technique in paraffin-embedded and formalin-fixed tissues was utilized to immunolocalization of p53 and p16 proteins. Counts were performed and submitted to specific statistical treatments. RESULTS: p53 and p16 immunolocalizations were detected in 63% and 66%, respectively, of 35 carcinomas studied. No correlation was found between p53 and p16 expressions and clinico-morphological parameters statistically analyzed. No correlation was found between the relationship p53/p16 expressions. CONCLUSION: p53 and p16 immunolocalization did not influence the clinico-morphological parameters analyzed in this study and apparently do not represent a molecular basis for the biologic significance of the invasive tumor front. Lack of a strong correlation between p53 and p16 immunolocalization suggests that both could participate in biological activities in the cell cycle control by independent molecular pathways.
Tp-e interval and Tp-e/QT ratio in patients with celiac disease.
Demirtaş, K; Yayla, Ç; Yüksel, M; Açar, B; Ünal, S; Ertem, A G; Kaplan, M; Akpinar, M Y; Kiliç, Z M Y; Kayaçetin, E
2017-11-01
Celiac disease is a chronic immune-mediated disease of the small intestine. It has been known that dilated cardiomyopathy and ischemic coronary artery disease have become more frequent in patients with celiac disease. The aim of the study was to assess Tp-e interval and Tp-e/QT ratio in patients with celiac disease. This study was conducted at a single center in collaboration with gastroenterology and cardiology clinics. Between January 2014 and June 2015, a total of 76 consecutive patients were enrolled (38 patients with celiac disease and 38 control subjects). Tp-e interval, Tp-e/QT and Tp-e/QTc ratio were measured from the 12-lead electrocardiogram. Tp-e interval (64.2±11.0 vs. 44.5±6.0; pceliac disease than control subjects. There was a significant positive correlation between Tp-e/QTc ratio and disease duration in patients with celiac disease (r=0.480, p=0.003) and also there was a significant positive correlation between Tp-e/QTc ratio and erythrocyte sedimentation rate (r=0.434, pceliac disease. Whether these changes increase the risk of ventricular arrhythmia deserve further studies. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
Pan, Chieh-Yu; Tsai, Tsung-Yu; Su, Bor-Chyuan; Hui, Cho-Fat; Chen, Jyh-Yih
2017-01-01
that V. vulnificus disrupted the outer membranes of cells, resulting in the loss of cell shape and integrity. We examined whether TP3 and TP4 increased the membrane permeability of V. vulnificus by measuring the fluorescence resulting from the uptake of 1-N-phenyl-naphthylamine (NPN). Treating fish with TP3 and TP4 under different pH and temperature conditions did not significantly increase MIC values, suggesting that temperature and the acid-base environment do not affect AMP function. In addition, the qPCR results showed that TP3 and TP4 influence the expression of immune-responsive genes, including interleukin (IL)-1β, IL-6, and IL-8. In this study, we demonstrate that TP3 and TP4 show potential for development as drugs to combat fish bacterial infections in aquaculture. PMID:28085905
[Evaluation of the Performance of Two Kinds of Anti-TP Enzyme-Linked Immunosorbent Assay].
Gao, Nan; Huang, Li-Qin; Wang, Rui; Jia, Jun-Jie; Wu, Shuo; Zhang, Jing; Ge, Hong-Wei
2018-06-01
To evaluate the accuracy and precision of 2 kinds of anti-treponema pallidum (anti-TP) ELISA reagents in our laboratory for detecting the anti-TP in voluntary blood donors, so as to provide the data support for use of ELISA reagents after introduction of chemiluminescene immunoassay (CLIA). The route detection of anti-TP was performed by using 2 kinds of ELISA reagents, then 546 responsive positive samples detected by anti-TP ELISA were collected, and the infections status of samples confirmed by treponema pallidum particle agglutination (TPPA) test was identified. The confirmed results of responsive samples detected by 2 kinds of anti-TP ELISA reagents were compared, the accuracy of 2 kinds of anti-TP ELISA reagents was analyzed by drawing ROC and comparing area under curve (AUC), and precision of 2 kinds of anti-TP ELISA reagents was compared by statistical analysis of quality control data from 7.1 2016 to 6.30 2017. There were no statistical difference in confirmed positive rate of responsive samples and weak positive samples between 2 kinds of anti-TP ELISA reagents. The responsive samples detected by 2 kinds of anti-TP ELISA reagents accounted for 85.53%(467/546) of all responsive samples, the positive rate confirmed by TPPA test was 82.87%. 44 responsive samples detected by anti-TP ELISA reagent A and 35 responsive samples detected by anti-TP ELISA reagent B were confirmed to be negative by TPPA test. Comparison of AUC showed that the accuracy of 2 kinds of anti-TP ELISA reagents was more high, the difference between 2 reagents was not statistically significant. The coefficient of variation (CV) of anti-TP ELISA reagent A and B was 14.98% and 18.04% respectively, which met the precision requirement of ELISA test. The accuracy and precision of 2 kinds of anti-TP ELISA reagents used in our laboratory are similar, and using any one of anti-TP ELISA reagents all can satisfy the requirements of blood screening.
Directory of Open Access Journals (Sweden)
Kurahashi Hiroki
2011-08-01
Full Text Available Abstract Background It has been well documented that pre-eclampsia and unexplained fetal growth restriction (FGR have a common etiological background, but little is known about their linkage at the molecular level. The aim of this study was to further investigate the mechanisms underlying pre-eclampsia and unexplained FGR. Methods We analyzed differentially expressed genes in placental tissue from severe pre-eclamptic pregnancies (n = 8 and normotensive pregnancies with or (n = 8 without FGR (n = 8 using a microarray method. Results A subset of the FGR samples showed a high correlation coefficient overall in the microarray data from the pre-eclampsia samples. Many genes that are known to be up-regulated in pre-eclampsia are also up-regulated in FGR, including the anti-angiogenic factors, FLT1 and ENG, believed to be associated with the onset of maternal symptoms of pre-eclampsia. A total of 62 genes were found to be differentially expressed in both disorders. However, gene set enrichment analysis for these differentially expressed genes further revealed higher expression of TP53-downstream genes in pre-eclampsia compared with FGR. TP53-downstream apoptosis-related genes, such as BCL6 and BAX, were found to be significantly more up-regulated in pre-eclampsia than in FGR, although the caspases are expressed at equivalent levels. Conclusions Our current data indicate a common pathophysiology for FGR and pre-eclampsia, leading to an up-regulation of placental anti-angiogenic factors. However, our findings also suggest that it may possibly be the excretion of these factors into the maternal circulation through the TP53-mediated early-stage apoptosis of trophoblasts that leads to the maternal symptoms of pre-eclampsia.
Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei
2017-06-01
Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.
Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.
Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C
2017-12-01
Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene
Directory of Open Access Journals (Sweden)
Nahed A Hussien
2014-01-01
Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.
Directory of Open Access Journals (Sweden)
Petrović Sandra
2015-01-01
Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046
Towards linked open gene mutations data
2012-01-01
Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives
Towards linked open gene mutations data.
Zappa, Achille; Splendiani, Andrea; Romano, Paolo
2012-03-28
With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on
Gene expression in SK-Mel-28 human melanoma cells treated with the snake venom jararhagin.
Klein, Anelise; Capitanio, Juliana Silva; Maria, Durvanei Augusto; Ruiz, Itamar Romano Garcia
2011-01-01
Alternative approaches to improve the treatment of advanced melanomas are highly needed. The disintegrin domain of metalloproteinases binds integrin receptors on tumor cells, blocking migration, invasion, and metastatization. Previous studies showed that jararhagin, from the Bothrops jararaca snake venom, induces changes in the morphology and viability of SK-Mel-28 human melanoma cells, and decreases the number of metastases in mice injected with pre-treated cells. The purpose of this study was to evaluate the molecular effects of jararhagin on SK-Mel-28 cells and fibroblasts, concerning the expression of integrins, cadherins, caspases, and TP53 genes. Sub-toxic doses of jararhagin were administered to confluent cells. RT-PCR was performed following extraction of total RNA. Jararhagin treatments induced similar morphological alterations in both normal and tumor cells, with higher IC50 values for fibroblasts. Integrin genes were downregulated in untreated cells, except for ITGA6a,b, ITGAv, and ITGB3 which were highly expressed in SK-Mel-28. The integrin expression profiles were not affected by the toxin. However, jararhagin 30ng/μl upregulated genes TP53, CDKN1A, CDKN2A, CASP3, CASP5, CASP6, CASP8, and E-CDH in SK-Mel-28, and genes ITGB6, ITGB7, CASP3, TP53, and CDKN1B in fibroblasts. Appropriate jararhagin concentration can have apoptotic and suppressant effects on SK-Mel-28 cells, rather than on fibroblasts, and can be used to develop potential anti-cancer drugs. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly
Braun, Daniela A; Rao, Jia; Mollet, Geraldine; Schapiro, David; Daugeron, Marie-Claire; Tan, Weizhen; Gribouval, Olivier; Boyer, Olivia; Revy, Patrick; Jobst-Schwan, Tilman; Schmidt, Johanna Magdalena; Lawson, Jennifer A; Schanze, Denny; Ashraf, Shazia; Ullmann, Jeremy F P; Hoogstraten, Charlotte A; Boddaert, Nathalie; Collinet, Bruno; Martin, Gaëlle; Liger, Dominique; Lovric, Svjetlana; Furlano, Monica; Guerrera, I Chiara; Sanchez-Ferras, Oraly; Hu, Jennifer F; Boschat, Anne-Claire; Sanquer, Sylvia; Menten, Björn; Vergult, Sarah; De Rocker, Nina; Airik, Merlin; Hermle, Tobias; Shril, Shirlee; Widmeier, Eugen; Gee, Heon Yung; Choi, Won-Il; Sadowski, Carolin E; Pabst, Werner L; Warejko, Jillian K; Daga, Ankana; Basta, Tamara; Matejas, Verena; Scharmann, Karin; Kienast, Sandra D; Behnam, Babak; Beeson, Brendan; Begtrup, Amber; Bruce, Malcolm; Ch'ng, Gaik-Siew; Lin, Shuan-Pei; Chang, Jui-Hsing; Chen, Chao-Huei; Cho, Megan T; Gaffney, Patrick M; Gipson, Patrick E; Hsu, Chyong-Hsin; Kari, Jameela A; Ke, Yu-Yuan; Kiraly-Borri, Cathy; Lai, Wai-Ming; Lemyre, Emmanuelle; Littlejohn, Rebecca Okashah; Masri, Amira; Moghtaderi, Mastaneh; Nakamura, Kazuyuki; Ozaltin, Fatih; Praet, Marleen; Prasad, Chitra; Prytula, Agnieszka; Roeder, Elizabeth R; Rump, Patrick; Schnur, Rhonda E; Shiihara, Takashi; Sinha, Manish D; Soliman, Neveen A; Soulami, Kenza; Sweetser, David A; Tsai, Wen-Hui; Tsai, Jeng-Daw; Topaloglu, Rezan; Vester, Udo; Viskochil, David H; Vatanavicharn, Nithiwat; Waxler, Jessica L; Wierenga, Klaas J; Wolf, Matthias T F; Wong, Sik-Nin; Leidel, Sebastian A; Truglio, Gessica; Dedon, Peter C; Poduri, Annapurna; Mane, Shrikant; Lifton, Richard P; Bouchard, Maxime; Kannu, Peter; Chitayat, David; Magen, Daniella; Callewaert, Bert; van Tilbeurgh, Herman; Zenker, Martin; Antignac, Corinne; Hildebrandt, Friedhelm
2017-01-01
Galloway-Mowat syndrome (GAMOS) is an autosomal-recessive disease characterized by the combination of early-onset nephrotic syndrome (SRNS) and microcephaly with brain anomalies. Here we identified recessive mutations in OSGEP, TP53RK, TPRKB, and LAGE3, genes encoding the four subunits of the KEOPS
Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice
International Nuclear Information System (INIS)
Zhang, Y.; Woloschak, G.E.
1997-01-01
This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
Directory of Open Access Journals (Sweden)
Maher Kurdi
2014-01-01
Full Text Available Background. The synchronous development of two primary brain tumors of distinct cell of origin in close proximity or in contact with each other is extremely rare. We present the first case of collision tumor with two histological distinct tumors. Case Presentation. A 54-year-old woman presented with progressive atypical left facial pain and numbness for 8 months. MRI of the brain showed left middle cranial fossa heterogeneous mass extending into the infratemporal fossa. At surgery, a distinct but intermingled intra- and extradural tumor was demonstrated which was completely removed through left orbitozygomatic-temporal craniotomy. Histopathological examination showed that the tumor had two distinct components: malignant nerve sheath tumor of the trigeminal nerve and temporal lobe anaplastic astrocytoma. Proliferative activity and expressed tumor protein 53 (TP53 gene mutations were demonstrated in both tumors. Conclusions. We describe the first case of malignant trigeminal nerve sheath tumor (MTNST and anaplastic astrocytoma in collision and discuss the possible hypothesis of this rare occurrence. We propose that MTNST, with TP53 mutation, have participated in the formation of anaplastic astrocytoma, or vice versa.
Tenekecioglu, Erhan; Karaagac, Kemal; Yontar, Osman Can; Agca, Fahriye Vatansever; Ozluk, Ozlem Arican; Tutuncu, Ahmet; Arslan, Burhan; Yilmaz, Mustafa
2015-06-01
Coronary slow flow (CSF) phenomenon is described by angiographically normal coronary arteries with delayed opacification of the distal vasculature. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-Te) may correspond to the transmural dispersion of the repolarization and that increased Tp-Te interval and Tp-Te/QT ratio are associated with malignant ventricular arrhythmias. The aim of this study was to evaluate the ventricular repolarization by using Tp-Te interval and Tp-Te/QT ratio in patients with CSF. This study included 50 CSF patients (40 male, mean age 48.6±12.5 years) and 40 control individuals (23 male, mean age 47.8±12.5 years). Tp-Te interval and Tp-Te/QT ratio were measured from the 12-lead electrocardiogram. These parameters were compared in groups. Baseline characteristics of the study groups were comparable. In electrocardiographic parameters analysis, QT and corrected QT were similar in CSF patients compared to the controls (357±35.2 vs 362±38.0 milliseconds and 419±25.8 vs 430±44.2 milliseconds, all p value >0.05). Tp-Te interval, Tp-Te/QT and Tp-Te/QTc ratio were significantly higher in CSF patients (85±13.7 vs 74±9.9 milliseconds and 0.24±0.03 vs 0.20±0.02 and 0.20±0.03 vs 0.17±0.02 all p value ratio are prolonged in patients with CSF.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Recent (t,p) and (3He,n) studies of elementary excitations in the lead region
International Nuclear Information System (INIS)
Flynn, E.R.
1978-01-01
A number of experiments involving two-nucleon transfer reactions were recently carried out in the region of 208 Pb to explore the limits of the pairing vibration model. ( 3 He,n) studies revealed that the proton pairing elementary excitations give a reasonably simple vibrational picture after corrections for important particle--hole terms. These data are also described accurately by microscopic calculations of the 0 + pairing phonon. (t,p) results on a 204 Hg target reveal a pairing vibrational state in 206 Hg near the predicted energy, after various interactions are taken into account. 14 figures
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Directory of Open Access Journals (Sweden)
Agnes C. Fett-Conte
2002-04-01
Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.
A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.
Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping
2018-05-23
PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Hermann, R.M.; Fest, J.; Christiansen, H.; Hille, A.; Rave-Fraenk, M.; Nitsche, M.; Gruendker, C.; Viereck, V.; Jarry, H.; Schmidberger, H.
2007-01-01
Background and Purpose: Simultaneous radiotherapy with chemotherapy is a standard treatment for inoperable non-small cell lung cancer (NSCLC), but the clinical outcome still remains poor. To further intensify treatment, substances need to be identified, which increase the effect of radiation on tumor cells without further enhancing toxicity to normal tissue. Hormones have a different toxicity profile than radiation or cytostatic drugs. As NSCLC often express estrogen receptors (ERs), the combination of genistein or estradiol and radiation in vitro was investigated. Material and Methods: A549 NSCLC cells with an inducible expression of a mutated TP53 and fibroblasts of a male donor (DF-18) were examined. ER expression was immunocytologically confirmed in all studied cell lines. Clonogenic survival was measured after incubation of the cells with genistein or estradiol (0.01 μM and 10 μM as maximum clinically applicable dose) and irradiation with different doses (0-4 Gy). The differentiation state of fibroblasts after combined therapy was analyzed. Results: A549 cells expressing mutated TP53 were more radioresistant than TP53 wild-type cells. Incubation of nonfunctional TP53 cells with genistein or estradiol increased radiosensitivity in both tested concentrations. By contrast, radiosensitivity of A549 with wild-type TP53 and DF-18 was not altered by hormonal incubation. In DF-18 radiation induced growth arrest that was not increased by additional hormonal incubation. Conclusion: NSCLC cells with nonfunctional TP53 might be sensitized against radiation by genistein or estradiol. As genistein is better tolerable than estradiol in patients, additional studies are warranted to assess potential gains of this combination therapy
Ishibashi, Naoki; Himeno, Kohei; Masuda, Yoshimitsu; Perez, Rodney Honrada; Iwatani, Shun; Wilaipun, Pongtep; Leelawatcharamas, Vichien; Nakayama, Jiro; Sonomoto, Kenji
2014-01-01
Enterococcus faecium NKR-5-3, isolated from Thai fermented fish, is characterized by the unique ability to produce five bacteriocins, namely, enterocins NKR-5-3A, -B, -C, -D, and -Z (Ent53A, Ent53B, Ent53C, Ent53D, and Ent53Z). Genetic analysis with a genome library revealed that the bacteriocin structural genes (enkA [ent53A], enkC [ent53C], enkD [ent53D], and enkZ [ent53Z]) that encode these peptides (except for Ent53B) are located in close proximity to each other. This NKR-5-3ACDZ (Ent53ACDZ) enterocin gene cluster (approximately 13 kb long) includes certain bacteriocin biosynthetic genes such as an ABC transporter gene (enkT), two immunity genes (enkIaz and enkIc), a response regulator (enkR), and a histidine protein kinase (enkK). Heterologous-expression studies of enkT and ΔenkT mutant strains showed that enkT is responsible for the secretion of Ent53A, Ent53C, Ent53D, and Ent53Z, suggesting that EnkT is a wide-range ABC transporter that contributes to the effective production of these bacteriocins. In addition, EnkIaz and EnkIc were found to confer self-immunity to the respective bacteriocins. Furthermore, bacteriocin induction assays performed with the ΔenkRK mutant strain showed that EnkR and EnkK are regulatory proteins responsible for bacteriocin production and that, together with Ent53D, they constitute a three-component regulatory system. Thus, the Ent53ACDZ gene cluster is essential for the biosynthesis and regulation of NKR-5-3 enterocins, and this is, to our knowledge, the first report that demonstrates the secretion of multiple bacteriocins by an ABC transporter. PMID:25149515
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
Evaluation of Tp-e interval and Tp-e/QT ratio in patients with ankylosing spondylitis.
