WorldWideScience

Sample records for total leaf resistance

  1. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  2. Resistance in winter barley against Ramularia leaf spot

    DEFF Research Database (Denmark)

    Hjortshøj, Rasmus Lund

    Ramularia leaf spot is an emerging disease in barley caused by R. collo-cygni. At present little is known about the resistance mechanisms carried out by the host plant to avoid disease development. Nor is the lifecycle of the fungus or its populations structure fully understood. To gain insight....... fulvum-tomato and S. tritici-wheat in order to find modelsystems to enhance interpretation of results from R. collo-cygni-barley interaction. Results from the mapping showed that resistance to Ramularia leaf spot is controlled by a number of QTL’s, some of which co-locate with other physiological traits....... The populations further segregated for physiological leaf spots, a phenomenon related to the leaf damage imposed by Rubellin, although, resistance to physiological leafspots appeared to come from the Ramularia leaf spot susceptible parent. The toxin assay further supported this result as the genotypes susceptible...

  3. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  4. Diallel analysis of leaf disease resistance in inbred Brazilian popcorn cultivars.

    Science.gov (United States)

    Vieira, R A; Scapim, C A; Moterle, L M; Tessmann, D J; Conrado, T V; Amaral Júnior, A T

    2009-12-01

    We estimated general and specific combining abilities and examined resistance to northern leaf blight (Exserohilum turcicum) and to gray leaf spot (Cercospora zeae-maydis) in a set of nine inbred popcorn lines. These inbreds were crossed in a complete diallel scheme without reciprocals, which produced 36 F(1) hybrids. Two experiments with a square lattice design and three replications were conducted during the 2008/2009 crop season, in Maringá, PR, Brazil. The severity of northern leaf blight and gray leaf spot was assessed under natural infestation conditions. Data were examined by individual and joint analysis of variance. Individual and joint Griffing's diallel analyses were carried out for adjusted means. General combining ability and specific combining ability were significant (P < 0.10) by the F-test for northern leaf blight and gray leaf spot infestation levels. This denotes that additive and non-additive gene effects both contributed to resistance to these diseases, but that the additive gene effects were more important. Among the inbred lines, P(8) and P(9) gave the highest resistance to northern leaf blight, and P(3) and P(4.3) gave the highest resistance to gray leaf spot. The hybrids P(7.4) x P(8) and P(4.3) x P(9) could be exploited by reciprocal recurrent selection to provide genotypes with both northern leaf blight and gray leaf spot resistance. Significant interaction between general combining ability and crop season (P < 0.10) denotes the importance of environment, even though the disease levels in the hybrids were quite consistent.

  5. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  6. Physico-chemical characterization of banana varieties resistant to black leaf streak disease for industrial purposes

    Directory of Open Access Journals (Sweden)

    Rossana Catie Bueno de Godoy

    2016-01-01

    Full Text Available ABSTRACT: Cultivated bananas have very low genetic diversity making them vulnerable to diseases such as black-Sigatoka leaf spot. However, the decision to adopt a new banana variety needs to be based on a robust evaluation of agronomical and physical-chemical characteristics. Here, we characterize new banana varieties resistant to black-Sigatoka leaf spot and compare them to the most widely used traditional variety (Grand Naine. Each variety was evaluated for a range of physic-chemical attributes associated with industrial processing and flavor: pH, TTA, TSS/TTA, total sugars, reducing sugars and non-reducing sugars, humidity, total solids and yield. The Thap Maeo variety had the highest potential as a substitute for the Grand Naine variety, having higher levels of total soluble solids, reducing sugars, total sugars and humidity. The Caipira and FHIA 2 varieties also performed well in comparison with the Grand Naine variety. Cluster analysis indicated that the Grand Naine variety was closely associated with varieties from the Gross Michel subgroup (Bucaneiro, Ambrosia and Calipso and the Caipira variety, all of which come from the same AAA genomic group. It was concluded that several of the new resistant varieties could potentially substitute the traditional variety in areas affected by black-Sigatoka leaf spot disease.

  7. Baby leaf lettuce germplasm enhancement: developing diverse populations with resistance to bacterial leaf spot caused by Xanthomonas campestris pv. vitians

    Science.gov (United States)

    Baby leaf lettuce cultivars with resistance to bacterial leaf spot (BLS) caused by Xanthomonas campestris pv. vitians (Xcv) are needed to reduce crop losses. The objectives of this research were to assess the genetic diversity for BLS resistance in baby leaf lettuce cultivars and to select early gen...

  8. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  9. Comparison of dwarf bamboos (Indocalamus sp.) leaf parameters to determine relationship between spatial density of plants and total leaf area per plant.

    Science.gov (United States)

    Shi, Pei-Jian; Xu, Qiang; Sandhu, Hardev S; Gielis, Johan; Ding, Yu-Long; Li, Hua-Rong; Dong, Xiao-Bo

    2015-10-01

    The relationship between spatial density and size of plants is an important topic in plant ecology. The self-thinning rule suggests a -3/2 power between average biomass and density or a -1/2 power between stand yield and density. However, the self-thinning rule based on total leaf area per plant and density of plants has been neglected presumably because of the lack of a method that can accurately estimate the total leaf area per plant. We aimed to find the relationship between spatial density of plants and total leaf area per plant. We also attempted to provide a novel model for accurately describing the leaf shape of bamboos. We proposed a simplified Gielis equation with only two parameters to describe the leaf shape of bamboos one model parameter represented the overall ratio of leaf width to leaf length. Using this method, we compared some leaf parameters (leaf shape, number of leaves per plant, ratio of total leaf weight to aboveground weight per plant, and total leaf area per plant) of four bamboo species of genus Indocalamus Nakai (I. pedalis (Keng) P.C. Keng, I. pumilus Q.H. Dai and C.F. Keng, I. barbatus McClure, and I. victorialis P.C. Keng). We also explored the possible correlation between spatial density and total leaf area per plant using log-linear regression. We found that the simplified Gielis equation fit the leaf shape of four bamboo species very well. Although all these four species belonged to the same genus, there were still significant differences in leaf shape. Significant differences also existed in leaf area per plant, ratio of leaf weight to aboveground weight per plant, and leaf length. In addition, we found that the total leaf area per plant decreased with increased spatial density. Therefore, we directly demonstrated the self-thinning rule to improve light interception.

  10. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  11. Pyramids of QTLs enhance host-plant resistance and Bt-mediated resistance to leaf-chewing insects in soybean.

    Science.gov (United States)

    Ortega, María A; All, John N; Boerma, H Roger; Parrott, Wayne A

    2016-04-01

    QTL-M and QTL-E enhance soybean resistance to insects. Pyramiding these QTLs with cry1Ac increases protection against Bt-tolerant pests, presenting an opportunity to effectively deploy Bt with host-plant resistance genes. Plant resistance to leaf-chewing insects minimizes the need for insecticide applications, reducing crop production costs and pesticide concerns. In soybean [Glycine max (L.) Merr.], resistance to a broad range of leaf-chewing insects is found in PI 229358 and PI 227687. PI 229358's resistance is conferred by three quantitative trait loci (QTLs): M, G, and H. PI 227687's resistance is conferred by QTL-E. The letters indicate the soybean Linkage groups (LGs) on which the QTLs are located. This study aimed to determine if pyramiding PI 229358 and PI 227687 QTLs would enhance soybean resistance to leaf-chewing insects, and if pyramiding these QTLs with Bt (cry1Ac) enhances resistance against Bt-tolerant pests. The near-isogenic lines (NILs): Benning(ME), Benning(MGHE), and Benning(ME+cry1Ac) were developed. Benning(ME) and Benning(MGHE) were evaluated in detached-leaf and greenhouse assays with soybean looper [SBL, Chrysodeixis includens (Walker)], corn earworm [CEW, Helicoverpa zea (Boddie)], fall armyworm [FAW, Spodoptera frugiperda (J.E. Smith)], and velvetbean caterpillar [VBC, Anticarsia gemmatalis (Hübner)]; and in field-cage assays with SBL. Benning(ME+cry1Ac) was tested in detached-leaf assays against SBL, VBC, and Southern armyworm [SAW, Spodoptera eridania (Cramer)]. In the detached-leaf assay, Benning(ME) showed the strongest antibiosis against CEW, FAW, and VBC. In field-cage conditions, Benning(ME) and Benning(MGHE) suffered 61 % less defoliation than Benning. Benning(ME+cry1Ac) was more resistant than Benning(ME) and Benning (cry1Ac) against SBL and SAW. Agriculturally relevant levels of resistance in soybean can be achieved with just two loci, QTL-M and QTL-E. ME+cry1Ac could present an opportunity to protect the durability of Bt

  12. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  13. Selection of valine-resistance in callus culture of Arabidopsis thaliana (L. Heynh. derived from leaf explants

    Directory of Open Access Journals (Sweden)

    Małgorzata D. Gaj

    2014-01-01

    Full Text Available The selection of valine-resistant mutants was carried out in leaf explant cultures of three Arabidopsis thaliana (L. Heynh. ecotypes: C-24, RLD and Columbia. The valine concentration used for in vitro selection, lethal for seed-growing plants, has not affected callus formation and growth. However, strong inhibition of shoot regeneration ability of calli growing under selection pressure was noticed. In total, 1043 explants were cultured on valine medium and 18 shoots were regenerated with an average frequency of 1.7 shoots per 100 calli. Most R1 shoots were sterile and seeds were collected from 3 plants. The transmission of valine-resistance to the sexual progeny of these plants was scored and the increased level of valine-resistance was found in progeny of one line - 61 C. This line originated from the culture of Columbia leaf explant and displayed tetraploid chromosome number.

  14. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  15. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  16. QTL mapping of resistance to gray leaf spot in maize.

    Science.gov (United States)

    Zhang, Yan; Xu, Ling; Fan, Xingming; Tan, Jing; Chen, Wei; Xu, Mingliang

    2012-12-01

    Gray leaf spot (GLS), caused by the causal fungal pathogen Cercospora zeae-maydis, is one of the most serious foliar diseases of maize worldwide. In the current study, a highly resistant inbred line Y32 and a susceptible line Q11 were used to produce segregating populations for both genetic analysis and QTL mapping. The broad-sense heritability (H (2)) for GLS resistance was estimated to be as high as 0.85, indicating that genetic factors played key roles in phenotypic variation. In initial QTL analysis, four QTL, located on chromosomes 1, 2, 5, and 8, were detected to confer GLS resistance. Each QTL could explain 2.53-23.90 % of the total phenotypic variation, predominantly due to additive genetic effects. Two major QTL, qRgls1 and qRgls2 on chromosomes 8 and 5, were consistently detected across different locations and replicates. Compared to the previous results, qRgls2 is located in a 'hotspot' for GLS resistance; while, qRgls1 does not overlap with any other known resistance QTL. Furthermore, the major QTL-qRgls1 was fine-mapped into an interval of 1.4 Mb, flanked by the markers GZ204 and IDP5. The QTL-qRgls1 could enhance the resistance percentages by 19.70-61.28 %, suggesting its usefulness to improve maize resistance to GLS.

  17. The genetic variance of resistance in M3 lines of rice against leaf blight disease

    International Nuclear Information System (INIS)

    Mugiono

    1979-01-01

    Seeds of Pelita I/1 rice variety were irradiated with 20, 30, 40 and 50 krad of gamma rays from a 60 Co source. Plants of M 3 lines were inoculated with bacterial leaf blight, Xanthomonas oryzae (Uzeda and Ishiyama) Downson, using clipping method. The coefficient of genetic variability of resistance against leaf blight disease increased with increasing dose. Highly significant difference in the genetic variance of resistance were found between the treated samples and the control. Dose of 20 krad gave good probability for selection of plants resistant against leaf blight disease. (author)

  18. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  19. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  20. Estimating the total leaf area of the green dwarf coconut tree (Cocos nucifera L.

    Directory of Open Access Journals (Sweden)

    Sousa Elias Fernandes de

    2005-01-01

    Full Text Available Leaf area has significant effect on tree transpiration, and its measurement is important to many study areas. This work aimed at developing a non-destructive, practical, and empirical method to estimate the total leaf area of green dwarf coconut palms (Cocos nucifera L. in plantations located at the northern region of Rio de Janeiro state, Brazil. A mathematical model was developed to estimate total leaf area values (TLA as function of the average lengths of the last three leaf raquis (LR3, and of the number of leaves in the canopy (NL. The model has satisfactory degree of accuracy for agricultural engineering purposes.

  1. Characterization and mapping of LanrBo: a locus conferring anthracnose resistance in narrow-leafed lupin (Lupinus angustifolius L.).

    Science.gov (United States)

    Fischer, Kristin; Dieterich, Regine; Nelson, Matthew N; Kamphuis, Lars G; Singh, Karam B; Rotter, Björn; Krezdorn, Nicolas; Winter, Peter; Wehling, Peter; Ruge-Wehling, Brigitte

    2015-10-01

    A novel and highly effective source of anthracnose resistance in narrow-leafed lupin was identified. Resistance was shown to be governed by a single dominant locus. Molecular markers have been developed, which can be used for selecting resistant genotypes in lupin breeding. A screening for anthracnose resistance of a set of plant genetic resources of narrow-leafed lupin (Lupinus angustifolius L.) identified the breeding line Bo7212 as being highly resistant to anthracnose (Colletotrichum lupini). Segregation analysis indicated that the resistance of Bo7212 is inherited by a single dominant locus. The corresponding resistance gene was given the designation LanrBo. Previously published molecular anchor markers allowed us to locate LanrBo on linkage group NLL-11 of narrow-leafed lupin. Using information from RNAseq data obtained with inoculated resistant vs. susceptible lupin entries as well as EST-sequence information from the model genome Lotus japonicus, additional SNP and EST markers linked to LanrBo were derived. A bracket of two LanrBo-flanking markers allows for precise marker-assisted selection of the novel resistance gene in narrow-leafed lupin breeding programs.

  2. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  3. Terpene Profile, Leaf Anatomy, and Enzyme Activity of Resistant and Susceptible Cocoa Clonesto Vascular Streak Dieback Disease

    Directory of Open Access Journals (Sweden)

    Adi Prawoto

    2014-10-01

    Full Text Available Vascular-streak dieback (VSD, Oncobasidium theobromae is the most prevalent disease of Theobroma cacao L. in Indonesia. This study aims to analyze resistance mechanism to VSD based on terpene profile, leaf anatomy, chitinase, and peroxidase study. Resistant clones of Sulawesi 1 and Sca 6 and susceptible clones of ICS 60 and TSH 858 were used for terpene profile, leaf anatomy analysis, chitinase, peroxides, polyphenol, lignin, and cellulose analysis. Those clones and KEE 2, KKM 22 and ICS 13 were used for peroxides analysis. For trichome study, the resistant clones of Sulawesi 1, Sca 6, KEE 2, and KKM 22, and susceptible clones of ICS 60 and TSH 858 were used. GCMS analysis showed that chromatogram pattern of resistant and susceptible groups were quite similar, but resistant clones contained 22% more components than the susceptible ones. Resistant clones contained groups of pinene, decane, myrcene, and octadecanoic acid, while those substances on usceptible clones were absent. Trichome was thicker on younger leaf, and its density on the basal was higher than that on the middle and tip leaf parts. Trichome density of resistant clone was not always thicker than that of susceptible ones. On resistant clones, stomatal density was lower and width of stomate pits was narrower, while thickness of epidermis layer and pallisade parenchym were higher. Polyphenol content of resistant clones were higher but lignin and cellulose of both groups were similar. Chitinase activity which has a role in hydrolysis of mycelia cell wall was higher on the resistant clones, but peroxides which has a role in polymeration of lignin biosynthesis was similar between both groups. It is concluded that groups of terpene pinene, decane, myrcene, and octadecanoic acid, thickness of leaf epidermis, density and width of stomata pit, and chitinase activity plays important role in cocoa resistance to VSD. Key words: Theobroma cacaoL., clone, vascular-streak dieback, resistance, leaf

  4. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  5. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  6. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  7. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  8. Increasing leaf longevity and disease resistance by altering salicylic acid catabolism

    Energy Technology Data Exchange (ETDEWEB)

    Gan, Susheng; Zhang, Kewei

    2018-01-23

    The present invention relates to a transgenic plant having an altered level of salicylic acid 3-hydroxylase ("S3H") protein, compared to that of a non-transgenic plant, where the transgenic plant displays an altered leaf senescence phenotype, relative to a non-transgenic plant. The present invention relates to a mutant plant comprising an inactivated gene encoding S3H protein, where the mutant plant displays a premature or precocious leaf senescence phenotype, relative to a non-mutant plant. The present invention also relates to methods for promoting premature or precocious leaf senescence in a plant, delaying leaf senescence in a plant, and making a mutant plant having a decreased level of S3H protein compared to that of a non-mutant plant, where the mutant plant displays a premature or precocious leaf senescence phenotype relative to a non-mutant plant. The present invention also relates to inducing or promoting pathogen resistance in plants.

  9. Association analysis of bacterial leaf spot resistance and SNP markers derived from expressed sequence tags (ESTs) in lettuce (Lactuca sativa L.)

    Science.gov (United States)

    Bacterial leaf spot of lettuce, caused by Xanthomonas campestris pv. vitians, is a devastating disease of lettuce worldwide. Since there are no chemicals available for effective control of the disease, host-plant resistance is highly desirable to protect lettuce production. A total of 179 lettuce ge...

  10. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  11. Major QTL Conferring Resistance to Rice Bacterial Leaf Streak

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Bacterial leaf streak (BLS) is one of the important limiting factors to rice production in southern China and other tropical and sub-tropical areas in Asia. Resistance to BLS was found to be a quantitative trait and no major resistant gene was located in rice until date. In the present study, a new major quantitative trait locus (QTL) conferring resistance to BLS was identified from a highly resistant variety Dular by the employment of Dular/Balilla (DB) and Dular/IR24 (DI) segregation populations and was designated qBLSR-11-1. This QTL was located between the simple sequence repeat (SSR) markers RM120 and RM441 on chromosome 11 and could account for 18.1-21.7% and 36.3% of the variance in DB and DI populations, respectively. The genetic pattern of rice resistance to BLS was discussed.

  12. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  13. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  14. Effect of urdbean leaf crinkle virus infection on total soluble protein and antioxidant enzymes in blackgram plants

    International Nuclear Information System (INIS)

    Ashfaq, M.; Mughal, S.M.; Khan, A.; Javed, N.; Sahi, S.T.; Shahid, M.

