WorldWideScience

Sample records for total leaf resistance

  1. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.

    1986-01-01

    in well adapted Northwest European spring cultivars. Virulence matching two hitherto not overcome resistances was demonstrated. Differences in apparent race nonspecific or partial resistance were also present, changing the percentage of infected plants of susceptible genotypes from about 20 to 44 per cent.......Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring...

  2. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  3. QTL mapping of resistance to gray leaf spot in maize.

    Science.gov (United States)

    Zhang, Yan; Xu, Ling; Fan, Xingming; Tan, Jing; Chen, Wei; Xu, Mingliang

    2012-12-01

    Gray leaf spot (GLS), caused by the causal fungal pathogen Cercospora zeae-maydis, is one of the most serious foliar diseases of maize worldwide. In the current study, a highly resistant inbred line Y32 and a susceptible line Q11 were used to produce segregating populations for both genetic analysis and QTL mapping. The broad-sense heritability (H (2)) for GLS resistance was estimated to be as high as 0.85, indicating that genetic factors played key roles in phenotypic variation. In initial QTL analysis, four QTL, located on chromosomes 1, 2, 5, and 8, were detected to confer GLS resistance. Each QTL could explain 2.53-23.90 % of the total phenotypic variation, predominantly due to additive genetic effects. Two major QTL, qRgls1 and qRgls2 on chromosomes 8 and 5, were consistently detected across different locations and replicates. Compared to the previous results, qRgls2 is located in a 'hotspot' for GLS resistance; while, qRgls1 does not overlap with any other known resistance QTL. Furthermore, the major QTL-qRgls1 was fine-mapped into an interval of 1.4 Mb, flanked by the markers GZ204 and IDP5. The QTL-qRgls1 could enhance the resistance percentages by 19.70-61.28 %, suggesting its usefulness to improve maize resistance to GLS.

  4. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight....... fulvum-tomato and S. tritici-wheat in order to find modelsystems to enhance interpretation of results from R. collo-cygni-barley interaction. Results from the mapping showed that resistance to Ramularia leaf spot is controlled by a number of QTL’s, some of which co-locate with other physiological traits....... The populations further segregated for physiological leaf spots, a phenomenon related to the leaf damage imposed by Rubellin, although, resistance to physiological leafspots appeared to come from the Ramularia leaf spot susceptible parent. The toxin assay further supported this result as the genotypes susceptible...

  5. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  6. Baby leaf lettuce germplasm enhancement: developing diverse populations with resistance to bacterial leaf spot caused by Xanthomonas campestris pv. vitians

    Science.gov (United States)

    Baby leaf lettuce cultivars with resistance to bacterial leaf spot (BLS) caused by Xanthomonas campestris pv. vitians (Xcv) are needed to reduce crop losses. The objectives of this research were to assess the genetic diversity for BLS resistance in baby leaf lettuce cultivars and to select early gen...

  7. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  8. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  9. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  10. Pyramiding of blast and bacterial leaf blight resistance genes into ...

    African Journals Online (AJOL)

    Blast caused by the fungus Magnaporthe oryzae (Hebert) Barr. and bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae (Xoo) are two major diseases of rice (Oryza sativa). The use of varietal resistance is the most appropriate strategy for controlling the diseases, and molecular assisted selection can ...

  11. Incorporation of resistance to angular leaf spot and bean common ...

    African Journals Online (AJOL)

    Luseko

    2013-07-03

    Jul 3, 2013 ... Angular leaf spot (ALS) caused by the fungus Pseudocercospora griseola and Bean common mosaic and necrosis virus (BCMV/BCMNV) are important diseases of common bean in Tanzania that can cause severe yield reduction when uncontrolled. This study was conducted to incorporate resistant genes ...

  12. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  13. Incorporation of resistance to angular leaf spot and bean common ...

    African Journals Online (AJOL)

    Angular leaf spot (ALS) caused by the fungus Pseudocercospora griseola and Bean common mosaic and necrosis virus (BCMV/BCMNV) are important diseases of common bean in Tanzania that can cause severe yield reduction when uncontrolled. This study was conducted to incorporate resistant genes for ALS and ...

  14. Major QTL Conferring Resistance to Rice Bacterial Leaf Streak

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Bacterial leaf streak (BLS) is one of the important limiting factors to rice production in southern China and other tropical and sub-tropical areas in Asia. Resistance to BLS was found to be a quantitative trait and no major resistant gene was located in rice until date. In the present study, a new major quantitative trait locus (QTL) conferring resistance to BLS was identified from a highly resistant variety Dular by the employment of Dular/Balilla (DB) and Dular/IR24 (DI) segregation populations and was designated qBLSR-11-1. This QTL was located between the simple sequence repeat (SSR) markers RM120 and RM441 on chromosome 11 and could account for 18.1-21.7% and 36.3% of the variance in DB and DI populations, respectively. The genetic pattern of rice resistance to BLS was discussed.

  15. Effect of weed control treatments on total leaf area of plantation black walnut (Juglans nigra)

    Science.gov (United States)

    Jason Cook; Michael R. Saunders

    2013-01-01

    Determining total tree leaf area is necessary for describing tree carbon balance, growth efficiency, and other measures used in tree-level and stand-level physiological growth models. We examined the effects of vegetation control methods on the total leaf area of sapling-size plantation black walnut trees using allometric approaches. We found significant differences in...

  16. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...

  17. Estimating the total leaf area of the green dwarf coconut tree (Cocos nucifera L.

    Directory of Open Access Journals (Sweden)

    Sousa Elias Fernandes de

    2005-01-01

    Full Text Available Leaf area has significant effect on tree transpiration, and its measurement is important to many study areas. This work aimed at developing a non-destructive, practical, and empirical method to estimate the total leaf area of green dwarf coconut palms (Cocos nucifera L. in plantations located at the northern region of Rio de Janeiro state, Brazil. A mathematical model was developed to estimate total leaf area values (TLA as function of the average lengths of the last three leaf raquis (LR3, and of the number of leaves in the canopy (NL. The model has satisfactory degree of accuracy for agricultural engineering purposes.

  18. Comparison of dwarf bamboos (Indocalamus sp.) leaf parameters to determine relationship between spatial density of plants and total leaf area per plant.

    Science.gov (United States)

    Shi, Pei-Jian; Xu, Qiang; Sandhu, Hardev S; Gielis, Johan; Ding, Yu-Long; Li, Hua-Rong; Dong, Xiao-Bo

    2015-10-01

    The relationship between spatial density and size of plants is an important topic in plant ecology. The self-thinning rule suggests a -3/2 power between average biomass and density or a -1/2 power between stand yield and density. However, the self-thinning rule based on total leaf area per plant and density of plants has been neglected presumably because of the lack of a method that can accurately estimate the total leaf area per plant. We aimed to find the relationship between spatial density of plants and total leaf area per plant. We also attempted to provide a novel model for accurately describing the leaf shape of bamboos. We proposed a simplified Gielis equation with only two parameters to describe the leaf shape of bamboos one model parameter represented the overall ratio of leaf width to leaf length. Using this method, we compared some leaf parameters (leaf shape, number of leaves per plant, ratio of total leaf weight to aboveground weight per plant, and total leaf area per plant) of four bamboo species of genus Indocalamus Nakai (I. pedalis (Keng) P.C. Keng, I. pumilus Q.H. Dai and C.F. Keng, I. barbatus McClure, and I. victorialis P.C. Keng). We also explored the possible correlation between spatial density and total leaf area per plant using log-linear regression. We found that the simplified Gielis equation fit the leaf shape of four bamboo species very well. Although all these four species belonged to the same genus, there were still significant differences in leaf shape. Significant differences also existed in leaf area per plant, ratio of leaf weight to aboveground weight per plant, and leaf length. In addition, we found that the total leaf area per plant decreased with increased spatial density. Therefore, we directly demonstrated the self-thinning rule to improve light interception.

  19. Measurements methods and variability assesment of the Norway spruce total leaf area. Implications for remote sensing

    Czech Academy of Sciences Publication Activity Database

    Homolová, L.; Lukeš, Petr; Malenovský, Z.; Lhotáková, Z.; Kaplan, Věroslav; Hanuš, Jan

    2013-01-01

    Roč. 27, č. 1 (2013), s. 111-121 ISSN 0931-1890 R&D Projects: GA ČR GA205/09/ 1989 Institutional support: RVO:67179843 Keywords : chlorophyll content * conversion factor * Picea abies * projected leaf area * remote sensing * total leaf area Subject RIV: EH - Ecology, Behaviour Impact factor: 1.869, year: 2013

  20. Physico-chemical characterization of banana varieties resistant to black leaf streak disease for industrial purposes

    Directory of Open Access Journals (Sweden)

    Rossana Catie Bueno de Godoy

    2016-01-01

    Full Text Available ABSTRACT: Cultivated bananas have very low genetic diversity making them vulnerable to diseases such as black-Sigatoka leaf spot. However, the decision to adopt a new banana variety needs to be based on a robust evaluation of agronomical and physical-chemical characteristics. Here, we characterize new banana varieties resistant to black-Sigatoka leaf spot and compare them to the most widely used traditional variety (Grand Naine. Each variety was evaluated for a range of physic-chemical attributes associated with industrial processing and flavor: pH, TTA, TSS/TTA, total sugars, reducing sugars and non-reducing sugars, humidity, total solids and yield. The Thap Maeo variety had the highest potential as a substitute for the Grand Naine variety, having higher levels of total soluble solids, reducing sugars, total sugars and humidity. The Caipira and FHIA 2 varieties also performed well in comparison with the Grand Naine variety. Cluster analysis indicated that the Grand Naine variety was closely associated with varieties from the Gross Michel subgroup (Bucaneiro, Ambrosia and Calipso and the Caipira variety, all of which come from the same AAA genomic group. It was concluded that several of the new resistant varieties could potentially substitute the traditional variety in areas affected by black-Sigatoka leaf spot disease.

  1. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  2. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  3. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  4. The genetic variance of resistance in M3 lines of rice against leaf blight disease

    International Nuclear Information System (INIS)

    Mugiono

    1979-01-01

    Seeds of Pelita I/1 rice variety were irradiated with 20, 30, 40 and 50 krad of gamma rays from a 60 Co source. Plants of M 3 lines were inoculated with bacterial leaf blight, Xanthomonas oryzae (Uzeda and Ishiyama) Downson, using clipping method. The coefficient of genetic variability of resistance against leaf blight disease increased with increasing dose. Highly significant difference in the genetic variance of resistance were found between the treated samples and the control. Dose of 20 krad gave good probability for selection of plants resistant against leaf blight disease. (author)

  5. Measurement methods and variability assessment of the Norway spruce total leaf area: Implications for remote sensing

    NARCIS (Netherlands)

    Homolova, L.; Lukes, P.; Malenovsky, Z.; Lhotakova, Z.; Kaplan, V.; Hanus, J.

    2013-01-01

    Estimation of total leaf area (LAT) is important to express biochemical properties in plant ecology and remote sensing studies. A measurement of LAT is easy in broadleaf species, but it remains challenging in coniferous canopies. We proposed a new geometrical model to estimate Norway spruce LAT and

  6. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  7. Diallel analysis of leaf disease resistance in inbred Brazilian popcorn cultivars.

    Science.gov (United States)

    Vieira, R A; Scapim, C A; Moterle, L M; Tessmann, D J; Conrado, T V; Amaral Júnior, A T

    2009-12-01

    We estimated general and specific combining abilities and examined resistance to northern leaf blight (Exserohilum turcicum) and to gray leaf spot (Cercospora zeae-maydis) in a set of nine inbred popcorn lines. These inbreds were crossed in a complete diallel scheme without reciprocals, which produced 36 F(1) hybrids. Two experiments with a square lattice design and three replications were conducted during the 2008/2009 crop season, in Maringá, PR, Brazil. The severity of northern leaf blight and gray leaf spot was assessed under natural infestation conditions. Data were examined by individual and joint analysis of variance. Individual and joint Griffing's diallel analyses were carried out for adjusted means. General combining ability and specific combining ability were significant (P < 0.10) by the F-test for northern leaf blight and gray leaf spot infestation levels. This denotes that additive and non-additive gene effects both contributed to resistance to these diseases, but that the additive gene effects were more important. Among the inbred lines, P(8) and P(9) gave the highest resistance to northern leaf blight, and P(3) and P(4.3) gave the highest resistance to gray leaf spot. The hybrids P(7.4) x P(8) and P(4.3) x P(9) could be exploited by reciprocal recurrent selection to provide genotypes with both northern leaf blight and gray leaf spot resistance. Significant interaction between general combining ability and crop season (P < 0.10) denotes the importance of environment, even though the disease levels in the hybrids were quite consistent.

  8. Optimal ship forms for minimum total resistance in shallow water

    OpenAIRE

    Zhao, Lian-en

    1984-01-01

    Optimal ship forms for minimum total resistance in shallow water Optimal ship forms for minimum total resistance in shallow water: An attempt is made to obtain shallow-water optimal ship forms for total resistance by means of "tent" function representation under the constraints that the main dimensions of the ship and the water-line area were kept constant. The objective function in the quadratic programming is the sum of wave-making resistance calculated by Sretenski's formula and viscou...

  9. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  10. Selection of valine-resistance in callus culture of Arabidopsis thaliana (L. Heynh. derived from leaf explants

    Directory of Open Access Journals (Sweden)

    Małgorzata D. Gaj

    2014-01-01

    Full Text Available The selection of valine-resistant mutants was carried out in leaf explant cultures of three Arabidopsis thaliana (L. Heynh. ecotypes: C-24, RLD and Columbia. The valine concentration used for in vitro selection, lethal for seed-growing plants, has not affected callus formation and growth. However, strong inhibition of shoot regeneration ability of calli growing under selection pressure was noticed. In total, 1043 explants were cultured on valine medium and 18 shoots were regenerated with an average frequency of 1.7 shoots per 100 calli. Most R1 shoots were sterile and seeds were collected from 3 plants. The transmission of valine-resistance to the sexual progeny of these plants was scored and the increased level of valine-resistance was found in progeny of one line - 61 C. This line originated from the culture of Columbia leaf explant and displayed tetraploid chromosome number.

  11. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  12. Genetic characterization of angular leaf spot resistance in selected ...

    African Journals Online (AJOL)

    Mr Tryphone

    2015-10-28

    Oct 28, 2015 ... Angular leaf spot disease (ALS) caused by Pseudocercospora griseola is one ... Author(s) agree that this article remains permanently open access under the terms ... that results in shrivelled seeds of reduced size and quality.

  13. prevalence of angular leaf spot disease and sources of resistance

    African Journals Online (AJOL)

    USER

    2017-02-17

    Feb 17, 2017 ... Angular leaf spot (Pseudocercospora griseola Crous U, Brown) is one of the ..... Incidence of six foliar bean diseases in two agro ecological zones of eastern Democratic Republic of .... use of poor quality farmer-saved seed.

  14. Leaf transpiration efficiency of some drought-resistant maize lines

    Science.gov (United States)

    Field measurements of leaf gas exchange in maize often indicate stomatal conductances higher than required to provide substomatal carbon dioxide concentrations saturating to photosynthesis. Thus maize leaves often operate at lower transpiration efficiency (TE) than potentially achievable for specie...

  15. Total Lactic Acid Bacteria (LAB), Antioxidant Activity, and Acceptance of Synbiotic Yoghurt with Binahong Leaf Extract (Anredera cordifolia (Ten.) Steenis)

    Science.gov (United States)

    Lestari, R. P.; Nissa, C.; Afifah, D. N.; Anjani, G.; Rustanti, N.

    2018-02-01

    Alternative treatment for metabolic syndrome can be done by providing a diet consist of functional foods or beverages. Synbiotic yoghurt containing binahong leaf extract which high in antioxidant, total LAB and fiber can be selected to reduce the risk of metabolic syndrome. The effect of binahong leaf extract in synbiotic yoghurt against total LAB, antioxidant activity, and acceptance were analyzed. The experiment was done with complete randomized design with addition of binahong leaf extract 0% (control); 0.12%; 0.25%; 0.5% in synbiotic yoghurt. Analysis of total LAB using Total Plate Count test, antioxidant activity using DPPH, and acceptance were analyzed by hedonic test. The addition of binahong leaf extract in various doses in synbiotic yoghurt decreased total LAB without significant effect (p=0,145). There was no effect of addition binahong leaf extract on antioxidant activity (p=0,297). The addition of binahong leaf extract had an effect on color, but not on aroma, texture and taste. The best result was yoghurt synbiotic with addition of 0,12% binahong leaf extract. Conclusion of the research was the addition of binahong leaf extract to synbiotic yogurt did not significantly affect total LAB, antioxidant activity, aroma, texture and taste; but had a significant effect on color.

  16. Partial stem and leaf resistance against the fungal pathogen Botrytis cinerea in wild relatives of tomato

    NARCIS (Netherlands)

    Have, ten A.; Berloo, van R.; Lindhout, P.; Kan, van J.A.L.

    2007-01-01

    Tomato (Solanum lycopersicum) is one of many greenhouse crops that can be infected by the necrotrophic ascomycete Botrytis cinerea. Commercial cultivation of tomato is hampered by the lack of resistance. Quantitative resistance has been reported in wild tomato relatives, mostly based on leaf assays.

  17. Effect of urdbean leaf crinkle virus infection on total soluble protein and antioxidant enzymes in blackgram plants

    International Nuclear Information System (INIS)

    Ashfaq, M.; Mughal, S.M.; Khan, A.; Javed, N.; Sahi, S.T.; Shahid, M.

    2010-01-01

    Urdbean leaf crinkle virus (ULCV) is a common, wide spread, destructive and economically important disease causing systemic infection in blackgram (Vigna mungo (L.) Hepper), resulting in extreme crinkling, curling, puckering and rugosity of leaves, and yield reductions. Effect of viral infection was investigated on total soluble proteins and antioxidant enzymes activity in two genotypes viz., Mash-88-susceptible and CM-2002-resistant, at different growth stages under both the inoculated and un-inoculated conditions. ULCV infection resulted in significant increase in total soluble protein contents of the leaves in both genotypes. In healthy plant, super oxide dismutase (SOD), catalase (CAT) and peroxidase (PO) showed similar activity levels. In inoculated plants of Mash-88, SOD and PO activities decreased and increased non-significantly at all growth stages, respectively. The activities of PO and SOD increased and decreased significantly after 15 and 30 days of inoculation in resistant genotype, respectively. No significant changes in catalase (CAT) activity were detected in ULCV-infected leaves over the control. It was concluded that the super oxide dismutase and peroxidases might be associated with resistance/susceptibility to ULCV infection. (author)

  18. Increasing leaf longevity and disease resistance by altering salicylic acid catabolism

    Energy Technology Data Exchange (ETDEWEB)

    Gan, Susheng; Zhang, Kewei

    2018-01-23

    The present invention relates to a transgenic plant having an altered level of salicylic acid 3-hydroxylase ("S3H") protein, compared to that of a non-transgenic plant, where the transgenic plant displays an altered leaf senescence phenotype, relative to a non-transgenic plant. The present invention relates to a mutant plant comprising an inactivated gene encoding S3H protein, where the mutant plant displays a premature or precocious leaf senescence phenotype, relative to a non-mutant plant. The present invention also relates to methods for promoting premature or precocious leaf senescence in a plant, delaying leaf senescence in a plant, and making a mutant plant having a decreased level of S3H protein compared to that of a non-mutant plant, where the mutant plant displays a premature or precocious leaf senescence phenotype relative to a non-mutant plant. The present invention also relates to inducing or promoting pathogen resistance in plants.

  19. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  20. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  1. Salicylic acid confers enhanced resistance to Glomerella leaf spot in apple.

    Science.gov (United States)

    Zhang, Ying; Shi, Xiangpeng; Li, Baohua; Zhang, Qingming; Liang, Wenxing; Wang, Caixia

    2016-09-01

    Glomerella leaf spot (GLS) caused by Glomerella cingulata is a newly emergent disease that results in severe defoliation and fruit spots in apple. Currently, there are no effective means to control this disease except for the traditional fungicide sprays. Induced resistance by elicitors against pathogens infection is a widely accepted eco-friendly strategy. In the present study, we investigated whether exogenous application of salicylic acid (SA) could improve resistance to GLS in a highly susceptible apple cultivar (Malus domestica Borkh. cv. 'Gala') and the underlying mechanisms. The results showed that pretreatment with SA, at 0.1-1.0 mM, induced strong resistance against GLS in 'Gala' apple leaves, with SA treated leaves showing significant reduction in lesion numbers and disease index. Concurrent with the enhanced disease resistance, SA treatment markedly increased the total antioxidant capacity (T-AOC) and defence-related enzyme activities, including catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), phenylalanine ammonia-lyase (PAL) and polyphenol oxidase (PPO). As expected, SA treatment also induced the expression levels of five pathogenesis-related (PR) genes including PR1, PR5, PR8, Chitinase and β-1,3-glucanase. Furthermore, the most pronounced and/or rapid increase was observed in leaves treated with SA and subsequently inoculated with G. cingulata compared to the treatment with SA or inoculation with the pathogen. Together, these results suggest that exogenous SA triggered increase in reactive oxygen species levels and the antioxidant system might be responsible for enhanced resistance against G. cingulata in 'Gala' apple leaves. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. NOTE - Genetic control of resistance to gray leaf spot of maize in tropical germplasm

    Directory of Open Access Journals (Sweden)

    André Humberto de Brito

    2012-01-01

    Full Text Available The main goal of this study was to assess the nature and magnitude of gene effects for resistance to Cercospora leaf spot. A randomized block design with three replications was used. The data were obtained at the plant level by assessing the disease severity. The data were analyzed per experiment, using the average data per plot. A dominant-additive genetic model without epistasis was considered, with estimation of the components of means and variance. The genetic control of resistance to gray leaf spot is polygenic with predominance of the additive effects. Dominance was observed in a few small-effect loci and high heritability values.

  3. Pyramids of QTLs enhance host-plant resistance and Bt-mediated resistance to leaf-chewing insects in soybean.

    Science.gov (United States)

    Ortega, María A; All, John N; Boerma, H Roger; Parrott, Wayne A

    2016-04-01

    QTL-M and QTL-E enhance soybean resistance to insects. Pyramiding these QTLs with cry1Ac increases protection against Bt-tolerant pests, presenting an opportunity to effectively deploy Bt with host-plant resistance genes. Plant resistance to leaf-chewing insects minimizes the need for insecticide applications, reducing crop production costs and pesticide concerns. In soybean [Glycine max (L.) Merr.], resistance to a broad range of leaf-chewing insects is found in PI 229358 and PI 227687. PI 229358's resistance is conferred by three quantitative trait loci (QTLs): M, G, and H. PI 227687's resistance is conferred by QTL-E. The letters indicate the soybean Linkage groups (LGs) on which the QTLs are located. This study aimed to determine if pyramiding PI 229358 and PI 227687 QTLs would enhance soybean resistance to leaf-chewing insects, and if pyramiding these QTLs with Bt (cry1Ac) enhances resistance against Bt-tolerant pests. The near-isogenic lines (NILs): Benning(ME), Benning(MGHE), and Benning(ME+cry1Ac) were developed. Benning(ME) and Benning(MGHE) were evaluated in detached-leaf and greenhouse assays with soybean looper [SBL, Chrysodeixis includens (Walker)], corn earworm [CEW, Helicoverpa zea (Boddie)], fall armyworm [FAW, Spodoptera frugiperda (J.E. Smith)], and velvetbean caterpillar [VBC, Anticarsia gemmatalis (Hübner)]; and in field-cage assays with SBL. Benning(ME+cry1Ac) was tested in detached-leaf assays against SBL, VBC, and Southern armyworm [SAW, Spodoptera eridania (Cramer)]. In the detached-leaf assay, Benning(ME) showed the strongest antibiosis against CEW, FAW, and VBC. In field-cage conditions, Benning(ME) and Benning(MGHE) suffered 61 % less defoliation than Benning. Benning(ME+cry1Ac) was more resistant than Benning(ME) and Benning (cry1Ac) against SBL and SAW. Agriculturally relevant levels of resistance in soybean can be achieved with just two loci, QTL-M and QTL-E. ME+cry1Ac could present an opportunity to protect the durability of Bt

  4. Association analysis of bacterial leaf spot resistance and SNP markers derived from expressed sequence tags (ESTs) in lettuce (Lactuca sativa L.)

    Science.gov (United States)

    Bacterial leaf spot of lettuce, caused by Xanthomonas campestris pv. vitians, is a devastating disease of lettuce worldwide. Since there are no chemicals available for effective control of the disease, host-plant resistance is highly desirable to protect lettuce production. A total of 179 lettuce ge...

  5. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  6. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL

    Science.gov (United States)

    Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...

  7. Inheritance of Resistance to Turcicum Leaf Blight in Sorghum ...

    African Journals Online (AJOL)

    Breeding for such complex traits is often compounded by genotype by environment interactions and as such, marker assisted selection could hasten the process. Further characterisation of resistance loci and mapping of quantitative trait loci will support effective more resistance breeding. Keywords: Exserohilum turcicum ...

  8. Phytochemicals Screening, Total Phenol Estimation, Antioxidant Activity of Blainvillea Acmella Leaf and Stem Successive Extracts

    International Nuclear Information System (INIS)

    Sharma, P.; Sharma, G.N.; Shrivastava, B.; Jadhav, H.R.

    2014-01-01

    The aim of present work was to investigate antioxidant potential of different extracts of Blainvillea acmella leaf and stem. The successive extraction of individual plant part was carried out using solvents of different polarity viz. n-hexane, ethyl acetate, methanol and water. Preliminary phyto chemical screening of all the extracts was done. The present total phenolic contents were estimated by Folin-Ciocalteu reagent method and expressed as μg/ mg of gallic acid equivalent. The antioxidant potential and reducing power of all the prepared extracts were measured against DPPH, as compared to standard ascorbic acid, and BHA respectively. The result data indicate that the phenolic contents were higher in methanolic extracts of leaf (73.67 ± 0.38 mg/ g) followed by ethyl acetate (29.08 ± 0.38 mg/ g), aqueous (21.50 ± 0.28 mg/ g), and n-Hexane (9.29 ± 0.38 mg/ g); gallic acid equivalent. The similar pattern in stem part was also observed for example methanolic extracts (41.90 ± 0.45 mg/ g), ethyl acetate (21.92 ± 0.28 mg/ g), aqueous (15.13 ± 0.18 mg/ g), and n-Hexane (3.69 ± 0.28 mg/ g). The antioxidant capacity of methanolic extract of both the part for example leaf and stem was found to be maximum, as IC50 values were 226.49 ± 0.16, 402.05 ± 1.10 respectively. The reducing power was also highest in methanol extract of both parts. The result data conclude that the higher antioxidant as well as reducing power may be due to present phenolic contents. (author)

  9. An extended PROSPECT: Advance in the leaf optical properties model separating total chlorophylls into chlorophyll a and b.

    Science.gov (United States)

    Zhang, Yao; Huang, Jingfeng; Wang, Fumin; Blackburn, George Alan; Zhang, Hankui K; Wang, Xiuzhen; Wei, Chuanwen; Zhang, Kangyu; Wei, Chen

    2017-07-25

    The PROSPECT leaf optical model has, to date, well-separated the effects of total chlorophyll and carotenoids on leaf reflectance and transmittance in the 400-800 nm. Considering variations in chlorophyll a:b ratio with leaf age and physiological stress, a further separation of total plant-based chlorophylls into chlorophyll a and chlorophyll b is necessary for advanced monitoring of plant growth. In this study, we present an extended version of PROSPECT model (hereafter referred to as PROSPECT-MP) that can combine the effects of chlorophyll a, chlorophyll b and carotenoids on leaf directional hemispherical reflectance and transmittance (DHR and DHT) in the 400-800 nm. The LOPEX93 dataset was used to evaluate the capabilities of PROSPECT-MP for spectra modelling and pigment retrieval. The results show that PROSPECT-MP can both simultaneously retrieve leaf chlorophyll a and b, and also performs better than PROSPECT-5 in retrieving carotenoids concentrations. As for the simulation of DHR and DHT, the performances of PROSPECT-MP are similar to that of PROSPECT-5. This study demonstrates the potential of PROSPECT-MP for improving capabilities of remote sensing of leaf photosynthetic pigments (chlorophyll a, chlorophyll b and carotenoids) and for providing a framework for future refinements in the modelling of leaf optical properties.

  10. Somaclonal variation in hybrid poplars for resistance to Septoria leaf spot

    Science.gov (United States)

    M.E. Ostry; D. D. Skilling

    1987-01-01

    Tissue culture techniques have been used to obtain hybrid poplars with putative resistance to leaf spot caused by Septoria musiva from clones previously susceptible to the disease. Stem internode explants were used to obtain proliferating callus cultures. Adventitious bud formation and shoot proliferation were then induced. Elongated shoots were excised and rooted in a...

  11. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  12. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  13. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.

  14. Red leaf lettuce breeding line with resistance to corky root, 06-810

    Science.gov (United States)

    The Agricultural Research Service, United States Department of Agriculture (USDA) announces the release of a breeding line of red leaf lettuce (Lactuca sativa L.), 06-810. The line may be suitable for commercial production, and is suitable for use as a source of resistance to corky root disease in t...

  15. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.

  16. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.

  17. The relationship between powdery mildew (Sphaerotheca fuliginea) resistance and leaf chlorosis sensitivity in cucumber (Cucumis sativus) studied in single seed descent lines

    NARCIS (Netherlands)

    Zijlstra, S.; Jansen, R.C.; Groot, S.P.C.

    1995-01-01

    The genetic relation between powdery mildew resistance and sensitivity for leaf chlorosis of glasshouse cucumber was investigated. The powdery mildew resistant, leaf chlorosis sensitive hybrid variety 'Profito' was crossed with the powdery mildew susceptible, non chlorosis sensitive hybrid variety

  18. Genetic analysis of the induced mutants of rice resistant to bacterial leaf blight

    International Nuclear Information System (INIS)

    Nakai, H.

    1990-01-01

    Full text: Seeds of the rice cultivar 'Harebare', which is susceptible to bacterial leaf blight (BLB), were treated with thermal neutrons, gamma-rays, ethyleneimine and ethylmethane-sulfonate. In the M2, plants with better resistance to BLB were identified through inoculation at the seedling and the flag leaf stages with an isolate (T7174) of the Japanese differential race I. Several mutant lines resistant to BLB were selected through tests of the M 3 or M 4 lines derived from selected resistant M 2 plants. The frequency of resistant mutants was significantly higher after the thermal neutron treatment than after treatments with other mutagens. Two mutants, which originated from the neutron treatment, showing a highly quantitative resistance to multiple BLB races were analysed for gene(s) for resistance. The resistance of one of them (M41) to the Japanese races I, II, III, IV, and V was found to be conditioned by a single recessive gene. Three other recessive genes for resistance are known, but their reaction to differential races is different. Therefore, this gene was thought to be new and was tentatively designated as xa-nm(t). The resistance of another mutant (M57) was found to be polygenically inherited. (author)

  19. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  20. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  1. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  2. Rice mutation breeding for resistance against leaf blight disease and brown planthopper

    International Nuclear Information System (INIS)

    Mugiono; Ismachin, M

    1981-01-01

    Seeds of Pelita 1/1 were treated variously with EMS 1%, 20, 30, 35, 40 and 50 krad doses gamma rays from a Co 60 source. The 1% EMS treatment, of presoaking for 36 hours in distilled water and stored for one week before sowing, yielded more mutants resistant against bacterial leaf blight compared to other treatments with EMS. Treatment with 20 krad of gamma rays gave an indication of a good probability for improving resistance. Screening for brown planthopper resistance among 350 M 4 lines yielded 4 moderate resistant (MR) lines. However, no resistant line was found. From 36 crosses between the mutants and IR-26 or mutants with Mudgo 86 promising lines were found. The promising lines, beside resistant against brown planthopper, were selected based on early maturity and short stem. (author)

  3. Leaf structural traits of tropical woody species resistant to cement dust.

    Science.gov (United States)

    Siqueira-Silva, Advanio Inácio; Pereira, Eduardo Gusmão; Modolo, Luzia Valentina; Paiva, Elder Antonio Sousa

    2016-08-01

    Cement industries located nearby limestone outcrops in Brazil have contributed to the coating of cement dust over native plant species. However, little is known about the extent of the response of tropical woody plants to such environmental pollutant particularly during the first stages of plant development and establishment. This work focused on the investigation of possible alterations in leaf structural and ultrastructural traits of 5-month-old Guazuma ulmifolia Lam. (Malvaceae), 6-month-old Myracrodruon urundeuva Allemão (Anacardiaceae), and 9-month-old Trichilia hirta L. (Meliaceae) challenged superficially with cement dust during new leaf development. Leaf surface of plants, the soil or both (leaf plus soil), were treated (or not) for 60 days, under controlled conditions, with cement dust at 2.5 or 5.0 mg cm(-2). After exposure, no significant structural changes were observed in plant leaves. Also, no plant death was recorded by the end of the experiment. There was also some evidence of localized leaf necrosis in G. ulmifolia and T. hirta, leaf curling in M. urundeuva and T. hirta, and bulges formation on epidermal surface of T. hirta, after cement dust contact with plant shoots. All species studied exhibited stomata obliteration while T. hirta, in particular, presented early leaf abscission, changes in cellular relief, and organization and content of midrib cells. No significant ultrastructural alterations were detected under the experimental conditions studied. Indeed, mesophyll cells presented plastids with intact membrane systems. The high plant survival rates, together with mild morphoanatomic traits alterations in leaves, indicate that G. ulmifolia is more resistant to cement dust pollutant, followed by M. urundeuva and T. hirta. Thus, the three plant species are promising for being used to revegetate areas impacted by cement industries activities.

  4. Diverse mechanisms of plant resistance to cauliflower mosaic virus revealed by leaf skeleton hybridization.

    Science.gov (United States)

    Melcher, U; Brannan, C M; Gardner, C O; Essenberg, R C

    1992-01-01

    Plants not hosts for cauliflower mosaic virus (CaMV) may prevent systemic CaMV infection by interfering with dissemination of infection through the plant or by preventing viral replication and maturation. Leaf skeleton hybridization allows distinction between these two barriers. The technique assesses the spatial distribution of CaMV in an inoculated leaf by hybridization of a skeleton of the leaf with a CaMV DNA probe. Leaves or leaflets of soybean, cucumber, peanut, tomato, lettuce, spinach, pepper, onion, wheat, maize and barley, inoculated with CaMV DNA or CaMV virions were processed for leaf skeleton hybridization either immediately after inoculation or two weeks thereafter. Autoradiographic images of soybean and cucumber skeletons had many dark spots suggesting that CaMV DNA replication and local spread had occurred. Images of onion leaf skeletons prepared two weeks after inoculation with CaMV DNA had fewer spots. To test whether these spots resulted from CaMV replication, DNA was extracted from inoculated onion leaves and analyzed by electrophoresis, blotting and hybridization. Molecules recovered two weeks after inoculation resembled those inoculated, indicating absence of replication. For the other species, we found no evidence of local spread of CaMV infections. Thus, many plant species resist systemic CaMV infection by preventing replication or local spread of CaMV, while others solely prevent systemic movement of infection.

  5. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    Full Text Available The common bean (Phaseolus vulgaris L. is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum and angular leaf spot (ALS; Pseudocercospora griseola are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will

  6. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Perseguini, Juliana Morini Küpper Cardoso; Oblessuc, Paula Rodrigues; Rosa, João Ricardo Bachega Feijó; Gomes, Kleber Alves; Chiorato, Alisson Fernando; Carbonell, Sérgio Augusto Morais; Garcia, Antonio Augusto Franco; Vianello, Rosana Pereira; Benchimol-Reis, Luciana Lasry

    2016-01-01

    The common bean (Phaseolus vulgaris L.) is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum) and angular leaf spot (ALS; Pseudocercospora griseola) are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL) controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will contribute to more

  7. Field evaluations of leaf spot resistance and yield in peanut genotypes in the United States and Bolivia

    Science.gov (United States)

    Field experiments were conducted in 2002-2006 to characterize yield potential and disease resistance to Cercospora arachidicola (early leaf spot) and Cercosporidium personatum (late leaf spot) in the Bolivian peanut (Arachis hypogaea) cultivar, Bayo Grande, and breeding lines developed from crosses ...

  8. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  9. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

  10. Characterization, antibacterial, total antioxidant, scavenging, reducing power and ion chelating activities of green synthesized silver, copper and titanium dioxide nanoparticles using Artemisia haussknechtii leaf extract.

    Science.gov (United States)

    Alavi, Mehran; Karimi, Naser

    2017-12-12

    Recently, major problem related to pathogenic bacteria is augmentation of antibiotic resistance which has been changed treatment and recovery of millions of infectious patients. The present study reports an eco-friendly, rapid and easy method for synthesis of silver (Ag), copper (Cu) and titanium dioxide (TiO 2 ) nanoparticles (NPs) using Artemisia haussknechtii leaf aqueous extract with antibacterial activities against multi-drug resistance (MDR) bacteria species. Three different concentrations (0.001, 0.01 and 0.1 M) of AgNO 3 , CuSO 4 and TiO (OH) 2 were investigated for obtaining optimum NPs green synthesis. Total phenolic content, total flavonoid content of leaf extract and total antioxidant activity (DPPH) assay were determined as radical scavenging methods. UV-Visible spectroscopy, Fourier transform infrared spectroscopy analysis, X-ray diffraction, energy dispersive X-ray spectroscopy, field emission scanning electron microscope and atomic force microscopy (AFM) were used due to NPs characterization. The size average of the Ag, Cu and TiO 2 NPs obtained were respectively 10.69 ± 5.55, 35.36 ± 44.4 and 92.58 ± 56.98 nm. In the case of antibacterial assay, disc diffusion assay, minimum inhibitory concentration, minimum bactericidal concentration, bacterial growth and morphology of four MDR species Staphylococcus aureus ATCC 43300, Staphylococcus epidermidis ATCC 12258, Serratia marcescens ATTC13880 and Escherichia coli ATCC 25922 were evaluated. Results of this study demonstrated that A. haussknechtii leaf extract with various groups of phytochemicals such as phenols and flavonoids had suitable ability in green synthesis of Ag, Cu and TiO 2 NPs. Also, Ag and Cu NPs had more antibacterial activities compared to TiO 2 NPs.

  11. Prospecting sugarcane resistance to Sugarcane yellow leaf virus by genome-wide association.

    Science.gov (United States)

    Debibakas, S; Rocher, S; Garsmeur, O; Toubi, L; Roques, D; D'Hont, A; Hoarau, J-Y; Daugrois, J H

    2014-08-01

    Using GWAS approaches, we detected independent resistant markers in sugarcane towards a vectored virus disease. Based on comparative genomics, several candidate genes potentially involved in virus/aphid/plant interactions were pinpointed. Yellow leaf of sugarcane is an emerging viral disease whose causal agent is a Polerovirus, the Sugarcane yellow leaf virus (SCYLV) transmitted by aphids. To identify quantitative trait loci controlling resistance to yellow leaf which are of direct relevance for breeding, we undertook a genome-wide association study (GWAS) on a sugarcane cultivar panel (n = 189) representative of current breeding germplasm. This panel was fingerprinted with 3,949 polymorphic markers (DArT and AFLP). The panel was phenotyped for SCYLV infection in leaves and stalks in two trials for two crop cycles, under natural disease pressure prevalent in Guadeloupe. Mixed linear models including co-factors representing population structure fixed effects and pairwise kinship random effects provided an efficient control of the risk of inflated type-I error at a genome-wide level. Six independent markers were significantly detected in association with SCYLV resistance phenotype. These markers explained individually between 9 and 14 % of the disease variation of the cultivar panel. Their frequency in the panel was relatively low (8-20 %). Among them, two markers were detected repeatedly across the GWAS exercises based on the different disease resistance parameters. These two markers could be blasted on Sorghum bicolor genome and candidate genes potentially involved in plant-aphid or plant-virus interactions were localized in the vicinity of sorghum homologs of sugarcane markers. Our results illustrate the potential of GWAS approaches to prospect among sugarcane germplasm for accessions likely bearing resistance alleles of significant effect useful in breeding programs.

  12. Terpene Profile, Leaf Anatomy, and Enzyme Activity of Resistant and Susceptible Cocoa Clonesto Vascular Streak Dieback Disease

    Directory of Open Access Journals (Sweden)

    Adi Prawoto

    2014-10-01

    Full Text Available Vascular-streak dieback (VSD, Oncobasidium theobromae is the most prevalent disease of Theobroma cacao L. in Indonesia. This study aims to analyze resistance mechanism to VSD based on terpene profile, leaf anatomy, chitinase, and peroxidase study. Resistant clones of Sulawesi 1 and Sca 6 and susceptible clones of ICS 60 and TSH 858 were used for terpene profile, leaf anatomy analysis, chitinase, peroxides, polyphenol, lignin, and cellulose analysis. Those clones and KEE 2, KKM 22 and ICS 13 were used for peroxides analysis. For trichome study, the resistant clones of Sulawesi 1, Sca 6, KEE 2, and KKM 22, and susceptible clones of ICS 60 and TSH 858 were used. GCMS analysis showed that chromatogram pattern of resistant and susceptible groups were quite similar, but resistant clones contained 22% more components than the susceptible ones. Resistant clones contained groups of pinene, decane, myrcene, and octadecanoic acid, while those substances on usceptible clones were absent. Trichome was thicker on younger leaf, and its density on the basal was higher than that on the middle and tip leaf parts. Trichome density of resistant clone was not always thicker than that of susceptible ones. On resistant clones, stomatal density was lower and width of stomate pits was narrower, while thickness of epidermis layer and pallisade parenchym were higher. Polyphenol content of resistant clones were higher but lignin and cellulose of both groups were similar. Chitinase activity which has a role in hydrolysis of mycelia cell wall was higher on the resistant clones, but peroxides which has a role in polymeration of lignin biosynthesis was similar between both groups. It is concluded that groups of terpene pinene, decane, myrcene, and octadecanoic acid, thickness of leaf epidermis, density and width of stomata pit, and chitinase activity plays important role in cocoa resistance to VSD. Key words: Theobroma cacaoL., clone, vascular-streak dieback, resistance, leaf

  13. Determination of total phenolic content and antioxidant activitity of methanol extract of Maranta arundinacea L fresh leaf and tuber

    Science.gov (United States)

    Kusbandari, A.; Susanti, H.

    2017-11-01

    Maranta arundinacea L is one of herbaceous plants in Indonesia which have flavonoid content. Flavonoids has antioxidants activity by inhibition of free radical oxidation reactions. The study aims were to determination total phenolic content and antioxidant activity of methanol extract of fresh leaf and tuber of M. arundinacea L by UV-Vis spectrophotometer. The methanol extracts were obtained with maceration and remaseration method of fresh leaves and tubers. The total phenolic content was assayed with visible spectrophotometric using Folin Ciocalteau reagent. The antioxidant activity was assayed with 1,1-diphenyl-2-picrilhidrazil (DPPH) compared to gallic acid. The results showed that methanol extract of tuber and fresh leaf of M. arundinacea L contained phenolic compound with total phenolic content (TPC) in fresh tuber of 3.881±0.064 (% GAE) and fresh leaf is 6.518±0.163 (% b/b GAE). IC50 value from fresh tuber is 1.780±0.0005 μg/mL and IC50 fresh leaf values of 0.274±0.0004 μg/mL while the standard gallic acid is IC50 of 0.640±0.0002 μg/mL.

  14. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  15. Development of the variety for resistance against bacterial leaf-blight in rice with thermal neutrons

    International Nuclear Information System (INIS)

    Nakai, Hirokazu

    1990-01-01

    In search for the development of genes for resistance against bacterial leaf-blight in rice, thermal neutrons generated from the Research Reactor at the Kyoto University have been applied to the breeding. In this paper, the developmental outcome is described, and a potential application of thermal neutrons for breeding the variety of resistance against bacterial leaf-blight in rice is reviewed. When thermal neutrons were delivered to the rice, the ratio of absorbed doses by B-10, which is contained in a small quantity in the plant, was found to be larger than expected. This implies characteristic effects of thermal neutrons on the plant. When boric acid was incorporated into the plant before irradiation, the effect of thermal neutrons per irradiation time was considered to become great. The frequency of mutations for resistance was significantly higher by thermal neutron, as compared with that induced by other mutagens, such as gamma radiation, ethylene-imine, ethyl-methane-sulfonate, and nitroso-methyl-urea. Genetic analysis of mutants for resistance revealed recessive genes and polygenes. Finally, the application of thermal neutrons and other radiations would contribute greatly to a resolution of serious pollution problems in global food and environment. (N.K.)

  16. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  17. The ability of Abelmoschus manihot L. leaf extract in scavenging of free radical DPPH and total flavonoid determination

    Science.gov (United States)

    Sudewi, S.; Lolo, W. A.; Warongan, M.; Rifai, Y.; Rante, H.

    2017-11-01

    Abelmoschus manihot L. has reported to have flavonoids content. This study aims were to determine the ability of A. manihot extract in counteracting free radical DPPH and determine the content of total flavonoids. A. manihot leaf was taken from 2 regions in North Sulawesi, namely Tomohon and Kotamobagu. The maceration was carried out to extract the active compound in a 96% ethanol solvent. Free radical scavenging analysis was carried out by DPPH and determination of its total flavonoid in the extract was measured using spectrophotometri method. The results showed that A. manihot extract from Tomohon and Kotamobagu could counteract free radical of DPPH with value of free radical activity of 88.151 and 88.801 %, respectively. A. manihot leaf from Kotamobagu has higher total flavonoids content 61.763 mg/g compare to Tomohon 46.679 mg/g which presented as quercetin. A. manihot has antioxidant activity.

  18. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  19. Characterization and mapping of LanrBo: a locus conferring anthracnose resistance in narrow-leafed lupin (Lupinus angustifolius L.).

    Science.gov (United States)

    Fischer, Kristin; Dieterich, Regine; Nelson, Matthew N; Kamphuis, Lars G; Singh, Karam B; Rotter, Björn; Krezdorn, Nicolas; Winter, Peter; Wehling, Peter; Ruge-Wehling, Brigitte

    2015-10-01

    A novel and highly effective source of anthracnose resistance in narrow-leafed lupin was identified. Resistance was shown to be governed by a single dominant locus. Molecular markers have been developed, which can be used for selecting resistant genotypes in lupin breeding. A screening for anthracnose resistance of a set of plant genetic resources of narrow-leafed lupin (Lupinus angustifolius L.) identified the breeding line Bo7212 as being highly resistant to anthracnose (Colletotrichum lupini). Segregation analysis indicated that the resistance of Bo7212 is inherited by a single dominant locus. The corresponding resistance gene was given the designation LanrBo. Previously published molecular anchor markers allowed us to locate LanrBo on linkage group NLL-11 of narrow-leafed lupin. Using information from RNAseq data obtained with inoculated resistant vs. susceptible lupin entries as well as EST-sequence information from the model genome Lotus japonicus, additional SNP and EST markers linked to LanrBo were derived. A bracket of two LanrBo-flanking markers allows for precise marker-assisted selection of the novel resistance gene in narrow-leafed lupin breeding programs.

  20. Artemisia annua dried leaf tablets treated malaria resistant to ACT and i.v. artesunate: Case reports.

    Science.gov (United States)

    Daddy, Nsengiyumva Bati; Kalisya, Luc Malemo; Bagire, Pascal Gisenya; Watt, Robert L; Towler, Melissa J; Weathers, Pamela J

    2017-08-15

    Dried leaf Artemisia annua (DLA) has shown efficacy against Plasmodium sp. in rodent studies and in small clinical trials. Rodent malaria also showed resiliency against the evolution of artemisinin drug resistance. This is a case report of a last resort treatment of patients with severe malaria who were responding neither to artemisinin combination therapy (ACT) nor i.v. artesunate. Of many patients treated with ACTs and i.v. artesunate during the 6 mon study period, 18 did not respond and were subsequently treated with DLA Artemisia annua. Patients were given a dose of 0.5g DLA per os, twice daily for 5d. Total adult delivered dose of artemisinin was 55mg. Dose was reduced for body weight under 30kg. Clinical symptoms, e.g. fever, coma etc., and parasite levels in thick blood smears were tracked. Patients were declared cured and released from hospital when parasites were microscopically undetectable and clinical symptoms fully subsided. All patients were previously treated with Coartem® provided through Santé Rurale (SANRU) and following the regimen prescribed by WHO. Of 18 ACT-resistant severe malaria cases compassionately treated with DLA, all fully recovered. Of the 18, this report details two pediatric cases. Successful treatment of all 18 ACT-resistant cases suggests that DLA should be rapidly incorporated into the antimalarial regimen for Africa and possibly wherever else ACT resistance has emerged. Copyright © 2017. Published by Elsevier GmbH.

  1. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L. Gaertn. Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX for tiller production, calmodulin (CaM binding protein for seed yield and pectin methylesterase inhibitor (PMEI for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of

  2. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Vinod, K K; Kalpana, Krishnan; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal

  3. In vitro antioxidant evaluation and total phenolics of methanolic leaf extracts of Nyctanthes arbor-tristis L.

    Science.gov (United States)

    Michael, J Savarimuthu; Kalirajan, A; Padmalatha, C; Singh, A J A Ranjit

    2013-09-01

    To investigate the in vitro antioxidant activity and total phenolic content of the methanolic leaf extract of Nyctanthes arbor-tristis L. (NA). The sample was tested using five in vitro antioxidant methods (1, 1-diphenyl-2-picryl hydrazine radical scavenging activity (DPPH), hydroxyl radical-scavenging activity (-OH), nitric oxide scavenging activity (NO), superoxide radical-scavenging activity, and total antioxidant activity) to evaluate the in vitro antioxidant potential of NA and the total phenolic content (Folin-Ciocalteu method). The extract showed good free radical scavenging property which was calculated as an IC50 value. IC50 (Half maximal inhibitory concentration) of the methanolic extract was found to be 57.93 μg·mL(-1) for DPPH, 98.61 μg·mL(-1) for -OH, 91.74 μg·mL(-1) for NO, and 196.07 μg·mL(-1) for superoxide radical scavenging activity. Total antioxidant capacity of the extract was found to be (1198 ± 24.05) mg ascorbic acid for the methanolic extract. Free radical scavenging activity observed in the extracts of NA showed a concentration-dependent reaction. The in vitro scavenging tested for free radicals was reported to be due to high phenolic content in the leaf extract. The leaf extract of NA showed the highest total phenolic content with a value of 78.48 ± 4.2 equivalent mg TAE/g (tannic acid equivalent). N. arbor-tristis leaf extract exhibited potent free radical scavenging activity. The finding suggests that N. arbor-tristis leaves could be a potential source of natural antioxidant. Copyright © 2013 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  4. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  5. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  6. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  7. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  8. Phytochemical screening, total phenolics and antioxidant activities of bark and leaf extracts of Goniothalamus velutinus (Airy Shaw from Brunei Darussalam

    Directory of Open Access Journals (Sweden)

    Erum Iqbal

    2015-07-01

    Full Text Available Goniothalamus velutinus Airy Shaw belongs to the family Annonaceae which is known to have anticancer, antitumor and many other bioactivities. Natives of Sabah and Sarawak use root decoction of G. velutinus for the treatment of headache and food poisoning while the bark was used as a mosquito repellent. Bark and leaf extracts of this plant, obtained from Brunei Darussalam, were tested for phytochemical and antioxidant activities. Phytochemical screening of plant extracts revealed the presence of alkaloids, steroids, terpenoids and cardiac glycosides. Quantitative determination of total phenolics, total flavonoids, and various in vitro antioxidant activities (DPPH, ABTS and FRAP of methanolic extract was carried out using colorimetric methods. The total phenolic content, expressed as mg of gallic acid equivalent (GAE per gram of extract, was found to be 68 mg GAE/g and 78 mg GAE/g for bark and leaves respectively. The radical scavenging activity measurement, expressed in terms of EC50 (effective concentration of extract in μg/mL that reduces DPPH absorbance to 50% as compared to negative control, for leaf and bark extracts was found to be 155 μg/mL and 204 μg/mL respectively. Standards trolox and ascorbic acid show EC50 value of 5 μg/mL and 4 μg/mL respectively. Trolox equivalent antioxidant capacity (TEAC was measured using the ABTS and FRAP method. Result for bark and leaf extracts was 79 mg and 106 mg trolox equivalent (TE/g respectively for the ABTS method. For FRAP assay, results for bark and leaf extracts were 80 and 89 mg TE/g respectively.

  9. Guava leaf extracts promote glucose metabolism in SHRSP.Z-Leprfa/Izm rats by improving insulin resistance in skeletal muscle.

    Science.gov (United States)

    Guo, Xiangyu; Yoshitomi, Hisae; Gao, Ming; Qin, Lingling; Duan, Ying; Sun, Wen; Xu, Tunhai; Xie, Peifeng; Zhou, Jingxin; Huang, Liansha; Liu, Tonghua

    2013-03-01

    Metabolic syndrome (MS) and type 2 diabetes mellitus (T2DM) have been associated with insulin-resistance; however, the effective therapies in improving insulin sensitivity are limited. This study is aimed at investigating the effect of Guava Leaf (GL) extracts on glucose tolerance and insulin resistance in SHRSP.Z-Leprfa/Izm rats (SHRSP/ZF), a model of spontaneously metabolic syndrome. Male rats at 7 weeks of age were administered with vehicle water or treated by gavage with 2 g/kg GL extracts daily for six weeks, and their body weights, water and food consumption, glucose tolerance, and insulin resistance were measured. Compared with the controls, treatment with GL extracts did not modulate the amounts of water and food consumption, but significantly reduced the body weights at six weeks post treatment. Treatment with GL extracts did not alter the levels of fasting plasma glucose and insulin, but significantly reduced the levels of plasma glucose at 60 and 120 min post glucose challenge, also reduced the values of AUC and quantitative insulin sensitivity check index (QUICKI) at 42 days post treatment. Furthermore, treatment with GL extracts promoted IRS-1, AKT, PI3Kp85 expression, then IRS-1, AMKP, and AKT308, but not AKT473, phosphorylation, accompanied by increasing the ratios of membrane to total Glut 4 expression and adiponectin receptor 1 transcription in the skeletal muscles. These data indicated that GL extracts improved glucose metabolism and insulin sensitivity in the skeletal muscles of rats by modulating the insulin-related signaling.

  10. New Generation of Resistant Sugar Beet Varieties for Advanced Integrated Management of Cercospora Leaf Spot in Central Europe

    OpenAIRE

    Johannes Vogel; Johannes Vogel; Christine Kenter; Carsten Holst; Bernward Märländer

    2018-01-01

    Cercospora leaf spot (CLS) epidemics in sugar beet have been increasing in recent years causing higher use of fungicides. Concomitantly, the availability of effective fungicides is at risk because of resistance development in the fungus, the lack of new active ingredients as well as restrictive approval practices. A key option for an integrated management of CLS is cultivation of resistant varieties. Because of the yield penalty in resistant varieties, acceptance in commercial practice so far...

  11. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  12. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  13. Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

    Science.gov (United States)

    Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

    2016-03-01

    RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

  14. Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents

    International Nuclear Information System (INIS)

    Baloch, M.J.; Baloch, Q.B.

    2005-01-01

    Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)

  15. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  16. The inheritance of resistance to bacterial leaf spot of lettuce caused by Xanthomonas campestris pv. vitians in three lettuce cultivars

    Science.gov (United States)

    Lettuce yields can be reduced by the disease bacterial leaf spot (BLS) caused by the pathogen Xanthomonas campestris pv. vitians (Xcv) and host resistance is the most feasible method to reduce disease losses. The cultivars La Brillante, Pavane, and Little Gem express an incompatible host-pathogen in...

  17. Resistance of solanum species to phytophthora infestans evaluated in the detached-leaf and whole-plant assays

    International Nuclear Information System (INIS)

    Akhtar, K.P.; Saleem, M.Y.; Asghar, M.

    2012-01-01

    The reaction of 82 tomato genotypes belonging to 8 Solanum and a Lycopersicon species against Phytophthora infestans causing late blight was determined using detached-leaf and whole-plant assays. None of the test genotypes was immune or highly resistant. Of the 82 commercial and wild genotypes only TMS-2 (male-sterile and characterized by indeterminate growth) belonging to Lycopersicon esculentum was resistant with severity index of 2.4 in the detached-leaf assay on 0-5 scale (where 5 was highly susceptible) and percent disease index (%DI) of 23.3% under the whole-plant assay. Among the remaining genotypes, 41 were susceptible and 40 were highly susceptible under the detached-leaf assay, while 18 were susceptible and 63 were highly susceptible under the whole-plant assay. However, there was a significant difference in %DI for genotypes under the whole-plant assay. The response of whole-plants to inoculation with P. infestans in the detached-leaf assay was similar in all cases. The overall screening results indicate that TMS-2 is a good source of resistance and it can be useful for the development of tomato hybrid cultivars resistant to late blight. (author)

  18. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  19. In vitro activity of total aqueous ethanol leaf extracts of Ricinus communis on Leishmania major promastigotes

    International Nuclear Information System (INIS)

    Okech, B.G.A.; Irungu, L.W.; Anjili, C.O.; Munyua, J.K.; Njagi, E.N.M.; Rukungu, G.

    2006-01-01

    The activity of aqueous and ethanol extracts of Ricinus communis was tested on Leishmania promastigotes in cell-free culture media. Serial dilutions of the extracts ranging from 500μg/ml, 250 μg/ml and 62.5μg/ml were prepared in triplicate using Schneiders Drosophila medium supplemented with 20% fetal bovine serum in the absence of antibiotics and the growth of approximately 1x 10 (power 6) parasites monitored every two days for a period of 8 days. Parasite density was estimated every two days using the Neuabeur counting chamber. At the end of the 8-day period cell morphology was observed and photographed. Significant growth inihibitory effect was observed on the promastigotes by the aqueous and ethanol extracts especially at high concentrations. However, there was an enhanced growth effect initially thereafter leading to to a rapid decline in promastigote cell population. Flagellar motility was also greatly affected at high concentration and it appeared that there was a linear relationship between flagellar motilities and the level of concentrations. Parasite morphology was affected severely. Most of the cultures observed appeared to have abnormal round morphology. Rosseting was also evident in the extract treated cultures. The aqueous leaf extract interfered with parasite morphology but this was dose dependent. The importance of R. communis plant as a potential source for chemotypes with antileishmanial activity is discussed. (author)

  20. Transcriptome reprogramming of resistant and susceptible peach genotypes during Xanthomonas arboricola pv. pruni early leaf infection.

    Directory of Open Access Journals (Sweden)

    Fabio Gervasi

    Full Text Available Bacterial spot caused by Xanthomonas arboricola pv. pruni (Xap is a major threat to Prunus species worldwide. The molecular mechanisms of peach resistance to Xap during early leaf infection were investigated by RNA-Seq analysis of two Prunus persica cultivars, 'Redkist' (resistant, and 'JH Hale' (susceptible at 30 minutes, 1 and 3 hours-post-infection (hpi. Both cultivars exhibited extensive modulation of gene expression at 30 mpi, which reduced significantly at 1 hpi, increasing again at 3 hpi. Overall, 714 differentially expressed genes (DEGs were detected in 'Redkist' (12% at 30 mpi and 1 hpi and 88% at 3 hpi. In 'JH Hale', 821 DEGs were identified (47% at 30 mpi and 1 hpi and 53% at 3 hpi. Highly up-regulated genes (fold change > 100 at 3 hpi exhibited higher fold change values in 'Redkist' than in 'JH Hale'. RNA-Seq bioinformatics analyses were validated by RT-qPCR. In both cultivars, DEGs included genes with putative roles in perception, signal transduction, secondary metabolism, and transcription regulation, and there were defense responses in both cultivars, with enrichment for the gene ontology terms, 'immune system process', 'defense response', and 'cell death'. There were particular differences between the cultivars in the intensity and kinetics of modulation of expression of genes with putative roles in transcriptional activity, secondary metabolism, photosynthesis, and receptor and signaling processes. Analysis of differential exon usage (DEU revealed that both cultivars initiated remodeling their transcriptomes at 30 mpi; however, 'Redkist' exhibited alternative exon usage for a greater number of genes at every time point compared with 'JH Hale'. Candidate resistance genes (WRKY-like, CRK-like, Copper amine oxidase-like, and TIR-NBS-LRR-like are of interest for further functional characterization with the aim of elucidating their role in Prunus spp. resistance to Xap.