Acar, Gurkan; Yorgun, Hikmet; Inci, Mehmet Fatih; Akkoyun, Murat; Bakan, Betul; Nacar, Alper Bugra; Dirnak, Imran; Cetin, Gozde Yildirim; Bozoglan, Orhan
2014-03-01
Ankylosing spondylitis (AS) is a chronic multi-systemic inflammatory rheumatic disorder. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-e) may correspond to the transmural dispersion of repolarization and that increased Tp-e interval and Tp-e/QT ratio are associated with malignant ventricular arrhythmias. The aim of this study was to evaluate ventricular repolarization by using Tp-e interval and Tp-e/QT ratio in patients with AS, and to assess the relation with inflammation. Sixty-two patients with AS and 50 controls were included. Tp-e interval and Tp-e/QT ratio were measured from a 12-lead electrocardiogram, and the Tp-e interval corrected for heart rate. The plasma level of high sensitive C-reactive protein (hsCRP) was measured. These parameters were compared between groups. In electrocardiographic parameters analysis, QT dispersion (QTd) and corrected QTd were significantly increased in AS patients compared to the controls (31.7 ± 9.6 vs 28.2 ± 7.4 and 35.8 ± 11.5 vs 30.6 ± 7.9 ms, P = 0.03 and P = 0.007, respectively). cTp-e interval and Tp-e/QT ratio were also significantly higher in AS patients (92.1 ± 10.2 vs 75.8 ± 8.4 and 0.22 ± 0.02 vs 0.19 ± 0.02 ms, all P values ratio were significantly correlated with hsCRP (r = 0.63, P ratio were increased in AS patients. These electrocardiographic ventricular repolarization indexes were significantly correlated with the plasma level of hsCRP.
Energy Technology Data Exchange (ETDEWEB)
Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying
2007-01-01
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
Influence of p53 (rs1625895 polymorphism in kidney transplant recipients
Directory of Open Access Journals (Sweden)
Negar Azarpira
2014-01-01
Full Text Available Reperfusion injury predisposes the kidney allograft to acute rejection. Apoptosis is a mechanism that results in graft injury, and TP53 is an important involved gene. To determine the association between single nucleotide polymorphism (SNP in the pro-apoptotic protein p53 (rs1625895 and acute rejection in renal transplants, we studied 100 recipients of kidney allografts and 100 healthy individuals served as controls. The polymorphism was determined by the polymerase chain reaction restriction-fragment length polymorphism (PCR-RFLP test. Overall, 31 recipients developed rejection. There was no difference in the genotype frequencies between the recipients and the controls. However, we found a difference of genotype and allele frequencies between recipients with and those without rejection. The WW genotype was more frequent in recipients with rejection. Although rejection is a complex immunologic event and functional importance of SNPs has not been confirmed yet, we suggest that wild type p53 may promote apoptosis during inflammation.
p53 protein expression in corneal squamous cell carcinomas of dogs
Directory of Open Access Journals (Sweden)
Lucas Bahdour Cossi
2015-06-01
Full Text Available Ocular tumors play an increasing concern in veterinary ophthalmology. Corneal squamous cell carcinoma is unfrequent in dogs, and by this way it has little studies. Studies that investigated the carcinogenesis mechanisms wich could help to the development of ocular squamous cell carcinoma (SCC in dog are rare. The aim of this work was to identify by immunohistochemical techniques, the p53 protein expression in the spontaneous dog corneal SCC. For this work, were used five cases of corneal SCC and one case of actinic keratitis. The sections were obtained from paraffin-wax blocks and submitted to histopathological and immunohistochemical analysis. All the six samples showed immunolabeling to cytokeratin and p53 protein. These results support the conclusions that the immunoreactivity of p53 protein by immunohistochemistry is present in canine corneal SCC suppporting its role in carcinogenesis of this tumor, but not provides prognostic indicators in cases of SCC corneal in dog; and can be a association of exposure to solar radiation with the possible mutation of the TP53 gene.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
Alterations in tumour suppressor gene p53 in human gliomas from ...
Indian Academy of Sciences (India)
Unknown
Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.
Suzuki, Shugo; Takeshita, Kentaro; Asamoto, Makoto; Takahashi, Satoru; Kandori, Hitoshi; Tsujimura, Kazunari; Saito, Fumiyo; Masuko, Kazuo; Shirai, Tomoyuki
2009-01-31
To identify genes important in hepatocellular carcinogenesis, especially processes involved in malignant transformation, we focused on differences in gene expression between adenomas and carcinomas by DNA microarray. Eighty-one genes for which expression was specific in carcinomas were analyzed using Ingenuity Pathway Analysis software and Gene Ontology, and found to be associated with TP53 and regulators of cell proliferation. In the genes associated with TP53, we selected high mobility group box (HMGB) for detailed analysis. Immunohistochemistry revealed expression of HMGBs in carcinomas to be significantly higher than in other lesions among both human and rat liver, and a positive correlation between HMGBs and TP53 was detected in rat carcinomas. Knock-down of HMGB 2 expression in a rat hepatocellular carcinoma cell line by RNAi resulted in inhibition of cell growth, although no effects on invasion were evident in vitro. These results suggest that acquisition of malignant potential in the liver requires specific signaling pathways related to high cell proliferation associated with TP53. In particular, HMGBs appear to have an important role for progression and cell proliferation associated with loss of TP53 function in rat and in human hepatocarcinogenesis.
International Nuclear Information System (INIS)
Suzuki, Shugo; Takeshita, Kentaro; Asamoto, Makoto; Takahashi, Satoru; Kandori, Hitoshi; Tsujimura, Kazunari; Saito, Fumiyo; Masuko, Kazuo; Shirai, Tomoyuki
2009-01-01
To identify genes important in hepatocellular carcinogenesis, especially processes involved in malignant transformation, we focused on differences in gene expression between adenomas and carcinomas by DNA microarray. Eighty-one genes for which expression was specific in carcinomas were analyzed using Ingenuity Pathway Analysis software and Gene Ontology, and found to be associated with TP53 and regulators of cell proliferation. In the genes associated with TP53, we selected high mobility group box (HMGB) for detailed analysis. Immunohistochemistry revealed expression of HMGBs in carcinomas to be significantly higher than in other lesions among both human and rat liver, and a positive correlation between HMGBs and TP53 was detected in rat carcinomas. Knock-down of HMGB 2 expression in a rat hepatocellular carcinoma cell line by RNAi resulted in inhibition of cell growth, although no effects on invasion were evident in vitro. These results suggest that acquisition of malignant potential in the liver requires specific signaling pathways related to high cell proliferation associated with TP53. In particular, HMGBs appear to have an important role for progression and cell proliferation associated with loss of TP53 function in rat and in human hepatocarcinogenesis
International Nuclear Information System (INIS)
Johansen, Annette H.; Broendsted, Lone; Hammer, Karin
2003-01-01
The repressor encoded by the cI gene of the temperate Lactococcus lactis subsp. cremoris bacteriophage TP901-1 has been purified. Gel-retardation and footprinting analyses identified three palindromic operator sites (O R , O L , and O D ). The operator site O R is located between the two divergent early promoters P R and P L , O L overlaps the transcriptional start of the lytic P L promoter, and O D is located downstream of the mor gene, the first gene in the lytic gene cluster. The function of O L was verified by mutational analysis. Binding was found to be specific and cooperative. Multimeric forms of the repressor were observed, thus indicating that the repressor may bind simultaneously to all three operator sites. Inverted repeats with homology to the operator sites of TP901-1 were identified in phage genomes encoding repressors homologous to CI of TP901-1. Interestingly, the locations of these repeats on the phage genomes correspond to those found in TP901-1, indicating that the same system of cooperative repression of early phage promoters has been inherited by modular evolution
Onaka, Hiroyasu; Taniguchi, Shin-ichi; Igarashi, Yasuhiro; Furumai, Tamotsu
2002-12-01
Staurosporine is a representative member of indolocarbazole antibiotics. The entire staurosporine biosynthetic and regulatory gene cluster spanning 20-kb was cloned from Streptomyces sp. TP-A0274 and sequenced. The gene cluster consists of 14 ORFs and the amino acid sequence homology search revealed that it contains three genes, staO, staD, and staP, coding for the enzymes involved in the indolocarbazole aglycone biosynthesis, two genes, staG and staN, for the bond formation between the aglycone and deoxysugar, eight genes, staA, staB, staE, staJ, staI, staK, staMA, and staMB, for the deoxysugar biosynthesis and one gene, staR is a transcriptional regulator. Heterologous gene expression of a 38-kb fragment containing a complete set of the biosynthetic genes for staurosporine cloned into pTOYAMAcos confirmed its role in staurosporine biosynthesis. Moreover, the distribution of the gene for chromopyrrolic acid synthase, the key enzyme for the biosynthesis of indolocarbazole aglycone, in actinomycetes was investigated, and rebD homologs were shown to exist only in the strains producing indolocarbazole antibiotics.
Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana; Blume, Carolin; Sellner, Leopold; Jauch, Anna; Sill, Martin; Kater, Arnon P.; te Raa, G. Doreen; Geisler, Christian; van Oers, Marinus; Dietrich, Sascha; Dreger, Peter; Ho, Anthony D.; Paruzynski, Anna; Schmidt, Manfred; von Kalle, Christof; Glimm, Hanno; Zenz, Thorsten
2013-01-01
Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were
DEFF Research Database (Denmark)
Jethwa, Alexander; Hüllein, Jennifer; Stolz, Tatjana
2013-01-01
Recurrent gene mutations contribute to the pathogenesis of chronic lymphocytic leukaemia (CLL). We developed a next-generation sequencing (NGS) platform to determine the genetic profile, intratumoural heterogeneity, and clonal structure of two independent CLL cohorts. TP53, SF3B1, and NOTCH1 were...
DEFF Research Database (Denmark)
Pedersen, Margit; Kilstrup, Mogens; Hammer, Karin
2006-01-01
Alt, encoded by the lactococcal phage TP901-1, is needed for late transcription. We identify Alt as a DNA-binding protein, and footprint analysis shows that Alt binds to a region containing four imperfect direct repeats (ALT boxes) located -76 to -32 relative to the P-late transcriptional start...... site. The importance of the ALT boxes was confirmed by deletion of one or two ALT boxes and by introducing mutations in ALT boxes 1 and 4. Alt is proposed to act as a tetramer or higher multimer activating transcription of TP901-1 late genes by binding to the four ALT boxes, and bending of the DNA may...... be important for transcriptional activation of P-late. Furthermore, our results suggest that DNA replication may be required for late transcription in TP901-1. Additionally, we identify gp28 of the related lactococcal phage Tuc2009 as an activator and show that the activators required for late transcription...
Koster, R.; Timmer-Bosscha, H.; Bischoff, R.; Gietema, J. A.; de Jong, S.
Wild-type p53 has a major role in the response and execution of apoptosis after chemotherapy in many cancers. Although high levels of wild-type p53 and hardly any TP53 mutations are found in testicular cancer (TC), chemotherapy resistance is still observed in a significant subgroup of TC patients.
Promoter Hypermethylation of the EMP3 Gene in a Series of 229 Human Gliomas
Directory of Open Access Journals (Sweden)
Marta Mellai
2013-01-01
Full Text Available The epithelial membrane protein 3 (EMP3 is a candidate tumor suppressor gene in the critical region 19q13.3 for several solid tumors, including tumors of the nervous systems. The aim of this study was to investigate the EMP3 promoter hypermethylation status in a series of 229 astrocytic and oligodendroglial tumors and in 16 GBM cell lines. The analysis was performed by methylation-specific PCR and capillary electrophoresis. Furthermore, the EMP3 expression at protein level was evaluated by immunohistochemistry and Western blotting analysis. Associations of EMP3 hypermethylation with total 1p/19q codeletion, MGMT promoter hypermethylation, IDH1/IDH2 and TP53 mutations, and EGFR amplification were studied, as well as its prognostic significance. The EMP3 promoter hypermethylation has been found in 39.5% of gliomas. It prevailed in low-grade tumors, especially in gliomas with an oligodendroglial component, and in sGBMs upon pGBMs. In oligodendroglial tumors, it was strongly associated with both IDH1/IDH2 mutations and total 1p/19q codeletion and inversely with EGFR gene amplification. No association was found with MGMT hypermethylation and TP53 mutations. In the whole series, the EMP3 hypermethylation status correlated with 19q13.3 loss and lack of EMP3 expression at protein level. A favorable prognostic significance on overall survival of the EMP3 promoter hypermethylation was found in patients with oligodendroglial tumors.
Bailon-Moscoso, Natalia; González-Arévalo, Gabriela; Velásquez-Rojas, Gabriela; Malagon, Omar; Vidari, Giovanni; Zentella-Dehesa, Alejandro; Ratovitski, Edward A; Ostrosky-Wegman, Patricia
2015-01-01
Accumulating evidence supports the idea that secondary metabolites obtained from medicinal plants (phytometabolites) may be important contributors in the development of new chemotherapeutic agents to reduce the occurrence or recurrence of cancer. Our study focused on Dehydroleucodine (DhL), a sesquiterpene found in the provinces of Loja and Zamora-Chinchipe. In this study, we showed that DhL displayed cytostatic and cytotoxic activities on the human cerebral astrocytoma D384 cell line. With lactone isolated from Gynoxys verrucosa Wedd, a medicinal plant from Ecuador, we found that DhL induced cell death in D384 cells by triggering cell cycle arrest and inducing apoptosis and DNA damage. We further found that the cell death resulted in the increased expression of CDKN1A and BAX proteins. A marked induction of the levels of total TP73 and phosphorylated TP53, TP73, and γ-H2AX proteins was observed in D384 cells exposed to DhL, but no increase in total TP53 levels was detected. Overall these studies demonstrated the marked effect of DhL on the diminished survival of human astrocytoma cells through the induced expression of TP73 and phosphorylation of TP73 and TP53, suggesting their key roles in the tumor cell response to DhL treatment.
Status and advances of p53-gene therapy and radiotherapy in malignant tumor
International Nuclear Information System (INIS)
Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong
2006-01-01
Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)
Tumor gene expression and prognosis in breast cancer patients with 10 or more positive lymph nodes.
Cobleigh, Melody A; Tabesh, Bita; Bitterman, Pincas; Baker, Joffre; Cronin, Maureen; Liu, Mei-Lan; Borchik, Russell; Mosquera, Juan-Miguel; Walker, Michael G; Shak, Steven
2005-12-15
This study, along with two others, was done to develop the 21-gene Recurrence Score assay (Oncotype DX) that was validated in a subsequent independent study and is used to aid decision making about chemotherapy in estrogen receptor (ER)-positive, node-negative breast cancer patients. Patients with >or=10 nodes diagnosed from 1979 to 1999 were identified. RNA was extracted from paraffin blocks, and expression of 203 candidate genes was quantified using reverse transcription-PCR (RT-PCR). Seventy-eight patients were studied. As of August 2002, 77% of patients had distant recurrence or breast cancer death. Univariate Cox analysis of clinical and immunohistochemistry variables indicated that HER2/immunohistochemistry, number of involved nodes, progesterone receptor (PR)/immunohistochemistry (% cells), and ER/immunohistochemistry (% cells) were significantly associated with distant recurrence-free survival (DRFS). Univariate Cox analysis identified 22 genes associated with DRFS. Higher expression correlated with shorter DRFS for the HER2 adaptor GRB7 and the macrophage marker CD68. Higher expression correlated with longer DRFS for tumor protein p53-binding protein 2 (TP53BP2) and the ER axis genes PR and Bcl2. Multivariate methods, including stepwise variable selection and bootstrap resampling of the Cox proportional hazards regression model, identified several genes, including TP53BP2 and Bcl2, as significant predictors of DRFS. Tumor gene expression profiles of archival tissues, some more than 20 years old, provide significant information about risk of distant recurrence even among patients with 10 or more nodes.
Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer
International Nuclear Information System (INIS)
Irshad, S.; Nawaz, T.
2008-01-01
Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)
DEFF Research Database (Denmark)
Pedersen, Margit; Østergaard, Solvej; Bresciani, José
2000-01-01
Two putative structural genes, orf tmp (tape measure protein) and orf bpp (baseplate protein), of the temperate lactococcal phage TP901-1 were examined by introduction of specific mutations in the prophage strain Lactococcus lactic ssp. cremoris 901-1. The adsorption efficiencies of the mutated...... or duplication of 29% in orf tmp was shown to shorten or lengthen the phage tail by approximately 30%, respectively. The orf tmp is proposed to function as a tape measure protein, TMP, important for assembly of the TP901-1 phage tail and involved in tail length determination. Specific mutations in orf bpp...... produced phages which were unable to adsorb to the indicator strain and electron microscopy revealed particles lacking the baseplate structure. The orf bpp is proposed to encode a highly immunogenic structural baseplate protein, BPP, important for assembly of the baseplate. Finally, an assembly pathway...
Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.
Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens
2005-04-01
The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D
2014-01-01
TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Polymorphism at codon 36 of the p53 gene.
Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A
1994-01-01
A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.
Energy Technology Data Exchange (ETDEWEB)
Abbas, Imane [Université de Lille, Lille (France); EA4492-UCEIV, Université du Littoral-Côte d’Opale, Dunkerque (France); Lebanese Atomic Energy Commission – CNRS, Beirut (Lebanon); Verdin, Anthony [Université de Lille, Lille (France); EA4492-UCEIV, Université du Littoral-Côte d’Opale, Dunkerque (France); Escande, Fabienne [Centre de Biologie Pathologie, Centre Hospitalier Régional et Universitaire, Lille (France); Saint-Georges, Françoise [Université de Lille, Lille (France); Groupement Hospitalier de l’Institut Catholique de Lille, Lille (France); Cazier, Fabrice [Université de Lille, Lille (France); Centre Commun de Mesures, Université du Littoral-Côte d’Opale, Dunkerque (France); Mulliez, Philippe [Université de Lille, Lille (France); Groupement Hospitalier de l’Institut Catholique de Lille, Lille (France); Courcot, Dominique; Shirali, Pirouz [Université de Lille, Lille (France); EA4492-UCEIV, Université du Littoral-Côte d’Opale, Dunkerque (France); Gosset, Pierre [Université de Lille, Lille (France); Groupement Hospitalier de l’Institut Catholique de Lille, Lille (France); and others
2016-05-15
Although its adverse health effects of air pollution particulate matter (PM2.5) are well-documented and often related to oxidative stress and pro-inflammatory response, recent evidence support the role of the remodeling of the airway epithelium involving the regulation of cell death processes. Hence, the overarching goals of the present study were to use an in vitro coculture model, based on human AM and L132 cells to study the possible alteration of TP53-RB gene signaling pathways (i.e. cell cycle phases, gene expression of TP53, BCL2, BAX, P21, CCND1, and RB, and protein concentrations of their active forms), and genetic instability (i.e. LOH and/or MSI) in the PM{sub 2.5-0.3}-exposed coculture model. PM{sub 2.5-0.3} exposure of human AM from the coculture model induced marked cell cycle alterations after 24 h, as shown by increased numbers of L132 cells in subG1 and S+G2 cell cycle phases, indicating apoptosis and proliferation. Accordingly, activation of the TP53-RB gene signaling pathways after the coculture model exposure to PM{sub 2.5-0.3} was reported in the L132 cells. Exposure of human AM from the coculture model to PM{sub 2.5-0.3} resulted in MS alterations in 3p chromosome multiple critical regions in L132 cell population. Hence, in vitro short-term exposure of the coculture model to PM{sub 2.5-0.3} induced cell cycle alterations relying on the sequential occurrence of molecular abnormalities from TP53-RB gene signaling pathway activation and genetic instability. - Highlights: • Better knowledge on health adverse effects of air pollution PM{sub 2.5}. • Human alveolar macrophage and normal human epithelial lung cell coculture. • Molecular abnormalities from TP53-RB gene signaling pathway. • Loss of heterozygosity and microsatellite instability. • Pathologic changes in morphology and number of cells in relation to airway remodeling.