    2010-01-01

    Urdbean leaf crinkle virus (ULCV) is a common, wide spread, destructive and economically important disease causing systemic infection in blackgram (Vigna mungo (L.) Hepper), resulting in extreme crinkling, curling, puckering and rugosity of leaves, and yield reductions. Effect of viral infection was investigated on total soluble proteins and antioxidant enzymes activity in two genotypes viz., Mash-88-susceptible and CM-2002-resistant, at different growth stages under both the inoculated and un-inoculated conditions. ULCV infection resulted in significant increase in total soluble protein contents of the leaves in both genotypes. In healthy plant, super oxide dismutase (SOD), catalase (CAT) and peroxidase (PO) showed similar activity levels. In inoculated plants of Mash-88, SOD and PO activities decreased and increased non-significantly at all growth stages, respectively. The activities of PO and SOD increased and decreased significantly after 15 and 30 days of inoculation in resistant genotype, respectively. No significant changes in catalase (CAT) activity were detected in ULCV-infected leaves over the control. It was concluded that the super oxide dismutase and peroxidases might be associated with resistance/susceptibility to ULCV infection. (author)

  15. Resistance of solanum species to phytophthora infestans evaluated in the detached-leaf and whole-plant assays

    International Nuclear Information System (INIS)

    Akhtar, K.P.; Saleem, M.Y.; Asghar, M.

    2012-01-01

    The reaction of 82 tomato genotypes belonging to 8 Solanum and a Lycopersicon species against Phytophthora infestans causing late blight was determined using detached-leaf and whole-plant assays. None of the test genotypes was immune or highly resistant. Of the 82 commercial and wild genotypes only TMS-2 (male-sterile and characterized by indeterminate growth) belonging to Lycopersicon esculentum was resistant with severity index of 2.4 in the detached-leaf assay on 0-5 scale (where 5 was highly susceptible) and percent disease index (%DI) of 23.3% under the whole-plant assay. Among the remaining genotypes, 41 were susceptible and 40 were highly susceptible under the detached-leaf assay, while 18 were susceptible and 63 were highly susceptible under the whole-plant assay. However, there was a significant difference in %DI for genotypes under the whole-plant assay. The response of whole-plants to inoculation with P. infestans in the detached-leaf assay was similar in all cases. The overall screening results indicate that TMS-2 is a good source of resistance and it can be useful for the development of tomato hybrid cultivars resistant to late blight. (author)

  16. Incorporation of resistance to angular leaf spot and bean common ...

    African Journals Online (AJOL)

    Luseko

    2013-07-03

    Jul 3, 2013 ... Angular leaf spot (ALS) caused by the fungus Pseudocercospora griseola and Bean common mosaic and necrosis virus (BCMV/BCMNV) are important diseases of common bean in Tanzania that can cause severe yield reduction when uncontrolled. This study was conducted to incorporate resistant genes ...

  17. Incorporation of resistance to angular leaf spot and bean common ...

    African Journals Online (AJOL)

    Angular leaf spot (ALS) caused by the fungus Pseudocercospora griseola and Bean common mosaic and necrosis virus (BCMV/BCMNV) are important diseases of common bean in Tanzania that can cause severe yield reduction when uncontrolled. This study was conducted to incorporate resistant genes for ALS and ...

  18. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  19. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  20. Effect of weed control treatments on total leaf area of plantation black walnut (Juglans nigra)

    Science.gov (United States)

    Jason Cook; Michael R. Saunders

    2013-01-01

    Determining total tree leaf area is necessary for describing tree carbon balance, growth efficiency, and other measures used in tree-level and stand-level physiological growth models. We examined the effects of vegetation control methods on the total leaf area of sapling-size plantation black walnut trees using allometric approaches. We found significant differences in...

  1. Genetic analysis of the induced mutants of rice resistant to bacterial leaf blight

    International Nuclear Information System (INIS)

    Nakai, H.

    1990-01-01

    Full text: Seeds of the rice cultivar 'Harebare', which is susceptible to bacterial leaf blight (BLB), were treated with thermal neutrons, gamma-rays, ethyleneimine and ethylmethane-sulfonate. In the M2, plants with better resistance to BLB were identified through inoculation at the seedling and the flag leaf stages with an isolate (T7174) of the Japanese differential race I. Several mutant lines resistant to BLB were selected through tests of the M 3 or M 4 lines derived from selected resistant M 2 plants. The frequency of resistant mutants was significantly higher after the thermal neutron treatment than after treatments with other mutagens. Two mutants, which originated from the neutron treatment, showing a highly quantitative resistance to multiple BLB races were analysed for gene(s) for resistance. The resistance of one of them (M41) to the Japanese races I, II, III, IV, and V was found to be conditioned by a single recessive gene. Three other recessive genes for resistance are known, but their reaction to differential races is different. Therefore, this gene was thought to be new and was tentatively designated as xa-nm(t). The resistance of another mutant (M57) was found to be polygenically inherited. (author)

  2. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  3. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  4. Pyramiding of blast and bacterial leaf blight resistance genes into ...

    African Journals Online (AJOL)

    Blast caused by the fungus Magnaporthe oryzae (Hebert) Barr. and bacterial leaf blight (BLB) caused by Xanthomonas oryzae pv. oryzae (Xoo) are two major diseases of rice (Oryza sativa). The use of varietal resistance is the most appropriate strategy for controlling the diseases, and molecular assisted selection can ...

  5. Prospecting sugarcane resistance to Sugarcane yellow leaf virus by genome-wide association.

    Science.gov (United States)

    Debibakas, S; Rocher, S; Garsmeur, O; Toubi, L; Roques, D; D'Hont, A; Hoarau, J-Y; Daugrois, J H

    2014-08-01

    Using GWAS approaches, we detected independent resistant markers in sugarcane towards a vectored virus disease. Based on comparative genomics, several candidate genes potentially involved in virus/aphid/plant interactions were pinpointed. Yellow leaf of sugarcane is an emerging viral disease whose causal agent is a Polerovirus, the Sugarcane yellow leaf virus (SCYLV) transmitted by aphids. To identify quantitative trait loci controlling resistance to yellow leaf which are of direct relevance for breeding, we undertook a genome-wide association study (GWAS) on a sugarcane cultivar panel (n = 189) representative of current breeding germplasm. This panel was fingerprinted with 3,949 polymorphic markers (DArT and AFLP). The panel was phenotyped for SCYLV infection in leaves and stalks in two trials for two crop cycles, under natural disease pressure prevalent in Guadeloupe. Mixed linear models including co-factors representing population structure fixed effects and pairwise kinship random effects provided an efficient control of the risk of inflated type-I error at a genome-wide level. Six independent markers were significantly detected in association with SCYLV resistance phenotype. These markers explained individually between 9 and 14 % of the disease variation of the cultivar panel. Their frequency in the panel was relatively low (8-20 %). Among them, two markers were detected repeatedly across the GWAS exercises based on the different disease resistance parameters. These two markers could be blasted on Sorghum bicolor genome and candidate genes potentially involved in plant-aphid or plant-virus interactions were localized in the vicinity of sorghum homologs of sugarcane markers. Our results illustrate the potential of GWAS approaches to prospect among sugarcane germplasm for accessions likely bearing resistance alleles of significant effect useful in breeding programs.

  6. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL

    Science.gov (United States)

    Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...

  7. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  8. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

  9. Total Lactic Acid Bacteria (LAB), Antioxidant Activity, and Acceptance of Synbiotic Yoghurt with Binahong Leaf Extract (Anredera cordifolia (Ten.) Steenis)

    Science.gov (United States)

    Lestari, R. P.; Nissa, C.; Afifah, D. N.; Anjani, G.; Rustanti, N.

    2018-02-01

    Alternative treatment for metabolic syndrome can be done by providing a diet consist of functional foods or beverages. Synbiotic yoghurt containing binahong leaf extract which high in antioxidant, total LAB and fiber can be selected to reduce the risk of metabolic syndrome. The effect of binahong leaf extract in synbiotic yoghurt against total LAB, antioxidant activity, and acceptance were analyzed. The experiment was done with complete randomized design with addition of binahong leaf extract 0% (control); 0.12%; 0.25%; 0.5% in synbiotic yoghurt. Analysis of total LAB using Total Plate Count test, antioxidant activity using DPPH, and acceptance were analyzed by hedonic test. The addition of binahong leaf extract in various doses in synbiotic yoghurt decreased total LAB without significant effect (p=0,145). There was no effect of addition binahong leaf extract on antioxidant activity (p=0,297). The addition of binahong leaf extract had an effect on color, but not on aroma, texture and taste. The best result was yoghurt synbiotic with addition of 0,12% binahong leaf extract. Conclusion of the research was the addition of binahong leaf extract to synbiotic yogurt did not significantly affect total LAB, antioxidant activity, aroma, texture and taste; but had a significant effect on color.

  10. Salicylic acid confers enhanced resistance to Glomerella leaf spot in apple.

    Science.gov (United States)

    Zhang, Ying; Shi, Xiangpeng; Li, Baohua; Zhang, Qingming; Liang, Wenxing; Wang, Caixia

    2016-09-01

    Glomerella leaf spot (GLS) caused by Glomerella cingulata is a newly emergent disease that results in severe defoliation and fruit spots in apple. Currently, there are no effective means to control this disease except for the traditional fungicide sprays. Induced resistance by elicitors against pathogens infection is a widely accepted eco-friendly strategy. In the present study, we investigated whether exogenous application of salicylic acid (SA) could improve resistance to GLS in a highly susceptible apple cultivar (Malus domestica Borkh. cv. 'Gala') and the underlying mechanisms. The results showed that pretreatment with SA, at 0.1-1.0 mM, induced strong resistance against GLS in 'Gala' apple leaves, with SA treated leaves showing significant reduction in lesion numbers and disease index. Concurrent with the enhanced disease resistance, SA treatment markedly increased the total antioxidant capacity (T-AOC) and defence-related enzyme activities, including catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), phenylalanine ammonia-lyase (PAL) and polyphenol oxidase (PPO). As expected, SA treatment also induced the expression levels of five pathogenesis-related (PR) genes including PR1, PR5, PR8, Chitinase and β-1,3-glucanase. Furthermore, the most pronounced and/or rapid increase was observed in leaves treated with SA and subsequently inoculated with G. cingulata compared to the treatment with SA or inoculation with the pathogen. Together, these results suggest that exogenous SA triggered increase in reactive oxygen species levels and the antioxidant system might be responsible for enhanced resistance against G. cingulata in 'Gala' apple leaves. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  12. NOTE - Genetic control of resistance to gray leaf spot of maize in tropical germplasm

    Directory of Open Access Journals (Sweden)

    André Humberto de Brito

    2012-01-01

    Full Text Available The main goal of this study was to assess the nature and magnitude of gene effects for resistance to Cercospora leaf spot. A randomized block design with three replications was used. The data were obtained at the plant level by assessing the disease severity. The data were analyzed per experiment, using the average data per plot. A dominant-additive genetic model without epistasis was considered, with estimation of the components of means and variance. The genetic control of resistance to gray leaf spot is polygenic with predominance of the additive effects. Dominance was observed in a few small-effect loci and high heritability values.

  13. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  14. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  15. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.

  16. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  17. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  18. Field evaluations of leaf spot resistance and yield in peanut genotypes in the United States and Bolivia

    Science.gov (United States)

    Field experiments were conducted in 2002-2006 to characterize yield potential and disease resistance to Cercospora arachidicola (early leaf spot) and Cercosporidium personatum (late leaf spot) in the Bolivian peanut (Arachis hypogaea) cultivar, Bayo Grande, and breeding lines developed from crosses ...

  19. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  20. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  1. Influence of Growth Stage and Leaf Age on Expression of the Components of Partial Resistance of Faba Bean to Botrytis fabae Sard.

    Directory of Open Access Journals (Sweden)

    A. Bouhassan

    2004-12-01

    Full Text Available In detached leaf tests on faba bean (Vicia faba L., genotypes partially resistant and susceptible to Botrytis fabae were examined. Expression of four components of partial resistance to a virulent isolate of B. fabae differed depending on the plant age and the leaf age of the genotypes. The incubation period of resistant genotypes at the podding stage was longer than that of susceptible genotypes at the same stage. The area under disease progress curve (AUDPC of the lesion size increased from the seedling to the flowering stage but declined at the podding stage in all genotypes. Differences between resistant and susceptible genotypes for lesion size were significant except on old leaves from plants at the podding stage. The latent period decreased, and spore production increased with increasing growth and leaf age but there was significant interaction with the genotype. These last two components of partial resistance were more clearly expressed at all growth stages on FRY167 (highly resistant but were expressed only at the seedling and podding stages on FRY7 (resistant. The resistant line BPL710 was not significantly different from the susceptible genotypes for the latent period at any growth stage, and for spore production at the seedling and flowering stages. Leaf age affected all genotypes, but with a significant interaction between leaf age and growth stage. Components of partial resistance were more strongly expressed on young leaves from plants at the seedling or flowering stage.

  2. Modelo matemático para estimativa da área foliar total de bananeira 'Prata-anã' Esteem method of total leaf area of 'Prata anã' banana tree

    Directory of Open Access Journals (Sweden)

    Moises Zucoloto

    2008-12-01

    Full Text Available O objetivo deste trabalho foi desenvolver um modelo para estimar a área foliar total de bananeira, cultivar Prata-Anã, utilizando dimensões lineares da terceira folha, como o comprimento, a largura e o número total de folhas na emissão da inflorescência. As regressões lineares foram determinadas considerando-se a área foliar total de cada planta (AFT como variável dependente e o comprimento (C e a largura (L da terceira folha, o produto de CxL, o número total de folhas por planta (N e o produto de CxLxN como variáveis independentes. O modelo linear que melhor estimou a área foliar total (AFTe da bananeira 'Prata-Anã', ao nível de 5% de significância com R² de 0,89, foi a equação AFTe = 0,5187(CxLxN + 9603,5.The objective of this work was to estimate the total leaf area of banana, cultivar Prata Anã, according to the linear dimensions of the third leaf, such as the length and the width and the total number of leves in the inflorescence emission. The linear regressions were determined considering total leaf area of each plant (AFT such as dependent variable and the length (C and the width (L of the third leaf, the product of CxL, the total number of leaf per plant (N and the product of CxLxN as independent variables. The best linear model that estimated the total leaf area (AFTe of banana 'Prata Anã' at the level of 5% of significance with R² of 0,89 was the equation AFTe = 0.5187 (CxLxN + 9603.5.

  3. Somaclonal variation in hybrid poplars for resistance to Septoria leaf spot

    Science.gov (United States)

    M.E. Ostry; D. D. Skilling

    1987-01-01

    Tissue culture techniques have been used to obtain hybrid poplars with putative resistance to leaf spot caused by Septoria musiva from clones previously susceptible to the disease. Stem internode explants were used to obtain proliferating callus cultures. Adventitious bud formation and shoot proliferation were then induced. Elongated shoots were excised and rooted in a...

  4. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  5. Rice mutation breeding for resistance against leaf blight disease and brown planthopper

    International Nuclear Information System (INIS)

    Mugiono; Ismachin, M

    1981-01-01

    Seeds of Pelita 1/1 were treated variously with EMS 1%, 20, 30, 35, 40 and 50 krad doses gamma rays from a Co 60 source. The 1% EMS treatment, of presoaking for 36 hours in distilled water and stored for one week before sowing, yielded more mutants resistant against bacterial leaf blight compared to other treatments with EMS. Treatment with 20 krad of gamma rays gave an indication of a good probability for improving resistance. Screening for brown planthopper resistance among 350 M 4 lines yielded 4 moderate resistant (MR) lines. However, no resistant line was found. From 36 crosses between the mutants and IR-26 or mutants with Mudgo 86 promising lines were found. The promising lines, beside resistant against brown planthopper, were selected based on early maturity and short stem. (author)

  6. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.

  7. The relationship between powdery mildew (Sphaerotheca fuliginea) resistance and leaf chlorosis sensitivity in cucumber (Cucumis sativus) studied in single seed descent lines

    NARCIS (Netherlands)

    Zijlstra, S.; Jansen, R.C.; Groot, S.P.C.

    1995-01-01

    The genetic relation between powdery mildew resistance and sensitivity for leaf chlorosis of glasshouse cucumber was investigated. The powdery mildew resistant, leaf chlorosis sensitive hybrid variety 'Profito' was crossed with the powdery mildew susceptible, non chlorosis sensitive hybrid variety

  8. Leaf structural traits of tropical woody species resistant to cement dust.

    Science.gov (United States)

    Siqueira-Silva, Advanio Inácio; Pereira, Eduardo Gusmão; Modolo, Luzia Valentina; Paiva, Elder Antonio Sousa

    2016-08-01

    Cement industries located nearby limestone outcrops in Brazil have contributed to the coating of cement dust over native plant species. However, little is known about the extent of the response of tropical woody plants to such environmental pollutant particularly during the first stages of plant development and establishment. This work focused on the investigation of possible alterations in leaf structural and ultrastructural traits of 5-month-old Guazuma ulmifolia Lam. (Malvaceae), 6-month-old Myracrodruon urundeuva Allemão (Anacardiaceae), and 9-month-old Trichilia hirta L. (Meliaceae) challenged superficially with cement dust during new leaf development. Leaf surface of plants, the soil or both (leaf plus soil), were treated (or not) for 60 days, under controlled conditions, with cement dust at 2.5 or 5.0 mg cm(-2). After exposure, no significant structural changes were observed in plant leaves. Also, no plant death was recorded by the end of the experiment. There was also some evidence of localized leaf necrosis in G. ulmifolia and T. hirta, leaf curling in M. urundeuva and T. hirta, and bulges formation on epidermal surface of T. hirta, after cement dust contact with plant shoots. All species studied exhibited stomata obliteration while T. hirta, in particular, presented early leaf abscission, changes in cellular relief, and organization and content of midrib cells. No significant ultrastructural alterations were detected under the experimental conditions studied. Indeed, mesophyll cells presented plastids with intact membrane systems. The high plant survival rates, together with mild morphoanatomic traits alterations in leaves, indicate that G. ulmifolia is more resistant to cement dust pollutant, followed by M. urundeuva and T. hirta. Thus, the three plant species are promising for being used to revegetate areas impacted by cement industries activities.

  9. Red leaf lettuce breeding line with resistance to corky root, 06-810

    Science.gov (United States)

    The Agricultural Research Service, United States Department of Agriculture (USDA) announces the release of a breeding line of red leaf lettuce (Lactuca sativa L.), 06-810. The line may be suitable for commercial production, and is suitable for use as a source of resistance to corky root disease in t...

  10. Partial stem and leaf resistance against the fungal pathogen Botrytis cinerea in wild relatives of tomato

    NARCIS (Netherlands)

    Have, ten A.; Berloo, van R.; Lindhout, P.; Kan, van J.A.L.

    2007-01-01

    Tomato (Solanum lycopersicum) is one of many greenhouse crops that can be infected by the necrotrophic ascomycete Botrytis cinerea. Commercial cultivation of tomato is hampered by the lack of resistance. Quantitative resistance has been reported in wild tomato relatives, mostly based on leaf assays.