  1. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  2. Genetic diversity and apple leaf spot disease resistance characterization assessed by SSR markers

    Directory of Open Access Journals (Sweden)

    Gustavo H.F. Klabunde

    2016-09-01

    Full Text Available Among the cultivation problems of apple production in Brazil, Apple Leaf Spot (ALS disease represents one of the main breeding challenges. This study aims at analyzing the genetic diversity among 152 apple scion accessions available at the Apple Gene Bank of EPAGRI, located in Caçador, Santa Catarina/ Brazil. Eleven genomic SSR loci were analyzed to assess genetic diversity of ALS resistant and susceptible accessions. Results revealed high genetic diversity of the studied accessions, being 120 exclusive alleles (67 unique from scion accessions resistant to ALS, and a mean PIC of 0.823. The locus Probability of Identity (I ranged from 0.017 to 0.089. The combined I was 4.11 x 10-16, and the Power of Exclusion was 99.99999259%. In addition, the DNA fingerprint patterns will contribute as additional descriptors to select parental for crosses and early identification of apple accessions for breeding purposes, and also for cultivar protection.

  3. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  4. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  5. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  6. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat.

    Science.gov (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie

    2018-01-01

    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  7. Antibacterial effect of mango (Mangifera indica Linn.) leaf extract against antibiotic sensitive and multi-drug resistant Salmonella typhi.

    Science.gov (United States)

    Hannan, Abdul; Asghar, Samra; Naeem, Tahir; Ikram Ullah, Muhammad; Ahmed, Ijaz; Aneela, Syeda; Hussain, Shabbir

    2013-07-01

    Alternative herbal medicine has been used to treat various infections from centuries. Natural plants contain phytoconstituents having similar chemical properties as of synthetic antibiotics. Typhoid fever is a serious infection and failure of its treatment emerged multi-drug resistant (MDR) bugs of Salmonella typhi. Due to multiple and repeated issues with antibiotics efficacy, it became essential to evaluate biological properties of plants from different geographical origins. Mango leaves have been Reported for various medicinal effects like antioxidant, antimicrobial, antihelminthic, antidiabetic and antiallergic etc. Objective of present study was to investigate anti-typhoid properties of acetone mango leaf extract (AMLE) against antibiotic sensitive and MDR S. typhi isolates. A total of 50 isolates of S. typhi including MDR (n=30) and antibiotic sensitive (n=20) were investigated. Staphylococcus aureus (ATCC 25923) and Salmonella typhimurium (ATCC14028) were used as quality control strains. AMLE was prepared and its antibacterial activity was evaluated by agar well diffusion screening method and minimum inhibitory concentration (MIC), by agar dilution technique. Zone of inhibition (mm) of AMLE against MDR and antibiotic sensitive isolates was 18±1.5mm (Mean±S.D). Zone of S. aureus (ATCC 25923) and S. typhimurium (ATCC14028) was 20±1.5mm (Mean±S.D). MIC of AMLE was Reported in range from 10-50 mg/ml. The present study described the inhibitory effects of mango leaves against S. typhi.

  8. Oreochromis mossambicus diet supplementation with Psidium guajava leaf extracts enhance growth, immune, antioxidant response and resistance to Aeromonas hydrophila.

    Science.gov (United States)

    Gobi, Narayanan; Ramya, Chinnu; Vaseeharan, Baskaralingam; Malaikozhundan, Balasubramanian; Vijayakumar, Sekar; Murugan, Kadarkarai; Benelli, Giovanni

    2016-11-01

    In this research, we focused on the efficacy of aqueous and ethanol leaf extracts of Psidium guajava L. (guava) based experimental diets on the growth, immune, antioxidant and disease resistance of tilapia, Oreochromis mossambicus following challenge with Aeromonas hydrophila. The experimental diets were prepared by mixing powdered (1, 5 and 10 mg/g) aqueous and ethanol extract of guava leaf with commercial diet. The growth (FW, FCR and SGR), non-specific cellular immune (myeloperoxidase activity, reactive oxygen activity and reactive nitrogen activity) humoral immune (complement activity, antiprotease, alkaline phosphatase activity and lysozyme activity) and antioxidant enzyme responses (SOD, GPX, and CAT) were examined after 30 days of post-feeding. A significant enhancement in the biochemical and immunological parameters of fish were observed fed with experimental diets compared to control. The dietary supplementation of P. guajava leaf extract powder for 30 days significantly reduced the mortality and increased the disease resistance of O. mossambicus following challenge with A. hydrophila at 50 μl (1 × 10 7  cells ml -1 ) compared to control after post-infection. The results suggest that the guava leaf extract could be used as a promising feed additive in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Modelo matemático para estimativa da área foliar total de bananeira 'Prata-anã' Esteem method of total leaf area of 'Prata anã' banana tree

    Directory of Open Access Journals (Sweden)

    Moises Zucoloto

    2008-12-01

    Full Text Available O objetivo deste trabalho foi desenvolver um modelo para estimar a área foliar total de bananeira, cultivar Prata-Anã, utilizando dimensões lineares da terceira folha, como o comprimento, a largura e o número total de folhas na emissão da inflorescência. As regressões lineares foram determinadas considerando-se a área foliar total de cada planta (AFT como variável dependente e o comprimento (C e a largura (L da terceira folha, o produto de CxL, o número total de folhas por planta (N e o produto de CxLxN como variáveis independentes. O modelo linear que melhor estimou a área foliar total (AFTe da bananeira 'Prata-Anã', ao nível de 5% de significância com R² de 0,89, foi a equação AFTe = 0,5187(CxLxN + 9603,5.The objective of this work was to estimate the total leaf area of banana, cultivar Prata Anã, according to the linear dimensions of the third leaf, such as the length and the width and the total number of leves in the inflorescence emission. The linear regressions were determined considering total leaf area of each plant (AFT such as dependent variable and the length (C and the width (L of the third leaf, the product of CxL, the total number of leaf per plant (N and the product of CxLxN as independent variables. The best linear model that estimated the total leaf area (AFTe of banana 'Prata Anã' at the level of 5% of significance with R² of 0,89 was the equation AFTe = 0.5187 (CxLxN + 9603.5.

  10. Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

    Directory of Open Access Journals (Sweden)

    Iftikhar Ali Khan

    2016-02-01

    Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

  11. Primisulfuron herbicide-resistant tobacco plants: mutant selection in vitro by adventitious shoot formation from cultured leaf discs

    International Nuclear Information System (INIS)

    Harms, C.T.; DiMaio, J.J.; Jayne, S.M.; Middlesteadt, L.A.; Negrotto, D.V.; Thompson-Taylor, H.; Montoya, A.L.

    1991-01-01

    A simple procedure has been developed for the rapid and direct selection of herbicide-resistant mutant plants. The procedure uses adventitious shoot formation from suitable explants, such as leaf discs, on a shoot-inducing culture medium containing a toxic herbicide concentration. Resistant green shoots were thus isolated from tobacco (Nicotiana tabacum L.) leaf explants cultured on medium containing 100 μg 1−1 primisulfuron, a new sulfonylurea herbicide. Resistant shoots were recovered from both haploid and diploid explants after UV mutagenesis, as well as without mutagenic treatment. Three mutant plants of separate origin were further analyzed biochemically and genetically. Their acetohydroxyacid synthase (AHAS) enzyme activity was less inhibited by sulfonylurea herbicides than that of unselected, sensitive wild type plants. The extent of inhibition of the AHAS enzyme among the three mutants was different for different sulfonylurea and imidazolinone herbicides suggesting different sites were affected by each mutation. Herbicide tolerance was scored for germinating seedling populations and was found to be inherited as a single dominant nuclear gene. Adventitious shoot formation from cultured leaf discs was used to determine the cross tolerance of mutant plants to various herbicidal AHAS inhibitors. The usefulness of this rapid and direct scheme for mutant selection based on adventitious shoot formation or embryogenesis is discussed. (author)

  12. Evaluation of Antioxidant Activity, Total Flavonoids, Tannins and Phenolic Compounds in Psychotria Leaf Extracts

    Directory of Open Access Journals (Sweden)

    Anelise Samara Nazari Formagio

    2014-11-01

    Full Text Available The antioxidant activity of Psychotria carthagenensis, P. leiocarpa, P. capillacea and P. deflexa (Rubiaceae extracts were investigated, and the concentrations of total phenolics, flavonoids, condensed tannins and flavonols were determined. The chemical compositions of the extracts were investigated using the high performance liquid chromatography (HPLC/PAD method. We used 1,1-diphenyl-1-picrylhydrazyl free radical (DPPH, β-Carotene bleaching and 2,2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS radical cations to determine antioxidant activity. The ability to scavenge radical was measured in these experiments by the discoloration of the solution. Concentrations of constituents were measured spectrophotometrically. P. carthagenensis and P. capillacea exhibited the highest antioxidant activity, in the DPPH test, β-carotene bleaching and ABTS system. The highest phenolic, flavonoid, condensed tannin and flavonol concentration was found in P. carthagenensis and P. capillacea extracts. HPLC-PDA analysis of P. carthagenensis and P. capillacea revealed hydroxycinnamic acid (p-coumaric acid. This is the first report on the antioxidant properties and constituent analysis of these Psychotria extracts.

  13. Influence of Growth Stage and Leaf Age on Expression of the Components of Partial Resistance of Faba Bean to Botrytis fabae Sard.

    Directory of Open Access Journals (Sweden)

    A. Bouhassan

    2004-12-01

    Full Text Available In detached leaf tests on faba bean (Vicia faba L., genotypes partially resistant and susceptible to Botrytis fabae were examined. Expression of four components of partial resistance to a virulent isolate of B. fabae differed depending on the plant age and the leaf age of the genotypes. The incubation period of resistant genotypes at the podding stage was longer than that of susceptible genotypes at the same stage. The area under disease progress curve (AUDPC of the lesion size increased from the seedling to the flowering stage but declined at the podding stage in all genotypes. Differences between resistant and susceptible genotypes for lesion size were significant except on old leaves from plants at the podding stage. The latent period decreased, and spore production increased with increasing growth and leaf age but there was significant interaction with the genotype. These last two components of partial resistance were more clearly expressed at all growth stages on FRY167 (highly resistant but were expressed only at the seedling and podding stages on FRY7 (resistant. The resistant line BPL710 was not significantly different from the susceptible genotypes for the latent period at any growth stage, and for spore production at the seedling and flowering stages. Leaf age affected all genotypes, but with a significant interaction between leaf age and growth stage. Components of partial resistance were more strongly expressed on young leaves from plants at the seedling or flowering stage.

  14. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  15. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  16. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  17. Performance of cotton leaf curl virus resistant intrahirsutum f/sub 1/ hybrids

    International Nuclear Information System (INIS)

    Baloch, M.J.

    2004-01-01

    The first and foremost effort to combat the devastating cotton leaf curl virus (clcv) disease would be to utilize those clcv resistant germplasm in a hybridization programme which can enhance the possibilities of selecting desirable progenies from segregating populations. In this connection, 16 clcv intrahirsutum F1 hybrids were developed and evaluated for their performance. The hybrids, on an average gave an increase of 26.02 % in seed cotton yield; 11.52 % in bolls per plant; 14.23 % in boll weight; 4.28 % in lint; 3.89 % in fibre length and 8.21 % in earliness against the average of parents. However, among the hybrids, the top three scoring for yield were, BH.121 x Cyto.9/91, Cyto.9/91 x CRIS-226 and VH-137 x CRIS-226. The number of bolls per plant was found to be a major contributing factor for increased yield because the hybrids which set higher bolls correspondingly gave higher yields. Boll weight was not regarded as an important attribute to increase yield because hybrids with moderate boll sizes were among the top three high yielders. For lint %, the hybrids CRIS-129 x LRA-5166 and FH-901 x VH-137 were first for fibre length, whereas CRIS-121 x Cyto.51 and BH-124 x CIM-448 were among the top two rankers. Regarding earliness, the hybrids CRIS-121 x Cyto. 51 gave the highest boll opening percent and next in order was the hybrid VH-137 x DNH-49. Our results thus generally suggest that although the best three hybrids were desirable for other traits, the choice of the hybrids may be made on the priority for characters to be bred. (author)

  18. Comparative transcriptome profiling of a resistant vs. susceptible tomato (Solanum lycopersicum cultivar in response to infection by tomato yellow leaf curl virus.

    Directory of Open Access Journals (Sweden)

    Tianzi Chen

    Full Text Available Tomato yellow leaf curl virus (TYLCV threatens tomato production worldwide by causing leaf yellowing, leaf curling, plant stunting and flower abscission. The current understanding of the host plant defense response to this virus is very limited. Using whole transcriptome sequencing, we analyzed the differential gene expression in response to TYLCV infection in the TYLCV-resistant tomato breeding line CLN2777A (R and TYLCV-susceptible tomato breeding line TMXA48-4-0 (S. The mixed inoculated samples from 3, 5 and 7 day post inoculation (dpi were compared to non-inoculated samples at 0 dpi. Of the total of 34831 mapped transcripts, 209 and 809 genes were differentially expressed in the R and S tomato line, respectively. The proportion of up-regulated differentially expressed genes (DEGs in the R tomato line (58.37% was higher than that in the S line (9.17%. Gene ontology (GO analyses revealed that similar GO terms existed in both DEGs of R and S lines; however, some sets of defense related genes and their expression levels were not similar between the two tomato lines. Genes encoding for WRKY transcriptional factors, R genes, protein kinases and receptor (-like kinases which were identified as down-regulated DEGs in the S line were up-regulated or not differentially expressed in the R line. The up-regulated DEGs in the R tomato line revealed the defense response of tomato to TYLCV infection was characterized by the induction and regulation of a series of genes involved in cell wall reorganization, transcriptional regulation, defense response, ubiquitination, metabolite synthesis and so on. The present study provides insights into various reactions underlining the successful establishment of resistance to TYLCV in the R tomato line, and helps in the identification of important defense-related genes in tomato for TYLCV disease management.

  19. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Mapping Late Leaf Spot Resistance in Peanut (Arachis hypogaea Using QTL-seq Reveals Markers for Marker-Assisted Selection

    Directory of Open Access Journals (Sweden)

    Josh Clevenger

    2018-02-01

    Full Text Available Late leaf spot (LLS; Cercosporidium personatum is a major fungal disease of cultivated peanut (Arachis hypogaea. A recombinant inbred line population segregating for quantitative field resistance was used to identify quantitative trait loci (QTL using QTL-seq. High rates of false positive SNP calls using established methods in this allotetraploid crop obscured significant QTLs. To resolve this problem, robust parental SNPs were first identified using polyploid-specific SNP identification pipelines, leading to discovery of significant QTLs for LLS resistance. These QTLs were confirmed over 4 years of field data. Selection with markers linked to these QTLs resulted in a significant increase in resistance, showing that these markers can be immediately applied in breeding programs. This study demonstrates that QTL-seq can be used to rapidly identify QTLs controlling highly quantitative traits in polyploid crops with complex genomes. Markers identified can then be deployed in breeding programs, increasing the efficiency of selection using molecular tools.Key Message: Field resistance to late leaf spot is a quantitative trait controlled by many QTLs. Using polyploid-specific methods, QTL-seq is faster and more cost effective than QTL mapping.

  1. A Simple Paper-Based Microfluidic Device for the Determination of the Total Amino Acid Content in a Tea Leaf Extract

    Science.gov (United States)

    Cai, Longfei; Wu, Yunying; Xu, Chunxiu; Chen, Zefeng

    2013-01-01

    An experiment was developed to demonstrate a microfluidic device in the analytical chemistry (instrumental analysis) laboratory. Students made the paper-based microfluidic device with a wax pen and a piece of filter paper and used it to determine the total quantity of amino acids in a green tea leaf

  2. Drought resistance in early and late secondary successional species from a tropical dry forest: the interplay between xylem resistance to embolism, sapwood water storage and leaf shedding.

    Science.gov (United States)

    Pineda-García, Fernando; Paz, Horacio; Meinzer, Frederick C

    2013-02-01

    The mechanisms of drought resistance that allow plants to successfully establish at different stages of secondary succession in tropical dry forests are not well understood. We characterized mechanisms of drought resistance in early and late-successional species and tested whether risk of drought differs across sites at different successional stages, and whether early and late-successional species differ in resistance to experimentally imposed soil drought. The microenvironment in early successional sites was warmer and drier than in mature forest. Nevertheless, successional groups did not differ in resistance to soil drought. Late-successional species resisted drought through two independent mechanisms: high resistance of xylem to embolism, or reliance on high stem water storage capacity. High sapwood water reserves delayed the effects of soil drying by transiently decoupling plant and soil water status. Resistance to soil drought resulted from the interplay between variations in xylem vulnerability to embolism, reliance on sapwood water reserves and leaf area reduction, leading to a tradeoff of avoidance against tolerance of soil drought, along which successional groups were not differentiated. Overall, our data suggest that ranking species' performance under soil drought based solely on xylem resistance to embolism may be misleading, especially for species with high sapwood water storage capacity. © 2012 Blackwell Publishing Ltd.

  3. Association Mapping of Quantitative Trait Loci in Spring Wheat Landraces Conferring Resistance to Bacterial Leaf Streak and Spot Blotch

    Directory of Open Access Journals (Sweden)

    Tika B. Adhikari

    2012-03-01

    Full Text Available Bacterial leaf streak (BLS, caused by pv. (Smith et al. Bragard et al., and spot blotch (SB, caused by (S. Ito & Kurib. Drechs. ex Dastur, are two emerging diseases of wheat ( L.. To achieve sustainable disease management strategies and reduce yield losses, identifying new genes that confer quantitative resistance would benefit resistance breeding efforts. The main objective of this study was to use association mapping (AM with 832 polymorphic Diversity Arrays Technology (DArT markers to identify genomic regions associated with resistance to BLS and SB in 566 spring wheat landraces. From data analysis of this diverse panel of wheat accessions, we discovered five novel genomic regions significantly associated with resistance to BLS on chromosomes 1A, 4A, 4B, 6B, and 7D. Similarly, four genomic regions were found to be associated with resistance to SB on chromosomes 1A, 3B, 7B, and 7D. A high degree of linkage disequilibrium (LD decayed over short genetic distance in the set of wheat accessions studied, and some of these genomic regions appear to be involved in multiple disease resistance (MDR. These results suggest that the AM approach provides a platform for discovery of resistance conditioned by multiple genes with quantitative effects, which could be validated and deployed in wheat breeding programs.

  4. High-resolution mapping and characterization of qRgls2, a major quantitative trait locus involved in maize resistance to gray leaf spot.

    Science.gov (United States)

    Xu, Ling; Zhang, Yan; Shao, Siquan; Chen, Wei; Tan, Jing; Zhu, Mang; Zhong, Tao; Fan, Xingming; Xu, Mingliang

    2014-08-31

    Gray leaf spot (GLS) caused by Cercospora zeae-maydis (Czm) or Cercospora zeina (Cz) is a devastating maize disease and results in substantial yield reductions worldwide. GLS resistance is a quantitatively inherited trait. The development and cultivation of GLS-resistant maize hybrids are the most cost-effective and efficient ways to control this disease. We previously detected a major GLS resistance QTL, qRgls2, in bin 5.03-04, which spans the whole centromere of chromosome 5 encompassing a physical distance of ~110-Mb. With advanced backcross populations derived from the cross between the resistant Y32 and susceptible Q11 inbred lines, a sequential recombinant-derived progeny testing strategy was adapted to fine map qRgls2. We narrowed the region of qRgls2 from an initial ~110-Mb to an interval of ~1-Mb, flanked by the markers G346 and DD11. qRgls2 showed predominantly additive genetic effects and significantly increased the resistance percentage by 20.6 to 24.6% across multiple generations. A total of 15 genes were predicted in the mapped region according to the 5b.60 annotation of the maize B73 genome v2. Two pieces of the mapped qRgls2 region shared collinearity with two distant segments on maize chromosome 4. qRgls2, a major QTL involved in GLS resistance, was mapped to a ~1-Mb region close to the centromere of chromosome 5. There are 15 predicted genes in the mapped region. It is assumed that qRgls2 could be widely used to improve maize resistance to GLS.

  5. Total resistance of native bacteria as an indicator of changes in the water environment

    Energy Technology Data Exchange (ETDEWEB)

    Harnisz, Monika [Department of Environmental Microbiology, University of Warmia and Mazury in Olsztyn, Prawocheńskiego 1, 10-957 Olsztyn (Poland)

    2013-03-15

    This study analyzes changes in the total (intrinsic and acquired) resistance of autochthonous bacteria in a river which is a receiver of treated wastewater. In the analyzed samples, tetracycline contamination levels were low and characteristic of surface water bodies. An increase in the populations of tetracycline-resistant and fluoroquinolone-resistant microorganisms was noted in downstream river water samples in comparison with upstream river water samples, but the above trend was not observed in bacteria resistant to macrolides and β-lactams. The counts of doxycycline-resistant bacteria (DOX{sup R}) were significantly correlated with doxycycline levels. The minimum inhibitory concentrations (MICs) for doxycycline in DOX{sup R} isolates were higher in downstream river water than in upstream river water samples. The discharge of treated wastewater had no effect on the multi-drug resistance of oxytetracycline-resistant and doxycycline-resistant isolates. The results of the experiment indicate that the presence of doxycycline-resistant bacteria is a robust indicator of anthropogenic stress in river water. -- Highlights: ► The total resistance of native bacteria in river which is a receiver of treated wastewater was analyzed. ► Tetracyclines contamination levels were low. ► The counts of doxycycline-resistant bacteria were correlated with doxycycline levels. -- The presence of doxycycline-resistant bacteria in rivers can be a robust indicator of anthropogenic stress.

  6. Total resistance of native bacteria as an indicator of changes in the water environment

    International Nuclear Information System (INIS)

    Harnisz, Monika

    2013-01-01

    This study analyzes changes in the total (intrinsic and acquired) resistance of autochthonous bacteria in a river which is a receiver of treated wastewater. In the analyzed samples, tetracycline contamination levels were low and characteristic of surface water bodies. An increase in the populations of tetracycline-resistant and fluoroquinolone-resistant microorganisms was noted in downstream river water samples in comparison with upstream river water samples, but the above trend was not observed in bacteria resistant to macrolides and β-lactams. The counts of doxycycline-resistant bacteria (DOX R ) were significantly correlated with doxycycline levels. The minimum inhibitory concentrations (MICs) for doxycycline in DOX R isolates were higher in downstream river water than in upstream river water samples. The discharge of treated wastewater had no effect on the multi-drug resistance of oxytetracycline-resistant and doxycycline-resistant isolates. The results of the experiment indicate that the presence of doxycycline-resistant bacteria is a robust indicator of anthropogenic stress in river water. -- Highlights: ► The total resistance of native bacteria in river which is a receiver of treated wastewater was analyzed. ► Tetracyclines contamination levels were low. ► The counts of doxycycline-resistant bacteria were correlated with doxycycline levels. -- The presence of doxycycline-resistant bacteria in rivers can be a robust indicator of anthropogenic stress

  7. Total belowground carbon flux in subalpine forests is related to leaf area index, soil nitrogen, and tree height

    Science.gov (United States)

    Berryman, Erin Michele; Ryan, Michael G.; Bradford, John B.; Hawbaker, Todd J.; Birdsey, R.

    2016-01-01

    In forests, total belowground carbon (C) flux (TBCF) is a large component of the C budget and represents a critical pathway for delivery of plant C to soil. Reducing uncertainty around regional estimates of forest C cycling may be aided by incorporating knowledge of controls over soil respiration and TBCF. Photosynthesis, and presumably TBCF, declines with advancing tree size and age, and photosynthesis increases yet C partitioning to TBCF decreases in response to high soil fertility. We hypothesized that these causal relationships would result in predictable patterns of TBCF, and partitioning of C to TBCF, with natural variability in leaf area index (LAI), soil nitrogen (N), and tree height in subalpine forests in the Rocky Mountains, USA. Using three consecutive years of soil respiration data collected from 22 0.38-ha locations across three 1-km2 subalpine forested landscapes, we tested three hypotheses: (1) annual soil respiration and TBCF will show a hump-shaped relationship with LAI; (2) variability in TBCF unexplained by LAI will be related to soil nitrogen (N); and (3) partitioning of C to TBCF (relative to woody growth) will decline with increasing soil N and tree height. We found partial support for Hypothesis 1 and full support for Hypotheses 2 and 3. TBCF, but not soil respiration, was explained by LAI and soil N patterns (r2 = 0.49), and the ratio of annual TBCF to TBCF plus aboveground net primary productivity (ANPP) was related to soil N and tree height (r2 = 0.72). Thus, forest C partitioning to TBCF can vary even within the same forest type and region, and approaches that assume a constant fraction of TBCF relative to ANPP may be missing some of this variability. These relationships can aid with estimates of forest soil respiration and TBCF across landscapes, using spatially explicit forest data such as national inventories or remotely sensed data products.

  8. Genetic characterization and linkage disequilibrium mapping of resistance to gray leaf spot in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Liyu Shi

    2014-04-01

    Full Text Available Gray leaf spot (GLS, caused by Cercospora zeae-maydis, is an important foliar disease of maize (Zea mays L. worldwide, resistance to which is controlled by multiple quantitative trait loci (QTL. To gain insights into the genetic architecture underlying the resistance to this disease, an association mapping population consisting of 161 inbred lines was evaluated for resistance to GLS in a plant pathology nursery at Shenyang in 2010 and 2011. Subsequently, a genome-wide association study, using 41,101 single-nucleotide polymorphisms (SNPs, identified 51 SNPs significantly (P < 0.001 associated with GLS resistance, which could be converted into 31 QTL. In addition, three candidate genes related to plant defense were identified, including nucleotide-binding-site/leucine-rich repeat, receptor-like kinase genes similar to those involved in basal defense. Two genic SNPs, PZE-103142893 and PZE-109119001, associated with GLS resistance in chromosome bins 3.07 and 9.07, can be used for marker-assisted selection (MAS of GLS resistance. These results provide an important resource for developing molecular markers closely linked with the target trait, enhancing breeding efficiency.

  9. A new gene, developed through mutagenesis with thermal neutrons, for resistance of rice to bacterial leaf blight

    International Nuclear Information System (INIS)

    Nakai, H.; Shimozawa, H.; Saito, M.

    1992-01-01

    Dry seed lots of a rice variety, Harebare, susceptible to bacterial leaf blight (BLB), were treated with thermal neutrons with and without pre-treatment of the seeds by boron-enrichment, gamma-rays and nitroso-methyl-urea (NMU). The selections were made on M 2 -M 3 materials by inoculation of Japanese BLB race III, with the result that several BLB resistant mutants to race III and the other differential races could be obtained. Mutagenic efficiency of thermal neutrons to the seeds without boron-enrichment for induction of BLB resistant mutants was found to be significantly higher than that of the other mutagens. Four mutant lines of all the selected ones were analyzed for genes for BLB resistance through cross tests between the mutants and the original variety. Harebare, indicating that the resistance in the mutants was conditioned by single recessive gene(s). The mutant designated 86M95 was especially noted for its gene conferring complete (or durable) resistance to multiple BLB races. The 86M95 mutant or the gene may be of practical value for breeding of rice for BLB resistance. (author)

  10. Genetic diversity/impurity estimation in sources of natural resistance against cotton leaf curl disease in pakistan

    International Nuclear Information System (INIS)

    Sarwar, G.

    2007-01-01

    Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)

  11. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    Science.gov (United States)

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

  12. Total antioxidant and oxidant status in obese children without insulin resistance

    OpenAIRE

    Ayşegül Doğan Demir; Ufuk Erenberk; İlker Tolga Özgen; Emin Özkaya; Aysel Vahapoğlu Türkmen; M. Ruşen Dündaröz; Özcan Erel

    2014-01-01

    Objective: Oxidative stress in obese children may lead in adulthood serious conditions such as coronary heart diseases or type 2 diabetes mellitus. In childhood oxidative stress is associated with insulin resistance or extreme obesity. In this study, we aimed to evaluate oxidative stress status in moderately obese children without insulin resistance. Methods: A total of 38 obese children (21 male, 17 female) without insulin resistance, mean aged 9.4±3.8 years) and 51 normal weight children...

  13. Induced resistance to septorial leaf blotch disease in wheat cv. 'SaberBeg' and its hybrids by fast neutrons

    International Nuclear Information System (INIS)

    Ibrahim, I.; Al-Marooff, E.; AI-Janabi, A.; Mahmood, A.; AI-Aubaidi

    1990-01-01

    Full text: Seeds of 'SaberBeg' and its hybrids in F 2 generation were irradiated with different doses of fast neutrons. 1324 variants selected from M 2 and F 4 M 2 were evaluated for resistance to septorial leaf blotch (Septoria tritici Rob ex Desm) with artificial inoculation under field conditions, through 3 successive generations. Results revealed 55 variants moderately resistant, along with better agronomic traits such as stiff stem, earliness in maturity and good adaption to semiarid zone conditions. The highest number of such variants was obtained from irradiated 'SaberBeg' x 'Mexipak' and 'SaberBeg' x ('Mexipak' x 'AbuGhraib 4'), while the lowest number was found from 'SaberBeg' x 'Araz'. (author)

  14. Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato

    KAUST Repository

    Mahfouz, Magdy M.

    2017-12-22

    CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

  15. New Generation of Resistant Sugar Beet Varieties for Advanced Integrated Management of Cercospora Leaf Spot in Central Europe.

    Science.gov (United States)

    Vogel, Johannes; Kenter, Christine; Holst, Carsten; Märländer, Bernward

    2018-01-01

    Cercospora leaf spot (CLS) epidemics in sugar beet have been increasing in recent years causing higher use of fungicides. Concomitantly, the availability of effective fungicides is at risk because of resistance development in the fungus, the lack of new active ingredients as well as restrictive approval practices. A key option for an integrated management of CLS is cultivation of resistant varieties. Because of the yield penalty in resistant varieties, acceptance in commercial practice so far has been low. The aim of our study was to characterize recent sugar beet varieties registered in Germany in terms of resistance and tolerance to CLS and their value for integrated pest management. The genetic basis of CLS resistance in varieties is protected by intellectual property rights even after variety registration and not open to the public due to economic competition. To gain reliable data for cultivation, varieties have to be tested for their resistance traits under field conditions at varying levels of infection with Cercospora beticola . In collaboration with variety related stakeholders, 15 sugar beet varieties were tested in 49 field trials in Germany from 2014 to 2016 for their yield response to CLS. The trials were set up in a split-plot design with and without infection (i.e., with and without fungicide). The classification of varietal reaction to CLS is based on symptomatic leaf area (susceptibility) and the resulting relative yield loss (tolerance). Since the relation between both parameters varied among varieties, it was used as an additional parameter to describe tolerance. On this basis, three groups of varieties were identified. They can be characterized as a susceptible, a resistant and a presumably tolerant cluster. A comparison of the data with an older dataset originating from 2009 to 2011 revealed that yield performance of recent varieties with resistance to C. beticola caught up with susceptible varieties due to breeding progress. They showed no

  16. Two alternative recessive quantitative trait loci influence resistance to spring black stem and leaf spot in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Oliver Richard P

    2008-03-01

    Full Text Available Abstract Background Knowledge of the genetic basis of plant resistance to necrotrophic pathogens is incomplete and has been characterised in relatively few pathosystems. In this study, the cytology and genetics of resistance to spring black stem and leaf spot caused by Phoma medicaginis, an economically important necrotrophic pathogen of Medicago spp., was examined in the model legume M. truncatula. Results Macroscopically, the resistant response of accession SA27063 was characterised by small, hypersensitive-like spots following inoculation while the susceptible interaction with accessions A17 and SA3054 showed necrotic lesions and spreading chlorosis. No unique cytological differences were observed during early infection (2 populations segregating for resistance to spring black stem and leaf spot were established between SA27063 and the two susceptible accessions, A17 and SA3054. The cross between SA27063 and A17 represented a wider cross than between SA27063 and SA3054, as evidenced by higher genetic polymorphism, reduced fertility and aberrant phenotypes of F2 progeny. In the SA27063 × A17 F2 population a highly significant quantitative trait locus (QTL, LOD = 7.37; P Phoma medicaginis one (rnpm1 genetically mapped to the top arm of linkage group 4 (LG4. rnpm1 explained 33.6% of the phenotypic variance in the population's response to infection depicted on a 1–5 scale and was tightly linked to marker AW256637. A second highly significant QTL (LOD = 6.77; P rnpm2, was located on the lower arm of LG8 in the SA27063 × SA3054 map. rnpm2 explained 29.6% of the phenotypic variance and was fine mapped to a 0.8 cM interval between markers h2_16a6a and h2_21h11d. rnpm1 is tightly linked to a cluster of Toll/Interleukin1 receptor-nucleotide binding site-leucine-rich repeat (TIR-NBS-LRR genes and disease resistance protein-like genes, while no resistance gene analogues (RGAs are apparent in the genomic sequence of the reference accession A17 at the

  17. Cytotoxicity and apoptosis induced by alfalfa (Medicago sativa) leaf extracts in sensitive and multidrug-resistant tumor cells.

    Science.gov (United States)

    Gatouillat, Grégory; Magid, Abdulmagid Alabdul; Bertin, Eric; Okiemy-Akeli, Marie-Genevieve; Morjani, Hamid; Lavaud, Catherine; Madoulet, Claudie

    2014-01-01

    Alfalfa (Medicago sativa) has been used to cure a wide variety of ailments. However, only a few studies have reported its anticancer effects. In this study, extracts were obtained from alfalfa leaves and their cytotoxic effects were assessed on several sensitive and multidrug-resistant tumor cells lines. Using the mouse leukaemia P388 cell line and its doxorubicin-resistant counterpart (P388/DOX), we showed that the inhibition of cell growth induced by alfalfa leaf extracts was mediated through the induction of apoptosis, as evidenced by DNA fragmentation analysis. The execution of programmed cell death was achieved via the activation of caspase-3, leading to PARP cleavage. Fractionation of toluene extract (To-1), the most active extract obtained from crude extract, led to the identification of 3 terpene derivatives and 5 flavonoids. Among them, (-)-medicarpin, (-)-melilotocarpan E, millepurpan, tricin, and chrysoeriol showed cytotoxic effects in P388 as well as P388/DOX cells. These results demonstrate that alfalfa leaf extract may have interesting potential in cancer chemoprevention and therapy.

  18. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  19. Association Mapping of Total Carotenoids in Diverse Soybean Genotypes Based on Leaf Extracts and High-Throughput Canopy Spectral Reflectance Measurements.

    Directory of Open Access Journals (Sweden)

    Arun Prabhu Dhanapal

    Full Text Available Carotenoids are organic pigments that are produced predominantly by photosynthetic organisms and provide antioxidant activity to a wide variety of plants, animals, bacteria, and fungi. The carotenoid biosynthetic pathway is highly conserved in plants and occurs mostly in chromoplasts and chloroplasts. Leaf carotenoids play important photoprotective roles and targeted selection for leaf carotenoids may offer avenues to improve abiotic stress tolerance. A collection of 332 soybean [Glycine max (L. Merr.] genotypes was grown in two years and total leaf carotenoid content was determined using three different methods. The first method was based on extraction and spectrophotometric determination of carotenoid content (eCaro in leaf tissue, whereas the other two methods were derived from high-throughput canopy spectral reflectance measurements using wavelet transformed reflectance spectra (tCaro and a spectral reflectance index (iCaro. An association mapping approach was employed using 31,253 single nucleotide polymorphisms (SNPs to identify SNPs associated with total carotenoid content using a mixed linear model based on data from two growing seasons. A total of 28 SNPs showed a significant association with total carotenoid content in at least one of the three approaches. These 28 SNPs likely tagged 14 putative loci for carotenoid content. Six putative loci were identified using eCaro, five loci with tCaro, and nine loci with iCaro. Three of these putative loci were detected by all three carotenoid determination methods. All but four putative loci were located near a known carotenoid-related gene. These results showed that carotenoid markers can be identified in soybean using extract-based as well as by high-throughput canopy spectral reflectance-based approaches, demonstrating the utility of field-based canopy spectral reflectance phenotypes for association mapping.

  20. Leaf-morphology-assisted selection for resistance to two-spotted spider mite Tetranychus urticae Koch (Acari: Tetranychidae) in carnations (Dianthus caryophyllus L).

    Science.gov (United States)

    Seki, Kousuke

    2016-10-01

    The development of a cultivar resistant to the two-spotted spider mite has provided both ecological and economic benefits to the production of cut flowers. This study aimed to clarify the mechanism of resistance to mites using an inbred population of carnations. In the resistant and susceptible plants selected from an inbred population, a difference was recognised in the thickness of the abaxial palisade tissue by microscopic examination of the damaged leaf. Therefore, it was assumed that mites displayed feeding preferences within the internal leaf structure of the carnation leaf. The suitability of the host plant for mites was investigated using several cultivars selected using an index of the thickness from the abaxial leaf surface to the spongy tissue. The results suggested that the cultivar associated with a thicker abaxial tissue lowered the intrinsic rate of natural increase of the mites. The cultivars with a thicker abaxial tissue of over 120 µm showed slight damage in the field test. The ability of mites to feed on the spongy tissue during an early life stage from hatching to adult emergence was critical. It was possible to select a cultivar that is resistant to mites under a real cultivation environment by observing the internal structure of the leaf. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  2. Feasible Management of Southern Corn Leaf Blight via Induction of Systemic Resistance by Bacillus cereus C1L in Combination with Reduced Use of Dithiocarbamate Fungicides

    Directory of Open Access Journals (Sweden)

    Yi-Ru Lai

    2016-10-01

    Full Text Available Dithiocarbamate fungicides such as maneb and mancozeb are widely used nonsystemic protectant fungicides to control various plant fungal diseases. Dithiocarbamate fungicides should be frequently applied to achieve optimal efficacy of disease control and avoid either decline in effectiveness or wash-off from leaf surface. Dithiocarbamates are of low resistance risk but have the potential to cause human neurological diseases. The objective of this study was to develop a strategy to effectively control plant disease with reduced use of dithiocarbamtes. Southern corn leaf blight was the model pathosystem for the investigation. When corn plants were drench-treated with Bacillus cereus C1L, a rhizobacterium able to induce systemic resistance in corn plants against southern leaf blight, frequency of spraying dithiocarbamate fungicides could be decreased. The treatment of B. cereus C1L was able to protect maize from southern leaf blight while residues of dithiocarbamates on leaf surface were too low to provide sufficient protection. On the other hand, frequent sprays of mancozeb slightly but significantly reduced growth of corn plants under natural conditions. In contrast, application of B. cereus C1L can significantly promote growth of corn plants whether sprayed with mancozeb or not. Our results provide the information that plant disease can be well controlled by rhizobacteria-mediated induced systemic resistance in combination with reduced but appropriate application of dithiocarbamate fungicides just before a heavy infection period. An appropriate use of rhizobacteria can enhance plant growth and help plants overcome negative effects caused by dithiocarbamates.

  3. Marker-Assisted Selection of Xa21 Conferring Resistance to Bacterial Leaf Blight in indica Rice Cultivar LT2

    Directory of Open Access Journals (Sweden)

    Hue Thi Nguyen

    2018-01-01

    Full Text Available Bacterial leaf blight of rice (BLB, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive diseases in Asian rice fields. A high-quality rice variety, LT2, was used as the recipient parent. IRBB21, which carries the Xa21 gene, was used as the donor parent. The resistance gene Xa21 was introduced into LT2 by marker-assisted backcrossing. Three Xoo races were used to inoculate the improved lines following the clipping method. Eleven BC3F3 lines carrying Xa21 were obtained based on molecular markers and agronomic performance. The 11 lines were then inoculated with the three Xoo races. All the 11 improved lines showed better resistance to BLB than the recipient parent LT2. Based on the level of resistance to BLB and their agronomic performance, five lines (BC3F3 5.1.5.1, BC3F3 5.1.5.12, BC3F3 8.5.6.44, BC3F3 9.5.4.1 and BC3F3 9.5.4.23 were selected as the most promising for commercial release. These improved lines could contribute to rice production in terms of food security.

  4. Marker-Assisted Selection of Xa21 Conferring Resistance to Bacterial Leaf Blight in indica Rice Cultivar LT2

    Institute of Scientific and Technical Information of China (English)

    Hue Thi NGUYEN; Trung Nguyen DINH; Nakano TOSHITSUGU; Liet Van VU; Quang Hong VU; Tan Van MAI; Thu Thi NGUYEN; Lam Duc VU; Tung Thanh NGUYEN; Long Viet NGUYEN; Hien Thu Thi VU; Hue Thi NONG

    2018-01-01

    Bacterial leaf blight of rice (BLB), caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive diseases in Asian rice fields. A high-quality rice variety, LT2, was used as the recipient parent. IRBB21, which carries the Xa21 gene, was used as the donor parent. The resistance gene Xa21 was introduced into LT2 by marker-assisted backcrossing. Three Xoo races were used to inoculate the improved lines following the clipping method. Eleven BC3F3lines carrying Xa21 were obtained based on molecular markers and agronomic performance. The 11 lines were then inoculated with the three Xoo races. All the 11 improved lines showed better resistance to BLB than the recipient parent LT2. Based on the level of resistance to BLB and their agronomic performance, five lines (BC3F35.1.5.1, BC3F35.1.5.12, BC3F38.5.6.44, BC3F3 9.5.4.1 and BC3F39.5.4.23) were selected as the most promising for commercial release. These improved lines could contribute to rice production in terms of food security.

  5. Determination of Leaf Area Index, Total Foliar N, and Normalized Difference Vegetation Index for Arctic Ecosystems Dominated by Cassiope tetragona

    DEFF Research Database (Denmark)

    Campioli, M; Street, LE; Michelsen, Anders

    2009-01-01

    have not been accurately quantified. We address this knowledge gap by (i) direct measurements of LAI and TFN for C. tetragona, and (ii) determining TFN-LAI and LAI–normalized difference vegetation index (NDVI) relationships for typical C. tetragona tundras in the subarctic (Sweden) and High Arctic...... leaf N and biomass. The LAI-NDVI and TFN-LAI relationships showed high correlation and can be used to estimate indirectly LAI and TFN. The LAI-NDVI relationship for C. tetragona vegetation differed from a generic LAI-NDVI relationship for arctic tundra, whereas the TFN-LAI relationship did not. Overall...

  6. Fitness and competition studies of QoI resistant and sensitive Cercospora sojina isolates, the causal agent of frogeye leaf spot

    Science.gov (United States)

    Frogeye leaf spot (FLS), caused by Cercospora sojina, is a yearly foliar disease of soybean in Tennessee and causes substantial economic losses if not properly managed. Quinone outside inhibitor (QoI) fungicides are often used to manage FLS, but C. sojina isolates have developed resistance to this c...

  7. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  8. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  9. Fine mapping of a quantitative resistance gene for gray leaf spot of maize (Zea mays L.) derived from teosinte (Z. mays ssp. parviglumis)

    Science.gov (United States)

    In previous work, using near isogenic line (NIL) populations in which segments of the tesosinte (Zea mays ssp. parviglumis) genome had been introgressed into the background of the maize line B73, we had identified a QTL on chromosome 8, here called Qgls8, for gray leaf spot resistance. We identified...

  10. Screening for anthracnose disease resistance in strawberry using a detached leaf assay

    Science.gov (United States)

    Inoculation of detached strawberry leaves with Colletotrichum species may provide a rapid, non-destructive method of identifying anthracnose resistant germplasm. The reliability and validity of assessing disease severity is critical to disease management decisions. We inoculated detached strawberr...

  11. Resistive vs. total power depositions by Alfven modes in pre-heated low aspect ratio tokamaks

    International Nuclear Information System (INIS)

    Cuperman, S.; Bruma, C.; Komoshvili, K.

    2004-01-01

    The power deposition of fast waves launched by a LFS located antenna in a pre-heated, strongly non-uniform low aspect ratio tokamak (START) is investigated. The rigorous computational results indicate a total power deposition by far larger than that predicted for Alfven continuum eigenmodes in cylindrical plasmas. For toroidal wave numbers |N| > 1, the resistive and total power depositions are almost equal. (author)

  12. Free Testosterone During Androgen Deprivation Therapy Predicts Castration-Resistant Progression Better Than Total Testosterone.

    Science.gov (United States)

    Regis, Lucas; Planas, Jacques; Carles, Joan; Maldonado, Xavier; Comas, Inma; Ferrer, Roser; Morote, Juan

    2017-01-01

    The optimal degree of testosterone suppression in patients with prostate cancer undergoing androgen deprivation therapy remains in question. Furthermore, serum free testosterone, which is the active form of testosterone, seems to correlate with intraprostatic testosterone. Here we compared free and total serum testosterone as predictors of survival free of castration resistance. Total testosterone (chemiluminescent assay, lower sensitivity 10 ng/dl) and free testosterone (analogue-ligand radioimmunoassay, lower sensitivity 0.05 pg/ml) were determined at 6 months of LHRH agonist treatment in a prospective cohort of 126 patients with prostate cancer. During a mean follow-up of 67 months (9-120), 75 (59.5%) events of castration-resistant progression were identified. Multivariate analysis and survival analysis according to total testosterone cutoffs of 50, 32, and 20 ng/dl, and free testosterone cutoffs of 1.7, 1.1, and 0.7 pg/ml were performed. Metastatic spread was the most powerful predictor of castration resistance, HR: 2.09 (95%CI: 1.18-3.72), P = 0.012. Gleason score, baseline PSA and PSA at 6 months were also independents predictors, but not free and total testosterone. Stratified analysis was conducted on the basis of the status of metastatic diseases and free testosterone was found to be an independent predictor of survival free of castration resistance in the subgroup of patients without metastasis, HR: 2.12 (95%CI: 1.16-3.85), P = 0.014. The lowest threshold of free testosterone which showed significant differences was 1.7 pg/ml, P = 0.003. Free testosterone at 6 months of LHRH agonist treatment seems to be a better surrogate than total testosterone to predict castration resistance in no metastatic prostate cancer patients. Prostate 77:114-120, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  14. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  15. Fine mapping of a quantitative resistance gene for gray leaf spot of maize (Zea mays L.) derived from teosinte (Z. mays ssp. parviglumis).

    Science.gov (United States)

    Zhang, Xinye; Yang, Qin; Rucker, Elizabeth; Thomason, Wade; Balint-Kurti, Peter

    2017-06-01

    In this study we mapped the QTL Qgls8 for gray leaf spot (GLS) resistance in maize to a ~130 kb region on chromosome 8 including five predicted genes. In previous work, using near isogenic line (NIL) populations in which segments of the teosinte (Zea mays ssp. parviglumis) genome had been introgressed into the background of the maize line B73, we had identified a QTL on chromosome 8, here called Qgls8, for gray leaf spot (GLS) resistance. We identified alternate teosinte alleles at this QTL, one conferring increased GLS resistance and one increased susceptibility relative to the B73 allele. Using segregating populations derived from NIL parents carrying these contrasting alleles, we were able to delimit the QTL region to a ~130 kb (based on the B73 genome) which encompassed five predicted genes.

  16. Ecological differentiation in xylem cavitation resistance is associated with stem and leaf structural traits

    NARCIS (Netherlands)

    Markesteijn, L.; Poorter, L.; Paz, H.; Sack, L.; Bongers, F.

    2011-01-01

    Cavitation resistance is a critical determinant of drought tolerance in tropical tree species, but little is known of its association with life history strategies, particularly for seasonal dry forests, a system critically driven by variation in water availability. We analysed vulnerability curves

  17. Phylogenetic prediction of Alternaria leaf blight resistance in wild and cultivated species of carrots (Daucus, Apiaceae)

    Science.gov (United States)

    Plant scientists make inferences and predictions from phylogenetic trees to solve scientific problems. Crop losses due to disease damage is an important problem that many plant breeders would like to solve, so the ability to predict traits like disease resistance from phylogenetic trees derived from...

  18. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    Science.gov (United States)

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  19. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

    Science.gov (United States)

    Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

    2010-03-01

    Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

  20. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  1. Total flavonoid and phenolic contents of n-butanol extract of Samanea saman leaf and the antibacterial activity towards Escherichia coli and Staphylococcus aureus

    Science.gov (United States)

    Rita, Wiwik Susanah; Swantara, I. Made Dira; Asih, I. A. Raka Astiti; Sinarsih, Ni Ketut; Suteja, I. Kadek Pater

    2016-03-01

    Total flavonoid and phenolic contents in some natural products was suspected of having a positive correlation to its activity in inhibiting the growth of bacteria. The aim of this study was to determine the total flavonoid and phenolic contents of n-butanol extract of Samanea saman leaf, and to evaluate the antibacterial activity towards Escherechia coli and Staphylococcus aureus. Extraction of compounds was done by ethanol 96%, followed by fractionation into n-hexane, ethyl acetate, and n-butanol. Determination of total flavonoid and phenolic contents was done by UV-Vis Spectrophotometer using standard of quersetin and galic acid respectively. In addition, antibacterial activity was evaluated by agar disc diffusion method. Extraction of 1000 g of Samanea saman leaf was obtained 80 g of ethanol extracts, fractionation of the extract was obtained 8.02 g of n-hexane extracts, 7.11 g of ethyl acetate extracts, 13.5 g of n-butanol extracts, and 14.16 g of aqueous extracts. Phytochemical screening of the n-butanol extracts revealed the presence of flavonoid and phenolic compounds. Total flavonoid and phenolic contents were successively 43.5798 mg QE/100g and 34.0180 mg GAE/100g. The butanol extracts inhibited the growth of S.aureus higher than the growth of E.coli. At the concentration of 2, 4, 6, 8 % (b/v), and positive control (meropenem μg/disc), inhibition zone towards S. aureus was successively 5.67, 9.33, 10.33, 12.00, and 32.33 mm, while the inhibition zone towards E. coli was1.33, 3.33, 4.33, 5.43, and 34.00 mm.

  2. Parâmetros genéticos da resistência ao complexo da queima-das-folhas em populações de cenoura Genetic parameters of the resistance to the leaf blight disease complex in carrot populations

    Directory of Open Access Journals (Sweden)

    Giovani O Silva

    2009-09-01

    November 2006 to February 2007. Five advanced breeding populations (processing 1 (P1, processing 2 (P2, table 3 (M3, table 4 (M4 and table 5 (M5, were evaluated using an experimental design of completely randomized block with two replicates. The total area per plot was of 2 m². Evaluation for leaf blight symptom severity was done 90 days after sowing. ANOVA was used to estimate genetic parameters and the genetic gain from selection. Leaf blight resistance levels were significant and allowed the discrimination of the populations under evaluation. According to the genetic parameters and the expected gains with selection, the population P1 was the most and M3 was the less promising genetic material aiming to improve leaf blight resistance levels in Brasília-type carrots. The values of the relationship among the genetic and environmental variation coefficients and heritability were low. Apparently, genetic variability for leaf blight resistance in the populations under study is already depleted. On the other hand, it might also indicate the need for refinement in both the evaluation system as well as in the inoculation technique, which are crucial to allow uniform epidemics of the leaf blight complex across field plots.

  3. Antibacterial activities of Rhazya stricta leaf extracts against multidrug-resistant human pathogens

    Directory of Open Access Journals (Sweden)

    Raziuddin Khan

    2016-09-01

    Full Text Available Bacterial resistance to antibiotics, first a major concern in the 1960s, has re-emerged worldwide over the last 20 years. The World Health Organization (WHO and other health organizations have, therefore, declared ‘war’ against human microbial pathogens, particularly hospital-acquired infections, and have made drug discovery a top priority for these diseases. Because these bacteria are refractory to conventional chemotherapy, medicinal and herbal plants used in various countries should be assessed for their therapeutic potential; these valuable bio-resources are a reservoir of complex bioactive molecules. Earlier studies from our laboratory on Rhazya stricta, a native herbal shrub of Asia, have shown that this plant has a number of therapeutic properties. In this study, we evaluated the antimicrobial activities of various concentrations of five solvent extracts (aqueous alkaloid, aqueous non-alkaloid, organic alkaloid, organic non-alkaloid and whole aqueous extracts derived from R. stricta leaves against several multidrug-resistant, human-pathogenic bacteria, including methicillin-resistant Staphylococcus aureus (MRSA and extended-spectrum beta-lactamase-positive Escherichia coli. In vitro, molecular and electron microscopy analyses conclusively demonstrated the antimicrobial effects of these extracts against a panel of Gram-negative and Gram-positive bacteria. The organic alkaloid extract was the most effective against E. coli and MRSA, resulting in cell membrane disruption visible with transmission electron microscopy. In the near future, we intend to further focus and delineate the molecular mechanism-of-action for specific alkaloids of R. stricta, particularly against MRSA.

  4. Induced resistant mutations in alfalfa and broad bean against rust, leaf spot and wilh diseases by Gamma rays and ethylmethanesulfonate

    International Nuclear Information System (INIS)

    1988-01-01

    In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease

  5. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  6. Development of a New BRDF-Resistant Vegetation Index for Improving the Estimation of Leaf Area Index

    Directory of Open Access Journals (Sweden)

    Su Zhang

    2016-11-01

    Full Text Available The leaf area index (LAI is one of the most important Earth surface parameters used in the modeling of ecosystems and their interaction with climate. Numerous vegetation indices have been developed to estimate the LAI. However, because of the effects of the bi-directional reflectance distribution function (BRDF, most of these vegetation indices are also sensitive to the effect of BRDF. In this study, we aim to present a new BRDF-resistant vegetation index (BRVI, which is sensitive to the LAI but insensitive to the effect of BRDF. Firstly, the BRDF effects of different bands were investigated using both simulated data and in-situ measurements of winter wheat made at different growth stages. We found bi-directional shape similarity in the solar principal plane between the green and the near-infrared (NIR bands and between the blue and red bands for farmland soil conditions and with medium chlorophyll content level. Secondly, the consistency of the shape of the BRDF across different bands was employed to develop a new BRDF-resistant vegetation index for estimating the LAI. The reflectance ratios of the NIR band to the green band and the blue band to the red band were reasonably assumed to be resistant to the BRDF effects. Nevertheless, the variation amplitude of the bi-directional reflectance in the solar principal plane was different for different bands. The divisors in the two reflectance ratios were improved by combining the reflectances at the red and green bands. The new BRVI was defined as a normalized combination of the two improved reflectance ratios. Finally, the potential of the proposed BRVI for estimation of the LAI was evaluated using both simulated data and in-situ measurements and also compared to other popular vegetation indices. The results showed that the influence of the BRDF on the BRVI was the weakest and that the BRVI retrieved LAI values well, with a coefficient of determination (R2 of 0.84 and an RMSE of 0.83 for the field

  7. Cytological and molecular analysis of nonhost resistance in rice to wheat powdery mildew and leaf rust pathogens.

    Science.gov (United States)

    Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng

    2015-07-01

    Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.

  8. Construction of Double Right-Border Binary Vector Carrying Non-Host Gene Rxol Resistant to Bacterial Leaf Streak of Rice

    Institute of Scientific and Technical Information of China (English)

    Xu Mei-rong; XIA Zhi-hui; ZHAI Wen-xue; XU Jian-long; ZHOU Yong-li; LI Zhi-kang

    2008-01-01

    Rxol cloned from maize is a non-host gene resistant to bacterial leaf streak of rice. pCAMBIA1305-1 with Rxol was digested with Sca Ⅰ and NgoM Ⅳ and the double right-border binary vector pMNDRBBin6 was digested with Hpa Ⅰ and Xma Ⅰ.pMNDRBBin6 carrying the gene Rxol was acquired by ligation of blunt-end and cohesive end. The results of PCR, restriction enzyme analysis and sequencing indicated that the Rxol gene had been cloned into pMNDRBBin6. This double right-border binary vector,named as pMNDRBBin6-Rxol, will play a role in breeding marker-free plants resistant to bacterial leaf streak of rice by genetic transformation.

  9. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  10. Total phenols and antioxidant activities of leaf and stem extracts from coriander, mint and parsley grown in Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Juhaimi, F.; Ghafoorr, K.

    2011-01-01

    Leaves and stems of three different herbs from two different families were used to extract phenolic compounds and the bioactivity of the extracts was evaluated by using 1, 1-diphenyl-2-picrylhydrazyl or DPPH scavenging ability or their antioxidant activities. Extract from leaves of mint, which belongs to Lamiaceae family contained 1.24 mgGAE/100 mL of total phenolic compounds and 34.21% antioxidant activity which were significantly higher than those in extracts from coriander and parsley, both of which belong to Apiaceae family. Extracts of leaves from these herbs showed more quantity of total phenols and higher antioxidant activities than extracts from stem parts, however both leaves and stems of these three herbs grown in Saudi Arabia contained good quantities of total phenols (>1.02 mgGAE/100 mL) and showed more than 18.3% free radical scavenging activity. (author)

  11. Total antioxidant and oxidant status in obese children without insulin resistance

    Directory of Open Access Journals (Sweden)

    Ayşegül Doğan Demir

    2014-06-01

    Full Text Available Objective: Oxidative stress in obese children may lead in adulthood serious conditions such as coronary heart diseases or type 2 diabetes mellitus. In childhood oxidative stress is associated with insulin resistance or extreme obesity. In this study, we aimed to evaluate oxidative stress status in moderately obese children without insulin resistance. Methods: A total of 38 obese children (21 male, 17 female without insulin resistance, mean aged 9.4±3.8 years and 51 normal weight children (25 male, 26 female as the control group, mean aged 9.3±3.9 years were enrolled to the study. Total oxidative status (TOS, total antioxidant capacity (TAC were measured and oxidative stress index (OSI was calculated. Results: The results reveal that obese children had lower TAC than normal weight children (2,27±0,28 vs. 2.76±0.35 mmol Trolox Eq./L; p<0,001. There was no statistical difference between obese and control groups regarding TOS (6,08±3,63 vs 5.25±4.16 μmol H2O2 Eq./L; p=0.333. OSI was higher in obese group (2.65±1.52 vs 1.92±1.56; p=0.029 Conclusion: Balance between oxidant and antioxidant system is disrupted due to the reduced TAC even in moderately obese children without insulin resistance. Further studies should also be performed to evaluate the beneficial effects of dietary intake of antioxidants in these children.

  12. Induction of resistance to bacterial leaf blight (Xanthomonas oryzae) disease in the high yielding variety Vijaya (IR 8 x T 90)

    International Nuclear Information System (INIS)

    Padmanabhan, S.Y.; Kaur, S.; Rao, M.

    1976-01-01

    The high-yield variety Vijaya ( IR 8 x T 90), susceptible to bacterial leaf blight (Xanthomonas oryzae, Uyeda and Ishiyama Dawson), was treated with EMS to induce resistance. Dehusked seeds were pre-soaked in distilled water for 4 hrs, and subjected to 0.1% and 0.2% EMS for 6 hrs. Seed germination and survival was low in 0.2% EMS. Seedlings of M 1 were raised in pots, and panicles of individual plants harvested separately. The seeds of M 2 (8800 plants) generation were grown in nursery beds, and transplanted in field after 30 days. The plants were inoculated at the boot leaf stage with X.oryzae by the clipping method, and lesion length measured 15 days later. The frequency distribution of controls was bimodal, the EMS-treated population polymodal with new peaks. A wider range of variability was induced on the resistant and susceptible side. In M 2 0.36% resistant and 0.62% moderately resistant plants occurred. The seeds of (11) resistant and (20) moderately resistant plants of M 2 were sown for M 3 generation. These plants also segregated in the range of 0-31 and 0-32 cm lesion length. The frequency distribution curve was polymodal. M 2 from ''R'' showed 1.07% of resistant plants and 0.42% from ''MR'', against, 4.28% of moderately resistant plants from ''R'' and 3.22% from ''MR''. Susceptible plants of M 2 also segregated towards resistance (1.15%) and moderately resistant (6.96%) plants in M 3 generation. Resistant (25) and moderately resistant (147) plants of M 3 were carried forward to M 4 generation, and segregated in the range of 2.1-25 cm lesion length. The frequency curve was polymodal. No resistant plant (up to 2.0 cm lesion length) could be isolated in M 4 . The percentage of moderately resistant plants was 4.44% from ''R'' of M 3 and 4.82% from ''MR'' of M 3 and 4.77% from ''S'' of M 3 generation. The yield of resistant plants was low whereas the yield of moderately resistant plants equalled the parent; the yield of susceptible segregants equalled or

  13. Description of load progression and pain response during progressive resistance training early after total hip arthroplasty

    DEFF Research Database (Denmark)

    Mikkelsen, Lone R; Petersen, Annemette K; Mechlenburg, Inger

    2016-01-01

    events during the initial four weeks of training. RESULTS: The majority of patients experienced only moderate hip pain during exercise (range in median across exercises and sessions: 5-35 mm Visual Analog Scale) and mild pain at rest (median: 1-18 mm Visual Analog Scale), both of which decreased over...... time ( p training load (67%-166 % across exercises, p training sessions, short term pain response (an increase >20 mm Visual Analog Scale) occurred in 13 patients in 24 training sessions. CONCLUSION: Progressive resistance......OBJECTIVE: To describe a progressive resistance training intervention implemented shortly after total hip arthroplasty, including a detailed description of load progression, pain response and adverse events to the training. DESIGN: Secondary analyses of data from the intervention group...