Directory of Open Access Journals (Sweden)
Natalia Bailon-Moscoso
Full Text Available Accumulating evidence supports the idea that secondary metabolites obtained from medicinal plants (phytometabolites may be important contributors in the development of new chemotherapeutic agents to reduce the occurrence or recurrence of cancer. Our study focused on Dehydroleucodine (DhL, a sesquiterpene found in the provinces of Loja and Zamora-Chinchipe. In this study, we showed that DhL displayed cytostatic and cytotoxic activities on the human cerebral astrocytoma D384 cell line. With lactone isolated from Gynoxys verrucosa Wedd, a medicinal plant from Ecuador, we found that DhL induced cell death in D384 cells by triggering cell cycle arrest and inducing apoptosis and DNA damage. We further found that the cell death resulted in the increased expression of CDKN1A and BAX proteins. A marked induction of the levels of total TP73 and phosphorylated TP53, TP73, and γ-H2AX proteins was observed in D384 cells exposed to DhL, but no increase in total TP53 levels was detected. Overall these studies demonstrated the marked effect of DhL on the diminished survival of human astrocytoma cells through the induced expression of TP73 and phosphorylation of TP73 and TP53, suggesting their key roles in the tumor cell response to DhL treatment.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Evaluation of Tp-e interval and Tp-e/QT ratio in patients with non-dipper hypertension.
Demir, Mehmet; Uyan, Umut
2014-01-01
Non-dipper hypertension is associated with increased cardiovascular morbidity and mortality. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-e) may correspond to the transmural dispersion of repolarization and that increased Tp-e interval and Tp-e/QT ratio are associated with malignant ventricular arrhythmias. The aim of this study was to evaluate ventricular repolarization by using Tp-e interval and Tp-e/QT ratio in patients with non-dipper hypertension. This study included 80 hypertensive patients. Hypertensive patients were divided into two groups: 50 dipper patients (29 male, mean age 51.5 ± 8 years) and 30 non-dipper patients (17 male, mean age 50.6 ± 5.4 years). Tp-e interval and Tp-e/QT ratio were measured from the 12-lead electrocardiogram. These parameters were compared between groups. No statistically significant difference was found between two groups in terms of basic characteristics. In electrocardiographic parameters analysis, QT dispersion (QTd) and corrected QTd were significantly increased in non-dipper patients compared to the dippers (39.4 ± 11.5 versus 27.3 ± 7.5 ms and 37.5 ± 9.5 versus 29.2 ± 6.5 ms, p = 0.001 and p = 0.01, respectively). Tp-e interval and Tp-e/QT ratio were also significantly higher in non-dipper patients (97.5 ± 11.2 versus 84.2 ± 8.3 ms and 0.23 ± 0.02 versus 0.17 ± 0.02, all p value ratio are prolonged in patients with non-dipper hypertension.
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer
International Nuclear Information System (INIS)
Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van
2013-01-01
p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression
International Nuclear Information System (INIS)
Sun Xingmin; Goehler, Andre; Heller, Knut J.; Neve, Horst
2006-01-01
The ltp gene, located within the lysogeny module of temperate Streptococcus thermophilus phage TP-J34, has been shown to be expressed in lysogenic strain S. thermophilus J34. It codes for a lipoprotein, as demonstrated by inhibition of cleavage of the signal sequence by globomycin. Exposure of Ltp on the surface of Lactococcus lactis protoplasts bearing a plasmid-encoded copy of ltp has been demonstrated by immunogold labeling and electron microscopy. Expression of ltp in prophage- and plasmid-cured S. thermophilus J34-6f interfered with TP-J34 infection. While plating efficiency was reduced by a factor of about 40 and lysis of strain J34-6f in liquid medium was delayed considerably, phage adsorption was not affected at all. Intracellular accumulation of phage DNA was shown to be inhibited by Ltp. This indicates interference of Ltp with infection at the stage of triggering DNA release and injection into the cell, indicating a role of Ltp in superinfection exclusion. Expression of ltp in L. lactis Bu2-60 showed that the same superinfection exclusion mechanism was strongly effective against phage P008, a member of the lactococcal 936 phage species: no plaque-formation was detectable with even 10 9 phage per ml applied, and lysis in liquid medium did not occur. In Lactococcus also, Ltp apparently inhibited phage DNA release and/or injection. Ltp appears to be a member of a family of small, secreted proteins with a 42 amino acids repeat structure encoded by genes of Gram-positive bacteria. Some of these homologous genes are part of the genomes of prophages
Wang, Lin; Meng, Jie; Cao, Weipeng; Li, Qizhai; Qiu, Yuqing; Sun, Baoyun; Li, Lei M
2014-06-01
those of HEK293T and MCF-7 cells induced by the miR-23a∼27a∼24-2 cluster. Furthermore, one of the inferred regulatory mechanisms comprises the apoptosis network centered around TP53, whose effective regulation of apoptosis is somehow reestablished after [Gd@C82(OH)22]n treatment. These results elucidate the application and development of [Gd@C82(OH)22]n and other fullerene derivates. Copyright © 2014 Elsevier Inc. All rights reserved.
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
Directory of Open Access Journals (Sweden)
Lenka Mikalová
2017-03-01
Full Text Available Treponema pallidum subsp. endemicum (TEN is the causative agent of endemic syphilis (bejel. An unusual human TEN 11q/j isolate was obtained from a syphilis-like primary genital lesion from a patient that returned to France from Pakistan.The TEN 11q/j isolate was characterized using nested PCR followed by Sanger sequencing and/or direct Illumina sequencing. Altogether, 44 chromosomal regions were analyzed. Overall, the 11q/j isolate clustered with TEN strains Bosnia A and Iraq B as expected from previous TEN classification of the 11q/j isolate. However, the 11q/j sequence in a 505 bp-long region at the TP0488 locus was similar to Treponema pallidum subsp. pallidum (TPA strains, but not to TEN Bosnia A and Iraq B sequences, suggesting a recombination event at this locus. Similarly, the 11q/j sequence in a 613 bp-long region at the TP0548 locus was similar to Treponema pallidum subsp. pertenue (TPE strains, but not to TEN sequences.A detailed analysis of two recombinant loci found in the 11q/j clinical isolate revealed that the recombination event occurred just once, in the TP0488, with the donor sequence originating from a TPA strain. Since TEN Bosnia A and Iraq B were found to contain TPA-like sequences at the TP0548 locus, the recombination at TP0548 took place in a treponeme that was an ancestor to both TEN Bosnia A and Iraq B. The sequence of 11q/j isolate in TP0548 represents an ancestral TEN sequence that is similar to yaws-causing treponemes. In addition to the importance of the 11q/j isolate for reconstruction of the TEN phylogeny, this case emphasizes the possible role of TEN strains in development of syphilis-like lesions.
Profile of TP53 gene mutations in sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Bornholdt, Jette; Suitiala, Tuula
2010-01-01
databases for head and neck squamous cell carcinoma (24%). Characteristically, in our SNC series, the mutations were scattered over a large number of codons, codon 248 being the most frequent target of base substitution. Codon 135 was the second most frequently mutated codon; this nucleotide position has...
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
International Nuclear Information System (INIS)
Yue-Hua Wang; De-jie Chen; Tie-Nan Yi
2010-01-01
To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.
Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick
2003-08-01
Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its
DEFF Research Database (Denmark)
Burgdorf, Kristoffer Sølvsten; Grarup, Niels; Justesen, Johanne Marie
2011-01-01
2 diabetes in the Danish samples. However, for all nine variants the estimate of increase in type 2 diabetes risk was observed for the same allele as previously reported. In a meta-analysis of published and online data including 55,521 Europeans the G-allele of rs1042522 in TP53 showed significant...... replicated associations in meta-analyses. Furthermore, we evaluated the impact on diabetes-related intermediate traits in a population-based sample of middle-aged Danes. Methods: We genotyped nine lead variants in the seven genes in 4,973 glucose-tolerant and 3,612 type 2 diabetes Danish individuals. In meta...... association with type 2 diabetes (OR = 1.06 95% CI 1.02–1.11, p = 0.0032). No substantial associations with diabetes-related intermediary phenotypes were found. Conclusion: The G-allele of TP53 rs1042522 is associated with an increased prevalence of type 2 diabetes in a combined analysis of 55,521 Europeans....
Tse, Chun Hing; Hwang, Harry C; Goldstein, Lynn C; Kandalaft, Patricia L; Wiley, Jesse C; Kussick, Steven J; Gown, Allen M
2011-11-01
The ratio of human epidermal growth factor receptor 2 (HER2) to CEP17 by fluorescent in situ hybridization (FISH) with the centromeric probe CEP17 is used to determine HER2 gene status in breast cancer. Increases in CEP17 copy number have been interpreted as representing polysomy 17. However, pangenomic studies have demonstrated that polysomy 17 is rare. This study tests the hypothesis that the use of alternative chromosome 17 reference genes might more accurately assess true HER2 gene status. In all, 171 patients with breast cancer who had HER2 FISH that had increased mean CEP17 copy numbers (> 2.6) were selected for additional chromosome 17 studies that used probes for Smith-Magenis syndrome (SMS), retinoic acid receptor alpha (RARA), and tumor protein p53 (TP53) genes. A eusomic copy number exhibited in one or more of these loci was used to calculate a revised HER2-to-chromosome-17 ratio by using the eusomic gene locus as the reference. Of 132 cases classified as nonamplified on the basis of their HER2:CEP17 ratios, 58 (43.9%) were scored as amplified by using alternative chromosome 17 reference gene probes, and 13 (92.9%) of 14 cases scored as equivocal were reclassified as amplified. Among the cases with mean HER2 copy number of 4 to 6, 41 (47.7%) of 86 had their HER2 gene status upgraded from nonamplified to amplified, and four (4.7%) of 86 were upgraded from equivocal to amplified. Our results support the findings of recent pangenomic studies that true polysomy 17 is uncommon. Additional FISH studies that use probes to the SMS, RARA, and TP53 genes are an effective way to determine the true HER2 amplification status in patients with polysomy 17 and they have important potential implications for guiding HER2-targeted therapy in breast cancer.
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Directory of Open Access Journals (Sweden)
Hui-Ching Chuang
Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.
Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Jun, Gyungah; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Denning, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Vronskaya, Maria; Johnson, Andrew D; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Baldwin, Clinton; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letenneur, Luc; Hernández, Isabel; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleo, Alberto; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick C; Hardy, John; Naranjo, Maria Candida Deniz; Bosco, Paolo; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Scarpini, Elio; Bonuccelli, Ubaldo; Mancuso, Michelangelo; Siciliano, Gabriele; Moebus, Susanne; Mecocci, Patrizia; Zompo, Maria Del; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Frank-García, Ana; Panza, Francesco; Solfrizzi, Vincenzo; Caffarra, Paolo; Nacmias, Benedetta; Perry, William; Mayhaus, Manuel; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alvarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Gu, Wei; Razquin, Cristina; Pastor, Pau; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee F A G; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John S K; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Van Broeckhoven, Christine; Farrer, Lindsay A; van Duijn, Cornelia M; Ramirez, Alfredo; Seshadri, Sudha; Schellenberg, Gerard D; Amouyel, Philippe; Williams, Julie
2014-01-01
Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls. In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6) and 14 (IGHV1-67 p = 7.9×10-8) which indexed novel susceptibility loci. The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.
Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Valentina Escott-Price
Full Text Available Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls.In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6 and 14 (IGHV1-67 p = 7.9×10-8 which indexed novel susceptibility loci.The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
An N-terminal Region of Mot-2 Binds to p53 In Vitro
Directory of Open Access Journals (Sweden)
Sunil C. Kaul
2001-01-01
Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Catalytic oxidation of methanol on Pt/X (X = CaTP, NaTP electrodes in sulfuric acid solution
Directory of Open Access Journals (Sweden)
Said Benmokhtar
2013-10-01
Full Text Available In this paper, we report the synthesis and characterization of electrodes based on NASICON type phosphates. The study of the electrochemical oxidation of methanol at ambient temperature on electrodes based on NASICON type Ca0,5Ti2(PO43 (CaTP and Na5Ti(PO43 (NaTP compared to that of the platinum electrode model has been conducted by cyclic voltammetry in acidic medium. The results showed a significant increase of current density on the electro oxidation of methanol on the material developed based NASICON structure CaTP, cons deactivation of the electro oxidation is observed the closed structure type NaTP.
International Nuclear Information System (INIS)
Takahashi, Momoko; Yasui, Hironobu; Ogura, Aki; Asanuma, Taketoshi; Inanami, Osamu; Kubota, Nobuo; Tsujitani, Michihiko; Kuwabara, Mikinori
2008-01-01
Our previous study showed that X irradiation induced the expression of death receptor DR5 on the cell surface in tumor cell lines under not only normoxia but also hypoxia. X irradiation combined with TNF α-related apoptosis-inducing ligand (TRAIL), which is the ligand of DR5, induced apoptosis in vitro (Takahashi et al., (2007) Journal of Radiation Research, 48: 461-468). In this report, we examined the in vivo antitumor efficacy of X irradiation combined with TRAIL treatment in tumor xenograft models derived from human gastric adenocarcinoma MKN45 and MKN28 cells in severe combined immunodeficiency (SCID) mice. X irradiation combined with TRAIL synergistically suppressed the tumor growth rates in the xenograft models derived from MKN45 and MKN28 cells, which have wild type Tp53 and mutated Tp53, respectively, indicating that the antitumor effects occurred in a Tp53-independent manner. Histological analysis showed that the combination of X irradiation and TRAIL induced caspase-3-dependent apoptotic cell death. Moreover, the immunohistochemical detection of hypoxic regions using the hypoxic marker pimonidazole revealed that caspase-3-dependent apoptosis occurred in the hypoxic regions in the tumors. These results indicated that X irradiation combined with TRAIL may be a useful treatment to reduce tumor growth in not only normoxic but also hypoxic regions. (author)
Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong
2018-03-01
Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.
Total Pancreatectomy (TP) and Islet Autotransplantation (IAT) for Chronic Pancreatitis (CP)
Sutherland, David E.R.; Radosevich, David M.; Bellin, Melena D.; Hering, Bernard J.; Beilman, Gregory J.; Dunn, Ty B.; Chinnakotla, Srinath; Vickers, Selwyn M.; Bland, Barbara; Balamurugan, A.N.; Freeman, Martin L.; Pruett, Timothy L.
2013-01-01
Background Total-pancreatectomy (TP) with intraportal-islet-auto-transplantation (IAT) can relieve pain and preserve beta-cell-mass in patients with chronic-pancreatitis (CP) when other-therapies fail. Reported is a >30-year-single-center-series. Study Design 409 patients (53 children, 5–18 yrs) with CP underwent TP-IAT from Feb/1977–Sept/2011; (etiology idiopathic-41%; SOD/biliary-9%; genetic-14%; divisum-17%; alcohol-7%; other-12%); mean age-35.3 yrs,); 74% female; prior-surgeries 21%--Puestow procedure 9%, Whipple 6%, distal pancreatectomy 7%; other 2%). Islet-function was classified as insulin-independent for those on no insulin; partial if known C-peptide positive or euglycemic on once-daily-insulin; and insulin-dependent if on standard basal–bolus diabetic regimen. An SF-36-survey for Quality-of-Life (QOL)) was completed before and in serial follow-up by patients done since 2007 with an integrated-survey that added in 2008. Results Actuarial-patient-survival post-TP-IAT was 96% in adults and 98% in children (1-year) and; 89% and 98% (5-years). Complications requiring relaparotomy occurred in 15.9%, bleeding (9.5%) being most common. IAT-function is achieved in 90% (C-peptide >0.6 ng/ml). At 3 years, 30% were insulin-independent (25% in adults, 55% in children) and 33% had partial-function. Mean HbA1C was 5000/kg (24%)] correlated with degree of function with insulin-independent rates at 3 yrs of 12, 22 and 72%, partial function 33, 62 and 24%. All patients had pain before TP-IAT and nearly all were on daily-narcotics. After TP-IAT, 85% had pain-improvement. By two years 59% had ceased-narcotics. All children were on narcotics before, 39% at follow-up; pain improved in 94%; 67% became pain-free. In the SF-36 survey, there was significant improvement from baseline in all dimensions including the Physical and Mental Component Summaries (P2/3 of patients with insulin-independence occurring in one-quarter of adults and half the children. PMID:22397977
Directory of Open Access Journals (Sweden)
Gustavo Rassier Isolan
2005-12-01
Full Text Available As neoplasias astrocitárias correspondem a 60% dos tumores do sistema nervoso central, sendo o estudo da biologia molecular um importante passo para a compreensão da gênese e comportamento biológico destas doenças. As proteínas Ki-67, que é um marcador de proliferação celular, e p53, que é o produto do gene supressor de tumor de mesmo nome, são importantes marcadores tumorais. O objetivo deste estudo foi identificar e quantificar as proteínas Ki-67 e produto do gene supressor de tumor TP53 em diferentes graus de malignidade das neoplasias astrocitárias, bem como analisar suas relações com idade e sexo. Foram estudadas por imuno-histoquímica as proteínas Ki-67 e p53 em 47 pacientes com neoplasias astrocitárias ressecadas cirurgicamente, classificadas previamente e revisadas quanto ao grau de malignidade, de acordo com o proposto pela Organização Mundial da Saúde. Os núcleos celulares imunomarcados foram quantificados no programa Imagelab-softium pela razão paramétrica absoluta entre os núcleos de células positivas e o número total de células tumorais, sendo contadas 1000 células. O delineamento utilizado foi transversal não controlado. Para análise estatística as variáveis foram divididas em grupos, que para a Ki-67 foram ausente, 5% e para a p53 foram ausente (0, The astrocytic neoplasms respond by 60% of the central nervous system tumors, being the study of the molecular biology an important step for the understanding of the genesis and biological behavior of these diseases. The Ki-67 proteins, which are markers of the cellular proliferation, and p53, which is the product of the tumor suppressor gene TP53, are both important tumoral markers. This study intends to identify and quantify the Ki-67 and p53 proteins in astrocytic tumors of different grades of malignancy, as well as to analyze their relations with age and gender. Ki-67 and p53 proteins in 47 patients with surgically resected astrocytic neoplasms were
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R
2014-01-01
The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.