  11. Characterization, antibacterial, total antioxidant, scavenging, reducing power and ion chelating activities of green synthesized silver, copper and titanium dioxide nanoparticles using Artemisia haussknechtii leaf extract.

    Science.gov (United States)

    Alavi, Mehran; Karimi, Naser

    2017-12-12

    Recently, major problem related to pathogenic bacteria is augmentation of antibiotic resistance which has been changed treatment and recovery of millions of infectious patients. The present study reports an eco-friendly, rapid and easy method for synthesis of silver (Ag), copper (Cu) and titanium dioxide (TiO 2 ) nanoparticles (NPs) using Artemisia haussknechtii leaf aqueous extract with antibacterial activities against multi-drug resistance (MDR) bacteria species. Three different concentrations (0.001, 0.01 and 0.1 M) of AgNO 3 , CuSO 4 and TiO (OH) 2 were investigated for obtaining optimum NPs green synthesis. Total phenolic content, total flavonoid content of leaf extract and total antioxidant activity (DPPH) assay were determined as radical scavenging methods. UV-Visible spectroscopy, Fourier transform infrared spectroscopy analysis, X-ray diffraction, energy dispersive X-ray spectroscopy, field emission scanning electron microscope and atomic force microscopy (AFM) were used due to NPs characterization. The size average of the Ag, Cu and TiO 2 NPs obtained were respectively 10.69 ± 5.55, 35.36 ± 44.4 and 92.58 ± 56.98 nm. In the case of antibacterial assay, disc diffusion assay, minimum inhibitory concentration, minimum bactericidal concentration, bacterial growth and morphology of four MDR species Staphylococcus aureus ATCC 43300, Staphylococcus epidermidis ATCC 12258, Serratia marcescens ATTC13880 and Escherichia coli ATCC 25922 were evaluated. Results of this study demonstrated that A. haussknechtii leaf extract with various groups of phytochemicals such as phenols and flavonoids had suitable ability in green synthesis of Ag, Cu and TiO 2 NPs. Also, Ag and Cu NPs had more antibacterial activities compared to TiO 2 NPs.

  12. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.

  13. Measurements methods and variability assesment of the Norway spruce total leaf area. Implications for remote sensing

    Czech Academy of Sciences Publication Activity Database

    Homolová, L.; Lukeš, Petr; Malenovský, Z.; Lhotáková, Z.; Kaplan, Věroslav; Hanuš, Jan

    2013-01-01

    Roč. 27, č. 1 (2013), s. 111-121 ISSN 0931-1890 R&D Projects: GA ČR GA205/09/ 1989 Institutional support: RVO:67179843 Keywords : chlorophyll content * conversion factor * Picea abies * projected leaf area * remote sensing * total leaf area Subject RIV: EH - Ecology, Behaviour Impact factor: 1.869, year: 2013

  14. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...

  15. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  16. An extended PROSPECT: Advance in the leaf optical properties model separating total chlorophylls into chlorophyll a and b.

    Science.gov (United States)

    Zhang, Yao; Huang, Jingfeng; Wang, Fumin; Blackburn, George Alan; Zhang, Hankui K; Wang, Xiuzhen; Wei, Chuanwen; Zhang, Kangyu; Wei, Chen

    2017-07-25

    The PROSPECT leaf optical model has, to date, well-separated the effects of total chlorophyll and carotenoids on leaf reflectance and transmittance in the 400-800 nm. Considering variations in chlorophyll a:b ratio with leaf age and physiological stress, a further separation of total plant-based chlorophylls into chlorophyll a and chlorophyll b is necessary for advanced monitoring of plant growth. In this study, we present an extended version of PROSPECT model (hereafter referred to as PROSPECT-MP) that can combine the effects of chlorophyll a, chlorophyll b and carotenoids on leaf directional hemispherical reflectance and transmittance (DHR and DHT) in the 400-800 nm. The LOPEX93 dataset was used to evaluate the capabilities of PROSPECT-MP for spectra modelling and pigment retrieval. The results show that PROSPECT-MP can both simultaneously retrieve leaf chlorophyll a and b, and also performs better than PROSPECT-5 in retrieving carotenoids concentrations. As for the simulation of DHR and DHT, the performances of PROSPECT-MP are similar to that of PROSPECT-5. This study demonstrates the potential of PROSPECT-MP for improving capabilities of remote sensing of leaf photosynthetic pigments (chlorophyll a, chlorophyll b and carotenoids) and for providing a framework for future refinements in the modelling of leaf optical properties.

  17. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    Full Text Available The common bean (Phaseolus vulgaris L. is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum and angular leaf spot (ALS; Pseudocercospora griseola are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will

  18. Genome-Wide Association Studies of Anthracnose and Angular Leaf Spot Resistance in Common Bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Perseguini, Juliana Morini Küpper Cardoso; Oblessuc, Paula Rodrigues; Rosa, João Ricardo Bachega Feijó; Gomes, Kleber Alves; Chiorato, Alisson Fernando; Carbonell, Sérgio Augusto Morais; Garcia, Antonio Augusto Franco; Vianello, Rosana Pereira; Benchimol-Reis, Luciana Lasry

    2016-01-01

    The common bean (Phaseolus vulgaris L.) is the world's most important legume for human consumption. Anthracnose (ANT; Colletotrichum lindemuthianum) and angular leaf spot (ALS; Pseudocercospora griseola) are complex diseases that cause major yield losses in common bean. Depending on the cultivar and environmental conditions, anthracnose and angular leaf spot infections can reduce crop yield drastically. This study aimed to estimate linkage disequilibrium levels and identify quantitative resistance loci (QRL) controlling resistance to both ANT and ALS diseases of 180 accessions of common bean using genome-wide association analysis. A randomized complete block design with four replicates was performed for the ANT and ALS experiments, with four plants per genotype in each replicate. Association mapping analyses were performed for ANT and ALS using a mixed linear model approach implemented in TASSEL. A total of 17 and 11 significant statistically associations involving SSRs were detected for ANT and ALS resistance loci, respectively. Using SNPs, 21 and 17 significant statistically associations were obtained for ANT and angular ALS, respectively, providing more associations with this marker. The SSR-IAC167 and PvM95 markers, both located on chromosome Pv03, and the SNP scaffold00021_89379, were associated with both diseases. The other markers were distributed across the entire common bean genome, with chromosomes Pv03 and Pv08 showing the greatest number of loci associated with ANT resistance. The chromosome Pv04 was the most saturated one, with six markers associated with ALS resistance. The telomeric region of this chromosome showed four markers located between approximately 2.5 Mb and 4.4 Mb. Our results demonstrate the great potential of genome-wide association studies to identify QRLs related to ANT and ALS in common bean. The results indicate a quantitative and complex inheritance pattern for both diseases in common bean. Our findings will contribute to more

  19. Leaf-morphology-assisted selection for resistance to two-spotted spider mite Tetranychus urticae Koch (Acari: Tetranychidae) in carnations (Dianthus caryophyllus L).

    Science.gov (United States)

    Seki, Kousuke

    2016-10-01

    The development of a cultivar resistant to the two-spotted spider mite has provided both ecological and economic benefits to the production of cut flowers. This study aimed to clarify the mechanism of resistance to mites using an inbred population of carnations. In the resistant and susceptible plants selected from an inbred population, a difference was recognised in the thickness of the abaxial palisade tissue by microscopic examination of the damaged leaf. Therefore, it was assumed that mites displayed feeding preferences within the internal leaf structure of the carnation leaf. The suitability of the host plant for mites was investigated using several cultivars selected using an index of the thickness from the abaxial leaf surface to the spongy tissue. The results suggested that the cultivar associated with a thicker abaxial tissue lowered the intrinsic rate of natural increase of the mites. The cultivars with a thicker abaxial tissue of over 120 µm showed slight damage in the field test. The ability of mites to feed on the spongy tissue during an early life stage from hatching to adult emergence was critical. It was possible to select a cultivar that is resistant to mites under a real cultivation environment by observing the internal structure of the leaf. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. In vitro antioxidant evaluation and total phenolics of methanolic leaf extracts of Nyctanthes arbor-tristis L.

    Science.gov (United States)

    Michael, J Savarimuthu; Kalirajan, A; Padmalatha, C; Singh, A J A Ranjit

    2013-09-01

    To investigate the in vitro antioxidant activity and total phenolic content of the methanolic leaf extract of Nyctanthes arbor-tristis L. (NA). The sample was tested using five in vitro antioxidant methods (1, 1-diphenyl-2-picryl hydrazine radical scavenging activity (DPPH), hydroxyl radical-scavenging activity (-OH), nitric oxide scavenging activity (NO), superoxide radical-scavenging activity, and total antioxidant activity) to evaluate the in vitro antioxidant potential of NA and the total phenolic content (Folin-Ciocalteu method). The extract showed good free radical scavenging property which was calculated as an IC50 value. IC50 (Half maximal inhibitory concentration) of the methanolic extract was found to be 57.93 μg·mL(-1) for DPPH, 98.61 μg·mL(-1) for -OH, 91.74 μg·mL(-1) for NO, and 196.07 μg·mL(-1) for superoxide radical scavenging activity. Total antioxidant capacity of the extract was found to be (1198 ± 24.05) mg ascorbic acid for the methanolic extract. Free radical scavenging activity observed in the extracts of NA showed a concentration-dependent reaction. The in vitro scavenging tested for free radicals was reported to be due to high phenolic content in the leaf extract. The leaf extract of NA showed the highest total phenolic content with a value of 78.48 ± 4.2 equivalent mg TAE/g (tannic acid equivalent). N. arbor-tristis leaf extract exhibited potent free radical scavenging activity. The finding suggests that N. arbor-tristis leaves could be a potential source of natural antioxidant. Copyright © 2013 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  1. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  2. Development of the variety for resistance against bacterial leaf-blight in rice with thermal neutrons

    International Nuclear Information System (INIS)

    Nakai, Hirokazu

    1990-01-01

    In search for the development of genes for resistance against bacterial leaf-blight in rice, thermal neutrons generated from the Research Reactor at the Kyoto University have been applied to the breeding. In this paper, the developmental outcome is described, and a potential application of thermal neutrons for breeding the variety of resistance against bacterial leaf-blight in rice is reviewed. When thermal neutrons were delivered to the rice, the ratio of absorbed doses by B-10, which is contained in a small quantity in the plant, was found to be larger than expected. This implies characteristic effects of thermal neutrons on the plant. When boric acid was incorporated into the plant before irradiation, the effect of thermal neutrons per irradiation time was considered to become great. The frequency of mutations for resistance was significantly higher by thermal neutron, as compared with that induced by other mutagens, such as gamma radiation, ethylene-imine, ethyl-methane-sulfonate, and nitroso-methyl-urea. Genetic analysis of mutants for resistance revealed recessive genes and polygenes. Finally, the application of thermal neutrons and other radiations would contribute greatly to a resolution of serious pollution problems in global food and environment. (N.K.)

  3. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L. Gaertn. Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Directory of Open Access Journals (Sweden)

    M Ramakrishnan

    Full Text Available Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX for tiller production, calmodulin (CaM binding protein for seed yield and pectin methylesterase inhibitor (PMEI for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of

  4. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    Science.gov (United States)

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Vinod, K K; Kalpana, Krishnan; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal

  5. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  6. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  7. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  8. Detection of food-borne bacteria in ready to eat betel leaf sold at local markets in Mymensingh.

    Science.gov (United States)

    Haque, Md Mazedul; Sarker, Md Atiqur Rahman; Rifa, Rafia Afroze; Islam, Md Ariful; Khatun, Mst Minara

    2017-09-01

    The present study was undertaken to determine bacterial load as well as characterize bacterial flora of ready to eat (RTE) betel leaf sold at local markets in Mymensingh city. A total of 25 RTE betel leaf samples were collected from five local markets such as Kamal-Ranjit (KR) market, Shesh more, Kewatkhali, Jobber more, and Ganginar par. Total viable count of bacteria in betel leaf (log 10 mean colony forming unit±standard deviation/ml) was 7.58±0.04 for KR market, 7.72±0.06 for Shesh more, 7.62±0.04 for Kewatkhali, 7.40±0.03 for Jobber more, and 7.60±0.06 for Ganginar par. A total of 98 bacterial isolates belong to five genera ( Escherichia coli , Salmonella spp., Vibrio spp., Bacillus spp., and Staphylococcus spp.) were identified. The prevalence of E. coli was 17.34%, Salmonella spp. was 25.51%, Vibrio spp. was 19.39%, Bacillus spp. was 18.37%, and Staphylococcus spp. was 19.39%. Antibiotic sensitivity test showed that all isolates were sensitive to two antibiotics such as ciprofloxacin and gentamicin. Four isolates ( E. coli , Salmonella spp., Vibrio spp., and Staphylococcus spp.) were resistant to two antibiotics (ampicillin and cephalexin). Antibiogram profile of bacterial isolates of betel leaf suggests that they were multidrug resistance. Data of this study indicate that betel leaf sold at local market harbors multidrug resistance food-borne bacteria which might cause public health hazards if these antibiotic resistant transfer to human through food chain.

  9. Detection of food-borne bacteria in ready to eat betel leaf sold at local markets in Mymensingh

    Directory of Open Access Journals (Sweden)

    Md. Mazedul Haque

    2017-09-01

    Full Text Available Aim: The present study was undertaken to determine bacterial load as well as characterize bacterial flora of ready to eat (RTE betel leaf sold at local markets in Mymensingh city. Materials and Methods: A total of 25 RTE betel leaf samples were collected from five local markets such as Kamal-Ranjit (KR market, Shesh more, Kewatkhali, Jobber more, and Ganginar par. Results: Total viable count of bacteria in betel leaf (log10 mean colony forming unit±standard deviation/ml was 7.58±0.04 for KR market, 7.72±0.06 for Shesh more, 7.62±0.04 for Kewatkhali, 7.40±0.03 for Jobber more, and 7.60±0.06 for Ganginar par. A total of 98 bacterial isolates belong to five genera (Escherichia coli, Salmonella spp., Vibrio spp., Bacillus spp., and Staphylococcus spp. were identified. The prevalence of E. coli was 17.34%, Salmonella spp. was 25.51%, Vibrio spp. was 19.39%, Bacillus spp. was 18.37%, and Staphylococcus spp. was 19.39%. Antibiotic sensitivity test showed that all isolates were sensitive to two antibiotics such as ciprofloxacin and gentamicin. Four isolates (E. coli, Salmonella spp., Vibrio spp., and Staphylococcus spp. were resistant to two antibiotics (ampicillin and cephalexin. Antibiogram profile of bacterial isolates of betel leaf suggests that they were multidrug resistance. Conclusion: Data of this study indicate that betel leaf sold at local market harbors multidrug resistance food-borne bacteria which might cause public health hazards if these antibiotic resistant transfer to human through food chain.

  10. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  11. Primisulfuron herbicide-resistant tobacco plants: mutant selection in vitro by adventitious shoot formation from cultured leaf discs

    International Nuclear Information System (INIS)

    Harms, C.T.; DiMaio, J.J.; Jayne, S.M.; Middlesteadt, L.A.; Negrotto, D.V.; Thompson-Taylor, H.; Montoya, A.L.

    1991-01-01

    A simple procedure has been developed for the rapid and direct selection of herbicide-resistant mutant plants. The procedure uses adventitious shoot formation from suitable explants, such as leaf discs, on a shoot-inducing culture medium containing a toxic herbicide concentration. Resistant green shoots were thus isolated from tobacco (Nicotiana tabacum L.) leaf explants cultured on medium containing 100 μg 1−1 primisulfuron, a new sulfonylurea herbicide. Resistant shoots were recovered from both haploid and diploid explants after UV mutagenesis, as well as without mutagenic treatment. Three mutant plants of separate origin were further analyzed biochemically and genetically. Their acetohydroxyacid synthase (AHAS) enzyme activity was less inhibited by sulfonylurea herbicides than that of unselected, sensitive wild type plants. The extent of inhibition of the AHAS enzyme among the three mutants was different for different sulfonylurea and imidazolinone herbicides suggesting different sites were affected by each mutation. Herbicide tolerance was scored for germinating seedling populations and was found to be inherited as a single dominant nuclear gene. Adventitious shoot formation from cultured leaf discs was used to determine the cross tolerance of mutant plants to various herbicidal AHAS inhibitors. The usefulness of this rapid and direct scheme for mutant selection based on adventitious shoot formation or embryogenesis is discussed. (author)

  12. Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

    Directory of Open Access Journals (Sweden)

    Iftikhar Ali Khan

    2016-02-01

    Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

  13. Evolution of resistance and tolerance to herbivores: testing the trade-off hypothesis

    Directory of Open Access Journals (Sweden)

    Eunice Kariñho-Betancourt

    2015-03-01

    Full Text Available Background. To cope with their natural enemies, plants rely on resistance and tolerance as defensive strategies. Evolution of these strategies among natural population can be constrained by the absence of genetic variation or because of the antagonistic genetic correlation (trade-off between them. Also, since plant defenses are integrated by several traits, it has been suggested that trade-offs might occur between specific defense traits.Methodology/Principal Findings. We experimentally assessed (1 the presence of genetic variance in tolerance, total resistance, and leaf trichome density as specific defense trait, (2 the extent of natural selection acting on plant defenses, and (3 the relationship between total resistance and leaf trichome density with tolerance to herbivory in the annual herb Datura stramonium. Full-sib families of D. stramonium were either exposed to natural herbivores (control or protected from them by a systemic insecticide. We detected genetic variance for leaf trichome density, and directional selection acting on this character. However, we did not detect a negative significant correlation between tolerance and total resistance, or between tolerance and leaf trichome density. We argue that low levels of leaf damage by herbivores precluded the detection of a negative genetic correlation between plant defense strategies.Conclusions/Significance. This study provides empirical evidence of the independent evolution of plant defense strategies, and a defensive role of leaf trichomes. The pattern of selection should favor individuals with high trichomes density. Also, because leaf trichome density reduces damage by herbivores and possess genetic variance in the studied population, its evolution is not constrained.

  14. Determination of total phenolic content and antioxidant activitity of methanol extract of Maranta arundinacea L fresh leaf and tuber

    Science.gov (United States)

    Kusbandari, A.; Susanti, H.

    2017-11-01

    Maranta arundinacea L is one of herbaceous plants in Indonesia which have flavonoid content. Flavonoids has antioxidants activity by inhibition of free radical oxidation reactions. The study aims were to determination total phenolic content and antioxidant activity of methanol extract of fresh leaf and tuber of M. arundinacea L by UV-Vis spectrophotometer. The methanol extracts were obtained with maceration and remaseration method of fresh leaves and tubers. The total phenolic content was assayed with visible spectrophotometric using Folin Ciocalteau reagent. The antioxidant activity was assayed with 1,1-diphenyl-2-picrilhidrazil (DPPH) compared to gallic acid. The results showed that methanol extract of tuber and fresh leaf of M. arundinacea L contained phenolic compound with total phenolic content (TPC) in fresh tuber of 3.881±0.064 (% GAE) and fresh leaf is 6.518±0.163 (% b/b GAE). IC50 value from fresh tuber is 1.780±0.0005 μg/mL and IC50 fresh leaf values of 0.274±0.0004 μg/mL while the standard gallic acid is IC50 of 0.640±0.0002 μg/mL.