  14. Identification of SSR and RAPD markers linked to a resistance allele for angular leaf spot in the common bean (Phaseolus vulgaris line ESAL 550

    Directory of Open Access Journals (Sweden)

    Gilvan Ferreira da Silva

    2003-12-01

    Full Text Available The objective of this study was to identify RAPD and SSR markers associated with a resistant allele for angular leaf spot (Phaeoisariopsis griseola from the line 'ESAL 550', derived from the Andean 'Jalo EEP 558' cultivar, to assist selection of resistant genotypes. The resistant line 'ESAL 550' and the susceptible cultivar 'Carioca MG' were crossed to generate F1 and F2 populations. One hundred and twenty F2:3 families were evaluated. The DNA of the 12 most resistant families was bulked and the same was done with the DNA of the 10 most susceptible, generating two contrasting bulks. One RAPD and one SSR marker was found to be linked in coupling phase to the resistant allele. The SSR marker was amplified by the primer PV-atct001(282C, and its distance from the resistant allele was 7.6 cM. This is the most useful marker for indirect selection of resistant plants in segregating populations. The RAPD marker was amplified by the primer OPP07(857C linked in coupling phase to the resistant allele, and distant 24.4 cM. Therefore, this RAPD marker is not so useful in assisting selection because it is too far from the resistant allele.

  15. Flutuação populacional do bicho-mineiro em cultivares de café arábica resistentes à ferrugem Fluctuation of leaf miner population in resistant arabica coffee cultivars to leaf rust

    Directory of Open Access Journals (Sweden)

    Celso Henrique Costa Conceição

    2005-01-01

    Full Text Available A intensidade de infestação pelo bicho-mineiro, Leucoptera coffeella (Guérin-Méneville (Lepidoptera: Lyonetiidae foi investigada nas cultivares Obatã IAC 1669-20 e Tupi IAC 1669-33, com resistência à ferrugem das folhas do cafeeiro, Hemileia vastatrix Berk. et Br., e Ouro Verde Amarelo IAC 4397, suscetível à doença, em ensaios de campo, localizados em Campinas (SP, Brasil. A incidência de ferrugem e a ocorrência de inimigos naturais da praga, assim como o enfolhamento das plantas, foram também observados nas três cultivares. As curvas de flutuação populacional obtidas para Obatã IAC 1669-20 e Tupi IAC 1669-33 revelaram maior incidência do bicho-mineiro entre abril e novembro. Já na cultivar Ouro Verde Amarelo IAC 4397, observaram-se dois picos de infestação, sendo o primeiro em abril-maio e o segundo em agosto-setembro. No entanto, a elevada percentagem de folhas minadas nas cultivares Tupi IAC 1669-33 e Obatã IAC 1669-20 em relação à Ouro Verde Amarelo IAC 4397 não é evidência de maior suscetibilidade à praga, mas sim devido à maior retenção foliar dessas cultivares, em conseqüência da resistência à ferrugem das folhas observada em ambas. De maneira oposta, na cultivar Ouro Verde Amarelo IAC 4397, os sintomas de ataque do bicho-mineiro ocorreram em menor nível especialmente devido a maior queda de folhas. Com base nas diferenças observadas entre as cultivares, sugere-se a adoção de estratégias distintas de manejo da praga.The intensity of infestation of leaf-miner, Leucoptera coffeella (Guérin-Méneville was investigated in coffee cultivars Obatã IAC 1669-20 and Tupi IAC 1669-33, both resistant to the leaf rust agent, Hemileia vastatrix Berk. et Br., and Ouro Verde Amarelo IAC 4397, susceptible to this coffee disease, at field assays in Campinas, SP, Brazil. The incidence of coffee rust and presence of natural enemies, as well as the plant leafiness, were also observed. In Obatã IAC 1669-20 and Tupi

  16. Effects of dietary sweet potato leaf meal on the growth, non-specific immune responses, total phenols and antioxidant capacity in channel catfish (Ictalurus punctatus).

    Science.gov (United States)

    Lochmann, Rebecca T; Islam, Shahidul; Phillips, Harold; Adam, Zelalem; Everette, Jace

    2013-04-01

    Traditional energy sources in catfish diets have become costly, and economical alternatives are needed. Sweet potato leaves are underutilised agricultural by-products that provide energy and substantial amounts of phenols, which affect animal and human health. There is little information on the effects of these compounds on catfish, or the capacity of catfish to accumulate dietary phenols. Catfish enriched with phenols have marketing potential as functional foods. This study investigated the effects of diets with sweet potato leaf meal (SPLM) on growth performance, health and total phenolic compounds in catfish. SPLM was substituted for wheat middlings in three diets fed to groups of juvenile catfish for 10 weeks. Weight gain, feed conversion, survival, alternative complement activity and lysozyme activity were similar among diets. Haematocrit was lower in fish fed diets with SPLM, but within the normal range. Total phenols and antioxidant capacity in the whole body were similar among treatments. SPLM was an effective energy source for catfish up to the maximum level tested (230 g kg(-1) diet). SPLM did not enhance total phenols in catfish, but there were no apparent antinutritional effects of the meal on catfish growth, health or survival. © 2012 Society of Chemical Industry.

  17. Evaluation of dried vegetables residues for poultry: II. Effects of feeding cabbage leaf residues on broiler performance, ileal digestibility and total tract nutrient digestibility.

    Science.gov (United States)

    Mustafa, A F; Baurhoo, B

    2017-03-01

    A study was conducted to investigate the effects of partial replacing corn and soybean meal with dried cabbage leaf residues (DCR) on broiler growth performance, apparent ileal nutrient digestibility, and apparent total tract nutrient utilization. Dietary treatments include 4 levels of DCR (0, 3, 6, and 9%). Two hundred and twenty-four day-old male broilers were randomly assigned to one of 4 groups (8 cage replicates; 7 birds/cage) and grown over a 35-d experimental period. Results showed that feeding DCR had no effects on daily body weigh gain (average 53.4 g/d), daily feed intake (average 94.9 g/d), and feed conversion ratio (average 1.78 g of feed/g of gain). Inclusion of DCR reduced apparent ileal DM (quadratic effect, P digestibility of younger birds (d 21) while incremental levels of DCR had no effect on apparent ileal nutrient digestibilities of older birds (d 35). Apparent total tract digestibility of DM, OM, and CP increased (linear effect, P digestibility of older birds and improved apparent total tract nutrient digestibility. © 2016 Poultry Science Association Inc.

  18. Sample preparation for total reflection X-ray fluorescence analysis using resist pattern technique

    Science.gov (United States)

    Tsuji, K.; Yomogita, N.; Konyuba, Y.

    2018-06-01

    A circular resist pattern layer with a diameter of 9 mm was prepared on a glass substrate (26 mm × 76 mm; 1.5 mm thick) for total reflection X-ray fluorescence (TXRF) analysis. The parallel cross pattern was designed with a wall thickness of 10 μm, an interval of 20 μm, and a height of 1.4 or 0.8 μm. This additional resist layer did not significantly increase background intensity on the XRF peaks in TXRF spectra. Dotted residue was obtained from a standard solution (10 μL) containing Ti, Cr, Ni, Pb, and Ga, each at a final concentration of 10 ppm, on a normal glass substrate with a silicone coating layer. The height of the residue was more than 100 μm, where self-absorption in the large residue affected TXRF quantification (intensity relative standard deviation (RSD): 12-20%). In contrast, from a droplet composed of a small volume of solution dropped and cast on the resist pattern structure, the obtained residue was not completely film but a film-like residue with a thickness less than 1 μm, where self-absorption was not a serious problem. In the end, this sample preparation was demonstrated to improve TXRF quantification (intensity RSD: 2-4%).

  19. Oral administration of Eclipta alba leaf aqueous extract enhances the non-specific immune responses and disease resistance of Oreochromis mossambicus.

    Science.gov (United States)

    Christybapita, D; Divyagnaneswari, M; Michael, R Dinakaran

    2007-10-01

    Immunostimulatory effects of the oral administration of the medicinal plant, Eclipta alba leaf extracts was studied in tilapia, Oreochromis mossambicus. For this purpose, fish were fed for 1, 2 or 3 weeks with diets containing E. alba leaf aqueous extract at 0, 0.01, 0.1 or 1% levels. After each week, non-specific humoral (lysozyme, antiprotease and complement) and cellular (myeloperoxidase content, production of reactive oxygen and nitrogen species) responses and disease resistance against Aeromonas hydrophila were determined. The results indicated that E. alba aqueous extract administered as feed supplement significantly enhanced most of the non-specific immune parameters tested. Among the humoral responses, lysozyme activity significantly increased after feeding with aqueous extract for 1, 2 or 3 weeks. No significant modulation was noticed in all the cellular responses tested after 3 weeks of feeding, while reactive oxygen species production and myeloperoxidase content showed significant enhancement after 1 week of feeding with aqueous extract. When challenged with A. hydrophila after 1, 2 or 3 weeks of feeding, the percentage mortality was significantly reduced in the treated fish. The highest dose of 1% gave better protection than the other doses with the relative percentage survival (RPS) values of 64, 75 and 32 after feeding for 1, 2 and 3 weeks respectively. The results indicate that dietary intake of E. alba aqueous leaf extract enhances the non-specific immune responses and disease resistance of O. mossambicus against A. hydrophila.

  20. Total body fat, pro-inflammatory cytokines and insulin resistance in Indian subjects

    Energy Technology Data Exchange (ETDEWEB)

    Yajnik, C S [Diabetes Unit, KEM Hospital Research Centre, Pune (India); Yudkin, J S [Whittington Hospital, University College of London, London (United Kingdom); Shetty, P S [London School of Hygiene and Tropical Medicine, London (United Kingdom); Kurpad, A [St. John' s Medical College, Bangalore (India)

    1999-07-01

    There is a growing epidemic of insulin resistance syndrome (IRS) in Indians. We postulate that increased susceptibility of the urban Indians to insulin resistance is a result of a tendency to increased fat deposition from the time of intrauterine life (thrifty phenotype), exaggerated in the urban environment by a positive energy balance. The pro-inflammatory cytokines secreted by the inflammatory cells as well by the adipose tissue could aggravate insulin resistance and endothelial damage and therefore, increase the susceptibility to type 2 diabetes and coronary heart disease (CHD) independent of the previously proposed glucose fatty acid cycle mechanism. In a preliminary study, we propose to make detailed measurements of the proposed mechanisms in a selected population from 3 geographical locations in and near the city of Pune, India and also validate simple 'epidemiologic' measurements of body composition with 'reference' measurements. One hundred men (30 to 50y) each from the three geographical locations (rural, urban slum-dwellers and urban middle class in Pune) will be studied for: (i) Body composition: Anthropometric and bioimpedance measurement of total body fat (to be calibrated against deuterated water in 30 subjects from each location), and muscle mass by anthropometry and urinary creatinine excretion; (ii) Body fat distribution by subscapular- triceps ratio, waist-hip ratio; (iii) Metabolic: Glucose tolerance and insulin resistance variables (insulin, lipids, NEFA) and leptin; (iv) Endothelial markers: e-Selectin and von Willebrand Factor (vWF); (v) Inflammatory markers and pro-inflammatory cytokines: C-reactive protein (CRP), Interleukin-6 (IL-6) and tumour necrosis factor (TNF- {alpha}); (vi) Energy Balance: Assessment of nutritional intake (calories, carbohydrates, proteins and fats, n3 and n6 fatty acids) and physical activity by a questionnaire. Insulin resistance variables, endothelial markers, cytokines and obesity parameters will be compared in

  1. Total body fat, pro-inflammatory cytokines and insulin resistance in Indian subjects

    International Nuclear Information System (INIS)

    Yajnik, C.S.; Yudkin, J.S.; Shetty, P.S.; Kurpad, A.

    1999-01-01

    There is a growing epidemic of insulin resistance syndrome (IRS) in Indians. We postulate that increased susceptibility of the urban Indians to insulin resistance is a result of a tendency to increased fat deposition from the time of intrauterine life (thrifty phenotype), exaggerated in the urban environment by a positive energy balance. The pro-inflammatory cytokines secreted by the inflammatory cells as well by the adipose tissue could aggravate insulin resistance and endothelial damage and therefore, increase the susceptibility to type 2 diabetes and coronary heart disease (CHD) independent of the previously proposed glucose fatty acid cycle mechanism. In a preliminary study, we propose to make detailed measurements of the proposed mechanisms in a selected population from 3 geographical locations in and near the city of Pune, India and also validate simple 'epidemiologic' measurements of body composition with 'reference' measurements. One hundred men (30 to 50y) each from the three geographical locations (rural, urban slum-dwellers and urban middle class in Pune) will be studied for: (i) Body composition: Anthropometric and bioimpedance measurement of total body fat (to be calibrated against deuterated water in 30 subjects from each location), and muscle mass by anthropometry and urinary creatinine excretion; (ii) Body fat distribution by subscapular- triceps ratio, waist-hip ratio; (iii) Metabolic: Glucose tolerance and insulin resistance variables (insulin, lipids, NEFA) and leptin; (iv) Endothelial markers: e-Selectin and von Willebrand Factor (vWF); (v) Inflammatory markers and pro-inflammatory cytokines: C-reactive protein (CRP), Interleukin-6 (IL-6) and tumour necrosis factor (TNF- α); (vi) Energy Balance: Assessment of nutritional intake (calories, carbohydrates, proteins and fats, n3 and n6 fatty acids) and physical activity by a questionnaire. Insulin resistance variables, endothelial markers, cytokines and obesity parameters will be compared in the 3

  2. Hippophae leaf extract (SBL-1) countered radiation induced dysbiosis in jejunum of total body 60Cobalt gamma - irradiated mice

    International Nuclear Information System (INIS)

    Beniwal, C.S.; Madhu Bala

    2014-01-01

    Single dose of SBL-1 administered at the rate 30 mg/kg body weight (b.w.) 30 min prior to whole body 60 Co-gamma-irradiation at lethal dose (10 Gy), rendered >90% survival in comparison to zero survival in the non-SBL-1 treated 60 Co-gamma-irradiated (10 Gy) mice population (J Herbs Spices Med Plants, 2009; 15(2): 203-215). Present study investigated the effect of SBL-1 on jejunal microbiota in lethally irradiated mice. Study was performed with inbred Swiss albino Strain 'A' male mice (age 9 weeks) weighing 28±2 g. The animals were maintained under controlled environment at 26±2℃; 12 h light/dark cycle and offered standard animal food (Golden feed, Delhi) as well as tap water ad libitum. Metagenomic DNA was extracted, purified and quantified from jejunum of the mice. Universal primers (27f and 1492r) were used to amplify the 16S rRNA DNA from the metagenomic DNA. Amplicons were sequenced, vector contamination and chimeras were removed. The sequences (GenBank Accession No: KF681283 to KF681351) were taxonomically classified by using Sequence Match program, Ribosomal Database Project as well as by nucleotide-BLAST (E-value: 10, database: 16S rRNA gene sequences, Bacteria and Archea). Phylogenetic Tree was prepared using MEGA 5.2 package, using maximum likelihood algorithm after sequence alignment by MUSCLE. Thermus aquaticus was used as out-group to construct rooted tree. Branch stability was assessed by bootstrap analysis. Untreated animals and the animals treated with SBL-1 had 100% Lactobacillus; 60 Co gamma-irradiated animals had 55% Cohaesibacter (Alphaproteobacteria); 27% Mycoplasma (Tenericutes) and only 18% Lactobacillus; animals treated with SBL-1 prior to irradiation had 89% Lactobacillus and 11% Clostridium. This study demonstrated that treatment with SBL-1 at radioprotective doses before total body irradiation with lethal dose (10 Gy) countered the jejunal dysbiosis. (author)

  3. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  4. Thin Layer Chromatography-Bioautography and Gas Chromatography-Mass Spectrometry of Antimicrobial Leaf Extracts from Philippine Piper betle L. against Multidrug-Resistant Bacteria

    Directory of Open Access Journals (Sweden)

    Demetrio L. Valle

    2016-01-01

    Full Text Available This study isolated and identified the antimicrobial compounds of Philippine Piper betle L. leaf ethanol extracts by thin layer chromatography- (TLC- bioautography and gas chromatography-mass spectrometry (GC-MS. Initially, TLC separation of the leaf ethanol extracts provided a maximum of eight compounds with Rf values of 0.92, 0.86, 0.76, 0.53, 0.40, 0.25, 0.13, and 0.013, best visualized when inspected under UV 366 nm. Agar-overlay bioautography of the isolated compounds demonstrated two spots with Rf values of 0.86 and 0.13 showing inhibitory activities against two Gram-positive multidrug-resistant (MDR bacteria, namely, methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. The compound with an Rf value of 0.86 also possessed inhibitory activity against Gram-negative MDR bacteria, namely, carbapenem-resistant Enterobacteriaceae-Klebsiella pneumoniae and metallo-β-lactamase-producing Acinetobacter baumannii. GC-MS was performed to identify the semivolatile and volatile compounds present in the leaf ethanol extracts. Six compounds were identified, four of which are new compounds that have not been mentioned in the medical literature. The chemical compounds isolated include ethyl diazoacetate, tris(trifluoromethylphosphine, heptafluorobutyrate, 3-fluoro-2-propynenitrite, 4-(2-propenylphenol, and eugenol. The results of this study could lead to the development of novel therapeutic agents capable of dealing with specific diseases that either have weakened reaction or are currently not responsive to existing drugs.

  5. Thin Layer Chromatography-Bioautography and Gas Chromatography-Mass Spectrometry of Antimicrobial Leaf Extracts from Philippine Piper betle L. against Multidrug-Resistant Bacteria.

    Science.gov (United States)

    Valle, Demetrio L; Puzon, Juliana Janet M; Cabrera, Esperanza C; Rivera, Windell L

    2016-01-01

    This study isolated and identified the antimicrobial compounds of Philippine Piper betle L. leaf ethanol extracts by thin layer chromatography- (TLC-) bioautography and gas chromatography-mass spectrometry (GC-MS). Initially, TLC separation of the leaf ethanol extracts provided a maximum of eight compounds with R f values of 0.92, 0.86, 0.76, 0.53, 0.40, 0.25, 0.13, and 0.013, best visualized when inspected under UV 366 nm. Agar-overlay bioautography of the isolated compounds demonstrated two spots with R f values of 0.86 and 0.13 showing inhibitory activities against two Gram-positive multidrug-resistant (MDR) bacteria, namely, methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. The compound with an R f value of 0.86 also possessed inhibitory activity against Gram-negative MDR bacteria, namely, carbapenem-resistant Enterobacteriaceae-Klebsiella pneumoniae and metallo-β-lactamase-producing Acinetobacter baumannii. GC-MS was performed to identify the semivolatile and volatile compounds present in the leaf ethanol extracts. Six compounds were identified, four of which are new compounds that have not been mentioned in the medical literature. The chemical compounds isolated include ethyl diazoacetate, tris(trifluoromethyl)phosphine, heptafluorobutyrate, 3-fluoro-2-propynenitrite, 4-(2-propenyl)phenol, and eugenol. The results of this study could lead to the development of novel therapeutic agents capable of dealing with specific diseases that either have weakened reaction or are currently not responsive to existing drugs.

  6. Tissue specific expression of potent insecticidal, Allium sativum leaf agglutinin (ASAL) in important pulse crop, chickpea (Cicer arietinum L.) to resist the phloem feeding Aphis craccivora.

    Science.gov (United States)

    Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain Ali; Das, Sampa

    2009-08-01

    The phloem sap-sucking hemipteran insect, Aphis craccivora, commonly known as cowpea aphid, cause major yield loss of important food legume crop chickpea. Among different plant lectins Allium sativum leaf agglutinin (ASAL), a mannose binding lectin was found to be potent antifeedant for sap sucking insect A. craccivora. Present study describes expression of ASAL in chickpea through Agrobacterium-mediated transformation of "single cotyledon with half embryo" explant. ASAL was expressed under the control of CaMV35S promoter for constitutive expression and phloem specific rolC promoter for specifically targeting the toxin at feeding site, using pCAMBIA2301 vector containing plant selection marker nptII. Southern blot analysis demonstrated the integration and copy number of chimeric ASAL gene in chickpea and its inheritance in T(1) and T(2) progeny plants. Expression of ASAL in T(0) and T(1) plants was confirmed through northern and western blot analysis. The segregation pattern of ASAL transgene was observed in T(1) progenies, which followed the 3:1 Mendelian ratio. Enzyme linked immunosorbant assay (ELISA) determined the level of ASAL expression in different transgenic lines in the range of 0.08-0.38% of total soluble protein. The phloem tissue specific expression of ASAL gene driven by rolC promoter has been monitored by immunolocalization analysis of mature stem sections. Survival and fecundity of A. craccivora decreased to 11-26% and 22-42%, respectively when in planta bioassay conducted on T(1) plants compared to untransformed control plant which showed 85% survival. Thus, through unique approach of phloem specific expression of novel insecticidal lectin (ASAL), aphid resistance has been successfully achieved in chickpea.

  7. Identification of quantitative trait Loci for resistance to southern leaf blight and days to anthesis in a maize recombinant inbred line population.

    Science.gov (United States)

    Balint-Kurti, P J; Krakowsky, M D; Jines, M P; Robertson, L A; Molnár, T L; Goodman, M M; Holl, J B

    2006-10-01

    ABSTRACT A recombinant inbred line population derived from a cross between the maize lines NC300 (resistant) and B104 (susceptible) was evaluated for resistance to southern leaf blight (SLB) disease caused by Cochliobolus heterostrophus race O and for days to anthesis in four environments (Clayton, NC, and Tifton, GA, in both 2004 and 2005). Entry mean and average genetic correlations between disease ratings in different environments were high (0.78 to 0.89 and 0.9, respectively) and the overall entry mean heritability for SLB resistance was 0.89. When weighted mean disease ratings were fitted to a model using multiple interval mapping, seven potential quantitative trait loci (QTL) were identified, the two strongest being on chromosomes 3 (bin 3.04) and 9 (bin 9.03-9.04). These QTL explained a combined 80% of the phenotypic variation for SLB resistance. Some time-point-specific SLB resistance QTL were also identified. There was no significant correlation between disease resistance and days to anthesis. Six putative QTL for time to anthesis were identified, none of which coincided with any SLB resistance QTL.

  8. NMR-Based Metabolic Profiling of Field-Grown Leaves from Sugar Beet Plants Harbouring Different Levels of Resistance to Cercospora Leaf Spot Disease

    Directory of Open Access Journals (Sweden)

    Yasuyo Sekiyama

    2017-01-01

    Full Text Available Cercospora leaf spot (CLS is one of the most serious leaf diseases for sugar beet (Beta vulgaris L. worldwide. The breeding of sugar beet cultivars with both high CLS resistance and high yield is a major challenge for breeders. In this study, we report the nuclear magnetic resonance (NMR-based metabolic profiling of field-grown leaves for a subset of sugar beet genotypes harbouring different levels of CLS resistance. Leaves were collected from 12 sugar beet genotypes at four time points: seedling, early growth, root enlargement, and disease development stages. 1H-NMR spectra of foliar metabolites soluble in a deuterium-oxide (D2O-based buffer were acquired and subjected to multivariate analyses. A principal component analysis (PCA of the NMR data from the sugar beet leaves shows clear differences among the growth stages. At the later time points, the sugar and glycine betaine contents were increased, whereas the choline content was decreased. The relationship between the foliar metabolite profiles and resistance level to CLS was examined by combining partial least squares projection to latent structure (PLS or orthogonal PLS (OPLS analysis and univariate analyses. It was difficult to build a robust model for predicting precisely the disease severity indices (DSIs of each genotype; however, GABA and Gln differentiated susceptible genotypes (genotypes with weak resistance from resistant genotypes (genotypes with resistance greater than a moderate level before inoculation tests. The results suggested that breeders might exclude susceptible genotypes from breeding programs based on foliar metabolites profiled without inoculation tests, which require an enormous amount of time and effort.

  9. Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Rosa Lozano-Durán

    2013-03-01

    Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

  10. Resistance to gray leaf spot of maize: genetic architecture and mechanisms elucidated through nested association mapping and near-isogenic line analysis.

    Science.gov (United States)

    Benson, Jacqueline M; Poland, Jesse A; Benson, Brent M; Stromberg, Erik L; Nelson, Rebecca J

    2015-03-01

    Gray leaf spot (GLS), caused by Cercospora zeae-maydis and Cercospora zeina, is one of the most important diseases of maize worldwide. The pathogen has a necrotrophic lifestyle and no major genes are known for GLS. Quantitative resistance, although poorly understood, is important for GLS management. We used genetic mapping to refine understanding of the genetic architecture of GLS resistance and to develop hypotheses regarding the mechanisms underlying quantitative disease resistance (QDR) loci. Nested association mapping (NAM) was used to identify 16 quantitative trait loci (QTL) for QDR to GLS, including seven novel QTL, each of which demonstrated allelic series with significant effects above and below the magnitude of the B73 reference allele. Alleles at three QTL, qGLS1.04, qGLS2.09, and qGLS4.05, conferred disease reductions of greater than 10%. Interactions between loci were detected for three pairs of loci, including an interaction between iqGLS4.05 and qGLS7.03. Near-isogenic lines (NILs) were developed to confirm and fine-map three of the 16 QTL, and to develop hypotheses regarding mechanisms of resistance. qGLS1.04 was fine-mapped from an interval of 27.0 Mb to two intervals of 6.5 Mb and 5.2 Mb, consistent with the hypothesis that multiple genes underlie highly significant QTL identified by NAM. qGLS2.09, which was also associated with maturity (days to anthesis) and with resistance to southern leaf blight, was narrowed to a 4-Mb interval. The distance between major leaf veins was strongly associated with resistance to GLS at qGLS4.05. NILs for qGLS1.04 were treated with the C. zeae-maydis toxin cercosporin to test the role of host-specific toxin in QDR. Cercosporin exposure increased expression of a putative flavin-monooxygenase (FMO) gene, a candidate detoxification-related gene underlying qGLS1.04. This integrated approach to confirming QTL and characterizing the potential underlying mechanisms advances the understanding of QDR and will facilitate the

  11. Resistance to gray leaf spot of maize: genetic architecture and mechanisms elucidated through nested association mapping and near-isogenic line analysis.

    Directory of Open Access Journals (Sweden)

    Jacqueline M Benson

    2015-03-01

    Full Text Available Gray leaf spot (GLS, caused by Cercospora zeae-maydis and Cercospora zeina, is one of the most important diseases of maize worldwide. The pathogen has a necrotrophic lifestyle and no major genes are known for GLS. Quantitative resistance, although poorly understood, is important for GLS management. We used genetic mapping to refine understanding of the genetic architecture of GLS resistance and to develop hypotheses regarding the mechanisms underlying quantitative disease resistance (QDR loci. Nested association mapping (NAM was used to identify 16 quantitative trait loci (QTL for QDR to GLS, including seven novel QTL, each of which demonstrated allelic series with significant effects above and below the magnitude of the B73 reference allele. Alleles at three QTL, qGLS1.04, qGLS2.09, and qGLS4.05, conferred disease reductions of greater than 10%. Interactions between loci were detected for three pairs of loci, including an interaction between iqGLS4.05 and qGLS7.03. Near-isogenic lines (NILs were developed to confirm and fine-map three of the 16 QTL, and to develop hypotheses regarding mechanisms of resistance. qGLS1.04 was fine-mapped from an interval of 27.0 Mb to two intervals of 6.5 Mb and 5.2 Mb, consistent with the hypothesis that multiple genes underlie highly significant QTL identified by NAM. qGLS2.09, which was also associated with maturity (days to anthesis and with resistance to southern leaf blight, was narrowed to a 4-Mb interval. The distance between major leaf veins was strongly associated with resistance to GLS at qGLS4.05. NILs for qGLS1.04 were treated with the C. zeae-maydis toxin cercosporin to test the role of host-specific toxin in QDR. Cercosporin exposure increased expression of a putative flavin-monooxygenase (FMO gene, a candidate detoxification-related gene underlying qGLS1.04. This integrated approach to confirming QTL and characterizing the potential underlying mechanisms advances the understanding of QDR and will

  12. Stress-reaction during hypokinesia and its effect on total resistance of the animal body

    International Nuclear Information System (INIS)

    Chernov, I.P.

    1980-01-01

    In the experiments on rats, shown has been that three-phase stress-reaction develops during the hypokinetic syndrome formation. This reaction is confirmed by specific changes of general state of the organism, body mass and by the activity of hypothalamic-hypophysial-adrenal system evaluated by oscillations of relative mass of pituitary body and adrenal glands and by karyometry of neuron of the hypothalamus arcuate nuclear and cells of zona fasciculata of adrenal glands. The hypokinetic stress affects the total resistance of the body, its sensitivity to gamma-irradiation in the dose of 800 rad. On the definite stage of development the hypokinetic stress forms the state of heightened ''cross'' stability

  13. Feasibility of Early-Initiated Progressive Resistance Training after Total Hip Replacement

    DEFF Research Database (Denmark)

    Mikkelsen, Lone Ramer; Mechlenburg, Inger; Petersen, Annemette Krintel

    during the exercises were measured at each training session. Isometric muscle strength was measured before and 4 weeks after the THR. Findings / Results: Pain during exercises and resting pain before and after each training session was unchanged or decreased during the 4 weeks of training. Averaged...... across exercises pain during training decreased from 3.6 (sd: 2.8) at the first session to 1.52 (sd: 1.8) VAS-mm at the last session, ptraining load increased progressively for all 4 exercises during the 4 weeks of training. For example: 2nd, 5th and 8th training session. Hip......Background: Muscle atrophy, reduced hip muscle strength and function are documented within the first weeks after Total Hip Replacement (THR). Purpose / Aim of Study: The purpose of this study was to evaluate the feasibility of early-initiated progressive resistance training (PRT) after THR...

  14. Total and high molecular weight adiponectin have similar utility for the identification of insulin resistance

    Directory of Open Access Journals (Sweden)

    Aguilar-Salinas Carlos A

    2010-06-01

    Full Text Available Abstract Background Insulin resistance (IR and related metabolic disturbances are characterized by low levels of adiponectin. High molecular weight adiponectin (HMWA is considered the active form of adiponectin and a better marker of IR than total adiponectin. The objective of this study is to compare the utility of total adiponectin, HMWA and the HMWA/total adiponectin index (SA index for the identification of IR and related metabolic conditions. Methods A cross-sectional analysis was performed in a group of ambulatory subjects, aged 20 to 70 years, in Mexico City. Areas under the receiver operator characteristic (ROC curve for total, HMWA and the SA index were plotted for the identification of metabolic disturbances. Sensitivity and specificity, positive and negative predictive values, and accuracy for the identification of IR were calculated. Results The study included 101 men and 168 women. The areas under the ROC curve for total and HMWA for the identification of IR (0.664 vs. 0.669, P = 0.74, obesity (0.592 vs. 0.610, P = 0.32, hypertriglyceridemia (0.661 vs. 0.671, P = 0.50 and hypoalphalipoproteinemia (0.624 vs. 0.633, P = 0.58 were similar. A total adiponectin level of 8.03 μg/ml was associated with a sensitivity of 57.6%, a specificity of 65.9%, a positive predictive value of 50.0%, a negative predictive value of 72.4%, and an accuracy of 62.7% for the diagnosis of IR. The corresponding figures for a HMWA value of 4.25 μg/dl were 59.6%, 67.1%, 51.8%, 73.7% and 64.2%. The area under the ROC curve of the SA index for the identification of IR was 0.622 [95% CI 0.554-0.691], obesity 0.613 [95% CI 0.536-0.689], hypertriglyceridemia 0.616 [95% CI 0.549-0.683], and hypoalphalipoproteinemia 0.606 [95% CI 0.535-0.677]. Conclusions Total adiponectin, HMWA and the SA index had similar utility for the identification of IR and metabolic disturbances.

  15. Combining powers of linkage and association mapping for precise dissection of QTL controlling resistance to gray leaf spot disease in maize (Zea mays L.).

    Science.gov (United States)

    Mammadov, Jafar; Sun, Xiaochun; Gao, Yanxin; Ochsenfeld, Cherie; Bakker, Erica; Ren, Ruihua; Flora, Jonathan; Wang, Xiujuan; Kumpatla, Siva; Meyer, David; Thompson, Steve

    2015-11-10

    Gray Leaf Spot (GLS causal agents Cercospora zeae-maydis and Cercospora zeina) is one of the most important foliar diseases of maize in all areas where the crop is being cultivated. Although in the USA the situation with GLS severity is not as critical as in sub-Saharan Africa or Brazil, the evidence of climate change, increasing corn monoculture as well as the narrow genetic base of North American resistant germplasm can turn the disease into a serious threat to US corn production. The development of GLS resistant cultivars is one way to control the disease. In this study we combined the high QTL detection power of genetic linkage mapping with the high resolution power of genome-wide association study (GWAS) to precisely dissect QTL controlling GLS resistance and identify closely linked molecular markers for robust marker-assisted selection and trait introgression. Using genetic linkage analysis with a small bi-parental mapping population, we identified four GLS resistance QTL on chromosomes 1, 6, 7, and 8, which were validated by GWAS. GWAS enabled us to dramatically increase the resolution within the confidence intervals of the above-mentioned QTL. Particularly, GWAS revealed that QTLGLSchr8, detected by genetic linkage mapping as a locus with major effect, was likely represented by two QTL with smaller effects. Conducted in parallel, GWAS of days-to-silking demonstrated the co-localization of flowering time QTL with GLS resistance QTL on chromosome 7 indicating that either QTLGLSchr7 is a flowering time QTL or it is a GLS resistance QTL that co-segregates with the latter. As a result, this genetic linkage - GWAS hybrid mapping system enabled us to identify one novel GLS resistance QTL (QTLGLSchr8a) and confirm with more refined positions four more previously mapped QTL (QTLGLSchr1, QTLGLSchr6, QTLGLSchr7, and QTLGLSchr8b). Through the novel Single Donor vs. Elite Panel method we were able to identify within QTL confidence intervals SNP markers that would be

  16. Contribution of the drought tolerance-related Stress-responsive NAC1 transcription factor to resistance of barley to Ramularia leaf spot

    OpenAIRE

    MCGRANN, GRAHAM R D; STEED, ANDREW; BURT, CHRISTOPHER; GODDARD, RACHEL; LACHAUX, CLEA; BANSAL, ANURADHA; CORBITT, MARGARET; GORNIAK, KALINA; NICHOLSON, PAUL; BROWN, JAMES K M

    2014-01-01

    NAC proteins are plant transcription factors that are involved in tolerance to abiotic and biotic stresses, as well as in many developmental processes. Stress-responsive NAC1 (SNAC1) transcription factor is involved in drought tolerance in barley and rice, but has not been shown previously to have a role in disease resistance. Transgenic over-expression of HvSNAC1 in barley cv. Golden Promise reduced the severity of Ramularia leaf spot (RLS), caused by the fungus Ramularia collo-cygni, but ha...

  17. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  18. SU-E-T-515: Field-In-Field Compensation Technique Using Multi-Leaf Collimator to Deliver Total Body Irradiation (TBI) Dose

    Energy Technology Data Exchange (ETDEWEB)

    Lakeman, T [The State University of New York at Buffalo (United States); Wang, IZ [The State University of New York at Buffalo (United States); Roswell Park Cancer Institute, Buffalo, NY (United States)

    2014-06-01

    Purpose: Total body irradiation (TBI) uses large parallel-opposed radiation fields to suppress the patient's immune system and eradicate the residual cancer cells in preparation of recipient for bone marrow transplant. The manual placement of lead compensators has been used conventionally to compensate for the varying thickness through the entire body in large-field TBI. The goal of this study is to pursue utilizing the modern field-in-field (FIF) technique with the multi-leaf collimator (MLC) to more accurately and efficiently deliver dose to patients in need of TBI. Method: Treatment plans utilizing the FIF technique to deliver a total body dose were created retrospectively for patients for whom CT data had been previously acquired. Treatment fields include one pair of opposed open large fields (collimator=45°) with a specific weighting and a succession of smaller fields (collimator=90°) each with their own weighting. The smaller fields are shaped by moving MLC to block the sections of the patient which have already received close to 100% of the prescribed dose. The weighting factors for each of these fields were calculated using the attenuation coefficient of the initial lead compensators and the separation of the patient in different positions in the axial plane. Results: Dose-volume histograms (DVH) were calculated for evaluating the FIF compensation technique. The maximum body doses calculated from the DVH were reduced from the non-compensated 179.3% to 148.2% in the FIF plans, indicating a more uniform dose with the FIF compensation. All calculated monitor units were well within clinically acceptable limits and exceeded those of the original lead compensation plan by less than 50 MU (only ~1.1% increase). Conclusion: MLC FIF technique for TBI will not significantly increase the beam on time while it can substantially reduce the compensator setup time and the potential risk of errors in manually placing lead compensators.

  19. Antibacterial and antioxidant activities of Musa sp. leaf extracts against multidrug resistant clinical pathogens causing nosocomial infection.

    Science.gov (United States)

    Karuppiah, Ponmurugan; Mustaffa, Muhammed

    2013-09-01

    To investigate different Musa sp. leave extracts of hexane, ethyl acetate and methanol were evaluated for antibacterial activity against multi-drug resistant pathogens causing nosocomial infection by agar well diffusion method and also antioxidant activities. The four different Musa species leaves were extracted with hexane, ethyl acetate and methanol. Antibacterial susceptibility test, minimum inhibitory concentration and minimum inhibitory bacterial concentration were determined by agar well diffusion method. Total phenolic content and in vitro antioxidant activity was determined. All the Musa sp. extracts showed moderate antibacterial activities expect Musa paradisiaca with the inhibition zone ranging from 8.0 to 18.6 mm. Among four species ethyl acetate extracts of Musa paradisiaca showed highest activity against tested pathogens particularly E. coli, P. aeruginosa and Citrobacter sp. The minimum inhibitory concentrations were within the value of 15.63- 250 µg/mL and minimum bactericidal concentrations were ranging from 31.25- 250 µg/mL. Antioxidant activity of Musa acuminate exhibited maximum activity among other three Musa species. The present study concluded that among the different Musa species, Musa paradisiaca displayed efficient antibacterial activity followed by Musa acuminata against multi-drug resistant nosocomial infection causing pathogens. Further, an extensive study is needed to identify the bioactive compounds, mode of action and toxic effect in vivo of Musa sp.

  20. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  1. Mapping of quantitative trait loci for resistance to fall armyworm and southwestern corn borer leaf-feeding damage in maize.

    Science.gov (United States)

    Fall armyworm (FAW), Spodoptera frugiperda (J. E. Smith), and southwestern corn borer (SWCB), Diatraea grandiosella Dyar are damaging insect pests of maize resulting in significant yield and economic losses. A previous study identified quantitative trait loci (QTL) that contribute to reduced leaf-fe...

  2. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  3. Electrical Resistance Tomography for Visualization of Moving Objects Using a Spatiotemporal Total Variation Regularization Algorithm

    Directory of Open Access Journals (Sweden)

    Bo Chen

    2018-05-01

    Full Text Available Electrical resistance tomography (ERT has been considered as a data collection and image reconstruction method in many multi-phase flow application areas due to its advantages of high speed, low cost and being non-invasive. In order to improve the quality of the reconstructed images, the Total Variation algorithm attracts abundant attention due to its ability to solve large piecewise and discontinuous conductivity distributions. In industrial processing tomography (IPT, techniques such as ERT have been used to extract important flow measurement information. For a moving object inside a pipe, a velocity profile can be calculated from the cross correlation between signals generated from ERT sensors. Many previous studies have used two sets of 2D ERT measurements based on pixel-pixel cross correlation, which requires two ERT systems. In this paper, a method for carrying out flow velocity measurement using a single ERT system is proposed. A novel spatiotemporal total variation regularization approach is utilised to exploit sparsity both in space and time in 4D, and a voxel-voxel cross correlation method is adopted for measurement of flow profile. Result shows that the velocity profile can be calculated with a single ERT system and that the volume fraction and movement can be monitored using the proposed method. Both semi-dynamic experimental and static simulation studies verify the suitability of the proposed method. For in plane velocity profile, a 3D image based on temporal 2D images produces velocity profile with accuracy of less than 1% error and a 4D image for 3D velocity profiling shows an error of 4%.

  4. Evaluation of fall armyworm resistance in maize germplasm lines using visual leaf injury rating and predator survey

    Science.gov (United States)

    After examining ear-colonizing pest resistance, 20 maize lines from the USDA-ARS germplasm enhancement of Maize (GEM) Program were evaluated for whorl-feeding fall armyworm (FAW) (Spodoptera frugiperda) resistance using four maize inbred lines as the resistant and susceptible controls. Both FAW inju...

  5. Contribution of the drought tolerance-related Stress-responsive NAC1 transcription factor to resistance of barley to Ramularia leaf spot

    Science.gov (United States)

    MCGRANN, GRAHAM R D; STEED, ANDREW; BURT, CHRISTOPHER; GODDARD, RACHEL; LACHAUX, CLEA; BANSAL, ANURADHA; CORBITT, MARGARET; GORNIAK, KALINA; NICHOLSON, PAUL; BROWN, JAMES K M

    2015-01-01

    NAC proteins are plant transcription factors that are involved in tolerance to abiotic and biotic stresses, as well as in many developmental processes. Stress-responsive NAC1 (SNAC1) transcription factor is involved in drought tolerance in barley and rice, but has not been shown previously to have a role in disease resistance. Transgenic over-expression of HvSNAC1 in barley cv. Golden Promise reduced the severity of Ramularia leaf spot (RLS), caused by the fungus Ramularia collo-cygni, but had no effect on disease symptoms caused by Fusarium culmorum, Oculimacula yallundae (eyespot), Blumeria graminis f. sp. hordei (powdery mildew) or Magnaporthe oryzae (blast). The HvSNAC1 transcript was weakly induced in the RLS-susceptible cv. Golden Promise during the latter stages of R. collo-cygni symptom development when infected leaves were senescing. Potential mechanisms controlling HvSNAC1-mediated resistance to RLS were investigated. Gene expression analysis revealed no difference in the constitutive levels of antioxidant transcripts in either of the over-expression lines compared with cv. Golden Promise, nor was any difference in stomatal conductance or sensitivity to reactive oxygen species-induced cell death observed. Over-expression of HvSNAC1 delayed dark-induced leaf senescence. It is proposed that mechanisms controlled by HvSNAC1 that are involved in tolerance to abiotic stress and that inhibit senescence also confer resistance to R. collo-cygni and suppress RLS symptoms. This provides further evidence for an association between abiotic stress and senescence in barley and the development of RLS. PMID:25040333

  6. Quantitative trait loci associated with resistance to gray leaf spot and grain yield in corn QTLs associados à resistência a cercosporiose e produção de grãos em milho

    Directory of Open Access Journals (Sweden)

    Adriano Delly Veiga

    2012-02-01

    Full Text Available The main objectives of hybrid development programs include incorporating genetic resistance to diseases and increasing grain yield. Identification of Quantitative Trait Loci (QTL through the statistical analysis of molecular markers allows efficient selection of resistant and productive hybrids. The objective of this research was to identify QTL associated with resistance to gray leaf spot and for grain yield in the germplasm of tropical corn. We used two strains with different degrees of reaction to the disease; the genotypes are owned by GENESEEDS Ltda, their F1 hybrid and the F2 population. The plants were evaluated for gray leaf spot resistance, for grain yield and were genotyped with 94 microsatellite markers. Association of the markers with the QTL was performed by single marker analysis using linear regression and maximum likelihood analysis. It was observed that the additive effect was predominant for genetic control of resistance to gray leaf spot, and the dominant effect in that of grain yield. The most promising markers to be used in studies of assisted selection are: umc2082 in bins 4.03 and umc1117 in bins 4.04 for resistance to gray leaf spot; for grain yield umc1042 in bins 2.07 and umc1058 in bins 4.11.A incorporação de resistência genética a doenças e o aumento na produtividade de grãos estão entre os principais objetivos dos programas de desenvolvimento de híbridos. A identificação de locos de caracteres quantitativos (QTL por meio de análises estatísticas associadas a marcadores moleculares possibilita a rápida obtenção de híbridos resistentes e produtivos. Nesta pesquisa, objetivou-se identificar locos de caracteres quantitativos (QTL associados com resistência à cercosporiose e com produção de grãos em germoplasma de milho tropical. Foram utilizadas duas linhagens contrastantes em níveis de reação à doença (genótipos pertencentes à GENESEEDS - Ltda, seu híbrido F1 e a população segregante F2

  7. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  8. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  9. Removal of total and antibiotic resistant bacteria in advanced wastewater treatment by ozonation in combination with different filtering techniques.

    Science.gov (United States)

    Lüddeke, Frauke; Heß, Stefanie; Gallert, Claudia; Winter, Josef; Güde, Hans; Löffler, Herbert

    2015-02-01

    Elimination of bacteria by ozonation in combination with charcoal or slow sand filtration for advanced sewage treatment to improve the quality of treated sewage and to reduce the potential risk for human health of receiving surface waters was investigated in pilot scale at the sewage treatment plant Eriskirch, Baden-Wuerttemberg/Germany. To determine the elimination of sewage bacteria, inflowing and leaving wastewater of different treatment processes was analysed in a culture-based approach for its content of Escherichia coli, enterococci and staphylococci and their resistance against selected antibiotics over a period of 17 month. For enterococci, single species and their antibiotic resistances were identified. In comparison to the established flocculation filtration at Eriskirch, ozonation plus charcoal or sand filtration (pilot-scale) reduced the concentrations of total and antibiotic resistant E. coli, enterococci and staphylococci. However, antibiotic resistant E. coli and staphylococci apparently survived ozone treatment better than antibiotic sensitive strains. Neither vancomycin resistant enterococci nor methicillin resistant Staphylococcus aureus (MRSA) were detected. The decreased percentage of antibiotic resistant enterococci after ozonation may be explained by a different ozone sensitivity of species: Enterococcus faecium and Enterococcus faecalis, which determined the resistance-level, seemed to be more sensitive for ozone than other Enterococcus-species. Overall, ozonation followed by charcoal or sand filtration led to 0.8-1.1 log-units less total and antibiotic resistant E. coli, enterococci and staphylococci, as compared to the respective concentrations in treated sewage by only flocculation filtration. Thus, advanced wastewater treatment by ozonation plus charcoal or sand filtration after common sewage treatment is an effective tool for further elimination of microorganisms from sewage before discharge in surface waters. Copyright © 2014 Elsevier

  10. Feeding behavior and performance of Nasonovia ribisnigri on grafts, detached leaves, and leaf disks of resistant and susceptible lettuce

    NARCIS (Netherlands)

    Broeke, ten Cindy J.M.; Dicke, Marcel; Loon, van Joop J.A.

    2016-01-01

    Aphids are dependent on the phloem sap of plants as their only source of nutrients. Host-plant resistance in lettuce, Lactuca sativa L. (Asteraceae), mediated by the Nr gene is used to control the lettuce aphid Nasonovia ribisnigri (Mosely) (Hemiptera: Aphididae). The resistance is located in the

  11. VARIABILITY OF FORCED OSCILLATION (SIEMENS SIREGNOST FD-5) MEASUREMENTS OF TOTAL RESPIRATORY RESISTANCE IN PATIENTS AND HEALTHY-SUBJECTS

    NARCIS (Netherlands)

    GIMENO, F; VANDERWEELE, LT; KOETER, GH; DEMONCHY, JGR; VANALTENA, R

    The reproducibility of total respiratory resistance (R(rs)) measured with a simplified forced oscillatory method (Siemens Siregnost FD 5) was measured and compared with that of slow inspiratory vital capacity (IVC) and forced expiratory volume in one second (FEV1). The former technique has the

  12. Endocrine factors related to changes in total peripheral vascular resistance after treatment of thyrotoxic and hypothyroid patients

    NARCIS (Netherlands)

    Diekman, M. J.; Harms, M. P.; Endert, E.; Wieling, W.; Wiersinga, W. M.

    2001-01-01

    Total peripheral vascular resistance (TPR) decreases in thyrotoxicosis and increases in hypothyroidism. Several mechanisms may be involved, including adaptation to changes in heat production and direct non-genomic effects of tri-iodothyronine (T3) on vascular smooth muscle cells. The aim of this

  13. Ethylene Contributes to maize insect resistance1-Mediated Maize Defense against the Phloem Sap-Sucking Corn Leaf Aphid1[OPEN

    Science.gov (United States)

    Louis, Joe; Basu, Saumik; Varsani, Suresh; Castano-Duque, Lina; Jiang, Victoria; Williams, W. Paul; Felton, Gary W.; Luthe, Dawn S.

    2015-01-01

    Signaling networks among multiple phytohormones fine-tune plant defense responses to insect herbivore attack. Previously, it was reported that the synergistic combination of ethylene (ET) and jasmonic acid (JA) was required for accumulation of the maize insect resistance1 (mir1) gene product, a cysteine (Cys) proteinase that is a key defensive protein against chewing insect pests in maize (Zea mays). However, this study suggests that mir1-mediated resistance to corn leaf aphid (CLA; Rhopalosiphum maidis), a phloem sap-sucking insect pest, is independent of JA but regulated by the ET-signaling pathway. Feeding by CLA triggers the rapid accumulation of mir1 transcripts in the resistant maize genotype, Mp708. Furthermore, Mp708 provided elevated levels of antibiosis (limits aphid population)- and antixenosis (deters aphid settling)-mediated resistance to CLA compared with B73 and Tx601 maize susceptible inbred lines. Synthetic diet aphid feeding trial bioassays with recombinant Mir1-Cys Protease demonstrates that Mir1-Cys Protease provides direct toxicity to CLA. Furthermore, foliar feeding by CLA rapidly sends defensive signal(s) to the roots that trigger belowground accumulation of the mir1, signifying a potential role of long-distance signaling in maize defense against the phloem-feeding insects. Collectively, our data indicate that ET-regulated mir1 transcript accumulation, uncoupled from JA, contributed to heightened resistance to CLA in maize. In addition, our results underscore the significance of ET acting as a central node in regulating mir1 expression to different feeding guilds of insect herbivores. PMID:26253737

  14. Shrub type dominates the vertical distribution of leaf C : N : P stoichiometry across an extensive altitudinal gradient

    Science.gov (United States)

    Zhao, Wenqiang; Reich, Peter B.; Yu, Qiannan; Zhao, Ning; Yin, Chunying; Zhao, Chunzhang; Li, Dandan; Hu, Jun; Li, Ting; Yin, Huajun; Liu, Qing

    2018-04-01

    Understanding leaf stoichiometric patterns is crucial for improving predictions of plant responses to environmental changes. Leaf stoichiometry of terrestrial ecosystems has been widely investigated along latitudinal and longitudinal gradients. However, very little is known about the vertical distribution of leaf C : N : P and the relative effects of environmental parameters, especially for shrubs. Here, we analyzed the shrub leaf C, N and P patterns in 125 mountainous sites over an extensive altitudinal gradient (523-4685 m) on the Tibetan Plateau. Results showed that the shrub leaf C and C : N were 7.3-47.5 % higher than those of other regional and global flora, whereas the leaf N and N : P were 10.2-75.8 % lower. Leaf C increased with rising altitude and decreasing temperature, supporting the physiological acclimation mechanism that high leaf C (e.g., alpine or evergreen shrub) could balance the cell osmotic pressure and resist freezing. The largest leaf N and high leaf P occurred in valley region (altitude 1500 m), likely due to the large nutrient leaching from higher elevations, faster litter decomposition and nutrient resorption ability of deciduous broadleaf shrub. Leaf N : P ratio further indicated increasing N limitation at higher altitudes. Interestingly, drought severity was the only climatic factor positively correlated with leaf N and P, which was more appropriate for evaluating the impact of water status than precipitation. Among the shrub ecosystem and functional types (alpine, subalpine, montane, valley, evergreen, deciduous, broadleaf, and conifer), their leaf element contents and responses to environments were remarkably different. Shrub type was the largest contributor to the total variations in leaf stoichiometry, while climate indirectly affected the leaf C : N : P via its interactive effects on shrub type or soil. Collectively, the large heterogeneity in shrub type was the most important factor explaining the overall leaf C : N : P variations

  15. Drought resistance in early and late secondary successional species from a tropical dry forest: the interplay between xylem resistance to embolism, sapwood water storage and leaf shedding

    Science.gov (United States)

    Fernando Pineda-Garcia; Horacio Paz; Frederick C. Meinzer

    2013-01-01

    The mechanisms of drought resistance that allow plants to successfully establish at different stages of secondary succession in tropical dry forests are not well understood. We characterized mechanisms of drought resistance in early and late-successional species and tested whether risk of drought differs across sites at different successional stages, and whether early...

  16. Differential effectiveness of Serratia plymuthica IC1270-induced systemic resistance against hemibiotrophic and necrotrophic leaf pathogens in rice

    Directory of Open Access Journals (Sweden)

    Höfte Monica M

    2009-01-01

    Full Text Available Abstract Background Induced resistance is a state of enhanced defensive capacity developed by a plant reacting to specific biotic or chemical stimuli. Over the years, several forms of induced resistance have been characterized, including systemic acquired resistance, which is induced upon localized infection by an avirulent necrotizing pathogen, and induced systemic resistance (ISR, which is elicited by selected strains of nonpathogenic rhizobacteria. However, contrary to the relative wealth of information on inducible defense responses in dicotyledoneous plants, our understanding of the molecular mechanisms underlying induced resistance phenomena in cereal crops is still in its infancy. Using a combined cytomolecular and pharmacological approach, we analyzed the host defense mechanisms associated with the establishment of ISR in rice by the rhizobacterium Serratia plymuthica IC1270. Results In a standardized soil-based assay, root treatment with IC1270 rendered foliar tissues more resistant to the hemibiotrophic pathogen Magnaporthe oryzae, causal agent of the devastating rice blast disease. Analysis of the cytological and biochemical alterations associated with restriction of fungal growth in IC1270-induced plants revealed that IC1270 primes rice for enhanced attacker-induced accumulation of reactive oxygen species (ROS and autofluorescent phenolic compounds in and near epidermal cells displaying dense cytoplasmic granulation. Similar, yet more abundant, phenotypes of hypersensitively dying cells in the vicinity of fungal hyphae were evident in a gene-for-gene interaction with an avirulent M. oryzae strain, suggesting that IC1270-inducible ISR and R protein conditioned effector-triggered immunity (ETI target similar defense mechanisms. Yet, this IC1270-inducible ISR response seems to act as a double-edged sword within the rice defense network as induced plants displayed an increased vulnerability to the necrotrophic pathogens Rhizoctonia

  17. Melhoramento do feijoeiro comum com grão tipo carioca, visando resistência à antracnose e à mancha angular Breeding of common bean with carioca type grain for the resistance to anthracnose and angular leaf spot

    Directory of Open Access Journals (Sweden)

    Mansuêmia Alves Couto

    2008-10-01

    Full Text Available Objetivou-se no trabalho, selecionar linhagens de feijoeiro comum que reunissem, além da alta produtividade, porte ereto e grãos do tipo Carioca, também a resistência à antracnose e à mancha angular. O material experimental constituiu-se de 143 linhagens oriundas de três famílias segregantes F1:4RC2 {[(G2333 X ESAL 696 X ESAL 696] X CI 140}. Foram conduzidos quatro experimentos em três localidades da região sul de Minas Gerais, avaliando-se a produção, o tipo de grão, o porte e a reação à mancha angular. A reação à antracnose foi determinada a partir de inoculações de plantas jovens de cada linhagem, com as raças 2047 e 1545, mantidas em câmara de nevoeiro por três dias e transferidas para casa de vegetação com irrigação por aspersão, a cada quatro horas. Selecionaram-se quatro linhagens com alta produtividade, porte mais arbustivo, grãos tipo carioca e com resistência à mancha angular (nota até 4. Uma das linhagens selecionada possui o alelo Co-4², outras duas possuem o alelo Co-7 de resistência à antracnose e a última, embora seja suscetível à antracnose, possui resistência à mancha angular (nota 3,97 e maior produtividade de grãos.Aiming to select common bean lines with high grain yield, Carioca grain type, upright plant habit and resistant to anthracnose and angular leaf spot, 143 lines were selected from three families of the cross F1:4RC2 {[(G2333 X ESAL 696 X ESAL 696] X CI 140}. The promising lines were selected based on the agronomical traits in four field experiments, set up in three places in Southern MG State using the square lattice design. The reaction of each line to the anthracnose was evaluated by inoculating the seedlings using the races 1545 and 2047, and kept in humid chamber during three days, and then moved to greenhouse with sprinkle irrigation every four hours. Four lines with high grain yield, upright plant habit, Carioca grain type, and resistance to angular leaf spot (score up

  18. Sulfonamide and tetracycline resistance genes in total- and culturable-bacterial assemblages in South African aquatic environments

    Directory of Open Access Journals (Sweden)

    Satoru eSuzuki

    2015-08-01

    Full Text Available Antibiotic resistant bacteria (ARB are ubiquitous in the natural environment. The introduction of effluent derived antibiotic resistance genes (ARGs into aquatic environments is of concern in the spreading of genetic risk. This study showed the prevalence of sulfonamide and tetracycline resistance genes, sul1, sul2, sul3 and tet(M, in the total bacterial assemblage and colony forming bacterial assemblage in river and estuarine water and sewage treatment plants (STP in South Africa. There was no correlation between antibiotic concentrations and ARGs, suggesting the targeted ARGs are spread in a wide area without connection to selection pressure. Among sul genes, sul1 and sul2 were major genes in the total (over 10-2 copies/16S and colony forming bacteria assemblages (approx 10-1 copies/16S. In urban waters, the sul3 gene was mostly not detectable in total and culturable assemblages, suggesting sul3 is not abundant. tet(M was found in natural assemblages with 10-3 copies/16S level in STP, but was not detected in colony forming bacteria, suggesting the non-culturable (yet-to-be cultured bacterial community in urban surface waters and STP effluent possess the tet(M gene. Sulfamethoxazole resistant (SMXr and oxytetracycline resistant (OTCr bacterial communities in urban waters possessed not only sul1 and sul2 but also sul3 and tet(M genes. These genes are widely distributed in SMXr and OTCr bacteria. In conclusion, urban river and estuarine water and STP effluent in the Durban area were highly contaminated with ARGs, and the yet-to-be cultured bacterial community may act as a non-visible ARG reservoir in certain situations.

  19. Evaluation of host resistance to Botrytis bunch rot in Vitis spp. and its correlation with Botrytis leaf spot

    Science.gov (United States)

    Botrytis cinerea, the causal agent of Botrytis bunch rot and gray mold, is the number one postharvest disease of fresh grapes in the United States. Fungicide applications are used to manage the disease, but fungicide-resistant isolates are common and postharvest losses occur annually. Host resistanc...

  20. High-resolution mapping of genes involved in plant stage-specific partial resistance of barley to leaf rust

    NARCIS (Netherlands)

    Yeo, F.K.S.; Bouchon, R.; Kuijken, R.; Loriaux, A.; Boyd, C.; Niks, R.E.; Marcel, T.C.