Inhibition of bladder cancer cell proliferation by allyl isothiocyanate (mustard essential oil)
Energy Technology Data Exchange (ETDEWEB)
Sávio, André Luiz Ventura, E-mail: savio.alv@gmail.com [UNESP – Universidade Estadual Paulista, Faculdade de Medicina de Botucatu, Departamento de Patologia, Botucatu, SP (Brazil); Nicioli da Silva, Glenda [UFOP – Universidade Federal de Ouro Preto, Escola de Farmácia, Departamento de Análises Clínicas, Ouro Preto, MG (Brazil); Salvadori, Daisy Maria Fávero [UNESP – Universidade Estadual Paulista, Faculdade de Medicina de Botucatu, Departamento de Patologia, Botucatu, SP (Brazil)
2015-01-15
Highlights: • AITC inhibits mutant and wild-type TP53 cell proliferation. • Morphological changes and cells debris were observed after AITC treatment in both cells. • BAX and BCL2 expression modulation was observed in wild-type TP53 cells. • BCL2, BAX and ANLN increased and S100P decreased expression was detected in mutated TP53 cells. • AITC effects in gene modulation are dependent TP53 gene status. - Abstract: Natural compounds hold great promise for combating antibiotic resistance, the failure to control some diseases, the emergence of new diseases and the toxicity of some contemporary medical products. Allyl isothiocyanate (AITC), which is abundant in cruciferous vegetables and mustard seeds and is commonly referred to as mustard essential oil, exhibits promising antineoplastic activity against bladder cancer, although its mechanism of action is not fully understood. Therefore, the aim of this study was to investigate the effects of AITC activity on bladder cancer cell lines carrying a wild type (wt; RT4) or mutated (T24) TP53 gene. Morphological changes, cell cycle kinetics and CDK1, SMAD4, BAX, BCL2, ANLN and S100P gene expression were evaluated. In both cell lines, treatment with AITC inhibited cell proliferation (at 62.5, 72.5, 82.5 and 92.5 μM AITC) and induced morphological changes, including scattered and elongated cells and cellular debris. Gene expression profiles revealed increased S100P and BAX and decreased BCL2 expression in RT4 cells following AITC treatment. T24 cells displayed increased BCL2, BAX and ANLN and decreased S100P expression. No changes in SMAD4 and CDK1 expression were observed in either cell line. In conclusion, AITC inhibits cell proliferation independent of TP53 status. However, the mechanism of action of AITC differed in the two cell lines; in RT4 cells, it mainly acted via the classical BAX/BCL2 pathway, while in T24 cells, AITC modulated the activities of ANLN (related to cytokinesis) and S100P. These data confirm
Inhibition of bladder cancer cell proliferation by allyl isothiocyanate (mustard essential oil)
International Nuclear Information System (INIS)
Sávio, André Luiz Ventura; Nicioli da Silva, Glenda; Salvadori, Daisy Maria Fávero
2015-01-01
Highlights: • AITC inhibits mutant and wild-type TP53 cell proliferation. • Morphological changes and cells debris were observed after AITC treatment in both cells. • BAX and BCL2 expression modulation was observed in wild-type TP53 cells. • BCL2, BAX and ANLN increased and S100P decreased expression was detected in mutated TP53 cells. • AITC effects in gene modulation are dependent TP53 gene status. - Abstract: Natural compounds hold great promise for combating antibiotic resistance, the failure to control some diseases, the emergence of new diseases and the toxicity of some contemporary medical products. Allyl isothiocyanate (AITC), which is abundant in cruciferous vegetables and mustard seeds and is commonly referred to as mustard essential oil, exhibits promising antineoplastic activity against bladder cancer, although its mechanism of action is not fully understood. Therefore, the aim of this study was to investigate the effects of AITC activity on bladder cancer cell lines carrying a wild type (wt; RT4) or mutated (T24) TP53 gene. Morphological changes, cell cycle kinetics and CDK1, SMAD4, BAX, BCL2, ANLN and S100P gene expression were evaluated. In both cell lines, treatment with AITC inhibited cell proliferation (at 62.5, 72.5, 82.5 and 92.5 μM AITC) and induced morphological changes, including scattered and elongated cells and cellular debris. Gene expression profiles revealed increased S100P and BAX and decreased BCL2 expression in RT4 cells following AITC treatment. T24 cells displayed increased BCL2, BAX and ANLN and decreased S100P expression. No changes in SMAD4 and CDK1 expression were observed in either cell line. In conclusion, AITC inhibits cell proliferation independent of TP53 status. However, the mechanism of action of AITC differed in the two cell lines; in RT4 cells, it mainly acted via the classical BAX/BCL2 pathway, while in T24 cells, AITC modulated the activities of ANLN (related to cytokinesis) and S100P. These data confirm
Jeong, Youngtae; Hoang, Ngoc T.; Lovejoy, Alexander; Stehr, Henning; Newman, Aaron M.; Gentles, Andrew J.; Kong, William; Truong, Diana; Martin, Shanique; Chaudhuri, Aadel; Heiser, Diane; Zhou, Li; Say, Carmen; Carter, Justin N.; Hiniker, Susan M.; Loo, Billy W.; West, Robert B.; Beachy, Philip; Alizadeh, Ash A.; Diehn, Maximilian
2016-01-01
Lung squamous cell carcinomas (LSCC) pathogenesis remains incompletely understood and biomarkers predicting treatment response remain lacking. Here we describe novel murine LSCC models driven by loss of Trp53 and Keap1, both of which are frequently mutated in human LSCCs. Homozygous inactivation of Keap1 or Trp53 promoted airway basal stem cell (ABSC) self-renewal, suggesting that mutations in these genes lead to expansion of mutant stem cell clones. Deletion of Trp53 and Keap1 in ABSCs, but not more differentiated tracheal cells, produced tumors recapitulating histological and molecular features of human LSCCs, indicating that they represent the likely cell of origin in this model. Deletion of Keap1 promoted tumor aggressiveness, metastasis, and resistance to oxidative stress and radiotherapy (RT). KEAP1/NRF2 mutation status predicted risk of local recurrence after RT in non-small lung cancer (NSCLC) patients and could be non-invasively identified in circulating tumor DNA. Thus, KEAP1/NRF2 mutations could serve as predictive biomarkers for personalization of therapeutic strategies for NSCLCs. PMID:27663899
Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan
2002-04-10
We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.
p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.
Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete
2018-06-11
CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation
International Nuclear Information System (INIS)
Ikehata, Hironobu
1998-01-01
Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.
Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko
2017-11-30
Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.
Rieber, Manuel; Strasberg-Rieber, Mary
2014-03-15
Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
TP53 gene polymorphism: Importance to cancer, ethnicity and birth ...
Indian Academy of Sciences (India)
1Functional Genomics Laboratory, Technology Development Centre (CDTec), Federal University of Pelotas. (UFPel) .... follows the definition: children whose birth weight for gestational ..... Welcome Trusts initiative entitled Major Awards for.
Directory of Open Access Journals (Sweden)
Hang-Ning Huang
2015-05-01
Full Text Available Antimicrobial peptides (AMPs are endogenous antibiotics that directly affect microorganisms, and also have a variety of receptor-mediated functions. One such AMP, Tilapia piscidin 4 (TP4, was isolated from Nile tilapia (Oreochromis niloticus; TP4 has antibacterial effects and regulates the innate immune system. The aim of the present study was to characterize the role of TP4 in the regulation of wound closure in mice and proliferation of a keratinocyte cell line (HaCaT and fibroblast cell line (Hs-68. In vitro, TP4 stimulated cell proliferation and activated collagen I, collagen III, and keratinocyte growth factor (KGF gene expression in Hs-68 cells, which induces keratin production by HaCaT cells. This effect was detectable at TP4 concentrations of 6.25 µg/mL in both cell lines. In vivo, TP4 was found to be highly effective at combating peritonitis and wound infection caused by MRSA in mouse models, without inducing adverse behavioral effects or liver or kidney toxicity. Taken together, our results indicate that TP4 enhances the survival rate of mice infected with the bacterial pathogen MRSA through both antimicrobial and wound closure activities mediated by epidermal growth factor (EGF, transforming growth factor (TGF, and vascular endothelial growth factor (VEGF. The peptide is likely involved in antibacterial processes and regulation of tissue homeostasis in infected wounds in mice. Overall, these results suggest that TP4 may be suitable for development as a novel topical agent for wound dressing.
2014-10-01
to cause other cancer susceptibility (CDKN2A, MLH1, MSH2, MSH6, PMS2 ); 3) genes known or postulated to be moderate penetrance cancer susceptibility...susceptibility (CDKN2A, MLH1, MSH2, MSH6, PMS2 ); 3) genes known or postulated to be moderate penetrance cancer susceptibility genes (ATM, BARD1, BRIP1...three patients in TP53 and 12 patients in MLH1, MSH2, MSH6, or PMS2 ; no VUSs were found in CDH1, CDKN2A, STK11 or PTEN. Three additional patients each
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Jardin, Fabrice; Picquenot, Jean-Michel; Parmentier, Françoise; Ruminy, Philippe; Cornic, Marie; Penther, Dominique; Bertrand, Philippe; Lanic, Hélène; Cassuto, Ophélie; Humbrecht, Catherine; Lemasle, Emilie; Wautier, Agathe; Bastard, Christian; Tilly, Hervé
2009-09-01
The t(11;14)(q13;q32) is the hallmark of mantle cell lymphoma (MCL). Additional genetic alterations occur in the majority of cases. This study aimed to design a polymerase chain reaction (PCR) assay to determine the incidence and relevance of recurrent gene copy number aberrations in this disease. Forty-two MCL cases with frozen- or paraffin-embedded (FFPE) tissues were selected. Three different quantitative Multiplex PCR of Short Fluorescent Fragments (QMPSF) assays were designed to simultaneously analyse eight genes (CDKN2A, RB1, ATM, CDK2, TP53, MYC, CDKN1B, MDM2), to analyse the 9p21 locus (CDKN2A/CDKN2B) and FFPE tissues. Gains of MYC, CDK2, CDKN1B, and MDM2 were observed in 10% of cases. Losses of RB1, CDKN2A, ATM or TP53 were observed in 38%, 31%, 24% and 10% of cases, respectively. Analysis of the 9p21 locus indicated that, in most cases, tumours displayed a complete inactivation of p14(ARF)/p15I(NK4B)/p16I(NK4A). CDKN2A and MYC aberrations were associated with a high MCL international prognostic index (MIPI). CDK2/MDM2 gains and CDKN2A/TP53 losses correlated with an unfavourable outcome. PCR experiments with frozen and FFPE-tissues indicated that our approach is valid in a routine diagnostic setting, providing a powerful tool that could be used for patient stratification in combination with MIPI in future clinical trials.
Long, Wen-Bo; Luan, Li; Wang, Xing; Liu, Yu-Hua; Tu, Sheng-Bin; Kong, Fan-Lun; He, Tao
2007-04-01
Cytogenetical comparison was made between high seed set restorers TP-4 and D minghui63 and eminent maintainer line D46B of autotetraploid rice. The meiosis observation demonstrated the genomes of our autotetraploid materials were all 2n = 48, the same as those in mitosis observation. Low percentages of univalent and trivalent in metaphase I (MI) of restorers TP-4 and D minghui63 and in metaphase I (MI) of maintainer line D46B of autotetraploid rice were observed. And the percentages of chromosome pairing were all over 99%, showing eminent cytological character. The frequency of TP-4 and D minghui63 in metaphase I (MI) was 2.00/PMC and 2.26/PMC, respectively. However the frequency of D46B was 6.00/PMC, significantly higher than those of TP-4 and D minghui63. It indicated that the maintainer D46B has better chromosome pairing capability in metaphase I (MI). While, the frequency of lagging chromosomes of the maintainer D46B in anaphase I (AI) was 10.62%, significantly lower than that of TP-4 (19.44%) or D minghui63 (23.14%), and it was close to the level of diploid control (7.30%). In telophase I (TI), maintainer D46B exhibited a lower frequency of microkernel, and in telophase II (TII) the frequency of normal quartered microspore of maintainer D46B was not only higher than that of TP-4 or D minghui63 but also than that of diploid control. The percentage of the cell observed chromosome lagging in A1 and the percentage of abnormal cell in TI showed a greatly significant positive correlation. That may demonstrate chromo some separation in anaphase I (AI) and microkernel formation in telophase I (TI) are controlled by the same dominant single gene or the major gene of QTL.
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.
1993-01-01
Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the
Hot spot mutations in Finnish non-small cell lung cancers.
Mäki-Nevala, Satu; Sarhadi, Virinder Kaur; Rönty, Mikko; Kettunen, Eeva; Husgafvel-Pursiainen, Kirsti; Wolff, Henrik; Knuuttila, Aija; Knuutila, Sakari
2016-09-01
Non-small cell lung cancer (NSCLC) is a common cancer with a poor prognosis. The aim of this study was to screen Finnish NSCLC tumor samples for common cancer-related mutations by targeted next generation sequencing and to determine their concurrences and associations with clinical features. Sequencing libraries were prepared from DNA isolated from formalin-fixed, paraffin-embedded tumor material of 425 patients using the AmpliSeq Colon and Lung panel covering mutational hot spot regions of 22 cancer genes. Sequencing was performed with the Ion Torrent Personal Genome Machine (PGM). Data analysis of the hot spot mutations revealed mutations in 77% of the patients, with 7% having 3 or more mutations reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. Two of the most frequently mutated genes were TP53 (46%) and KRAS (25%). KRAS codon 12 mutations were the most recurrently occurring mutations. EGFR mutations were significantly associated with adenocarcinoma, female gender and never/light-smoking history; CTNNB1 mutations with light ex-smokers, PIK3CA and TP53 mutations with squamous cell carcinoma, and KRAS with adenocarcinoma. TP53 mutations were most prevalent in current smokers and ERBB2, ERBB4, PIK3CA, NRAS, NOTCH1, FBWX7, PTEN and STK11 mutations occurred exclusively in a group of ever-smokers, however the association was not statistically significant. No mutation was found that associated with asbestos exposure. Finnish NSCLC patients have a similar mutation profile as other Western patients, however with a higher frequency of BRAF mutations but a lower frequency of STK11 and ERBB2 mutations. Moreover, TP53 mutations occurred frequently with other gene mutations, most commonly with KRAS, MET, EGFR and PIK3CA mutations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D
2016-03-01
Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes
Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.
2016-01-01
Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping
Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes
Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo
2010-01-01
We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513
Directory of Open Access Journals (Sweden)
Hayder M. Al-kuraishy
2018-01-01
Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.
Identification of apoptosis-related PLZF target genes
International Nuclear Information System (INIS)
Bernardo, Maria Victoria; Yelo, Estefania; Gimeno, Lourdes; Campillo, Jose Antonio; Parrado, Antonio
2007-01-01
The PLZF gene encodes a BTB/POZ-zinc finger-type transcription factor, involved in physiological development, proliferation, differentiation, and apoptosis. In this paper, we investigate proliferation, survival, and gene expression regulation in stable clones from the human haematopoietic K562, DG75, and Jurkat cell lines with inducible expression of PLZF. In Jurkat cells, but not in K562 and DG75 cells, PLZF induced growth suppression and apoptosis in a cell density-dependent manner. Deletion of the BTB/POZ domain of PLZF abrogated growth suppression and apoptosis. PLZF was expressed with a nuclear speckled pattern distinctively in the full-length PLZF-expressing Jurkat clones, suggesting that the nuclear speckled localization is required for PLZF-induced apoptosis. By microarray analysis, we identified that the apoptosis-inducer TP53INP1, ID1, and ID3 genes were upregulated, and the apoptosis-inhibitor TERT gene was downregulated. The identification of apoptosis-related PLZF target genes may have biological and clinical relevance in cancer typified by altered PLZF expression
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Identification of Genetic Susceptibility to Childhood Cancer through Analysis of Genes in Parallel
Plon, Sharon E.; Wheeler, David A.; Strong, Louise C.; Tomlinson, Gail E.; Pirics, Michael; Meng, Qingchang; Cheung, Hannah C.; Begin, Phyllis R.; Muzny, Donna M.; Lewis, Lora; Biegel, Jaclyn A.; Gibbs, Richard A.
2011-01-01
Clinical cancer genetic susceptibility analysis typically proceeds sequentially beginning with the most likely causative gene. The process is time consuming and the yield is low particularly for families with unusual patterns of cancer. We determined the results of in parallel mutation analysis of a large cancer-associated gene panel. We performed deletion analysis and sequenced the coding regions of 45 genes (8 oncogenes and 37 tumor suppressor or DNA repair genes) in 48 childhood cancer patients who also (1) were diagnosed with a second malignancy under age 30, (2) have a sibling diagnosed with cancer under age 30 and/or (3) have a major congenital anomaly or developmental delay. Deleterious mutations were identified in 6 of 48 (13%) families, 4 of which met the sibling criteria. Mutations were identified in genes previously implicated in both dominant and recessive childhood syndromes including SMARCB1, PMS2, and TP53. No pathogenic deletions were identified. This approach has provided efficient identification of childhood cancer susceptibility mutations and will have greater utility as additional cancer susceptibility genes are identified. Integrating parallel analysis of large gene panels into clinical testing will speed results and increase diagnostic yield. The failure to detect mutations in 87% of families highlights that a number of childhood cancer susceptibility genes remain to be discovered. PMID:21356188
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Directory of Open Access Journals (Sweden)
Zhihong CHEN
2011-10-01
Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.
Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.
Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke
2018-06-01
In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .
PAF53 is essential in mammalian cells: CRISPR/Cas9 fails to eliminate PAF53 expression.
Rothblum, Lawrence I; Rothblum, Katrina; Chang, Eugenie
2017-05-15
When mammalian cells are nutrient and/or growth factor deprived, exposed to inhibitors of protein synthesis, stressed by heat shock or grown to confluence, rDNA transcription is essentially shut off. Various mechanisms are available to accomplish this downshift in ribosome biogenesis. Muramatsu's laboratory (Hanada et al., 1996) first demonstrated that mammalian PAF53 was essential for specific rDNA transcription and that PAF53 levels were regulated in response to growth factors. While S. cerevisae A49, the homologue of vertebrate PAF53, is not essential for viability (Liljelund et al., 1992), deletion of yA49 results in colonies that grow at 6% of the wild type rate at 25°C. Experiments described by Wang et al. (2015) identified PAF53 as a gene "essential for optimal proliferation". However, they did not discriminate genes essential for viability. Hence, in order to resolve this question, we designed a series of experiments to determine if PAF53 was essential for cell survival. We set out to delete the gene product from mammalian cells using CRISPR/CAS9 technology. Human 293 cells were transfected with lentiCRISPR v2 carrying genes for various sgRNA that targeted PAF53. In some experiments, the cells were cotransfected in parallel with plasmids encoding FLAG-tagged mouse PAF53. After treating the transfected cells with puromycin (to select for the lentiCRISPR backbone), cells were cloned and analyzed by western blots for PAF53 expression. Genomic DNA was amplified across the "CRISPRd" exon, cloned and sequenced to identify mutated PAF53 genes. We obtained cell lines in which the endogenous PAF53 gene was "knocked out" only when we rescued with FLAG-PAF53. DNA sequencing demonstrated that in the absence of ectopic PAF53 expression, cells demonstrated unique means of surviving; including recombination or the utilization of alternative reading frames. We never observed a clone in which one PAF53 gene is expressed, unless there was also ectopic expression In the
Rapid detection of single nucleotide mutation in p53 gene based on ...
Indian Academy of Sciences (India)
mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.
International Nuclear Information System (INIS)
Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.
2005-01-01
Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes
Czech Academy of Sciences Publication Activity Database
Vymetálková, Veronika; Souček, P.; Kunická, T.; Jirásková, Kateřina; Brynychová, V.; Pardini, B.; Novosadová, V.; Polívková, Z.; Kubáčková, K.; Kozevnikovová, R.; Ambruš, M.; Vodičková, Ludmila; Naccarati, Alessio; Vodička, Pavel
2015-01-01
Roč. 10, č. 7 (2015), e0134463 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP304/12/1585; GA MZd(CZ) NT13424 Institutional support: RVO:68378041 Keywords : single-nucleotide polymorphisms * repair pathway genes * colorectal - cancer * adjuvant therapy * arginine allele * cell-lines * in-vivo * mutations * susceptibility Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.057, year: 2015
Prolonged Tp-e Interval in Down Syndrome Patients with Congenitally Normal Hearts.