  15. Diverse mechanisms of plant resistance to cauliflower mosaic virus revealed by leaf skeleton hybridization.

    Science.gov (United States)

    Melcher, U; Brannan, C M; Gardner, C O; Essenberg, R C

    1992-01-01

    Plants not hosts for cauliflower mosaic virus (CaMV) may prevent systemic CaMV infection by interfering with dissemination of infection through the plant or by preventing viral replication and maturation. Leaf skeleton hybridization allows distinction between these two barriers. The technique assesses the spatial distribution of CaMV in an inoculated leaf by hybridization of a skeleton of the leaf with a CaMV DNA probe. Leaves or leaflets of soybean, cucumber, peanut, tomato, lettuce, spinach, pepper, onion, wheat, maize and barley, inoculated with CaMV DNA or CaMV virions were processed for leaf skeleton hybridization either immediately after inoculation or two weeks thereafter. Autoradiographic images of soybean and cucumber skeletons had many dark spots suggesting that CaMV DNA replication and local spread had occurred. Images of onion leaf skeletons prepared two weeks after inoculation with CaMV DNA had fewer spots. To test whether these spots resulted from CaMV replication, DNA was extracted from inoculated onion leaves and analyzed by electrophoresis, blotting and hybridization. Molecules recovered two weeks after inoculation resembled those inoculated, indicating absence of replication. For the other species, we found no evidence of local spread of CaMV infections. Thus, many plant species resist systemic CaMV infection by preventing replication or local spread of CaMV, while others solely prevent systemic movement of infection.

  16. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat.

    Science.gov (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie

    2018-01-01

    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  17. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  18. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  19. New Generation of Resistant Sugar Beet Varieties for Advanced Integrated Management of Cercospora Leaf Spot in Central Europe

    OpenAIRE

    Johannes Vogel; Johannes Vogel; Christine Kenter; Carsten Holst; Bernward Märländer

    2018-01-01

    Cercospora leaf spot (CLS) epidemics in sugar beet have been increasing in recent years causing higher use of fungicides. Concomitantly, the availability of effective fungicides is at risk because of resistance development in the fungus, the lack of new active ingredients as well as restrictive approval practices. A key option for an integrated management of CLS is cultivation of resistant varieties. Because of the yield penalty in resistant varieties, acceptance in commercial practice so far...

  20. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  1. Construction of Double Right-Border Binary Vector Carrying Non-Host Gene Rxol Resistant to Bacterial Leaf Streak of Rice

    Institute of Scientific and Technical Information of China (English)

    Xu Mei-rong; XIA Zhi-hui; ZHAI Wen-xue; XU Jian-long; ZHOU Yong-li; LI Zhi-kang

    2008-01-01

    Rxol cloned from maize is a non-host gene resistant to bacterial leaf streak of rice. pCAMBIA1305-1 with Rxol was digested with Sca Ⅰ and NgoM Ⅳ and the double right-border binary vector pMNDRBBin6 was digested with Hpa Ⅰ and Xma Ⅰ.pMNDRBBin6 carrying the gene Rxol was acquired by ligation of blunt-end and cohesive end. The results of PCR, restriction enzyme analysis and sequencing indicated that the Rxol gene had been cloned into pMNDRBBin6. This double right-border binary vector,named as pMNDRBBin6-Rxol, will play a role in breeding marker-free plants resistant to bacterial leaf streak of rice by genetic transformation.

  2. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  3. Artemisia annua dried leaf tablets treated malaria resistant to ACT and i.v. artesunate: Case reports.

    Science.gov (United States)

    Daddy, Nsengiyumva Bati; Kalisya, Luc Malemo; Bagire, Pascal Gisenya; Watt, Robert L; Towler, Melissa J; Weathers, Pamela J

    2017-08-15

    Dried leaf Artemisia annua (DLA) has shown efficacy against Plasmodium sp. in rodent studies and in small clinical trials. Rodent malaria also showed resiliency against the evolution of artemisinin drug resistance. This is a case report of a last resort treatment of patients with severe malaria who were responding neither to artemisinin combination therapy (ACT) nor i.v. artesunate. Of many patients treated with ACTs and i.v. artesunate during the 6 mon study period, 18 did not respond and were subsequently treated with DLA Artemisia annua. Patients were given a dose of 0.5g DLA per os, twice daily for 5d. Total adult delivered dose of artemisinin was 55mg. Dose was reduced for body weight under 30kg. Clinical symptoms, e.g. fever, coma etc., and parasite levels in thick blood smears were tracked. Patients were declared cured and released from hospital when parasites were microscopically undetectable and clinical symptoms fully subsided. All patients were previously treated with Coartem® provided through Santé Rurale (SANRU) and following the regimen prescribed by WHO. Of 18 ACT-resistant severe malaria cases compassionately treated with DLA, all fully recovered. Of the 18, this report details two pediatric cases. Successful treatment of all 18 ACT-resistant cases suggests that DLA should be rapidly incorporated into the antimalarial regimen for Africa and possibly wherever else ACT resistance has emerged. Copyright © 2017. Published by Elsevier GmbH.

  4. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  5. Oreochromis mossambicus diet supplementation with Psidium guajava leaf extracts enhance growth, immune, antioxidant response and resistance to Aeromonas hydrophila.

    Science.gov (United States)

    Gobi, Narayanan; Ramya, Chinnu; Vaseeharan, Baskaralingam; Malaikozhundan, Balasubramanian; Vijayakumar, Sekar; Murugan, Kadarkarai; Benelli, Giovanni

    2016-11-01

    In this research, we focused on the efficacy of aqueous and ethanol leaf extracts of Psidium guajava L. (guava) based experimental diets on the growth, immune, antioxidant and disease resistance of tilapia, Oreochromis mossambicus following challenge with Aeromonas hydrophila. The experimental diets were prepared by mixing powdered (1, 5 and 10 mg/g) aqueous and ethanol extract of guava leaf with commercial diet. The growth (FW, FCR and SGR), non-specific cellular immune (myeloperoxidase activity, reactive oxygen activity and reactive nitrogen activity) humoral immune (complement activity, antiprotease, alkaline phosphatase activity and lysozyme activity) and antioxidant enzyme responses (SOD, GPX, and CAT) were examined after 30 days of post-feeding. A significant enhancement in the biochemical and immunological parameters of fish were observed fed with experimental diets compared to control. The dietary supplementation of P. guajava leaf extract powder for 30 days significantly reduced the mortality and increased the disease resistance of O. mossambicus following challenge with A. hydrophila at 50 μl (1 × 10 7  cells ml -1 ) compared to control after post-infection. The results suggest that the guava leaf extract could be used as a promising feed additive in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  7. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  8. Mapping Late Leaf Spot Resistance in Peanut (Arachis hypogaea Using QTL-seq Reveals Markers for Marker-Assisted Selection

    Directory of Open Access Journals (Sweden)

    Josh Clevenger

    2018-02-01

    Full Text Available Late leaf spot (LLS; Cercosporidium personatum is a major fungal disease of cultivated peanut (Arachis hypogaea. A recombinant inbred line population segregating for quantitative field resistance was used to identify quantitative trait loci (QTL using QTL-seq. High rates of false positive SNP calls using established methods in this allotetraploid crop obscured significant QTLs. To resolve this problem, robust parental SNPs were first identified using polyploid-specific SNP identification pipelines, leading to discovery of significant QTLs for LLS resistance. These QTLs were confirmed over 4 years of field data. Selection with markers linked to these QTLs resulted in a significant increase in resistance, showing that these markers can be immediately applied in breeding programs. This study demonstrates that QTL-seq can be used to rapidly identify QTLs controlling highly quantitative traits in polyploid crops with complex genomes. Markers identified can then be deployed in breeding programs, increasing the efficiency of selection using molecular tools.Key Message: Field resistance to late leaf spot is a quantitative trait controlled by many QTLs. Using polyploid-specific methods, QTL-seq is faster and more cost effective than QTL mapping.

  9. Optimal ship forms for minimum total resistance in shallow water

    OpenAIRE

    Zhao, Lian-en

    1984-01-01

    Optimal ship forms for minimum total resistance in shallow water Optimal ship forms for minimum total resistance in shallow water: An attempt is made to obtain shallow-water optimal ship forms for total resistance by means of "tent" function representation under the constraints that the main dimensions of the ship and the water-line area were kept constant. The objective function in the quadratic programming is the sum of wave-making resistance calculated by Sretenski's formula and viscou...

  10. Measurement methods and variability assessment of the Norway spruce total leaf area: Implications for remote sensing

    NARCIS (Netherlands)

    Homolova, L.; Lukes, P.; Malenovsky, Z.; Lhotakova, Z.; Kaplan, V.; Hanus, J.

    2013-01-01

    Estimation of total leaf area (LAT) is important to express biochemical properties in plant ecology and remote sensing studies. A measurement of LAT is easy in broadleaf species, but it remains challenging in coniferous canopies. We proposed a new geometrical model to estimate Norway spruce LAT and

  11. The ability of Abelmoschus manihot L. leaf extract in scavenging of free radical DPPH and total flavonoid determination

    Science.gov (United States)

    Sudewi, S.; Lolo, W. A.; Warongan, M.; Rifai, Y.; Rante, H.

    2017-11-01

    Abelmoschus manihot L. has reported to have flavonoids content. This study aims were to determine the ability of A. manihot extract in counteracting free radical DPPH and determine the content of total flavonoids. A. manihot leaf was taken from 2 regions in North Sulawesi, namely Tomohon and Kotamobagu. The maceration was carried out to extract the active compound in a 96% ethanol solvent. Free radical scavenging analysis was carried out by DPPH and determination of its total flavonoid in the extract was measured using spectrophotometri method. The results showed that A. manihot extract from Tomohon and Kotamobagu could counteract free radical of DPPH with value of free radical activity of 88.151 and 88.801 %, respectively. A. manihot leaf from Kotamobagu has higher total flavonoids content 61.763 mg/g compare to Tomohon 46.679 mg/g which presented as quercetin. A. manihot has antioxidant activity.

  12. Comparative transcriptome profiling of a resistant vs. susceptible tomato (Solanum lycopersicum cultivar in response to infection by tomato yellow leaf curl virus.

    Directory of Open Access Journals (Sweden)

    Tianzi Chen

    Full Text Available Tomato yellow leaf curl virus (TYLCV threatens tomato production worldwide by causing leaf yellowing, leaf curling, plant stunting and flower abscission. The current understanding of the host plant defense response to this virus is very limited. Using whole transcriptome sequencing, we analyzed the differential gene expression in response to TYLCV infection in the TYLCV-resistant tomato breeding line CLN2777A (R and TYLCV-susceptible tomato breeding line TMXA48-4-0 (S. The mixed inoculated samples from 3, 5 and 7 day post inoculation (dpi were compared to non-inoculated samples at 0 dpi. Of the total of 34831 mapped transcripts, 209 and 809 genes were differentially expressed in the R and S tomato line, respectively. The proportion of up-regulated differentially expressed genes (DEGs in the R tomato line (58.37% was higher than that in the S line (9.17%. Gene ontology (GO analyses revealed that similar GO terms existed in both DEGs of R and S lines; however, some sets of defense related genes and their expression levels were not similar between the two tomato lines. Genes encoding for WRKY transcriptional factors, R genes, protein kinases and receptor (-like kinases which were identified as down-regulated DEGs in the S line were up-regulated or not differentially expressed in the R line. The up-regulated DEGs in the R tomato line revealed the defense response of tomato to TYLCV infection was characterized by the induction and regulation of a series of genes involved in cell wall reorganization, transcriptional regulation, defense response, ubiquitination, metabolite synthesis and so on. The present study provides insights into various reactions underlining the successful establishment of resistance to TYLCV in the R tomato line, and helps in the identification of important defense-related genes in tomato for TYLCV disease management.

  13. Cytotoxicity and apoptosis induced by alfalfa (Medicago sativa) leaf extracts in sensitive and multidrug-resistant tumor cells.

    Science.gov (United States)

    Gatouillat, Grégory; Magid, Abdulmagid Alabdul; Bertin, Eric; Okiemy-Akeli, Marie-Genevieve; Morjani, Hamid; Lavaud, Catherine; Madoulet, Claudie

    2014-01-01

    Alfalfa (Medicago sativa) has been used to cure a wide variety of ailments. However, only a few studies have reported its anticancer effects. In this study, extracts were obtained from alfalfa leaves and their cytotoxic effects were assessed on several sensitive and multidrug-resistant tumor cells lines. Using the mouse leukaemia P388 cell line and its doxorubicin-resistant counterpart (P388/DOX), we showed that the inhibition of cell growth induced by alfalfa leaf extracts was mediated through the induction of apoptosis, as evidenced by DNA fragmentation analysis. The execution of programmed cell death was achieved via the activation of caspase-3, leading to PARP cleavage. Fractionation of toluene extract (To-1), the most active extract obtained from crude extract, led to the identification of 3 terpene derivatives and 5 flavonoids. Among them, (-)-medicarpin, (-)-melilotocarpan E, millepurpan, tricin, and chrysoeriol showed cytotoxic effects in P388 as well as P388/DOX cells. These results demonstrate that alfalfa leaf extract may have interesting potential in cancer chemoprevention and therapy.

  14. Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents

    International Nuclear Information System (INIS)

    Baloch, M.J.; Baloch, Q.B.

    2005-01-01

    Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)

  15. Resistance to gray leaf spot of maize: genetic architecture and mechanisms elucidated through nested association mapping and near-isogenic line analysis.

    Science.gov (United States)

    Benson, Jacqueline M; Poland, Jesse A; Benson, Brent M; Stromberg, Erik L; Nelson, Rebecca J

    2015-03-01

    Gray leaf spot (GLS), caused by Cercospora zeae-maydis and Cercospora zeina, is one of the most important diseases of maize worldwide. The pathogen has a necrotrophic lifestyle and no major genes are known for GLS. Quantitative resistance, although poorly understood, is important for GLS management. We used genetic mapping to refine understanding of the genetic architecture of GLS resistance and to develop hypotheses regarding the mechanisms underlying quantitative disease resistance (QDR) loci. Nested association mapping (NAM) was used to identify 16 quantitative trait loci (QTL) for QDR to GLS, including seven novel QTL, each of which demonstrated allelic series with significant effects above and below the magnitude of the B73 reference allele. Alleles at three QTL, qGLS1.04, qGLS2.09, and qGLS4.05, conferred disease reductions of greater than 10%. Interactions between loci were detected for three pairs of loci, including an interaction between iqGLS4.05 and qGLS7.03. Near-isogenic lines (NILs) were developed to confirm and fine-map three of the 16 QTL, and to develop hypotheses regarding mechanisms of resistance. qGLS1.04 was fine-mapped from an interval of 27.0 Mb to two intervals of 6.5 Mb and 5.2 Mb, consistent with the hypothesis that multiple genes underlie highly significant QTL identified by NAM. qGLS2.09, which was also associated with maturity (days to anthesis) and with resistance to southern leaf blight, was narrowed to a 4-Mb interval. The distance between major leaf veins was strongly associated with resistance to GLS at qGLS4.05. NILs for qGLS1.04 were treated with the C. zeae-maydis toxin cercosporin to test the role of host-specific toxin in QDR. Cercosporin exposure increased expression of a putative flavin-monooxygenase (FMO) gene, a candidate detoxification-related gene underlying qGLS1.04. This integrated approach to confirming QTL and characterizing the potential underlying mechanisms advances the understanding of QDR and will facilitate the

  16. Resistance to gray leaf spot of maize: genetic architecture and mechanisms elucidated through nested association mapping and near-isogenic line analysis.

    Directory of Open Access Journals (Sweden)

    Jacqueline M Benson

    2015-03-01

    Full Text Available Gray leaf spot (GLS, caused by Cercospora zeae-maydis and Cercospora zeina, is one of the most important diseases of maize worldwide. The pathogen has a necrotrophic lifestyle and no major genes are known for GLS. Quantitative resistance, although poorly understood, is important for GLS management. We used genetic mapping to refine understanding of the genetic architecture of GLS resistance and to develop hypotheses regarding the mechanisms underlying quantitative disease resistance (QDR loci. Nested association mapping (NAM was used to identify 16 quantitative trait loci (QTL for QDR to GLS, including seven novel QTL, each of which demonstrated allelic series with significant effects above and below the magnitude of the B73 reference allele. Alleles at three QTL, qGLS1.04, qGLS2.09, and qGLS4.05, conferred disease reductions of greater than 10%. Interactions between loci were detected for three pairs of loci, including an interaction between iqGLS4.05 and qGLS7.03. Near-isogenic lines (NILs were developed to confirm and fine-map three of the 16 QTL, and to develop hypotheses regarding mechanisms of resistance. qGLS1.04 was fine-mapped from an interval of 27.0 Mb to two intervals of 6.5 Mb and 5.2 Mb, consistent with the hypothesis that multiple genes underlie highly significant QTL identified by NAM. qGLS2.09, which was also associated with maturity (days to anthesis and with resistance to southern leaf blight, was narrowed to a 4-Mb interval. The distance between major leaf veins was strongly associated with resistance to GLS at qGLS4.05. NILs for qGLS1.04 were treated with the C. zeae-maydis toxin cercosporin to test the role of host-specific toxin in QDR. Cercosporin exposure increased expression of a putative flavin-monooxygenase (FMO gene, a candidate detoxification-related gene underlying qGLS1.04. This integrated approach to confirming QTL and characterizing the potential underlying mechanisms advances the understanding of QDR and will

  17. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Association Mapping of Total Carotenoids in Diverse Soybean Genotypes Based on Leaf Extracts and High-Throughput Canopy Spectral Reflectance Measurements.