    2017-01-01

    Partial resistance quantitative trait loci (QTLs) Rphq11 and rphq16 against Puccinia hordei isolate 1.2.1 were previously mapped in seedlings of the mapping populations Steptoe/Morex and Oregon Wolfe Barleys, respectively. In this study, QTL mapping was performed at adult plant stage for the two

  1. Genetic and molecular characterization of leaf rust resistance in two durum landraces against the durum- specific Puccinia triticina races

    Science.gov (United States)

    The Portuguese durum landraces, Aus26582 and Aus26579, showed resistance against two very different durum-specific Puccinia triticina (Pt) races CA 1.2 and ETH 12.5-2 collected from California and Ethiopia, respectively. Aus26582 and Aus26579 were crossed with a susceptible landrace Bansi to develop...

  2. Identification of mutations associated with pyrethroid resistance in the voltage-gated sodium channel of the tomato leaf miner (Tuta absoluta).

    Science.gov (United States)

    Haddi, Khalid; Berger, Madeleine; Bielza, Pablo; Cifuentes, Dina; Field, Linda M; Gorman, Kevin; Rapisarda, Carmelo; Williamson, Martin S; Bass, Chris

    2012-07-01

    The tomato leaf miner, Tuta absoluta (Lepidoptera) is a significant pest of tomatoes that has undergone a rapid expansion in its range during the past six years and is now present across Europe, North Africa and parts of Asia. One of the main means of controlling this pest is through the use of chemical insecticides. In the current study insecticide bioassays were used to determine the susceptibility of five T. absoluta strains established from field collections from Europe and Brazil to pyrethroids. High levels of resistance to λ cyhalothrin and tau fluvalinate were observed in all five strains tested. To investigate whether pyrethroid resistance was mediated by mutation of the para-type sodium channel in T. absoluta the IIS4-IIS6 region of the para gene, which contains many of the mutation sites previously shown to confer knock down (kdr)-type resistance to pyrethroids across a range of different arthropod species, was cloned and sequenced. This revealed that three kdr/super-kdr-type mutations (M918T, T929I and L1014F), were present at high frequencies within all five resistant strains at known resistance 'hot-spots'. This is the first description of these mutations together in any insect population. High-throughput DNA-based diagnostic assays were developed and used to assess the prevalence of these mutations in 27 field strains from 12 countries. Overall mutant allele frequencies were high (L1014F 0.98, M918T 0.35, T929I 0.60) and remarkably no individual was observed that did not carry kdr in combination with either M918T or T929I. The presence of these mutations at high frequency in T. absoluta populations across much of its range suggests pyrethroids are likely to be ineffective for control and supports the idea that the rapid expansion of this species over the last six years may be in part mediated by the resistance of this pest to chemical insecticides. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  3. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  4. Dissociated time course between peak torque and total work recovery following bench press training in resistance trained men.

    Science.gov (United States)

    Ferreira, Diogo V; Gentil, Paulo; Ferreira-Junior, João B; Soares, Saulo R S; Brown, Lee E; Bottaro, Martim

    2017-10-01

    To evaluate the time course of peak torque and total work recovery after a resistance training session involving the bench press exercise. Repeated measures with a within subject design. Twenty-six resistance-trained men (age: 23.7±3.7years; height: 176.0±5.7cm; mass: 79.65±7.61kg) performed one session involving eight sets of the bench press exercise performed to momentary muscle failure with 2-min rest between sets. Shoulder horizontal adductors peak torque (PT), total work (TW), delayed onset muscle soreness (DOMS) and subjective physical fitness were measured pre, immediately post, 24, 48, 72 and 96h following exercise. The exercise protocol resulted in significant pectoralis major DOMS that lasted for 72h. Immediately after exercise, the reduction in shoulder horizontal adductors TW (25%) was greater than PT (17%). TW, as a percentage of baseline values, was also less than PT at 24, 48 and 96h after exercise. Additionally, PT returned to baseline at 96h, while TW did not. Resistance trained men presented dissimilar PT and TW recovery following free weight bench press exercise. This indicates that recovery of maximal voluntary contraction does not reflect the capability to perform multiple contractions. Strength and conditioning professionals should be cautious when evaluating muscle recovery by peak torque, since it can lead to the repetition of a training session sooner than recommended. Copyright © 2017. Published by Elsevier Inc.

  5. Antidiabetic Effect of Hydroalcholic Urtica dioica Leaf Extract in Male Rats with Fructose-Induced Insulin Resistance

    Science.gov (United States)

    Ahangarpour, Akram; Mohammadian, Maryam; Dianat, Mahin

    2012-01-01

    Background: Urtica dioica has been used as antihypertensive, antihyperlipidemic and antidiabetic herbal medicine. The purpose of this study was to study the effect of hydroalcoholic extract of Urtica dioica on fructose-induced insulin resistance rats. Methods: Forty male Wistar rats were randomly divided into five groups including control, fructose, extract 50, extract 100 and extract 200. The control rat received vehicle, the fructose and extract groups received fructose 10% for eight weeks. The extract groups received single daily injection of vehicle, 50, 100 or 200 mg/kg/day for the two weeks. Blood glucose, insulin, last fasting insulin resistance index (FIRI), serum triglyceride (TG), low-density lipoprotein (LDL), very low-density lipoprotein (VLDL), high-density lipoprotein (HDL), alanin trasaminase (AST) and alkaline phosphatase (ALP), leptin and LDL/HDL ratio were determined. Results: Compared to control group, daily administration of fructose was associated with significant increase in FIRI, blood glucose and insulin, significant decrease in lepin, and no significant change in TG, HDL, LDL, LDL/HDL ratio, VLDL, ALT, and ALP. The extract significantly decreased serum glucose, insulin, LDL and leptin, and LDL/HDL ratio and FIRI. It also significantly increased serum TG, VLDL, and AST, but did not change serum ALP. Conclusion: We suggest that Urtica dioica extract, by decreasing serum glucose, and FIRI, may be useful to improve type 2 diabetes mellitus. Also, by positive effect on lipid profile and by decreasing effect on leptin, it may improve metabolic syndrome. PMID:23115450

  6. Antidiabetic Effect of Hydroalcholic Urtica dioica Leaf Extract in Male Rats with Fructose-Induced Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Akram Ahangarpour

    2012-09-01

    Full Text Available Background: Urtica dioica has been used as antihypertensive, antihyperlipidemic and antidiabetic herbal medicine. The purpose of this study was to study the effect of hydroalcoholic extract of Urtica dioica on fructose-induced insulin resistance rats. Methods: Forty male Wistar rats were randomly divided into five groups including control, fructose, extract 50, extract 100 and extract 200. The control rat received vehicle, the fructose and extract groups received fructose 10% for eight weeks. The extract groups received single daily injection of vehicle, 50, 100 or 200 mg/kg/day for the two weeks. Blood glucose, insulin, last fasting insulin resistance index (FIRI, serum triglyceride (TG, low-density lipoprotein (LDL, very low-density lipoprotein (VLDL, high-density lipoprotein (HDL, alanin trasaminase (AST and alkaline phosphatase (ALP, leptin and LDL/HDL ratio were determined.Results: Compared to control group, daily administration of fructose was associated with significant increase in FIRI, blood glucose and insulin, significant decrease in lepin, and no significant change in TG, HDL, LDL, LDL/HDL ratio, VLDL, ALT, and ALP. The extract significantly decreased serum glucose, insulin, LDL and leptin, and LDL/HDL ratio and FIRI. It also significantly increased serum TG, VLDL, and AST, but did not change serum ALP.Conclusion: We suggest that Urtica dioica extract, by decreasing serum glucose, and FIRI, may be useful to improve type 2 diabetes mellitus. Also, by positive effect on lipid profile and by decreasing effect on leptin, it may improve metabolic syndrome.

  7. Effect of dietary protein quality on the resistance of rats to total body radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bounous, G.; Pageau, R.

    1983-02-01

    Young rats have been fed four defined-formula diets before and after ..gamma..-irradiation (700 rd (7.0 Gy), 75 rd/min (750 mGy), 80 cm from the source, total body). Animals eating a diet containing lactalbumin hydrolyzate (20 g/100 g diet) exhibited less anorexia and weight loss following ..gamma..-rays than a corresponding group eating casein hydrolyzate (20 g/100 g diet).

  8. Castanea sativa (European Chestnut Leaf Extracts Rich in Ursene and Oleanene Derivatives Block Staphylococcus aureus Virulence and Pathogenesis without Detectable Resistance.

    Directory of Open Access Journals (Sweden)

    Cassandra L Quave

    Full Text Available The Mediterranean is home to a rich history of medical traditions that have developed under the influence of diverse cultures over millennia. Today, many such traditions are still alive in the folk medical practices of local people. Investigation of botanical folk medicines used in the treatment of skin and soft tissue infections led us to study Castanea sativa (European Chestnut for its potential antibacterial activity. Here, we report the quorum sensing inhibitory activity of refined and chemically characterized European Chestnut leaf extracts, rich in oleanene and ursene derivatives (pentacyclic triterpenes, against all Staphylococcus aureus accessory gene regulator (agr alleles. We present layers of evidence of agr blocking activity (IC50 1.56-25 μg mL-1, as measured in toxin outputs, reporter assays hemolytic activity, cytotoxicity studies, and an in vivo abscess model. We demonstrate the extract's lack of cytotoxicity to human keratinocytes and murine skin, as well as lack of growth inhibitory activity against S. aureus and a panel of skin commensals. Lastly, we demonstrate that serial passaging of the extract does not result in acquisition of resistance to the quorum quenching composition. In conclusion, through disruption of quorum sensing in the absence of growth inhibition, this study provides insight into the role that non-biocide inhibitors of virulence may play in future antibiotic therapies.

  9. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  10. Determination of total arsenic in soil and arsenic-resistant bacteria from selected ground water in Kandal Province, Cambodia

    International Nuclear Information System (INIS)

    Hamzah, A.; Wong, K.K.; Hasan, F.N.; Mustafa, S.; Khoo, K.S.; Sarmani, S.B.

    2013-01-01

    Cambodia has geological environments conducive to generation of high-arsenic groundwater and people are at high risk of chronic arsenic exposure. The aims of this study are to investigate the concentration of total arsenic and to isolate and identify arsenic-resistant bacteria from selected locations in Kandal Province, Cambodia. The INAA technique was used to measure the concentration of total arsenic in soils. The arsenic concentrations in soils were above permissible 5 mg/kg, ranging from 5.34 to 27.81 mg/kg. Bacteria resistant to arsenic from two arsenic-contaminated wells in Preak Russey were isolated by enrichment method in nutrient broth (NB). Colonies isolated from NB was then grown on minimal salt media (MSM) added with arsenic at increasing concentrations of 10, 20, 30, 50, 100 and 250 ppm. Two isolates that can tolerate 750 ppm of arsenic were identified as Enterobacter agglomerans and Acinetobacter lwoffii based on a series of biochemical, physiological and morphological analysis. Optimum growth of both isolates ranged from pH 6.6 to 7.0 and 30-35 deg C. E. agglomerans and A. lwoffii were able to remove 66.4 and 64.1 % of arsenic, respectively at the initial concentration of 750 ppm, within 72 h of incubation. Using energy dispersive X-ray technique, the percentage of arsenic absorbed by E. agglomerans and A. lwoffii was 0.09 and 0.15 %, respectively. This study suggested that arsenic-resistant E. agglomerans and A. lwoffii removed arsenic from media due to their ability to absorb arsenic. (author)

  11. Total body fat, proinflammatory cytokines and insulin resistance in Indian subjects

    International Nuclear Information System (INIS)

    Yajnik, C.S.; Lubree, H.G.; Rege, S.S.; Bhat, D.S.; Raut, K.N.; Panchanadikar, A.S.; Joglekar, C.B.; Naik, S.S.; Shetty, P.; Yudkin, J.; Kurpad, A.V.

    2002-01-01

    We studied cardiovascular risk factors in 30 to 50 year old Indian men in three geographical locations (rural, urban slums and urban middle class) in relation to their body fat. A total of 1,222 subjects, selected by stratified random sampling were screened: 39 reported diabetic or hypertensive. Of the remaining subjects 600 were randomly selected for further testing. This is a report 441 men studied (149 rural, 142 slums, 150 urban middle class). The mean age of these men was 38 y rural, 38 y urban slums, 41 y urban middle class, mean BMI 21.0 kg/m 2 , 22.3 kg/m 2 and 24.3 kg/m 2 respectively, mean body fat percent by bio-impedance 20.4%, 22.5% and 30.4% and by Deuterated water was 19.9%, 21.6% and 27.2% respectively. A 75 g oral glucose tolerance test (WHO 1985) showed no diabetes in rural subjects, while 4% urban slum dwellers and 10 in urban middle class were diabetic; 9% rural men had IGT, compared to 12% in urban slums and 20% in urban middle class. Hypertension (blood pressure ≥ 140/90 mm Bg) was present in 2% rural men, 4% in urban slums and in 10% men in urban middle class. Mean plasma cholesterol concentration was 148 mg% in rural, 53 mg% in urban slums and 64 mg% in urban middle class, mean plasma triglyceride concentrations were 82 mg%, 95 mg% and 108 mg% respectively. All cardiovascular risk factors were strongly related to measures of obesity (body fat % and waist hip ratio). On multivariate analysis 2h plasma glucose (OGTT) concentration and blood pressure were additionally related to geographical location (urban middle class>slums>rural). Our results suggest that urbanisation increases the risk of glucose intolerance and hypertension independent of the body fat percent or its central distribution. This suggests there may he additional environmental factors in the urban environment increasing the risk of diabetes over and above the effect of body fat. (author)

  12. Total body fat, proinflammatory cytokines and insulin resistance in Indian subjects

    Energy Technology Data Exchange (ETDEWEB)

    Yajnik, C S; Lubree, H G; Rege, S S; Bhat, D S; Raut, K N; Panchanadikar, A S; Joglekar, C B; Naik, S S [Diabetest Unit, KEM Hospital Resarch Centre, Pune (India); Shetty, P [London School of Hygiene and Tropical Medicine, London (United Kingdom); Yudkin, J [International Health and Medical Education Centre, UCL, London (United Kingdom); Kurpad, A V [St. John' s Medical College, Bangalore (India)

    2002-07-01

    We studied cardiovascular risk factors in 30 to 50 year old Indian men in three geographical locations (rural, urban slums and urban middle class) in relation to their body fat. A total of 1,222 subjects, selected by stratified random sampling were screened: 39 reported diabetic or hypertensive. Of the remaining subjects 600 were randomly selected for further testing. This is a report 441 men studied (149 rural, 142 slums, 150 urban middle class). The mean age of these men was 38 y rural, 38 y urban slums, 41 y urban middle class, mean BMI 21.0 kg/m{sup 2}, 22.3 kg/m{sup 2} and 24.3 kg/m{sup 2} respectively, mean body fat percent by bio-impedance 20.4%, 22.5% and 30.4% and by Deuterated water was 19.9%, 21.6% and 27.2% respectively. A 75 g oral glucose tolerance test (WHO 1985) showed no diabetes in rural subjects, while 4% urban slum dwellers and 10 in urban middle class were diabetic; 9% rural men had IGT, compared to 12% in urban slums and 20% in urban middle class. Hypertension (blood pressure {>=} 140/90 mm Bg) was present in 2% rural men, 4% in urban slums and in 10% men in urban middle class. Mean plasma cholesterol concentration was 148 mg% in rural, 53 mg% in urban slums and 64 mg% in urban middle class, mean plasma triglyceride concentrations were 82 mg%, 95 mg% and 108 mg% respectively. All cardiovascular risk factors were strongly related to measures of obesity (body fat % and waist hip ratio). On multivariate analysis 2h plasma glucose (OGTT) concentration and blood pressure were additionally related to geographical location (urban middle class>slums>rural). Our results suggest that urbanisation increases the risk of glucose intolerance and hypertension independent of the body fat percent or its central distribution. This suggests there may he additional environmental factors in the urban environment increasing the risk of diabetes over and above the effect of body fat. (author)

  13. Azadirachta indica (neem) leaf dietary effects on the immunity response and disease resistance of Asian seabass, Lates calcarifer challenged with Vibrio harveyi.

    Science.gov (United States)

    Talpur, Allah Dad; Ikhwanuddin, Mhd

    2013-01-01

    The present study was aimed to address the possible evaluation of Azadirachta indica (neem) leaf-supplemented diets on innate immune response in Asian seabass, Lates calcarifer fingerlings against Vibrio harveyi infection. Fish were fed for two weeks diets containing six graded levels of neem leaf at 0 g, 1 g, 2 g, 3 g, 4 g and 5 g per kg feed. Fish fed neem leaf-supplemented diet displayed significant differences (p growth rate (SGR) and feed conversion ratio (FCR) compared to the control group fed without neem leaf-supplemented diet. Various innate immune parameters were examined pre-challenge and post-challenge. Fish was injected intraperitoneally with a lethal dose of V. harveyi containing 10(8) cells mL(-1). Supplementation of neem leaf diet significantly increased phagocytic activity, superoxide anion production, serum lysozyme, serum bactericidal activity, serum anti-protease activity throughout the experimental period when compared with the control group. Dietary doses of neem leaf diet significantly influenced the immune parameters, haematological parameters and blood biochemical indices of treated fish. The results suggested that fish fed neem leaf-supplemented diet improved the immune system and increased survival rate in L. calcarifer fingerlings against V. harveyi infection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  15. Tissue Clearance of {sup 131}I and Total Peripheral Resistance in Myocardial Infarction and Hypertension, and During Angiotensin Infusion

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, F. K.; Bors, K. J.; Long, T. E.; Lestina, J. [University of Southern California School of Medicine, Los Angeles, CA (United States)

    1971-02-15

    Tissue clearance of {sup 131}I from the thigh, cardiac output and peripheral resistance was determined in 25 patients: 13 normotensive with recent myocardial infarction but not in congestive heart failure, 7 with hypertension and 5 normotensive control subjects. The effect of the synthesized pressor agent Angiotensin II on the same three measurements was also studied. The present investigation continues a previous one of ours, where a tracer dose of {sup 131}I was injected into the thigh of patients with recent myocardial infarction without signs of heart failure, and its clearance was found to be longer than that of normal subjects. This was thought to be due to increased peripheral resistance or to reduced perfusion of the capillary bed secondary to lowered cardiac output, With the 25 subjects, injection into the thigh of tracer amounts of radioactive iodine was done by Hypospray, a method with distinct advantages over needle injection. After measuring tissue clearance of the tracer, cardiac output was determined by a method which records the transit of the injected radioactive bolus through the heart. The Angiotensin was administered by intravenous infusion to four of the normotensive and one of the hypertensive patients. Calculations of cardiac output, total peripheral resistance, mean blood pressure and blood volume were made by means of standard formulae. Results of the study confirmed expectations. Those patients with myocardial infarction who had delayed tissue clearance of {sup 131}I also had reduced cardiac output. The patients with hypertension had normal tissue clearance of {sup 131}I and normal cardiac output in the presence of increased peripheral resistance. Equivalent hypertension and increased peripheral resistance induced in normotensive subjects by Angiotensin resulted in lowered cardiac output and delayed tissue clearance of {sup 131}I. An increased sensitivity to Angiotensin was noted in hypertensive patients. The tissue clearance of {sup 131}I

  16. Md-miR156ab and Md-miR395 Target WRKY Transcription Factors to Influence Apple Resistance to Leaf Spot Disease.

    Science.gov (United States)

    Zhang, Qiulei; Li, Yang; Zhang, Yi; Wu, Chuanbao; Wang, Shengnan; Hao, Li; Wang, Shengyuan; Li, Tianzhong

    2017-01-01

    MicroRNAs (miRNAs) are key regulators of gene expression that post-transcriptionally regulate transcription factors involved in plant physiological activities. Little is known about the effects of miRNAs in disease resistance in apple ( Malus × domestica ). We globally profiled miRNAs in the apple cultivar Golden Delicious (GD) infected or not with the apple leaf spot fungus Alternaria alternaria f. sp. mali (ALT1), and identified 58 miRNAs that exhibited more than a 2-fold upregulation upon ALT1 infection. We identified a pair of miRNAs that target protein-coding genes involved in the defense response against fungal pathogens; Md-miR156ab targets a novel WRKY transcription factor, MdWRKYN1, which harbors a TIR and a WRKY domain. Md-miR395 targets another transcription factor, MdWRKY26, which contains two WRKY domains. Real-time PCR analysis showed that Md-miR156ab and Md-miR395 levels increased, while MdWRKYN1 and MdWRKY26 expression decreased in ALT1-inoculated GD leaves; furthermore, the overexpression of Md-miR156ab and Md-miR395 resulted in a significant reduction in MdWRKYN1 and MdWRKY26 expression. To investigate whether these miRNAs and their targets play a crucial role in plant defense, we overexpressed MdWRKYN1 or knocked down Md-miR156ab activity, which in both cases enhanced the disease resistance of the plants by upregulating the expression of the WRKY-regulated pathogenesis-related (PR) protein-encoding genes MdPR3-1, MdPR3-2, MdPR4, MdPR5, MdPR10-1 , and MdPR10-2 . In a similar analysis, we overexpressed MdWRKY26 or suppressed Md-miR395 activity, and found that many PR protein-encoding genes were also regulated by MdWRKY26 . In GD, ALT-induced Md-miR156ab and Md-miR395 suppress MdWRKYN1 and MdWRKY26 expression, thereby decreasing the expression of some PR genes, and resulting in susceptibility to ALT1.

  17. Aegilops tauschii Accessions with Geographically Diverse Origin Show Differences in Chromosome Organization and Polymorphism of Molecular Markers Linked to Leaf Rust and Powdery Mildew Resistance Genes.

    Science.gov (United States)

    Majka, Maciej; Kwiatek, Michał T; Majka, Joanna; Wiśniewska, Halina

    2017-01-01

    Aegilops tauschii (2n = 2x = 14) is a diploid wild species which is reported as a donor of the D-genome of cultivated bread wheat. The main goal of this study was to examine the differences and similarities in chromosomes organization among accessions of Ae. tauschii with geographically diversed origin, which is believed as a potential source of genes, especially determining resistance to fungal diseases (i.e., leaf rust and powdery mildew) for breeding of cereals. We established and compared the fluorescence in situ hybridization patterns of 21 accessions of Ae. tauschii using various repetitive sequences mainly from the BAC library of wheat cultivar Chinese Spring. Results obtained for Ae. tauschii chromosomes revealed many similarities between analyzed accessions, however, some hybridization patterns were specific for accessions, which become from cognate regions of the World. The most noticeable differences were observed for accessions from China which were characterized by presence of distinct signals of pTa-535 in the interstitial region of chromosome 3D, less intensity of pTa-86 signals in chromosome 2D, as well as lack of additional signals of pTa-86 in chromosomes 1D, 5D, or 6D. Ae. tauschii of Chinese origin appeared homogeneous and separate from landraces that originated in western Asia. Ae. tauschii chromosomes showed similar hybridization patterns to wheat D-genome chromosomes, but some differences were also observed among both species. What is more, we identified reciprocal translocation between short arm of chromosome 1D and long arm of chromosome 7D in accession with Iranian origin. High polymorphism between analyzed accessions and extensive allelic variation were revealed using molecular markers associated with resistance genes. Majority of the markers localized in chromosomes 1D and 2D showed the diversity of banding patterns between accessions. Obtained results imply, that there is a moderate or high level of polymorphism in the genome of Ae

  18. Resistência genética à mancha-bacteriana em genótipos de pimentão Genetic resistance to bacterial leaf spot on sweet pepper genotypes

    Directory of Open Access Journals (Sweden)

    Roberto Alexandre Costa

    2002-03-01

    Full Text Available A mancha-bacteriana, principal doença bacteriana do pimentão causa desfolha intensa quando em condições favoráveis, deixando os frutos expostos ao sol, depreciando-os e diminuindo a produção. Para estimar, nas condições de Campos dos Goytacazes, os efeitos genéticos da reação do hospedeiro ao patógeno, tanto em folhas como em frutos, foram obtidos híbridos F1, sem recíprocos, a partir de cruzamentos dialélicos entre cinco genótipos de pimentão, sendo três suscetíveis ('UENF 1420', 'UENF 1421' e 'UENF 1422' e dois resistentes ('UENF 1381' e 'UENF 1382'. A inoculação com Xanthomonas campestris pv. vesicatoria constou de infiltração no mesófilo foliar, utilizando-se a concentração de 10³ células/ml, ajustada com auxílio de espectrofotômetro. Os efeitos de variedade e de heterose média foram significativos para resistência em folhas, indicando que efeitos aditivos e de dominância estão envolvidos no controle genético deste caráter. Para resistência em frutos, apenas os efeitos de variedade foram significativos, indicando a presença de efeitos aditivos no controle desta característica. A partir das análises puderam ser selecionados os parentais para RMB em folhas: 'UENF 1381' e 'UENF 1382'. Para RMB em frutos 'UENF 1381' e 'UENF 1421' foram os melhores parentais. Os melhores híbridos para RMB em folhas foram: 'UENF 1420' x 'UENF 1421', 'UENF 1382' x 'UENF 1420', 'UENF 1381' x 'UENF 1420', 'UENF 1381' x 'UENF 1421', 'UENF 1381' x 'UENF 1422' e 'UENF 1381' x 'UENF 1382'.Bacterial leaf spot (BLS is the most important bacterial disease in sweet pepper, causing intense defoliation under favorable conditions, leaving the exposed fruits to sunburn and decreasing the yield. To estimate genetic effects of the reaction to BLS on leaves and fruits, under the conditions of Campos dos Goytacazes (Brazil, hybrids F1, without reciprocals, were obtained from diallel crosses among five pepper genotypes, three susceptible

  19. No exacerbation of knee joint pain and effusion following preoperative progressive resistance training in patients scheduled for total knee arthroplasty

    DEFF Research Database (Denmark)

    Skoffer, Birgit; Dalgas, Ulrik; Maribo, Thomas

    2017-01-01

    BACKGROUND: Preoperative progressive resistance training (PRT) is controversial in patients scheduled for total knee arthroplasty (TKA), because of the concern that it may exacerbate knee joint pain and effusion. OBJECTIVE: To examine if preoperative PRT initiated 5 weeks prior to TKA would 1......) exacerbate pain and knee effusion, 2) allow a progressively increased training load throughout the training period that would subsequently increase muscle strength. DESIGN: Secondary analyses from a randomized controlled trial. SETTING: University Hospital and a Regional Hospital. PATIENTS: Thirty patients...... OUTCOME MEASURES: Before and after each training session, knee joint pain rated on an 11-point scale, effusion assessed by measuring the knee joint circumference, and training load were recorded. The first and last training session were initiated by 1RM testing of unilateral leg press, knee extension...

  20. Effects of phosphorus availability and genetic variation of leaf terpene content and emission rate in Pinus pinaster seedlings susceptible and resistant to the pine weevil, Hylobius abietis.

    Science.gov (United States)

    Blanch, J-S; Sampedro, L; Llusià, J; Moreira, X; Zas, R; Peñuelas, J

    2012-03-01

    We studied the effects of phosphorus fertilisation on foliar terpene concentrations and foliar volatile terpene emission rates in six half-sib families of Pinus pinaster Ait. seedlings. Half of the seedlings were resistant to attack of the pine weevil Hylobius abietis L., a generalist phloem feeder, and the remaining seedlings were susceptible to this insect. We hypothesised that P stress could modify the terpene concentration in the needles and thus lead to altered terpene emission patterns relevant to plant-insect signalling. The total concentration and emission rate ranged between 5732 and 13,995 μg·g(-1) DW and between 2 and 22 μg·g(-1) DW·h(-1), respectively. Storage and emission were dominated by the isomers α- and β-pinene (77.2% and 84.2% of the total terpene amount amassed and released, respectively). In both resistant and susceptible families, P stress caused an increase of 31% in foliar terpene concentration with an associated 5-fold decrease in terpene emission rates. A higher terpene content in the leaves implies that the 'excess carbon', available under limiting growth conditions (P scarcity), is allocated to terpene production. Sensitive families showed a greater increase in terpene emission rates with increasing P concentrations, which could explain their susceptibility to H. abietis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

  1. Soja: queima das folhas como critério de seleção para resistência à acidez do solo Leaf scorching as a criteria to select soybean for resistance to soil acidity

    Directory of Open Access Journals (Sweden)

    Manoel Albino Coelho de Miranda

    1988-01-01

    duplicated simple lattice design. Soil concentrations of Al, P and K were high. A single row plot two meters long was used with spacing of 60 centimeters between rows and 20 plants per meter. The soybean cultivars were seeded in November in order to insure the maximum vegetative growth. The parameters measured were: dry matter weight, plant height, primary root length and scores of root coloration and leaf scorching at 60 days after planting. The cultivars IAC-9, Biloxi, IAC-Santa Maria 702, IAC-2 and PI 274.454 had higher dry matter weight, plant heigth and lower scores on leaf scorching, aluminum and manganese contents and better indices than other genotypes. Althought the root lenght and scores on root color showed differences, they were not as good as the former parameters. There was a significant correlation between dry matter weight and leaf scorching suggesting the utilization of this criteria in soybean breeding for resistance to soil acidity. This method also takes into account the importance of symbiotic nitrogen fixation in the increase of dry matter weight of those cultivars resistant to leaf scorching since the plants were grown in natural environment.

  2. Corrosion resistance of API 5L grade B steel with taro leaf (Colocasia esculenta) addition as corrosion inhibitor in HCl 0.1 M

    Science.gov (United States)

    Lestari, Yulinda; Priyotomo, Gadang

    2018-05-01

    Taro leaf (Colocasia esculenta) has the potential to be used as a corrosion inhibitor because it has a substance called polyphenol that binds to the hydroxyl group and essential amino acids. Taro leaf extract is taken by maceration method. In this study, the specimen was steel API 5L grade B that would measured the corosivity in 0.1 M HCl solution + taro leaf extract with a specific concentration (in ppm). Tests conducted by FTIR method taro leaves, potentiodynamic polarization (Tafel) and Electrochemical Impedance Spectroscopy (EIS). Based on the results revealed that there is a phenolic group in taro leaves, which has polyphenol content 0.053 % (mg/100 mg). The optimum composition of taro leaf extract is 4000 ppm which generate corrosion rate value of 30.22 mpy and efficiency inhibitor performance of 72.7 %. In this study, the Kads value of taro leaf extract ranged from 0.885 to greater than Kads value of ginger extract in hydrochloric acid solution. The high Kads values indicate a more efficient process of adsorption and better value of inhibition efficiency.

  3. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  4. PP064. Total vascular resistances in early pregnancy: A key to understand abnormal cardiovascular adaptation associated with spontaneous abortion.

    Science.gov (United States)

    Lo Presti, Damiano; Scala, Roberta Licia; Tiralongo, Grazia Maria; Pisani, Ilaria; Gagliardi, Giulia; Novelli, Gian Paolo; Vasapollo, Barbara; Valensise, Herbert

    2013-04-01

    From early pregnancy, maternal hemodynamic profile begins to change. The absence of these changes leads to increased risk of complication during the gestation. Aim of this study is to understand in early pregnancy the behaviour of total vascular resistances (TVR) as a sign of maternal cardiovascular adaptation to pregnancy. A cross section study was conducted. We followed 160 healthy women with singleton pregnancy during the first trimester of gestation. We evaluated cardiac output (CO) and TVR at 7, 9 and 11 weeks of gestation. We obtained the following haemodynamic measurements with the USCOM system, a non invasive method: heart rate (HR), systolic and diastolic blood pressure (SBP, DBP), CO and TVR. 160 healthy pregnant women were selected, 8 patients, were excluded for a bad signal. Absolute values of the haemodynamic measures are shown in Fig. 1. 41 patients underwent spontaneous embryonic demise. This last group of patients showed in 54% (group A) TVR values within the normal limits (TVR1200) and CO values below the normal adaptation to pregnancy. Table 1 shows hemodynamic measures for the group A and group B; we found differences in term of CO, TVR and PAS between the two groups. Elevated TVR might indicate an abnormal vascular adaptation already in first weeks of pregnancy. Moreover, in women who undergo to abortion, elevated TVR could be use to distinguish genetic or environmental causes of miscarriage. Copyright © 2013. Published by Elsevier B.V.

  5. Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

    Science.gov (United States)

    An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

  6. Seleção de famílias de feijoeiro resistente à antracnose e à mancha-angular Selection of common bean families resistant to anthracnose and angular leaf spot

    Directory of Open Access Journals (Sweden)

    Marcelo Geraldo de Morais Silva

    2006-10-01

    Full Text Available O objetivo deste trabalho foi identificar famílias de feijoeiro com resistência a Colletotrichum lindemuthianum e Phaeoisariopsis griseola e com outros fenótipos agronômicos desejáveis. As famílias utilizadas foram obtidas do cruzamento entre a linhagem H91, portadora de três alelos de resistência à antracnose, com três famílias F2:5 resistentes à mancha-angular, derivadas da cultivar Jalo EEP 558. Foi utilizado o delineamento látice quadrado em todos os experimentos. Inicialmente, foram avaliadas 144 famílias F2:3, no inverno de 2004, em Lavras, MG, com base no tipo de grão. Foram selecionadas 80 famílias F2:4 e avaliadas com a testemunha BRSMG Talismã, no período das águas de 2004/2005, no mesmo local. Considerando-se o tipo de grão e a resistência à mancha-angular e antracnose, foram mantidas 48 famílias F2:5, que foram avaliadas na seca de 2005, em Lavras e Lambari, MG. Essas 48 famílias passaram por inoculação das raças 2047, 73 e 1545 de C. lindemuthianum, para verificação da presença dos alelos de resistência Co-4², Co-5 e Co-7, respectivamente. Foram identificados genótipos da maioria das 48 famílias, quanto à reação à antracnose, das quais se destacaram quatro, em relação ao tipo de grão semelhante ao 'Carioca', de porte ereto, produtividade elevada e resistência à mancha-angular.The objective of this work was to select common bean families resistant to Colletotrichum lindemuthianum and Phaeoisariopsis griseola and, also, with superior agronomical traits. Families used were obtained from crosses of H91 lineage, bearer of three alleles resistant to anthracnose, and F2;5 families derived from the cultivar Jalo EEP 558, which is resistant to angular leaf spot. Square lattice design was used in all experiments. Initially the F2:3 families (144 were evaluated in the winter of 2004, in Lavras county, MG, Brazil, based on grain type. Eighty families (F2:4 were selected and evaluated with the check

  7. Effects of resistance or aerobic exercise training on total and regional body composition in sedentary overweight middle-aged adults.

    Science.gov (United States)

    Donges, Cheyne E; Duffield, Rob

    2012-06-01

    The purpose of this study was to examine the effects of 10 weeks of aerobic endurance training (AET), resistance exercise training (RET), or a control (CON) condition on absolute and relative fat mass (FM) or fat-free mass (FFM) in the total body (TB) and regions of interest (ROIs) of sedentary overweight middle-aged males and females. Following prescreening, 102 subjects underwent anthropometric measurements, dual-energy X-ray absorptiometry, and strength and aerobic exercise testing. Randomized subjects (male RET, n = 16; female RET, n = 19; male AET, n = 16; and female AET, n = 25) completed supervised and periodized exercise programs (AET, 30-50 min cycling at 70%-75% maximal heart rate; RET, 2-4 sets × 8-10 repetitions of 5-7 exercises at 70%-75% 1 repetition maximum) or a nonexercising control condition (male CON, n = 13 and female CON, n = 13). Changes in absolute and relative TB-FM and TB-FFM and ROI-FM and ROI-FFM were determined. At baseline, and although matched for age and body mass index, males had greater strength, aerobic fitness, body mass, absolute and relative TB-FFM and ROI-FFM, but reduced absolute and relative TB-FM and ROI-FM, compared with females (p FFM and reduced TB-FM more than did the female exercise groups (p FFM, thus resulting in a greater enhancement of relative FFM. Despite equivalent or greater responses to RET or AET by female subjects, the corresponding respective increases in FFM or reductions in FM were lower than those in males, indicating that a biased dose-response relationship exists between sexes following 10 weeks of exercise training.

  8. Shrub type dominates the vertical distribution of leaf C : N : P stoichiometry across an extensive altitudinal gradient

    Directory of Open Access Journals (Sweden)

    W. Zhao

    2018-04-01

    Full Text Available Understanding leaf stoichiometric patterns is crucial for improving predictions of plant responses to environmental changes. Leaf stoichiometry of terrestrial ecosystems has been widely investigated along latitudinal and longitudinal gradients. However, very little is known about the vertical distribution of leaf C : N : P and the relative effects of environmental parameters, especially for shrubs. Here, we analyzed the shrub leaf C, N and P patterns in 125 mountainous sites over an extensive altitudinal gradient (523–4685 m on the Tibetan Plateau. Results showed that the shrub leaf C and C : N were 7.3–47.5 % higher than those of other regional and global flora, whereas the leaf N and N : P were 10.2–75.8 % lower. Leaf C increased with rising altitude and decreasing temperature, supporting the physiological acclimation mechanism that high leaf C (e.g., alpine or evergreen shrub could balance the cell osmotic pressure and resist freezing. The largest leaf N and high leaf P occurred in valley region (altitude 1500 m, likely due to the large nutrient leaching from higher elevations, faster litter decomposition and nutrient resorption ability of deciduous broadleaf shrub. Leaf N : P ratio further indicated increasing N limitation at higher altitudes. Interestingly, drought severity was the only climatic factor positively correlated with leaf N and P, which was more appropriate for evaluating the impact of water status than precipitation. Among the shrub ecosystem and functional types (alpine, subalpine, montane, valley, evergreen, deciduous, broadleaf, and conifer, their leaf element contents and responses to environments were remarkably different. Shrub type was the largest contributor to the total variations in leaf stoichiometry, while climate indirectly affected the leaf C : N : P via its interactive effects on shrub type or soil. Collectively, the large heterogeneity in shrub type was the most

  9. PCR detection of oxytetracycline resistance genes from diverse habitats in total community DNA and in streptomycete isolates.

    NARCIS (Netherlands)

    Nikolakopoulou, T.L.; Egan, S.; Overbeek, van L.S.; Guillaume, G.; Heuer, H.; Wellington, E.M.H.; Elsas, van J.D.; Collard, J.M.; Smalla, K.; Karagouni, A.D.

    2005-01-01

    A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolates from

  10. within plant resistance to water flow in tomato and sweet melons

    African Journals Online (AJOL)

    Administrator

    high pressure flow meter (HPFM) and evaporative flux (EF) methods. In the evaporative flux method, measure- ments of transpiration flux and leaf water potential were used to calculate the total resistance to water flow using. Ohm's law analogy. Measurements of tranpiration flux (Q) relationship, plant resistance calculated ...

  11. Within plant resistance to water flow in tomato and sweet melons ...

    African Journals Online (AJOL)

    In the evaporative flux method, measurements of transpiration flux and leaf water potential were used to calculate the total resistance to water flow using Ohm's law analogy. Measurements of tranpiration flux (Q) relationship, plant resistance calculated from the slope of their relationship, ranged from 6.57x10-01 to ...

  12. Combined effects of leaf litter and soil microsite on decomposition process in arid rangelands.

    Science.gov (United States)

    Carrera, Analía Lorena; Bertiller, Mónica Beatriz

    2013-01-15

    The objective of this study was to analyze the combined effects of leaf litter quality and soil properties on litter decomposition and soil nitrogen (N) mineralization at conserved (C) and disturbed by sheep grazing (D) vegetation states in arid rangelands of the Patagonian Monte. It was hypothesized that spatial differences in soil inorganic-N levels have larger impact on decomposition processes of non-recalcitrant than recalcitrant leaf litter (low and high concentration of secondary compounds, respectively). Leaf litter and upper soil were extracted from modal size plant patches (patch microsite) and the associated inter-patch area (inter-patch microsite) in C and D. Leaf litter was pooled per vegetation state and soil was pooled combining vegetation state and microsite. Concentrations of N and secondary compounds in leaf litter and total and inorganic-N in soil were assessed at each pooled sample. Leaf litter decay and soil N mineralization at microsites of C and D were estimated in 160 microcosms incubated at field capacity (16 month). C soils had higher total N than D soils (0.58 and 0.41 mg/g, respectively). Patch soil of C and inter-patch soil of D exhibited the highest values of inorganic-N (8.8 and 8.4 μg/g, respectively). Leaf litter of C was less recalcitrant and decomposed faster than that of D. Non-recalcitrant leaf litter decay and induced soil N mineralization had larger variation among microsites (coefficients of variation = 25 and 41%, respectively) than recalcitrant leaf litter (coefficients of variation = 12 and 32%, respectively). Changes in the canopy structure induced by grazing disturbance increased leaf litter recalcitrance, and reduced litter decay and soil N mineralization, independently of soil N levels. This highlights the importance of the combined effects of soil and leaf litter properties on N cycling probably with consequences for vegetation reestablishment and dynamics, rangeland resistance and resilience with implications

  13. Leaf habit and woodiness regulate different leaf economy traits at a given nutrient supply.

    Science.gov (United States)

    Ordoñez, Jenny C; van Bodegom, Peter M; Witte, Jan-Philip M; Bartholomeus, Ruud P; van Dobben, Han F; Aerts, Rien

    2010-11-01

    The large variation in the relationships between environmental factors and plant traits observed in natural communities exemplifies the alternative solutions that plants have developed in response to the same environmental limitations. Qualitative attributes, such as growth form, woodiness, and leaf habit can be used to approximate these alternative solutions. Here, we quantified the extent to which these attributes affect leaf trait values at a given resource supply level, using measured plant traits from 105 different species (254 observations) distributed across 50 sites in mesic to wet plant communities in The Netherlands. For each site, soil total N, soil total P, and water supply estimates were obtained by field measurements and modeling. Effects of growth forms, woodiness, and leaf habit on relations between leaf traits (SLA, specific leaf area; LNC, leaf nitrogen concentration; and LPC, leaf phosphorus concentration) vs. nutrient and water supply were quantified using maximum-likelihood methods and Bonferroni post hoc tests. The qualitative attributes explained 8-23% of the variance within sites in leaf traits vs. soil fertility relationships, and therefore they can potentially be used to make better predictions of global patterns of leaf traits in relation to nutrient supply. However, at a given soil fertility, the strength of the effect of each qualitative attribute was not the same for all leaf traits. These differences may imply a differential regulation of the leaf economy traits at a given nutrient supply, in which SLA and LPC seem to be regulated in accordance to changes in plant size and architecture while LNC seems to be primarily regulated at the leaf level by factors related to leaf longevity.

  14. An investigation of total bacterial communities, culturable antibiotic-resistant bacterial communities and integrons in the river water environments of Taipei city.

    Science.gov (United States)

    Yang, Chu-Wen; Chang, Yi-Tang; Chao, Wei-Liang; Shiung, Iau-Iun; Lin, Han-Sheng; Chen, Hsuan; Ho, Szu-Han; Lu, Min-Jheng; Lee, Pin-Hsuan; Fan, Shao-Ning

    2014-07-30

    The intensive use of antibiotics may accelerate the development of antibiotic-resistant bacteria (ARB). The global geographical distribution of environmental ARB has been indicated by many studies. However, the ARB in the water environments of Taiwan has not been extensively investigated. The objective of this study was to investigate the communities of ARB in Huanghsi Stream, which presents a natural acidic (pH 4) water environment. Waishuanghsi Stream provides a neutral (pH 7) water environment and was thus also monitored to allow comparison. The plate counts of culturable bacteria in eight antibiotics indicate that the numbers of culturable carbenicillin- and vancomycin-resistant bacteria in both Huanghsi and Waishuanghsi Streams are greater than the numbers of culturable bacteria resistant to the other antibiotics tested. Using a 16S rDNA sequencing approach, both the antibiotic-resistant bacterial communities (culture-based) and the total bacterial communities (metagenome-based) in Waishuanghsi Stream exhibit a higher diversity than those in Huanghsi Stream were observed. Of the three classes of integron, only class I integrons were identified in Waishuanghsi Stream. Our results suggest that an acidic (pH 4) water environment may not only affect the community composition of antibiotic-resistant bacteria but also the horizontal gene transfer mediated by integrons. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Genetic relationships among alfalfa gemplasms resistant to common ...

    African Journals Online (AJOL)

    Genetic relationships among 26 alfalfa cultivars, of which, 12 were of high resistance to common leaf spot (CLS), were assessed using sequence-related amplified polymorphism (SRAP) markers. 34 SRAP primer combinations were selected for fingerprinting of these cultivars and a total of 281 bands were observed, among ...

  16. Eradication of multidrug-resistant Acinetobacter baumannii in a female patient with total hip arthroplasty, with debridement and retention: a case report

    Directory of Open Access Journals (Sweden)

    Beieler Alison M

    2009-02-01

    Full Text Available Abstract Introduction Multidrug-resistant Acinetobacter baumannii has become a significant cause of healthcare-associated infections, but few reports have addressed Acinetobacter baumannii infections associated with orthopedic devices. The current recommended treatment for complicated infections due to orthopedic devices, including resistant gram-negative rods, consists of antimicrobial therapy with debridement and removal of implants. Case presentation The patient, a 47-year-old woman, had previously had a prior total hip arthroplasty at 16 years of age for a complex femoral neck fracture, and multiple subsequent revisions. This time, she underwent a fifth revision secondary to pain. Surgery was complicated by hypotension resulting in transfer to the intensive care unit and prolonged respiratory failure. She received peri-operative cefazolin but postoperatively developed surgical wound drainage requiring debridement of a hematoma. Cultures of this grew ampicillin-sensitive Enterococcus and Acinetobacter baumannii (sensitive only to amikacin and imipenem. The patient was started on imipenem. Removal of the total hip arthroplasty was not recommended because of the recent surgical complications, and the patient was eventually discharged home. She was seen weekly for laboratory tests and examinations and, after 4 months of therapy, the imipenem was discontinued. She did well clinically for 7 months before recurrent pain led to removal of the total hip arthroplasty. Intra-operative cultures grew ampicillin-sensitive Enterococcus and coagulase-negative Staphylococcus but no multidrug-resistant Acinetobacter baumannii. The patient received ampicillin for 8 weeks and had not had recurrent infection at the time of writing, 37 months after discontinuing imipenem. Conclusion We describe the successful treatment of an acute infection from multidrug-resistant Acinetobacter baumannii with debridement and retention of the total hip arthroplasty, using

  17. Association of increased total antioxidant capacity and anovulation in nonobese infertile patients with clomiphene citrate-resistant polycystic ovary syndrome.

    Science.gov (United States)

    Verit, Fatma Ferda; Erel, Ozcan; Kocyigit, Abdurrahim

    2007-08-01

    To investigate whether total antioxidant capacity (TAC) could predict the response to ovulation induction to clomiphene citrate (CC) in nonobese women with polycystic ovary syndrome. Prospective longitudinal follow-up study. Academic hospital. Fifty-five nonobese, oligomenorrheic women with polycystic ovary syndrome and normal indices of insulin sensitivity. None. Standard clinical examinations and ultrasonographic and endocrine screening, including FSH, LH, E(2), P, total T, sex hormone-binding globulin, DHEAS, and TAC were performed before initiation of CC medication. Within the total group, 27 (49%) of the patients did not ovulate at the end of follow-up. TAC, free androgen index, and ovarian volume were all significantly different in CC nonresponders from those in responders. Total antioxidant capacity was found to be the best predictor in univariate analysis (odds ratio, 171.55; 95% confidence interval, 10.61-2,772.93), and it had the highest area in the receiver operating characteristics analysis (0.91). In a multivariate prediction model, TAC, free androgen index, and ovarian volume showed good predictive power, with Hosmer-Lemeshow goodness of fit test of 0.80. Total antioxidant capacity was the strongest predictor of ovarian response during CC induction of ovulation in these patients. It can be concluded that TAC can be used as a routine screening test.

  18. Estimation of Insulin Resistance in Mexican Adults by the [13C]Glucose Breath Test Corrected for Endogenous Total CO2 Production

    Directory of Open Access Journals (Sweden)

    Erika Ibarra-Pastrana

    2012-01-01

    Full Text Available Objective. To evaluate the efficacy of the [13C]glucose breath test for measuring insulin resistance in Mexican adults with different glycemic states. Research Design and Methods. Fifty-eight adults underwent a [13C]glucose breath test with simultaneous measurement of total CO2 production by indirect calorimetry, at baseline and 90 minutes after the ingestion of 15 g of dextrose and 25 mg of [13C]glucose. HOMA was used as a marker of insulin resistance. Results. We found an inverse correlation between HOMA and the breath test δ13CO2 (‰, r=-0.41 (P=0.001. After adjusting for total CO2 production, correlations between HOMA and fasting glucose were less strong but remained significant. An ROC curve was constructed using δ13CO2 (‰ and HOMA values; the cut-off point was 9.99‰ δ13CO2, corresponding to a sensitivity of 80.0 (95% CI: 51.9, 95.7 and a specificity of 67.4 (95% CI: 51.5, 80.9. Conclusions. The [13C]glucose breath test is a simple noninvasive procedure but was not sufficiently robust for an accurate diagnosis of insulin resistance. Our findings suggest that the test might be helpful in identifying individuals who are not IR, which in turn may contribute to improved diabetes prevention.

  19. Breeding poplars with durable resistance to Melampsora larici-populina leaf rust: a multidisciplinary approach to understand and delay pathogen adaptation

    Science.gov (United States)

    V. Jorge Dowkiw; M. Villar; E. Voisin; V. Guérin; P. Faivre-Rampant; A. Bresson; F. Bitton; S. Duplessis; P. Frey; B. Petre; C. Guinet; C. Xhaard; B. Fabre; F. Halkett; C. Plomion; C. Lalanne; C. Bastien

    2012-01-01

    During the last decades, European poplar breeders learned the hard way that Melampsora larici-populina (commonly abbreviated as Mlp…) has an impressive adaptive potential (McDonald and Linde 2002). This fungal pathogen defeated all the deployed cultivars carrying qualitative (i.e., complete) resistances inherited from the...

  20. Detection of food-borne bacteria in ready to eat betel leaf sold at local markets in Mymensingh.

    Science.gov (United States)

    Haque, Md Mazedul; Sarker, Md Atiqur Rahman; Rifa, Rafia Afroze; Islam, Md Ariful; Khatun, Mst Minara

    2017-09-01

    The present study was undertaken to determine bacterial load as well as characterize bacterial flora of ready to eat (RTE) betel leaf sold at local markets in Mymensingh city. A total of 25 RTE betel leaf samples were collected from five local markets such as Kamal-Ranjit (KR) market, Shesh more, Kewatkhali, Jobber more, and Ganginar par. Total viable count of bacteria in betel leaf (log 10 mean colony forming unit±standard deviation/ml) was 7.58±0.04 for KR market, 7.72±0.06 for Shesh more, 7.62±0.04 for Kewatkhali, 7.40±0.03 for Jobber more, and 7.60±0.06 for Ganginar par. A total of 98 bacterial isolates belong to five genera ( Escherichia coli , Salmonella spp., Vibrio spp., Bacillus spp., and Staphylococcus spp.) were identified. The prevalence of E. coli was 17.34%, Salmonella spp. was 25.51%, Vibrio spp. was 19.39%, Bacillus spp. was 18.37%, and Staphylococcus spp. was 19.39%. Antibiotic sensitivity test showed that all isolates were sensitive to two antibiotics such as ciprofloxacin and gentamicin. Four isolates ( E. coli , Salmonella spp., Vibrio spp., and Staphylococcus spp.) were resistant to two antibiotics (ampicillin and cephalexin). Antibiogram profile of bacterial isolates of betel leaf suggests that they were multidrug resistance. Data of this study indicate that betel leaf sold at local market harbors multidrug resistance food-borne bacteria which might cause public health hazards if these antibiotic resistant transfer to human through food chain.

  1. Detection of food-borne bacteria in ready to eat betel leaf sold at local markets in Mymensingh

    Directory of Open Access Journals (Sweden)

    Md. Mazedul Haque

    2017-09-01

    Full Text Available Aim: The present study was undertaken to determine bacterial load as well as characterize bacterial flora of ready to eat (RTE betel leaf sold at local markets in Mymensingh city. Materials and Methods: A total of 25 RTE betel leaf samples were collected from five local markets such as Kamal-Ranjit (KR market, Shesh more, Kewatkhali, Jobber more, and Ganginar par. Results: Total viable count of bacteria in betel leaf (log10 mean colony forming unit±standard deviation/ml was 7.58±0.04 for KR market, 7.72±0.06 for Shesh more, 7.62±0.04 for Kewatkhali, 7.40±0.03 for Jobber more, and 7.60±0.06 for Ganginar par. A total of 98 bacterial isolates belong to five genera (Escherichia coli, Salmonella spp., Vibrio spp., Bacillus spp., and Staphylococcus spp. were identified. The prevalence of E. coli was 17.34%, Salmonella spp. was 25.51%, Vibrio spp. was 19.39%, Bacillus spp. was 18.37%, and Staphylococcus spp. was 19.39%. Antibiotic sensitivity test showed that all isolates were sensitive to two antibiotics such as ciprofloxacin and gentamicin. Four isolates (E. coli, Salmonella spp., Vibrio spp., and Staphylococcus spp. were resistant to two antibiotics (ampicillin and cephalexin. Antibiogram profile of bacterial isolates of betel leaf suggests that they were multidrug resistance. Conclusion: Data of this study indicate that betel leaf sold at local market harbors multidrug resistance food-borne bacteria which might cause public health hazards if these antibiotic resistant transfer to human through food chain.

  2. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  3. Low light and low ammonium are key factors for guayule leaf tissue shoot organogenesis and transformation.

    Science.gov (United States)

    Dong, Niu; Montanez, Belen; Creelman, Robert A; Cornish, Katrina

    2006-02-01

    A new method has been developed for guayule tissue culture and transformation. Guayule leaf explants have a poor survival rate when placed on normal MS medium and under normal culture room light conditions. Low light and low ammonium treatment greatly improved shoot organogenesis and transformation from leaf tissues. Using this method, a 35S promoter driven BAR gene and an ubiquitin-3 promoter driven GUS gene (with intron) have been successfully introduced into guayule. These transgenic guayule plants were resistant to the herbicide ammonium-glufosinate and were positive to GUS staining. Molecular analysis showed the expected band and signal in all GUS positive transformants. The transformation efficiency with glufosinate selection ranged from 3 to 6%. Transformation with a pBIN19-based plasmid containing a NPTII gene and then selection with kanamycin also works well using this method. The ratio of kanamycin-resistant calli to total starting explants reached 50% in some experiments.

  4. Coconut leaf bioactivity toward generalist maize insect pests

    Science.gov (United States)

    Tropical plants are often more resistant to insects than temperate plants due to evolution of robust defenses to cope with a more constant insect threat. Coconut (Cocos nucifera L.) has very few chewing leaf feeding insect pests and was tested against two omnivorous leaf feeding caterpillar species,...

  5. Betel leaf in stoma care.

    Science.gov (United States)

    Banu, Tahmina; Talukder, Rupom; Chowdhury, Tanvir Kabir; Hoque, Mozammel

    2007-07-01

    Construction of a stoma is a common procedure in pediatric surgical practice. For care of these stomas, commercially available devices such as ostomy bag, either disposable or of longer duration are usually used. These are expensive, particularly in countries like Bangladesh, and proper-sized ones are not always available. We have found an alternative for stoma care, betel leaf, which is suitable for Bangladeshis. We report the outcome of its use. After construction of stoma, at first zinc oxide paste was applied on the peristomal skin. A betel leaf with shiny, smooth surface outwards and rough surface inwards was put over the stoma with a hole made in the center according to the size of stoma. Another intact leaf covers the stomal opening. When bowel movement occurs, the overlying intact leaf was removed and the fecal matter was washed away from both. The leaves were reused after cleaning. Leaves were changed every 2 to 3 days. From June 1998 to December 2005, in the department of pediatric surgery, Chittagong Medical College and Hospital, Chittagong, Bangladesh, a total of 623 patients had exteriorization of bowel. Of this total, 495 stomas were cared for with betel leaves and 128 with ostomy bags. Of 623 children, 287 had sigmoid colostomy, 211 had transverse colostomy, 105 had ileostomy, and 20 had jejunostomy. Of the 495 children under betel leaf stoma care, 13 patients (2.6%) developed skin excoriation. There were no allergic reactions. Of the 128 patients using ostomy bag, 52 (40.65%) had skin excoriation. Twenty-four (18.75%) children developed some allergic reactions to adhesive. Monthly costs for betel leaves were 15 cents (10 BDT), whereas ostomy bags cost about US$24. In the care of stoma, betel leaves are cheap, easy to handle, nonirritant, and nonallergic.

  6. CO2 and temperature effects on leaf area production in two annual plant species

    International Nuclear Information System (INIS)

    Ackerly, D.D.; Coleman, J.S.; Morse, S.R.; Bazzaz, F.A.

    1992-01-01

    The authors studied leaf area production in two annual plant species, Abutilon theophrasti and Amaranthus retroflexus, under three day/night temperature regimes and two concentrations of carbon dioxide. The production of whole-plant leaf area during the first 30 d of growth was analyzed in terms of the leaf initiation rate, leaf expansion, individual leaf area, and, in Amaranthus, production of branch leaves. Temperature and CO 2 influenced leaf area production through effects on the rate of development, determined by the production of nodes on the main stem, and through shifts in the relationship between whole-plant leaf area and the number of main stem nodes. In Abutilon, leaf initiation rate was highest at 38 degree, but area of individual leaves was greatest at 28 degree. Total leaf area was greatly reduced at 18 degree due to slow leaf initiation rates. Elevated CO 2 concentration increased leaf initiation rate at 28 degree, resulting in an increase in whole-part leaf area. In Amaranthus, leaf initiation rate increased with temperature, and was increased by elevated CO 2 at 28 degree. Individual leaf area was greatest at 28 degree, and was increased by elevated CO 2 at 28 degree but decreased at 38 degree. Branch leaf area displayed a similar response to CO 2 , butt was greater at 38 degree. Overall, wholeplant leaf area was slightly increased at 38 degree relative to 28 degree, and elevated CO 2 levels resulted in increased leaf area at 28 degree but decreased leaf area at 38 degree

  7. EFEITO DE TRICOMAS, ALELOQUÍMICOS E NUTRIENTES NA RESISTÊNCIA DE LYCOPERSICON HIRSUTUM À TRAÇA-DO-TOMATEIRO EFFECT OF TRICHOMES, ALELLOCHEMICALS AND MINERALS ON THE RESISTANCE OF LYCOPERSICON HIRSUTUM TO TOMATO LEAF MINER

    Directory of Open Access Journals (Sweden)

    GERMANO LEÃO DEMOLIN LEITE

    1999-11-01

    Full Text Available Estudos foram conduzidos com o objetivo de verificar o efeito de tricomas, aleloquímicos e nutrientes nas folhas de partes do dossel das plantas na resistência de Lycopersicon hirsutum à traça- do-tomateiro, Tuta absoluta (Lepidoptera: Gelechiidae. Foram quantificados os teores de 2-tridecanona (2-TD, 2-undecanona (2-UD, N, P, K, Ca e Mg, densidade e tipos de tricomas e tamanho das folhas nos terços apical, mediano e basal do dossel de plantas de L. hirsutum e de L. esculentum e estudaram- se os efeitos destes fatores sobre características biológicas de T. absoluta. Observou-se elevação no teor de 2-TD da base para o ápice do dossel. Não se detectou diferença significativa quanto ao número de ovos de T. absoluta ao longo do dossel de L. hirsutum, constatando-se em L. esculentum maior oviposição nos terços apical e mediano do que no basal. As folhas do terço apical de L. hirsutum apresentaram maior efeito deletério sobre as larvas de traça.The objective of this work was to study the effect of trichomes, alellochemicals and minerals in the leaves of different canopy heights on the resistance of Lycopersicon hirsutum to tomato leaf miner, Tuta absoluta (Lepidoptera: Gelechiidae. Effects of 2-tridecanone (2-TD, 2-undecanone (2-UD, N, P, K, Ca and Mg levels, density and types of trichomes and leaf area on apical, medium and basal parts of plant dossel of L. hirsutum and L. esculentum on the oviposition and mines number of T. absoluta was studied. Production of 2-TD increased from the bottom to the top of the canopy. The apical part of plants of L. hirsutum showed more antibiotic effect on the caterpillar. T. absoluta oviposited more on leaves of the apical and medium portion of the plants than in the basal parts of L. esculentum.