Kucuk, Mehmet; Karadeniz, Cem; Ozdemir, Rahmi; Meşe, Timur
2018-03-25
Heterogeneity of ventricular repolarization has been assessed by using the QT dispersion in Down syndrome (DS) patients with congenitally normal hearts. However, novel repolarization indexes, the Tp-e interval and Tp-e/QT ratio, have not previously been evaluated in these patients. The aim of this study was to evaluate the Tp-e interval and Tp-e/QT ratio in DS patients without congenital heart defects. Twelve-lead surface electrocardiograms of 160 DS patients and 110 age- and sex-matched healthy controls were used to evaluate and compare the Tp-e interval, Tp-e dispersion, and Tp-e/QT ratio. Heart rate, Tp-e interval, Tp-e dispersion, Tp-e/QT and Tp-e/QTc ratios were significantly higher in DS group than in the controls. Myocardial repolarization indexes in DS patients with congenitally normal hearts were found to be prolonged compared to those in normal controls. Further evaluation is warranted to reveal a relationship between prolonged repolarization indexes and arrhythmic events in these patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Iwayanagi, Takao; Miyamoto, Sei; Konno, Takeshi; Mizutani, Hisashi; Hirai, Tomohiro; Shigemoto, Yasumasa; Gojobori, Takashi; Sugawara, Hideaki
2012-09-01
The Targeted Proteins Research Program (TPRP) promoted by the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan is the phase II of structural biology project (2007-2011) following the Protein 3000 Project (2002-2006) in Japan. While the phase I Protein 3000 Project put partial emphasis on the construction and maintenance of pipelines for structural analyses, the TPRP is dedicated to revealing the structures and functions of the targeted proteins that have great importance in both basic research and industrial applications. To pursue this objective, 35 Targeted Proteins (TP) Projects selected in the three areas of fundamental biology, medicine and pharmacology, and food and environment are tightly collaborated with 10 Advanced Technology (AT) Projects in the four fields of protein production, structural analyses, chemical library and screening, and information platform. Here, the outlines and achievements of the 35 TP Projects are summarized in the system named TP Atlas. Progress in the diversified areas is described in the modules of Graphical Summary, General Summary, Tabular Summary, and Structure Gallery of the TP Atlas in the standard and unified format. Advances in TP Projects owing to novel technologies stemmed from AT Projects and collaborative research among TP Projects are illustrated as a hallmark of the Program. The TP Atlas can be accessed at http://net.genes.nig.ac.jp/tpatlas/index_e.html .
International Nuclear Information System (INIS)
Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun
2007-01-01
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Energy Technology Data Exchange (ETDEWEB)
Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Kim, Jusik; Choi, Inseo; Lee, Youngsoo
2017-11-01
Maintenance of genomic integrity is one of the critical features for proper neurodevelopment and inhibition of neurological diseases. The signals from both ATM and ATR to TP53 are well-known mechanisms to remove neural cells with DNA damage during neurogenesis. Here we examined the involvement of Atm and Atr in genomic instability due to Terf2 inactivation during mouse brain development. Selective inactivation of Terf2 in neural progenitors induced apoptosis, resulting in a complete loss of the brain structure. This neural loss was rescued partially in both Atm and Trp53 deficiency, but not in an Atr-deficient background in the mouse. Atm inactivation resulted in incomplete brain structures, whereas p53 deficiency led to the formation of multinucleated giant neural cells and the disruption of the brain structure. These giant neural cells disappeared in Lig4 deficiency. These data demonstrate ATM and TP53 are important for the maintenance of telomere homeostasis and the surveillance of telomere dysfunction during neurogenesis.
Li-Fraumeni-like syndrome associated with a large BRCA1 intragenic deletion
International Nuclear Information System (INIS)
Silva, Amanda Gonçalves; Achatz, Maria Isabel W; Rosenberg, Carla; Krepischi, Ana C V; Ewald, Ingrid Petroni; Sapienza, Marina; Pinheiro, Manuela; Peixoto, Ana; Nóbrega, Amanda França de; Carraro, Dirce M; Teixeira, Manuel R; Ashton-Prolla, Patricia
2012-01-01
Li-Fraumeni (LFS) and Li-Fraumeni-like (LFL) syndromes are associated to germline TP53 mutations, and are characterized by the development of central nervous system tumors, sarcomas, adrenocortical carcinomas, and other early-onset tumors. Due to the high frequency of breast cancer in LFS/LFL families, these syndromes clinically overlap with hereditary breast cancer (HBC). Germline point mutations in BRCA1, BRCA2, and TP53 genes are associated with high risk of breast cancer. Large rearrangements involving these genes are also implicated in the HBC phenotype. We have screened DNA copy number changes by MLPA on BRCA1, BRCA2, and TP53 genes in 23 breast cancer patients with a clinical diagnosis consistent with LFS/LFL; most of these families also met the clinical criteria for other HBC syndromes. We found no DNA copy number alterations in the BRCA2 and TP53 genes, but we detected in one patient a 36.4 Kb BRCA1 microdeletion, confirmed and further mapped by array-CGH, encompassing exons 9–19. Breakpoints sequencing analysis suggests that this rearrangement was mediated by flanking Alu sequences. This is the first description of a germline intragenic BRCA1 deletion in a breast cancer patient with a family history consistent with both LFL and HBC syndromes. Our results show that large rearrangements in these known cancer predisposition genes occur, but are not a frequent cause of cancer susceptibility
International Nuclear Information System (INIS)
Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.
1997-01-01
Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong
2008-01-01
Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)
Allelic deletions of cell growth regulators during progression of bladder cancer
DEFF Research Database (Denmark)
Primdahl, H; von der Maase, H; Christensen, M
2000-01-01
Cell growth regulators include proteins of the p53 pathway encoded by the genes CDKN2A (p16, p14arf), MDM2, TP53, and CDKN1A (p21) as well as proteins encoded by genes like RB1, E2F, and MYCL. In the present study we investigated allelic deletions of all these genes in each recurrent bladder tumor...... difference in the numbers of gene loci hit by deletions muscle-invasive versus noninvasive tumors (P = 0.0000002), with the genes most often hit by deletions in muscle-invasive tumors being TP53, RB1, and MYCL. A number of novel findings were made. Losses of MYCL and RB1 alleles were more pronounced...... that a characteristic difference between recurrent noninvasive and recurrent progressing bladder tumors is loss of cell cycle-regulatory genes in the latter group....
Main - TP Atlas | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...me: tp_atlas_en.zip File URL: ftp://ftp.biosciencedbc.jp/archive/tp_atlas/LATEST/...d License Update History of This Database Site Policy | Contact Us Main - TP Atlas | LSDB Archive ...
Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao
2015-07-01
A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.
International Nuclear Information System (INIS)
Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang
2006-01-01
The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
International Nuclear Information System (INIS)
Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi
2015-01-01
Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized
White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M
2014-08-01
The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the
Directory of Open Access Journals (Sweden)
Vladimir O. Pustylnyak
2015-01-01
Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.
Melloy, Patricia G
2015-01-01
A two-part laboratory exercise was developed to enhance classroom instruction on the significance of p53 mutations in cancer development. Students were asked to mine key information from an international database of p53 genetic changes related to cancer, the IARC TP53 database. Using this database, students designed several data mining activities to look at the changes in the p53 gene from a number of perspectives, including potential cancer-causing agents leading to particular changes and the prevalence of certain p53 variations in certain cancers. In addition, students gained a global perspective on cancer prevalence in different parts of the world. Students learned how to use the database in the first part of the exercise, and then used that knowledge to search particular cancers and cancer-causing agents of their choosing in the second part of the exercise. Students also connected the information gathered from the p53 exercise to a previous laboratory exercise looking at risk factors for cancer development. The goal of the experience was to increase student knowledge of the link between p53 genetic variation and cancer. Students also were able to walk a similar path through the website as a cancer researcher using the database to enhance bench work-based experiments with complementary large-scale database p53 variation information. © 2014 The International Union of Biochemistry and Molecular Biology.
Directory of Open Access Journals (Sweden)
Rashid Mir
2016-01-01
Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.
[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].
Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G
2012-01-01
In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
TP Organics - maheuuringute tehnoloogiaplatvorm
2015-01-01
TP Organics on 2008. a loodud Euroopa mahepõllumajanduse ja mahetoidu ning vähese sisendiga põllumajanduse tehnoloogiaplatvorm. Platvormi eesmärk on selgitada välja teadustöö ja uuenduste vajadused ning edastada see info poliitikutele
Stodden, Genna R.; Lindberg, Mallory E.; King, Mandy L.; Paquet, Maril?ne; MacLean, James A.; Mann, Jordan L.; DeMayo, Francesco J.; Lydon, John P.; Hayashi, Kanako
2014-01-01
Type II endometrial carcinomas are estrogen independent, poorly differentiated tumors that behave in an aggressive manner. Since TP53 mutation and CDH1 inactivation occur in 80% of human endometrial type II carcinomas, we hypothesized that mouse uteri lacking both Trp53 and Cdh1 would exhibit a phenotype indicative of neoplastic transformation. Mice with conditional ablation of Cdh1 and Trp53 (Cdh1d/dTrp53d/d ) clearly demonstrate architectural features characteristic of type II endometrial c...
Directory of Open Access Journals (Sweden)
Reza Akhavan-Sigari
2014-08-01
Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.
Directory of Open Access Journals (Sweden)
Yahya eAli
2014-03-01
Full Text Available Lipoprotein Ltp encoded by temperate Streptococcus thermophilus phage TP-J34 is the prototype of the wide-spread family of host cell surface-exposed lipoproteins involved in superinfection exclusion. When screening for other S. thermophilus phages expressing this type of lipoprotein, three temperate phages - TP-EW, TP-DSM20617 and TP-778 - were isolated. In this communication we present the total nucleotide sequences of TP-J34 and TP-778L. For TP-EW, a phage almost identical to TP-J34, besides the ltp gene only the two regions of deviation from TP-J34 DNA were analyzed: the gene encoding the tail protein causing an assembly defect in TP-J34 and the gene encoding the lysin, which in TP-EW contains an intron. For TP-DSM20617 only the sequence of the lysogeny module containing the ltp gene was determined. The region showed high homology to the same region of TP-778. For TP-778 we could show that absence of the attR region resulted in aberrant excision of phage DNA. The amino acid sequence of mature LtpTP-EW was shown to be identical to that of mature LtpTP-J34, whereas the amino acid sequence of mature LtpTP-778 was shown to differ from mature LtpTP-J34 in eight amino acid positions. LtpTP-DSM20617 was shown to differ from LtpTP-778 in just one amino acid position. In contrast to LtpTP-J34, LtpTP-778 did not affect infection of lactococcal phage P008 instead increased activity against phage P001 was noticed.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Wang, Nini; Yin, Jianchuan
2017-12-01
A precipitation-based regionalization for the Tibetan Plateau (TP) was investigated for regional precipitation trend analysis and frequency analysis using data from 1113 grid points covering the period 1900-2014. The results utilizing self-organizing map (SOM) network suggest that four clusters of precipitation coherent zones can be identified, including the southwestern edge, the southern edge, the southeastern region, and the north central region. Regionalization results of the SOM network satisfactorily represent the influences of the atmospheric circulation systems such as the East Asian summer monsoon, the south Asian summer monsoon, and the mid-latitude westerlies. Regionalization results also well display the direct impacts of physical geographical features of the TP such as orography, topography, and land-sea distribution. Regional-scale annual precipitation trend as well as regional differences of annual and seasonal total precipitation were investigated by precipitation index such as precipitation concentration index (PCI) and Standardized Anomaly Index (SAI). Results demonstrate significant negative long-term linear trends in southeastern TP and the north central part of the TP, indicating arid and semi-arid regions in the TP are getting drier. The empirical mode decomposition (EMD) method shows an evolution of the main cycle with 4 and 12 months for all the representative grids of four sub-regions. The cross-wavelet analysis suggests that predominant and effective period of Indian Ocean Dipole (IOD) on monthly precipitation is around ˜12 months, except for the representative grid of the northwestern region.
Molecular genetic analysis of 103 sporadic colorectal tumours in Czech patients.
Directory of Open Access Journals (Sweden)
Peter Vasovcak
Full Text Available The Czech Republic has one of the highest incidences of colorectal cancer (CRC in Europe. To evaluate whether sporadic CRCs in Czech patients have specific mutational profiles we analysed somatic genetic changes in known CRC genes (APC, KRAS, TP53, CTNNB1, MUTYH and BRAF, loss of heterozygosity (LOH at the APC locus, microsatellite instability (MSI, and methylation of the MLH1 promoter in 103 tumours from 102 individuals. The most frequently mutated gene was APC (68.9% of tumours, followed by KRAS (31.1%, TP53 (27.2%, BRAF (8.7% and CTNNB1 (1.9%. Heterozygous germline MUTYH mutations in 2 patients were unlikely to contribute to the development of their CRCs. LOH at the APC locus was found in 34.3% of tumours, MSI in 24.3% and MLH1 methylation in 12.7%. Seven tumours (6.9% were without any changes in the genes tested. The analysis yielded several findings possibly specific for the Czech cohort. Somatic APC mutations did not cluster in the mutation cluster region (MCR. Tumours with MSI but no MLH1 methylation showed earlier onset and more severe mutational profiles compared to MSI tumours with MLH1 methylation. TP53 mutations were predominantly located outside the hot spots, and transitions were underrepresented. Our analysis supports the observation that germline MUTYH mutations are rare in Czech individuals with sporadic CRCs. Our findings suggest the influence of specific ethnic genetic factors and/or lifestyle and dietary habits typical for the Czech population on the development of these cancers.
International Nuclear Information System (INIS)
Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee
1996-12-01
The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs
De Keukeleire, Steven; Desmet, Stefanie; Lagrou, Katrien; Oosterlynck, Julie; Verhulst, Manon; Van Besien, Jessica; Saegeman, Veroniek; Reynders, Marijke
2017-03-01
The performance of Elecsys Syphilis was compared to Architect Syphilis TP and Reformulated Architect Syphilis TP. The overall sensitivity and specificity were 98.4% and 99.5%, 97.7% and 97.1%, and 99.2% and 99.7% respectively. The assays are comparable and considered adequate for syphilis screening. Copyright © 2016 Elsevier Inc. All rights reserved.
Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression
International Nuclear Information System (INIS)
Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo
2009-01-01
A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.
Directory of Open Access Journals (Sweden)
Akihiro Kawashima
Full Text Available Maternal cigarette smoking is reportedly associated with miscarriage, fetal growth restriction and placental abruption, and is paradoxically associated with a decreased risk of developing preeclampsia. In the present study, we investigated the gene expression levels of villous tissues in early gestation. We compared the expression levels of the genes related to angiogenesis and apoptosis in the villous tissues obtained from smoking and non-smoking pregnant women.We collected villous tissue samples from 57 women requesting surgical termination due to non-medical reasons at 6-8 weeks of gestation. The maternal cigarette smoking status was evaluated by the level of serum cotinine and patients were divided into active smokers and non-smokers by the serum cotinine level. The placental levels of VEGFA, PGF, FLT1, HIF1A, TP53, BAX and BCL2 mRNA were quantified by real time PCR.The gene expression level of PGF and HIF1A in the active smoker group was significantly higher than that in the non-smoker group. We did not observe any significant differences in the VEGFA or FLT1 expression between the groups. In active smoker group, the gene expression levels of TP53 and BAX were significantly higher than those in the non-smoker group. The ratio of BAX/BCL2 mRNA in the active smoker group was significantly higher than that in the non-smoker group.Our findings revealed that smoking might affect the placenta during early pregnancy. Maternal cigarette smoking in early pregnancy may be associated with villus hypoxia, which may influence angiogenesis and apoptosis.
The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.
Directory of Open Access Journals (Sweden)
Krzysztof Puszynski
2014-12-01
Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.
LOS GENES BRCA1 y BRCA2. ESTUDIO MOLECULAR
Directory of Open Access Journals (Sweden)
N. Alonso
2006-11-01
Full Text Available RESUMENEn los últimos años, se realizaron numerosos estudios para establecer la predisposición hereditaria al cáncer y las alteraciones mutacionales a nivel de genes susceptibles de originar cáncer de mama y ovario. En 1994 se identificaron los genes BRCA1 (Breast Cancer Gene 1 y BRCA2 (Breast Cancer Gene 2 como susceptibles de cáncer de mama y ovario. En la actualidad se sabe que las mutaciones en BRCA1 y BRCA2 están lejos de explicar la totalidad de los casos de cáncer de mama y/o ovario, y a pesar de que se postulan alteraciones mutacionales en otros genes como CHEK2, TP53 y PTEN, el BRCA1 y BRCA2, siguen teniendo su importancia y utilidad en la valoración del riesgo de predisposición hereditaria. Aunque las cifras son variables según los distintos estudios y autores, se trata en cualquier caso de porcentajes importantes. Entre el 15 y el 85% de las mujeres portadoras de mutación BRCA 1 o BRCA 2 tienen riesgo de desarrollar un cáncer de mama y entre un 10 y 60% de desarrollar un cáncer de ovario. ABSTRACT:In the last years, numerous studies were made to establish the hereditary predisposition to the cancer and the mutationals alterations at level of genes susceptible to originate breast and ovarian cancers. In 1994 genes BRCA1 (Breast Cancer Gene 1 and BRCA2 were identified (Breast Cancer Gene 2 as susceptible of both of breast and ovarian cancers. At the present time, it is knows that the mutations in BRCA 1 and BRCA 2 are far from explaining the totality of the cases of breast cancer and/or ovary, and although mutationals alterations in other genes like CHEK2, TP53 and PTEN, the BRCA1 and BRCA2 are postulated, they continue having his importance and utility in the valuation of the risk of hereditary predisposition. Correlations between both BRCA1 and BRCA2 levels with tumour grade metastasis and prognostic accuracy. Between 15 and 85% of the carrying women of mutation BRCA 1 or BRCA 2 have risk of developing a cancer of breast
Hassan, Saima; Esch, Amanda; Liby, Tiera; Gray, Joe W; Heiser, Laura M
2017-12-01
Effective treatment of patients with triple-negative (ER-negative, PR-negative, HER2-negative) breast cancer remains a challenge. Although PARP inhibitors are being evaluated in clinical trials, biomarkers are needed to identify patients who will most benefit from anti-PARP therapy. We determined the responses of three PARP inhibitors (veliparib, olaparib, and talazoparib) in a panel of eight triple-negative breast cancer cell lines. Therapeutic responses and cellular phenotypes were elucidated using high-content imaging and quantitative immunofluorescence to assess markers of DNA damage (53BP1) and apoptosis (cleaved PARP). We determined the pharmacodynamic changes as percentage of cells positive for 53BP1, mean number of 53BP1 foci per cell, and percentage of cells positive for cleaved PARP. Inspired by traditional dose-response measures of cell viability, an EC 50 value was calculated for each cellular phenotype and each PARP inhibitor. The EC 50 values for both 53BP1 metrics strongly correlated with IC 50 values for each PARP inhibitor. Pathway enrichment analysis identified a set of DNA repair and cell cycle-associated genes that were associated with 53BP1 response following PARP inhibition. The overall accuracy of our 63 gene set in predicting response to olaparib in seven breast cancer patient-derived xenograft tumors was 86%. In triple-negative breast cancer patients who had not received anti-PARP therapy, the predicted response rate of our gene signature was 45%. These results indicate that 53BP1 is a biomarker of response to anti-PARP therapy in the laboratory, and our DNA damage response gene signature may be used to identify patients who are most likely to respond to PARP inhibition. Mol Cancer Ther; 16(12); 2892-901. ©2017 AACR . ©2017 American Association for Cancer Research.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Gene expression profiles of primary colorectal carcinomas, liver metastases, and carcinomatoses
Directory of Open Access Journals (Sweden)
Myklebost Ola
2007-01-01
Full Text Available Abstract Background Despite the fact that metastases are the leading cause of colorectal cancer deaths, little is known about the underlying molecular changes in these advanced disease stages. Few have studied the overall gene expression levels in metastases from colorectal carcinomas, and so far, none has investigated the peritoneal carcinomatoses by use of DNA microarrays. Therefore, the aim of the present study is to investigate and compare the gene expression patterns of primary carcinomas (n = 18, liver metastases (n = 4, and carcinomatoses (n = 4, relative to normal samples from the large bowel. Results Transcriptome profiles of colorectal cancer metastases independent of tumor site, as well as separate profiles associated with primary carcinomas, liver metastases, or peritoneal carcinomatoses, were assessed by use of Bayesian statistics. Gains of chromosome arm 5p are common in peritoneal carcinomatoses and several candidate genes (including PTGER4, SKP2, and ZNF622 mapping to this region were overexpressed in the tumors. Expression signatures stratified on TP53 mutation status were identified across all tumors regardless of stage. Furthermore, the gene expression levels for the in vivo tumors were compared with an in vitro model consisting of cell lines representing all three tumor stages established from one patient. Conclusion By statistical analysis of gene expression data from primary colorectal carcinomas, liver metastases, and carcinomatoses, we are able to identify genetic patterns associated with the different stages of tumorigenesis.