    Directory of Open Access Journals (Sweden)

    Arun Prabhu Dhanapal

    Full Text Available Carotenoids are organic pigments that are produced predominantly by photosynthetic organisms and provide antioxidant activity to a wide variety of plants, animals, bacteria, and fungi. The carotenoid biosynthetic pathway is highly conserved in plants and occurs mostly in chromoplasts and chloroplasts. Leaf carotenoids play important photoprotective roles and targeted selection for leaf carotenoids may offer avenues to improve abiotic stress tolerance. A collection of 332 soybean [Glycine max (L. Merr.] genotypes was grown in two years and total leaf carotenoid content was determined using three different methods. The first method was based on extraction and spectrophotometric determination of carotenoid content (eCaro in leaf tissue, whereas the other two methods were derived from high-throughput canopy spectral reflectance measurements using wavelet transformed reflectance spectra (tCaro and a spectral reflectance index (iCaro. An association mapping approach was employed using 31,253 single nucleotide polymorphisms (SNPs to identify SNPs associated with total carotenoid content using a mixed linear model based on data from two growing seasons. A total of 28 SNPs showed a significant association with total carotenoid content in at least one of the three approaches. These 28 SNPs likely tagged 14 putative loci for carotenoid content. Six putative loci were identified using eCaro, five loci with tCaro, and nine loci with iCaro. Three of these putative loci were detected by all three carotenoid determination methods. All but four putative loci were located near a known carotenoid-related gene. These results showed that carotenoid markers can be identified in soybean using extract-based as well as by high-throughput canopy spectral reflectance-based approaches, demonstrating the utility of field-based canopy spectral reflectance phenotypes for association mapping.

  19. Thin Layer Chromatography-Bioautography and Gas Chromatography-Mass Spectrometry of Antimicrobial Leaf Extracts from Philippine Piper betle L. against Multidrug-Resistant Bacteria

    Directory of Open Access Journals (Sweden)

    Demetrio L. Valle

    2016-01-01

    Full Text Available This study isolated and identified the antimicrobial compounds of Philippine Piper betle L. leaf ethanol extracts by thin layer chromatography- (TLC- bioautography and gas chromatography-mass spectrometry (GC-MS. Initially, TLC separation of the leaf ethanol extracts provided a maximum of eight compounds with Rf values of 0.92, 0.86, 0.76, 0.53, 0.40, 0.25, 0.13, and 0.013, best visualized when inspected under UV 366 nm. Agar-overlay bioautography of the isolated compounds demonstrated two spots with Rf values of 0.86 and 0.13 showing inhibitory activities against two Gram-positive multidrug-resistant (MDR bacteria, namely, methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. The compound with an Rf value of 0.86 also possessed inhibitory activity against Gram-negative MDR bacteria, namely, carbapenem-resistant Enterobacteriaceae-Klebsiella pneumoniae and metallo-β-lactamase-producing Acinetobacter baumannii. GC-MS was performed to identify the semivolatile and volatile compounds present in the leaf ethanol extracts. Six compounds were identified, four of which are new compounds that have not been mentioned in the medical literature. The chemical compounds isolated include ethyl diazoacetate, tris(trifluoromethylphosphine, heptafluorobutyrate, 3-fluoro-2-propynenitrite, 4-(2-propenylphenol, and eugenol. The results of this study could lead to the development of novel therapeutic agents capable of dealing with specific diseases that either have weakened reaction or are currently not responsive to existing drugs.

  20. Thin Layer Chromatography-Bioautography and Gas Chromatography-Mass Spectrometry of Antimicrobial Leaf Extracts from Philippine Piper betle L. against Multidrug-Resistant Bacteria.

    Science.gov (United States)

    Valle, Demetrio L; Puzon, Juliana Janet M; Cabrera, Esperanza C; Rivera, Windell L

    2016-01-01

    This study isolated and identified the antimicrobial compounds of Philippine Piper betle L. leaf ethanol extracts by thin layer chromatography- (TLC-) bioautography and gas chromatography-mass spectrometry (GC-MS). Initially, TLC separation of the leaf ethanol extracts provided a maximum of eight compounds with R f values of 0.92, 0.86, 0.76, 0.53, 0.40, 0.25, 0.13, and 0.013, best visualized when inspected under UV 366 nm. Agar-overlay bioautography of the isolated compounds demonstrated two spots with R f values of 0.86 and 0.13 showing inhibitory activities against two Gram-positive multidrug-resistant (MDR) bacteria, namely, methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. The compound with an R f value of 0.86 also possessed inhibitory activity against Gram-negative MDR bacteria, namely, carbapenem-resistant Enterobacteriaceae-Klebsiella pneumoniae and metallo-β-lactamase-producing Acinetobacter baumannii. GC-MS was performed to identify the semivolatile and volatile compounds present in the leaf ethanol extracts. Six compounds were identified, four of which are new compounds that have not been mentioned in the medical literature. The chemical compounds isolated include ethyl diazoacetate, tris(trifluoromethyl)phosphine, heptafluorobutyrate, 3-fluoro-2-propynenitrite, 4-(2-propenyl)phenol, and eugenol. The results of this study could lead to the development of novel therapeutic agents capable of dealing with specific diseases that either have weakened reaction or are currently not responsive to existing drugs.

  1. Fine mapping of a quantitative resistance gene for gray leaf spot of maize (Zea mays L.) derived from teosinte (Z. mays ssp. parviglumis).

    Science.gov (United States)

    Zhang, Xinye; Yang, Qin; Rucker, Elizabeth; Thomason, Wade; Balint-Kurti, Peter

    2017-06-01

    In this study we mapped the QTL Qgls8 for gray leaf spot (GLS) resistance in maize to a ~130 kb region on chromosome 8 including five predicted genes. In previous work, using near isogenic line (NIL) populations in which segments of the teosinte (Zea mays ssp. parviglumis) genome had been introgressed into the background of the maize line B73, we had identified a QTL on chromosome 8, here called Qgls8, for gray leaf spot (GLS) resistance. We identified alternate teosinte alleles at this QTL, one conferring increased GLS resistance and one increased susceptibility relative to the B73 allele. Using segregating populations derived from NIL parents carrying these contrasting alleles, we were able to delimit the QTL region to a ~130 kb (based on the B73 genome) which encompassed five predicted genes.

  2. within plant resistance to water flow in tomato and sweet melons

    African Journals Online (AJOL)

    Administrator

    high pressure flow meter (HPFM) and evaporative flux (EF) methods. In the evaporative flux method, measure- ments of transpiration flux and leaf water potential were used to calculate the total resistance to water flow using. Ohm's law analogy. Measurements of tranpiration flux (Q) relationship, plant resistance calculated ...

  3. Parâmetros genéticos da resistência ao complexo da queima-das-folhas em populações de cenoura Genetic parameters of the resistance to the leaf blight disease complex in carrot populations

    Directory of Open Access Journals (Sweden)

    Giovani O Silva

    2009-09-01

    November 2006 to February 2007. Five advanced breeding populations (processing 1 (P1, processing 2 (P2, table 3 (M3, table 4 (M4 and table 5 (M5, were evaluated using an experimental design of completely randomized block with two replicates. The total area per plot was of 2 m². Evaluation for leaf blight symptom severity was done 90 days after sowing. ANOVA was used to estimate genetic parameters and the genetic gain from selection. Leaf blight resistance levels were significant and allowed the discrimination of the populations under evaluation. According to the genetic parameters and the expected gains with selection, the population P1 was the most and M3 was the less promising genetic material aiming to improve leaf blight resistance levels in Brasília-type carrots. The values of the relationship among the genetic and environmental variation coefficients and heritability were low. Apparently, genetic variability for leaf blight resistance in the populations under study is already depleted. On the other hand, it might also indicate the need for refinement in both the evaluation system as well as in the inoculation technique, which are crucial to allow uniform epidemics of the leaf blight complex across field plots.

  4. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  5. Leaf habit and woodiness regulate different leaf economy traits at a given nutrient supply.

    Science.gov (United States)

    Ordoñez, Jenny C; van Bodegom, Peter M; Witte, Jan-Philip M; Bartholomeus, Ruud P; van Dobben, Han F; Aerts, Rien

    2010-11-01

    The large variation in the relationships between environmental factors and plant traits observed in natural communities exemplifies the alternative solutions that plants have developed in response to the same environmental limitations. Qualitative attributes, such as growth form, woodiness, and leaf habit can be used to approximate these alternative solutions. Here, we quantified the extent to which these attributes affect leaf trait values at a given resource supply level, using measured plant traits from 105 different species (254 observations) distributed across 50 sites in mesic to wet plant communities in The Netherlands. For each site, soil total N, soil total P, and water supply estimates were obtained by field measurements and modeling. Effects of growth forms, woodiness, and leaf habit on relations between leaf traits (SLA, specific leaf area; LNC, leaf nitrogen concentration; and LPC, leaf phosphorus concentration) vs. nutrient and water supply were quantified using maximum-likelihood methods and Bonferroni post hoc tests. The qualitative attributes explained 8-23% of the variance within sites in leaf traits vs. soil fertility relationships, and therefore they can potentially be used to make better predictions of global patterns of leaf traits in relation to nutrient supply. However, at a given soil fertility, the strength of the effect of each qualitative attribute was not the same for all leaf traits. These differences may imply a differential regulation of the leaf economy traits at a given nutrient supply, in which SLA and LPC seem to be regulated in accordance to changes in plant size and architecture while LNC seems to be primarily regulated at the leaf level by factors related to leaf longevity.

  6. Genetic diversity and apple leaf spot disease resistance characterization assessed by SSR markers

    Directory of Open Access Journals (Sweden)

    Gustavo H.F. Klabunde

    2016-09-01

    Full Text Available Among the cultivation problems of apple production in Brazil, Apple Leaf Spot (ALS disease represents one of the main breeding challenges. This study aims at analyzing the genetic diversity among 152 apple scion accessions available at the Apple Gene Bank of EPAGRI, located in Caçador, Santa Catarina/ Brazil. Eleven genomic SSR loci were analyzed to assess genetic diversity of ALS resistant and susceptible accessions. Results revealed high genetic diversity of the studied accessions, being 120 exclusive alleles (67 unique from scion accessions resistant to ALS, and a mean PIC of 0.823. The locus Probability of Identity (I ranged from 0.017 to 0.089. The combined I was 4.11 x 10-16, and the Power of Exclusion was 99.99999259%. In addition, the DNA fingerprint patterns will contribute as additional descriptors to select parental for crosses and early identification of apple accessions for breeding purposes, and also for cultivar protection.

  7. Within plant resistance to water flow in tomato and sweet melons ...

    African Journals Online (AJOL)

    In the evaporative flux method, measurements of transpiration flux and leaf water potential were used to calculate the total resistance to water flow using Ohm's law analogy. Measurements of tranpiration flux (Q) relationship, plant resistance calculated from the slope of their relationship, ranged from 6.57x10-01 to ...

  8. Feasible Management of Southern Corn Leaf Blight via Induction of Systemic Resistance by Bacillus cereus C1L in Combination with Reduced Use of Dithiocarbamate Fungicides

    Directory of Open Access Journals (Sweden)

    Yi-Ru Lai

    2016-10-01

    Full Text Available Dithiocarbamate fungicides such as maneb and mancozeb are widely used nonsystemic protectant fungicides to control various plant fungal diseases. Dithiocarbamate fungicides should be frequently applied to achieve optimal efficacy of disease control and avoid either decline in effectiveness or wash-off from leaf surface. Dithiocarbamates are of low resistance risk but have the potential to cause human neurological diseases. The objective of this study was to develop a strategy to effectively control plant disease with reduced use of dithiocarbamtes. Southern corn leaf blight was the model pathosystem for the investigation. When corn plants were drench-treated with Bacillus cereus C1L, a rhizobacterium able to induce systemic resistance in corn plants against southern leaf blight, frequency of spraying dithiocarbamate fungicides could be decreased. The treatment of B. cereus C1L was able to protect maize from southern leaf blight while residues of dithiocarbamates on leaf surface were too low to provide sufficient protection. On the other hand, frequent sprays of mancozeb slightly but significantly reduced growth of corn plants under natural conditions. In contrast, application of B. cereus C1L can significantly promote growth of corn plants whether sprayed with mancozeb or not. Our results provide the information that plant disease can be well controlled by rhizobacteria-mediated induced systemic resistance in combination with reduced but appropriate application of dithiocarbamate fungicides just before a heavy infection period. An appropriate use of rhizobacteria can enhance plant growth and help plants overcome negative effects caused by dithiocarbamates.

  9. Genetic characterization and linkage disequilibrium mapping of resistance to gray leaf spot in maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Liyu Shi

    2014-04-01

    Full Text Available Gray leaf spot (GLS, caused by Cercospora zeae-maydis, is an important foliar disease of maize (Zea mays L. worldwide, resistance to which is controlled by multiple quantitative trait loci (QTL. To gain insights into the genetic architecture underlying the resistance to this disease, an association mapping population consisting of 161 inbred lines was evaluated for resistance to GLS in a plant pathology nursery at Shenyang in 2010 and 2011. Subsequently, a genome-wide association study, using 41,101 single-nucleotide polymorphisms (SNPs, identified 51 SNPs significantly (P < 0.001 associated with GLS resistance, which could be converted into 31 QTL. In addition, three candidate genes related to plant defense were identified, including nucleotide-binding-site/leucine-rich repeat, receptor-like kinase genes similar to those involved in basal defense. Two genic SNPs, PZE-103142893 and PZE-109119001, associated with GLS resistance in chromosome bins 3.07 and 9.07, can be used for marker-assisted selection (MAS of GLS resistance. These results provide an important resource for developing molecular markers closely linked with the target trait, enhancing breeding efficiency.

  10. The inheritance of resistance to bacterial leaf spot of lettuce caused by Xanthomonas campestris pv. vitians in three lettuce cultivars

    Science.gov (United States)

    Lettuce yields can be reduced by the disease bacterial leaf spot (BLS) caused by the pathogen Xanthomonas campestris pv. vitians (Xcv) and host resistance is the most feasible method to reduce disease losses. The cultivars La Brillante, Pavane, and Little Gem express an incompatible host-pathogen in...

  11. Phytochemical screening, total phenolics and antioxidant activities of bark and leaf extracts of Goniothalamus velutinus (Airy Shaw from Brunei Darussalam

    Directory of Open Access Journals (Sweden)

    Erum Iqbal

    2015-07-01

    Full Text Available Goniothalamus velutinus Airy Shaw belongs to the family Annonaceae which is known to have anticancer, antitumor and many other bioactivities. Natives of Sabah and Sarawak use root decoction of G. velutinus for the treatment of headache and food poisoning while the bark was used as a mosquito repellent. Bark and leaf extracts of this plant, obtained from Brunei Darussalam, were tested for phytochemical and antioxidant activities. Phytochemical screening of plant extracts revealed the presence of alkaloids, steroids, terpenoids and cardiac glycosides. Quantitative determination of total phenolics, total flavonoids, and various in vitro antioxidant activities (DPPH, ABTS and FRAP of methanolic extract was carried out using colorimetric methods. The total phenolic content, expressed as mg of gallic acid equivalent (GAE per gram of extract, was found to be 68 mg GAE/g and 78 mg GAE/g for bark and leaves respectively. The radical scavenging activity measurement, expressed in terms of EC50 (effective concentration of extract in μg/mL that reduces DPPH absorbance to 50% as compared to negative control, for leaf and bark extracts was found to be 155 μg/mL and 204 μg/mL respectively. Standards trolox and ascorbic acid show EC50 value of 5 μg/mL and 4 μg/mL respectively. Trolox equivalent antioxidant capacity (TEAC was measured using the ABTS and FRAP method. Result for bark and leaf extracts was 79 mg and 106 mg trolox equivalent (TE/g respectively for the ABTS method. For FRAP assay, results for bark and leaf extracts were 80 and 89 mg TE/g respectively.

  12. Fitness and competition studies of QoI resistant and sensitive Cercospora sojina isolates, the causal agent of frogeye leaf spot

    Science.gov (United States)

    Frogeye leaf spot (FLS), caused by Cercospora sojina, is a yearly foliar disease of soybean in Tennessee and causes substantial economic losses if not properly managed. Quinone outside inhibitor (QoI) fungicides are often used to manage FLS, but C. sojina isolates have developed resistance to this c...

  13. Flutuação populacional do bicho-mineiro em cultivares de café arábica resistentes à ferrugem Fluctuation of leaf miner population in resistant arabica coffee cultivars to leaf rust

    Directory of Open Access Journals (Sweden)

    Celso Henrique Costa Conceição

    2005-01-01

    Full Text Available A intensidade de infestação pelo bicho-mineiro, Leucoptera coffeella (Guérin-Méneville (Lepidoptera: Lyonetiidae foi investigada nas cultivares Obatã IAC 1669-20 e Tupi IAC 1669-33, com resistência à ferrugem das folhas do cafeeiro, Hemileia vastatrix Berk. et Br., e Ouro Verde Amarelo IAC 4397, suscetível à doença, em ensaios de campo, localizados em Campinas (SP, Brasil. A incidência de ferrugem e a ocorrência de inimigos naturais da praga, assim como o enfolhamento das plantas, foram também observados nas três cultivares. As curvas de flutuação populacional obtidas para Obatã IAC 1669-20 e Tupi IAC 1669-33 revelaram maior incidência do bicho-mineiro entre abril e novembro. Já na cultivar Ouro Verde Amarelo IAC 4397, observaram-se dois picos de infestação, sendo o primeiro em abril-maio e o segundo em agosto-setembro. No entanto, a elevada percentagem de folhas minadas nas cultivares Tupi IAC 1669-33 e Obatã IAC 1669-20 em relação à Ouro Verde Amarelo IAC 4397 não é evidência de maior suscetibilidade à praga, mas sim devido à maior retenção foliar dessas cultivares, em conseqüência da resistência à ferrugem das folhas observada em ambas. De maneira oposta, na cultivar Ouro Verde Amarelo IAC 4397, os sintomas de ataque do bicho-mineiro ocorreram em menor nível especialmente devido a maior queda de folhas. Com base nas diferenças observadas entre as cultivares, sugere-se a adoção de estratégias distintas de manejo da praga.The intensity of infestation of leaf-miner, Leucoptera coffeella (Guérin-Méneville was investigated in coffee cultivars Obatã IAC 1669-20 and Tupi IAC 1669-33, both resistant to the leaf rust agent, Hemileia vastatrix Berk. et Br., and Ouro Verde Amarelo IAC 4397, susceptible to this coffee disease, at field assays in Campinas, SP, Brazil. The incidence of coffee rust and presence of natural enemies, as well as the plant leafiness, were also observed. In Obatã IAC 1669-20 and Tupi

  14. New Generation of Resistant Sugar Beet Varieties for Advanced Integrated Management of Cercospora Leaf Spot in Central Europe.