  8. Exercise order affects the total training volume and the ratings of perceived exertion in response to a super-set resistance training session

    Directory of Open Access Journals (Sweden)

    Balsamo S

    2012-02-01

    Full Text Available Sandor Balsamo1–3, Ramires Alsamir Tibana1,2,4, Dahan da Cunha Nascimento1,2, Gleyverton Landim de Farias1,2, Zeno Petruccelli1,2, Frederico dos Santos de Santana1,2, Otávio Vanni Martins1,2, Fernando de Aguiar1,2, Guilherme Borges Pereira4, Jéssica Cardoso de Souza4, Jonato Prestes41Department of Physical Education, Centro Universitário UNIEURO, Brasília, 2GEPEEFS (Resistance training and Health Research Group, Brasília/DF, 3Graduate Program in Medical Sciences, School of Medicine, Universidade de Brasília (UnB, Brasília, 4Graduation Program in Physical Education, Catholic University of Brasilia (UCB, Brasília/DF, BrazilAbstract: The super-set is a widely used resistance training method consisting of exercises for agonist and antagonist muscles with limited or no rest interval between them – for example, bench press followed by bent-over rows. In this sense, the aim of the present study was to compare the effects of different super-set exercise sequences on the total training volume. A secondary aim was to evaluate the ratings of perceived exertion and fatigue index in response to different exercise order. On separate testing days, twelve resistance-trained men, aged 23.0 ± 4.3 years, height 174.8 ± 6.75 cm, body mass 77.8 ± 13.27 kg, body fat 12.0% ± 4.7%, were submitted to a super-set method by using two different exercise orders: quadriceps (leg extension + hamstrings (leg curl (QH or hamstrings (leg curl + quadriceps (leg extension (HQ. Sessions consisted of three sets with a ten-repetition maximum load with 90 seconds rest between sets. Results revealed that the total training volume was higher for the HQ exercise order (P = 0.02 with lower perceived exertion than the inverse order (P = 0.04. These results suggest that HQ exercise order involving lower limbs may benefit practitioners interested in reaching a higher total training volume with lower ratings of perceived exertion compared with the leg extension plus leg curl

  9. Antibacterial activity of mangrove leaf extracts against human pathogens

    Digital Repository Service at National Institute of Oceanography (India)

    Sahoo, G.; Mulla, N.S.S.; Ansari, Z.A.; Mohandass, C.

    ., Salmonella typhi, Proteus vulgaris and Proteus mirabilis. As compared to aqueous, ethanol extract showed broad-spectrum activity. The multidrug-resistant (MDR) bacteria Salmonella typhi was inhibited by the ethanol extract of S. alba leaf whereas the other...

  10. Developing markers for Sigatoka leaf spot disease (Mycosphaerella ...

    African Journals Online (AJOL)

    Jane

    2011-07-06

    Jul 6, 2011 ... Developing markers for Sigatoka leaf spot disease ... OPERON primer pairs were used to screen genomic DNA from two resistant cultivars: Calcutta 4 ( ..... Blomme G, Eden-Green S, Mustaffa M, Nwauzoma B, Thangavelu R.

  11. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  12. Effect of early supervised progressive resistance training compared to unsupervised home-based exercise after fast-track total hip replacement applied to patients with preoperative functional limitations

    DEFF Research Database (Denmark)

    Mikkelsen, L R; Mechlenburg, I; Søballe, K

    2014-01-01

    OBJECTIVE: To examine if 2 weekly sessions of supervised progressive resistance training (PRT) in combination with 5 weekly sessions of unsupervised home-based exercise is more effective than 7 weekly sessions of unsupervised home-based exercise in improving leg-extension power of the operated leg...... 10 weeks after total hip replacement (THR) in patients with lower pre-operative function. METHOD: A total of 73 patients scheduled for THR were randomised (1:1) to intervention group (IG, home based exercise 5 days/week and PRT 2 days/week) or control group (CG, home based exercise 7 days...... of the operated leg, at the primary endpoint 10 weeks after surgery in THR patients with lower pre-operative function. TRIAL REGISTRATION: NCT01214954....

  13. Overexpression of E3 Ubiquitin Ligase Gene AdBiL Contributes to Resistance against Chilling Stress and Leaf Mold Disease in Tomato

    Directory of Open Access Journals (Sweden)

    Shuangchen Chen

    2017-06-01

    Full Text Available Ubiquitination is a common regulatory mechanism, playing a critical role in diverse cellular and developmental processes in eukaryotes. However, a few reports on the functional correlation between E3 ubiquitin ligases and reactive oxygen species (ROS or reactive nitrogen species (RNS metabolism in response to stress are currently available in plants. In the present study, the E3 ubiquitin ligase gene AdBiL (Adi3 Binding E3 Ligase was introduced into tomato line Ailsa Craig via Agrobacterium-mediated method. Transgenic lines were confirmed for integration into the tomato genome using PCR. Transcription of AdBiL in various transgenic lines was determined using real-time PCR. Evaluation of stress tolerance showed that T1 generation of transgenic tomato lines showed only mild symptoms of chilling injury as evident by higher biomass accumulation and chlorophyll content than those of non-transformed plants. Compared with wild-type plants, the contents of AsA, AsA/DHA, GSH and the activity of GaILDH, γ-GCS and GSNOR were increased, while H2O2, O2.−, MDA, NO, SNOs, and GSNO accumulations were significantly decreased in AdBiL overexpressing plants in response to chilling stress. Furthermore, transgenic tomato plants overexpressing AdBiL showed higher activities of enzymes such as G6PDH, 6PGDH, NADP-ICDH, and NADP-ME involved in pentose phosphate pathway (PPP. The transgenic tomato plants also exhibited an enhanced tolerance against the necrotrophic fungus Cladosporium fulvum. Tyrosine nitration protein was activated in the plants infected with leaf mold disease, while the inhibition could be recovered in AdBiL gene overexpressing lines. Taken together, our results revealed a possible physiological role of AdBiL in the activation of the key enzymes of AsA–GSH cycle, PPP and down-regulation of GSNO reductase, thereby reducing oxidative and nitrosative stress in plants. This study demonstrates an optimized transgenic strategy using AdBiL gene for crop

  14. Characterization of multiple antibiotic resistance of culturable microorganisms and metagenomic analysis of total microbial diversity of marine fish sold in retail shops in Mumbai, India.

    Science.gov (United States)

    Naik, Onkar A; Shashidhar, Ravindranath; Rath, Devashish; Bandekar, Jayant R; Rath, Archana

    2018-03-01

    Marine fish species were analyzed for culturable and total metagenomic microbial diversity, antibiotic resistance (AR) pattern, and horizontal gene transfer in culturable microorganisms. We observed a high AR microbial load of 3 to 4 log CFU g -1 . Many fish pathogens like Providencia, Staphylococcus, Klebsiella pneumoniae, Enterobacter, Vagococcus, and Aeromonas veronii were isolated. Photobacterium and Vibrio were two major fish and human pathogens which were identified in the fish metagenome. Other pathogens that were identified were Shewanella, Acinetobacter, Psychrobacter, and Flavobacterium. Most of these pathogens were resistant to multiple antibiotics such as erythromycin, kanamycin, neomycin, streptomycin, penicillin, cefotaxime, bacitracin, rifampicin, trimethoprim, ciprofloxacin, and doxycycline with a high multiple antibiotic resistance index of 0.54-0.77. The fish microflora showed high prevalence of AR genes like bla TEM , Class I integron, tetA, aph(3')-IIIa, ermB, aadA, and sul1. Nineteen of 26 AR isolates harbored Class I integrons showing high co-resistance to trimethoprim, kanamycin, doxycycline, and cefotaxime. Mobile R-plasmids from 6 of the 12 AR pathogens were transferred to recipient E. coli after conjugation. The transconjugants harbored the same R-plasmid carrying bla CTX-M , dfr1, tetA, bla TEM , and cat genes. This study confirms that fish is a potential carrier of AR pathogens which can enter the human gut via food chain. To the best of our knowledge, this is the first study in the Indian subcontinent reporting a direct evidence of spread of AR pathogens to humans from specific marine fish consumption.

  15. Measurement for the MLC leaf velocity profile by considering the leaf leakage using a radiographic film

    International Nuclear Information System (INIS)

    Chow, James C L; Grigorov, Grigor N

    2006-01-01

    A method to measure the velocity profile of a multi-leaf collimator (MLC) leaf along its travel range using a radiographic film is reported by considering the intra-leaf leakage. A specific dynamic MLC field with leaves travelling from the field edge to the isocentre line was designed. The field was used to expose a radiographic film, which was then scanned, and the dose profile along the horizontal leaf axis was measured. The velocity at a sampling point on the film can be calculated by considering the horizontal distance between the sampling point and the isocentre line, dose at the sampling point, dose rate of the linear accelerator, the total leaf travel time from the field edge to isocentre line and the pre-measured dose rate of leaf leakage. With the leaf velocities and velocity profiles for all MLC leaves measured routinely, a comprehensive and simple QA for the MLC can be set up to test the consistency of the leaf velocity performance which is essential to the IMRT delivery using a sliding window technique. (note)

  16. Effects of leaf movement on leaf temperature, transpiration and radiation interception in soybean under water stress conditions

    International Nuclear Information System (INIS)

    Isoda, A.; Wang, P.

    2001-01-01

    Varietal differences in leaf movement were examined in terms of radiation interception, leaf temperature and transpiration under water stressed conditions. Five cultivars (Qindou 7232, Gaofei 16, Dongnong 87 - 138, 8285 - 8 and 8874) were grown in a concrete frame field in Xinjiang, China. Irrigation treatments (irrigation and no irrigation) were made from the flowering to the pod filling stage. A leaflet in the uppermost layer of the canopy was restrained horizontally. Leaf temperatures, transpiration rate (stem sap flow rate of the main stem per unit leaf area) and intercepted radiation of each leaflet were measured. There were greater varietal differences in leaf movement, leaf temperature and transpiration rate. Leaf temperature seemed to be adjusted by leaf movement and transpiration. The extent to which is adjusted by leaf movement and transpiration differed among the cultivars; leaf temperature was influenced mainly by leaf movement for Gaofei 16 and Dongnong 87 - 138, mainly by transpiration for Qindou 7232 and 8874, and by both for 8285 - 8. Intercepted radiation in the upper two layers of the canopy (20 cm from the uppermost) was greater in the irrigated plot, although the mean values of total leaflets of the irrigated plot were not different as compared to the non-irrigated plot. Although paraheliotropic leaf movement decreased radiation interception, it offers some possibilities for the improvement in radiation penetration within a dense canopy. Cumulated amount of transpiration during a day was compared between the restrained-leaf and the non-leaf-restrained plants in 8874. Paraheliotropic leaf movement reduced water loss by 23% in the irrigated and 71% in the non-irrigated plots

  17. Seagrass leaf element content

    NARCIS (Netherlands)

    Vonk, J.A.; Smulders, Fee O.H.; Christianen, Marjolijn J.A.; Govers, Laura L.

    2017-01-01

    Knowledge on the role of seagrass leaf elements and in particular micronutrients and their ranges is limited. We present a global database, consisting of 1126 unique leaf values for ten elements, obtained from literature and unpublished data, spanning 25 different seagrass species from 28 countries.

  18. Evolution of resistance and tolerance to herbivores: testing the trade-off hypothesis

    Directory of Open Access Journals (Sweden)

    Eunice Kariñho-Betancourt

    2015-03-01

    Full Text Available Background. To cope with their natural enemies, plants rely on resistance and tolerance as defensive strategies. Evolution of these strategies among natural population can be constrained by the absence of genetic variation or because of the antagonistic genetic correlation (trade-off between them. Also, since plant defenses are integrated by several traits, it has been suggested that trade-offs might occur between specific defense traits.Methodology/Principal Findings. We experimentally assessed (1 the presence of genetic variance in tolerance, total resistance, and leaf trichome density as specific defense trait, (2 the extent of natural selection acting on plant defenses, and (3 the relationship between total resistance and leaf trichome density with tolerance to herbivory in the annual herb Datura stramonium. Full-sib families of D. stramonium were either exposed to natural herbivores (control or protected from them by a systemic insecticide. We detected genetic variance for leaf trichome density, and directional selection acting on this character. However, we did not detect a negative significant correlation between tolerance and total resistance, or between tolerance and leaf trichome density. We argue that low levels of leaf damage by herbivores precluded the detection of a negative genetic correlation between plant defense strategies.Conclusions/Significance. This study provides empirical evidence of the independent evolution of plant defense strategies, and a defensive role of leaf trichomes. The pattern of selection should favor individuals with high trichomes density. Also, because leaf trichome density reduces damage by herbivores and possess genetic variance in the studied population, its evolution is not constrained.

  19. Transformation of miniature potted rose (Rosa hybrida cv. Linda) with P( SAG12 )-ipt gene delays leaf senescence and enhances resistance to exogenous ethylene.

    Science.gov (United States)

    Zakizadeh, Hedayat; Lütken, Henrik; Sriskandarajah, Sridevy; Serek, Margrethe; Müller, Renate

    2013-02-01

    KEY MESSAGE : The P ( SAG12 ) -ipt gene was transferred to miniature rose, as the first woody species, resulting in increased ethylene resistance due to specific up-regulation of the ipt gene under senescence promoting conditions. Transgenic plants of Rosa hybrida 'Linda' were obtained via transformation with Agrobacterium tumefaciens strain harboring the binary vector pSG529(+) containing the P( SAG12 )-ipt construct. A. tumefaciens strains AGL1, GV3850 and LBA4404 (containing P(35S)-INTGUS gene) were used for transformation of embryogenic callus, but transgenic shoots were obtained only when AGL1 was applied. The highest transformation frequency was 10 % and it was achieved when half MS medium was used for the dilution of overnight culture of Agrobacterium. Southern blot confirmed integration of 1-6 copies of the nptII gene into the rose genome in the tested lines. Four transgenic lines were obtained which were morphologically true-to-type and indistinguishable from Wt shoots while they were in in vitro cultures. Adventitious root induction was more difficult in transgenic shoots compared to the Wt shoots, however, one of the transgenic lines (line 6) was rooted and subsequently analyzed phenotypically. The ipt expression levels were determined in this line after exposure to exogenous ethylene (3.5 μl l(-1)) and/or darkness. Darkness resulted in twofold up-regulation of ipt expression, whereas darkness combined with ethylene caused eightfold up-regulation in line 6 compared to Wt plants. The transgenic line had significantly higher content of chlorophyll at the end of the treatment period compared to Wt plants.

  20. Psidium guajava Linn. leaf extract affects hepatic glucose transporter-2 to attenuate early onset of insulin resistance consequent to high fructose intake: An experimental study

    Science.gov (United States)

    Mathur, R.; Dutta, Shagun; Velpandian, T.; Mathur, S.R.

    2015-01-01

    Background: Insulin resistance (IR) is amalgam of pathologies like altered glucos metabolism, dyslipidemia, impaired glucose tolerance, non-alcoholic fatty liver disease, and associated with type-II diabetes and cardiometabolic diseases. One of the reasons leading to its increased and early incidence is understood to be a high intake of processed fructose containing foods and beverages by individuals, especially, during critical developmental years. Objective: To investigate the preventive potential of aqueous extract of Psidium guajava leaves (PG) against metabolic pathologies, vis-à-vis, IR, dyslipidemia, hyperleptinemia and hypertension, due to excess fructose intake initiated during developmental years. Materials and Methods: Post-weaning (4 weeks old) male rats were provided fructose (15%) as drinking solution, ad libitum, for 8 weeks and assessed for food and water/fructose intake, body weight, fasting blood sugar, mean arterial pressure, lipid biochemistry, endocrinal (insulin, leptin), histopathological (fatty liver) and immunohistochemical (hepatic glucose transporter [GLUT2]) parameters. Parallel treatment groups were administered PG in doses of 250 and 500 mg/kg/d, po × 8 weeks and assessed for same parameters. Using extensive liquid chromatography-mass spectrometry protocols, PG was analyzed for the presence of phytoconstituents like Myrecetin, Luteolin, Kaempferol and Guavanoic acid and validated to contain Quercetin up to 9.9%w/w. Results: High fructose intake raised circulating levels of insulin and leptin and hepatic GLUT2 expression to promote IR, dyslipidemia, and hypertension that were favorably re-set with PG. Although PG is known for its beneficial role in diabetes mellitus, for the first time we report its potential in the management of lifelong pathologies arising from high fructose intake initiated during developmental years. PMID:25829790

  1. Preliminary application of a novel algorithm to monitor changes in pre-flight total peripheral resistance for prediction of post-flight orthostatic intolerance in astronauts

    Science.gov (United States)

    Arai, Tatsuya; Lee, Kichang; Stenger, Michael B.; Platts, Steven H.; Meck, Janice V.; Cohen, Richard J.

    2011-04-01

    Orthostatic intolerance (OI) is a significant challenge for astronauts after long-duration spaceflight. Depending on flight duration, 20-80% of astronauts suffer from post-flight OI, which is associated with reduced vascular resistance. This paper introduces a novel algorithm for continuously monitoring changes in total peripheral resistance (TPR) by processing the peripheral arterial blood pressure (ABP). To validate, we applied our novel mathematical algorithm to the pre-flight ABP data previously recorded from twelve astronauts ten days before launch. The TPR changes were calculated by our algorithm and compared with the TPR value estimated using cardiac output/heart rate before and after phenylephrine administration. The astronauts in the post-flight presyncopal group had lower pre-flight TPR changes (1.66 times) than those in the non-presyncopal group (2.15 times). The trend in TPR changes calculated with our algorithm agreed with the TPR trend calculated using measured cardiac output in the previous study. Further data collection and algorithm refinement are needed for pre-flight detection of OI and monitoring of continuous TPR by analysis of peripheral arterial blood pressure.

  2. Determination of total dietary fiber in selected foods containing resistant maltodextrin by a simplified enzymatic-gravimetric method and liquid chromatography: interlaboratory study in China.

    Science.gov (United States)

    Fu, Boqiang; Wang, Jing; Roturier, Jean Michel; Tang, Zhiyu; Li, Huan; Wei, Guangyan

    2008-01-01

    An interlaboratory study was conducted in China to validate the modified AOAC Official Method 2001.03 for the determination of total dietary fiber (TDF) in foods containing resistant maltodextrin (RMD), which will be adopted as the National Standard Method of China. The kind of buffer solution, the volume of filtrate evaporation, the volume of eluent for desalting and residual solution after evaporation, etc. were modified, which had been proved to have acceptable accuracy and precision in the routine assay. TDF contents in 3 representative foods and 2 kinds of RMD ingredient (i.e., NUTRIOSE 06 and NUTRIOSE 10) were measured using the modified method in 6 eligible laboratories representing commercial, industrial, and governmental laboratories in China. The results of the interlaboratory study indicated that the intralaboratory repeatability, interlaboratory reproducibility, and precision of the modified method are adequate for reliable analysis of TDF in food containing RMD, as well as resistant dextrin. Compared to AOAC Official Method 2001.03, the modified method is time- and cost-saving.

  3. Higher Total Protein Intake and Change in Total Protein Intake Affect Body Composition but Not Metabolic Syndrome Indexes in Middle-Aged Overweight and Obese Adults Who Perform Resistance and Aerobic Exercise for 36 Weeks.

    Science.gov (United States)

    Campbell, Wayne W; Kim, Jung Eun; Amankwaah, Akua F; Gordon, Susannah L; Weinheimer-Haus, Eileen M

    2015-09-01

    Studies assessing the effects of protein supplementation on changes in body composition (BC) and health rarely consider the impact of total protein intake (TPro) or the change in TPro (CTPro) from participants' usual diets. This secondary data analysis assessed the impact of TPro and CTPro on changes in BC and metabolic syndrome (MetS) indexes in overweight and obese middle-aged adults who participated in an exercise training program. Men and women [n = 117; age: 50 ± 0.7 y, body mass index (BMI; in kg/m(2)): 30.1 ± 0.3; means ± SEs] performed resistance exercise 2 d/wk and aerobic exercise 1 d/wk and consumed an unrestricted diet along with 200-kcal supplements (0, 10, 20, or 30 g whey protein) twice daily for 36 wk. Protein intake was assessed via 4-d food records. Multiple linear regression model and stratified analysis were applied for data analyses. Among all subjects, TPro and CTPro were inversely associated (P exercise training, higher TPro promoted positive changes in BC but not in MetS indexes in overweight and obese middle-aged adults. Changes in TPro from before to during the intervention also influenced BC responses and should be considered in future research when different TPro is achieved via diet or supplements. This trial was registered at clinicaltrials.gov as NCT00812409. © 2015 American Society for Nutrition.

  4. Validation of anthropometry and foot-to-foot bioelectrical resistance against a three-component model to assess total body fat in children: the IDEFICS study.

    Science.gov (United States)

    Bammann, K; Huybrechts, I; Vicente-Rodriguez, G; Easton, C; De Vriendt, T; Marild, S; Mesana, M I; Peeters, M W; Reilly, J J; Sioen, I; Tubic, B; Wawro, N; Wells, J C; Westerterp, K; Pitsiladis, Y; Moreno, L A

    2013-04-01

    To compare different field methods for estimating body fat mass with a reference value derived by a three-component (3C) model in pre-school and school children across Europe. Multicentre validation study. Seventy-eight preschool/school children aged 4-10 years from four different European countries. A standard measurement protocol was carried out in all children by trained field workers. A 3C model was used as the reference method. The field methods included height and weight measurement, circumferences measured at four sites, skinfold measured at two-six sites and foot-to-foot bioelectrical resistance (BIA) via TANITA scales. With the exception of height and neck circumference, all single measurements were able to explain at least 74% of the fat-mass variance in the sample. In combination, circumference models were superior to skinfold models and height-weight models. The best predictions were given by trunk models (combining skinfold and circumference measurements) that explained 91% of the observed fat-mass variance. The optimal data-driven model for our sample includes hip circumference, triceps skinfold and total body mass minus resistance index, and explains 94% of the fat-mass variance with 2.44 kg fat mass limits of agreement. In all investigated models, prediction errors were associated with fat mass, although to a lesser degree in the investigated skinfold models, arm models and the data-driven models. When studying total body fat in childhood populations, anthropometric measurements will give biased estimations as compared to gold standard measurements. Nevertheless, our study shows that when combining circumference and skinfold measurements, estimations of fat mass can be obtained with a limit of agreement of 1.91 kg in normal weight children and of 2.94 kg in overweight or obese children.

  5. Transcriptional analyses of natural leaf senescence in maize.

    Directory of Open Access Journals (Sweden)

    Wei Yang Zhang

    Full Text Available Leaf senescence is an important biological process that contributes to grain yield in crops. To study the molecular mechanisms underlying natural leaf senescence, we harvested three different developmental ear leaves of maize, mature leaves (ML, early senescent leaves (ESL, and later senescent leaves (LSL, and analyzed transcriptional changes using RNA-sequencing. Three sets of data, ESL vs. ML, LSL vs. ML, and LSL vs. ESL, were compared, respectively. In total, 4,552 genes were identified as differentially expressed. Functional classification placed these genes into 18 categories including protein metabolism, transporters, and signal transduction. At the early stage of leaf senescence, genes involved in aromatic amino acids (AAAs biosynthetic process and transport, cellular polysaccharide biosynthetic process, and the cell wall macromolecule catabolic process, were up-regulated. Whereas, genes involved in amino acid metabolism, transport, apoptosis, and response to stimulus were up-regulated at the late stage of leaf senescence. Further analyses reveals that the transport-related genes at the early stage of leaf senescence potentially take part in enzyme and amino acid transport and the genes upregulated at the late stage are involved in sugar transport, indicating nutrient recycling mainly takes place at the late stage of leaf senescence. Comparison between the data of natural leaf senescence in this study and previously reported data for Arabidopsis implies that the mechanisms of leaf senescence in maize are basically similar to those in Arabidopsis. A comparison of natural and induced leaf senescence in maize was performed. Athough many basic biological processes involved in senescence occur in both types of leaf senescence, 78.07% of differentially expressed genes in natural leaf senescence were not identifiable in induced leaf senescence, suggesting that differences in gene regulatory network may exist between these two leaf senescence

  6. Herança da resistência à ferrugem da folha da aveia (Puccinia coronata f. sp. avenae Fraser & Led. em genótipos brasileiros de aveia branca Inheritance of oat leaf rust (Puccinia coronata f. sp. avenae Fraser & Led. resistance in white oat brazilian genotypes

    Directory of Open Access Journals (Sweden)

    Eduardo Alano Vieira

    2006-02-01

    the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.

  7. An ozone budget for the UK: using measurements from the national ozone monitoring network; measured and modelled meteorological data, and a 'big-leaf' resistance analogy model of dry deposition

    International Nuclear Information System (INIS)

    Coyle, M.; Smith, R.; Fowler, D.

    2003-01-01

    A method of calculating a mass budget for O 3 in the UK boundary layer is presented which shows that the spatial scale of the UK is small relative to the footprint of the atmosphere influenced by UK emissions. - Data from the UK national air-quality monitoring network are used to calculate an annual mass budget for ozone (O 3 ) production and loss in the UK boundary layer during 1996. Monthly losses by dry deposition are quantified from 1 kmx1 km scale maps of O 3 concentration and O 3 deposition velocities based on a 'big-leaf' resistance analogy. The quantity of O 3 deposition varies from ∼50 Gg-O 3 month -1 in the winter to over 200 Gg-O 3 month -1 in the summer when vegetation is actively absorbing O 3 . The net O 3 production or loss in the UK boundary layer is found by selecting days when the UK is receiving 'clean' Atlantic air from the SW to NW. In these conditions, the difference in O 3 concentration observed at Mace Head and a rural site on the east coast of the UK indicates the net O 3 production or loss within the UK boundary layer. A simple box model is then used to convert the concentration difference into a mass. The final budget shows that for most of the year the UK is a net sink for O 3 (-25 to -800 Gg-O 3 month -1 ) with production only exceeding losses in the photochemically active summer months (+45 Gg-O 3 month -1 )

  8. An ozone budget for the UK: using measurements from the national ozone monitoring network; measured and modelled meteorological data, and a 'big-leaf' resistance analogy model of dry deposition

    Energy Technology Data Exchange (ETDEWEB)

    Coyle, M.; Smith, R.; Fowler, D

    2003-05-01

    A method of calculating a mass budget for O{sub 3} in the UK boundary layer is presented which shows that the spatial scale of the UK is small relative to the footprint of the atmosphere influenced by UK emissions. - Data from the UK national air-quality monitoring network are used to calculate an annual mass budget for ozone (O{sub 3}) production and loss in the UK boundary layer during 1996. Monthly losses by dry deposition are quantified from 1 kmx1 km scale maps of O{sub 3} concentration and O{sub 3} deposition velocities based on a 'big-leaf' resistance analogy. The quantity of O{sub 3} deposition varies from {approx}50 Gg-O{sub 3} month{sup -1} in the winter to over 200 Gg-O{sub 3} month{sup -1} in the summer when vegetation is actively absorbing O{sub 3}. The net O{sub 3} production or loss in the UK boundary layer is found by selecting days when the UK is receiving 'clean' Atlantic air from the SW to NW. In these conditions, the difference in O{sub 3} concentration observed at Mace Head and a rural site on the east coast of the UK indicates the net O{sub 3} production or loss within the UK boundary layer. A simple box model is then used to convert the concentration difference into a mass. The final budget shows that for most of the year the UK is a net sink for O{sub 3} (-25 to -800 Gg-O{sub 3} month{sup -1}) with production only exceeding losses in the photochemically active summer months (+45 Gg-O{sub 3} month{sup -1})

  9. A combined methodology using electrical resistivity tomography, ordinary kriging and porosimetry for quantifying total C trapped in carbonate formations associated with natural analogues for CO2 leakage

    Science.gov (United States)

    Prado-Pérez, A. J.; Aracil, E.; Pérez del Villar, L.

    2014-06-01

    Currently, carbon deep geological storage is one of the most accepted methods for CO2 sequestration, being the long-term behaviour assessment of these artificial systems absolutely essential to guarantee the safety of the CO2 storage. In this sense, hydrogeochemical modelling is being used for evaluating any artificial CO2 deep geological storage as a potential CO2 sinkhole and to assess the leakage processes that are usually associated with these engineered systems. Carbonate precipitation, as travertines or speleothems, is a common feature in the CO2 leakage scenarios and, therefore, is of the utmost importance to quantify the total C content trapped as a stable mineral phase in these carbonate formations. A methodology combining three classical techniques such as: electrical resistivity tomography, geostatistical analysis and mercury porosimetry is described in this work, which was developed for calculating the total amount of C trapped as CaCO3 associated with the CO2 leakages in Alicún de las Torres natural analogue (Granada, Spain). The proposed methodology has allowed estimating the amount of C trapped as calcite, as more than 1.7 Mt. This last parameter, focussed on an artificial CO2 deep geological storage, is essential for hydrogeochemical modellers when evaluating whether CO2 storages constitute or not CO2 sinkholes. This finding is extremely important when assessing the long-term behaviour and safety of any artificial CO2 deep geological storage.

  10. Benzothiadiazole affects the leaf proteome in arctic bramble (Rubus arcticus).

    Science.gov (United States)

    Hukkanen, Anne; Kokko, Harri; Buchala, Antony; Häyrinen, Jukka; Kärenlampi, Sirpa

    2008-11-01

    Benzothiadiazole (BTH) induces resistance to the downy mildew pathogen, Peronospora sparsa, in arctic bramble, but the basis for the BTH-induced resistance is unknown. Arctic bramble cv. Mespi was treated with BTH to study the changes in leaf proteome and to identify proteins with a putative role in disease resistance. First, BTH induced strong expression of one PR-1 protein isoform, which was also induced by salicylic acid (SA). The PR-1 was responsive to BTH and exogenous SA despite a high endogenous SA content (20-25 microg/g fresh weight), which increased to an even higher level after treatment with BTH. Secondly, a total of 792 protein spots were detected in two-dimensional gel electrophoresis, eight proteins being detected solely in the BTH-treated plants. BTH caused up- or down-regulation of 72 and 31 proteins, respectively, of which 18 were tentatively identified by mass spectrometry. The up-regulation of flavanone-3-hydroxylase, alanine aminotransferase, 1-aminocyclopropane-1-carboxylate oxidase, PR-1 and PR-10 proteins may partly explain the BTH-induced resistance against P. sparsa. Other proteins with changes in intensity appear to be involved in, for example, energy metabolism and protein processing. The decline in ATP synthase, triosephosphate isomerase, fructose bisphosphate aldolase and glutamine synthetase suggests that BTH causes significant changes in primary metabolism, which provides one possible explanation for the decreased vegetative growth of foliage and rhizome observed in BTH-treated plants.

  11. Cassava brown streak disease effects on leaf metabolites and ...

    African Journals Online (AJOL)

    Cassava brown streak disease effects on leaf metabolites and pigment accumulation. ... Total reducing sugar and starch content also dropped significantly (-30 and -60%, respectively), much as NASE 14 maintained a relatively higher amount of carbohydrates. Leaf protein levels were significantly reduced at a rate of 0.07 ...

  12. Evaluation of Microdesmis puberula leaf meal as feed ingredient in ...

    African Journals Online (AJOL)

    The material was milled using a hammer mill to produce the leaf meal. Microdesmis puberula leaf meal contain 17.32% crude protein, 6.52% ether extract, 12.25% total ash, 24.84% crude fibre, 24.06% NFE and an appreciable percent of minerals. Three broiler starter diets were formulated to contain the meal at dietary ...

  13. Resistance to stem canker, frogeye leaf spot and powdery mildew of soybean lines lacking lipoxigenases in the seeds Resistência ao cancro-da-haste, à cercosporiose e ao oídio de linhagens de soja sem lipoxigenases nas sementes

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Osório Martins

    2002-12-01

    Full Text Available The soybean [Glycine max (L. Merrill] crop holds a prominent position in the Brazilian economy because of the extension of the planted area and volume of grain production, but the beany flavor has been a limiting factor for soybean derivatives consumption by western population. This flavor is produced mainly by action of lipoxygenase enzymes (Lox1, Lox2 and Lox3, present in some commercial varieties. The genetic elimination of the alleles that codify these enzymes is the most appropriate way to avoid problems associated to this deleterious flavor. To elucidate the effect of seed lipoxygenase elimination on the resistance to plant pathogens, normal varieties of soybean (FT-Cristalina RCH, Doko RC and IAC-12 and their backcross-derived lines, both with the three lipoxygenases present in their seeds (triple-positive, TP and without the three lipoxygenases (triple-null, TN, were tested for their resistance to stem canker (Diaporthe phaseolorum f.sp. meridionalis, frogeye leaf spot (Cercospora sojina Hara, and powdery mildew (Microsphaera diffusa Cke. & Pk.. All genetic materials studied were resistant to stem canker. FT-Cristalina RCH and Doko-RC and their TP and TN lines were resistant to frogeye leaf spot. IAC-12 and its derived lines not only presented a higher disease index, but also the derived lines, TP and TN, were more susceptible, indicating the loss of genes for disease resistance in the backcrosses. There was no association between the elimination of lipoxygenases from the seeds with the resistance to frogeye leaf spot. In relation to the powdery mildew, TP or TN lines presented similar or higher resistance than their respective recurrent parents whose susceptibility appeared in the following order: IAC-12, less susceptible, Doko-RC, intermediate and FT-Cristalina RCH, more susceptible.A cultura da soja [Glycine max (L. Merrill] ocupa lugar de destaque na economia brasileira, tanto em termos de área plantada, quanto de produção de gr

  14. Geometric leaf placement strategies

    International Nuclear Information System (INIS)

    Fenwick, J D; Temple, S W P; Clements, R W; Lawrence, G P; Mayles, H M O; Mayles, W P M

    2004-01-01

    Geometric leaf placement strategies for multileaf collimators (MLCs) typically involve the expansion of the beam's-eye-view contour of a target by a uniform MLC margin, followed by movement of the leaves until some point on each leaf end touches the expanded contour. Film-based dose-distribution measurements have been made to determine appropriate MLC margins-characterized through an index d 90 -for multileaves set using one particular strategy to straight lines lying at various angles to the direction of leaf travel. Simple trigonometric relationships exist between different geometric leaf placement strategies and are used to generalize the results of the film work into d 90 values for several different strategies. Measured d 90 values vary both with angle and leaf placement strategy. A model has been derived that explains and describes quite well the observed variations of d 90 with angle. The d 90 angular variations of the strategies studied differ substantially, and geometric and dosimetric reasoning suggests that the best strategy is the one with the least angular variation. Using this criterion, the best straightforwardly implementable strategy studied is a 'touch circle' approach for which semicircles are imagined to be inscribed within leaf ends, the leaves being moved until the semicircles just touch the expanded target outline

  15. BOREAS TE-9 NSA Leaf Chlorophyll Density

    Science.gov (United States)

    Hall, Forrest G. (Editor); Curd, Shelaine (Editor); Margolis, Hank; Sy, Mikailou

    2000-01-01

    The BOREAS TE-9 team collected several data sets related to chemical and photosynthetic properties of leaves in boreal forest tree species. These data were collected to help provide an explanation of potential seasonal and spatial changes of leaf pigment properties in boreal forest species at the NSA. At different dates (FFC-Winter, FFC-Thaw, IFC-1, IFC-2, and IMC-3), foliage samples were collected from the upper third of the canopy for five NSA sites (YJP, OJP, OBS, UBS, and OA) near Thompson, Manitoba. Subsamples of 100 needles for black spruce, 20 needles for jack pine, and single leaf for trembling aspen were cut into pieces and immersed in a 20-mL DMF aliquot in a Nalgene test tube. The extracted foliage materials were then oven-dried at 68 C for 48 hours and weighed. Extracted leaf dry weight was converted to a total leaf area basis to express the chlorophyll content in mg/sq cm of total leaf area. The data are provided in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  16. Resistance Training with Single vs. Multi-joint Exercises at Equal Total Load Volume: Effects on Body Composition, Cardiorespiratory Fitness, and Muscle Strength.

    Science.gov (United States)

    Paoli, Antonio; Gentil, Paulo; Moro, Tatiana; Marcolin, Giuseppe; Bianco, Antonino

    2017-01-01

    The present study aimed to compare the effects of equal-volume resistance training performed with single-joint (SJ) or multi-joint exercises (MJ) on VO 2 max, muscle strength and body composition in physically active males. Thirty-six participants were divided in two groups: SJ group ( n = 18, 182.1 ± 5.2, 80.03 ± 2.78 kg, 23.5 ± 2.7 years) exercised with only SJ exercises (e.g., dumbbell fly, knee extension, etc.) and MJ group ( n = 18, 185.3 ± 3.6 cm, 80.69 ± 2.98 kg, 25.5 ± 3.8 years) with only MJ exercises (e.g., bench press, squat, etc.). The total work volume (repetitions × sets × load) was equated between groups. Training was performed three times a week for 8 weeks. Before and after the training period, participants were tested for VO 2 max, body composition, 1 RM on the bench press, knee extension and squat. Analysis of covariance (ANCOVA) was used to compare post training values between groups, using baseline values as covariates. According to the results, both groups decreased body fat and increased fat free mass with no difference between them. Whilst both groups significantly increased cardiorespiratory fitness and maximal strength, the improvements in MJ group were higher than for SJ in VO 2 max (5.1 and 12.5% for SJ and MJ), bench press 1 RM (8.1 and 10.9% for SJ and MJ), knee extension 1 RM (12.4 and 18.9% for SJ and MJ) and squat 1 RM (8.3 and 13.8% for SJ and MJ). In conclusion, when total work volume was equated, RT programs involving MJ exercises appear to be more efficient for improving muscle strength and maximal oxygen consumption than programs involving SJ exercises, but no differences were found for body composition.

  17. No Exacerbation of Knee Joint Pain and Effusion Following Preoperative Progressive Resistance Training in Patients Scheduled for Total Knee Arthroplasty: Secondary Analyses From a Randomized Controlled Trial.

    Science.gov (United States)

    Skoffer, Birgit; Dalgas, Ulrik; Maribo, Thomas; Søballe, Kjeld; Mechlenburg, Inger

    2017-11-09

    Preoperative progressive resistance training (PRT) is controversial in patients scheduled for total knee arthroplasty (TKA), because of the concern that it may exacerbate knee joint pain and effusion. To examine whether preoperative PRT initiated 5 weeks prior to TKA would exacerbate pain and knee effusion, and would allow a progressively increased training load throughout the training period that would subsequently increase muscle strength. Secondary analyses from a randomized controlled trial. University Hospital and a Regional Hospital. A total of 30 patients who were scheduled for TKA due to osteoarthritis and assigned as the intervention group. Patients underwent unilateral PRT (3 sessions per week). Exercise loading was 12 repetitions maximum (RM) with progression toward 8 RM. The training program consisted of 6 exercises performed unilaterally. Before and after each training session, knee joint pain was rated on an 11-point scale, effusion was assessed by measuring the knee joint circumference, and training load was recorded. The first and last training sessions were initiated by 1 RM testing of unilateral leg press, unilateral knee extension, and unilateral knee flexion. The median pain change score from before to after each training session was 0 at all training sessions. The average increase in knee joint effusion across the 12 training sessions was a mean 0.16 cm ± 0.23 cm. No consistent increase in knee joint effusion after training sessions during the training period was found (P = .21). Training load generally increased, and maximal muscle strength improved as follows: unilateral leg press: 18% ± 30% (P = .03); unilateral knee extension: 81% ± 156% (P knee flexion: 53% ± 57% (P knee joint pain and effusion, despite a substantial progression in loading and increased muscle strength. Concerns for side effects such as pain and effusion after PRT seem unfounded. To be determined. Copyright © 2017. Published by Elsevier Inc.

  18. Role of rs1501299 variant in the adiponectin gene on total adiponectin levels, insulin resistance and weight loss after a Mediterranean hypocaloric diet.

    Science.gov (United States)

    de Luis, Daniel Antonio; Izaola, Olatz; Primo, David; Aller, Rocio

    2017-11-14

    Several adiponectin gene (ADIPOQ) single nucleotide polymorphisms (SNPS) have been related with adiponectin levels and risk for obesity. Our aim was to analyze the effects of rs1501299 ADIPOQ gene polymorphism on total adiponectin levels, insulin resistance and weight loss after a Mediterranean hypocaloric diet in obese subjects. A Caucasian population of 82 obese patients was analyzed, before and after 3 months on a Mediterranean hypocaloric diet. Before and after 3 months on a hypocaloric diet, an anthropometric evaluation, an assessment of nutritional intake and a biochemical analysis were performed. After dietary treatment and in wild type group, weight, BMI, fat mass, leptin levels, systolic blood pressure and waist circumference decreases were similar to the mutant type group. In wild type group, the decrease in total cholesterol was -28.1±15.3 mg/dl (mutant group: -12.6±16.7 mg/dl:p=0.009), LDL- cholesterol was -31.8±20.5 mg/dl (-12.2±11.5 mg/dl:p=0.006), fasting glucose plasma -4.8±2.5 mg/dL (-0.5±0.1 mg/dL:p=0.02), insulin -3.6±1.5 mUI/L (+0.6±1.1 mUI/L:p=0.02) and HOMA-IR -1.2±0.9 (-0.1±1.1:p=0.03). The present study suggests that T allele of ADIPO (rs1501299) could be a predictor of a lack of response of HOMA-IR, insulin, fasting glucose and LDL cholesterol secondary to a Mediterranean hypocaloric diet in obese subjects. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Rapid, high-resolution measurement of leaf area and leaf orientation using terrestrial LiDAR scanning data

    International Nuclear Information System (INIS)

    Bailey, Brian N; Mahaffee, Walter F

    2017-01-01

    The rapid evolution of high performance computing technology has allowed for the development of extremely detailed models of the urban and natural environment. Although models can now represent sub-meter-scale variability in environmental geometry, model users are often unable to specify the geometry of real domains at this scale given available measurements. An emerging technology in this field has been the use of terrestrial LiDAR scanning data to rapidly measure the three-dimensional geometry of trees, such as the distribution of leaf area. However, current LiDAR methods suffer from the limitation that they require detailed knowledge of leaf orientation in order to translate projected leaf area into actual leaf area. Common methods for measuring leaf orientation are often tedious or inaccurate, which places constraints on the LiDAR measurement technique. This work presents a new method to simultaneously measure leaf orientation and leaf area within an arbitrarily defined volume using terrestrial LiDAR data. The novelty of the method lies in the direct measurement of the fraction of projected leaf area G from the LiDAR data which is required to relate projected leaf area to total leaf area, and in the new way in which radiation transfer theory is used to calculate leaf area from the LiDAR data. The method was validated by comparing LiDAR-measured leaf area to (1) ‘synthetic’ or computer-generated LiDAR data where the exact area was known, and (2) direct measurements of leaf area in the field using destructive sampling. Overall, agreement between the LiDAR and reference measurements was very good, showing a normalized root-mean-squared-error of about 15% for the synthetic tests, and 13% in the field. (paper)

  20. A hairy-leaf gene, BLANKET LEAF, of wild Oryza nivara increases photosynthetic water use efficiency in rice.

    Science.gov (United States)

    Hamaoka, Norimitsu; Yasui, Hideshi; Yamagata, Yoshiyuki; Inoue, Yoko; Furuya, Naruto; Araki, Takuya; Ueno, Osamu; Yoshimura, Atsushi

    2017-12-01

    High water use efficiency is essential to water-saving cropping. Morphological traits that affect photosynthetic water use efficiency are not well known. We examined whether leaf hairiness improves photosynthetic water use efficiency in rice. A chromosome segment introgression line (IL-hairy) of wild Oryza nivara (Acc. IRGC105715) with the genetic background of Oryza sativa cultivar 'IR24' had high leaf pubescence (hair). The leaf hairs developed along small vascular bundles. Linkage analysis in BC 5 F 2 and F 3 populations showed that the trait was governed by a single gene, designated BLANKET LEAF (BKL), on chromosome 6. IL-hairy plants had a warmer leaf surface in sunlight, probably due to increased boundary layer resistance. They had a lower transpiration rate under moderate and high light intensities, resulting in higher photosynthetic water use efficiency. Introgression of BKL on chromosome 6 from O. nivara improved photosynthetic water use efficiency in the genetic background of IR24.

  1. Leaf size indices and structure of the peat swamp forest

    Directory of Open Access Journals (Sweden)

    L.G. Aribal

    2017-12-01

    Full Text Available Leaf size indices of the tree species in the peatland of Agusan del Sur in Mindanao in Philippines was examined to deduce the variation of forest structure and observed forest zonation.  Using raunkiaer and webb’s leaf size classification, the leaf morphometrics of seven tree species consistently found on the established sampling plots were determined.  The species includes Ternstroemia philippinensis Merr., Polyscias aherniana Merr. Lowry and G.M. Plunkett, Calophyllum sclerophyllum Vesque, Fagraea racemosa Jack, Ilex cymosa Blume, Syzygium tenuirame (Miq. Merr. and Tristaniopsis micrantha Merr. Peter G.Wilson and J.T.Waterh.The LSI were correlated against the variables of the peat physico-chemical properties (such as bulk density, acrotelm thickness, peat depth, total organic carbon, nitrogen, phosphorus, and potassium, pH; water (pH, ammonium, nitrate, phosphate; and leaf tissue elements (nitrogen, phosphorus and potassium.  Result showed a decreasing leaf size indices and a three leaf size category consisting of mesophyllous, mesophyllous-notophyllous and microphyllous were observed which corresponds to the structure of vegetation i.e., from the tall-pole forest having the biggest average leaf area of 6,142.29 mm2 to the pygmy forest with average leaf area of 1,670.10 mm2.  Such decreased leaf size indices were strongly correlated to soil nitrogen, acrotelm thickness, peat depth, phosphate in water, nitrogen and phosphorus in the plant tissue.

  2. Estudio de parámetros hídricos foliares en trigo (Triticum aestivum L. y su uso en selección de genotipos resistentes a sequía Leaf water parameters of wheat (Triticum aestivum L. and their use in the selection of drought resistant genotypes

    Directory of Open Access Journals (Sweden)

    MAURICIO ORTIZ

    2003-06-01

    , CRA y AO, y otra que consideró la pendiente y el promedio de psish y CRA. Luego se correlacionó el orden de los genotipos de ambas selecciones con los ordenes establecidos para los métodos de calculo de AO y se estableció que el orden que considera la pendiente y el promedio de ysh, CRA y AO se correlaciona con los ordenes establecidos por los tres métodos de cálculo de AO. Los parámetros hídricos foliares CRA, psish y AO no estuvieron correlacionados con el rendimiento bajo estrés hídrico. La pendiente de psish se correlacionó negativamente con el rendimiento, lo que indica que el AO permite a la planta sobrevivir al estrés pero no tener mayor rendimiento. Se concluye que con la metodología utilizada es posible seleccionar genotipos resistentes a sequía en base a la pendiente y el promedio de los parámetros psish, CRA y AO obtenidos en campo, removiendo parte del ruido ambientalThe leaf water parameters ys (solute potential, RWC (relative water content and OA (osmotic adjustment characterize the response of plants to water stress and presumably allow the identification of better adapted genotypes. These parameters, however, are highly influenced by the environment what makes their analysis difficult. In this work we hypothesize that it is possible to characterize and select drought resistant wheat genotypes based on the field value of the leaf water parameters using the appropriate analytical techniques. Thirty one wheat (Triticum aestivum L. genotypes were grown in two field trials, one irrigated and one non-irrigated that received 218.3 mm of winter rain. The statistical design was a randomized complete block with two replicates. Between 77 and 121 days after emergence (DC 41 to DC 77, five samplings of relative water content (RWC and solute potential of hydrated flag leaves (psish were made in each replication of each trial (10 observations per trial. The replicates were sampled in alternate days with a 24-h interval between 12:00 and 14:00 h

  3. Phytochemical Analysis, Antifungal and Antioxidant Activity of Leaf ...

    African Journals Online (AJOL)

    Science, Technology and Arts Research Journal ... of total phenolics, antifungal and antioxidant activity of leaf and fruit extract of Zizyphus xylopyrus (Retz.) ... Flavonoids, saponins, terpenoids, tannins and phenols were found in both extracts.

  4. Influence of spectral properties on cassava leaf development and ...

    African Journals Online (AJOL)

    sunny t

    2014-02-12

    Feb 12, 2014 ... changes in leaf spectral characteristics were studied using Digimizer ... main wavelengths used by plants (blue, green and red) with the blue being the most preferred. Total ...... differences observed allude to plant behavior.

  5. Twenty Percent of Patients May Remain Colonized With Methicillin-resistant Staphylococcus aureus Despite a Decolonization Protocol in Patients Undergoing Elective Total Joint Arthroplasty.

    Science.gov (United States)

    Baratz, Michael D; Hallmark, Ruth; Odum, Susan M; Springer, Bryan D

    2015-07-01

    Staphylococcus aureus is the most commonly isolated organism in periprosthetic joint infection (PJI). Resistant strains such as methicillin-resistant S aureus (MRSA) are on the rise, and many programs have instituted decolonization protocols. There are limited data on the success of S aureus nasal decolonization programs and their impact on PJI. The purposes of this study were to (1) determine the proportion of patients successfully decolonized using a 2-week protocol; (2) compare infection risks between our surveillance and decolonization protocol group against a historical control cohort to evaluate changes in proportions of S aureus infections; and (3) assess infection risk based on carrier type, comparing S aureus carriers with noncarrier controls. We retrospectively evaluated a group of 3434 patients who underwent elective primary and revision hip and knee arthroplasty over a 2-year period; each patient in the treatment group underwent a surveillance protocol, and a therapeutic regimen of mupurocin and chlorhexidine was instituted when colonization criteria were met. A 2009 to 2010 comparative historical cohort was chosen as the control group. We compared risks of infection between our treatment group and the historical control cohort. Furthermore, in patients who developed surgical site infections (SSIs), we compared the proportions of each S aureus type between the two cohorts. Finally, we compared infection rates based on carrier status. Surveillance for infection was carried out by the hospital infection control coordinator using the Centers for Disease Control and Prevention (CDC) criteria. During the time period of this study, the CDC defined hospital-acquired infection related to a surgical procedure as any infection diagnosed within 1 year of the procedure. With the numbers available, we had 41% power to detect a difference of 0.3% in infection rate between the treatment and control groups. To achieve 80% power, a total of 72,033 patients would be

  6. The effects of feeding resistant starch on apparent total tract macronutrient digestibility, faecal characteristics and faecal fermentative end-products in healthy adult dogs.

    Science.gov (United States)

    Beloshapka, Alison N; Alexander, Lucille G; Buff, Preston R; Swanson, Kelly S

    2014-01-01

    The benefits of whole grain consumption have been studied in human subjects, but little research exists on their effects in dogs. The objective of the present study was to test the effects of resistant starch (RS) in the diet of healthy adult dogs. Twelve adult Miniature Schnauzer dogs (eight males, four females; mean age: 3·3 (1·6) years; mean body weight: 8·4 (1·2) kg; mean body condition score: D/ideal) were randomly allotted to one of three treatment groups, which consisted of different amounts of RS supplied in a biscuit format. Dogs received either 0, 10 or 20 g biscuits per d (estimated to be 0, 2·5 or 5 g RS per d) that were fed within their daily energetic allowance. A balanced Latin square design was used, with each treatment period lasting 21 d (days 0-17 adaptation; days 18-21 fresh and total faecal collection). All dogs were fed the same diet to maintain body weight throughout the study. Dogs fed 5 g RS per d had lower (P = 0·03) fat digestibility than dogs fed 0 gRS per d, but DM, organic matter and crude protein digestibilities were not affected. Faecal fermentative end-products, including SCFA and branched-chain fatty acids, ammonia, phenols and indoles, and microbial populations were not affected. The minor changes observed in the present study suggest the RS doses provided to the dogs were too low. Further work is required to assess the dose of RS required to affect gut health.

  7. Resistance Training with Single vs. Multi-joint Exercises at Equal Total Load Volume: Effects on Body Composition, Cardiorespiratory Fitness, and Muscle Strength

    Directory of Open Access Journals (Sweden)

    Antonio Paoli

    2017-12-01

    Full Text Available The present study aimed to compare the effects of equal-volume resistance training performed with single-joint (SJ or multi-joint exercises (MJ on VO2max, muscle strength and body composition in physically active males. Thirty-six participants were divided in two groups: SJ group (n = 18, 182.1 ± 5.2, 80.03 ± 2.78 kg, 23.5 ± 2.7 years exercised with only SJ exercises (e.g., dumbbell fly, knee extension, etc. and MJ group (n = 18, 185.3 ± 3.6 cm, 80.69 ± 2.98 kg, 25.5 ± 3.8 years with only MJ exercises (e.g., bench press, squat, etc.. The total work volume (repetitions × sets × load was equated between groups. Training was performed three times a week for 8 weeks. Before and after the training period, participants were tested for VO2max, body composition, 1 RM on the bench press, knee extension and squat. Analysis of covariance (ANCOVA was used to compare post training values between groups, using baseline values as covariates. According to the results, both groups decreased body fat and increased fat free mass with no difference between them. Whilst both groups significantly increased cardiorespiratory fitness and maximal strength, the improvements in MJ group were higher than for SJ in VO2max (5.1 and 12.5% for SJ and MJ, bench press 1 RM (8.1 and 10.9% for SJ and MJ, knee extension 1 RM (12.4 and 18.9% for SJ and MJ and squat 1 RM (8.3 and 13.8% for SJ and MJ. In conclusion, when total work volume was equated, RT programs involving MJ exercises appear to be more efficient for improving muscle strength and maximal oxygen consumption than programs involving SJ exercises, but no differences were found for body composition.

  8. A non-destructive method for estimating onion leaf area

    Directory of Open Access Journals (Sweden)

    Córcoles J.I.

    2015-06-01

    Full Text Available Leaf area is one of the most important parameters for characterizing crop growth and development, and its measurement is useful for examining the effects of agronomic management on crop production. It is related to interception of radiation, photosynthesis, biomass accumulation, transpiration and gas exchange in crop canopies. Several direct and indirect methods have been developed for determining leaf area. The aim of this study is to develop an indirect method, based on the use of a mathematical model, to compute leaf area in an onion crop using non-destructive measurements with the condition that the model must be practical and useful as a Decision Support System tool to improve crop management. A field experiment was conducted in a 4.75 ha commercial onion plot irrigated with a centre pivot system in Aguas Nuevas (Albacete, Spain, during the 2010 irrigation season. To determine onion crop leaf area in the laboratory, the crop was sampled on four occasions between 15 June and 15 September. At each sampling event, eight experimental plots of 1 m2 were used and the leaf area for individual leaves was computed using two indirect methods, one based on the use of an automated infrared imaging system, LI-COR-3100C, and the other using a digital scanner EPSON GT-8000, obtaining several images that were processed using Image J v 1.43 software. A total of 1146 leaves were used. Before measuring the leaf area, 25 parameters related to leaf length and width were determined for each leaf. The combined application of principal components analysis and cluster analysis for grouping leaf parameters was used to reduce the number of variables from 25 to 12. The parameter derived from the product of the total leaf length (L and the leaf diameter at a distance of 25% of the total leaf length (A25 gave the best results for estimating leaf area using a simple linear regression model. The model obtained was useful for computing leaf area using a non

  9. Leaf-IT: An Android application for measuring leaf area.

    Science.gov (United States)

    Schrader, Julian; Pillar, Giso; Kreft, Holger

    2017-11-01

    The use of plant functional traits has become increasingly popular in ecological studies because plant functional traits help to understand key ecological processes in plant species and communities. This also includes changes in diversity, inter- and intraspecific interactions, and relationships of species at different spatiotemporal scales. Leaf traits are among the most important traits as they describe key dimensions of a plant's life history strategy. Further, leaf area is a key parameter with relevance for other traits such as specific leaf area, which in turn correlates with leaf chemical composition, photosynthetic rate, leaf longevity, and carbon investment. Measuring leaf area usually involves the use of scanners and commercial software and can be difficult under field conditions. We present Leaf-IT, a new smartphone application for measuring leaf area and other trait-related areas. Leaf-IT is free, designed for scientific purposes, and runs on Android 4 or higher. We tested the precision and accuracy using objects with standardized area and compared the area measurements of real leaves with the well-established, commercial software WinFOLIA using the Altman-Bland method. Area measurements of standardized objects show that Leaf-IT measures area with high accuracy and precision. Area measurements with Leaf-IT of real leaves are comparable to those of WinFOLIA. Leaf-IT is an easy-to-use application running on a wide range of smartphones. That increases the portability and use of Leaf-IT and makes it possible to measure leaf area under field conditions typical for remote locations. Its high accuracy and precision are similar to WinFOLIA. Currently, its main limitation is margin detection of damaged leaves or complex leaf morphologies.

  10. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  11. Intake of total dietary sugar and fibre is associated with insulin resistance among Danish 8-10- and 14-16-year-old girls but not boys. European Youth Heart Studies I and II

    DEFF Research Database (Denmark)

    Kynde, Iben; Johnsen, Nina Føns; Wedderkopp, Niels

    2010-01-01

    Objective: To examine the dietary intake of total sugar, added sugar, non-added sugar and starch as well as dietary fibre and glycaemic index (GI) and their respective associations with insulin resistance. Design: Mixed linear models were used to study both cross-sectional and prospective...... associations between carbohydrate components and insulin resistance separately in girls and boys. Diet was assessed by a single 24 h recall interview and insulin resistance was calculated using the homoestasis model assessment (HOMA). Setting: The Danish part of the European Youth Heart Studies (EYHS) I and II....... Subjects: Girls and boys at 8–10 and 14–16 years from EYHS I (n 651) and 8–10-year olds from baseline followed up 6 years later in EYHS II (n 233). Results: Among girls, a difference in dietary total sugar of 43 g/MJ was associated with a 1 SD difference of HOMA and a difference in dietary fibre of 28g...

  12. Final report on the safety assessment of AloeAndongensis Extract, Aloe Andongensis Leaf Juice,aloe Arborescens Leaf Extract, Aloe Arborescens Leaf Juice, Aloe Arborescens Leaf Protoplasts, Aloe Barbadensis Flower Extract, Aloe Barbadensis Leaf, Aloe Barbadensis Leaf Extract, Aloe Barbadensis Leaf Juice,aloe Barbadensis Leaf Polysaccharides, Aloe Barbadensis Leaf Water, Aloe Ferox Leaf Extract, Aloe Ferox Leaf Juice, and Aloe Ferox Leaf Juice Extract.

    Science.gov (United States)

    2007-01-01

    Review Expert Panel concluded that anthraquinone levels in the several Aloe Barbadensis extracts are well understood and can conform to the industry-established level of 50 ppm. Although the phototoxicity anthraquinone components of Aloe plants have been demonstrated, several clinical studies of preparations derived from Aloe barbadensis plants demonstrated no phototoxicity, confirming that the concentrations of anthraquinones in such preparations are too low to induce phototoxicity. The characterization of aloe-derived ingredients from other species is not clear. In the absence of well-characterized derivatives, biological studies of these materials are considered necessary. The studies needed are 28-day dermal toxicity studies on Aloe Andongensis Extract, Aloe Andongensis Leaf Juice, Aloe Arborescens Leaf Extract, Aloe Arborescens Leaf Juice, Aloe Ferox Leaf Extract, Aloe Ferox Leaf Juice, and Aloe Ferox Leaf Juice (ingredients should be tested at current use concentrations). In Aloe-derived ingredients used in cosmetics, regardless of species, anthraquinone levels should not exceed 50 ppm. The Cosmetic Ingredient Review Expert Panel advised the industry that the total polychlorobiphenyl (PCB)/pesticide contamination of any plant-derived cosmetic ingredient should be limited to not more than 40 ppm, with not more than 10 ppm for any specific residue and that limits were appropriate for the following impurities: arsenic (3 mg/kg maximum), heavy metals (20 mg/kg maximum), and lead (5 mg/kg maximum).