Directory of Open Access Journals (Sweden)
Yan Wang
Full Text Available Nijmegen breakage syndrome (NBS with NBS1 germ-line mutation is a human autosomal recessive disease characterized by genomic instability and enhanced cancer predisposition. The NBS1 gene codes for a protein, Nbs1(p95/Nibrin, involved in the processing/repair of DNA double-strand breaks. Hepatocellular carcinoma (HCC is a complex and heterogeneous tumor with several genomic alterations. Recent studies have shown that heterozygous NBS1 mice exhibited a higher incidence of HCC than did wild-type mice. The objective of the present study is to assess whether NBS1 mutations play a role in the pathogenesis of human primary liver cancer, including HBV-associated HCC and intrahepatic cholangiocarcinoma (ICC. Eight missense NBS1 mutations were identified in six of 64 (9.4% HCCs and two of 18 (11.1% ICCs, whereas only one synonymous mutation was found in 89 control cases of cirrhosis and chronic hepatitis B. Analysis of the functional consequences of the identified NBS1 mutations in Mre11-binding domain showed loss of nuclear localization of Nbs1 partner Mre11, one of the hallmarks for Nbs1 deficiency, in one HCC and two ICCs with NBS1 mutations. Moreover, seven of the eight tumors with NBS1 mutations had at least one genetic alteration in the TP53 pathway, including TP53 mutation, MDM2 amplification, p14ARF homozygous deletion and promoter methylation, implying a synergistic effect of Nbs1 disruption and p53 inactivation. Our findings provide novel insight on the molecular pathogenesis of primary liver cancer characterized by mutation inactivation of NBS1, a DNA repair associated gene.
Heijink, Anne Margriet; Blomen, Vincent A; Bisteau, Xavier; Degener, Fabian; Matsushita, Felipe Yu; Kaldis, Philipp; Foijer, Floris; van Vugt, Marcel A T M
2015-12-08
The Wee1 cell cycle checkpoint kinase prevents premature mitotic entry by inhibiting cyclin-dependent kinases. Chemical inhibitors of Wee1 are currently being tested clinically as targeted anticancer drugs. Wee1 inhibition is thought to be preferentially cytotoxic in p53-defective cancer cells. However, TP53 mutant cancers do not respond consistently to Wee1 inhibitor treatment, indicating the existence of genetic determinants of Wee1 inhibitor sensitivity other than TP53 status. To optimally facilitate patient selection for Wee1 inhibition and uncover potential resistance mechanisms, identification of these currently unknown genes is necessary. The aim of this study was therefore to identify gene mutations that determine Wee1 inhibitor sensitivity. We performed a genome-wide unbiased functional genetic screen in TP53 mutant near-haploid KBM-7 cells using gene-trap insertional mutagenesis. Insertion site mapping of cells that survived long-term Wee1 inhibition revealed enrichment of G1/S regulatory genes, including SKP2, CUL1, and CDK2. Stable depletion of SKP2, CUL1, or CDK2 or chemical Cdk2 inhibition rescued the γ-H2AX induction and abrogation of G2 phase as induced by Wee1 inhibition in breast and ovarian cancer cell lines. Remarkably, live cell imaging showed that depletion of SKP2, CUL1, or CDK2 did not rescue the Wee1 inhibition-induced karyokinesis and cytokinesis defects. These data indicate that the activity of the DNA replication machinery, beyond TP53 mutation status, determines Wee1 inhibitor sensitivity, and could serve as a selection criterion for Wee1-inhibitor eligible patients. Conversely, loss of the identified S-phase genes could serve as a mechanism of acquired resistance, which goes along with development of severe genomic instability.
Imprinted Genes and the Environment: Links to the Toxic Metals Arsenic, Cadmium and Lead
Smeester, Lisa; Yosim, Andrew E.; Nye, Monica D.; Hoyo, Cathrine; Murphy, Susan K.; Fry, Rebecca C.
2014-01-01
Imprinted genes defy rules of Mendelian genetics with their expression tied to the parent from whom each allele was inherited. They are known to play a role in various diseases/disorders including fetal growth disruption, lower birth weight, obesity, and cancer. There is increasing interest in understanding their influence on environmentally-induced disease. The environment can be thought of broadly as including chemicals present in air, water and soil, as well as food. According to the Agency for Toxic Substances and Disease Registry (ATSDR), some of the highest ranking environmental chemicals of concern include metals/metalloids such as arsenic, cadmium, and lead. The complex relationships between toxic metal exposure, imprinted gene regulation/expression and health outcomes are understudied. Herein we examine trends in imprinted gene biology, including an assessment of the imprinted genes and their known functional roles in the cell, particularly as they relate to toxic metals exposure and disease. The data highlight that many of the imprinted genes have known associations to developmental diseases and are enriched for their role in the TP53 and AhR pathways. Assessment of the promoter regions of the imprinted genes resulted in the identification of an enrichment of binding sites for two transcription factor families, namely the zinc finger family II and PLAG transcription factors. Taken together these data contribute insight into the complex relationships between toxic metals in the environment and imprinted gene biology. PMID:24921406
Imprinted Genes and the Environment: Links to the Toxic Metals Arsenic, Cadmium and Lead
Directory of Open Access Journals (Sweden)
Lisa Smeester
2014-06-01
Full Text Available Imprinted genes defy rules of Mendelian genetics with their expression tied to the parent from whom each allele was inherited. They are known to play a role in various diseases/disorders including fetal growth disruption, lower birth weight, obesity, and cancer. There is increasing interest in understanding their influence on environmentally-induced disease. The environment can be thought of broadly as including chemicals present in air, water and soil, as well as food. According to the Agency for Toxic Substances and Disease Registry (ATSDR, some of the highest ranking environmental chemicals of concern include metals/metalloids such as arsenic, cadmium, lead and mercury. The complex relationships between toxic metal exposure, imprinted gene regulation/expression and health outcomes are understudied. Herein we examine trends in imprinted gene biology, including an assessment of the imprinted genes and their known functional roles in the cell, particularly as they relate to toxic metals exposure and disease. The data highlight that many of the imprinted genes have known associations to developmental diseases and are enriched for their role in the TP53 and AhR pathways. Assessment of the promoter regions of the imprinted genes resulted in the identification of an enrichment of binding sites for two transcription factor families, namely the zinc finger family II and PLAG transcription factors. Taken together these data contribute insight into the complex relationships between toxic metals in the environment and imprinted gene biology.
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika
2016-01-01
Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
Directory of Open Access Journals (Sweden)
Ge Q
2016-01-01
Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Regional variability among nonlinear chlorophyll-phosphorus relationships in lakes
Filstrup, Christopher T.; Wagner, Tyler; Soranno, Patricia A.; Stanley, Emily H.; Stow, Craig A.; Webster, Katherine E.; Downing, John A.
2014-01-01
The relationship between chlorophyll a (Chl a) and total phosphorus (TP) is a fundamental relationship in lakes that reflects multiple aspects of ecosystem function and is also used in the regulation and management of inland waters. The exact form of this relationship has substantial implications on its meaning and its use. We assembled a spatially extensive data set to examine whether nonlinear models are a better fit for Chl a—TP relationships than traditional log-linear models, whether there were regional differences in the form of the relationships, and, if so, which regional factors were related to these differences. We analyzed a data set from 2105 temperate lakes across 35 ecoregions by fitting and comparing two different nonlinear models and one log-linear model. The two nonlinear models fit the data better than the log-linear model. In addition, the parameters for the best-fitting model varied among regions: the maximum and lower Chl aasymptotes were positively and negatively related to percent regional pasture land use, respectively, and the rate at which chlorophyll increased with TP was negatively related to percent regional wetland cover. Lakes in regions with more pasture fields had higher maximum chlorophyll concentrations at high TP concentrations but lower minimum chlorophyll concentrations at low TP concentrations. Lakes in regions with less wetland cover showed a steeper Chl a—TP relationship than wetland-rich regions. Interpretation of Chl a—TP relationships depends on regional differences, and theory and management based on a monolithic relationship may be inaccurate.
The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy
International Nuclear Information System (INIS)
Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.
1996-01-01
cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression
Directory of Open Access Journals (Sweden)
Jacqueline Miranda de Lima
2006-03-01
Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the
Imprinted genes and the environment: links to the toxic metals arsenic, cadmium, lead and mercury.
Smeester, Lisa; Yosim, Andrew E; Nye, Monica D; Hoyo, Cathrine; Murphy, Susan K; Fry, Rebecca C
2014-06-11
Imprinted genes defy rules of Mendelian genetics with their expression tied to the parent from whom each allele was inherited. They are known to play a role in various diseases/disorders including fetal growth disruption, lower birth weight, obesity, and cancer. There is increasing interest in understanding their influence on environmentally-induced disease. The environment can be thought of broadly as including chemicals present in air, water and soil, as well as food. According to the Agency for Toxic Substances and Disease Registry (ATSDR), some of the highest ranking environmental chemicals of concern include metals/metalloids such as arsenic, cadmium, lead and mercury. The complex relationships between toxic metal exposure, imprinted gene regulation/expression and health outcomes are understudied. Herein we examine trends in imprinted gene biology, including an assessment of the imprinted genes and their known functional roles in the cell, particularly as they relate to toxic metals exposure and disease. The data highlight that many of the imprinted genes have known associations to developmental diseases and are enriched for their role in the TP53 and AhR pathways. Assessment of the promoter regions of the imprinted genes resulted in the identification of an enrichment of binding sites for two transcription factor families, namely the zinc finger family II and PLAG transcription factors. Taken together these data contribute insight into the complex relationships between toxic metals in the environment and imprinted gene biology.
Directory of Open Access Journals (Sweden)
Ewa Sawosz
2015-10-01
Full Text Available Our previous studies revealed that graphene had anticancer properties in experiments in vitro with glioblastoma multiforme (GBM cells and in tumors cultured in vivo. We hypothesized that the addition of arginine or proline to graphene solutions might counteract graphene agglomeration and increase the activity of graphene. Experiments were performed in vitro with GBM U87 cells and in vivo with GBM tumors cultured on chicken embryo chorioallantoic membranes. The measurements included cell morphology, mortality, viability, tumor morphology, histology, and gene expression. The cells and tumors were treated with reduced graphene oxide (rGO and rGO functionalized with arginine (rGO + Arg or proline (rGO + Pro. The results confirmed the anticancer effect of graphene on GBM cells and tumor tissue. After functionalization with amino acids, nanoparticles were distributed more specifically, and the flakes of graphene were less agglomerated. The molecule of rGO + Arg did not increase the expression of TP53 in comparison to rGO, but did not increase the expression of MDM2 or the MDM2/TP53 ratio in the tumor, suggesting that arginine may block MDM2 expression. The expression of NQO1, known to be a strong protector of p53 protein in tumor tissue, was greatly increased. The results indicate that the complex of rGO + Arg has potential in GBM therapy.
Sawosz, Ewa; Jaworski, Sławomir; Kutwin, Marta; Vadalasetty, Krishna Prasad; Grodzik, Marta; Wierzbicki, Mateusz; Kurantowicz, Natalia; Strojny, Barbara; Hotowy, Anna; Lipińska, Ludwika; Jagiełło, Joanna; Chwalibog, André
2015-01-01
Our previous studies revealed that graphene had anticancer properties in experiments in vitro with glioblastoma multiforme (GBM) cells and in tumors cultured in vivo. We hypothesized that the addition of arginine or proline to graphene solutions might counteract graphene agglomeration and increase the activity of graphene. Experiments were performed in vitro with GBM U87 cells and in vivo with GBM tumors cultured on chicken embryo chorioallantoic membranes. The measurements included cell morphology, mortality, viability, tumor morphology, histology, and gene expression. The cells and tumors were treated with reduced graphene oxide (rGO) and rGO functionalized with arginine (rGO + Arg) or proline (rGO + Pro). The results confirmed the anticancer effect of graphene on GBM cells and tumor tissue. After functionalization with amino acids, nanoparticles were distributed more specifically, and the flakes of graphene were less agglomerated. The molecule of rGO + Arg did not increase the expression of TP53 in comparison to rGO, but did not increase the expression of MDM2 or the MDM2/TP53 ratio in the tumor, suggesting that arginine may block MDM2 expression. The expression of NQO1, known to be a strong protector of p53 protein in tumor tissue, was greatly increased. The results indicate that the complex of rGO + Arg has potential in GBM therapy. PMID:26512645
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
Prediction of Microcystis Blooms Based on TN:TP Ratio and Lake Origin
Directory of Open Access Journals (Sweden)
Yoshimasa Amano
2008-01-01
Full Text Available We evaluated the relationship between TN:TP ratio and Microcystis growth via a database that includes worldwide lakes based on four types of lake origin (dammed, tectonic, coastal, and volcanic lakes. We used microcosm and mesocosm for the nutrient elution tests with lake water and four kinds of sediment (nontreated, MgO sprinkling treated, dissolved air flotation [DAF] treated, and combined treated sediment in order to control TN:TP ratio and to suppress Microcystis growth. Microcystis growth was related to TN:TP ratio, with the maximum value at an optimum TN:TP ratio and the minimum values when the TN:TP ratios reached to 0 or ∞. The kurtosis of the distribution curve varied with the type of lake origin; the lowest kurtosis was found in dammed lakes, while the highest was found in volcanic lakes. The lake trophic state could affect the change in the kurtosis, providing much lower kurtosis at eutrophic lakes (dammed lakes than that at oligotrophic lakes (volcanic lakes. The relationship between TN:TP ratio and Microcystis growth could be explained by the nutrient elution tests under controlled TN:TP ratios through the various sediment treatments. A significant suppression of Microcystis growth of 70% could be achieved when the TN:TP ratios exceeded 21. Lake origin could be regarded as an index including morphological and geographical factors, and controlling the trophic state in lakes. The origin rather than trophic state for lakes could be considered as an important factor of TN:TP influences on Microcystis growth.
Peng, Fan; Wang, Chao; Zhu, Jianshu; Zeng, Jian; Kang, Houyang; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Wang, Yi
2018-06-01
TpRNAMP5 is mainly expressed in the plasma membrane of roots and basal stems. It functions as a metal transporter for Cd, Mn and Co accumulation. Numerous natural resistance-associated macrophage proteins (NRAMPs) have been functionally identified in various plant species, including Arabidopsis, rice, soybean and tobacco, but no information is available on NRAMP genes in wheat. In this study, we isolated a TpNRAMP5 from dwarf Polish wheat (DPW, Triticum polonicum L.), a species with high tolerance to Cd and Zn. Expression pattern analysis revealed that TpNRAMP5 is mainly expressed in roots and basal stems of DPW. TpNRAMP5 was localized at the plasma membrane of Arabidopsis leaf protoplast. Expression of TpNRAMP5 in yeast significantly increased yeast sensitivity to Cd and Co, but not Zn, and enhanced Cd and Co concentrations. Expression of TpNRAMP5 in Arabidopsis significantly increased Cd, Co and Mn concentrations in roots, shoots and whole plants, but had no effect on Fe and Zn concentrations. These results indicate that TpNRAMP5 is a metal transporter enhancing the accumulation of Cd, Co and Mn, but not Zn and Fe. Genetic manipulation of TpNRAMP5 can be applied in the future to limit the transfer of Cd from soil to wheat grains, thereby protecting human health.
Clear Plaque Mutants of Lactococcal Phage TP901-1
DEFF Research Database (Denmark)
Kot, Witold; Kilstrup, Mogens; Vogensen, Finn K.
2016-01-01
We report a method for obtaining turbid plaques of the lactococcal bacteriophage TP901-1 and its derivative TP901-BC1034. We have further used the method to isolate clear plaque mutants of this phage. Analysis of 8 such mutants that were unable to lysogenize the host included whole genome...
Energy Technology Data Exchange (ETDEWEB)
Carvalho, Ana Terra Silva
2012-07-01
Background: In Brazil, cervical cancer is the second most common among women. Radiation therapy is part of its interdisciplinary management, playing an important role in their loco regional control. The major challenge of modern medicine in radiotherapy is to develop predictive methods that can determine the level of radiosensitivity of the patient and the healthy surrounding tissue in order to individualize the prescribed radiation dose, to prevent severe side effects and promoting better local tumor control. This study evaluated the acute and chronic adverse effects on the skin, lower gastrointestinal tract and urinary tract of radiotherapy in 47 cervical cancer patients. Methods and Materials: Biological material was collected and DNA from peripheral blood was extracted of ali patients studied. The fragments of TP53 and ATM were amplified to be sequenced, to verify if there are any polymorphisms witch could be responsible to the radiosensitivity of the patients. Results and Discussion: In a univariate analysis, the variable age was strongly associated with a risk of acute toxicity skin (p=O,023). Patients that received a high dose of external beam radiation and patients who have undergone brachytherapy, showed a significantly higher incidence of chronic urinary tract toxicity (p=O,031) and (p=O,019), respectively. The exchange G>A in the position 5557 of the A TM gene was significantly associated with the risk of acute lower gastrointestinal tract (p=O,008). There wasn't association between the other TP53 polymorphisms analyzed and the frequency of side effects (p>O,05). Our data revealed that patients who evolved significant association presented death (p=O,019) with the increase of chronic skin radiossensitivity. Conclusions: These observations corroborate the importance of investigating the genetic profile to predict adverse side effects in cervical cancer patients undergoing radiotherapy. These genes have an important role in DNA repair pathways and
Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer
International Nuclear Information System (INIS)
Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong
2009-01-01
Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Diagnostic value of recombinant Tp0821 protein in serodiagnosis for syphilis.
Xie, Y; Xu, M; Wang, C; Xiao, J; Xiao, Y; Jiang, C; You, X; Zhao, F; Zeng, T; Liu, S; Kuang, X; Wu, Y
2016-04-01
Syphilis is a multistage sexually transmitted disease that remains a serious public health concern worldwide. The coexistence of Treponema pallidum with other closely related members of spirochaeta, such as Leptospira spp. and Borrelia burgdorferi, has complicated the serodiagnosis due to cross-reactive antigens. In this study, recombinant Tp0821 protein was expressed in Escherichia coli and purified by metal affinity chromatography. Then enzyme-linked immunosorbent assays (ELISAs) based on Tp0821 for the detection of specific antibodies were established. The relative positive rates of the IgM ELISA and the IgG ELISA were found to be 91·0 and 98·3%, respectively, when screening 578 syphilis specimens. The specificities were 94·3 and 100%, respectively, when cross-checking with serum samples obtained from 30 patients with Lyme disease, five patients with leptospirosis, and 52 uninfected controls. In addition, relative positive rates and specificities of Tp0821 for human sera were all 100% in Western blotting. When compared to the syphilis diagnostic tests commonly used in clinical settings, we found that the results of Tp0821-based ELISAs correlated well with the results of the treponemal tests, specifically the T. pallidum particle agglutination (TP-PA) test and the chemiluminescent immunoassay (CIA). Thus, these findings identify Tp0821 as a novel serodiagnostic candidate for syphilis. In this study, we expressed and purified the Treponema pallidum protein Tp0821 and developed Tp0821-based enzyme-linked immunosorbent assays (ELISAs) for the detection of specific antibodies. The serodiagnostic performance of the recombinant protein was then evaluated. When compared to the results of syphilis diagnostic tests commonly used in clinical settings, we found that the reactivities of syphilitic sera with the recombinant antigen correlated well with the results of the treponemal tests, specifically the T. pallidum particle agglutination (TP-PA) test and the
Directory of Open Access Journals (Sweden)
Ruth Villalonga-Planells
2011-04-01
Full Text Available Glioblastoma multiforme (GBM is the most common and aggressive primary brain tumor in adults. Despite concerted efforts to improve current therapies and develop novel clinical approaches, patient survival remains poor. As such, increasing attention has focused on developing new therapeutic strategies that specifically target the apoptotic pathway in order to improve treatment responses. Recently, nutlins, small-molecule antagonists of MDM2, have been developed to inhibit p53-MDM2 interaction and activate p53 signaling in cancer cells. Glioma cell lines and primary cultured glioblastoma cells were treated with nutlin-3a. Nutlin-3a induced p53-dependent G1- and G2-M cell cycle arrest and apoptosis in glioma cell lines with normal TP53 status. In addition, nutlin-arrested glioma cells show morphological features of senescence and persistent induction of p21 protein. Furthermore, senescence induced by nutlin-3a might be depending on mTOR pathway activity. In wild-type TP53 primary cultured cells, exposure to nutlin-3a resulted in variable degrees of apoptosis as well as cellular features of senescence. Nutlin-3a-induced apoptosis and senescence were firmly dependent on the presence of functional p53, as revealed by the fact that glioblastoma cells with knockdown p53 with specific siRNA, or cells with mutated or functionally impaired p53 pathway, were completely insensitive to the drug. Finally, we also found that nutlin-3a increased response of glioma cells to radiation therapy. The results provide a basis for the rational use of MDM2 antagonists as a novel treatment option for glioblastoma patients.