    Science.gov (United States)

    Vogel, Johannes; Kenter, Christine; Holst, Carsten; Märländer, Bernward

    2018-01-01

    Cercospora leaf spot (CLS) epidemics in sugar beet have been increasing in recent years causing higher use of fungicides. Concomitantly, the availability of effective fungicides is at risk because of resistance development in the fungus, the lack of new active ingredients as well as restrictive approval practices. A key option for an integrated management of CLS is cultivation of resistant varieties. Because of the yield penalty in resistant varieties, acceptance in commercial practice so far has been low. The aim of our study was to characterize recent sugar beet varieties registered in Germany in terms of resistance and tolerance to CLS and their value for integrated pest management. The genetic basis of CLS resistance in varieties is protected by intellectual property rights even after variety registration and not open to the public due to economic competition. To gain reliable data for cultivation, varieties have to be tested for their resistance traits under field conditions at varying levels of infection with Cercospora beticola . In collaboration with variety related stakeholders, 15 sugar beet varieties were tested in 49 field trials in Germany from 2014 to 2016 for their yield response to CLS. The trials were set up in a split-plot design with and without infection (i.e., with and without fungicide). The classification of varietal reaction to CLS is based on symptomatic leaf area (susceptibility) and the resulting relative yield loss (tolerance). Since the relation between both parameters varied among varieties, it was used as an additional parameter to describe tolerance. On this basis, three groups of varieties were identified. They can be characterized as a susceptible, a resistant and a presumably tolerant cluster. A comparison of the data with an older dataset originating from 2009 to 2011 revealed that yield performance of recent varieties with resistance to C. beticola caught up with susceptible varieties due to breeding progress. They showed no

  15. Coconut leaf bioactivity toward generalist maize insect pests

    Science.gov (United States)

    Tropical plants are often more resistant to insects than temperate plants due to evolution of robust defenses to cope with a more constant insect threat. Coconut (Cocos nucifera L.) has very few chewing leaf feeding insect pests and was tested against two omnivorous leaf feeding caterpillar species,...

  16. A new gene, developed through mutagenesis with thermal neutrons, for resistance of rice to bacterial leaf blight

    International Nuclear Information System (INIS)

    Nakai, H.; Shimozawa, H.; Saito, M.

    1992-01-01

    Dry seed lots of a rice variety, Harebare, susceptible to bacterial leaf blight (BLB), were treated with thermal neutrons with and without pre-treatment of the seeds by boron-enrichment, gamma-rays and nitroso-methyl-urea (NMU). The selections were made on M 2 -M 3 materials by inoculation of Japanese BLB race III, with the result that several BLB resistant mutants to race III and the other differential races could be obtained. Mutagenic efficiency of thermal neutrons to the seeds without boron-enrichment for induction of BLB resistant mutants was found to be significantly higher than that of the other mutagens. Four mutant lines of all the selected ones were analyzed for genes for BLB resistance through cross tests between the mutants and the original variety. Harebare, indicating that the resistance in the mutants was conditioned by single recessive gene(s). The mutant designated 86M95 was especially noted for its gene conferring complete (or durable) resistance to multiple BLB races. The 86M95 mutant or the gene may be of practical value for breeding of rice for BLB resistance. (author)

  17. Resistance to Barley Leaf Stripe

    DEFF Research Database (Denmark)

    Nørgaard Knudsen, J. C.

    1986-01-01

    in well adapted Northwest European spring cultivars. Virulence matching two hitherto not overcome resistances was demonstrated. Differences in apparent race nonspecific or partial resistance were also present, changing the percentage of infected plants of susceptible genotypes from about 20 to 44 per cent.......Ten barley [Hordeum vulgare] genotypes were inoculated with twelve isolates of Pyrenophora graminea of diverse European and North African origin. Race specific resistance occurred. Four, possibly five, genetically different sources of race-specific resistance were found, three of them occurring...

  18. Induction of resistance to bacterial leaf blight (Xanthomonas oryzae) disease in the high yielding variety Vijaya (IR 8 x T 90)

    International Nuclear Information System (INIS)

    Padmanabhan, S.Y.; Kaur, S.; Rao, M.

    1976-01-01

    The high-yield variety Vijaya ( IR 8 x T 90), susceptible to bacterial leaf blight (Xanthomonas oryzae, Uyeda and Ishiyama Dawson), was treated with EMS to induce resistance. Dehusked seeds were pre-soaked in distilled water for 4 hrs, and subjected to 0.1% and 0.2% EMS for 6 hrs. Seed germination and survival was low in 0.2% EMS. Seedlings of M 1 were raised in pots, and panicles of individual plants harvested separately. The seeds of M 2 (8800 plants) generation were grown in nursery beds, and transplanted in field after 30 days. The plants were inoculated at the boot leaf stage with X.oryzae by the clipping method, and lesion length measured 15 days later. The frequency distribution of controls was bimodal, the EMS-treated population polymodal with new peaks. A wider range of variability was induced on the resistant and susceptible side. In M 2 0.36% resistant and 0.62% moderately resistant plants occurred. The seeds of (11) resistant and (20) moderately resistant plants of M 2 were sown for M 3 generation. These plants also segregated in the range of 0-31 and 0-32 cm lesion length. The frequency distribution curve was polymodal. M 2 from ''R'' showed 1.07% of resistant plants and 0.42% from ''MR'', against, 4.28% of moderately resistant plants from ''R'' and 3.22% from ''MR''. Susceptible plants of M 2 also segregated towards resistance (1.15%) and moderately resistant (6.96%) plants in M 3 generation. Resistant (25) and moderately resistant (147) plants of M 3 were carried forward to M 4 generation, and segregated in the range of 2.1-25 cm lesion length. The frequency curve was polymodal. No resistant plant (up to 2.0 cm lesion length) could be isolated in M 4 . The percentage of moderately resistant plants was 4.44% from ''R'' of M 3 and 4.82% from ''MR'' of M 3 and 4.77% from ''S'' of M 3 generation. The yield of resistant plants was low whereas the yield of moderately resistant plants equalled the parent; the yield of susceptible segregants equalled or

  19. High-resolution mapping and characterization of qRgls2, a major quantitative trait locus involved in maize resistance to gray leaf spot.

    Science.gov (United States)

    Xu, Ling; Zhang, Yan; Shao, Siquan; Chen, Wei; Tan, Jing; Zhu, Mang; Zhong, Tao; Fan, Xingming; Xu, Mingliang

    2014-08-31

    Gray leaf spot (GLS) caused by Cercospora zeae-maydis (Czm) or Cercospora zeina (Cz) is a devastating maize disease and results in substantial yield reductions worldwide. GLS resistance is a quantitatively inherited trait. The development and cultivation of GLS-resistant maize hybrids are the most cost-effective and efficient ways to control this disease. We previously detected a major GLS resistance QTL, qRgls2, in bin 5.03-04, which spans the whole centromere of chromosome 5 encompassing a physical distance of ~110-Mb. With advanced backcross populations derived from the cross between the resistant Y32 and susceptible Q11 inbred lines, a sequential recombinant-derived progeny testing strategy was adapted to fine map qRgls2. We narrowed the region of qRgls2 from an initial ~110-Mb to an interval of ~1-Mb, flanked by the markers G346 and DD11. qRgls2 showed predominantly additive genetic effects and significantly increased the resistance percentage by 20.6 to 24.6% across multiple generations. A total of 15 genes were predicted in the mapped region according to the 5b.60 annotation of the maize B73 genome v2. Two pieces of the mapped qRgls2 region shared collinearity with two distant segments on maize chromosome 4. qRgls2, a major QTL involved in GLS resistance, was mapped to a ~1-Mb region close to the centromere of chromosome 5. There are 15 predicted genes in the mapped region. It is assumed that qRgls2 could be widely used to improve maize resistance to GLS.

  20. Combined effects of leaf litter and soil microsite on decomposition process in arid rangelands.

    Science.gov (United States)

    Carrera, Analía Lorena; Bertiller, Mónica Beatriz

    2013-01-15

    The objective of this study was to analyze the combined effects of leaf litter quality and soil properties on litter decomposition and soil nitrogen (N) mineralization at conserved (C) and disturbed by sheep grazing (D) vegetation states in arid rangelands of the Patagonian Monte. It was hypothesized that spatial differences in soil inorganic-N levels have larger impact on decomposition processes of non-recalcitrant than recalcitrant leaf litter (low and high concentration of secondary compounds, respectively). Leaf litter and upper soil were extracted from modal size plant patches (patch microsite) and the associated inter-patch area (inter-patch microsite) in C and D. Leaf litter was pooled per vegetation state and soil was pooled combining vegetation state and microsite. Concentrations of N and secondary compounds in leaf litter and total and inorganic-N in soil were assessed at each pooled sample. Leaf litter decay and soil N mineralization at microsites of C and D were estimated in 160 microcosms incubated at field capacity (16 month). C soils had higher total N than D soils (0.58 and 0.41 mg/g, respectively). Patch soil of C and inter-patch soil of D exhibited the highest values of inorganic-N (8.8 and 8.4 μg/g, respectively). Leaf litter of C was less recalcitrant and decomposed faster than that of D. Non-recalcitrant leaf litter decay and induced soil N mineralization had larger variation among microsites (coefficients of variation = 25 and 41%, respectively) than recalcitrant leaf litter (coefficients of variation = 12 and 32%, respectively). Changes in the canopy structure induced by grazing disturbance increased leaf litter recalcitrance, and reduced litter decay and soil N mineralization, independently of soil N levels. This highlights the importance of the combined effects of soil and leaf litter properties on N cycling probably with consequences for vegetation reestablishment and dynamics, rangeland resistance and resilience with implications

  1. Genetic relationships among alfalfa gemplasms resistant to common ...

    African Journals Online (AJOL)

    Genetic relationships among 26 alfalfa cultivars, of which, 12 were of high resistance to common leaf spot (CLS), were assessed using sequence-related amplified polymorphism (SRAP) markers. 34 SRAP primer combinations were selected for fingerprinting of these cultivars and a total of 281 bands were observed, among ...

  2. Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

    Science.gov (United States)

    Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

    2016-03-01

    RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

  3. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    Science.gov (United States)

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

  4. Oral administration of Eclipta alba leaf aqueous extract enhances the non-specific immune responses and disease resistance of Oreochromis mossambicus.

    Science.gov (United States)

    Christybapita, D; Divyagnaneswari, M; Michael, R Dinakaran

    2007-10-01

    Immunostimulatory effects of the oral administration of the medicinal plant, Eclipta alba leaf extracts was studied in tilapia, Oreochromis mossambicus. For this purpose, fish were fed for 1, 2 or 3 weeks with diets containing E. alba leaf aqueous extract at 0, 0.01, 0.1 or 1% levels. After each week, non-specific humoral (lysozyme, antiprotease and complement) and cellular (myeloperoxidase content, production of reactive oxygen and nitrogen species) responses and disease resistance against Aeromonas hydrophila were determined. The results indicated that E. alba aqueous extract administered as feed supplement significantly enhanced most of the non-specific immune parameters tested. Among the humoral responses, lysozyme activity significantly increased after feeding with aqueous extract for 1, 2 or 3 weeks. No significant modulation was noticed in all the cellular responses tested after 3 weeks of feeding, while reactive oxygen species production and myeloperoxidase content showed significant enhancement after 1 week of feeding with aqueous extract. When challenged with A. hydrophila after 1, 2 or 3 weeks of feeding, the percentage mortality was significantly reduced in the treated fish. The highest dose of 1% gave better protection than the other doses with the relative percentage survival (RPS) values of 64, 75 and 32 after feeding for 1, 2 and 3 weeks respectively. The results indicate that dietary intake of E. alba aqueous leaf extract enhances the non-specific immune responses and disease resistance of O. mossambicus against A. hydrophila.

  5. Method of manufacturing leaf spring for PWR type reactor fuel assembly

    International Nuclear Information System (INIS)

    Yokoyama, Takashi; Mori, Kazuma.

    1991-01-01

    A leaf spring is manufactured by precision casting using corrosion resistant and heat resistant high strength steel material and, subsequently, the surface is treated with slight surface grinding or pickling. Further, for increasing resistance to stress corrosion cracks (SCC), shot blasting is applied to the surface. This reduces the surface roughness (Rmax) of the leaf spring to less than 0.005 mm, and the dimensional tolerance can be set to +0.005 mm, -0.0 mm. In this way, since the surface roughness is so small as not causing fabrication injury to the surface, the material has sufficient resistance to SCC. Further, since the accuracy for the plate thickness is high, stress distribution as designed can be attained to prevent stress concentration. Then, if a casting die is once prepared, the casting mass production is enabled to reduce the manufacturing cost for the leaf spring. (T.M.)

  6. NMR-Based Metabolic Profiling of Field-Grown Leaves from Sugar Beet Plants Harbouring Different Levels of Resistance to Cercospora Leaf Spot Disease

    Directory of Open Access Journals (Sweden)

    Yasuyo Sekiyama

    2017-01-01

    Full Text Available Cercospora leaf spot (CLS is one of the most serious leaf diseases for sugar beet (Beta vulgaris L. worldwide. The breeding of sugar beet cultivars with both high CLS resistance and high yield is a major challenge for breeders. In this study, we report the nuclear magnetic resonance (NMR-based metabolic profiling of field-grown leaves for a subset of sugar beet genotypes harbouring different levels of CLS resistance. Leaves were collected from 12 sugar beet genotypes at four time points: seedling, early growth, root enlargement, and disease development stages. 1H-NMR spectra of foliar metabolites soluble in a deuterium-oxide (D2O-based buffer were acquired and subjected to multivariate analyses. A principal component analysis (PCA of the NMR data from the sugar beet leaves shows clear differences among the growth stages. At the later time points, the sugar and glycine betaine contents were increased, whereas the choline content was decreased. The relationship between the foliar metabolite profiles and resistance level to CLS was examined by combining partial least squares projection to latent structure (PLS or orthogonal PLS (OPLS analysis and univariate analyses. It was difficult to build a robust model for predicting precisely the disease severity indices (DSIs of each genotype; however, GABA and Gln differentiated susceptible genotypes (genotypes with weak resistance from resistant genotypes (genotypes with resistance greater than a moderate level before inoculation tests. The results suggested that breeders might exclude susceptible genotypes from breeding programs based on foliar metabolites profiled without inoculation tests, which require an enormous amount of time and effort.

  7. Induced resistance to septorial leaf blotch disease in wheat cv. 'SaberBeg' and its hybrids by fast neutrons

    International Nuclear Information System (INIS)

    Ibrahim, I.; Al-Marooff, E.; AI-Janabi, A.; Mahmood, A.; AI-Aubaidi

    1990-01-01

    Full text: Seeds of 'SaberBeg' and its hybrids in F 2 generation were irradiated with different doses of fast neutrons. 1324 variants selected from M 2 and F 4 M 2 were evaluated for resistance to septorial leaf blotch (Septoria tritici Rob ex Desm) with artificial inoculation under field conditions, through 3 successive generations. Results revealed 55 variants moderately resistant, along with better agronomic traits such as stiff stem, earliness in maturity and good adaption to semiarid zone conditions. The highest number of such variants was obtained from irradiated 'SaberBeg' x 'Mexipak' and 'SaberBeg' x ('Mexipak' x 'AbuGhraib 4'), while the lowest number was found from 'SaberBeg' x 'Araz'. (author)

  8. Guava leaf extracts promote glucose metabolism in SHRSP.Z-Leprfa/Izm rats by improving insulin resistance in skeletal muscle.

    Science.gov (United States)

    Guo, Xiangyu; Yoshitomi, Hisae; Gao, Ming; Qin, Lingling; Duan, Ying; Sun, Wen; Xu, Tunhai; Xie, Peifeng; Zhou, Jingxin; Huang, Liansha; Liu, Tonghua

    2013-03-01

    Metabolic syndrome (MS) and type 2 diabetes mellitus (T2DM) have been associated with insulin-resistance; however, the effective therapies in improving insulin sensitivity are limited. This study is aimed at investigating the effect of Guava Leaf (GL) extracts on glucose tolerance and insulin resistance in SHRSP.Z-Leprfa/Izm rats (SHRSP/ZF), a model of spontaneously metabolic syndrome. Male rats at 7 weeks of age were administered with vehicle water or treated by gavage with 2 g/kg GL extracts daily for six weeks, and their body weights, water and food consumption, glucose tolerance, and insulin resistance were measured. Compared with the controls, treatment with GL extracts did not modulate the amounts of water and food consumption, but significantly reduced the body weights at six weeks post treatment. Treatment with GL extracts did not alter the levels of fasting plasma glucose and insulin, but significantly reduced the levels of plasma glucose at 60 and 120 min post glucose challenge, also reduced the values of AUC and quantitative insulin sensitivity check index (QUICKI) at 42 days post treatment. Furthermore, treatment with GL extracts promoted IRS-1, AKT, PI3Kp85 expression, then IRS-1, AMKP, and AKT308, but not AKT473, phosphorylation, accompanied by increasing the ratios of membrane to total Glut 4 expression and adiponectin receptor 1 transcription in the skeletal muscles. These data indicated that GL extracts improved glucose metabolism and insulin sensitivity in the skeletal muscles of rats by modulating the insulin-related signaling.

  9. Sugarbeet leaf spot disease (Cercospora beticola Sacc.)dagger.

    Science.gov (United States)

    Weiland, John; Koch, Georg

    2004-05-01

    SUMMARY Leaf spot disease caused by Cercospora beticola Sacc. is the most destructive foliar pathogen of sugarbeet worldwide. In addition to reducing yield and quality of sugarbeet, the control of leaf spot disease by extensive fungicide application incurs added costs to producers and repeatedly has selected for fungicide-tolerant C. beticola strains. The genetics and biochemistry of virulence have been examined less for C. beticola as compared with the related fungi C. nicotianae, C. kikuchii and C. zeae-maydis, fungi to which the physiology of C. beticola is often compared. C. beticola populations generally are not characterized as having race structure, although a case of race-specific resistance in sugarbeet to C. beticola has been reported. Resistance currently implemented in the field is quantitatively inherited and exhibits low to medium heritability. Cercospora beticola Sacc.; Kingdom Fungi, Subdivision Deuteromycetes, Class Hyphomycetes, Order Hyphales, Genus Cercospora. Circular, brown to red delimited spots with ashen-grey centre, 0.5-6 mm diameter; dark brown to black stromata against grey background; pale brown unbranched sparingly septate conidiophores, hyaline acicular conidia, multiseptate, from 2.5 to 4 microm wide and 50-200 microm long. Propagative on Beta vulgaris and most species of Beta. Reported on members of the Chenopodiaceae and on Amaranthus. Disease symptoms: Infected leaves and petioles of B. vulgaris exhibit numerous circular leaf spots that coalesce in severe cases causing complete leaf collapse. Dark specks within a grey spot centre are characteristic for the disease. Older leaves exhibit a greater number of lesions with larger spot diameter. During the latter stage of severe epiphytotics, new leaf growth can be seen emerging from the plant surrounded by prostrate, collapsed leaves. Fungicides in the benzimidazole and triazole class as well as organotin derivatives and strobilurins have successfully been used to control Cercospora

  10. On the temporal variation of leaf magnetic parameters: seasonal accumulation of leaf-deposited and leaf-encapsulated particles of a roadside tree crown.