  13. Timing and duration of autumn leaf development in Sweden

    Science.gov (United States)

    Bolmgren, Kjell

    2014-05-01

    The growing season is changing in both ends and autumn phases seem to be responding in more diverse ways than spring events. Indeed, we know little about autumn leaf phenological strategies and how they are correlated with fitness components or ecosystem properties, and how they vary between species and over bioclimatic gradients. In this study more than 10 000 students were involved in observing autumn leaf development at 378 sites all over Sweden (55-68°N). They followed an image based observation protocol classifying autumn leaf development into five levels, from summer green (level 0) to 100% autumn leaf colored (level 4) canopy. In total, they submitted almost 12 000 observations between August 9 and November 15. 75% of the observations were made on the common species of Populus tremula, Betula pendula/pubescens and Sorbus aucuparia. The expected (negative) correlation between latitude and start of leaf senescence (level 2) was found in Populus and Betula, but not in Sorbus. The duration of the leaf senescence period, defined as the period between 1/3 (level 2) and 100% (level 4) of the canopy autumn leaf colored, was negatively correlated with latitude in Populus and Betula, but not in Sorbus. There was also a strong (negative) correlation of the start (level 2) and the duration of the leaf senescence in the early senescing Sorbus and Betula, while this effect was weaker in the late senescing Populus.

  14. On the temporal variation of leaf magnetic parameters: seasonal accumulation of leaf-deposited and leaf-encapsulated particles of a roadside tree crown.

    Science.gov (United States)

    Hofman, Jelle; Wuyts, Karen; Van Wittenberghe, Shari; Samson, Roeland

    2014-09-15

    Understanding the accumulation behaviour of atmospheric particles inside tree leaves is of great importance for the interpretation of biomagnetic monitoring results. In this study, we evaluated the temporal variation of the saturation isothermal remanent magnetisation (SIRM) of leaves of a roadside urban Platanus × acerifolia Willd. tree in Antwerp, Belgium. We hereby examined the seasonal development of the total leaf SIRM signal as well as the leaf-encapsulated fraction of the deposited dust, by washing the leaves before biomagnetic analysis. On average 38% of the leaf SIRM signal was exhibited by the leaf-encapsulated particles. Significant correlations were found between the SIRM and the cumulative daily average atmospheric PM10 and PM2.5 measurements. Moreover, a steady increase of the SIRM throughout the in-leaf season was observed endorsing the applicability of biomagnetic monitoring as a proxy for the time-integrated PM exposure of urban tree leaves. Strongest correlations were obtained for the SIRM of the leaf-encapsulated particles which confirms the dynamic nature of the leaf surface-accumulated particles. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. The dosimetric impact of leaf interdigitation and leaf width on VMAT treatment planning in Pinnacle: comparing Pareto fronts

    International Nuclear Information System (INIS)

    Van Kesteren, Z; Janssen, T M; Damen, E; Van Vliet-Vroegindeweij, C

    2012-01-01

    To evaluate in an objective way the effect of leaf interdigitation and leaf width on volumetric modulated arc therapy plans in Pinnacle. Three multileaf collimators (MLCs) were modeled: two 10 mm leaf width MLCs, with and without interdigitating leafs, and a 5 mm leaf width MLC with interdigitating leafs. Three rectum patients and three prostate patients were used for the planning study. In order to compare treatment techniques in an objective way, a Pareto front comparison was carried out. 200 plans were generated in an automated way, per patient per MLC model, resulting in a total of 3600 plans. From these plans, Pareto-optimal plans were selected which were evaluated for various dosimetric variables. The capability of leaf interdigitation showed little dosimetric impact on the treatment plans, when comparing the 10 mm leaf width MLC with and without leaf interdigitation. When comparing the 10 mm leaf width MLC with the 5 mm leaf width MLC, both with interdigitating leafs, improvement in plan quality was observed. For both patient groups, the integral dose was reduced by 0.6 J for the thin MLC. For the prostate patients, the mean dose to the anal sphincter was reduced by 1.8 Gy and the conformity of the V 95% was reduced by 0.02 using the thin MLC. The V 65% of the rectum was reduced by 0.1% and the dose homogeneity with 1.5%. For rectum patients, the mean dose to the bowel was reduced by 1.4 Gy and the mean dose to the bladder with 0.8 Gy for the thin MLC. The conformity of the V 95% was equivalent for the 10 and 5 mm leaf width MLCs for the rectum patients. We have objectively compared three types of MLCs in a planning study for prostate and rectum patients by analyzing Pareto-optimal plans which were generated in an automated way. Interdigitation of MLC leafs does not generate better plans using the SmartArc algorithm in Pinnacle. Changing the MLC leaf width from 10 to 5 mm generates better treatment plans although the clinical relevance remains to be proven

  16. The dosimetric impact of leaf interdigitation and leaf width on VMAT treatment planning in Pinnacle: comparing Pareto fronts.

    Science.gov (United States)

    van Kesteren, Z; Janssen, T M; Damen, E; van Vliet-Vroegindeweij, C

    2012-05-21

    To evaluate in an objective way the effect of leaf interdigitation and leaf width on volumetric modulated arc therapy plans in Pinnacle. Three multileaf collimators (MLCs) were modeled: two 10 mm leaf width MLCs, with and without interdigitating leafs, and a 5 mm leaf width MLC with interdigitating leafs. Three rectum patients and three prostate patients were used for the planning study. In order to compare treatment techniques in an objective way, a Pareto front comparison was carried out. 200 plans were generated in an automated way, per patient per MLC model, resulting in a total of 3600 plans. From these plans, Pareto-optimal plans were selected which were evaluated for various dosimetric variables. The capability of leaf interdigitation showed little dosimetric impact on the treatment plans, when comparing the 10 mm leaf width MLC with and without leaf interdigitation. When comparing the 10 mm leaf width MLC with the 5 mm leaf width MLC, both with interdigitating leafs, improvement in plan quality was observed. For both patient groups, the integral dose was reduced by 0.6 J for the thin MLC. For the prostate patients, the mean dose to the anal sphincter was reduced by 1.8 Gy and the conformity of the V(95%) was reduced by 0.02 using the thin MLC. The V(65%) of the rectum was reduced by 0.1% and the dose homogeneity with 1.5%. For rectum patients, the mean dose to the bowel was reduced by 1.4 Gy and the mean dose to the bladder with 0.8 Gy for the thin MLC. The conformity of the V(95%) was equivalent for the 10 and 5 mm leaf width MLCs for the rectum patients. We have objectively compared three types of MLCs in a planning study for prostate and rectum patients by analyzing Pareto-optimal plans which were generated in an automated way. Interdigitation of MLC leafs does not generate better plans using the SmartArc algorithm in Pinnacle. Changing the MLC leaf width from 10 to 5 mm generates better treatment plans although the clinical relevance remains

  17. Early detection of crop injury from herbicide glyphosate by leaf biochemical parameter inversion

    Science.gov (United States)

    Early detection of crop injury from glyphosate is of significant importance in crop management. In this paper, we attempt to detect glyphosate-induced crop injury by PROSPECT (leaf optical PROperty SPECTra model) inversion through leaf hyperspectral reflectance measurements for non-Glyphosate-Resist...

  18. Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

    Energy Technology Data Exchange (ETDEWEB)

    Bouriaud, O. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France); Soudani, K. [Univ. Paris-Sud XI, Dept. d' Ecophysiologie Vegetale, Lab. Ecologie Systematique et Evolution, Orsay Cedex (France); Breda, N. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France)

    2003-06-01

    Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m{sup 2}{center_dot}g{sup -1}) is used to convert dry leaf litter biomass (g .m{sup -}2) into leaf area per ground unit area (m{sup 2}{center_dot}m{sup -2}). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m{sup 2}) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm{sup 2}{center_dot}g{sup -1}. Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant

  19. Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

    International Nuclear Information System (INIS)

    Bouriaud, O.; Soudani, K.; Breda, N.

    2003-01-01

    Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m 2 ·g -1 ) is used to convert dry leaf litter biomass (g .m - 2) into leaf area per ground unit area (m 2 ·m -2 ). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m 2 ) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm 2 ·g -1 . Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant relationship between SLA and soil properties was observed. Both SLA

  20. RFLP-facilitated investigation of the quantitative resistance of rice to brown planthopper ( Nilaparvata lugens).

    Science.gov (United States)

    Xu, X. F.; Mei, H. W.; Luo, L. J.; Cheng, X. N.; Li, Z. K.

    2002-02-01

    Quantitative trait loci (QTLs), conferring quantitative resistance to rice brown planthopper (BPH), were investigated using 160 F(11) recombinant inbred lines (RILs) from the Lemont/Teqing cross, a complete RFLP map, and replicated phenotyping of seedbox inoculation. The paternal indica parent, Teqing, was more-resistant to BPH than the maternal japonica parent, Lemont. The RILs showed transgressive segregation for resistance to BPH. Seven main-effect QTLs and many epistatic QTL pairs were identified and mapped on the 12 rice chromosomes. Collectively, the main-effect and epistatic QTLs accounted for over 70% of the total variation in damage scores. Teqing has the resistance allele at four main-effect QTLs, and the Lemont allele resulted in resistance at the other three. Of the main-effect QTLs identified, QBphr5b was mapped to the vicinity of gl1, a major gene controlling leaf and stem pubescence. The Teqing allele controlling leaf and stem pubescence was associated with resistance, while the Lemont allele for glabrous stem and leaves was associated with susceptibility, indicating that this gene may have contributed to resistance through antixenosis. Similar to the reported BPH resistance genes, the other six detected main-effect QTLs were all mapped to regions where major disease resistance genes locate, suggesting they might have contributed either to antibiosis or tolerance. Our results indicated that marker-aided pyramiding of major resistance genes and QTLs should provide effective and stable control over this devastating pest.

  1. Leaf absorbance and photosynthesis

    Science.gov (United States)

    Schurer, Kees

    1994-01-01

    The absorption spectrum of a leaf is often thought to contain some clues to the photosynthetic action spectrum of chlorophyll. Of course, absorption of photons is needed for photosynthesis, but the reverse, photosynthesis when there is absorption, is not necessarily true. As a check on the existence of absorption limits we measured spectra for a few different leaves. Two techniques for measuring absorption have been used, viz. the separate determination of the diffuse reflectance and the diffuse transmittance with the leaf at a port of an integrating sphere and the direct determination of the non-absorbed fraction with the leaf in the sphere. In a cross-check both methods yielded the same results for the absorption spectrum. The spectrum of a Fuchsia leaf, covering the short-wave region from 350 to 2500 nm, shows a high absorption in UV, blue and red, the well known dip in the green and a steep fall-off at 700 nm. Absorption drops to virtually zero in the near infrared, with subsequent absorptions, corresponding to the water absorption bands. In more detailed spectra, taken at 5 nm intervals with a 5 nm bandwidth, differences in chlorophyll content show in the different depths of the dip around 550 nm and in a small shift of the absorption edge at 700 nm. Spectra for Geranium (Pelargonium zonale) and Hibiscus (with a higher chlorophyll content) show that the upper limit for photosynthesis can not be much above 700 nm. No evidence, however, is to be seen of a lower limit for photosynthesis and, in fact, some experiments down to 300 nm still did not show a decrease of the absorption although it is well recognized that no photosynthesis results with 300 nm wavelengths.

  2. Infestation of froghopper nymphs changes the amounts of total phenolics in sugarcane

    Directory of Open Access Journals (Sweden)

    Silva Rafael José Navas da

    2005-01-01

    Full Text Available The increased rate of sugarcane harvest without previous burn has provided a very favorable environment to the froghopper Mahanarva fimbriolata (Stal, 1854, with high moisture and low temperature variation. Few works have studied the response of sugarcane to this pest, so little is known about resistant cultivars. Plant phenolics are widely studied compounds because of their known antiherbivore effect. This research aims to determine if the attack of M. fimbriolata nymphs stimulates the accumulation of total phenolics in sugarcane. The experiment was carried out in greenhouse and arranged in completely randomized design, in a 3 X 2 X 4 factorial with three replications. Second instar nymphs of M. fimbriolata were infested at the following rates: control, 2-4 and 4-8 nymphs per pot (first-second infestations, respectively. Pots were covered with nylon net and monitored daily to isolate the effect of leaf sucking adults. Leaf and root samples were collected and kept frozen in liquid nitrogen until analyses. Infested plants showed higher levels of phenolics in both root and leaf tissues. In roots, the cultivar SP80-1816 accumulated more phenolic compounds in response to the infestation of M. fimbriolata. On the other hand, higher levels were found in leaves and roots of control plants of SP86-42, which might be an indication of a non-preference mechanism. The increase of total phenolics in sugarcane infested with root-sucking froghopper nymphs does not seem to be useful to detect the resistance to this pest.

  3. AP2/ERF Transcription Factors Involved in Response to Tomato Yellow Leaf Curly Virus in Tomato

    Directory of Open Access Journals (Sweden)

    Ying Huang

    2016-07-01

    Full Text Available Tomato yellow leaf curly virus (TYLCV, transmitted by the whitefly (, causes leaf curling and yellowing, plant dwarfism, and growth inhibition in tomato ( L.. The APETALA2 (AP2 and ethylene response factor (ERF transcription factor (TF family, the largest plant-specific TF family, was identified to function in plant development and pathogen defense. Our study aimed to analyze the mechanism underlying the function of ERF (SlERF TFs in response to TYLCV infection and improve useful information to increase the resistance to TYLCV in tomato. A total of 22 tomato AP2/ERF TFs in response to TYLCV were identified according to transcriptome database. Five ERF-B3 TFs were identified in cultivars Hongbeibei (highly resistant, Zheza-301, Zhefen-702 (both resistant, Jinpeng-1, and Xianke-6 (both susceptible. Interaction network indicated that SlERF TFs could interact with mitogen-activated protein kinase (MAPK. Expression profiles of five ERF-B3 genes (, , , , and were detected by quantitative real-time–polymerase chain reaction (qRT-PCR after TYLCV infection in five tomato cultivars. expression was upregulated in five tomato cultivars. The expressions of three genes (, , and were upregulated in Zheza-301 and Zhefen-702. and expressions were downregulated in Hongbeibei and Xianke-6, respectively. Yeast one-hybrid showed that the GCC-box binding ability of ERF-B3 TFs differed in resistant and susceptible tomato cultivars. Expression profiles were related to the GCC-box binding ability of SlERF TFs in resistant and susceptible tomato cultivars. The defense mechanism underlying the tomato’s response to TYLCV involved a complicated network, which provided important information for us in breeding and genetic analysis.

  4. Infrared remote sensing for canopy temperature in paddy field and relationship between leaf temperature and leaf color

    International Nuclear Information System (INIS)

    Wakiyama, Y.

    2002-01-01

    Infrared remote sensing is used for crop monitoring, for example evaluation of water stress, detection of infected crops and estimation of transpiration and photosynthetic rates. This study was conducted to show another application of remote sensing information. The relationship between rice leaf temperature and chlorophyll content in the leaf blade was investigated by using thermography during the ripening period. The canopy of a rice community fertilized by top dressing was cooler than that not fertilized in a 1999 field experiment. In an experiment using thermocouples to measure leaf temperature, a rice leaf with high chlorophyll content was also cooler than that with a low chlorophyll content. Transpiration resistance and transpiration rate were measured with a porometer. Transpiration rate was higher with increasing chlorophyll content in the leaf blade. Stomatal aperture is related to chlorophyll content in the leaf blade. High degree of stomatal aperture is caused by high chlorophyll content in the leaf blade. As degree of stomatal aperture increases, transpiration rate increases. Therefore the rice leaf got cooler with increasing chlorophyll content in leaf blade. Paddy rice communities with different chlorophyll contents were provided with fertilization of different nitrogen levels on basal and top dressing in a 2000 field experiment. Canopy temperature of the rice community with high chlorophyll content was 0.85°C cooler than that of the rice community with low chlorophyll content. Results of this study revealed that infrared remote sensing could detect difference in chlorophyll contents in rice communities and could be used in fertilizer management in paddy fields. (author)

  5. Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...

    African Journals Online (AJOL)

    Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...

  6. identification of common bean genotypes with dual leaf and pod ...

    African Journals Online (AJOL)

    ACSS

    2018-02-08

    Feb 8, 2018 ... IDENTIFICATION OF COMMON BEAN GENOTYPES WITH DUAL LEAF AND. POD RESISTANCE TO COMMON BACTERIAL BLIGHT DISEASE IN UGANDA. B.M.E. ALLADASSI, S.T. NKALUBO1, C. MUKANKUSI2, H.N. KAYAGA, P. GIBSON, R. EDEMA,. C.A. URREA3, J.D. KELLY4 and P.R. RUBAIHAYO.

  7. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  8. The Major Mobilization of the Unconscious and the Total Removal of Resistance in Davanloo's Intensive Short-term Dynamic Psychotherapy Part I: An Introduction.

    Science.gov (United States)

    Hickey, Catherine

    2015-01-01

    Davanloo's Intensive Short-term Dynamic Psychotherapy has been the subject of various reviews. Davanloo has published extensively on his early work, but there have been no publications on his most recent work-most notably his Montreal Closed-circuit training program. This program focuses on his most recent discoveries and techniques and is a unique, videotaped supervisory program. It focuses on self-assessment and peer-assessment. It is also a unique format in which to review Davanloo's theoretical conceptions of resistance and the transference component of the resistance. This paper will review the early work of Davanloo as well as his most recent research findings. A case from the Montreal Closed-circuit training program will be reviewed in detail to highlight these findings.

  9. Total protein

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003483.htm Total protein To use the sharing features on this page, please enable JavaScript. The total protein test measures the total amount of two classes ...

  10. Field performance of Populus expressing somaclonal variation in resistance to Septoria musiva

    Science.gov (United States)

    M. E. Ostry; K. T. Ward

    2003-01-01

    Over 1500 trees from two hybrid poplar clones regenerated from tissue culture and expressing somatic variation in leaf disease resistance in a laboratory leaf disk bioassay were field-tested for 5-11 years to examine their resistance to Septoria leaf spot and canker and to assess their growth characteristics compared with the source clones....

  11. The relationship between leaf water status, gas exchange, and spectral reflectance in cotton leaves

    Science.gov (United States)

    Bowman, William D.

    1989-01-01

    Measurements of leaf spectral reflectance, the components of water potential, and leaf gas exchanges as a function of leaf water content were made to evaluate the use of NIR reflectance as an indicator of plant water status. Significant correlations were determined between spectral reflectance at 810 nm, 1665 nm, and 2210 nm and leaf relative water content, total water potential, and turgor pressure. However, the slopes of these relationships were relatively shallow and, when evaluated over the range of leaf water contents in which physiological activity occurs (e.g., photosynthesis), had lower r-squared values, and some relationships were not statistically significant. NIR reflectance varied primarily as a function of leaf water content, and not independently as a function of turgor pressure, which is a sensitive indicator of leaf water status. The limitations of this approach to measuring plant water stress are discussed.

  12. Leaf litter processing and invertebrate assemblages along a pollution gradient in a Maine (USA) headwater stream

    International Nuclear Information System (INIS)

    Woodcock, Thomas S.; Huryn, Alexander D.

    2005-01-01

    During the autumn of 1997 and 1998, leaf litter processing rates and leaf pack invertebrate assemblages were examined at eight stations along a pollution gradient in Goosefare Brook, a first-order coastal plain stream in southern Maine (USA). There was no significant effect on litter softening rate in 1997, and only the most polluted station showed a decrease in 1998. However, litter loss rates showed decreases in both years. The structure of invertebrate assemblages changed in response to the stresses, showing a decline in EPT richness and an increase in the proportion of collecting taxa. However, total shredder biomass was only weakly affected. Shredder biomass at all stations was dominated by Tipula, and biomass of other shredder taxa showed a serial replacement along the gradient of stress related to their pollution tolerance. Rather than the expected relationship with shredder biomass, litter processing rates were directly related to water and sediment quality. Goosefare Brook demonstrates how variable pollution tolerance of community members enables stress resistance and a consequent preservation of ecosystem function. - Variable pollution tolerance of community members provides stress resistance at the ecosystem level in streams

  13. Accumulation of three different sizes of particulate matter on plant leaf surfaces: Effect on leaf traits

    Directory of Open Access Journals (Sweden)

    Chen Xiaoping

    2015-01-01

    Full Text Available Plants not only improve air quality by adsorbing particulate matter (PM on leaf surfaces but can also be affected by their accumulation. In this study, a field investigation was performed in Wuhan, China, into the relationship between seven leaf traits and the accumulation of three different sizes of PM (PM11, PM2.5 and PM0.2 on leaves. The retention abilities of plant leaves with respect to the three sizes of PM differed significantly at different sites and species. The average PM retention capabilities of plant leaves and specific leaf area (SLA were significantly greater in a seriously polluted area, whereas the average values of chlorophyll a (Chl a, chlorophyll b (Chl b, total chlorophyll, carotenoid, pH and relative water content (RWC were greater at the control site. SLA significantly positively correlated with the size of PM, but Chl a, Chl b, total chlorophyll, RWC significantly negatively correlated with the size of PM, whereas the pH did not correlate significantly with the the PM fractions. Additionally, SLA was found to be affected by large particles (PM11, p<0.01; PM2.5 had a more obvious effect on plant leaf traits than the other PM (p<0.05. Overall, the findings from this study provide useful information regarding the selection of plants to reduce atmospheric pollution.

  14. (TECTONA GRANDIS LEAF POWDER

    Directory of Open Access Journals (Sweden)

    Yash Mishra

    2015-01-01

    Full Text Available In this study, the adsorption potential of Teak (Tectona grandis leaf powder (TLP toremove Methylene blue (MB and Malachite Green (MG dye molecules from aqueoussolution was investigated. Batch experiments were conducted to evaluate the influenceof operational parameters such as, pH (2−9, adsorbent dosage (1−7 g/L, contact time(15−150 minutes and initial dye concentration (20−120 mg/L at stirring speed of 150rpm for the adsorption of MB and MG on TLP. Maximum removal efficiency of 98.4%and 95.1% was achieved for MB and MG dye, respectively. The experimentalequilibrium data were analysed using Langmuir, Freundlich and Temkin isothermmodels and it was found that, it fitted well to the Freundlich isotherm model. Thesurface structure and morphology of the adsorbent was characterized using scanningelectron microscopy (SEM and the presence of functional groups and its interactionwith the dye molecules were analysed using Fourier transform infrared spectroscopy(FTIR. Based on the investigation, it has been demonstrated that the teak leaf powderhas good potential for effective adsorption of methylene blue and malachite green dye.

  15. Distribution of Serum Total Homocysteine and Its Association with Diabetes and Cardiovascular Risk Factors of the Insulin Resistance Syndrome in Mexican American Men: The Third National Health and Nutrition Examination Survey

    Directory of Open Access Journals (Sweden)

    Gillum Richard

    2003-08-01

    Full Text Available Abstract Background Few data have been published on the association of variables of the insulin resistance syndrome and serum total homocysteine (tHcy, a putative risk factor for cardiovascular morbidity, in representative samples of total populations or in Hispanic Americans. Methods To describe the distributions of serum tHcy concentration and variables associated with insulin resistance in Mexican American men and to assess their association, data from a cross-sectional survey of a large national sample, the Third National Health and Nutrition Examination Survey were analyzed. Analyses were restricted to Mexican American men aged 40–74 years with data on glycated hemoglobin (%, body mass index (BMI, body fat distribution, HDL cholesterol, fasting serum insulin, serum triglycerides and serum tHcy concentrations. Results Cumulative distributions of serum tHcy shifted to the right with increasing age. Log serum tHcy was not associated with prevalence of diagnosed diabetes mellitus or glycated hemoglobin percent or other risk factors other than age. Log serum tHcy concentration showed borderline significant (p = 0.049 positive association with fasting serum insulin concentration independent of age and BMI, only in men aged 60–74. Conclusion No consistent association of tHcy with diabetes prevalence or variables of the insulin resistance syndrome were found in Mexican American men aged 40–74 years. Further research is needed on the associations of serum tHcy concentration with insulin resistance and other components of the insulin resistance syndrome in persons of varying ethnicity.

  16. Extraction of antioxidant pigments from dye sorghum leaf sheaths

    NARCIS (Netherlands)

    Kayode, A.P.P.; Bara, C.A.; Dalode-Vieira, G.; Linnemann, A.R.; Nout, M.J.R.

    2012-01-01

    Extraction of antioxidant biocolorant pigments from leaf sheaths of dye sorghum was optimized. Effects of temperature and ethanol concentration of the extraction solvent on the concentrations of the 3-deoxyanthocyanidins, total phenolics and total anthocyanins, and the colour parameters of the

  17. Effect of subchronic administration of ethanolic leaf extract of croton ...

    African Journals Online (AJOL)

    The biochemical effcts of ethanolic leaf extract of Croton zambesicus on serum alkaline phosphatase(SAP),aspartate aminotransferase (AST) ,alanine aminotransferase(ALT),serum total protein and albumin were studied.The levels of these enzymes and that of total protein and albumin in the extract treated rats were not ...

  18. Effects of combination of leaf resources on competition in container mosquito larvae.

    Science.gov (United States)

    Reiskind, M H; Zarrabi, A A; Lounibos, L P

    2012-08-01

    Resource diversity is critical to fitness in many insect species, and may determine the coexistence of competitive species and the function of ecosystems. Plant material provides the nutritional base for numerous aquatic systems, yet the consequences of diversity of plant material have not been studied in aquatic container systems important for the production of mosquitoes. To address how diversity in leaf detritus affects container-inhabiting mosquitoes, we examined how leaf species affect competition between two container inhabiting mosquito larvae, Aedes aegypti and Aedes albopictus, that co-occur in many parts of the world. We tested the hypotheses that leaf species changes the outcome of intra- and interspecific competition between these mosquito species, and that combinations of leaf species affect competition in a manner not predictable based upon the response to each leaf species alone (i.e. the response to leaf combinations is non-additive). We find support for our first hypothesis that leaf species can affect competition, evidence that, in general, leaf combination alters competitive interactions, and no support that leaf combination impacts interspecific competition differently than intraspecific competition. We conclude that combinations of leaves increase mosquito production non-additively such that combinations of leaves act synergistically, in general, and result in higher total yield of adult mosquitoes in most cases, although certain leaf combinations for A. albopictus are antagonistic. We also conclude that leaf diversity does not have a different effect on interspecific competition between A. aegypti and A. albopictus, relative to intraspecific competition for each mosquito.

  19. Total hip prosthesis complication, periprosthetic infection with external fistulizing due to Enterobacter cloacae complex multiple drugs resistance: A clinical case report

    Directory of Open Access Journals (Sweden)

    V. Amorese

    2017-01-01

    Conclusion: The patient was hospitalized in our facility and 2 months later she underwent another operation to remove the antibiotic spacer and to place a new total hip arthroprosthesis. Multiple swabs showed the complete healing from the infection, which was confirmed a couple of months later.

  20. Tolerance of Glyphosate-Resistant Maize to Glyphosate Plus MCPA Amine Is Influenced by Dose and Timing

    Directory of Open Access Journals (Sweden)

    Nader Soltani

    2015-01-01

    Full Text Available There is little information on tolerance of glyphosate-resistant maize to glyphosate plus MCPA amine as influenced by dose and timing under Ontario environmental conditions. A total of seven field trials were conducted at various locations in Ontario, Canada, in 2011–2013 to evaluate tolerance of field maize to tank mixes of glyphosate (900 g a.e./ha plus MCPA amine (79, 158, 315, 630, 1260, 2520, or 5040 g a.e./ha at either the 4- or 8-leaf stage. The predicted dose of MCPA amine that caused 5, 10, and 20% injury was 339, 751, and 1914 g a.e./ha when applied to 4-leaf maize but only 64, 140, and 344 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% reduction in shoot dry weight of maize was 488, 844, and 1971 g a.e./ha when applied to 4-leaf maize and only 14, 136, and 616 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% yield reduction was 2557, 4247, and >5040 g a.e./ha when applied to 4-leaf maize and 184, 441, and 1245 g a.e./ha when applied to 8-leaf maize, respectively. Based on these results, glyphosate plus MCPA amine applied at the manufacturer’s recommended dose of 630 g a.e./ha applied to 4-leaf maize has potential to cause injury but the injury is transient with no significant reduction in yield. However, when glyphosate plus MCPA amine is applied to 8-leaf maize it has the potential to cause significant injury and yield loss in maize.

  1. Evaluation of cost-effective total nucleic acids extraction protocols for cultured Mycobacterium tuberculosis; a comparison by PCR amplification of genes associated with drug resistance

    Directory of Open Access Journals (Sweden)

    Gyamfi Oti K

    2010-02-01

    Full Text Available Abstract Background The emergence of drug resistant strains of Mycobacterium tuberculosis complex has made the management of tuberculosis difficult. Also, Mycobacterium species has a peculiar cell wall, made of an impermeable complex structure rich in mycolate, making the lyses of its cell difficult. In order to apply a radio-labelled-probe based detection of mutations in selected genes leading to drug resistance, we concede that the evaluation and modifications of nucleic acid extraction protocols that are less sophisticated and less prone to contamination would be useful in the management of tuberculosis in a resource-constrained setting. Findings The average amount of nucleic acids was determined for different extraction treatments. High temperature treatment only, yielded the lowest amount of nucleic acids, i.e. 15.7 ± 3.2 μg. The average amount of nucleic acids obtained with the addition of TE and triton-X100, was 133.7 ± 8.9 μg, while that obtained with the addition of TE only, and TE and SDS were 68.4 ± 22.7 μg and 70.4 ± 20.3 μg respectively. Other treatments yielded 28.8 ± 6.7 μg, 32.5 ± 2.4 μg and 36.9 ± 15.5 μg. The average amount of nucleic acids obtained with high temperature treatment in TE, and that obtained by freezing prior to high temperature treatment, successfully amplified for the genes of interest (rpoB, KatG, rrs. Conclusion We strongly recommend the use of 1× TE buffer, and freezing and heating for improved lysis of cultured M. tuberculosis, and therefore, as an effective method for the preparation of M. tuberculosis nucleic acid useful for PCR.

  2. Total algorithms

    NARCIS (Netherlands)

    Tel, G.

    We define the notion of total algorithms for networks of processes. A total algorithm enforces that a "decision" is taken by a subset of the processes, and that participation of all processes is required to reach this decision. Total algorithms are an important building block in the design of

  3. An analytical approach for optimizing the leaf design of a multi-leaf collimator in a linear accelerator

    International Nuclear Information System (INIS)

    Topolnjak, R; Heide, U A van der

    2008-01-01

    In this study, we present an analytical approach for optimizing the leaf design of a multi-leaf collimator (MLC) in a linear accelerator. Because leaf designs vary between vendors, our goal is to characterize and quantify the effects of different compromises which have to be made between performance parameters. Subsequently, an optimal leaf design for an earlier proposed six-bank MLC which combines a high-resolution field-shaping ability with a large field size is determined. To this end a model of the linac is created that includes the following parameters: the source size, the maximum field size, the distance between source and isocenter, and the leaf's design parameters. First, the optimal radius of the leaf tip was found. This optimum was defined by the requirement that the fluence intensity should fall from 80% of the maximum value to 20% in a minimal distance, defining the width of the fluence penumbra. A second requirement was that this penumbra width should be constant when a leaf moves from one side of the field to the other. The geometric, transmission and total penumbra width (80-20%) were calculated depending on the design parameters. The analytical model is in agreement with Elekta, Varian and Siemens collimator designs. For leaves thinner than 4 cm, the transmission penumbra becomes dominant, and for leaves close to the source the geometric penumbra plays a role. Finally, by choosing the leaf thickness of 3.5 cm, 4 cm and 5 cm from the lowest to the highest bank, respectively, an optimal leaf design for a six-bank MLC is achieved

  4. The effects of synbiotic supplementation on insulin resistance/sensitivity, lipid profile and total antioxidant capacity in women with gestational diabetes mellitus: A randomized double blind placebo controlled clinical trial.

    Science.gov (United States)

    Nabhani, Zohoor; Hezaveh, Seyed Jamal Ghaemmaghami; Razmpoosh, Elham; Asghari-Jafarabadi, Mohammad; Gargari, Bahram Pourghassem

    2018-04-01

    The role of gut microbiota in the management of diabetes is shown. In this randomized clinical trial we assessed the effects of synbiotic supplementation on insulin, lipid profile and antioxidative status among women with gestational diabetes mellitus (GDM). Ninety pregnant women with GDM were randomly assigned into two groups to receive either a daily synbiotic capsule - consisting of L. acidophilus, L. plantarum, L. fermentum, L. gasseri (1.5-7.0 × 10 9-10  CFU/g) - with fructooligosaccharide (38.5 mg), or placebo for 6 weeks. Fasting plasma glucose (FPG), insulin, homeostasis model assessment-insulin resistance (HOMA-IR), quantitative insulin sensitivity check index (QUICKI), high- and low density lipoprotein cholesterol (HDL-C, LDL-C), total cholesterol (TC), triglycerides (TG), total antioxidant capacity (TAC), and systolic and diastolic blood pressure (SBP, DSP) were assessed before and after the intervention. No significant changes in FPG, insulin resistance/sensitivity, lipid profile and TAC indices were seen in synbiotic group compared to the placebo one (p > 0.05). Significant within group increases for HDL-C and TAC levels in synbiotic group were observed (p insulin resistance/sensitivity indices. Lipid profile and TAC status may be affected by synbiotic supplementation. Synbiotic is effective in reducing of blood pressure in women with GDM. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Hydraulic resistance of biofilms

    KAUST Repository

    Dreszer, C.; Vrouwenvelder, Johannes S.; Paulitsch-Fuchs, Astrid H.; Zwijnenburg, Arie; Kruithof, Joop C.; Flemming, Hans Curt

    2013-01-01

    resistance is very low compared to the expected biofilm resistance and, thus, biofilm resistance can be determined accurately. Transmembrane pressure drop was monitored. As biofilm parameters, thickness, total cell number, TOC, and extracellular polymeric

  6. Seleção de linhagens de feijão rosinha de boa cocção, resistentes à antracnose e mancha angular Selection of pink grain common bean lines with good cooking ability, resistance to anthracnose and angular leaf spot

    Directory of Open Access Journals (Sweden)

    Diego Velásquez Faleiro e Silva

    2009-09-01

    Full Text Available Cultivares de feijoeiro com grão rosinha foram de grande importância, no passado, e ainda hoje, mesmo com a preferência pelo grão carioca, há nichos de mercado para feijões do grupo Rosinha. Dessa forma, o objetivo do trabalho foi selecionar linhagens de feijoeiro comum com grão rosinha, alta produção de grãos, rápido cozimento e resistentes à antracnose e à mancha angular. A partir de cinco famílias F8 superiores, provenientes do cruzamento entre os genitores Rosinha Maria da Fé e ESAL 693, foram extraídas 143 linhagens as quais foram avaliadas na safra das águas de 2005/2006 em Lavras (MG. Dessas, manteve-se 99 linhagens que foram avaliadas em Lavras e Lambari (MG, na safra da seca de 2006. As 24 linhagens selecionadas foram novamente avaliadas nos dois locais, no inverno de 2006. Os caracteres avaliados foram produção e tipo de grão, tempo de cocção, reação à mancha angular e também, foi realizado o teste de resistência ao patótipo 65 de Colletotrichum lindemuthianum. Nas linhagens, observaram-se variabilidade genética para todos os caracteres avaliados, altas estimativas dos coeficientes de herdabilidade, assegurando elevados ganhos com a seleção. Foram selecionadas quatro linhagens com alta produção, tipo de grão ideal, com rápido tempo de cocção e resistência à mancha angular e à antracnose.Common bean cultivars with pink grain type used to be very important, although there is still some market spot for them. The objective of the research was to select common bean lines with pink grain, high grain yield with good cooking ability, and resistance to anthracnose and angular leaf spot. One hundred and forty three lines were selected from five F8 segregant families derived from the cross Rosinha Maria da Fé x ESAL 693. Those lines were evaluated in the rainy season of 2005/2006 at Lavras county, MG State. Ninety nine lines were kept and tested in the dry season of 2006 at Lavras and Lambari. The 24

  7. Low Dose Total Body Irradiation Combined With Recombinant CD19-Ligand × Soluble TRAIL Fusion Protein is Highly Effective Against Radiation-resistant B-precursor Acute Lymphoblastic Leukemia in Mice

    Directory of Open Access Journals (Sweden)

    Fatih M. Uckun

    2015-04-01

    Full Text Available In high-risk remission B-precursor acute lymphoblastic leukemia (BPL patients, relapse rates have remained high post-hematopoietic stem cell transplantation (HSCT even after the use of very intensive total body irradiation (TBI-based conditioning regimens, especially in patients with a high “minimal residual disease” (MRD burden. New agents capable of killing radiation-resistant BPL cells and selectively augmenting their radiation sensitivity are therefore urgently needed. We report preclinical proof-of-principle that the potency of radiation therapy against BPL can be augmented by combining radiation with recombinant human CD19-Ligand × soluble TRAIL (“CD19L–sTRAIL” fusion protein. CD19L–sTRAIL consistently killed radiation-resistant primary leukemia cells from BPL patients as well as BPL xenograft cells and their leukemia-initiating in vivo clonogenic fraction. Low dose total body irradiation (TBI combined with CD19L–sTRAIL was highly effective against (1 xenografted CD19+ radiochemotherapy-resistant human BPL in NOD/SCID (NS mice challenged with an otherwise invariably fatal dose of xenograft cells derived from relapsed BPL patients as well as (2 radiation-resistant advanced stage CD19+ murine BPL with lymphomatous features in CD22ΔE12xBCR-ABL double transgenic mice. We hypothesize that the incorporation of CD19L–sTRAIL into the pre-transplant TBI regimens of patients with very high-risk BPL will improve their survival outcome after HSCT.

  8. Socioeconomic and hygienic aspects of nutrition correction and water supply in order to improve total resistance and reduce the risk of radiation carcinogenesis

    International Nuclear Information System (INIS)

    Knizhnikov, V.A.; Shandala, N.K.; Komleva, V.A.; Tutel'yan, V.A.

    1995-01-01

    The authors have experimentally demonstrated that selenium deficit in the dies of the population the Russian Federation increases the risk of cancer similarly as total irradiation dose equal to 200 sZv, that is, much more than the doses of irradiation of the population after the Chernobyl power plant accident. Artificial enrichment of diets for selenium helps reduce the risk of death from leukemia and cancer by 5 up to times. Combinations of trace elements and vitamins may bring about a still better effect. The authors discuss nutrition correction and its economic and social validity. 6 refs.; 3 tabs

  9. Working Towards Disease Resistance in Peanuts Through Biotechnology

    Science.gov (United States)

    Resistant cultivars are the most desirable approach to disease control in agriculture. Early and late leaf spot are the most important foliar diseases of peanut worldwide. Significant progress for leaf spot resistance in peanut can be achieved through biotechnology. The National Peanut Research ...

  10. Maize YABBY genes drooping leaf1 and drooping leaf2 affect agronomic traits by regulating leaf architecture

    Science.gov (United States)

    Leaf architectural traits, such as length, width and angle, directly influence canopy structure and light penetration, photosynthate production and overall yield. We discovered and characterized a maize (Zea mays) mutant with aberrant leaf architecture we named drooping leaf1 (drl1), as leaf blades ...

  11. A finger leaf design for dual layer MLCs

    International Nuclear Information System (INIS)

    Cui Weijie; Dai Jianrong

    2010-01-01

    Objective: To introduce a finger leaf design that is applied to dual layer MLCs. Methods: An optimization model was firstly constructed to describe the problem of determining leaf end shapes,and the corresponding problems were then solved by the simplex search method or the simulated annealing technique. Optimal parameters for arc shapes of leaf end projections were obtained, and a comparison was done between optimized MLCs and conventional MLCs in terms of field conformity. The optimization process was based on 634 target fields selected from the patient data base of a treatment planning system. Areas of these fields ranged from 20.0 to 602.7 cm with a mean and its standard deviation of (125.7 ± 0.0) cm 2 . Results: The optimized leaf end shapes projected to the isocenter plane were semicircles. With the finger leaf design, the total area of discrepancy regions between MLC fields and target fields was reduced by 32.3%. Conclusions: The finger leaf design improves the conformity of the MLC shaped fields to the desired target fields. (authors)

  12. Totally James

    Science.gov (United States)

    Owens, Tom

    2006-01-01

    This article presents an interview with James Howe, author of "The Misfits" and "Totally Joe". In this interview, Howe discusses tolerance, diversity and the parallels between his own life and his literature. Howe's four books in addition to "The Misfits" and "Totally Joe" and his list of recommended books with lesbian, gay, bisexual, transgender,…

  13. Antibacterial, Antibiofilm Effect of Burdock (Arctium lappa L.) Leaf Fraction and Its Efficiency in Meat Preservation.

    Science.gov (United States)

    Lou, Zaixiang; Li, Cheng; Kou, Xingran; Yu, Fuhao; Wang, Hongxin; Smith, Gary M; Zhu, Song

    2016-08-01

    First, the antibacterial, antibiofilm effect and chemical composition of burdock (Arctium lappa L.) leaf fractions were studied. Then, the efficiency of burdock leaf fractions in pork preservation was evaluated. The results showed that burdock leaf fraction significantly inhibited the growth and biofilm development of Escherichia coli and Salmonella Typhimurium. MICs of burdock leaf fractions on E. coli and Salmonella Typhimurium were both 2 mg/ml. At a concentration of 2.0 mg/ml, the inhibition rates of the fraction on growth and development of E. coli and Salmonella Typhimurium biofilms were 78.7 and 69.9%, respectively. During storage, the log CFU per gram of meat samples treated with burdock leaf fractions decreased 2.15, compared with the samples without treatment. The shelf life of pork treated with burdock leaf fractions was extended 6 days compared with the pork without treatment, and the sensory property was obviously improved. Compared with the control group, burdock leaf fraction treatment significantly decreased the total volatile basic nitrogen value and pH of the meat samples. Chemical composition analysis showed that the burdock leaf fraction consisted of chlorogenic acid, caffeic acid, p-coumaric acid, rutin, cynarin, crocin, luteolin, arctiin, and quercetin. As a vegetable with an abundant source, burdock leaf is safe, affordable, and efficient in meat preservation, indicating that burdock leaf fraction is a promising natural preservative for pork.

  14. Effect of Plant Growth Regulators on Leaf Number, Leaf Area and Leaf Dry Matter in Grape

    Directory of Open Access Journals (Sweden)

    Zahoor Ahmad BHAT

    2011-03-01

    Full Text Available Influence of phenylureas (CPPU and brassinosteriod (BR along with GA (gibberellic acid were studied on seedless grape vegetative characteristics like leaf number, leaf area and leaf dry matter. Growth regulators were sprayed on the vines either once (7 days after fruit set or 15 days after fruit set or twice (7+15 days after fruit set. CPPU 2 ppm+BR 0.4 ppm+GA 25 ppm produced maximum number of leaves (18.78 while as untreated vines produced least leaf number (16.22 per shoot. Maximum leaf area (129.70 cm2 and dry matter content (26.51% was obtained with higher CPPU (3 ppm and BR (0.4 ppm combination along with GA 25 ppm. Plant growth regulators whether naturally derived or synthetic are used to improve the productivity and quality of grapes. The relatively high value of grapes justifies more expensive inputs. A relatively small improvement in yield or fruit quality can justify the field application of a very costly product. Application of new generation growth regulators like brassinosteroids and phenylureas like CPPU have been reported to increase the leaf number as well as leaf area and dry matter thereby indirectly influencing the fruit yield and quality in grapes.

  15. Antibacterial and antioxidant activities of Vaccinium corymbosum L. leaf extract

    Directory of Open Access Journals (Sweden)

    Mehnaz Pervin

    2013-12-01

    Full Text Available Objective: To investigate antibacterial and antioxidant activity of the leaf extract of tropical medicinal herb and food plant Vaccinium corymbosum L. (V. corymbosum . Methods: Free radical scavenging activity on DPPH, ABTS, and nitrites were used to analyse phenolic and flavonoid contents of leaf extract. Other focuses included the determination of antioxidant enzymatic activity (SOD, CAT and GPx, metal chelating activity, reduction power, lipid peroxidation inhibition and the prevention of oxidative DNA damage. Antibacterial activity was determined by using disc diffusion method against seven strains of bacteria. Results: Results found that V. corymbosum leaf extract had significant antibacterial activity. The tested extract displayed the highest activity (about 23.18 mm inhibition zone against Salmonella typhymurium and the lowest antibacterial activity was observed against Enterococcus faecalis (about 14.08 mm inhibition zone at 10 mg/ disc. The IC 50 values for DPPH, ABTS and radical scavenging activity were 0.120, 0.049 and 1.160 mg/mL, respectively. V. corymbosum leaf extract also showed dose dependent reduction power, lipid peroxidation, DNA damage prevention and significant antioxidant enzymatic activity. Conclusions: These findings demonstrate that leaf extract of V. corymbosum could be used as an alternative therapy for antibiotic-resistant bacteria and help prevent various free radical related diseases.

  16. Antibacterial and antioxidant activities of Vaccinium corymbosum L. leaf extract

    Science.gov (United States)

    Pervin, Mehnaz; Hasnat, Md Abul; Lim, Beong Ou

    2013-01-01

    Objective To investigate antibacterial and antioxidant activity of the leaf extract of tropical medicinal herb and food plant Vaccinium corymbosum L. (V. corymbosum). Methods Free radical scavenging activity on DPPH, ABTS, and nitrites were used to analyse phenoic and flavonoid contents of leaf extract. Other focuses included the determination of antioxidant enzymatic activity (SOD, CAT and GPx), metal chelating activity, reduction power, lipid peroxidation inhibition and the prevention of oxidative DNA damage. Antibacterial activity was determined by using disc diffusion for seven strains of bacteria. Results Results found that V. corymbosum leaf extract had significant antibacterial activity. The tested extract displayed the highest activity (about 23.18 mm inhibition zone) against Salmonella typhymurium and the lowest antibacterial activity was observed against Enterococcus faecalis (about 14.08 mm inhibition zone) at 10 mg/ disc. The IC50 values for DPPH, ABTS and radical scavenging activity were 0.120, 0.049 and 1.160 mg/mL, respectively. V. corymbosum leaf extract also showed dose dependent reduction power, lipid peroxidation, DNA damage prevention and significant antioxidant enzymatic activity. Conclusions These findings demonstrate that leaf extract of V. corymbosum could be used as an alternative therapy for antibiotic-resistant bacteria and help prevent various free radical related diseases.

  17. Effect of progressive drought stress on growth, leaf gas exchange, and antioxidant production in two maize cultivars.

    Science.gov (United States)

    Anjum, Shakeel Ahmad; Tanveer, Mohsin; Ashraf, Umair; Hussain, Saddam; Shahzad, Babar; Khan, Imran; Wang, Longchang

    2016-09-01

    Drought stress is one of the major environmental factors responsible for reduction in crop productivity. In the present study, responses of two maize cultivars (Rung Nong 35 and Dong Dan 80) were examined to explicate the growth, yield, leaf gas exchange, leaf water contents, osmolyte accumulation, membrane lipid peroxidation, and antioxidant activity under progressive drought stress. Maize cultivars were subjected to varying field capacities (FC) viz., well-watered (80 % FC) and drought-stressed (35 % FC) at 45 days after sowing. The effects of drought stress were analyzed at 5, 10, 15, 20, ad 25 days after drought stress (DAS) imposition. Under prolonged drought stress, Rung Nong 35 exhibited higher reduction in growth and yield as compared to Dong Dan 80. Maize cultivar Dong Dan 80 showed higher leaf relative water content (RWC), free proline, and total carbohydrate accumulation than Run Nong 35. Malondialdehyde (MDA) and superoxide anion were increased with prolongation of drought stress, with higher rates in cultivar Run Nong 35 than cultivar Dong Dan 80. Higher production of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) and glutathione reductase (GR) resulted in improved growth and yield in Dong Dan 80. Overall, the cultivar Dong Dan 80 was better able to resist the detrimental effects of progressive drought stress as indicated by better growth and yield due to higher antioxidant enzymes, reduced lipid peroxidation, better accumulation of osmolytes, and maintenance of tissue water contents.

  18. The grapevine root-specific aquaporin VvPIP2;4N controls root hydraulic conductance and leaf gas exchange under well-watered conditions but not under water stress.

    Science.gov (United States)

    Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio

    2012-10-01

    We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.

  19. Evaluation of banana hybrids for tolerance to black leaf streak (Mycosphaerella fijiensis Morelet) in Puerto Rico

    Science.gov (United States)

    In Puerto Rico, bananas (including plantains) are important agricultural commodities; their combined production totaled 133,500 tons in 2008. Black leaf streak (BLS) and Sigatoka leaf spot diseases, caused by Mycosphaerella fijiensis and M. musicola, respectively, are responsible for significant los...

  20. The leaf size-twig size spectrum in evergreen broadleaved forest of ...

    African Journals Online (AJOL)

    Compared to deciduous broad-leaved species, the evergreen broad-leaved species were smaller in total leaf area for a given cross-sectional area or stem mass. This suggests that the species would support less leaf area at a given twig cross-sectional area with increasing environmental stress. And the life form can modify ...

  1. Estimating leaf photosynthetic pigments information by stepwise multiple linear regression analysis and a leaf optical model

    Science.gov (United States)

    Liu, Pudong; Shi, Runhe; Wang, Hong; Bai, Kaixu; Gao, Wei

    2014-10-01

    Leaf pigments are key elements for plant photosynthesis and growth. Traditional manual sampling of these pigments is labor-intensive and costly, which also has the difficulty in capturing their temporal and spatial characteristics. The aim of this work is to estimate photosynthetic pigments at large scale by remote sensing. For this purpose, inverse model were proposed with the aid of stepwise multiple linear regression (SMLR) analysis. Furthermore, a leaf radiative transfer model (i.e. PROSPECT model) was employed to simulate the leaf reflectance where wavelength varies from 400 to 780 nm at 1 nm interval, and then these values were treated as the data from remote sensing observations. Meanwhile, simulated chlorophyll concentration (Cab), carotenoid concentration (Car) and their ratio (Cab/Car) were taken as target to build the regression model respectively. In this study, a total of 4000 samples were simulated via PROSPECT with different Cab, Car and leaf mesophyll structures as 70% of these samples were applied for training while the last 30% for model validation. Reflectance (r) and its mathematic transformations (1/r and log (1/r)) were all employed to build regression model respectively. Results showed fair agreements between pigments and simulated reflectance with all adjusted coefficients of determination (R2) larger than 0.8 as 6 wavebands were selected to build the SMLR model. The largest value of R2 for Cab, Car and Cab/Car are 0.8845, 0.876 and 0.8765, respectively. Meanwhile, mathematic transformations of reflectance showed little influence on regression accuracy. We concluded that it was feasible to estimate the chlorophyll and carotenoids and their ratio based on statistical model with leaf reflectance data.

  2. Resistance to mycobacteria in mice treated with fractionated total lymphoid irradiation (TLI) and in mice reconstituted with allogeneic bone marrow cells following radiotherapy

    International Nuclear Information System (INIS)

    Mor, N.; Lutsky, I.; Weiss, L.; Morecki, S.; Slavin, S.

    1985-01-01

    The increased clinical use of total lymphoid irradiation (TLI) as an immunosuppressive adjunct in transplantation suggested the need for determining the effects of TLI on the in vivo susceptibility of animals to infections controlled by cell-mediated immunity. TLI-treated, TLI-treated and splenectomized, and chimeric mice prepared with TLI were inoculated in the hind foot pad with Mycobacterium marinum or Mycobacterium leprae. Although M. marinum organisms multiplied in greater numbers in the TLI mice, ultimately they were destroyed as effectively in TLI mice as in the non-irradiated control mice. M. leprae multiplied at the same rate and to the same maximum in TLI mice as in controls. Mice previously challenged with M. marinum in one hind foot pad, and challenged subsequently with the same organism in the opposite hind foot pad, showed a solid immunity against this reinfection. It appears that upon recovery from the immediate effects of radiotherapy TLI-treated mice are able to mount an effective immune response to experimental infection with M. marinum and M. leprae

  3. Resistance to mycobacteria in mice treated with fractionated total lymphoid irradiation (TLI) and in mice reconstituted with allogeneic bone marrow cells following radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Mor, N.; Lutsky, I.; Weiss, L.; Morecki, S.; Slavin, S.

    1985-01-01

    The increased clinical use of total lymphoid irradiation (TLI) as an immunosuppressive adjunct in transplantation suggested the need for determining the effects of TLI on the in vivo susceptibility of animals to infections controlled by cell-mediated immunity. TLI-treated, TLI-treated and splenectomized, and chimeric mice prepared with TLI were inoculated in the hind foot pad with Mycobacterium marinum or Mycobacterium leprae. Although M. marinum organisms multiplied in greater numbers in the TLI mice, ultimately they were destroyed as effectively in TLI mice as in the non-irradiated control mice. M. leprae multiplied at the same rate and to the same maximum in TLI mice as in controls. Mice previously challenged with M. marinum in one hind foot pad, and challenged subsequently with the same organism in the opposite hind foot pad, showed a solid immunity against this reinfection. It appears that upon recovery from the immediate effects of radiotherapy TLI-treated mice are able to mount an effective immune response to experimental infection with M. marinum and M. leprae.

  4. Seasonal patterns of leaf gas exchange and water relations in dry rain forest trees of contrasting leaf phenology.

    Science.gov (United States)

    Choat, Brendan; Ball, Marilyn C; Luly, Jon G; Donnelly, Christine F; Holtum, Joseph A M

    2006-05-01

    Diurnal and seasonal patterns of leaf gas exchange and water relations were examined in tree species of contrasting leaf phenology growing in a seasonally dry tropical rain forest in north-eastern Australia. Two drought-deciduous species, Brachychiton australis (Schott and Endl.) A. Terracc. and Cochlospermum gillivraei Benth., and two evergreen species, Alphitonia excelsa (Fenzal) Benth. and Austromyrtus bidwillii (Benth.) Burret. were studied. The deciduous species had higher specific leaf areas and maximum photosynthetic rates per leaf dry mass in the wet season than the evergreens. During the transition from wet season to dry season, total canopy area was reduced by 70-90% in the deciduous species and stomatal conductance (g(s)) and assimilation rate (A) were markedly lower in the remaining leaves. Deciduous species maintained daytime leaf water potentials (Psi(L)) at close to or above wet season values by a combination of stomatal regulation and reduction in leaf area. Thus, the timing of leaf drop in deciduous species was not associated with large negative values of daytime Psi(L) (greater than -1.6 MPa) or predawn Psi(L) (greater than -1.0 MPa). The deciduous species appeared sensitive to small perturbations in soil and leaf water status that signalled the onset of drought. The evergreen species were less sensitive to the onset of drought and g(s) values were not significantly lower during the transitional period. In the dry season, the evergreen species maintained their canopies despite increasing water-stress; however, unlike Eucalyptus species from northern Australian savannas, A and g(s) were significantly lower than wet season values.

  5. A specific PCR-assay for resistance to Biotypes 1 and 2 of the rosy leaf curling aphid in apple based on an RFLP marker closely linked to the Sd1 gene

    NARCIS (Netherlands)

    Roche, P.; Arkel, van G.; Heusden, van A.W.

    1997-01-01

    This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this

  6. Why do leaf-tying caterpillars abandon their leaf ties?

    Directory of Open Access Journals (Sweden)

    Michelle Sliwinski

    2013-09-01

    Full Text Available Leaf-tying caterpillars act as ecosystem engineers by building shelters between overlapping leaves, which are inhabited by other arthropods. Leaf-tiers have been observed to leave their ties and create new shelters (and thus additional microhabitats, but the ecological factors affecting shelter fidelity are poorly known. For this study, we explored the effects of resource limitation and occupant density on shelter fidelity and assessed the consequences of shelter abandonment. We first quantified the area of leaf material required for a caterpillar to fully develop for two of the most common leaf-tiers that feed on white oak, Quercus alba. On average, Psilocorsis spp. caterpillars consumed 21.65 ± 0.67 cm2 leaf material to complete development. We also measured the area of natural leaf ties found in a Maryland forest, to determine the distribution of resources available to caterpillars in situ. Of 158 natural leaf ties examined, 47% were too small to sustain an average Psilocorsis spp. caterpillar for the entirety of its development. We also manipulated caterpillar densities within experimental ties on potted trees to determine the effects of cohabitants on the likelihood of a caterpillar to leave its tie. We placed 1, 2, or 4 caterpillars in ties of a standard size and monitored the caterpillars twice daily to track their movement. In ties with more than one occupant, caterpillars showed a significantly greater propensity to leave their tie, and left sooner and at a faster rate than those in ties as single occupants. To understand the consequences of leaf tie abandonment, we observed caterpillars searching a tree for a site to build a shelter in the field. This is a risky behavior, as 17% of the caterpillars observed died while searching for a shelter site. Caterpillars that successfully built a shelter traveled 110 ± 20 cm and took 28 ± 7 min to find a suitable site to build a shelter. In conclusion, leaf-tying caterpillars must frequently

  7. Agave Americana Leaf Fibers

    Directory of Open Access Journals (Sweden)

    Ashish Hulle

    2015-02-01

    Full Text Available The growing environmental problems, the problem of waste disposal and the depletion of non-renewable resources have stimulated the use of green materials compatible with the environment to reduce environmental impacts. Therefore, there is a need to design products by using natural resources. Natural fibers seem to be a good alternative since they are abundantly available and there are a number of possibilities to use all the components of a fiber-yielding crop; one such fiber-yielding plant is Agave Americana. The leaves of this plant yield fibers and all the parts of this plant can be utilized in many applications. The “zero-waste” utilization of the plant would enable its production and processing to be translated into a viable and sustainable industry. Agave Americana fibers are characterized by low density, high tenacity and high moisture absorbency in comparison with other leaf fibers. These fibers are long and biodegradable. Therefore, we can look this fiber as a sustainable resource for manufacturing and technical applications. Detailed discussion is carried out on extraction, characterization and applications of Agave Americana fiber in this paper.

  8. Wear resistant performance of highly cross-linked and annealed ultra-high molecular weight polyethylene against ceramic heads in total hip arthroplasty.

    Science.gov (United States)

    Sato, Taishi; Nakashima, Yasuharu; Akiyama, Mio; Yamamoto, Takuaki; Mawatari, Taro; Itokawa, Takashi; Ohishi, Masanobu; Motomura, Goro; Hirata, Masanobu; Iwamoto, Yukihide

    2012-12-01

    The purpose of this study was to examine the effects of ceramic femoral head material, size, and implantation periods on the wear of annealed, cross-linked ultra-high molecular weight polyethylene (UHMWPE) (XLPE) in total hip arthroplasty compared to non-cross-linked conventional UHMWPE (CPE). XLPE was fabricated by cross-linking with 60 kGy irradiation and annealing. Femoral heads made from zirconia and alumina ceramics and cobalt-chrome (CoCr) of 22 or 26 mm diameter were used. In this retrospective cohort study, the femoral head penetration into the cup was measured digitally on radiographs of 367 hips with XLPE and 64 hips with CPE. The average follow-up periods were 6.3 and 11.9 years, respectively. Both XLPE creep and wear rates were significantly lower than those of CPE (0.19 mm vs. 0.44 mm, 0.0001 mm/year vs. 0.09 mm/year, respectively). Zirconia displayed increased wear rates compared to alumina in CPE; however, there was no difference among head materials in XLPE (0.0008, 0.00007, and -0.009 mm/year for zirconia, alumina, and CoCr, respectively). Neither head size or implantation period impacted XLPE wear. In contrast to CPE, XLPE displayed low wear rates surpassing the effects of varying femoral head material, size, implantation period, and patient demographics. Further follow-up is required to determine the long-term clinical performance of the annealed XLPE. Copyright © 2012 Orthopaedic Research Society.

  9. Method of manufacturing leaf spring for PWR type reactor fuel assembly

    International Nuclear Information System (INIS)

    Yokoyama, Takashi; Mori, Kazuma.

    1991-01-01

    A leaf spring is manufactured by precision casting using corrosion resistant and heat resistant high strength steel material and, subsequently, the surface is treated with slight surface grinding or pickling. Further, for increasing resistance to stress corrosion cracks (SCC), shot blasting is applied to the surface. This reduces the surface roughness (Rmax) of the leaf spring to less than 0.005 mm, and the dimensional tolerance can be set to +0.005 mm, -0.0 mm. In this way, since the surface roughness is so small as not causing fabrication injury to the surface, the material has sufficient resistance to SCC. Further, since the accuracy for the plate thickness is high, stress distribution as designed can be attained to prevent stress concentration. Then, if a casting die is once prepared, the casting mass production is enabled to reduce the manufacturing cost for the leaf spring. (T.M.)