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Directory of Open Access Journals (Sweden)
David Lindgren
Full Text Available Similar to other malignancies, urothelial carcinoma (UC is characterized by specific recurrent chromosomal aberrations and gene mutations. However, the interconnection between specific genomic alterations, and how patterns of chromosomal alterations adhere to different molecular subgroups of UC, is less clear. We applied tiling resolution array CGH to 146 cases of UC and identified a number of regions harboring recurrent focal genomic amplifications and deletions. Several potential oncogenes were included in the amplified regions, including known oncogenes like E2F3, CCND1, and CCNE1, as well as new candidate genes, such as SETDB1 (1q21, and BCL2L1 (20q11. We next combined genome profiling with global gene expression, gene mutation, and protein expression data and identified two major genomic circuits operating in urothelial carcinoma. The first circuit was characterized by FGFR3 alterations, overexpression of CCND1, and 9q and CDKN2A deletions. The second circuit was defined by E3F3 amplifications and RB1 deletions, as well as gains of 5p, deletions at PTEN and 2q36, 16q, 20q, and elevated CDKN2A levels. TP53/MDM2 alterations were common for advanced tumors within the two circuits. Our data also suggest a possible RAS/RAF circuit. The tumors with worst prognosis showed a gene expression profile that indicated a keratinized phenotype. Taken together, our integrative approach revealed at least two separate networks of genomic alterations linked to the molecular diversity seen in UC, and that these circuits may reflect distinct pathways of tumor development.
International Nuclear Information System (INIS)
Geng, L.; Walter, S; Vaughan, A.T.M.
1997-01-01
Purpose: Despite attempts with a variety of therapeutic approaches there has been little impact on the survival of patients with Glioblastoma multiforme, with median survivals reported of approximately 12 months. In this study a replication restricted adenovirus vector is used to transfer the wild type p53 gene into two cell lines derived from a human astrocytoma U87MG or glioblastoma T98G, to determine its ability to act as a radiosensitizer in conjunction with conventional radiotherapy. Methods: An adenovirus vector containing the human wild type p53 (Advp53) gene was used in addition to a control vector containing the β-galactosidase (Advγgal) reporter gene. To achieve cellular incorporation both vectors were incubated with cells for 30 minutes - washed and returned to culture. The successful incorporation of each vector was determined by either a p53 assay using either a western blotting or flow cytometry techniques, or specific staining for β-galactosidase activity. The presence of each vector was assayed until the constructs were eliminated from the cell. To determine the effects of these vectors on cell survival sufficient vector was added to produce a measurable reduction in clonogenic survival and this value was used in subsequent irradiation experiments. To determine the ability of wild type p53 to induce apoptosis the cells were examined from 1 to 5 days after irradiation by H and E staining for the characteristic morphology indicating an apoptotic process. Results: Both the Advp53 and Advβgal vectors were successfully incorporated into each cell line. Expression of each gene was reduced to approximately half by 5 days and virtually eliminated by 15 days after transfection in both lines. At the doses used the wild type Advp53 adenovirus was toxic to both cell lines giving surviving fractions between 39-74%. When this toxicity was taken into account the presence of the Advp53 gene had a radiosensitizing effect in each cell line. To determine the
International Nuclear Information System (INIS)
Carvalho, Ana Terra Silva
2012-01-01
Background: In Brazil, cervical cancer is the second most common among women. Radiation therapy is part of its interdisciplinary management, playing an important role in their loco regional control. The major challenge of modern medicine in radiotherapy is to develop predictive methods that can determine the level of radiosensitivity of the patient and the healthy surrounding tissue in order to individualize the prescribed radiation dose, to prevent severe side effects and promoting better local tumor control. This study evaluated the acute and chronic adverse effects on the skin, lower gastrointestinal tract and urinary tract of radiotherapy in 47 cervical cancer patients. Methods and Materials: Biological material was collected and DNA from peripheral blood was extracted of ali patients studied. The fragments of TP53 and ATM were amplified to be sequenced, to verify if there are any polymorphisms witch could be responsible to the radiosensitivity of the patients. Results and Discussion: In a univariate analysis, the variable age was strongly associated with a risk of acute toxicity skin (p=O,023). Patients that received a high dose of external beam radiation and patients who have undergone brachytherapy, showed a significantly higher incidence of chronic urinary tract toxicity (p=O,031) and (p=O,019), respectively. The exchange G>A in the position 5557 of the A TM gene was significantly associated with the risk of acute lower gastrointestinal tract (p=O,008). There wasn't association between the other TP53 polymorphisms analyzed and the frequency of side effects (p>O,05). Our data revealed that patients who evolved significant association presented death (p=O,019) with the increase of chronic skin radiossensitivity. Conclusions: These observations corroborate the importance of investigating the genetic profile to predict adverse side effects in cervical cancer patients undergoing radiotherapy. These genes have an important role in DNA repair pathways and probably
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
Protein - TP Atlas | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...p_atlas_protein.zip File URL: ftp://ftp.biosciencedbc.jp/archive/tp_atlas/LATEST/...story of This Database Site Policy | Contact Us Protein - TP Atlas | LSDB Archive ...
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Liu, Xiaoming; Yang, Jiasheng; Zhang, Yi; Fang, Yun; Wang, Fayou; Wang, Jun; Zheng, Xiaoqi; Yang, Jialiang
2016-03-01
We have studied drug-response associated (DRA) gene expressions by applying a systems biology framework to the Cancer Cell Line Encyclopedia data. More than 4,000 genes are inferred to be DRA for at least one drug, while the number of DRA genes for each drug varies dramatically from almost 0 to 1,226. Functional enrichment analysis shows that the DRA genes are significantly enriched in genes associated with cell cycle and plasma membrane. Moreover, there might be two patterns of DRA genes between genders. There are significantly shared DRA genes between male and female for most drugs, while very little DRA genes tend to be shared between the two genders for a few drugs targeting sex-specific cancers (e.g., PD-0332991 for breast cancer and ovarian cancer). Our analyses also show substantial difference for DRA genes between young and old samples, suggesting the necessity of considering the age effects for personalized medicine in cancers. Lastly, differential module and key driver analyses confirm cell cycle related modules as top differential ones for drug sensitivity. The analyses also reveal the role of TSPO, TP53, and many other immune or cell cycle related genes as important key drivers for DRA network modules. These key drivers provide new drug targets to improve the sensitivity of cancer therapy.
Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe
2017-01-01
The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Clonal expansion to anaplasia in Wilms` tumors is associated with p53 mutations
Energy Technology Data Exchange (ETDEWEB)
Pelletier, J.; Beckwith, B.; Bardeesy, N. [Loma Linda Univ., CA (United States)]|[McGill Univ., Montreal (Canada)
1994-09-01
The genetics of Wilms` tumor (WT), a pediatric malignancy of the kidney, is complex. Three loci are implicated in WT initiation and include the WT1 tumor suppressor gene (residing at 11p13), an 11p15 locus, and a non-11p locus. As well, allelic loss at 16q24 in {approximately}20% of sporadic WTs suggests the location of (an) additional gene(s) involved in tumor progression. Initiation and progression in WTs is associated with multiple histological variants. Anaplasia is a rare WT subtype associated with poor prognosis and defined by enlarged and multipolar mitotic figures, a threefold nuclear enlargement (compared with adjacent nuclei of the same cell type), and hyperchromasia of the enlarged nuclei. We have previously demonstrated that p53 gene mutations are exclusively associated with anaplastic WTs, being absent from a large number of non-anaplastic WTs analyzed. To determine if such mutations are involved in clonal progression to anaplasia, we performed a retrospective analysis of histologically defined sections from tumor specimens. Six of ten WTs demonstrated p53 mutations by PCR-single stranded conformational polymorphism analysis. Two of these samples were paired, consisting of geographically demarcated anaplastic cells embedded within a non-anaplastic tumor bed. In these cases, p53 mutations were only present in the anaplastic region of the tumor. An overall decrease in the number of apoptotic cells was found associated with the anaplastic tumor region, compared to adjacent non-anaplastic tumor bed. These results indicate that p53 mutations arise during progression to anaplasia late in Wilms` tumor etiology and are associated with a more aggressive form of this cancer.
THE EXON 5, 6, 7, 8 OF P53 MUTATIONS IN ORAL SQUAMOUS CELLS CARCINOMA
Directory of Open Access Journals (Sweden)
Retno P Rahayu
2012-04-01
Full Text Available Genetic instability may underlie the etiology of multistep carcinogenesis. The altered p53 gene observed in tumors may represent the expression of such instability and may allow the accumulation of other gene alterations caused by multiple mechanism. p53 gene is the guardian of the genome, that is why we pay more attention to this gene. In this study, we evaluated the significance of p53 mutation in 55 patient with oral squamous carcinoma. Thirty among them underwent well-differentiated carcinoma, while the remaining 25 patients underwent poorly differentiated carcinoma. The mutations were detected by PCR-SSCP (Single strand Conformational Polymorphism analysis in the region between exon 5 and exon 8. The results indicated that the p53 mutation in exon 5 (40%, exon 6 (28%, exon 7 (24% and exon 8 (8% were associated with poorly differentiated carcinoma, whereas mutation in exon 5 (10%, exon 6 (30%, exon 7 (40% and exon 8 (20% were associated with well-differentiated carcinoma. These observations suggest that p53 mutation in exon 5, 6, and 7 have strong correlation with poorly differentiated in oral squamous carcinoma while well-differentiated level was related with mutation in exon 6,7 and 8.
Screening for common copy-number variants in cancer genes.
Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L
2010-12-01
For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ali A. Alshatwi
2012-01-01
Full Text Available With the increased use of plant-based cancer chemotherapy, exploring the antiproliferative effects of phytochemicals for anticancer drug design has gained considerable attention worldwide. This study was undertaken to investigate the effect of walnut green husk extracts on cell proliferation and to determine the possible molecular mechanism of extract-induced cell death by quantifying the expression of Bcl-2, Bax, caspases-3, and Tp53. PC-3 human prostate cancer cells. In this study, we found that green husk extracts suppressed proliferation and induced apoptosis in a dose- and time-dependent manner by modulating expression of apoptosis-related genes. This involved DNA fragmentation (determined by TUNEL assay and significant changes in levels of mRNA and the expression of corresponding proteins. An increase in expressions of Bax, caspase-3, and tp53 genes and their corresponding proteins was detected using real-time PCR and western blot analysis in PC-3 cells treated with the green husk organic extracts. In contrast, Bcl2 expression was downregulated after exposure to the extracts. Our data suggest the presence of bioactive compound(s in walnut green husks that are capable of killing prostate carcinoma cells by inducing apoptosis and that the husks are a candidate source of anticancer drugs.
Taguchi, Y-H
2017-12-21
Although post-traumatic stress disorder (PTSD) is primarily a mental disorder, it can cause additional symptoms that do not seem to be directly related to the central nervous system, which PTSD is assumed to directly affect. PTSD-mediated heart diseases are some of such secondary disorders. In spite of the significant correlations between PTSD and heart diseases, spatial separation between the heart and brain (where PTSD is primarily active) prevents researchers from elucidating the mechanisms that bridge the two disorders. Our purpose was to identify genes linking PTSD and heart diseases. In this study, gene expression profiles of various murine tissues observed under various types of stress or without stress were analyzed in an integrated manner using tensor decomposition (TD). Based upon the obtained features, ∼ 400 genes were identified as candidate genes that may mediate heart diseases associated with PTSD. Various gene enrichment analyses supported biological reliability of the identified genes. Ten genes encoding protein-, DNA-, or mRNA-interacting proteins-ILF2, ILF3, ESR1, ESR2, RAD21, HTT, ATF2, NR3C1, TP53, and TP63-were found to be likely to regulate expression of most of these ∼ 400 genes and therefore are candidate primary genes that cause PTSD-mediated heart diseases. Approximately 400 genes in the heart were also found to be strongly affected by various drugs whose known adverse effects are related to heart diseases and/or fear memory conditioning; these data support the reliability of our findings. TD-based unsupervised feature extraction turned out to be a useful method for gene selection and successfully identified possible genes causing PTSD-mediated heart diseases.
Population-based statistical inference for temporal sequence of somatic mutations in cancer genomes.
Rhee, Je-Keun; Kim, Tae-Min
2018-04-20
It is well recognized that accumulation of somatic mutations in cancer genomes plays a role in carcinogenesis; however, the temporal sequence and evolutionary relationship of somatic mutations remain largely unknown. In this study, we built a population-based statistical framework to infer the temporal sequence of acquisition of somatic mutations. Using the model, we analyzed the mutation profiles of 1954 tumor specimens across eight tumor types. As a result, we identified tumor type-specific directed networks composed of 2-15 cancer-related genes (nodes) and their mutational orders (edges). The most common ancestors identified in pairwise comparison of somatic mutations were TP53 mutations in breast, head/neck, and lung cancers. The known relationship of KRAS to TP53 mutations in colorectal cancers was identified, as well as potential ancestors of TP53 mutation such as NOTCH1, EGFR, and PTEN mutations in head/neck, lung and endometrial cancers, respectively. We also identified apoptosis-related genes enriched with ancestor mutations in lung cancers and a relationship between APC hotspot mutations and TP53 mutations in colorectal cancers. While evolutionary analysis of cancers has focused on clonal versus subclonal mutations identified in individual genomes, our analysis aims to further discriminate ancestor versus descendant mutations in population-scale mutation profiles that may help select cancer drivers with clinical relevance.
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
LPL gene expression is associated with poor prognosis in CLL and closely related to NOTCH1 mutations
DEFF Research Database (Denmark)
Kristensen, Louise; Kielsgaard Kristensen, Thomas; Abildgaard, Niels
2016-01-01
these markers. AIM: To evaluate LPL gene expression together with the well-established prognostic markers of CLL and investigate correlations with more recently identified prognostic markers, NOTCH1 and TP53 mutations. METHODS: On 149 patients LPL gene expression was analyzed by real-time RT-PCR. Exon 34...... of NOTCH1 was PCR amplified and directly sequenced. RESULTS: LPL gene expression could be measured as a categorical variable (LPL+/LPL-) and was associated with time to treatment (p... and new prognostic markers, 3 out of 4 patients, who received treatment within 24 months after diagnosis, were LPL+ (p=0.03). There was a strong correlation between NOTCH1 mutation and LPL+ (p=0.005). The unfavorable prognosis of LPL+ was maintained in CLL with wild-type NOTCH1. CONCLUSIONS: NOTCH1...
MicroRNA-34a: A Key Regulator in the Hallmarks of Renal Cell Carcinoma
Hussein, Mohammad H.; Al-Qahtani, Saeed Awad M.; Shaalan, Aly A. M.
2017-01-01
Renal cell carcinoma (RCC) incidence has increased over the past two decades. Recent studies reported microRNAs as promising biomarkers for early cancer detection, accurate prognosis, and molecular targets for future treatment. This study aimed to evaluate the expression levels of miR-34a and 11 of its bioinformatically selected target genes and proteins to test their potential dysregulation in RCC. Quantitative real-time PCR for miR-34a and its targets; MET oncogene; gene-regulating apoptosis (TP53INP2 and DFFA); cell proliferation (E2F3); and cell differentiation (SOX2 and TGFB3) as well as immunohistochemical assay for VEGFA, TP53, Bcl2, TGFB1, and Ki67 protein expression have been performed in 85 FFPE RCC tumor specimens. Clinicopathological parameter correlation and in silico network analysis have also implicated. We found RCC tissues displayed significantly higher miR-34a expression level than their corresponding noncancerous tissues, particularly in chromophobic subtype. MET and E2F3 were significantly upregulated, while TP53INP2 and SOX2 were downregulated. ROC analysis showed high diagnostic performance of miR-34a (AUC = 0.854), MET (AUC = 0.765), and E2F3 (AUC = 0.761). The advanced pathological grade was associated with strong TGFB1, VEGFA, and Ki67 protein expression and absent Tp53 staining. These findings indicate miR-34a along with its putative target genes could play a role in RCC tumorigenesis and progression. PMID:29104726
MicroRNA-34a: A Key Regulator in the Hallmarks of Renal Cell Carcinoma
Directory of Open Access Journals (Sweden)
Eman A. Toraih
2017-01-01
Full Text Available Renal cell carcinoma (RCC incidence has increased over the past two decades. Recent studies reported microRNAs as promising biomarkers for early cancer detection, accurate prognosis, and molecular targets for future treatment. This study aimed to evaluate the expression levels of miR-34a and 11 of its bioinformatically selected target genes and proteins to test their potential dysregulation in RCC. Quantitative real-time PCR for miR-34a and its targets; MET oncogene; gene-regulating apoptosis (TP53INP2 and DFFA; cell proliferation (E2F3; and cell differentiation (SOX2 and TGFB3 as well as immunohistochemical assay for VEGFA, TP53, Bcl2, TGFB1, and Ki67 protein expression have been performed in 85 FFPE RCC tumor specimens. Clinicopathological parameter correlation and in silico network analysis have also implicated. We found RCC tissues displayed significantly higher miR-34a expression level than their corresponding noncancerous tissues, particularly in chromophobic subtype. MET and E2F3 were significantly upregulated, while TP53INP2 and SOX2 were downregulated. ROC analysis showed high diagnostic performance of miR-34a (AUC = 0.854, MET (AUC = 0.765, and E2F3 (AUC = 0.761. The advanced pathological grade was associated with strong TGFB1, VEGFA, and Ki67 protein expression and absent Tp53 staining. These findings indicate miR-34a along with its putative target genes could play a role in RCC tumorigenesis and progression.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
The prognosis of MYC translocation positive diffuse large B-cell lymphoma depends on the second hit.