    Science.gov (United States)

    Hofman, Jelle; Wuyts, Karen; Van Wittenberghe, Shari; Samson, Roeland

    2014-09-15

    Understanding the accumulation behaviour of atmospheric particles inside tree leaves is of great importance for the interpretation of biomagnetic monitoring results. In this study, we evaluated the temporal variation of the saturation isothermal remanent magnetisation (SIRM) of leaves of a roadside urban Platanus × acerifolia Willd. tree in Antwerp, Belgium. We hereby examined the seasonal development of the total leaf SIRM signal as well as the leaf-encapsulated fraction of the deposited dust, by washing the leaves before biomagnetic analysis. On average 38% of the leaf SIRM signal was exhibited by the leaf-encapsulated particles. Significant correlations were found between the SIRM and the cumulative daily average atmospheric PM10 and PM2.5 measurements. Moreover, a steady increase of the SIRM throughout the in-leaf season was observed endorsing the applicability of biomagnetic monitoring as a proxy for the time-integrated PM exposure of urban tree leaves. Strongest correlations were obtained for the SIRM of the leaf-encapsulated particles which confirms the dynamic nature of the leaf surface-accumulated particles. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. A Simple Paper-Based Microfluidic Device for the Determination of the Total Amino Acid Content in a Tea Leaf Extract

    Science.gov (United States)

    Cai, Longfei; Wu, Yunying; Xu, Chunxiu; Chen, Zefeng

    2013-01-01

    An experiment was developed to demonstrate a microfluidic device in the analytical chemistry (instrumental analysis) laboratory. Students made the paper-based microfluidic device with a wax pen and a piece of filter paper and used it to determine the total quantity of amino acids in a green tea leaf

  12. A hairy-leaf gene, BLANKET LEAF, of wild Oryza nivara increases photosynthetic water use efficiency in rice.

    Science.gov (United States)

    Hamaoka, Norimitsu; Yasui, Hideshi; Yamagata, Yoshiyuki; Inoue, Yoko; Furuya, Naruto; Araki, Takuya; Ueno, Osamu; Yoshimura, Atsushi

    2017-12-01

    High water use efficiency is essential to water-saving cropping. Morphological traits that affect photosynthetic water use efficiency are not well known. We examined whether leaf hairiness improves photosynthetic water use efficiency in rice. A chromosome segment introgression line (IL-hairy) of wild Oryza nivara (Acc. IRGC105715) with the genetic background of Oryza sativa cultivar 'IR24' had high leaf pubescence (hair). The leaf hairs developed along small vascular bundles. Linkage analysis in BC 5 F 2 and F 3 populations showed that the trait was governed by a single gene, designated BLANKET LEAF (BKL), on chromosome 6. IL-hairy plants had a warmer leaf surface in sunlight, probably due to increased boundary layer resistance. They had a lower transpiration rate under moderate and high light intensities, resulting in higher photosynthetic water use efficiency. Introgression of BKL on chromosome 6 from O. nivara improved photosynthetic water use efficiency in the genetic background of IR24.

  13. Phytochemicals Screening, Total Phenol Estimation, Antioxidant Activity of Blainvillea Acmella Leaf and Stem Successive Extracts

    International Nuclear Information System (INIS)

    Sharma, P.; Sharma, G.N.; Shrivastava, B.; Jadhav, H.R.

    2014-01-01

    The aim of present work was to investigate antioxidant potential of different extracts of Blainvillea acmella leaf and stem. The successive extraction of individual plant part was carried out using solvents of different polarity viz. n-hexane, ethyl acetate, methanol and water. Preliminary phyto chemical screening of all the extracts was done. The present total phenolic contents were estimated by Folin-Ciocalteu reagent method and expressed as μg/ mg of gallic acid equivalent. The antioxidant potential and reducing power of all the prepared extracts were measured against DPPH, as compared to standard ascorbic acid, and BHA respectively. The result data indicate that the phenolic contents were higher in methanolic extracts of leaf (73.67 ± 0.38 mg/ g) followed by ethyl acetate (29.08 ± 0.38 mg/ g), aqueous (21.50 ± 0.28 mg/ g), and n-Hexane (9.29 ± 0.38 mg/ g); gallic acid equivalent. The similar pattern in stem part was also observed for example methanolic extracts (41.90 ± 0.45 mg/ g), ethyl acetate (21.92 ± 0.28 mg/ g), aqueous (15.13 ± 0.18 mg/ g), and n-Hexane (3.69 ± 0.28 mg/ g). The antioxidant capacity of methanolic extract of both the part for example leaf and stem was found to be maximum, as IC50 values were 226.49 ± 0.16, 402.05 ± 1.10 respectively. The reducing power was also highest in methanol extract of both parts. The result data conclude that the higher antioxidant as well as reducing power may be due to present phenolic contents. (author)

  14. Drought resistance in early and late secondary successional species from a tropical dry forest: the interplay between xylem resistance to embolism, sapwood water storage and leaf shedding.

    Science.gov (United States)

    Pineda-García, Fernando; Paz, Horacio; Meinzer, Frederick C

    2013-02-01

    The mechanisms of drought resistance that allow plants to successfully establish at different stages of secondary succession in tropical dry forests are not well understood. We characterized mechanisms of drought resistance in early and late-successional species and tested whether risk of drought differs across sites at different successional stages, and whether early and late-successional species differ in resistance to experimentally imposed soil drought. The microenvironment in early successional sites was warmer and drier than in mature forest. Nevertheless, successional groups did not differ in resistance to soil drought. Late-successional species resisted drought through two independent mechanisms: high resistance of xylem to embolism, or reliance on high stem water storage capacity. High sapwood water reserves delayed the effects of soil drying by transiently decoupling plant and soil water status. Resistance to soil drought resulted from the interplay between variations in xylem vulnerability to embolism, reliance on sapwood water reserves and leaf area reduction, leading to a tradeoff of avoidance against tolerance of soil drought, along which successional groups were not differentiated. Overall, our data suggest that ranking species' performance under soil drought based solely on xylem resistance to embolism may be misleading, especially for species with high sapwood water storage capacity. © 2012 Blackwell Publishing Ltd.

  15. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  16. Genetic diversity/impurity estimation in sources of natural resistance against cotton leaf curl disease in pakistan

    International Nuclear Information System (INIS)

    Sarwar, G.

    2007-01-01

    Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)

  17. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  18. Quantitative trait loci associated with resistance to gray leaf spot and grain yield in corn QTLs associados à resistência a cercosporiose e produção de grãos em milho

    Directory of Open Access Journals (Sweden)

    Adriano Delly Veiga

    2012-02-01

    Full Text Available The main objectives of hybrid development programs include incorporating genetic resistance to diseases and increasing grain yield. Identification of Quantitative Trait Loci (QTL through the statistical analysis of molecular markers allows efficient selection of resistant and productive hybrids. The objective of this research was to identify QTL associated with resistance to gray leaf spot and for grain yield in the germplasm of tropical corn. We used two strains with different degrees of reaction to the disease; the genotypes are owned by GENESEEDS Ltda, their F1 hybrid and the F2 population. The plants were evaluated for gray leaf spot resistance, for grain yield and were genotyped with 94 microsatellite markers. Association of the markers with the QTL was performed by single marker analysis using linear regression and maximum likelihood analysis. It was observed that the additive effect was predominant for genetic control of resistance to gray leaf spot, and the dominant effect in that of grain yield. The most promising markers to be used in studies of assisted selection are: umc2082 in bins 4.03 and umc1117 in bins 4.04 for resistance to gray leaf spot; for grain yield umc1042 in bins 2.07 and umc1058 in bins 4.11.A incorporação de resistência genética a doenças e o aumento na produtividade de grãos estão entre os principais objetivos dos programas de desenvolvimento de híbridos. A identificação de locos de caracteres quantitativos (QTL por meio de análises estatísticas associadas a marcadores moleculares possibilita a rápida obtenção de híbridos resistentes e produtivos. Nesta pesquisa, objetivou-se identificar locos de caracteres quantitativos (QTL associados com resistência à cercosporiose e com produção de grãos em germoplasma de milho tropical. Foram utilizadas duas linhagens contrastantes em níveis de reação à doença (genótipos pertencentes à GENESEEDS - Ltda, seu híbrido F1 e a população segregante F2

  19. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  20. Fine mapping of a quantitative resistance gene for gray leaf spot of maize (Zea mays L.) derived from teosinte (Z. mays ssp. parviglumis)

    Science.gov (United States)

    In previous work, using near isogenic line (NIL) populations in which segments of the tesosinte (Zea mays ssp. parviglumis) genome had been introgressed into the background of the maize line B73, we had identified a QTL on chromosome 8, here called Qgls8, for gray leaf spot resistance. We identified...

  1. Low light and low ammonium are key factors for guayule leaf tissue shoot organogenesis and transformation.

    Science.gov (United States)

    Dong, Niu; Montanez, Belen; Creelman, Robert A; Cornish, Katrina

    2006-02-01

    A new method has been developed for guayule tissue culture and transformation. Guayule leaf explants have a poor survival rate when placed on normal MS medium and under normal culture room light conditions. Low light and low ammonium treatment greatly improved shoot organogenesis and transformation from leaf tissues. Using this method, a 35S promoter driven BAR gene and an ubiquitin-3 promoter driven GUS gene (with intron) have been successfully introduced into guayule. These transgenic guayule plants were resistant to the herbicide ammonium-glufosinate and were positive to GUS staining. Molecular analysis showed the expected band and signal in all GUS positive transformants. The transformation efficiency with glufosinate selection ranged from 3 to 6%. Transformation with a pBIN19-based plasmid containing a NPTII gene and then selection with kanamycin also works well using this method. The ratio of kanamycin-resistant calli to total starting explants reached 50% in some experiments.

  2. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Measurement for the MLC leaf velocity profile by considering the leaf leakage using a radiographic film

    International Nuclear Information System (INIS)

    Chow, James C L; Grigorov, Grigor N

    2006-01-01

    A method to measure the velocity profile of a multi-leaf collimator (MLC) leaf along its travel range using a radiographic film is reported by considering the intra-leaf leakage. A specific dynamic MLC field with leaves travelling from the field edge to the isocentre line was designed. The field was used to expose a radiographic film, which was then scanned, and the dose profile along the horizontal leaf axis was measured. The velocity at a sampling point on the film can be calculated by considering the horizontal distance between the sampling point and the isocentre line, dose at the sampling point, dose rate of the linear accelerator, the total leaf travel time from the field edge to isocentre line and the pre-measured dose rate of leaf leakage. With the leaf velocities and velocity profiles for all MLC leaves measured routinely, a comprehensive and simple QA for the MLC can be set up to test the consistency of the leaf velocity performance which is essential to the IMRT delivery using a sliding window technique. (note)

  4. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  5. Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato

    KAUST Repository

    Mahfouz, Magdy M.

    2017-12-22

    CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

  6. Infrared remote sensing for canopy temperature in paddy field and relationship between leaf temperature and leaf color

    International Nuclear Information System (INIS)

    Wakiyama, Y.

    2002-01-01

    Infrared remote sensing is used for crop monitoring, for example evaluation of water stress, detection of infected crops and estimation of transpiration and photosynthetic rates. This study was conducted to show another application of remote sensing information. The relationship between rice leaf temperature and chlorophyll content in the leaf blade was investigated by using thermography during the ripening period. The canopy of a rice community fertilized by top dressing was cooler than that not fertilized in a 1999 field experiment. In an experiment using thermocouples to measure leaf temperature, a rice leaf with high chlorophyll content was also cooler than that with a low chlorophyll content. Transpiration resistance and transpiration rate were measured with a porometer. Transpiration rate was higher with increasing chlorophyll content in the leaf blade. Stomatal aperture is related to chlorophyll content in the leaf blade. High degree of stomatal aperture is caused by high chlorophyll content in the leaf blade. As degree of stomatal aperture increases, transpiration rate increases. Therefore the rice leaf got cooler with increasing chlorophyll content in leaf blade. Paddy rice communities with different chlorophyll contents were provided with fertilization of different nitrogen levels on basal and top dressing in a 2000 field experiment. Canopy temperature of the rice community with high chlorophyll content was 0.85°C cooler than that of the rice community with low chlorophyll content. Results of this study revealed that infrared remote sensing could detect difference in chlorophyll contents in rice communities and could be used in fertilizer management in paddy fields. (author)

  7. A non-destructive method for estimating onion leaf area

    Directory of Open Access Journals (Sweden)

    Córcoles J.I.

    2015-06-01

    Full Text Available Leaf area is one of the most important parameters for characterizing crop growth and development, and its measurement is useful for examining the effects of agronomic management on crop production. It is related to interception of radiation, photosynthesis, biomass accumulation, transpiration and gas exchange in crop canopies. Several direct and indirect methods have been developed for determining leaf area. The aim of this study is to develop an indirect method, based on the use of a mathematical model, to compute leaf area in an onion crop using non-destructive measurements with the condition that the model must be practical and useful as a Decision Support System tool to improve crop management. A field experiment was conducted in a 4.75 ha commercial onion plot irrigated with a centre pivot system in Aguas Nuevas (Albacete, Spain, during the 2010 irrigation season. To determine onion crop leaf area in the laboratory, the crop was sampled on four occasions between 15 June and 15 September. At each sampling event, eight experimental plots of 1 m2 were used and the leaf area for individual leaves was computed using two indirect methods, one based on the use of an automated infrared imaging system, LI-COR-3100C, and the other using a digital scanner EPSON GT-8000, obtaining several images that were processed using Image J v 1.43 software. A total of 1146 leaves were used. Before measuring the leaf area, 25 parameters related to leaf length and width were determined for each leaf. The combined application of principal components analysis and cluster analysis for grouping leaf parameters was used to reduce the number of variables from 25 to 12. The parameter derived from the product of the total leaf length (L and the leaf diameter at a distance of 25% of the total leaf length (A25 gave the best results for estimating leaf area using a simple linear regression model. The model obtained was useful for computing leaf area using a non

  8. Final report on the safety assessment of AloeAndongensis Extract, Aloe Andongensis Leaf Juice,aloe Arborescens Leaf Extract, Aloe Arborescens Leaf Juice, Aloe Arborescens Leaf Protoplasts, Aloe Barbadensis Flower Extract, Aloe Barbadensis Leaf, Aloe Barbadensis Leaf Extract, Aloe Barbadensis Leaf Juice,aloe Barbadensis Leaf Polysaccharides, Aloe Barbadensis Leaf Water, Aloe Ferox Leaf Extract, Aloe Ferox Leaf Juice, and Aloe Ferox Leaf Juice Extract.

    Science.gov (United States)

    2007-01-01

    Review Expert Panel concluded that anthraquinone levels in the several Aloe Barbadensis extracts are well understood and can conform to the industry-established level of 50 ppm. Although the phototoxicity anthraquinone components of Aloe plants have been demonstrated, several clinical studies of preparations derived from Aloe barbadensis plants demonstrated no phototoxicity, confirming that the concentrations of anthraquinones in such preparations are too low to induce phototoxicity. The characterization of aloe-derived ingredients from other species is not clear. In the absence of well-characterized derivatives, biological studies of these materials are considered necessary. The studies needed are 28-day dermal toxicity studies on Aloe Andongensis Extract, Aloe Andongensis Leaf Juice, Aloe Arborescens Leaf Extract, Aloe Arborescens Leaf Juice, Aloe Ferox Leaf Extract, Aloe Ferox Leaf Juice, and Aloe Ferox Leaf Juice (ingredients should be tested at current use concentrations). In Aloe-derived ingredients used in cosmetics, regardless of species, anthraquinone levels should not exceed 50 ppm. The Cosmetic Ingredient Review Expert Panel advised the industry that the total polychlorobiphenyl (PCB)/pesticide contamination of any plant-derived cosmetic ingredient should be limited to not more than 40 ppm, with not more than 10 ppm for any specific residue and that limits were appropriate for the following impurities: arsenic (3 mg/kg maximum), heavy metals (20 mg/kg maximum), and lead (5 mg/kg maximum).

  9. Total antioxidant and oxidant status in obese children without insulin resistance

    OpenAIRE

    Ayşegül Doğan Demir; Ufuk Erenberk; İlker Tolga Özgen; Emin Özkaya; Aysel Vahapoğlu Türkmen; M. Ruşen Dündaröz; Özcan Erel

    2014-01-01

    Objective: Oxidative stress in obese children may lead in adulthood serious conditions such as coronary heart diseases or type 2 diabetes mellitus. In childhood oxidative stress is associated with insulin resistance or extreme obesity. In this study, we aimed to evaluate oxidative stress status in moderately obese children without insulin resistance. Methods: A total of 38 obese children (21 male, 17 female) without insulin resistance, mean aged 9.4±3.8 years) and 51 normal weight children...

  10. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  11. Contribution of the drought tolerance-related Stress-responsive NAC1 transcription factor to resistance of barley to Ramularia leaf spot

    Science.gov (United States)

    MCGRANN, GRAHAM R D; STEED, ANDREW; BURT, CHRISTOPHER; GODDARD, RACHEL; LACHAUX, CLEA; BANSAL, ANURADHA; CORBITT, MARGARET; GORNIAK, KALINA; NICHOLSON, PAUL; BROWN, JAMES K M

    2015-01-01

    NAC proteins are plant transcription factors that are involved in tolerance to abiotic and biotic stresses, as well as in many developmental processes. Stress-responsive NAC1 (SNAC1) transcription factor is involved in drought tolerance in barley and rice, but has not been shown previously to have a role in disease resistance. Transgenic over-expression of HvSNAC1 in barley cv. Golden Promise reduced the severity of Ramularia leaf spot (RLS), caused by the fungus Ramularia collo-cygni, but had no effect on disease symptoms caused by Fusarium culmorum, Oculimacula yallundae (eyespot), Blumeria graminis f. sp. hordei (powdery mildew) or Magnaporthe oryzae (blast). The HvSNAC1 transcript was weakly induced in the RLS-susceptible cv. Golden Promise during the latter stages of R. collo-cygni symptom development when infected leaves were senescing. Potential mechanisms controlling HvSNAC1-mediated resistance to RLS were investigated. Gene expression analysis revealed no difference in the constitutive levels of antioxidant transcripts in either of the over-expression lines compared with cv. Golden Promise, nor was any difference in stomatal conductance or sensitivity to reactive oxygen species-induced cell death observed. Over-expression of HvSNAC1 delayed dark-induced leaf senescence. It is proposed that mechanisms controlled by HvSNAC1 that are involved in tolerance to abiotic stress and that inhibit senescence also confer resistance to R. collo-cygni and suppress RLS symptoms. This provides further evidence for an association between abiotic stress and senescence in barley and the development of RLS. PMID:25040333

  12. Infestation of froghopper nymphs changes the amounts of total phenolics in sugarcane

    Directory of Open Access Journals (Sweden)

    Silva Rafael José Navas da

    2005-01-01

    Full Text Available The increased rate of sugarcane harvest without previous burn has provided a very favorable environment to the froghopper Mahanarva fimbriolata (Stal, 1854, with high moisture and low temperature variation. Few works have studied the response of sugarcane to this pest, so little is known about resistant cultivars. Plant phenolics are widely studied compounds because of their known antiherbivore effect. This research aims to determine if the attack of M. fimbriolata nymphs stimulates the accumulation of total phenolics in sugarcane. The experiment was carried out in greenhouse and arranged in completely randomized design, in a 3 X 2 X 4 factorial with three replications. Second instar nymphs of M. fimbriolata were infested at the following rates: control, 2-4 and 4-8 nymphs per pot (first-second infestations, respectively. Pots were covered with nylon net and monitored daily to isolate the effect of leaf sucking adults. Leaf and root samples were collected and kept frozen in liquid nitrogen until analyses. Infested plants showed higher levels of phenolics in both root and leaf tissues. In roots, the cultivar SP80-1816 accumulated more phenolic compounds in response to the infestation of M. fimbriolata. On the other hand, higher levels were found in leaves and roots of control plants of SP86-42, which might be an indication of a non-preference mechanism. The increase of total phenolics in sugarcane infested with root-sucking froghopper nymphs does not seem to be useful to detect the resistance to this pest.