  10. Increasing Resistance of Coagulase-Negative Staphylococci in Total Hip Arthroplasty Infections: 278 THA-Revisions due to Infection Reported to the Norwegian Arthroplasty Register from 1993 to 2007

    Directory of Open Access Journals (Sweden)

    Olav Lutro

    2014-01-01

    Full Text Available We investigated bacterial findings from intraoperative tissue samples taken during revision due to infection after total hip arthroplasty (THA. The aim was to investigate whether the susceptibility patterns changed during the period from 1993 through 2007. Reported revisions due to infection in the Norwegian Arthroplasty Register (NAR were identified, and 10 representative hospitals in Norway were visited. All relevant information on patients reported to the NAR for a revision due to infection, including bacteriological findings, was collected from the medical records. A total of 278 revision surgeries with bacterial growth in more than 2 samples were identified and included. Differences between three 5-year time periods were tested by the chi-square test for linear trend. The most frequent isolates were coagulase-negative staphylococci (CoNS (41%, 113/278 and Staphylococcus aureus (19%, 53/278. The proportion of CoNS resistant to the methicillin-group increased from 57% (16/28 in the first period, 1993–1997, to 84% (52/62 in the last period, 2003–2007 (P = 0.003. There was also significant increase in resistance for CoNS to cotrimoxazole, quinolones, clindamycin, and macrolides. All S. aureus isolates were sensitive to both the methicillin-group and the aminoglycosides. For the other bacteria identified no changes in susceptibility patterns were found.

  11. Peach leaf responses to soil and cement dust pollution.

    Science.gov (United States)

    Maletsika, Persefoni A; Nanos, George D; Stavroulakis, George G

    2015-10-01

    Dust pollution can negatively affect plant productivity in hot, dry and with high irradiance areas during summer. Soil or cement dust were applied on peach trees growing in a Mediterranean area with the above climatic characteristics. Soil and cement dust accumulation onto the leaves decreased the photosynthetically active radiation (PAR) available to the leaves without causing any shade effect. Soil and mainly cement dust deposition onto the leaves decreased stomatal conductance, photosynthetic and transpiration rates, and water use efficiency due possibly to stomatal blockage and other leaf cellular effects. In early autumn, rain events removed soil dust and leaf functions partly recovered, while cement dust created a crust partially remaining onto the leaves and causing more permanent stress. Leaf characteristics were differentially affected by the two dusts studied due to their different hydraulic properties. Leaf total chlorophyll decreased and total phenol content increased with dust accumulation late in the summer compared to control leaves due to intense oxidative stress. The two dusts did not cause serious metal imbalances to the leaves, except of lower leaf K content.

  12. Serum total and bone alkaline phosphatase and tartrate-resistant acid phosphatase activities for the assessment of bone fracture healing in dogs

    Directory of Open Access Journals (Sweden)

    C. Sousa

    2011-08-01

    Full Text Available O objetivo deste trabalho foi estudar o padrão de variação da atividade sérica da fosfatase alcalina total (tALP, da isoenzima óssea da fosfatase alcalina (BALP e da fosfatase ácida resistente ao tartarato (TRAP, assim como a variação da concentração dos minerais séricos durante o processo de cicatrização de fraturas ósseas no cão. A variação sérica destes marcadores do metabolismo ósseo foi avaliada em nove cães com fraturas diafisárias fechadas de ossos longos, submetidas a tratamento cirúrgico para osteosíntese. Durante o período pós-operatório, sete animais evoluíram no sentido de uma normal união óssea, sendo que dois deles desenvolveram um processo de não união óssea. Foram observados, relativamente à BALP, valores de actividade sérica mais elevados e com diferença estatística (P<0,05 no grupo de animais que evoluiu no sentido de uma normal união óssea, comparativamente ao grupo de animais que evoluiu no sentido do processo de não união. No grupo de animais que evoluiu para a completa união óssea foram, adicionalmente, observados valores diminuidos (P<0,05 da atividade sérica da TRAP, até ao dia 60 do período pós-operatório seguido de uma elevação estatisticamente significativa após este período. Em conclusão, os biomarcadores do metabolismo ósseo poderão vir a constituir um método auxiliar de diagnóstico na monitorização do processo de cicatrização de fracturas ósseas, possibilitando, a detecção precoce de complicações pós-operatórias.

  13. Abrogation of bone marrow allograft resistance in mice by increased total body irradiation correlates with eradication of host clonable T cells and alloreactive cytotoxic precursors

    International Nuclear Information System (INIS)

    Schwartz, E.; Lapidot, T.; Gozes, D.; Singer, T.S.; Reisner, Y.

    1987-01-01

    Host-vs-graft activity presents a major obstacle for transplantation of T cell-depleted bone marrow in HLA-mismatched patients. In a primate model, conditioned exactly like leukemia patients, it was shown that residual host clonable T cells, as well as alloreactive cytotoxic precursors, were present in peripheral blood and spleen after completion of cytoreduction. We have now extended this study in a mouse model for allogeneic bone marrow transplantation. C 3 H/HeJ mice were treated by 9 Gy total body irradiation (TBI), and 24 hr later their spleen cells were cultured in the presence of T cell growth factor and phytohemagglutinin according to the limit dilution procedure. After 7 days of culture the average frequency of clonable cells was 2.5 X 10(-3) compared with 37 X 10(-3) in the spleens of normal mice. The T cell derivation of the growing cells was ascertained by complement-mediated cytotoxicity with anti-Thy-1 as well as with anti-Lyt-2 and anti-Ly-3T4. In parallel, we found that the initial engraftment rate of bone marrow allograft in mice given 9 Gy TBI was lower than that found in recipients of syngeneic marrow. The initial engraftment rate was measured by the number of colony-forming units in the spleen and by splenic uptake of 125 IUdR. A slight increase in TBI from 9 Gy to 11 Gy markedly reduced the difference in the number of spleen colony-forming units or the IUdR uptake between recipients of allogeneic and syngeneic bone marrow. This increase in TBI also coincided with eradication of detectable clonable T cells. Moreover, in mice transplanted with T cell-depleted bone marrow after 9 Gy TBI, we also demonstrate that cytotoxicity against donor-type target cells is present in the spleen 10 to 14 days posttransplantation, whereas in mice treated by 11 Gy TBI such alloreactivity could not be detected

  14. A Global Data Set of Leaf Photosynthetic Rates, Leaf N and P, and Specific Leaf Area

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: This global data set of photosynthetic rates and leaf nutrient traits was compiled from a comprehensive literature review. It includes estimates of Vcmax...

  15. A Global Data Set of Leaf Photosynthetic Rates, Leaf N and P, and Specific Leaf Area

    Data.gov (United States)

    National Aeronautics and Space Administration — This global data set of photosynthetic rates and leaf nutrient traits was compiled from a comprehensive literature review. It includes estimates of Vcmax (maximum...

  16. Induced mutation for disease resistance in rice with special reference to blast, bacterial blight and tungro

    International Nuclear Information System (INIS)

    Mathur, S.C.

    1983-01-01

    Rice varieties Ratna, Pusa 2-21, Vijaya and Pankaj have been treated with gamma rays, EMS or sodium azide to improve their resistance against blast, bacterial leaf blight or tungro virus. For blast and tungro, mutants with improved resistance were selected. Variation in reaction to bacterial leaf blight has been used in crossbreeding to accumulate genes for resistance. (author)

  17. Pretreatment of albino rats with aqueous leaf extract of Ziziphus ...

    African Journals Online (AJOL)

    Purpose: The effect of the aqueous extract of Ziziphus mauritiana leaf on hepatic lipid peroxidation, reduced glutathione and total antioxidant status was studied in chronic alcohol-induced liver damage. Method: Alcohol-induced liver toxicity was created by oral administration of 40% alcohol solution (v/v, 1ml/100g) to rats for ...

  18. Spectroscopic determination of leaf water content using linear ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-02-02

    Feb 2, 2012 ... characteristics, this study measured 33 groups of peach tree leaf ... spectral absorption values were obtained from a total of 33 groups of leaves .... using the trial and error method, based on the following empirical ... be used as indicators for evaluation of prediction models. .... Comparison of the methods of.

  19. Nutritional evaluation of bitter leaf meal ( Vernonia amygdalina ...

    African Journals Online (AJOL)

    Nutritional evaluation of bitter leaf meal ( Vernonia amygdalina ): effects on ... A total of 72 one-day-old broiler chicks of Abor-acre breed were used for the trial and ... reduced the level of cholesterol, triglyceride, glucose, low density lipoprotein, ...

  20. Sugarbeet leaf spot disease (Cercospora beticola Sacc.)dagger.

    Science.gov (United States)

    Weiland, John; Koch, Georg

    2004-05-01

    SUMMARY Leaf spot disease caused by Cercospora beticola Sacc. is the most destructive foliar pathogen of sugarbeet worldwide. In addition to reducing yield and quality of sugarbeet, the control of leaf spot disease by extensive fungicide application incurs added costs to producers and repeatedly has selected for fungicide-tolerant C. beticola strains. The genetics and biochemistry of virulence have been examined less for C. beticola as compared with the related fungi C. nicotianae, C. kikuchii and C. zeae-maydis, fungi to which the physiology of C. beticola is often compared. C. beticola populations generally are not characterized as having race structure, although a case of race-specific resistance in sugarbeet to C. beticola has been reported. Resistance currently implemented in the field is quantitatively inherited and exhibits low to medium heritability. Cercospora beticola Sacc.; Kingdom Fungi, Subdivision Deuteromycetes, Class Hyphomycetes, Order Hyphales, Genus Cercospora. Circular, brown to red delimited spots with ashen-grey centre, 0.5-6 mm diameter; dark brown to black stromata against grey background; pale brown unbranched sparingly septate conidiophores, hyaline acicular conidia, multiseptate, from 2.5 to 4 microm wide and 50-200 microm long. Propagative on Beta vulgaris and most species of Beta. Reported on members of the Chenopodiaceae and on Amaranthus. Disease symptoms: Infected leaves and petioles of B. vulgaris exhibit numerous circular leaf spots that coalesce in severe cases causing complete leaf collapse. Dark specks within a grey spot centre are characteristic for the disease. Older leaves exhibit a greater number of lesions with larger spot diameter. During the latter stage of severe epiphytotics, new leaf growth can be seen emerging from the plant surrounded by prostrate, collapsed leaves. Fungicides in the benzimidazole and triazole class as well as organotin derivatives and strobilurins have successfully been used to control Cercospora

  1. The invasive plant Alternanthera philoxeroides was suppressed more intensively than its native congener by a native generalist: implications for the biotic resistance hypothesis.

    Directory of Open Access Journals (Sweden)

    Shufeng Fan

    Full Text Available Prior studies on preferences of native herbivores for native or exotic plants have tested both the enemy release hypothesis and the biotic resistance hypothesis and have reported inconsistent results. The different levels of resistance of native and exotic plants to native herbivores could resolve this controversy, but little attention has been paid to this issue. In this study, we investigated population performance, photosynthesis, leaf nitrogen concentration, and the constitutive and induced resistances of the successful invasive plant, Alternanthera philoxeroides, and its native congener, Alternanthera sessilis, in the presence of three population densities of the grasshopper, Atractomorpha sinensis. When the grasshopper was absent, leaf biomass, total biomass, photosynthesis, and leaf nitrogen concentration of A. philoxeroides were higher than those of A. sessilis. However, the morphological and physiological performances of A. philoxeroides were all decreased more intensively than A. sessilis after herbivory by grasshoppers. Especially as the concentrations of constitutive lignin and cellulose in leaf of A. philoxeroides were higher than A. sessilis, A. philoxeroides exhibited increased leaf lignin concentration to reduce its palatability only at severe herbivore load, whereas, leaf lignin, cellulose, and polyphenolic concentrations of A. sessilis all increased with increasing herbivory pressure, and cellulose and polyphenolic concentrations were higher in A. sessilis than in A. philoxeroides after herbivory. Our study indicated that the capability of the invasive plant to respond to native insect damage was lower than the native plant, and the invasive plant was suppressed more intensively than its native congener by the native insect. Our results support the biotic resistance hypothesis and suggest that native herbivores can constrain the abundance and reduce the adverse effects of invasive species.

  2. How Does Temperature Impact Leaf Size and Shape in Four Woody Dicot Species? Testing the Assumptions of Leaf Physiognomy-Climate Models

    Science.gov (United States)

    McKee, M.; Royer, D. L.

    2017-12-01

    The physiognomy (size and shape) of fossilized leaves has been used to reconstruct the mean annual temperature of ancient environments. Colder temperatures often select for larger and more abundant leaf teeth—serrated edges on leaf margins—as well as a greater degree of leaf dissection. However, to be able to accurately predict paleotemperature from the morphology of fossilized leaves, leaves must be able to react quickly and in a predictable manner to changes in temperature. We examined the extent to which temperature affects leaf morphology in four tree species: Carpinus caroliniana, Acer negundo, Ilex opaca, and Ostrya virginiana. Saplings of these species were grown in two growth cabinets under contrasting temperatures (17 and 25 °C). Compared to the cool treatment, in the warm treatment Carpinus caroliniana leaves had significantly fewer leaf teeth and a lower ratio of total number of leaf teeth to internal perimeter; and Acer negundo leaves had a significantly lower feret diameter ratio (a measure of leaf dissection). In addition, a two-way ANOVA tested the influence of temperature and species on leaf physiognomy. This analysis revealed that all plants, regardless of species, tended to develop more highly dissected leaves with more leaf teeth in the cool treatment. Because the cabinets maintained equivalent moisture, humidity, and CO2 concentration between the two treatments, these results demonstrate that these species could rapidly adapt to changes in temperature. However, not all of the species reacted identically to temperature changes. For example, Acer negundo, Carpinus caroliniana, and Ostrya virginiana all had a higher number of total teeth in the cool treatment compared to the warm treatment, but the opposite was true for Ilex opaca. Our work questions a fundamental assumption common to all models predicting paleotemperature from the physiognomy of fossilized leaves: a given climate will inevitably select for the same leaf physiognomy

  3. Climatic Controls on Leaf Nitrogen Content and Implications for Biochemical Modeling.

    Science.gov (United States)

    Tcherednichenko, I. A.; White, M.; Bastidas, L.

    2007-12-01

    Leaf nitrogen (N) content, expressed as percent total nitrogen per unit of leaf dry mass, is a widely used parameter in biochemical modeling, due mainly to its role as a potentially limiting factor for photosynthesis. The amount of nitrogen, however, does not occur in a fixed amount in every leaf, but rather varies continuously with the leaf life cycle, in constant response to soil-root-stem-leaf-climate interactions and demand for growth. Moreover, while broad data on leaf N has become available it is normally measured under ambient conditions with consequent difficulty for distinguishing between genetic and time specific environmental effects. In the present work we: 1) Investigate the theoretical variation of leaf mass, specific heat capacity and leaf thickness of full sun-expanded leaves as a regulatory mechanism to ensure thermal survival along with long-term climatic radiation/temperature gradient; and discuss nitrogen and carbon controls on leaf thickness. 2) Based on possible states of partition between nitrogenous and non-nitrogenous components of a leaf we further derive probability density functions (PDFs) of nitrogen and carbon content and assess the effect of water and nutrient uptake on the PDFs. 3) Translate the results to spatially explicit representation over the conterminous USA at 1 km spatial resolution by providing maximum potential values of leaf N of fully expanded leaf optimally suited for long term climatic averages values and soils conditions. Implications for potential presence of inherently slow/fast growing species are discussed along with suitability of results for use by biochemical models.

  4. Occurrence of barley leaf disease and control strategies in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten

    Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...

  5. [Relationships among leaf traits and their expression in different vegetation zones in Yanhe River basin, Northwest China].

    Science.gov (United States)

    Guo, Ru; Wen, Zhong-ming; Wang, Hong-xia; Qi, De-hui

    2015-12-01

    This article selected zonal plant communities as the research objects in different vegetation zones in Yanhe River basin. We measured six leaf traits of the dominant species and main accompanying species in each community, and then analyzed the relationships and their changes along with environmental gradients between these traits in order to understand the plant adaptation strategies to the environment changes. The results showed that the specific leaf area was significantly negatively correlated to leaf tissue density, area-based leaf nitrogen and phosphorus concentrations, and significantly positively correlated to mass-based leaf phosphorus concentration. Both the scaling relationships among these traits and plant life strategies were different among the three vegetation zones, the scaling-dependent relationship between leaf tissue density and specific leaf area was stronger in steppe and forest-steppe zones than in forest zone, but the correlations among area-based leaf nitrogen/phosphorus concentrations and specific leaf area and leaf tissue density were more significant in forest zone than in steppe zone. In the arid grassland and forest-steppe zone, plants give priority to defensive and stress resistance strategies, and in relatively moist nutrient-rich forest zone, plants give priority to fast growth and resource optimization allocation strategies.

  6. Leaf structural characteristics are less important than leaf chemical properties in determining the response of leaf mass per area and photosynthesis of Eucalyptus saligna to industrial-age changes in [CO2] and temperature.

    Science.gov (United States)

    Xu, Cheng-Yuan; Salih, Anya; Ghannoum, Oula; Tissue, David T

    2012-10-01

    The rise in atmospheric [CO(2)] is associated with increasing air temperature. However, studies on plant responses to interactive effects of [CO(2)] and temperature are limited, particularly for leaf structural attributes. In this study, Eucalyptus saligna plants were grown in sun-lit glasshouses differing in [CO(2)] (290, 400, and 650 µmol mol(-1)) and temperature (26 °C and 30 °C). Leaf anatomy and chloroplast parameters were assessed with three-dimensional confocal microscopy, and the interactive effects of [CO(2)] and temperature were quantified. The relative influence of leaf structural attributes and chemical properties on the variation of leaf mass per area (LMA) and photosynthesis within these climate regimes was also determined. Leaf thickness and mesophyll size increased in higher [CO(2)] but decreased at the warmer temperature; no treatment interaction was observed. In pre-industrial [CO(2)], warming reduced chloroplast diameter without altering chloroplast number per cell, but the opposite pattern (reduced chloroplast number per cell and unchanged chloroplast diameter) was observed in both current and projected [CO(2)]. The variation of LMA was primarily explained by total non-structural carbohydrate (TNC) concentration rather than leaf thickness. Leaf photosynthetic capacity (light- and [CO(2)]-saturated rate at 28 °C) and light-saturated photosynthesis (under growth [CO(2)] and temperature) were primarily determined by leaf nitrogen contents, while secondarily affected by chloroplast gas exchange surface area and chloroplast number per cell, respectively. In conclusion, leaf structural attributes are less important than TNC and nitrogen in affecting LMA and photosynthesis responses to the studied climate regimes, indicating that leaf structural attributes have limited capacity to adjust these functional traits in a changing climate.

  7. 'Dangshansuli' pear leaf

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... metabolism of these two organic acids, including citrate synthase (CS), cytoplast aconitase ... malate dehydrogenase (MDH) (Miller et al., 1998), and ... a pH of 6.28, a soil organic matter content of 0.54% (w·w-1), a total.

  8. Biophysical control of leaf temperature

    Science.gov (United States)

    Dong, N.; Prentice, I. C.; Wright, I. J.

    2014-12-01

    In principle sunlit leaves can maintain their temperatures within a narrower range than ambient temperatures. This is an important and long-known (but now overlooked) prediction of energy balance theory. Net radiation at leaf surface in steady state (which is reached rapidly) must be equal to the combination of sensible and latent heat exchanges with surrounding air, the former being proportional to leaf-to-air temperature difference (ΔT), the latter to the transpiration rate. We present field measurements of ΔT which confirm the existence of a 'crossover temperature' in the 25-30˚C range for species in a tropical savanna and a tropical rainforest environment. This finding is consistent with a simple representation of transpiration as a function of net radiation and temperature (Priestley-Taylor relationship) assuming an entrainment factor (ω) somewhat greater than the canonical value of 0.26. The fact that leaves in tropical forests are typically cooler than surrounding air, often already by solar noon, is consistent with a recently published comparison of MODIS day-time land-surface temperatures with air temperatures. Theory further predicts a strong dependence of leaf size (which is inversely related to leaf boundary-layer conductance, and therefore to absolute magnitude of ΔT) on moisture availability. Theoretically, leaf size should be determined by either night-time constraints (risk of frost damage to active leaves) or day-time constraints (risk of heat stress damage),with the former likely to predominate - thereby restricting the occurrence of large leaves - at high latitudes. In low latitudes, daytime maximum leaf size is predicted to increase with temperature, provided that water is plentiful. If water is restricted, however, transpiration cannot proceed at the Priestley-Taylor rate, and it quickly becomes advantageous for plants to have small leaves, which do not heat up much above the temperature of their surroundings. The difference between leaf

  9. Waiting for the Leaf; Warten auf den Leaf

    Energy Technology Data Exchange (ETDEWEB)

    Wilms, Jan

    2012-01-15

    Nissan will be the first manufacturer to launch an electric vehicle of the VW Golf category in the German market. With a mileage of about 170 km and a roomy passenger compartment, the Leaf promises much comfort. In the US market, it was launched two years ago. Was it worth while waiting for?.

  10. Models for leaf area estimation in dwarf pigeon pea by leaf dimensions

    Directory of Open Access Journals (Sweden)

    Rafael Vieira Pezzini

    2018-03-01

    Full Text Available ABSTRACT This study aims to determine the most suitable model to estimate the leaf area of dwarf pigeon pea in function of the leaf central leaflet dimension. Six samplings of 200 leaves were performed in the first experiment, at 36, 42, 50, 56, 64, and 72 days after emergence (DAE. In the second experiment, seven samplings of 200 leaves were performed at 29, 36, 43, 49, 57, 65, and 70 DAE, totaling 2600 leaves. The length (L and width (W of the central leaflet were measured in all leaves composed by left, central, and right leaflets, the product of length times width (LW was calculated, and the leaf area (Y – sum of left, central, and right leaflet areas was determined by digital images. Linear, power, quadratic, and cubic models of Y as function of L, W, and LW were built using data from the second experiment. Leaves from the first experiment were used to validate the models. In dwarf pigeon pea, the linear (Ŷ = – 0.4088 + 1.6669x, R2 = 0.9790 is preferable, but power (Ŷ = 1.6097x1.0065, R2 = 0.9766, quadratic (Ŷ = – 0.3625 + 1.663x + 0.00007x2, R2 = 0.9790, and cubic (Ŷ = 0.7216 + 1.522x + 0.005x2 – 5E–05x3, R2 = 0.9791 models in function of LW are also suitable to estimate the leaf area obtained by digital images. The power model (Ŷ = 5.2508x1.7868, R2 = 0.95 based on the central leaflet width is less laborious because requires only one variable, but it presents accuracy reduction.

  11. Effect of nitrogen supply on leaf appearance, leaf growth, leaf nitrogen economy and photosynthetic capacity in maize (Zea mays L.)

    NARCIS (Netherlands)

    Vos, J.; Putten, van der P.E.L.; Birch, C.J.

    2005-01-01

    Leaf area growth and nitrogen concentration per unit leaf area, Na (g m-2 N) are two options plants can use to adapt to nitrogen limitation. Previous work indicated that potato (Solanum tuberosum L.) adapts the size of leaves to maintain Na and photosynthetic capacity per unit leaf area. This paper

  12. Effects of Psidium guajava Leaf Infusion on Streptococci viridans

    Directory of Open Access Journals (Sweden)

    Hing Yi Chen

    2016-09-01

    Full Text Available Background: Dental caries is recognized as the most important oral burden. It is caused by the formation of lactate acid formed through reaction of bacteria and carbohydrates. Streptococci viridans has been proven as the primary etiologic agents for dental caries. Low accessibility in oral care services leads the Indonesian community to use plants in order to prevent dental caries. One of those plants is Psidium guajava (pink guava. The leaves were suggested to have antimicrobial effects on some gram-positive bacteria. When the organism is resistant to specific substance tested on media, a circular/inhibition zone around a disc containing antimicrobial substance was formed. The purpose of this study was to identify the presence of inhibition zones by infusion of Psidium guajava leaf on Streptococci viridians in vitro. Methods: This laboratory experiment was carried out in September to October 2014 at the Microbiology Laboratory, Faculty of Medicine, Universitas Padjadjaran. Infusions of Psidium guajava leaf were made into four different concentrations (10%, 25%, 50% and 100%, respectively and the identification of inhibition zones on Streptococci viridans obtained from the laboratory was tested using modified disk diffusion test. Distilled water acted as negative control. The results were then interpreted after 24 hours of incubation. Every procedure was repeated three times. Results: All four concentrations of Psidium guajava leaf infusions have formed inhibition zones on the media, with the highest concentration (100% producing largest average diameter. Conclusions: The infusion of Psidium guajava leaf produces inhibition zones on Streptococci virdans in vitro.

  13. Spectral reflectance relationships to leaf water stress

    Science.gov (United States)

    Ripple, William J.

    1986-01-01

    Spectral reflectance data were collected from detached snapbean leaves in the laboratory with a multiband radiometer. Four experiments were designed to study the spectral response resulting from changes in leaf cover, relative water content of leaves, and leaf water potential. Spectral regions included in the analysis were red (630-690 nm), NIR (760-900 nm), and mid-IR (2.08-2.35 microns). The red and mid-IR bands showed sensitivity to changes in both leaf cover and relative water content of leaves. The NIR was only highly sensitive to changes in leaf cover. Results provided evidence that mid-IR reflectance was governed primarily by leaf moisture content, although soil reflectance was an important factor when leaf cover was less than 100 percent. High correlations between leaf water potentials and reflectance were attributed to covariances with relative water content of leaves and leaf cover.

  14. Dependence of fluence errors in dynamic IMRT on leaf-positional errors varying with time and leaf number

    International Nuclear Information System (INIS)

    Zygmanski, Piotr; Kung, Jong H.; Jiang, Steve B.; Chin, Lee

    2003-01-01

    ALPO is an Average Leaf Pair Opening (the concept of ALPO was previously introduced by us in Med. Phys. 28, 2220-2226 (2001). Therefore, dose errors associated with RLP errors are larger for fields requiring small leaf gaps. For an N-field IMRT plan, we demonstrate that the total fluence error (if we neglect inhomogeneities and scatter) is proportional to 1/√(N), where N is the number of fields, which slightly reduces the impact of RLP errors of individual fields on the total fluence error. We tested and applied the analytical apparatus in the context of commercial inverse treatment planning systems used in our clinics (Helios TM and BrainScan TM ). We determined the actual distribution of leaf-positional errors by studying MLC controller (Varian Mark II and Brainlab Novalis MLCs) log files created by the controller after each field delivery. The analytically derived relationship between fluence error and RLP errors was confirmed by numerical simulations. The equivalence of relative fluence error to relative dose error was verified by a direct dose calculation. We also experimentally verified the truthfulness of fluences derived from the log file data by comparing them to film data

  15. An evolutionary perspective on leaf economics : Phylogenetics of leaf mass per area in vascular plants

    NARCIS (Netherlands)

    Flores, Olivier; Garnier, Eric; Wright, Ian J.; Reich, Peter B.; Pierce, Simon; Diaz, Sandra; Pakeman, Robin J.; Rusch, Graciela M.; Bernard-Verdier, Maud; Testi, Baptiste; Bakker, Jan P.; Bekker, Renee M.; Cerabolini, Bruno E. L.; Ceriani, Roberta M.; Cornu, Guillaume; Cruz, Pablo; Delcamp, Matthieu; Dolezal, Jiri; Eriksson, Ove; Fayolle, Adeline; Freitas, Helena; Golodets, Carly; Gourlet-Fleury, Sylvie; Hodgson, John G.; Brusa, Guido; Kleyer, Michael; Kunzmann, Dieter; Lavorel, Sandra; Papanastasis, Vasilios P.; Perez-Harguindeguy, Natalia; Vendramini, Fernanda; Weiher, Evan

    In plant leaves, resource use follows a trade-off between rapid resource capture and conservative storage. This "worldwide leaf economics spectrum" consists of a suite of intercorrelated leaf traits, among which leaf mass per area, LMA, is one of the most fundamental as it indicates the cost of leaf

  16. The Nissan LEAF electric powertrain

    Energy Technology Data Exchange (ETDEWEB)

    Nakazawa, Shinsuke [Nissan Motor Co., Ltd. (Japan)

    2011-07-01

    The need for CO{sub 2} reduction as a countermeasure to global warming, and to move away from our dependence on fossil fuels as a countermeasure to energy security are urgent issues. One of the ultimate goals to achieving these targets is to develop a 'Zero emission car' such as an electric vehicle or a fuel cell vehicle, along with the manufacturing of clean energy. Nissan have developed a new powertrain for the electric vehicle, and have installed it in the Nissan LEAF. Sales of the Nissan LEAF started in North America, Europe and Japan in 2010, with plans to sell it globally by 2012. In order to achieve an improved driving range, power performance and drivability performance, Nissan have adapted a high efficiency synchronous motor, a water-cooled inverter, and reducer. Moreover, the Nissan LEAF has the capability of a 3.3kW AC charge and a 50kW DC quick charge. This presentation will introduce the features of the electric powertrain adopted for Nissan LEAF. (orig.)

  17. Coordination of Leaf Photosynthesis, Transpiration, and Structural Traits in Rice and Wild Relatives (Genus Oryza).

    Science.gov (United States)

    Giuliani, Rita; Koteyeva, Nuria; Voznesenskaya, Elena; Evans, Marc A; Cousins, Asaph B; Edwards, Gerald E

    2013-07-01

    The genus Oryza, which includes rice (Oryza sativa and Oryza glaberrima) and wild relatives, is a useful genus to study leaf properties in order to identify structural features that control CO(2) access to chloroplasts, photosynthesis, water use efficiency, and drought tolerance. Traits, 26 structural and 17 functional, associated with photosynthesis and transpiration were quantified on 24 accessions (representatives of 17 species and eight genomes). Hypotheses of associations within, and between, structure, photosynthesis, and transpiration were tested. Two main clusters of positively interrelated leaf traits were identified: in the first cluster were structural features, leaf thickness (Thick(leaf)), mesophyll (M) cell surface area exposed to intercellular air space per unit of leaf surface area (S(mes)), and M cell size; a second group included functional traits, net photosynthetic rate, transpiration rate, M conductance to CO(2) diffusion (g(m)), stomatal conductance to gas diffusion (g(s)), and the g(m)/g(s) ratio.While net photosynthetic rate was positively correlated with gm, neither was significantly linked with any individual structural traits. The results suggest that changes in gm depend on covariations of multiple leaf (S(mes)) and M cell (including cell wall thickness) structural traits. There was an inverse relationship between Thick(leaf) and transpiration rate and a significant positive association between Thick(leaf) and leaf transpiration efficiency. Interestingly, high g(m) together with high g(m)/g(s) and a low S(mes)/g(m) ratio (M resistance to CO(2) diffusion per unit of cell surface area exposed to intercellular air space) appear to be ideal for supporting leaf photosynthesis while preserving water; in addition, thick M cell walls may be beneficial for plant drought tolerance.

  18. Total Thyroidectomy

    Directory of Open Access Journals (Sweden)

    Lopez Moris E

    2016-06-01

    Full Text Available Total thyroidectomy is a surgery that removes all the thyroid tissue from the patient. The suspect of cancer in a thyroid nodule is the most frequent indication and it is presume when previous fine needle puncture is positive or a goiter has significant volume increase or symptomes. Less frequent indications are hyperthyroidism when it is refractory to treatment with Iodine 131 or it is contraindicated, and in cases of symptomatic thyroiditis. The thyroid gland has an important anatomic relation whith the inferior laryngeal nerve and the parathyroid glands, for this reason it is imperative to perform extremely meticulous dissection to recognize each one of these elements and ensure their preservation. It is also essential to maintain strict hemostasis, in order to avoid any postoperative bleeding that could lead to a suffocating neck hematoma, feared complication that represents a surgical emergency and endangers the patient’s life.It is essential to run a formal technique, without skipping steps, and maintain prudence and patience that should rule any surgical act.

  19. 7 CFR 30.2 - Leaf tobacco.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf tobacco. 30.2 Section 30.2 Agriculture... Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS TOBACCO STOCKS AND STANDARDS Classification of Leaf Tobacco Covering Classes, Types and Groups of Grades § 30.2 Leaf...

  20. 7 CFR 29.3035 - Leaf structure.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf structure. 29.3035 Section 29.3035 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Leaf structure. The cell development of a leaf as indicated by its porosity or solidity. (See Elements...

  1. 7 CFR 29.6023 - Leaf structure.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf structure. 29.6023 Section 29.6023 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Definitions § 29.6023 Leaf structure. The cell development of a leaf as indicated by its...

  2. 7 CFR 29.1030 - Leaf structure.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf structure. 29.1030 Section 29.1030 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 92) § 29.1030 Leaf structure. The cell development of a leaf as indicated by its porosity. (See...

  3. 7 CFR 29.3527 - Leaf structure.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf structure. 29.3527 Section 29.3527 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 95) § 29.3527 Leaf structure. The cell development of a leaf as indicated by its porosity. (See...

  4. 7 CFR 29.3526 - Leaf scrap.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf scrap. 29.3526 Section 29.3526 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 95) § 29.3526 Leaf scrap. A byproduct of unstemmed tobacco Leaf scrap results from handling...

  5. 7 CFR 29.3034 - Leaf scrap.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf scrap. 29.3034 Section 29.3034 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Leaf scrap. A by-product of unstemmed tobacco. Leaf scrap results from handling unstemmed tobacco and...

  6. 7 CFR 29.6022 - Leaf scrap.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf scrap. 29.6022 Section 29.6022 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Definitions § 29.6022 Leaf scrap. A byproduct of unstemmed tobacco Leaf scrap results...

  7. Hydroxychavicol, a Piper betle leaf component, induces apoptosis of CML cells through mitochondrial reactive oxygen species-dependent JNK and endothelial nitric oxide synthase activation and overrides imatinib resistance.

    Science.gov (United States)

    Chakraborty, Jayashree B; Mahato, Sanjit K; Joshi, Kalpana; Shinde, Vaibhav; Rakshit, Srabanti; Biswas, Nabendu; Choudhury Mukherjee, Indrani; Mandal, Labanya; Ganguly, Dipyaman; Chowdhury, Avik A; Chaudhuri, Jaydeep; Paul, Kausik; Pal, Bikas C; Vinayagam, Jayaraman; Pal, Churala; Manna, Anirban; Jaisankar, Parasuraman; Chaudhuri, Utpal; Konar, Aditya; Roy, Siddhartha; Bandyopadhyay, Santu

    2012-01-01

    Alcoholic extract of Piper betle (Piper betle L.) leaves was recently found to induce apoptosis of CML cells expressing wild type and mutated Bcr-Abl with imatinib resistance phenotype. Hydroxy-chavicol (HCH), a constituent of the alcoholic extract of Piper betle leaves, was evaluated for anti-CML activity. Here, we report that HCH and its analogues induce killing of primary cells in CML patients and leukemic cell lines expressing wild type and mutated Bcr-Abl, including the T315I mutation, with minimal toxicity to normal human peripheral blood mononuclear cells. HCH causes early but transient increase of mitochondria-derived reactive oxygen species. Reactive oxygen species-dependent persistent activation of JNK leads to an increase in endothelial nitric oxide synthase-mediated nitric oxide generation. This causes loss of mitochondrial membrane potential, release of cytochrome c from mitochondria, cleavage of caspase 9, 3 and poly-adenosine diphosphate-ribose polymerase leading to apoptosis. One HCH analogue was also effective in vivo in SCID mice against grafts expressing the T315I mutation, although to a lesser extent than grafts expressing wild type Bcr-Abl, without showing significant bodyweight loss. Our data describe the role of JNK-dependent endothelial nitric oxide synthase-mediated nitric oxide for anti-CML activity of HCH and this molecule merits further testing in pre-clinical and clinical settings. © 2011 Japanese Cancer Association.

  8. Effect of Olive Leaf ( Powder on Laying Hens Performance, Egg Quality and Egg Yolk Cholesterol Levels

    Directory of Open Access Journals (Sweden)

    H. Cayan

    2015-04-01

    Full Text Available This experiment was conducted to measure the effects of olive leaf powder on performance, egg yield, egg quality and yolk cholesterol level of laying hens. A total of 120 Lohmann Brown laying hens of 22 weeks old were used in this experiment. The birds were fed on standard layer diets containing 0, 1%, 2%, or 3% olive leaf powder for 8 weeks. Egg weight and yield were recorded daily; feed intake weekly; egg quality and cholesterol content at the end of the trial. Olive leaf powder had no effect on feed intake, egg weight, egg yield and feed conversion ratio (p>0.05 while olive leaf powder increased final body weight of hens (p0.05. To conclude, olive leaf powder can be used for reducing egg yolk cholesterol content and egg yolk coloring agent in layer diets.

  9. Photosynthate partitioning in basal zones of tall fescue leaf blades

    International Nuclear Information System (INIS)

    Allard, G.; Nelson, C.J.

    1991-01-01

    Elongating grass leaves have successive zones of cell division, cell elongation, and cell maturation in the basal portion of the blade and are a strong sink for photosynthate. Our objective was to determine dry matter (DM) deposition and partitioning in basal zones of elongating tall fescue (Festuca arundinacea Schreb.) leaf blades. Vegetative tall fescue plants were grown in continuous light (350 micromoles per square meter per second photosynthetic photon flux density) to obtain a constant spatial distribution of elongation growth with time. Content and net deposition rates of water-soluble carbohydrates (WSC) and DM along elongating leaf blades were determined. These data were compared with accumulation of 14 C in the basal zones following leaf-labeling with 14 CO 2 . Net deposition of DM was highest in the active cell elongation zone, due mainly to deposition of WSC. The maturation zone, just distal to the elongation zone, accounted for 22% of total net deposition of DM in elongating leaves. However, the spatial profile of 14 C accumulation suggested that the elongation zone and the maturation zone were sinks of equal strength. WSC-free DM accounted for 55% of the total net DM deposition in elongating leaf blades, but only 10% of incoming 14 C-photosynthate accumulated in the water-insoluble fraction (WIF ∼ WSC-free DM) after 2 hours. In the maturation zone, more WSC was used for synthesis of WSC-free DM than was imported as recent photosynthate

  10. Sheep fed with banana leaf hay reduce ruminal protozoa population.

    Science.gov (United States)

    Freitas, Cláudio Eduardo Silva; Duarte, Eduardo Robson; Alves, Dorismar David; Martinele, Isabel; D'Agosto, Marta; Cedrola, Franciane; de Moura Freitas, Angélica Alves; Dos Santos Soares, Franklin Delano; Beltran, Makenzi

    2017-04-01

    A ciliate protozoa suppression can reduce methane production increasing the energy efficiency utilization by ruminants. The physicochemical characteristics of rumen fluid and the profile of the rumen protozoa populations were evaluated for sheep fed banana leaf hay in replacement of the Cynodon dactylon cv. vaqueiro hay. A total of 30 male sheep were raised in intensive system during 15 days of adaptation and 63 days of experimental period. The animals were distributed in a completely randomized design that included six replicates of five treatments with replacement levels (0, 25, 50, 75, and 100%) of the grass vaquero for the banana leaf hay. Samples of fluid were collected directly from the rumen with sterile catheters. Color, odor, viscosity, and the methylene blue reduction potential (MBRP) were evaluated and pH estimated using a digital potentiometer. After decimal dilutions, counts of genus protozoa were performed in Sedgewick Rafter chambers. The averages of pH, MBRP, color, odor, and viscosity were not influenced by the inclusion of the banana leaf hay. However, the total number of protozoa and Entodinium spp. population significantly decreased at 75 and 100% inclusions of banana leaf hay as roughage.

  11. Plant traits and environment: floating leaf blade production and turnover of waterlilies

    Directory of Open Access Journals (Sweden)

    Peter F. Klok

    2017-04-01

    Full Text Available Floating leaf blades of waterlilies fulfill several functions in wetland ecosystems by production, decomposition and turnover as well as exchange processes. Production and turnover rates of floating leaf blades of three waterlily species, Nuphar lutea (L. Sm., Nymphaea alba L. and Nymphaea candida Presl, were studied in three freshwater bodies, differing in trophic status, pH and alkalinity. Length and percentages of leaf loss of marked leaf blades were measured weekly during the growing season. Area and biomass were calculated based on leaf length and were used to calculate the turnover rate of floating leaf blades. Seasonal changes in floating leaf production showed that values decreased in the order: Nymphaea alba, Nuphar lutea, Nymphaea candida. The highest production was reached for Nuphar lutea and Nymphaea alba in alkaline, eutrophic water bodies. The production per leaf was relatively high for both species in the acid water body. Nymphaea candida showed a very short vegetation period and low turnover rates. The ratio Total potential leaf biomass/Maximum potential leaf biomass (P/Bmax of the three species ranged from 1.35–2.25. The ratio Vegetation period (Period with floating leaves/Mean leaf life span ranged from 2.94–4.63, the ratio Growth period (Period with appearance of new floating leaves/Vegetation period from 0.53–0.73. The clear differences between Nymphaea candida versus Nuphar lutea and Nymphaea alba, may be due to adaptations of Nymphaea candida to an Euro-Siberic climate with short-lasting summer conditions.

  12. Plant traits and environment: floating leaf blade production and turnover of waterlilies.

    Science.gov (United States)

    Klok, Peter F; van der Velde, Gerard

    2017-01-01

    Floating leaf blades of waterlilies fulfill several functions in wetland ecosystems by production, decomposition and turnover as well as exchange processes. Production and turnover rates of floating leaf blades of three waterlily species, Nuphar lutea (L.) Sm., Nymphaea alba L. and Nymphaea candida Presl, were studied in three freshwater bodies, differing in trophic status, pH and alkalinity. Length and percentages of leaf loss of marked leaf blades were measured weekly during the growing season. Area and biomass were calculated based on leaf length and were used to calculate the turnover rate of floating leaf blades. Seasonal changes in floating leaf production showed that values decreased in the order: Nymphaea alba , Nuphar lutea , Nymphaea candida . The highest production was reached for Nuphar lutea and Nymphaea alba in alkaline, eutrophic water bodies. The production per leaf was relatively high for both species in the acid water body. Nymphaea candida showed a very short vegetation period and low turnover rates. The ratio Total potential leaf biomass/Maximum potential leaf biomass (P/B max ) of the three species ranged from 1.35-2.25. The ratio Vegetation period (Period with floating leaves)/Mean leaf life span ranged from 2.94-4.63, the ratio Growth period (Period with appearance of new floating leaves)/Vegetation period from 0.53-0.73. The clear differences between Nymphaea candida versus Nuphar lutea and Nymphaea alba , may be due to adaptations of Nymphaea candida to an Euro-Siberic climate with short-lasting summer conditions.

  13. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  14. Drought-Induced Leaf Proteome Changes in Switchgrass Seedlings

    Directory of Open Access Journals (Sweden)

    Zhujia Ye

    2016-08-01

    Full Text Available Switchgrass (Panicum virgatum is a perennial crop producing deep roots and thus highly tolerant to soil water deficit conditions. However, seedling establishment in the field is very susceptible to prolonged and periodic drought stress. In this study, a “sandwich” system simulating a gradual water deletion process was developed. Switchgrass seedlings were subjected to a 20-day gradual drought treatment process when soil water tension was increased to 0.05 MPa (moderate drought stress and leaf physiological properties had expressed significant alteration. Drought-induced changes in leaf proteomes were identified using the isobaric tags for relative and absolute quantitation (iTRAQ labeling method followed by nano-scale liquid chromatography mass spectrometry (nano-LC-MS/MS analysis. Additionally, total leaf proteins were processed using a combinatorial library of peptide ligands to enrich for lower abundance proteins. Both total proteins and those enriched samples were analyzed to increase the coverage of the quantitative proteomics analysis. A total of 7006 leaf proteins were identified, and 257 (4% of the leaf proteome expressed a significant difference (p < 0.05, fold change <0.6 or >1.7 from the non-treated control to drought-treated conditions. These proteins are involved in the regulation of transcription and translation, cell division, cell wall modification, phyto-hormone metabolism and signaling transduction pathways, and metabolic pathways of carbohydrates, amino acids, and fatty acids. A scheme of abscisic acid (ABA-biosynthesis and ABA responsive signal transduction pathway was reconstructed using these drought-induced significant proteins, showing systemic regulation at protein level to deploy the respective mechanism. Results from this study, in addition to revealing molecular responses to drought stress, provide a large number of proteins (candidate genes that can be employed to improve switchgrass seedling growth and

  15. Anatomical indications of fume resistance in certain woody plants

    Energy Technology Data Exchange (ETDEWEB)

    Ninova, D.

    1970-01-01

    An attempt is made to describe studies on seven species of fruit and forest trees close to or far from a Bulgarian factory emitting fumes containing S. The most resistant species (Quercus borealis, Gleditsia triacanthos, Morus alba) had the smallest stomata and the greatest number of stomata per unit leaf area. Changes observed in leaf anatomy as a result of exposure to the fumes were: decreased leaf aeration, elongated palisade cells, thicker cuticles, and more stomata.

  16. Influence of heat stress on leaf morphology and nitrogen–carbohydrate metabolisms in two wucai (Brassica campestris L. genotypes

    Directory of Open Access Journals (Sweden)

    Lingyun Yuan

    2017-06-01

    Full Text Available Heat stress is a major environmental stress that limits plant growth and yield worldwide. The present study was carried out to explore the physiological mechanism of heat tolerant to provide the theoretical basis for heat-tolerant breeding. The changes of leaf morphology, anatomy, nitrogen assimilation, and carbohydrate metabolism in two wucai genotypes (WS-1, heat tolerant; WS-6, heat sensitive grown under heat stress (40°C/30°C for 7 days were investigated. Our results showed that heat stress hampered the plant growth and biomass accumulation in certain extent in WS-1 and WS-6. However, the inhibition extent of WS-1 was significantly smaller than WS-6. Thickness of leaf lamina, upper epidermis, and palisade mesophyll were increased by heat in WS-1, which might be contributed to the higher assimilation of photosynthates. During nitrogen assimilation, WS-1 possessed the higher nitrogen-related metabolic enzyme activities, including nitrate reductase (NR, glutamine synthetase (GS, glutamate synthase (GOGAT, and glutamate dehydrogenase (GDH, which were reflected by higher photosynthetic nitrogen-use efficiency (PNUE with respect to WS-6. The total amino acids level had no influence in WS-1, whereas it was reduced in WS-6 by heat. And the proline contents of both wucai genotypes were all increased to respond the heat stress. Additionally, among all treatments, the total soluble sugar content of WS-1 by heat got the highest level, including higher contents of sucrose, fructose, and starch than those of WS-6. Moreover, the metabolism efficiency of sucrose to starch in WS-1 was greater than WS-6 under heat stress, proved by higher activities of sucrose phosphate synthase (SPS, sucrose synthase (SuSy, acid invertase (AI, and amylase. These results demonstrated that leaf anatomical alterations resulted in higher nitrogen and carbon assimilation in heat-tolerant genotype WS-1, which exhibited a greater performance to resist heat stress.

  17. Interactive influence of leaf age, light intensity, and girdling on green ash foliar chemistry and emerald ash borer development.

    Science.gov (United States)

    Chen, Yigen; Poland, Therese M

    2009-07-01

    Biotic and abiotic environmental factors affect plant nutritional quality and defensive compounds that confer plant resistance to herbivory. Influence of leaf age, light availability, and girdling on foliar nutrition and defense of green ash (Fraxinus pennsylvanica Marsh) was examined in this study. Longevity of the emerald ash borer, Agrilus planipennis Fairmaire (Coleoptera: Buprestidae), adults reared on green ash foliage subjected to these factors was assayed. Mature leaves generally were more nutritious with greater amino acids and a greater ratio of protein to non-structural carbohydrate (P:C) than young leaves, in particular when trees were grown in shade. On the other hand, mature leaves had lower amounts of trypsin and chymotrypsin inhibitors, and total phenolics compared to young leaves. Lower defense of mature leaves alone, or along with higher nutritional quality may lead to increased survival and longevity of emerald ash borer feeding on mature leaves. Sunlight reduced amino acids and P:C ratio, irrespective of leaf age and girdling, and elevated total protein of young foliage, but not protein of mature leaves. Sunlight also dramatically increased all investigated defensive compounds of young, but not mature leaves. Girdling reduced green ash foliar nutrition, especially, of young leaves grown in shade and of mature leaves grown in sun. However emerald ash borer performance did not differ when fed leaves from trees grown in sun or shade, or from girdled or control trees. One explanation is that emerald ash borer reared on lower nutritional quality food may compensate for nutrient deficiency by increasing its consumption rate. The strong interactions among leaf age, light intensity, and girdling on nutrition and defense highlight the need for caution when interpreting data without considering possible interactions.

  18. Relationships of leaf dark respiration to leaf nitrogen, specific leaf area and leaf life-span: a test across biomes and functional groups.

    Science.gov (United States)

    Reich, Peter B; Walters, Michael B; Ellsworth, David S; Vose, James M; Volin, John C; Gresham, Charles; Bowman, William D

    1998-05-01

    Based on prior evidence of coordinated multiple leaf trait scaling, we hypothesized that variation among species in leaf dark respiration rate (R d ) should scale with variation in traits such as leaf nitrogen (N), leaf life-span, specific leaf area (SLA), and net photosynthetic capacity (A max ). However, it is not known whether such scaling, if it exists, is similar among disparate biomes and plant functional types. We tested this idea by examining the interspecific relationships between R d measured at a standard temperature and leaf life-span, N, SLA and A max for 69 species from four functional groups (forbs, broad-leafed trees and shrubs, and needle-leafed conifers) in six biomes traversing the Americas: alpine tundra/subalpine forest, Colorado; cold temperate forest/grassland, Wisconsin; cool temperate forest, North Carolina; desert/shrubland, New Mexico; subtropical forest, South Carolina; and tropical rain forest, Amazonas, Venezuela. Area-based R d was positively related to area-based leaf N within functional groups and for all species pooled, but not when comparing among species within any site. At all sites, mass-based R d (R d-mass ) decreased sharply with increasing leaf life-span and was positively related to SLA and mass-based A max and leaf N (leaf N mass ). These intra-biome relationships were similar in shape and slope among sites, where in each case we compared species belonging to different plant functional groups. Significant R d-mass -N mass relationships were observed in all functional groups (pooled across sites), but the relationships differed, with higher R d at any given leaf N in functional groups (such as forbs) with higher SLA and shorter leaf life-span. Regardless of biome or functional group, R d-mass was well predicted by all combinations of leaf life-span, N mass and/or SLA (r 2 ≥ 0.79, P morphological, chemical and metabolic traits.

  19. Safety evaluation of Sapindus laurifolius leaf extract in Wistar rats

    Directory of Open Access Journals (Sweden)

    C. N. Santhosh Kumar

    2013-10-01

    Full Text Available Objectives:The present work was aimed to study the phytochemical composition of the Sapindus laurifolius leaves andtoxicological effect of the Sapindus laurifolius leaf extract in a systematic way using Wistar albino rats as a model animal.Materials and Methods :The identification of phytoconstituents present in the leaf extract was performed using Highperformance thin layer chromatography (HPTLC. In toxicity studies, the acute oral toxicity study was conducted as per theguidelines of Organization for Economic Co-operation and Development (OECD 423 Acute Toxic Class Method for testingof chemicals. In repeated dose 28-day oral toxicity study (OECD 407, methanolic leaf extract administered at the dose of 50,200 and 800 mg/kg BWand limit dose of 1000 mg/kg BW.Results: Saponins, flavanoids, glycosides and bitter principles were the major phytoconstituents identified. In acute toxicitystudy, the LD cut-off values were found to be more than 2g/kg in leaf extract. In repeated dose 28-day oral toxicity, significant 50(P<0.05 increase in AST, ALT, BUN and creatinine, significant (P<0.05 increase in total protein was noticed. Thehistopathological changes confined to liver, kidney and intestine, revealed mild to moderate hepatotoxicity, severenephrotoxicity and increased goblet cell activity. The changes were found to correlate with increased dose of leaf extract.Conclusion:The phytochemical analysis of Sapindus laurifolius revealed the presence of saponins, glycosides, flavonoidsand bitter principles.The acute oral toxicity study of S. laurifolius methanolic leaf extract in rats resulted in no toxicity even atthe highest dose, but in repeated 28-day oral toxicity study revealed mild to moderate hepatotoxicity, severe nephrotoxicityand intestinal damage.

  20. Antimicrobial compounds from leaf extracts of Jatropha curcas, Psidium guajava, and Andrographis paniculata.

    Science.gov (United States)

    Rahman, M M; Ahmad, S H; Mohamed, M T M; Ab Rahman, M Z

    2014-01-01

    The present research was conducted to discover antimicrobial compounds in methanolic leaf extracts of Jatropha curcas and Andrographis paniculata and ethanolic leaf extract of Psidium guajava and the effectiveness against microbes on flower preservative solution of cut Mokara Red orchid flowers was evaluated. The leaves were analyzed using gas chromatography-mass spectrometry. A total of nine, 66, and 29 compounds were identified in J. curcas, P. guajava, and A. paniculata leaf extracts, with five (88.18%), four (34.66%), and three (50.47%) having unique antimicrobial compounds, respectively. The experimental design on vase life was conducted using a completely randomized design with 10 replications. The flower vase life was about 6 days in the solution containing the P. guajava and A. paniculata leaf extracts at 15 mg/L. Moreover, solution with leaf extracts of A. paniculata had the lowest bacterial count compared to P. guajava and J. curcas. Thus, these leaf extracts revealed the presence of relevant antimicrobial compounds. The leaf extracts have the potential as a cut flower solution to minimize microbial populations and extend flower vase life. However, the activities of specific antimicrobial compounds and double or triple combination leaf extracts to enhance the effectiveness to extend the vase life need to be tested.

  1. Algorithm for retrieving vegetative canopy and leaf parameters from multi- and hyperspectral imagery

    Science.gov (United States)

    Borel, Christoph

    2009-05-01

    In recent years hyper-spectral data has been used to retrieve information about vegetative canopies such as leaf area index and canopy water content. For the environmental scientist these two parameters are valuable, but there is potentially more information to be gained as high spatial resolution data becomes available. We developed an Amoeba (Nelder-Mead or Simplex) based program to invert a vegetative canopy radiosity model coupled with a leaf (PROSPECT5) reflectance model and modeled for the background reflectance (e.g. soil, water, leaf litter) to a measured reflectance spectrum. The PROSPECT5 leaf model has five parameters: leaf structure parameter Nstru, chlorophyll a+b concentration Cab, carotenoids content Car, equivalent water thickness Cw and dry matter content Cm. The canopy model has two parameters: total leaf area index (LAI) and number of layers. The background reflectance model is either a single reflectance spectrum from a spectral library() derived from a bare area pixel on an image or a linear mixture of soil spectra. We summarize the radiosity model of a layered canopy and give references to the leaf/needle models. The method is then tested on simulated and measured data. We investigate the uniqueness, limitations and accuracy of the retrieved parameters on canopy parameters (low, medium and high leaf area index) spectral resolution (32 to 211 band hyperspectral), sensor noise and initial conditions.

  2. The effect of air pollution and other environmental stressors on leaf fluctuating asymmetry and specific leaf area of Salix alba L

    Energy Technology Data Exchange (ETDEWEB)

    Wuytack, Tatiana, E-mail: tatiana.wuytack@ua.ac.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Wuyts, Karen, E-mail: karen.wuyts@ugent.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Laboratory of Forestry, Department of Forest and Water Management, Ghent University, Geraardsbergsesteenweg 267, B-9090 Gontrode (Melle) (Belgium); Van Dongen, Stefan, E-mail: stefan.vandongen@ua.ac.be [Department of Biology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Baeten, Lander, E-mail: lander.baeten@ugent.be [Laboratory of Forestry, Department of Forest and Water Management, Ghent University, Geraardsbergsesteenweg 267, B-9090 Gontrode (Melle) (Belgium); Kardel, Fatemeh, E-mail: fatemeh.kardel@ua.ac.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Verheyen, Kris, E-mail: kris.verheyen@ugent.be [Laboratory of Forestry, Department of Forest and Water Management, Ghent University, Geraardsbergsesteenweg 267, B-9090 Gontrode, Melle (Belgium); Samson, Roeland, E-mail: roeland.samson@ua.ac.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

    2011-10-15

    We aimed at evaluating the effect of low-level air pollution on leaf area fluctuating asymmetry (FAA) and specific leaf area (SLA) of Salix alba L., taking into account other environmental factors. Cuttings were grown in standardized conditions in the near vicinity of air quality measuring stations in Belgium. Variability of SLA and FAA between measuring stations explained 83% and 7.26%, respectively, of the total variability. FAA was not influenced by air pollution or environmental factors such as shading, herbivory, air temperature and humidity. SLA was increased by an increase in shadow, while NO{sub x} and O{sub 3} concentrations had only a marginal influence. The influence of SO{sub 2} concentration was negligible. Although our data analysis suggests a relationship between SLA and NO{sub x}/O{sub 3} concentration, the absence of a straightforward relationship between FAA and SLA and air pollution still questions the usefulness of these bio-indicators for monitoring air pollution. - Highlights: > Leaf characteristics of white willow as possible bio-indicators for air quality. > Fluctuating asymmetry is not a good bio-indicator for monitoring the air quality. > Shadow increases specific leaf area. > NO{sub x} and O{sub 3} change specific leaf area of white willow. - Specific leaf area of S. alba increased with increasing shade and, in less extent, with increasing NO{sub x} and decreasing O{sub 3} concentration, while leaf asymmetry did not respond to air pollution

  3. The effect of air pollution and other environmental stressors on leaf fluctuating asymmetry and specific leaf area of Salix alba L

    International Nuclear Information System (INIS)

    Wuytack, Tatiana; Wuyts, Karen; Van Dongen, Stefan; Baeten, Lander; Kardel, Fatemeh; Verheyen, Kris; Samson, Roeland

    2011-01-01

    We aimed at evaluating the effect of low-level air pollution on leaf area fluctuating asymmetry (FAA) and specific leaf area (SLA) of Salix alba L., taking into account other environmental factors. Cuttings were grown in standardized conditions in the near vicinity of air quality measuring stations in Belgium. Variability of SLA and FAA between measuring stations explained 83% and 7.26%, respectively, of the total variability. FAA was not influenced by air pollution or environmental factors such as shading, herbivory, air temperature and humidity. SLA was increased by an increase in shadow, while NO x and O 3 concentrations had only a marginal influence. The influence of SO 2 concentration was negligible. Although our data analysis suggests a relationship between SLA and NO x /O 3 concentration, the absence of a straightforward relationship between FAA and SLA and air pollution still questions the usefulness of these bio-indicators for monitoring air pollution. - Highlights: → Leaf characteristics of white willow as possible bio-indicators for air quality. → Fluctuating asymmetry is not a good bio-indicator for monitoring the air quality. → Shadow increases specific leaf area. → NO x and O 3 change specific leaf area of white willow. - Specific leaf area of S. alba increased with increasing shade and, in less extent, with increasing NO x and decreasing O 3 concentration, while leaf asymmetry did not respond to air pollution

  4. Antimalarial activity of methanolic leaf extract of Piper betle L.

    Science.gov (United States)

    Al-Adhroey, Abdulelah H; Nor, Zurainee M; Al-Mekhlafi, Hesham M; Amran, Adel A; Mahmud, Rohela

    2010-12-28

    The need for new compounds active against malaria parasites is made more urgent by the rapid spread of drug-resistance to available antimalarial drugs. The crude methanol extract of Piper betle leaves (50-400 mg/kg) was investigated for its antimalarial activity against Plasmodium berghei (NK65) during early and established infections. The phytochemical and antioxidant potentials of the crude extract were evaluated to elucidate the possibilities of its antimalarial effects. The safety of the extract was also investigated in ICR mice of both sexes by the acute oral toxicity limit test. The leaf extract demonstrated significant (P Piper betle leaves is toxicologically safe by oral administration. The results suggest that the Malaysian folklorical medicinal application of the extract of Piper betle leaf has a pharmacological basis.

  5. Removal of nutrient limitations in forest gaps enhances growth rate and resistance to cavitation in subtropical canopy tree species differing in shade tolerance.