Clipson, Alexandra; Barrans, Sharon; Zeng, Naiyan; Crouch, Simon; Grigoropoulos, Nicholas F; Liu, Hongxiang; Kocialkowski, Sylvia; Wang, Ming; Huang, Yuanxue; Worrillow, Lisa; Goodlad, John; Buxton, Jenny; Neat, Michael; Fields, Paul; Wilkins, Bridget; Grant, John W; Wright, Penny; Ei-Daly, Hesham; Follows, George A; Roman, Eve; Watkins, A James; Johnson, Peter W M; Jack, Andrew; Du, Ming-Qing
2015-07-01
A proportion of MYC translocation positive diffuse large B-cell lymphomas (DLBCL) harbour a BCL2 and/or BCL6 translocation, known as double-hit DLBCL, and are clinically aggressive. It is unknown whether there are other genetic abnormalities that cooperate with MYC translocation and form double-hit DLBCL, and whether there is a difference in clinical outcome between the double-hit DLBCL and those with an isolated MYC translocation. We investigated TP53 gene mutations along with BCL2 and BCL6 translocations in a total of 234 cases of DLBCL, including 81 with MYC translocation. TP53 mutations were investigated by PCR and sequencing, while BCL2 and BCL6 translocation was studied by interphase fluorescence in situ hybridization. The majority of MYC translocation positive DLBCLs (60/81 = 74%) had at least one additional genetic hit. In MYC translocation positive DLBCL treated by R-CHOP ( n = 67), TP53 mutation and BCL2, but not BCL6 translocation had an adverse effect on patient overall survival. In comparison with DLBCL with an isolated MYC translocation, cases with MYC/TP53 double-hits had the worst overall survival, followed by those with MYC/BCL2 double-hits. In MYC translocation negative DLBCL treated by R-CHOP ( n = 101), TP53 mutation, BCL2 and BCL6 translocation had no impact on patient survival. The prognosis of MYC translocation positive DLBCL critically depends on the second hit, with TP53 mutations and BCL2 translocation contributing to an adverse prognosis. It is pivotal to investigate both TP53 mutations and BCL2 translocations in MYC translocation positive DLBCL, and to distinguish double-hit DLBCLs from those with an isolated MYC translocation.
Analisis Jaringan VPN Menggunakan PPTP dan L2TP
Directory of Open Access Journals (Sweden)
Syariful Ikhwan
2017-08-01
Full Text Available VPN adalah teknologi yang membuat jaringan private (pribadi dengan menggunakan jaringan publik agar proses pertukaran data menjadi aman. Teknologi VPN biasanya diterapkan untuk koneksi antara kantor pusat dan kantor cabang. Dinhubkominfo Kabupaten Banyumas sebagai tempat penelitian memiliki beberapa kantor cabang (SKPD. Data yang dipertukarkan antar kantor cabang pada Dinhubkominfo terdiri dari beberapa jenis, namun pada penelitian ini hanya difokuskan pada pertukaran layanan FTP. Teknologi vpn yang saat ini digunakan pada jaringan Dinhubkominfo adalah PPTP. Akan tetapi, penggunaan teknologi tersebut belum tersebut masih belum diketahui tingkat performansi jaringan dibandingkan dengan penggunaan teknologi vpn yang lain. Pada penelitian ini akan dibandingkan penggunaan dua teknologi vpn yang berbeda yaitu antara PPTP dan L2TP, dimana parameter yang digunakan adalah throughput, delay, jitter, dan packet loss. Proses pengambilan data dilakukan dengan menambahkan beban trafik sebesar 512 kbps, 1024 kbps, dan 2048 kbps. Dari hasil penelitian diperoleh data bahwa, rata-rata nilai Delay pada L2TP lebih besar hingga 41% dibanding saat menggunakan PPTP, rata-rata Throughput PPTP naik hingga 34% dibandingkan L2TP, Rata-rata Jitter pada PPTP lebih besar hingga 44% dibandingkan L2TP, sedangkan packet loss yang terjadi pada masing-masing layanan vpn adalah 0
Directory of Open Access Journals (Sweden)
İbrahim Kulaç
2017-03-01
Full Text Available Objective: Chronic lymphocytic leukemia (CLL is the most common lymphoproliferative disease in adults. The aim of this study is to find out if the extent of proliferation centers or the immunohistochemical expression of p53 is related to disease prognosis. Materials and Methods: In the scope of this study, 54 biopsy specimens from 51 patients (50 of lymph nodes; the others of spleen, tonsil, orbit, and liver diagnosed with CLL at the Hacettepe University Department of Pathology in 2000-2013 were reevaluated. The clinical and demographic data of the patients were obtained from our patient database. Biopsy samples were assessed semi-quantitatively for the percentage of proliferation center/total biopsy area (PC/TBA and an immunohistochemical study was performed on representative blocks of tissues for p53 expression. Results: When the patients were divided into two categories according to Rai stage as high and low (stages 0, 1, and 2 vs. stages 3 and 4, it was seen that patients with low Rai stage had a better prognosis than those with high stages (p=0.030. However, there was no statistically significant correlation between overall survival and PC/TBA ratio or p53 expression levels. Conclusion: In our cohort, PC/TBA ratio and immunopositivity of p53 did not show correlations with overall survival.
Genomic instability--an evolving hallmark of cancer.
Negrini, Simona; Gorgoulis, Vassilis G; Halazonetis, Thanos D
2010-03-01
Genomic instability is a characteristic of most cancers. In hereditary cancers, genomic instability results from mutations in DNA repair genes and drives cancer development, as predicted by the mutator hypothesis. In sporadic (non-hereditary) cancers the molecular basis of genomic instability remains unclear, but recent high-throughput sequencing studies suggest that mutations in DNA repair genes are infrequent before therapy, arguing against the mutator hypothesis for these cancers. Instead, the mutation patterns of the tumour suppressor TP53 (which encodes p53), ataxia telangiectasia mutated (ATM) and cyclin-dependent kinase inhibitor 2A (CDKN2A; which encodes p16INK4A and p14ARF) support the oncogene-induced DNA replication stress model, which attributes genomic instability and TP53 and ATM mutations to oncogene-induced DNA damage.
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
Mulvaney, Eamon P; Shilling, Christine; Eivers, Sarah B; Perry, Antoinette S; Bjartell, Anders; Kay, Elaine W; Watson, R William; Kinsella, B Therese
2016-11-08
The prostanoid thromboxane (TX)A2 plays a central role in haemostasis and is increasingly implicated in cancer progression. TXA2 signals through two T Prostanoid receptor (TP) isoforms termed TPα and TPβ, with both encoded by the TBXA2R gene. Despite exhibiting several functional and regulatory differences, the role of the individual TP isoforms in neoplastic diseases is largely unknown.This study evaluated expression of the TPα and TPβ isoforms in tumour microarrays of the benign prostate and different pathological (Gleason) grades of prostate cancer (PCa). Expression of TPβ was significantly increased in PCa relative to benign tissue and strongly correlated with increasing Gleason grade. Furthermore, higher TPβ expression was associated with increased risk of biochemical recurrence (BCR) and significantly shorter disease-free survival time in patients post-surgery. While TPα was more variably expressed than TPβ in PCa, increased/high TPα expression within the tumour also trended toward increased BCR and shorter disease-free survival time. Comparative genomic CpG DNA methylation analysis revealed substantial differences in the extent of methylation of the promoter regions of the TBXA2R that specifically regulate expression of TPα and TPβ, respectively, both in benign prostate and in clinically-derived tissue representative of precursor lesions and progressive stages of PCa. Collectively, TPα and TPβ expression is differentially regulated both in the benign and tumourigenic prostate, and coincides with clinical pathology and altered CpG methylation of the TBXA2R gene. Analysis of TPβ, or a combination of TPα/TPβ, expression levels may have significant clinical potential as a diagnostic biomarker and predictor of PCa disease recurrence.
DEFF Research Database (Denmark)
Wikman, Friedrik; Lu, Ming-Lan; Andersen, Thomas Thykjær
2000-01-01
sensitivity, from 0.92 to 0.84, leading to a much better concordance (92%) with results obtained by traditional sequencing. The chip method detected as little as 1% mutated DNA. Conclusions: Microarray-based sequencing is a novel option to assess TP53 mutations, representing a fast and inexpensive method...
Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M
2004-11-01
Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.
Recurrent Somatic Structural Variations Contribute to Tumorigenesis in Pediatric Osteosarcoma
Directory of Open Access Journals (Sweden)
Xiang Chen
2014-04-01
Full Text Available Pediatric osteosarcoma is characterized by multiple somatic chromosomal lesions, including structural variations (SVs and copy number alterations (CNAs. To define the landscape of somatic mutations in pediatric osteosarcoma, we performed whole-genome sequencing of DNA from 20 osteosarcoma tumor samples and matched normal tissue in a discovery cohort, as well as 14 samples in a validation cohort. Single-nucleotide variations (SNVs exhibited a pattern of localized hypermutation called kataegis in 50% of the tumors. We identified p53 pathway lesions in all tumors in the discovery cohort, nine of which were translocations in the first intron of the TP53 gene. Beyond TP53, the RB1, ATRX, and DLG2 genes showed recurrent somatic alterations in 29%–53% of the tumors. These data highlight the power of whole-genome sequencing for identifying recurrent somatic alterations in cancer genomes that may be missed using other methods.
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
TP508 accelerates fracture repair by promoting cell growth over cell death
International Nuclear Information System (INIS)
Li Xinmin; Wang Hali; Touma, Edward; Qi Yuchen; Rousseau, Emma; Quigg, Richard J.; Ryaby, James T.
2007-01-01
TP508 is a synthetic 23-amino acid peptide representing a receptor-binding domain of human thrombin. We have previously shown that a single injection of TP508 accelerates fracture healing in a rat femoral fracture model. To understand how TP508 acts at the protein level during fracture healing, we compared the translational profiles between saline-control and fractured femur at six time points after TP508 treatment using the second generation of BD Clontech TM Antibody Microarray. Here, we demonstrate that TP508 accelerates fracture healing by modulating expression levels of proteins primarily involved in the functional categories of cell cycle, cellular growth and proliferation, and cell death. The majority of those proteins are physically interrelated and functionally overlapped. The action of those proteins is highlighted by a central theme of promoting cell growth via balance of cell survival over cell death signals. This appears to occur through the stimulation of several bone healing pathways including cell cycle-G1/S checkpoint regulation, apoptosis, JAK/STAT, NF-κB, PDGF, PI3K/AKT, PTEN, and ERK/MAPK
Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J
2014-01-01
The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331
A Physical Mechanism and Global Quantification of Breast Cancer.
Directory of Open Access Journals (Sweden)
Chong Yu
Full Text Available Initiation and progression of cancer depend on many factors. Those on the genetic level are often considered crucial. To gain insight into the physical mechanisms of breast cancer, we construct a gene regulatory network (GRN which reflects both genetic and environmental aspects of breast cancer. The construction of the GRN is based on available experimental data. Three basins of attraction, representing the normal, premalignant and cancer states respectively, were found on the phenotypic landscape. The progression of breast cancer can be seen as switching transitions between different state basins. We quantified the stabilities and kinetic paths of the three state basins to uncover the biological process of breast cancer formation. The gene expression levels at each state were obtained, which can be tested directly in experiments. Furthermore, by performing global sensitivity analysis on the landscape topography, six key genes (HER2, MDM2, TP53, BRCA1, ATM, CDK2 and four regulations (HER2⊣TP53, CDK2⊣BRCA1, ATM→MDM2, TP53→ATM were identified as being critical for breast cancer. Interestingly, HER2 and MDM2 are the most popular targets for treating breast cancer. BRCA1 and TP53 are the most important oncogene of breast cancer and tumor suppressor gene, respectively. This further validates the feasibility of our model and the reliability of our prediction results. The regulation ATM→MDM2 has been extensive studied on DNA damage but not on breast cancer. We notice the importance of ATM→MDM2 on breast cancer. Previous studies of breast cancer have often focused on individual genes and the anti-cancer drugs are mainly used to target the individual genes. Our results show that the network-based strategy is more effective on treating breast cancer. The landscape approach serves as a new strategy for analyzing breast cancer on both the genetic and epigenetic levels and can help on designing network based medicine for breast cancer.
Gene alterations in radiation-induced F344 rat lung tumors
International Nuclear Information System (INIS)
Kelly, G.; Hahn, F.F.
1994-01-01
The p53 tumor suppressor gene is frequently altered in all major histopathologic types of human lung tumors. Reported p53 mutations include base substitutions, allelic loss, rearrangements, and deletions. Point mutations resulting in base substitutions are clustered within a highly conserved region of the gene encoding exons 508, and mutations in this region substantially extend the half-life of the p53 protein. In addition to its prominent importance in lung carcinogenesis, the p53 gene plays a critical role in the cellular response to genetic damage caused by radiation. Specifically, the protein product of p53 induces a pause or block at the G 1 to S boundary of the cell cycle following radiation-caused DNA damage. This G 1 block may allow the cell time to repair the damaged DNA prior to replication. Cells lacking a functional p53 protein fail to pause for repair and consequently accumulate mutations in the genome at an accelerated rate. p53 has also been implicated as a controlling factor in apoptosis or in programmed cell death induced by DNA-damaging agents, such as ionizing radiation. The p53 gene is mutated in approximately 50% of squamous cell carcinomas from uranium miners who inhaled high doses of radon daughters. The purpose of the present study was to determine if a similar percentage of squamous cell carcinomas with p53 mutations developed in the lungs of rats exposed to aerosols of 239 PuO 2
Directory of Open Access Journals (Sweden)
Lech Chyczewski
2008-02-01
Full Text Available Lung cancer is the leading cause of death worldwide. High mortality comes out mainly of the fact that majority of the cases are diagnosed in advanced stadium. An expanded diagnostics of precancerous conditions would certainly contribute to lowering the mortality rate. Many of the molecular changes accompanying the multistep cancer development could be observed using the immunohistochemistry method. In this paper we describe the morphology and cell cycle proteins immunoexpression of the novel probable preinvasive lesion - bronchiolar columnar cell dysplasia (BCCD. Thirty cases of BCCD selected out of 193 patients population, treated for primary non-small cell lung cancer were investigated. Loss of P16INK4a protein was observed in 70% of all cases and was statistically significant in patients with adenocarcinoma. Two cases show abnormal cytoplasmic localization of this protein. TP53 protein accumulates in 26.7% of all BCCD. Rb protein was active in 48.3% of the BCCD cases. In two cases we observed differentiation of the cells composing BCCD into multilayer epithelium of the squamous type, which occurs with formation of desmosomes. We suppose that BCCD may be preneoplastic lesion leading to adenocarcinoma as well as to peripheral squamous cell lung cancer.
MicroRNA‑663b mediates TAM resistance in breast cancer by modulating TP73 expression.
Jiang, Hua; Cheng, Lin; Hu, Pan; Liu, Renbin
2018-05-23
Breast cancer is the second leading cause of cancer‑associated mortalities in women. Tamoxifen (TAM) is an endocrine therapy commonly used in the treatment of patients with breast cancer expressing estrogen receptor α. However, treatment often ends in failure due to the emergence of drug resistance. MicroRNAs (miRNAs), a family of small non‑coding RNAs, serve critical roles in the regulation of gene expression and cell events. To date, whether miRNA‑663b could mediate TAM resistance in breast cancer remains unknown. Therefore, the aim of the present study was to investigate the role of miRNA‑663b in TAM resistance in breast cancer. The results demonstrated that miRNA‑663b was upregulated in breast cancer with TAM resistance. Tumor protein 73 (TP73) was a direct target of miRNA‑663b, and was negatively regulated by miRNA‑663b in MCF‑7 cells. Furthermore, it was identified that downregulation of miRNA‑663b inhibited cell proliferation ability and promoted cell apoptosis, resulting in enhanced TAM sensitivity. In addition, these findings suggested that TP73 silencing may have eliminated the effects of miRNA‑663b inhibitor on breast cancer cells. In conclusion, the present study verified a novel molecular link between miRNA‑663b and TP73, and indicated that miRNA‑663b may be a critical therapeutic target in breast cancer.
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Goh, Gerald; Walradt, Trent; Markarov, Vladimir; Blom, Astrid; Riaz, Nadeem; Doumani, Ryan; Stafstrom, Krista; Moshiri, Ata; Yelistratova, Lola; Levinsohn, Jonathan; Chan, Timothy A; Nghiem, Paul; Lifton, Richard P; Choi, Jaehyuk
2016-01-19
Merkel cell carcinoma (MCC) is a rare but highly aggressive cutaneous neuroendocrine carcinoma, associated with the Merkel cell polyomavirus (MCPyV) in 80% of cases. To define the genetic basis of MCCs, we performed exome sequencing of 49 MCCs. We show that MCPyV-negative MCCs have a high mutation burden (median of 1121 somatic single nucleotide variants (SSNVs) per-exome with frequent mutations in RB1 and TP53 and additional damaging mutations in genes in the chromatin modification (ASXL1, MLL2, and MLL3), JNK (MAP3K1 and TRAF7), and DNA-damage pathways (ATM, MSH2, and BRCA1). In contrast, MCPyV-positive MCCs harbor few SSNVs (median of 12.5 SSNVs/tumor) with none in the genes listed above. In both subgroups, there are rare cancer-promoting mutations predicted to activate the PI3K pathway (HRAS, KRAS, PIK3CA, PTEN, and TSC1) and to inactivate the Notch pathway (Notch1 and Notch2). TP53 mutations appear to be clinically relevant in virus-negative MCCs as 37% of these tumors harbor potentially targetable gain-of-function mutations in TP53 at p.R248 and p.P278. Moreover, TP53 mutational status predicts death in early stage MCC (5-year survival in TP53 mutant vs wild-type stage I and II MCCs is 20% vs. 92%, respectively; P = 0.0036). Lastly, we identified the tumor neoantigens in MCPyV-negative and MCPyV-positive MCCs. We found that virus-negative MCCs harbor more tumor neoantigens than melanomas or non-small cell lung cancers (median of 173, 65, and 111 neoantigens/sample, respectively), two cancers for which immune checkpoint blockade can produce durable clinical responses. Collectively, these data support the use of immunotherapies for virus-negative MCCs.
Directory of Open Access Journals (Sweden)
O. B. Abdurakhmanov
2015-01-01
Full Text Available Objective. To investigate the prognostic value of the apoptotic markers (p53 and vascular endothelial growth factor (VEGF in evaluating the clinical course of juvenile nasopharyngeal angiofibroma (JNA.Subjects and methods. The investigation enrolled 43 patients with primary JNA (a study group and 20 with its relapses (a control group. The expression of VEGF and mutant p53 (mtp53 gene was immunohistochemically determined using DAKO kits (Denmark. The results of reactions with antibodies to VEGF-A and mtp53 located in the nuclei and membranes were expressed as percentages in terms of stained cell counts per 100 cells examined in different visual fields.Results. An associative analysis showed that both study and control group patients with high mtp53 gene expression in the tumor cells had clinical stages IIIA–B and IV and those in whom the expression of this gene in the tumor cells was weak or absent were found to have clinical stages I and II. The high (3+ and moderate (2+ mtp53 gene expressions suggest that the disease is severe. Consequently, this is of prognostic value and a poor predictor and the absence of mutations or the decreased expression of this gene is associated with a favorable disease outcome.Our investigations indicated that the high expression of the VEGF gene was detected in none of the tumor specimens. In the study group, the tumor cell expression of this gene was found to be moderate (2+ in 18 (41.9 % patients, weak in 6 (13.9 % and absent in 19 (44.2 % of the 43 patients. In the control group, the absence of VEGF gene expression in the tumor specimens was 9 times lower than that in the study group.A comparison with the clinical characteristics of the patients demonstrated that in both the study and control groups, the VEGF expression was observed to be moderate, or weak and absent in those with clinical stages IIIA–B and IV or in those with stage II and I, respectively.Conclusion. The associative analysis showed that both
International Nuclear Information System (INIS)
Ohnishi, Takeo
1997-01-01
I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)
Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia
2004-06-01
G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for
Update History of This Database - TP Atlas | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us TP Atlas Update History of This Database Date Update contents 2013/12/16 The email address i...s ( http://www.tanpaku.org/tpatlas/ ) is opened. About This Database Database Description Download License Update History of Thi...s Database Site Policy | Contact Us Update History of This Database - TP Atlas | LSDB Archive ... ...n the contact information is corrected. 2013/11/19 TP Atlas English archive site is opened. 2008/4/1 TP Atla