    Science.gov (United States)

    Villagra, Mariana; Campanello, Paula I; Montti, Lia; Goldstein, Guillermo

    2013-03-01

    A 4-year fertilization experiment with nitrogen (N) and phosphorus (P) was carried out in natural gaps of a subtropical forest in northeastern Argentina. Saplings of six dominant canopy species differing in shade tolerance were grown in five control and five N + P fertilized gaps. Hydraulic architectural traits such as wood density, the leaf area to sapwood area ratio (LA : SA), vulnerability to cavitation (P50) and specific and leaf-specific hydraulic conductivity were measured, as well as the relative growth rate, specific leaf area (SLA) and percentage of leaf damage by insect herbivores. Plant growth rates and resistance to drought-induced embolisms increased when nutrient limitations were removed. On average, the P50 of control plants was -1.1 MPa, while the P50 of fertilized plants was -1.6 MPa. Wood density and LA : SA decreased with N + P additions. A trade-off between vulnerability to cavitation and efficiency of water transport was not observed. The relative growth rate was positively related to the total leaf surface area per plant and negatively related to LA : SA, while P50 was positively related to SLA across species and treatments. Plants with higher growth rates and higher total leaf area in fertilized plots were able to avoid hydraulic dysfunction by becoming less vulnerable to cavitation (more negative P50). Two high-light-requiring species exhibited relatively low growth rates due to heavy herbivore damage. Contrary to expectations, shade-tolerant plants with relatively high resistance to hydraulic dysfunction and reduced herbivory damage were able to grow faster. These results suggest that during the initial phase of sapling establishment in gaps, species that were less vulnerable to cavitation and exhibited reduced herbivory damage had faster realized growth rates than less shade-tolerant species with higher potential growth rates. Finally, functional relationships between hydraulic traits and growth rate across species and treatments

  6. Alpha-glucosidase Inhibitory and Antioxidant Potential of Antidiabetic Herb Alternanthera sessilis: Comparative Analyses of Leaf and Callus Solvent Fractions.

    Science.gov (United States)

    Chai, Tsun-Thai; Khoo, Chee-Siong; Tee, Chong-Siang; Wong, Fai-Chu

    2016-01-01

    Alternanthera sessilis is a medicinal herb which is consumed as vegetable and used as traditional remedies of various ailments in Asia and Africa. This study aimed to investigate the antiglucosidase and antioxidant activity of solvent fractions of A. sessilis leaf and callus. Leaf and callus methanol extracts were fractionated to produce hexane, chloroform, ethyl acetate, butanol, and water fractions. Antiglucosidase and 1,1-diphenyl-2-picrylhydrazyl scavenging activities as well as total phenolic (TP), total flavonoid (TF), and total coumarin (TC) contents were evaluated. Lineweaver-Burk plot analysis was performed on leaf and callus fractions with the strongest antiglucosidase activity. Leaf ethyl acetate fraction (LEF) had the strongest antiglucosidase (EC 50 0.55 mg/mL) and radical scavenging (EC 50 10.81 μg/mL) activity among leaf fractions. Callus ethyl acetate fraction (CEF) and chloroform fraction had the highest antiglucosidase (EC 50 0.25 mg/mL) and radical scavenging (EC 50 34.12 μg/mL) activity, respectively, among callus fractions. LEF and CEF were identified as noncompetitive and competitive α-glucosidase inhibitors, respectively. LEF and CEF had greater antiglucosidase activity than acarbose. Leaf fractions had higher phytochemical contents than callus fractions. LEF had the highest TP, TF, and TC contents. Antiglucosidase and antioxidant activities of leaf fractions correlated with phytochemical contents. LEF had potent antiglucosidase activity and concurrent antioxidant activity. CEF had the highest antiglucosidase activity among all fractions. Callus culture is a promising tool for enhancing production of potent α-glucosidase inhibitors. Leaf ethyl acetate fraction (LEF) had the strongest antiglucosidase (EC 50 0.55 mg/mL) and radical scavenging (EC 50 10.81 μg/mL) activity among leaf fractionsCallus ethyl acetate fraction (CEF) and chloroform fraction had the highest antiglucosidase (EC 50 0.25 mg/mL) and radical scavenging (EC 50 34.12

  7. Leaf chemical composition of twenty-one Populus hybrid clones grown under intensive culture

    Science.gov (United States)

    Richard E. Dickson; Philip R. Larson

    1976-01-01

    Leaf material from 21 nursery-grown Populus hybrid clones was analyzed for three nitrogen fractions (total N, soluble protein, and soluble amino acids) and three carbhydrate fractions (reducing sugars, total soluble sugars, and total nonstructural carbohydrates-TNC). In addition, nursery-grown green ash and silver maple, field-grown bigtooth and trembling aspen, and...

  8. Variations of leaf N and P concentrations in shrubland biomes across northern China: phylogeny, climate, and soil

    Science.gov (United States)

    Yang, Xian; Chi, Xiulian; Ji, Chengjun; Liu, Hongyan; Ma, Wenhong; Mohhammat, Anwar; Shi, Zhaoyong; Wang, Xiangping; Yu, Shunli; Yue, Ming; Tang, Zhiyao

    2016-08-01

    Concentrations of leaf nitrogen (N) and phosphorus (P) are two key traits of plants for ecosystem functioning and dynamics. Foliar stoichiometry varies remarkably among life forms. However, previous studies have focused on the stoichiometric patterns of trees and grasses, leaving a significant knowledge gap for shrubs. In this study, we explored the intraspecific and interspecific variations of leaf N and P concentrations in response to the changes in climate, soil property, and evolutionary history. We analysed 1486 samples composed of 163 shrub species from 361 shrubland sites in northern China encompassing 46.1° (86.7-132.8° E) in longitude and 19.8° (32.6-52.4° N) in latitude. Leaf N concentrations decreased with precipitation, while leaf P concentrations decreased with temperature and increased with precipitation and soil total P concentrations. Both leaf N and P concentrations were phylogenetically conserved, but leaf P concentrations were less conserved than leaf N concentrations. At the community level, climate explained more interspecific variation of leaf nutrient concentrations, while soil nutrients explained most of the intraspecific variation. These results suggested that leaf N and P concentrations responded to climate, soil, and phylogeny in different ways. Climate influenced the community chemical traits through the shift in species composition, whereas soil directly influenced the community chemical traits. New patterns were discovered using our observations on specific regions and vegetation types, which improved our knowledge of broad biogeographic patterns of leaf chemical traits.

  9. Associational resistance protects mangrove leaves from crab herbivory

    Science.gov (United States)

    Erickson, Amy A.; Bell, Susan S.; Dawes, Clinton J.

    2012-05-01

    While associational defenses have been well documented in many plant and algal ecosystems, this study is the first to document associational resistance in mangroves. Mangrove tree crab (Aratus pisonii) density and herbivory on three life-stages of the red mangrove (Rhizophora mangle) were documented in pure red versus mixed-species and predominantly non-red mangrove stands containing black (Avicennia germinans) and white (Laguncularia racemosa) mangroves in 1999-2000 in Tampa Bay, Florida. This study first established that R. mangle is the focal species in the context of associational resistance because it is damaged more than either of the other mangrove species. Next, it was hypothesized that crab density and leaf damage on R. mangle would be lower when in mixed-species and predominantly non-red versus red mangrove stands. A non-significant trend suggested that crab density varies among stands, and crab damage on R. mangle leaves was significantly lower in mixed-species and non-red stands. Mechanisms to explain associational resistance were examined. Positive Pearson correlations between the percent of adult R. mangle in a stand and both crab density and R. mangle leaf damage provided support for the resource concentration hypothesis. Limited support was found for the attractant-decoy hypothesis because the total amount of damaged leaves of all mangrove species combined typically differed among stands, suggesting that crabs were not shifting to alternative mangrove species to offset reduced availability of R. mangle leaves. Finally, while R. mangle seedlings were shorter in non-red stands compared to others, intra-specific differences in R. mangle leaf chemistry and sclerophylly among stands failed to explain associational patterns. These combined results argue for the need for additional experiments to elucidate mechanisms responsible for defensive plant associations in mangrove ecosystems and to determine whether such associations could be of use in mangrove

  10. Calibrations between chlorophyll meter values and chlorophyll contents vary as the result of differences in leaf structure

    Science.gov (United States)

    In order to relate leaf chlorophyll meter values with total leaf chlorophyll contents (µg cm-2), calibration equations are established with measured data on leaves. Many studies have documented differences in calibration equations using different species and using different growing conditions for th...

  11. Role of secondary metabolites biosynthesis in resistance to cotton ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.

  12. Analysis of Peanut Leaf Proteome

    DEFF Research Database (Denmark)

    Ramesh, R.; Suravajhala, Prashanth; Pechan, T.

    2010-01-01

    Peanut (Arachis hypogaea) is one of the most important sources of plant protein. Current selection of genotypes requires molecular characterization of available populations. Peanut genome database has several EST cDNAs which can be used to analyze gene expression. Analysis of proteins is a direct...... approach to define function of their associated genes. Proteome analysis linked to genome sequence information is critical for functional genomics. However, the available protein expression data is extremely inadequate. Proteome analysis of peanut leaf was conducted using two-dimensional gel...... electrophoresis in combination with sequence identification using MALDI/TOF to determine their identity and function related to growth, development and responses to stresses. Peanut leaf proteins were resolved into 300 polypeptides with pI values between 3.5 and 8.0 and relative molecular masses from 12 to 100 k...

  13. Can Leaf Spectroscopy Predict Leaf and Forest Traits Along a Peruvian Tropical Forest Elevation Gradient?

    Science.gov (United States)

    Doughty, Christopher E.; Santos-Andrade, P. E.; Goldsmith, G. R.; Blonder, B.; Shenkin, A.; Bentley, L. P.; Chavana-Bryant, C.; Huaraca-Huasco, W.; Díaz, S.; Salinas, N.; Enquist, B. J.; Martin, R.; Asner, G. P.; Malhi, Y.

    2017-11-01

    High-resolution spectroscopy can be used to measure leaf chemical and structural traits. Such leaf traits are often highly correlated to other traits, such as photosynthesis, through the leaf economics spectrum. We measured VNIR (visible-near infrared) leaf reflectance (400-1,075 nm) of sunlit and shaded leaves in 150 dominant species across ten, 1 ha plots along a 3,300 m elevation gradient in Peru (on 4,284 individual leaves). We used partial least squares (PLS) regression to compare leaf reflectance to chemical traits, such as nitrogen and phosphorus, structural traits, including leaf mass per area (LMA), branch wood density and leaf venation, and "higher-level" traits such as leaf photosynthetic capacity, leaf water repellency, and woody growth rates. Empirical models using leaf reflectance predicted leaf N and LMA (r2 > 30% and %RMSE < 30%), weakly predicted leaf venation, photosynthesis, and branch density (r2 between 10 and 35% and %RMSE between 10% and 65%), and did not predict leaf water repellency or woody growth rates (r2<5%). Prediction of higher-level traits such as photosynthesis and branch density is likely due to these traits correlations with LMA, a trait readily predicted with leaf spectroscopy.

  14. Beyond leaf color: Comparing camera-based phenological metrics with leaf biochemical, biophysical, and spectral properties throughout the growing season of a temperate deciduous forest

    Science.gov (United States)

    Yang, Xi; Tang, Jianwu; Mustard, John F.

    2014-03-01

    Plant phenology, a sensitive indicator of climate change, influences vegetation-atmosphere interactions by changing the carbon and water cycles from local to global scales. Camera-based phenological observations of the color changes of the vegetation canopy throughout the growing season have become popular in recent years. However, the linkages between camera phenological metrics and leaf biochemical, biophysical, and spectral properties are elusive. We measured key leaf properties including chlorophyll concentration and leaf reflectance on a weekly basis from June to November 2011 in a white oak forest on the island of Martha's Vineyard, Massachusetts, USA. Concurrently, we used a digital camera to automatically acquire daily pictures of the tree canopies. We found that there was a mismatch between the camera-based phenological metric for the canopy greenness (green chromatic coordinate, gcc) and the total chlorophyll and carotenoids concentration and leaf mass per area during late spring/early summer. The seasonal peak of gcc is approximately 20 days earlier than the peak of the total chlorophyll concentration. During the fall, both canopy and leaf redness were significantly correlated with the vegetation index for anthocyanin concentration, opening a new window to quantify vegetation senescence remotely. Satellite- and camera-based vegetation indices agreed well, suggesting that camera-based observations can be used as the ground validation for satellites. Using the high-temporal resolution dataset of leaf biochemical, biophysical, and spectral properties, our results show the strengths and potential uncertainties to use canopy color as the proxy of ecosystem functioning.

  15. Genetic diversity of flavonoid content in leaf of hawthorn resources

    International Nuclear Information System (INIS)

    Zhao, Y.; Wang, G.; Liu, Z.

    2014-01-01

    Hawthorn (Cratageus spp.) are important medicinal plants. Flavonoids are the main active ingredient in hawthorn. With the help of hawthorn leaf flavonoids efficient detection system, vitexin, rhamnosylvitexin, hyperin, rutin and quercetin of 122 hawthorn resources was precisely measured.The flavonoid contents of 10 hawthorn species were explicited. The comparation of flavonoids revealed the abundant genetic diversity of hawthorn flavones. Large variable coefficient has been observed among 5 flavonoid monomer traits. The coefficients of variation were 44.17%, 132.2%, 157.08%, 113.91% and 31.05 for Vitexin, Rhamnosylvitexin, Hyperoside, Rutin and Quercetin respectively. The sum of these 5 flavonoid monomer contents represented the total flavonoids in hawthorn. The total coefficients of variation was 44.01%. Some high-content-flavone and valuable leaf resources were found. This research could provide accurate date for further production, breeding and the effective use of medicinal resources. (author)

  16. Comparative Study on the Antioxidant Activity of Leaf Extract and Carotenoids Extract from Ipomoea batatas var. Oren (Sweetpotato) Leaves

    OpenAIRE

    Seow-Mun Hue; Amru Nasrulhaq Boyce; Chandran Somasundram

    2011-01-01

    Ipomoea batatas (Sweetpotato) is currently ranked sixth in the total world food production and are planted mainly for their storage roots. The present study was undertaken to evaluate and compare the antioxidant properties of the leaf and carotenoids extract from the Ipomoea batatas var. Oren leaves. Total flavonoids in the leaf extract was 144.6 ± 40.5 μg/g compared to 114.86 ± 4.35 μg/g catechin equivalent in the carotenoids extract. Total polyphenols in the leaf extrac...

  17. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology.

    Directory of Open Access Journals (Sweden)

    Feng Qin

    Full Text Available Common leaf spot (caused by Pseudopeziza medicaginis, rust (caused by Uromyces striatus, Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana and Cercospora leaf spot (caused by Cercospora medicaginis are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis. After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection, disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features was the optimal model. For this SVM model, the

  18. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology

    Science.gov (United States)

    Qin, Feng; Liu, Dongxia; Sun, Bingda; Ruan, Liu; Ma, Zhanhong; Wang, Haiguang

    2016-01-01

    Common leaf spot (caused by Pseudopeziza medicaginis), rust (caused by Uromyces striatus), Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana) and Cercospora leaf spot (caused by Cercospora medicaginis) are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering) and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis). After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection), disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM) and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features) was the optimal model. For this SVM model, the

  19. Leaf venation, as a resistor, to optimize a switchable IR absorber.

    Science.gov (United States)

    Alston, M E; Barber, R

    2016-08-24

    Leaf vascular patterns are the mechanisms and mechanical support for the transportation of fluidics for photosynthesis and leaf development properties. Vascular hierarchical networks in leaves have far-reaching functions in optimal transport efficiency of functional fluidics. Embedding leaf morphogenesis as a resistor network is significant in the optimization of a translucent thermally functional material. This will enable regulation through pressure equalization by diminishing flow pressure variation. This paper investigates nature's vasculature networks that exhibit hierarchical branching scaling applied to microfluidics. To enable optimum potential for pressure drop regulation by algorithm design. This code analysis of circuit conduit optimization for transport fluidic flow resistance is validated against CFD simulation, within a closed loop network. The paper will propose this self-optimization, characterization by resistance seeking targeting to determine a microfluidic network as a resistor. To advance a thermally function material as a switchable IR absorber.

  20. Tuning Transpiration by Interfacial Solar Absorber-Leaf Engineering.

    Science.gov (United States)

    Zhuang, Shendong; Zhou, Lin; Xu, Weichao; Xu, Ning; Hu, Xiaozhen; Li, Xiuqiang; Lv, Guangxin; Zheng, Qinghui; Zhu, Shining; Wang, Zhenlin; Zhu, Jia

    2018-02-01

    Plant transpiration, a process of water movement through a plant and its evaporation from aerial parts especially leaves, consumes a large component of the total continental precipitation (≈48%) and significantly influences global water distribution and climate. To date, various chemical and/or biological explorations have been made to tune the transpiration but with uncertain environmental risks. In recent years, interfacial solar steam/vapor generation is attracting a lot of attention for achieving high energy transfer efficiency. Various optical and thermal designs at the solar absorber-water interface for potential applications in water purification, seawater desalination, and power generation appear. In this work, the concept of interfacial solar vapor generation is extended to tunable plant transpiration by showing for the first time that the transpiration efficiency can also be enhanced or suppressed through engineering the solar absorber-leaf interface. By tuning the solar absorption of membrane in direct touch with green leaf, surface temperature of green leaf will change accordingly because of photothermal effect, thus the transpiration efficiency as well as temperature and relative humidity in the surrounding environment will be tuned. This tunable transpiration by interfacial absorber-leaf engineering can open an alternative avenue to regulate local atmospheric temperature, humidity, and eventually hydrologic cycle.

  1. Tuning Transpiration by Interfacial Solar Absorber‐Leaf Engineering

    Science.gov (United States)

    Zhuang, Shendong; Zhou, Lin; Xu, Weichao; Xu, Ning; Hu, Xiaozhen; Li, Xiuqiang; Lv, Guangxin; Zheng, Qinghui; Zhu, Shining

    2017-01-01

    Abstract Plant transpiration, a process of water movement through a plant and its evaporation from aerial parts especially leaves, consumes a large component of the total continental precipitation (≈48%) and significantly influences global water distribution and climate. To date, various chemical and/or biological explorations have been made to tune the transpiration but with uncertain environmental risks. In recent years, interfacial solar steam/vapor generation is attracting a lot of attention for achieving high energy transfer efficiency. Various optical and thermal designs at the solar absorber–water interface for potential applications in water purification, seawater desalination, and power generation appear. In this work, the concept of interfacial solar vapor generation is extended to tunable plant transpiration by showing for the first time that the transpiration efficiency can also be enhanced or suppressed through engineering the solar absorber–leaf interface. By tuning the solar absorption of membrane in direct touch with green leaf, surface temperature of green leaf will change accordingly because of photothermal effect, thus the transpiration efficiency as well as temperature and relative humidity in the surrounding environment will be tuned. This tunable transpiration by interfacial absorber‐leaf engineering can open an alternative avenue to regulate local atmospheric temperature, humidity, and eventually hydrologic cycle. PMID:29619300

  2. Leaf optical properties with explicit description of its biochemical composition: direct and inverse problems

    Energy Technology Data Exchange (ETDEWEB)

    Fourty, T. [INRA, Avignon (France); Baret, F.; Jacquemoud, S.; Schmuck, G.; Verdebout, J.

    1996-05-15

    spectral domain show poor predictive performances. In particular, the protein content is very poorly retrieved. The retrieval performances of several combinations of the biochemical compounds are investigated. Results show that the total amount of dry matter per unit leaf area is the only variable to be accurately retrieved. Possible improvements of these results are discussed. (author)

  3. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  4. Leaf Surface Effects on Retrieving Chlorophyll Content from Hyperspectral Remote Sensing

    Science.gov (United States)

    Qiu, Feng; Chen, JingMing; Ju, Weimin; Wang, Jun; Zhang, Qian

    2017-04-01

    Light reflected directly from the leaf surface without entering the surface layer is not influenced by leaf internal biochemical content. Leaf surface reflectance varies from leaf to leaf due to differences in the surface roughness features and is relatively more important in strong absorption spectral regions. Therefore it introduces dispersion of data points in the relationship between biochemical concentration and reflectance (especially in the visible region). Separation of surface from total leaf reflection is important to improve the link between leaf pigments content and remote sensing data. This study aims to estimate leaf surface reflectance from hyperspectral remote sensing data and retrieve chlorophyll content by inverting a modified PROSPECT model. Considering leaf surface reflectance is almost the same in the visible and near infrared spectral regions, a surface layer with a reflectance independent of wavelength but varying from leaf to leaf was added to the PROSPECT model. The specific absorption coefficients of pigments were recalibrated. Then the modified model was inverted on independent datasets to check the performance of the model in predicting the chlorophyll content. Results show that differences in estimated surface layer reflectance of various species are noticeable. Surface reflectance of leaves with epicuticular waxes and trichomes is usually higher than other samples. Reconstruction of leaf reflectance and transmittance in the 400-1000 nm wavelength region using the modified PROSPECT model is excellent with low root mean square error (RMSE) and bias. Improvements for samples with high surface reflectance (e.g. maize) are significant, especially for high pigment leaves. Moreover, chlorophyll retrieved from inversion of the modified model is consequently improved (RMSE from 5.9-13.3 ug/cm2 with mean value 8.1 ug/cm2, while mean correlation coefficient is 0.90) compared to results of PROSPECT-5 (RMSE from 9.6-20.2 ug/cm2 with mean value 13

  5. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  6. Induced multiple disease resistance in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.; Worland, A.J.

    1990-01-01

    Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)

  7. Leaf Physiological and Morphological Responses to Shade in Grass-Stage Seedlings and Young Trees of Longleaf Pine

    Directory of Open Access Journals (Sweden)

    Lisa J. Samuelson

    2012-08-01

    Full Text Available Longleaf pine has been classified as very shade intolerant but leaf physiological plasticity to light is not well understood, especially given longleaf pine’s persistent seedling grass stage. We examined leaf morphological and physiological responses to light in one-year-old grass-stage seedlings and young trees ranging in height from 4.6 m to 6.3 m to test the hypothesis that young longleaf pine would demonstrate leaf phenotypic plasticity to light environment. Seedlings were grown in a greenhouse under ambient levels of photosynthetically active radiation (PAR or a 50% reduction in ambient PAR and whole branches of trees were shaded to provide a 50% reduction in ambient PAR. In seedlings, shading reduced leaf mass per unit area (LMA, the light compensation point, and leaf dark respiration (RD, and increased the ratio of light-saturated photosynthesis to RD and chlorophyll b and total chlorophyll expressed per unit leaf dry weight. In trees, shading reduced LMA, increased chlorophyll a, chlorophyll b and total chlorophyll on a leaf dry weight basis, and increased allocation of total foliar nitrogen to chlorophyll nitrogen. Changes in leaf morphological and physiological traits indicate a degree of shade tolerance that may have implications for even and uneven-aged management of longleaf pine.

  8. Assessment of antibacterial activity of crude leaf and root extracts of ...

    African Journals Online (AJOL)

    ... whether crude leaf and root extracts of Cassia alata (Caesalpiniaceae) have antimicrobial activity against clinically resistant Neisseria gonorrhoeae bacteria. To determine and compare the MICs of their ether and methanol extracts. Materials and methods: Ether and methanol extracts were prepared from the plant parts.

  9. Cytohistological study of the leaf structures of Panax ginseng Meyer and Panax quinquefolius L.

    Directory of Open Access Journals (Sweden)

    Ok Ran Lee

    2017-10-01

    Conclusion: The anatomical leaf structure of both P. ginseng and P. quinquefolius shows that they are typical shade-loving sciophytes. Slight differences in chloroplast structure suggests that the two different species can be authenticated using transmission electron microscopy images, and light-resistant cultivar breeding can be performed via controlling photosynthesis efficiency.

  10. Leaf protein and mineral concentrations across the "miracle tree" genus Moringa

    Science.gov (United States)

    The moringa tree Moringa oleifera is a fast-growing, drought-resistant tree cultivated across the lowland dry tropics worldwide for its nutritious leaves. Despite its nutritious reputation, there has been no systematic survey of the variation in leaf nutritional quality across M. oleifera grown worl...

  11. Coordination of leaf and stem water transport properties in tropical forest trees

    Science.gov (United States)

    Frederick C. Meinzer; David R. Woodruff; Jean-Christophe Domec; Guillermo Goldstein; Paula I. Campanello; Genoveva M. Gatti; Randol Villalobos-Vega

    2008-01-01

    Stomatal regulation of transpiration constrains leaf water potential (ψ l) within species-specific ranges that presumably avoid excessive tension and embolism in the stem xylem upstream. However, the hydraulic resistance of leaves can be highly variable over short time scales, uncoupling tension in the xylem of leaves from that in the...

  12. Defensive Responses of Rice Genotypes for Resistance Against Rice Leaffolder Cnaphalocrocis medinalis

    Directory of Open Access Journals (Sweden)

    M. PUNITHAVALLI

    2013-09-01

    Full Text Available The experiment was carried out to assess the reaction of different categories of rice genotypes viz., resistant, susceptible, hybrid, scented, popular and wild in response to the infestation by rice leaffolder (RLF, Cnaphalocrocis medinalis (Guenee and to explore the possible use of these genotypes in developing RLF-resistant rice varieties. The changes of various biochemical constituents such as leaf soluble protein, phenol, ortho-dihydroxy phenol, tannin and enzymes viz., peroxidase, phenyl alanine ammonia lyase (PAL were assessed spectrophotometrically in all the rice genotypes before and after RLF infestation. The protein profile was analyzed using sodium dodecyl sulphate-poly acrylamide gel electrophoresis (SDS-PAGE method. A significant constituent of biochemical content such as tannin, phenol and ortho-dihydroxy phenol has been increased along with enzyme activities of peroxidase and PAL in the infested resistant (Ptb 33, TKM6 and LFR831311 and wild rice genotypes (Oryza minuta and O. rhizomatis. A decrease in leaf protein content was evident invariably in all the infested rice genotypes. It is also evident that the contents of biochemicals such as phenol, ortho-dihydroxy phenol and tannin were negatively correlated with leaffolder damage. However, leaf protein content was positively correlated with the damage by rice leaffolder. SDS-PAGE analysis for total protein profiling of healthy and C. medinalis-infested genotypes revealed the enhanced expression of a high molecular weight (> 97 kDa protein in all the genotypes. Besides, there was also an increased induction of a 38 kDa protein in C. medinalis infested resistant genotypes, which was absent in uninfested plants. The present investigation proved that the elevated levels of biochemicals and enzymes may play a vital role in rice plants resistance to RLF.

  13. Leveraging multiple datasets for deep leaf counting

    OpenAIRE

    Dobrescu, Andrei; Giuffrida, Mario Valerio; Tsaftaris, Sotirios A

    2017-01-01

    The number of leaves a plant has is one of the key traits (phenotypes) describing its development and growth. Here, we propose an automated, deep learning based approach for counting leaves in model rosette plants. While state-of-the-art results on leaf counting with deep learning methods have recently been reported, they obtain the count as a result of leaf segmentation and thus require per-leaf (instance) segmentation to train the models (a rather strong annotation). Instead, our method tre...

  14. Antimalarial Activity of Methanolic Leaf Extract of Piper betle L.

    Directory of Open Access Journals (Sweden)

    Adel A. Amran

    2010-12-01

    Full Text Available The need for new compounds active against malaria parasites is made more urgent by the rapid spread of drug-resistance to available antimalarial drugs. The crude methanol extract of Piper betle leaves (50–400 mg/kg was investigated for its antimalarial activity against Plasmodium berghei (NK65 during early and established infections. The phytochemical and antioxidant potentials of the crude extract were evaluated to elucidate the possibilities of its antimalarial effects. The safety of the extract was also investigated in ICR mice of both sexes by the acute oral toxicity limit test. The leaf extract demonstrated significant (P < 0.05 schizonticidal activity in all three antimalarial evaluation models. Phytochemical screening showed that the leaf extract contains some vital antiplasmodial chemical constituents. The extract also exhibited a potent ability to scavenge the free radicals. The results of acute toxicity showed that the methanol extract of Piper betle leaves is toxicologically safe by oral administration. The results suggest that the Malaysian folklorical medicinal application of the extract of Piper betle leaf has a pharmacological basis.

  15. Mango leaf gall formation: varietal susceptibility and within tree distribution

    International Nuclear Information System (INIS)

    Khan, H.A.; Akram, W.; Khan, M.A.

    2012-01-01

    The present study was carried out to screen most commonly cultivated mango, Mangifera indica L., cultivars for their susceptibility to gall formation. Sarooli cultivar proved to be the most resistant one by having a minimum number of galls per 100 leaves. The abundance of galls in four quadrants of the tree i.e., east, west, north and south, was also studied which revealed that east quadrant had maximum number of galls while the abundance of galls in the remaining quadrants was variable. Gall formation on mango leaves seemed to increase gradually with increasing height from the ground level, reached a maximum at the height 12 ft to 16 ft and then declined. Leaf area measurements and nutrient analysis of the leaves were also done to see their impact on gall formation. Correlation analysis revealed that gall formation was positively linked with leaf area and the amount of Zn (ppm), P (%), K (%) while N (%) had negative correlation (P<0.05) with gall formation. In conclusion, the findings of the present study could be helpful in the management of mango leaf gall formation. (author)

  16. Leaf sequencing algorithms for segmented multileaf collimation

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Li, Jonathan; Palta, Jatinder; Ranka, Sanjay

    2003-01-01

    The delivery of intensity-modulated radiation therapy (IMRT) with a multileaf collimator (MLC) requires the conversion of a radiation fluence map into a leaf sequence file that controls the movement of the MLC during radiation delivery. It is imperative that the fluence map delivered using the leaf sequence file is as close as possible to the fluence map generated by the dose optimization algorithm, while satisfying hardware constraints of the delivery system. Optimization of the leaf sequencing algorithm has been the subject of several recent investigations. In this work, we present a systematic study of the optimization of leaf sequencing algorithms for segmental multileaf collimator beam delivery and provide rigorous mathematical proofs of optimized leaf sequence settings in terms of monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation constraint and leaf interdigitation constraint. Our analytical analysis shows that leaf sequencing based on unidirectional movement of the MLC leaves is as MU efficient as bidirectional movement of the MLC leaves

  17. Leaf sequencing algorithms for segmented multileaf collimation

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States)

    2003-02-07

    The delivery of intensity-modulated radiation therapy (IMRT) with a multileaf collimator (MLC) requires the conversion of a radiation fluence map into a leaf sequence file that controls the movement of the MLC during radiation delivery. It is imperative that the fluence map delivered using the leaf sequence file is as close as possible to the fluence map generated by the dose optimization algorithm, while satisfying hardware constraints of the delivery system. Optimization of the leaf sequencing algorithm has been the subject of several recent investigations. In this work, we present a systematic study of the optimization of leaf sequencing algorithms for segmental multileaf collimator beam delivery and provide rigorous mathematical proofs of optimized leaf sequence settings in terms of monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation constraint and leaf interdigitation constraint. Our analytical analysis shows that leaf sequencing based on unidirectional movement of the MLC leaves is as MU efficient as bidirectional movement of the MLC leaves.

  18. Enhancement of Biogas Yield of Poplar Leaf by High-Solid Codigestion with Swine Manure.

    Science.gov (United States)

    Wangliang, Li; Zhikai, Zhang; Guangwen, Xu

    2016-05-01

    The aim of this work was to examine the improvement of anaerobic biodegradability of organic fractions of poplar leaf from codigestion with swine manure (SM), thus biogas yield and energy recovery. When poplar leaf was used as a sole substrate, the cumulative biogas yield was low, about 163 mL (g volatile solid (VS))(-1) after 45 days of digestion with a substrate/inoculum ratio of 2.5 and a total solid (TS) of 22 %. Under the same condition, the cumulative biogas yield of poplar leaf reached 321 mL (g VS)(-1) when SM/poplar leaf ratio was 2:5 (based on VS). The SM/poplar leaf ratio can determine C/N ratio of the cosubstrate and thus has significant influence on biogas yield. When the SM/poplar leaf ratio was 2:5, C/N ratio was calculated to be 27.02, and the biogas yield in 45 days of digestion was the highest. The semi-continuous digestion of poplar leaf was carried out with the organic loading rate of 1.25 and 1.88 g VS day(-1). The average daily biogas yield was 230.2 mL (g VS)(-1) and 208.4 mL (g VS)(-1). The composition analysis revealed that cellulose and hemicellulose contributed to the biogas production.

  19. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Purpose: To optimize extraction of total triterpene acids from loquat leaf and evaluate their in vitro antioxidant activities. Methods: The independent variables were ethanol concentration, extraction time, and solvent ratio, while the dependent variable was content of total triterpene acids. Composite design and response ...

  20. Antimicrobial potential of leaf and fruit extracts and oils of wild and cultivated edible olive

    International Nuclear Information System (INIS)

    Hussain, A.; Qurshi, I.A.; Liaqat, R.; Akhtar, S.; Aziz, I.

    2014-01-01

    Olive tree is the first botanical noted in the Bible. Leaves and fruits of olive are rich sources of Phenols, triterpenes, and flavanoids. Oleuropein obtained from the leaves extract is believed to be important therapeutic compound. Olive leaf and oils are used for the treatment of different diseases as folklore medicines by different ethnic groups in different countries of the world. The present study aims to investigate the potential antimicrobial activities of wild (Olea ferruginea) and edible (Olea europaea) olive leaf crude extracts, crude oils from ripe and unripe fruits and extra virgin oils against the selected gram positive and gram negative bacterial strains. The results show that olive leaf and oil have potential antibacterial activities against some of the gram positive and gram negative bacterial strains. However, certain strains were resistant to the extracts. It was also found that the activities were higher for the gram negative strains as compared to gram positive strains. The methanolic and ethanolic extracts were found to be more efficient in extraction than the other solvents used. Leaf extracts were more effective than the oil extracted from ripe and unripe fruits. There was no significant difference in the activities of extra virgin oils and crude leaf extracts. From the results it is concluded that the leaf extract is a cheap and effective antibacterial agent that can be used as alternative to purified oil. (author)

  1. Effect of Addition of Moringa Leaf By-Product (Leaf-Waste) on ...

    African Journals Online (AJOL)

    The effects of incorporation of Moringa leaf fibre (a by-product of leaf processing which contains 24% Crude Fibre by dry weight at 0, 5 and 10 % substitution of wheat flour in cookies was investigated. Three products containing wheat flour: Moringa leaf fibre ratios of 100:0, 95:5, and 90:10 respectively were prepared, and a ...

  2. Specific leaf area estimation from leaf and canopy reflectance through optimization and validation of vegetation indices

    NARCIS (Netherlands)

    Ali, A.M.; Darvishzadeh, R.; Skidmore, A.K.; van Duren, I.C.

    2017-01-01

    Specific leaf area (SLA), which is defined as the leaf area per unit of dry leaf mass is an important component when assessing functional diversity and plays a key role in ecosystem modeling, linking plant carbon and water cycles as well as quantifying plant physiological processes. However, studies

  3. Leaf size and leaf display of thirty-eight tropical tree species

    NARCIS (Netherlands)

    Poorter, L.; Rozendaal, D.M.A.

    2008-01-01

    Trees forage for light through optimal leaf display. Effective leaf display is determined by metamer traits (i.e., the internode, petiole, and corresponding leaf), and thus these traits strongly co-determine carbon gain and as a result competitive advantage in a light-limited environment. We

  4. Using a Chlorophyll Meter to Evaluate the Nitrogen Leaf Content in Flue-Cured Tobacco (Nicotiana tabacum L.

    Directory of Open Access Journals (Sweden)

    Fabio Castelli

    2009-06-01

    Full Text Available In flue-cured tobacco N fertilizer is commonly applied during pre-planting, and very often applied again later as a growth-starter. It is generally held that the efficiency of N-fertilizer use can be improved by evaluating the leaf Nstatus after transplanting and until flowering stage. N use efficiency in this context does not refer merely to the yield but also to the quality, in the meanwhile minimizing the negative effects on the environment. To investigate these aspects, we evaluated the capacity of a Minolta model SPAD-502 chlorophyll meter to estimate the N-status in flue-cured tobacco. The aims was to verify if a relationship exists between SPAD readings and leaf N content, and if a single leaf, in a well defined stalk position, could represent the nitrogen content of the whole plant. During the years 1995 and 1996, a pot experiment was conducted using two flue-cured tobacco varieties. SPAD values, total chlorophyll, total N contents and leaf area were measured throughout the growing season, on each odd leaf stalk position. SPAD values were well-correlated with both total chlorophyll and total N leaf concentration, and the regression coefficients were higher when relationships were calculated on a leaf-area basis. For both relationships, SPAD-total chlorophyll and SPAD-total N, the best fittings were obtained with quadratic equations. One leaf stalk position alone is able to monitor the N-status of the whole plant during the first six weeks after transplanting, without distinction of year and variety effects. The SPAD measurement of one leaf per plant, throughout the vegetative growing season, is therefore a valid tool to test the N-status of the crop in a period when a required N supply is still effective.

  5. Incorporation of resistance to angular leaf spot and bean common ...

    African Journals Online (AJOL)

    Luseko

    2013-07-03

    Jul 3, 2013 ... indicating high reliability for markers. In selection, it was ... Generation of breeding lines. Planting was .... the variances from the distribution of the score data for ALS disease. ... were distributed along the scale but it skewed to the left side showing ..... Standard system for the evaluation of bean germplasm.

  6. Research Note Genetics of resistance to Cercospora leaf spot ...

    Indian Academy of Sciences (India)

    ACER

    2Cenler for Advanced Studies for Agriculturc and Food (CASAF), Kasetsart University. Institute for ... Generation mean analysis showed that a simple additive- ... Artificial inoculation was also carried out at 40 and 50 days after planting.

  7. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Generation means and variance analyses were performed for the estimation of ... population falls into clearly defined and easily recogni- zable categories by ... additive x dominance and dominance x dominance gene effects.

  8. Genetic diversity in upland cotton for cotton leaf curl virus disease, earliness and fiber quality

    International Nuclear Information System (INIS)

    Saeed, F.; Farooq, J.; Mahmood, A.; Hussain, T.

    2014-01-01

    In Pakistan during last two decades the major factor limiting cotton production is cotton leaf curl virus disease (CLCuD). For estimation of genetic diversity regarding CLCuD tolerance, fiber quality and some yield contributing traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like days taken to 1 square and days taken to 1 flower had positive correlation with each other and both these traits also showed their positive association with ginning out turn. The negative significant correlation of CLCuD was obtained with monopodial branches, sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st cluster 1 only showed reasonable values for days to 1 square and flower, sympodia per plant, ginning out turn, staple length and fiber fineness and the genotypes in cluster 5 showed promising values for the traits like cotton leaf curl virus, ginning out turn and fiber fineness. The genotypes in cluster 1 and 5 may be combined to obtain desirable traits related to earliness and better disease tolerance. Scatter plot and tree diagrams demonstrated sufficient diversity among the cotton accessions for various traits and some extent of association between various clusters. It is concluded that diversity among the genotypes could be utilized for the development of CLCuD resistant lines with increased seed

  9. Development of abiotic-stress resistant warm season trufgrasses by proton-beam irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Y. W.; Kim, J. Y.; Jeong, S. H. [Korea Univ., Seoul (Korea, Republic of)

    2007-04-15

    The direct use of mutation is a valuable approach to generate genetic variation in crop species by altering agronomically useful major traits. The proton beam, as a mutagen, was applied to improve resistance traits of Zoysia grass under various abiotic stresses. Proton beam was irradiated to mature dry seeds of Zenith (Zoysia grass), which is well-adapted to Korean climate, using a proton- accelerator with seven different doses (50, 100, 150, 200, 250, 300, 400 Gy). Individual seedling of M1 plant was transplanted from the seed bed and allowed to reach appropriate plant mass. Clones that showed superior growth were chosen and transplanted to pots for further clone propagation and field evaluation. Growth characteristics of turfgrass, such as plant height, leaf length, leaf width, number of tiller were evaluated ninety days after sowing. Although large variation within each dose, noticeable differences were found among different irradiated doses. Most of the mutant clones derived from the irradiation treatment showed more vigorous growth than the control plants. RAPD (Random Amplified Polymorphic DNA) and AFLP (Amplified Fragment Length Polymorphism) methods were conducted to analyze genomic variations associated with proton beam irradiation. In order to establish selection criteria for selection of salt-stress resistance plants, an in vitro method that is able to select salt-stress resistant mutants in liquid media without ambient disturbances. Total 647 predominance clones that were considered as abiotic stress resistant mutants were transplanted to the field for further evaluation.

  10. Tensile bond strength of self-etching versus total-etching adhesive systems under different dentinal substrate conditions Resistência de união à tração de sistemas adesivos autocondicionantes versus de condicionamento total, em diferentes condições de substrato dentinário

    Directory of Open Access Journals (Sweden)

    Alexandre Henrique Susin

    2007-03-01

    Full Text Available The use of acid etchants to produce surface demineralization and collagen network exposure, allowing adhesive monomers interdiffusion and consequently the formation of a hybrid layer, has been considered the most efficient mechanism of dentin bonding. The aim of this study was to compare the tensile bond strength to dentin of three adhesive systems, two self-etching ones (Clearfil SE Bond - CSEB and One Up Bond F - OUBF and one total-etching one (Single Bond - SB, under three dentinal substrate conditions (wet, dry and re-wet. Ninety human, freshly extracted third molars were sectioned at the occlusal surface to remove enamel and to form a flat dentin wall. The specimens were restored with composite resin (Filtek Z250 and submitted to tensile bond strength testing (TBS in an MTS 810. The data were submitted to two-way ANOVA and Tukey's test (p = 0.05. Wet dentin presented the highest TBS values for SB and CSEB. Dry dentin and re-wet produced significantly lower TBS values when using SB. OUBF was not affected by the different conditions of the dentin substrate, producing similar TBS values regardless of the surface pretreatments.O uso de condicionadores ácidos para desmineralizar a superfície dental e expor a rede de fibras colágenas para interdifusão dos monômeros adesivos e conseqüente formação da camada híbrida tem sido considerado o mais eficiente mecanismo de adesão dos agentes de união. O objetivo deste estudo foi comparar a resistência de união à dentina de três sistemas adesivos, dois autocondicionantes (Clearfil SE Bond - CSEB e One Up Bond F - OUBF e um de condicionamento total (Single Bond - SB, sob três diferentes condições de substrato dentinário (úmido, seco e reidratado. Noventa terceiros molares humanos recém-extraídos foram cortados na superfície oclusal, para se remover o esmalte e formar uma parede plana de dentina. Os espécimes foram restaurados com resina composta (Filtek Z250 e submetidos ao teste de

  11. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    Science.gov (United States)

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  12. TLC profiles and antibacterial activity of Glinus oppositifolius L. Aug. DC. (Molluginaceae leaf and stem extracts against bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Juliana Janet R. Martin-Puzon

    2015-07-01

    Full Text Available Objective: To determine the antibacterial activities and the thin-layer chromatography (TLC fingerprint profiles of leaf and stem extracts of Glinus oppositifolius L. Aug. DC (G. oppositifolius. Methods: The leaves and stems were extracted using chloroform, ethanol and methanol as solvents. The antibacterial activity of the extracts were evaluated through disc diffusion, minimum inhibitory concentration and bactericidal concentration assays against methicillinresistant Staphylococcus aureus, vancomycin-resistant Enterococcus, extended spectrum β-lactamase-producing, carbapenem-resistant Enterobacteriaceae, and metallo-β-lactamaseproducing Pseudomonas aeruginosa (P. aeruginosa and Acinetobacter baumanii (A. baumanii. The TLC separation was carried out on leaf and stem ethanol extracts in ethyl acetate: n-hexane solvent system. Distinct spots were examined under visible light, UV 254 nm, UV 366 nm and after spraying with vanillin-sulfuric acid. Results: The leaf extracts revealed antibacterial activities, inhibiting the growth of the nonresistant and multidrug-resistant strains of the Gram-negative bacteria Escherichia coli, P. aeruginosa and A. baumanii. The TLC fingerprint profiles demonstrated the presence of various phytochemicals in leaf and stem extracts. Leaf extracts exhibited more diverse constituents compared to stem extracts, but some constituents were similar in both plant parts. Conclusions: G. oppositifolius leaf extracts can be used as new, alternative sources of antimicrobials against non-resistant and multidrug-resistant strains of the Gram-negative bacteria Escherichia coli, P. aeruginosa and A. baumanii. The TLC profiles represent the chemical integrity of G. oppositifolius leaf and stem extracts which form an important and powerful tool for standardization, authentication, quality control and determination of bioactive components of G. oppositifolius in any formulation and in powder form.

  13. Spectral measurements at different spatial scales in potato: relating leaf, plant and canopy nitrogen status

    Science.gov (United States)

    Jongschaap, Raymond E. E.; Booij, Remmie

    2004-09-01

    Chlorophyll contents in vegetation depend on soil nitrogen availability and on crop nitrogen uptake, which are important management factors in arable farming. Crop nitrogen uptake is important, as nitrogen is needed for chlorophyll formation, which is important for photosynthesis, i.e. the conversion of absorbed radiance into plant biomass. The objective of this study was to estimate leaf and canopy nitrogen contents by near and remote sensing observations and to link observations at leaf, plant and canopy level. A theoretical base is presented for scaling-up leaf optical properties to whole plants and crops, by linking different optical recording techniques at leaf, plant and canopy levels through the integration of vertical nitrogen distribution. Field data come from potato experiments in The Netherlands in 1997 and 1998, comprising two potato varieties: Eersteling and Bintje, receiving similar nitrogen treatments (0, 100, 200 and 300 kg N ha -1) in varying application schemes to create differences in canopy nitrogen status during the growing season. Ten standard destructive field samplings were performed to follow leaf area index and crop dry weight evolution. Samples were analysed for inorganic nitrogen and total nitrogen contents. At sampling dates, spectral measurements were taken both at leaf level and at canopy level. At leaf level, an exponential relation between SPAD-502 readings and leaf organic nitrogen contents with a high correlation factor of 0.91 was found. At canopy level, an exponential relation between canopy organic nitrogen contents and red edge position ( λrep, nm) derived from reflectance measurements was found with a good correlation of 0.82. Spectral measurements (SPAD-502) at leaf level of a few square mm were related to canopy reflectance measurements (CropScan™) of approximately 0.44 m 2. Statistical regression techniques were used to optimise theoretical vertical nitrogen profiles that allowed scaling-up leaf chlorophyll measurements

  14. From leaf to whole-plant water use efficiency (WUE in complex canopies: Limitations of leaf WUE as a selection target

    Directory of Open Access Journals (Sweden)

    Hipólito Medrano

    2015-06-01

    Full Text Available Plant water use efficiency (WUE is becoming a key issue in semiarid areas, where crop production relies on the use of large volumes of water. Improving WUE is necessary for securing environmental sustainability of food production in these areas. Given that climate change predictions include increases in temperature and drought in semiarid regions, improving crop WUE is mandatory for global food production. WUE is commonly measured at the leaf level, because portable equipment for measuring leaf gas exchange rates facilitates the simultaneous measurement of photosynthesis and transpiration. However, when those measurements are compared with daily integrals or whole-plant estimates of WUE, the two sometimes do not agree. Scaling up from single-leaf to whole-plant WUE was tested in grapevines in different experiments by comparison of daily integrals of instantaneous water use efficiency [ratio between CO2 assimilation (AN and transpiration (E; AN/E] with midday AN/E measurements, showing a low correlation, being worse with increasing water stress. We sought to evaluate the importance of spatial and temporal variation in carbon and water balances at the leaf and plant levels. The leaf position (governing average light interception in the canopy showed a marked effect on instantaneous and daily integrals of leaf WUE. Night transpiration and respiration rates were also evaluated, as well as respiration contributions to total carbon balance. Two main components were identified as filling the gap between leaf and whole plant WUE: the large effect of leaf position on daily carbon gain and water loss and the large flux of carbon losses by dark respiration. These results show that WUE evaluation among genotypes or treatments needs to be revised.

  15. Leaf development of soybean and bean crops and weeds

    International Nuclear Information System (INIS)

    Procopio, Sergio de Oliveira; Santos, Jose Barbosa do; Silva, Antonio Alberto da; Costa, Luiz Claudio

    2003-01-01

    The objective of this study was to compare the emission rate and expansion of the leaves, duration of the leaf area (DLA) and the extinction coefficient (k) for the crops soybean and of the bean, and for the weeds Euphorbia heterophylla sensitive and Euphorbia heterophylla resistant to the herbicides inhibiting of the ALS enzyme, Bidens pilosa and Desmodium tortuosum. The experiment was developed in the field, in soil classified as Red-Yellow Claysoil, in the period of october of 2000 to march of 2001. Each plant species consisted of a treatment. The treatments were arranged in a randomized complete block design with four replications. The mensurations of the photosynthetically active radiation (PAR) were accomplished in two points of the plants: above and bellow the canopy, by means of a light ceptometer. The emission rate and the expansion of leaves was calculated at the end of the cycle of the crops. The DLA and k were calculated before and after the plant flowering. It was not observed differences in the development of the biotypes of E. heterophylla with relation to the rate of appearance of leaves, expansion rate, DLA or k. Among the cultures, the bean presented smaller leaf emission rate (0.591 / day) compared to the soybean (0.933 / day). Among the weeds, the largest leaf emission rate was with D. tortuosum (0.699 / day). The leaf expansion rate observed by the soybean was superior to all the other species (6.77 cm 2 .day-1). All plant species presented larger value for DLA after the flowering compared before flowering. The soybean presented larger value of k (before and after the flowering 0.52 and 0.93, respectively) compared to the other species, demonstrating high potential of interception of solar radiation. (author)

  16. Phytochemical analysis and gastroprotective activity of an olive leaf extract

    Directory of Open Access Journals (Sweden)

    IVANA ARSIĆ

    2009-04-01

    Full Text Available Some medicinal features of olive leaf have been known for centuries. It has been traditionally used as an antimicrobial and to prevent and treat diabetes mellitus and heart disease. Whether olive leaf, a natural antioxidant, influences the gastric defense mechanism and exhibits gastroprotection against experimentally-induced gastric lesions remains unknown. In this study, the content of total phenols, total flavonoids and tannins in olive leaf extract (OLE were determined. Seven phenolic compounds were identified and quantified (oleuropein, caffeic acid, luteolin, luteolin-7-O-glucoside, apigenin-7-O-glucoside, quercetin, and chryseriol. Furthermore, the protective activity of the OLE in gastric mucosal injury induced by a corrosive concentration of ethanol was investigated. In relation to the control group, pretreatment with OLE (40, 80 and 120 mg kg-1 significantly (p < 0.001 attenuated the gastric lesions induced by absolute ethanol. The protective effect of the OLE was similar to that obtained with a reference drug, ranitidine. The results obtained indicate that OLE possesses significant gastroprotective activity, and that the presence of compounds with antioxidative properties would probably explain this effect.

  17. Effect of drought stress on leaf soluble sugar content, leaf rolling index and relative water content of proso millet (Panicum miliaceum L. genotypes

    Directory of Open Access Journals (Sweden)

    mohamad javad seghatol eslami

    2009-06-01

    Full Text Available With respect to water shortage in arid and semi- arid regions, the study about drought stress effects on crop plants and selection of resistance cultivars, are among the most important goals in the agricultural researches. In order to examine drought stress effects on millet, an experiment was conducted in Birjand and Sarbisheh, simultaneously. In this experiment, five irrigation treatments (well-watered, drought stress in vegetative stage, in ear emergence stage, in seed filling stage and in vegetative and seed filling stage and five proso millet genotypes (Native, K-C-M.2, K-C-M.4, K-C-M.6 and K-C-M.9 were compared in a split plot design along with three replications. Drought stress increased grain protein content, leaf rolling index and soluble sugars concentration and decreased seed germination and leaf RWC. Although seed protein content and germination percentage of genotypes were not significantly different, there were some differences among leaf rolling index, RWC and soluble sugar content of these genotypes. The results of this study indicated that leaf sugar content, RWC and leaf rolling index can not be considered as the only parameters for selection of high yield genotypes. Therefore, it is recommended that some other factors should also be used apart from the above mentioned ones.

  18. "Breath figures" on leaf surfaces-formation and effects of microscopic leaf wetness.

    Science.gov (United States)

    Burkhardt, Juergen; Hunsche, Mauricio

    2013-01-01

    "Microscopic leaf wetness" means minute amounts of persistent liquid water on leaf surfaces which are invisible to the naked eye. The water is mainly maintained by transpired water vapor condensing onto the leaf surface and to attached leaf surface particles. With an estimated average thickness of less than 1 μm, microscopic leaf wetness is about two orders of magnitude thinner than morning dewfall. The most important physical processes which reduce the saturation vapor pressure and promote condensation are cuticular absorption and the deliquescence of hygroscopic leaf surface particles. Deliquescent salts form highly concentrated solutions. Depending on the type and concentration of the dissolved ions, the physicochemical properties of microscopic leaf wetness can be considerably different from those of pure water. Microscopic leaf wetness can form continuous thin layers on hydrophobic leaf surfaces and in specific cases can act similar to surfactants, enabling a strong potential influence on the foliar exchange of ions. Microscopic leaf wetness can also enhance the dissolution, the emission, and the reaction of specific atmospheric trace gases e.g., ammonia, SO2, or ozone, leading to a strong potential role for microscopic leaf wetness in plant/atmosphere interaction. Due to its difficult detection, there is little knowledge about the occurrence and the properties of microscopic leaf wetness. However, based on the existing evidence and on physicochemical reasoning it can be hypothesized that microscopic leaf wetness occurs on almost any plant worldwide and often permanently, and that it significantly influences the exchange processes of the leaf surface with its neighboring compartments, i.e., the plant interior and the atmosphere. The omission of microscopic water in general leaf wetness concepts has caused far-reaching, misleading conclusions in the past.

  19. ‘Breath figures’ on leaf surfaces – formation and effects of microscopic leaf wetness

    Directory of Open Access Journals (Sweden)

    Jürgen eBurkhardt

    2013-10-01

    Full Text Available ‘Microscopic leaf wetness’ means minute amounts of persistent liquid water on leaf surfaces which are invisible to the naked eye. The water is mainly maintained by transpired water vapor condensing onto the leaf surface and to attached leaf surface particles. With an estimated average thickness of less than 1 µm, microscopic leaf wetness it is about 2 orders of magnitude thinner than morning dewfall. The most important physical processes which reduce the saturation vapor pressure and promote condensation are cuticular absorption and the deliquescence of hygroscopic leaf surface particles. Deliquescent salts form highly concentrated solutions. Depending on the amount and concentration of the dissolved ions, the physicochemical properties of microscopic leaf wetness can be considerably different from those of pure water. Microscopic leaf wetness can form continuous thin layers on hydrophobic leaf surfaces and in specific cases can act similar to surfactants, enabling a strong potential influence on the foliar exchange of ions. Microscopic leaf wetness can also enhance the dissolution, the emission, and the reaction of specific atmospheric trace gases e.g. ammonia, SO2, or ozone, leading to a strong potential role for microscopic leaf wetness in plant/atmosphere interaction. Due to its difficult detection, there is little knowledge about the occurrence and the properties of microscopic leaf wetness. However, based on the existing evidence and on physicochemical reasoning it can be hypothesized that microscopic leaf wetness occurs on almost any plant worldwide and often permanently, and that it significantly influences the exchange processes of the leaf surface with its neighboring compartments, i.e., the plant interior and the atmosphere. The omission of microscopic water in general leaf wetness concepts has caused far-reaching, misleading conclusions in the past.

  20. Leaf anatomy of the South African Danthonieae (Poaceae. XIII. Pentameris macrocalycina and P. obtusifolia

    Directory of Open Access Journals (Sweden)

    R. P. Ellis

    1984-12-01

    Full Text Available The leaf blade anatomy of Peniameris macrocalycina (Steud. Schweick. and P. obtusifolia (Hochst, Schweick. is described and illustrated. The leaf anatomy of these two species shows many similarities suggesting a close relationship between them. A slight problem appears to exist with the circumscription of P. obtusifolia and a minor taxonomic adjustment may result in a classification which agrees totally with that based on leaf anatomy. This would result in details of the leaf outline being diagnostic for these two taxa. The nomenclature of P. obtusifolia is also very confusing and clarification is needed by reference to the relevant type specimens. P. macrocalycina and P. obtusifolia together with  P. longiglumis (Nees Stapf, appear to form a distinct genus and do not bear close anatomical resemblances to either P. thuarri Beauv. or P. dregeana Stapf.

  1. Relation between Silver Nanoparticle Formation Rate and Antioxidant Capacity of Aqueous Plant Leaf Extracts

    Directory of Open Access Journals (Sweden)

    Azat Akbal

    2016-01-01

    Full Text Available Correlation between the antioxidant capacity and silver nanoparticle formation rates of pomegranate (Punica granatum, quince (Cydonia oblonga, chestnut (Castanea sativa, fig (Ficus carica, walnut (Juglans cinerea, black mulberry (Morus nigra, and white mulberry (Morus alba leaf extracts is investigated at a fixed illumination. Silver nanoparticles formed in all plant leaf extracts possess round shapes with average particle size of 15 to 25 nm, whereas corresponding surface plasmon resonance peak wavelengths vary between 422 nm and 451 nm. Cupric reducing antioxidant capacity technique is used as a reference method to determine total antioxidant capacity of the plant leaf extracts. Integrated absorbance over the plasmon resonance peaks exhibits better linear relation with antioxidant capacities of various plant leaf extracts compared to peak absorbance values, with correlation coefficient values of 0.9333 and 0.7221, respectively.

  2. Impact of phenolic compounds and related enzymes in Sorghum varieties for resistance and susceptibility to biotic and abiotic stresses

    NARCIS (Netherlands)

    Dicko, M.H.; Gruppen, H.; Barro, C.; Traore, A.S.; Berkel, van W.J.H.; Voragen, A.G.J.

    2005-01-01

    Contents of phenolic compounds and related enzymes before and after sorghum grain germination were compared between varieties either resistant or susceptible to biotic (sooty stripe, sorghum midge, leaf anthracnose, striga, and grain molds) and abiotic (lodging, drought resistance, and photoperiod

  3. Leaf Wetness within a Lily Canopy

    NARCIS (Netherlands)

    Jacobs, A.F.G.; Heusinkveld, B.G.; Klok, E.J.

    2005-01-01

    A wetness duration experiment was carried out within a lily field situated adjacent to coastal dunes in the Netherlands. A within-canopy model was applied to simulate leaf wetness in three layers, with equal leaf area indices, within the canopy. This simulation model is an extension of an existing

  4. 7 CFR 29.3528 - Leaf surface.

    Science.gov (United States)

    2010-01-01

    ... INSPECTION Standards Official Standard Grades for Dark Air-Cured Tobacco (u.s. Types 35, 36, 37 and Foreign Type 95) § 29.3528 Leaf surface. The roughness or smoothness of the web or lamina of a tobacco leaf...

  5. Estimation of leaf area in tropical maize

    NARCIS (Netherlands)

    Elings, A.

    2000-01-01

    Leaf area development of six tropical maize cultivars grown in 1995 and 1996 in several tropical environments in Mexico (both favourable and moisture-and N-limited) was observed and analysed. First, the validity of a bell-shaped curve describing the area of individual leaves as a function of leaf

  6. Chromosome-damaging effect of betel leaf.

    Science.gov (United States)

    Sadasivan, G; Rani, G; Kumari, C K

    1978-05-01

    The chewing of betel leaf with other ingredients is a widespread addiction in India. The chromosome damaging effect was studied in human leukocyte cultures. There was an increase in the frequency of chromatid aberrations when the leaf extract was added to cultures.

  7. ANXIOLYTIC ACTIVITY OF OCIMUM SANCTUM LEAF EXTRACT

    OpenAIRE

    Chattopadhyay, R.R.

    1994-01-01

    The anxiolytic activity of Ocimum sanctum leaf extract was studied in mice. O.sanctum leaf extract produced significant anxiolytic activity in plus – maze and open field behaviour test models. The effect was compared with diazepam, a standard antianxiety drug.

  8. 7 CFR 29.2530 - Leaf structure.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf structure. 29.2530 Section 29.2530 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing...-Cured Tobacco (u.s. Types 22, 23, and Foreign Type 96) § 29.2530 Leaf structure. The cell development of...

  9. 7 CFR 29.2278 - Leaf structure.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Leaf structure. 29.2278 Section 29.2278 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... structure. The cell development of a leaf as indicated by its porosity. (See chart, § 29.2351.) ...