  13. Identification of quantitative trait Loci for resistance to southern leaf blight and days to anthesis in a maize recombinant inbred line population.

    Science.gov (United States)

    Balint-Kurti, P J; Krakowsky, M D; Jines, M P; Robertson, L A; Molnár, T L; Goodman, M M; Holl, J B

    2006-10-01

    ABSTRACT A recombinant inbred line population derived from a cross between the maize lines NC300 (resistant) and B104 (susceptible) was evaluated for resistance to southern leaf blight (SLB) disease caused by Cochliobolus heterostrophus race O and for days to anthesis in four environments (Clayton, NC, and Tifton, GA, in both 2004 and 2005). Entry mean and average genetic correlations between disease ratings in different environments were high (0.78 to 0.89 and 0.9, respectively) and the overall entry mean heritability for SLB resistance was 0.89. When weighted mean disease ratings were fitted to a model using multiple interval mapping, seven potential quantitative trait loci (QTL) were identified, the two strongest being on chromosomes 3 (bin 3.04) and 9 (bin 9.03-9.04). These QTL explained a combined 80% of the phenotypic variation for SLB resistance. Some time-point-specific SLB resistance QTL were also identified. There was no significant correlation between disease resistance and days to anthesis. Six putative QTL for time to anthesis were identified, none of which coincided with any SLB resistance QTL.

  14. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  15. Genetic characterization of angular leaf spot resistance in selected ...

    African Journals Online (AJOL)

    Mr Tryphone

    2015-10-28

    Oct 28, 2015 ... Angular leaf spot disease (ALS) caused by Pseudocercospora griseola is one ... Author(s) agree that this article remains permanently open access under the terms ... that results in shrivelled seeds of reduced size and quality.

  16. Association Mapping of Quantitative Trait Loci in Spring Wheat Landraces Conferring Resistance to Bacterial Leaf Streak and Spot Blotch

    Directory of Open Access Journals (Sweden)

    Tika B. Adhikari

    2012-03-01

    Full Text Available Bacterial leaf streak (BLS, caused by pv. (Smith et al. Bragard et al., and spot blotch (SB, caused by (S. Ito & Kurib. Drechs. ex Dastur, are two emerging diseases of wheat ( L.. To achieve sustainable disease management strategies and reduce yield losses, identifying new genes that confer quantitative resistance would benefit resistance breeding efforts. The main objective of this study was to use association mapping (AM with 832 polymorphic Diversity Arrays Technology (DArT markers to identify genomic regions associated with resistance to BLS and SB in 566 spring wheat landraces. From data analysis of this diverse panel of wheat accessions, we discovered five novel genomic regions significantly associated with resistance to BLS on chromosomes 1A, 4A, 4B, 6B, and 7D. Similarly, four genomic regions were found to be associated with resistance to SB on chromosomes 1A, 3B, 7B, and 7D. A high degree of linkage disequilibrium (LD decayed over short genetic distance in the set of wheat accessions studied, and some of these genomic regions appear to be involved in multiple disease resistance (MDR. These results suggest that the AM approach provides a platform for discovery of resistance conditioned by multiple genes with quantitative effects, which could be validated and deployed in wheat breeding programs.

  17. Two alternative recessive quantitative trait loci influence resistance to spring black stem and leaf spot in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Oliver Richard P

    2008-03-01

    Full Text Available Abstract Background Knowledge of the genetic basis of plant resistance to necrotrophic pathogens is incomplete and has been characterised in relatively few pathosystems. In this study, the cytology and genetics of resistance to spring black stem and leaf spot caused by Phoma medicaginis, an economically important necrotrophic pathogen of Medicago spp., was examined in the model legume M. truncatula. Results Macroscopically, the resistant response of accession SA27063 was characterised by small, hypersensitive-like spots following inoculation while the susceptible interaction with accessions A17 and SA3054 showed necrotic lesions and spreading chlorosis. No unique cytological differences were observed during early infection (2 populations segregating for resistance to spring black stem and leaf spot were established between SA27063 and the two susceptible accessions, A17 and SA3054. The cross between SA27063 and A17 represented a wider cross than between SA27063 and SA3054, as evidenced by higher genetic polymorphism, reduced fertility and aberrant phenotypes of F2 progeny. In the SA27063 × A17 F2 population a highly significant quantitative trait locus (QTL, LOD = 7.37; P Phoma medicaginis one (rnpm1 genetically mapped to the top arm of linkage group 4 (LG4. rnpm1 explained 33.6% of the phenotypic variance in the population's response to infection depicted on a 1–5 scale and was tightly linked to marker AW256637. A second highly significant QTL (LOD = 6.77; P rnpm2, was located on the lower arm of LG8 in the SA27063 × SA3054 map. rnpm2 explained 29.6% of the phenotypic variance and was fine mapped to a 0.8 cM interval between markers h2_16a6a and h2_21h11d. rnpm1 is tightly linked to a cluster of Toll/Interleukin1 receptor-nucleotide binding site-leucine-rich repeat (TIR-NBS-LRR genes and disease resistance protein-like genes, while no resistance gene analogues (RGAs are apparent in the genomic sequence of the reference accession A17 at the

  18. Leaf transpiration efficiency of some drought-resistant maize lines

    Science.gov (United States)

    Field measurements of leaf gas exchange in maize often indicate stomatal conductances higher than required to provide substomatal carbon dioxide concentrations saturating to photosynthesis. Thus maize leaves often operate at lower transpiration efficiency (TE) than potentially achievable for specie...

  19. Working Towards Disease Resistance in Peanuts Through Biotechnology

    Science.gov (United States)

    Resistant cultivars are the most desirable approach to disease control in agriculture. Early and late leaf spot are the most important foliar diseases of peanut worldwide. Significant progress for leaf spot resistance in peanut can be achieved through biotechnology. The National Peanut Research ...

  20. Total antioxidant and oxidant status in obese children without insulin resistance

    Directory of Open Access Journals (Sweden)

    Ayşegül Doğan Demir

    2014-06-01

    Full Text Available Objective: Oxidative stress in obese children may lead in adulthood serious conditions such as coronary heart diseases or type 2 diabetes mellitus. In childhood oxidative stress is associated with insulin resistance or extreme obesity. In this study, we aimed to evaluate oxidative stress status in moderately obese children without insulin resistance. Methods: A total of 38 obese children (21 male, 17 female without insulin resistance, mean aged 9.4±3.8 years and 51 normal weight children (25 male, 26 female as the control group, mean aged 9.3±3.9 years were enrolled to the study. Total oxidative status (TOS, total antioxidant capacity (TAC were measured and oxidative stress index (OSI was calculated. Results: The results reveal that obese children had lower TAC than normal weight children (2,27±0,28 vs. 2.76±0.35 mmol Trolox Eq./L; p<0,001. There was no statistical difference between obese and control groups regarding TOS (6,08±3,63 vs 5.25±4.16 μmol H2O2 Eq./L; p=0.333. OSI was higher in obese group (2.65±1.52 vs 1.92±1.56; p=0.029 Conclusion: Balance between oxidant and antioxidant system is disrupted due to the reduced TAC even in moderately obese children without insulin resistance. Further studies should also be performed to evaluate the beneficial effects of dietary intake of antioxidants in these children.

  1. Effects of leaf movement on leaf temperature, transpiration and radiation interception in soybean under water stress conditions

    International Nuclear Information System (INIS)

    Isoda, A.; Wang, P.

    2001-01-01

    Varietal differences in leaf movement were examined in terms of radiation interception, leaf temperature and transpiration under water stressed conditions. Five cultivars (Qindou 7232, Gaofei 16, Dongnong 87 - 138, 8285 - 8 and 8874) were grown in a concrete frame field in Xinjiang, China. Irrigation treatments (irrigation and no irrigation) were made from the flowering to the pod filling stage. A leaflet in the uppermost layer of the canopy was restrained horizontally. Leaf temperatures, transpiration rate (stem sap flow rate of the main stem per unit leaf area) and intercepted radiation of each leaflet were measured. There were greater varietal differences in leaf movement, leaf temperature and transpiration rate. Leaf temperature seemed to be adjusted by leaf movement and transpiration. The extent to which is adjusted by leaf movement and transpiration differed among the cultivars; leaf temperature was influenced mainly by leaf movement for Gaofei 16 and Dongnong 87 - 138, mainly by transpiration for Qindou 7232 and 8874, and by both for 8285 - 8. Intercepted radiation in the upper two layers of the canopy (20 cm from the uppermost) was greater in the irrigated plot, although the mean values of total leaflets of the irrigated plot were not different as compared to the non-irrigated plot. Although paraheliotropic leaf movement decreased radiation interception, it offers some possibilities for the improvement in radiation penetration within a dense canopy. Cumulated amount of transpiration during a day was compared between the restrained-leaf and the non-leaf-restrained plants in 8874. Paraheliotropic leaf movement reduced water loss by 23% in the irrigated and 71% in the non-irrigated plots

  2. Genetic control of the angular leaf spot reaction in common bean leaves and pods

    Directory of Open Access Journals (Sweden)

    Jerônimo Constantino Borel

    2011-12-01

    Full Text Available Information about genetic control of plant reaction to pathogens is essential in plant breeding programs focusing resistance. This study aimed to obtain information about genetic control of the angular leaf spot reaction in leaves and pods from common bean (Phaseolus vulgaris L. line ESAL 686. This line was crossed with cultivars Jalo EEP 558 (resistant, Cornell 49-242 (resistant and Carioca MG (susceptible. Generations F1, F2 and backcrosses (BC11 and BC21 were obtained. In the dry season (2009, parents and respective populations were evaluated for angular leaf spot reaction under field conditions. Disease severity was evaluated on leaves and pods using diagrammatic scales. Severity scores were obtained and mean and variance genetic components were estimated for both. Segregation of F2 generation was analyzed for some crosses. Different genes control angular leaf spot reaction in leaves and pods. Mean and variance components showed predominance of additive effects. Heritability was high, however, was greater on pods than on leaves which indicated that leaf reaction is more influenced by the environment.

  3. Melhoramento do feijoeiro comum com grão tipo carioca, visando resistência à antracnose e à mancha angular Breeding of common bean with carioca type grain for the resistance to anthracnose and angular leaf spot

    Directory of Open Access Journals (Sweden)

    Mansuêmia Alves Couto

    2008-10-01

    Full Text Available Objetivou-se no trabalho, selecionar linhagens de feijoeiro comum que reunissem, além da alta produtividade, porte ereto e grãos do tipo Carioca, também a resistência à antracnose e à mancha angular. O material experimental constituiu-se de 143 linhagens oriundas de três famílias segregantes F1:4RC2 {[(G2333 X ESAL 696 X ESAL 696] X CI 140}. Foram conduzidos quatro experimentos em três localidades da região sul de Minas Gerais, avaliando-se a produção, o tipo de grão, o porte e a reação à mancha angular. A reação à antracnose foi determinada a partir de inoculações de plantas jovens de cada linhagem, com as raças 2047 e 1545, mantidas em câmara de nevoeiro por três dias e transferidas para casa de vegetação com irrigação por aspersão, a cada quatro horas. Selecionaram-se quatro linhagens com alta produtividade, porte mais arbustivo, grãos tipo carioca e com resistência à mancha angular (nota até 4. Uma das linhagens selecionada possui o alelo Co-4², outras duas possuem o alelo Co-7 de resistência à antracnose e a última, embora seja suscetível à antracnose, possui resistência à mancha angular (nota 3,97 e maior produtividade de grãos.Aiming to select common bean lines with high grain yield, Carioca grain type, upright plant habit and resistant to anthracnose and angular leaf spot, 143 lines were selected from three families of the cross F1:4RC2 {[(G2333 X ESAL 696 X ESAL 696] X CI 140}. The promising lines were selected based on the agronomical traits in four field experiments, set up in three places in Southern MG State using the square lattice design. The reaction of each line to the anthracnose was evaluated by inoculating the seedlings using the races 1545 and 2047, and kept in humid chamber during three days, and then moved to greenhouse with sprinkle irrigation every four hours. Four lines with high grain yield, upright plant habit, Carioca grain type, and resistance to angular leaf spot (score up

  4. Contribution of the drought tolerance-related Stress-responsive NAC1 transcription factor to resistance of barley to Ramularia leaf spot

    OpenAIRE

    MCGRANN, GRAHAM R D; STEED, ANDREW; BURT, CHRISTOPHER; GODDARD, RACHEL; LACHAUX, CLEA; BANSAL, ANURADHA; CORBITT, MARGARET; GORNIAK, KALINA; NICHOLSON, PAUL; BROWN, JAMES K M

    2014-01-01

    NAC proteins are plant transcription factors that are involved in tolerance to abiotic and biotic stresses, as well as in many developmental processes. Stress-responsive NAC1 (SNAC1) transcription factor is involved in drought tolerance in barley and rice, but has not been shown previously to have a role in disease resistance. Transgenic over-expression of HvSNAC1 in barley cv. Golden Promise reduced the severity of Ramularia leaf spot (RLS), caused by the fungus Ramularia collo-cygni, but ha...

  5. BOREAS TE-9 NSA Leaf Chlorophyll Density

    Science.gov (United States)

    Hall, Forrest G. (Editor); Curd, Shelaine (Editor); Margolis, Hank; Sy, Mikailou

    2000-01-01

    The BOREAS TE-9 team collected several data sets related to chemical and photosynthetic properties of leaves in boreal forest tree species. These data were collected to help provide an explanation of potential seasonal and spatial changes of leaf pigment properties in boreal forest species at the NSA. At different dates (FFC-Winter, FFC-Thaw, IFC-1, IFC-2, and IMC-3), foliage samples were collected from the upper third of the canopy for five NSA sites (YJP, OJP, OBS, UBS, and OA) near Thompson, Manitoba. Subsamples of 100 needles for black spruce, 20 needles for jack pine, and single leaf for trembling aspen were cut into pieces and immersed in a 20-mL DMF aliquot in a Nalgene test tube. The extracted foliage materials were then oven-dried at 68 C for 48 hours and weighed. Extracted leaf dry weight was converted to a total leaf area basis to express the chlorophyll content in mg/sq cm of total leaf area. The data are provided in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  6. Early detection of crop injury from herbicide glyphosate by leaf biochemical parameter inversion

    Science.gov (United States)

    Early detection of crop injury from glyphosate is of significant importance in crop management. In this paper, we attempt to detect glyphosate-induced crop injury by PROSPECT (leaf optical PROperty SPECTra model) inversion through leaf hyperspectral reflectance measurements for non-Glyphosate-Resist...

  7. Shrub type dominates the vertical distribution of leaf C : N : P stoichiometry across an extensive altitudinal gradient

    Science.gov (United States)

    Zhao, Wenqiang; Reich, Peter B.; Yu, Qiannan; Zhao, Ning; Yin, Chunying; Zhao, Chunzhang; Li, Dandan; Hu, Jun; Li, Ting; Yin, Huajun; Liu, Qing

    2018-04-01

    Understanding leaf stoichiometric patterns is crucial for improving predictions of plant responses to environmental changes. Leaf stoichiometry of terrestrial ecosystems has been widely investigated along latitudinal and longitudinal gradients. However, very little is known about the vertical distribution of leaf C : N : P and the relative effects of environmental parameters, especially for shrubs. Here, we analyzed the shrub leaf C, N and P patterns in 125 mountainous sites over an extensive altitudinal gradient (523-4685 m) on the Tibetan Plateau. Results showed that the shrub leaf C and C : N were 7.3-47.5 % higher than those of other regional and global flora, whereas the leaf N and N : P were 10.2-75.8 % lower. Leaf C increased with rising altitude and decreasing temperature, supporting the physiological acclimation mechanism that high leaf C (e.g., alpine or evergreen shrub) could balance the cell osmotic pressure and resist freezing. The largest leaf N and high leaf P occurred in valley region (altitude 1500 m), likely due to the large nutrient leaching from higher elevations, faster litter decomposition and nutrient resorption ability of deciduous broadleaf shrub. Leaf N : P ratio further indicated increasing N limitation at higher altitudes. Interestingly, drought severity was the only climatic factor positively correlated with leaf N and P, which was more appropriate for evaluating the impact of water status than precipitation. Among the shrub ecosystem and functional types (alpine, subalpine, montane, valley, evergreen, deciduous, broadleaf, and conifer), their leaf element contents and responses to environments were remarkably different. Shrub type was the largest contributor to the total variations in leaf stoichiometry, while climate indirectly affected the leaf C : N : P via its interactive effects on shrub type or soil. Collectively, the large heterogeneity in shrub type was the most important factor explaining the overall leaf C : N : P variations

  8. Rapid, high-resolution measurement of leaf area and leaf orientation using terrestrial LiDAR scanning data

    International Nuclear Information System (INIS)

    Bailey, Brian N; Mahaffee, Walter F

    2017-01-01

    The rapid evolution of high performance computing technology has allowed for the development of extremely detailed models of the urban and natural environment. Although models can now represent sub-meter-scale variability in environmental geometry, model users are often unable to specify the geometry of real domains at this scale given available measurements. An emerging technology in this field has been the use of terrestrial LiDAR scanning data to rapidly measure the three-dimensional geometry of trees, such as the distribution of leaf area. However, current LiDAR methods suffer from the limitation that they require detailed knowledge of leaf orientation in order to translate projected leaf area into actual leaf area. Common methods for measuring leaf orientation are often tedious or inaccurate, which places constraints on the LiDAR measurement technique. This work presents a new method to simultaneously measure leaf orientation and leaf area within an arbitrarily defined volume using terrestrial LiDAR data. The novelty of the method lies in the direct measurement of the fraction of projected leaf area G from the LiDAR data which is required to relate projected leaf area to total leaf area, and in the new way in which radiation transfer theory is used to calculate leaf area from the LiDAR data. The method was validated by comparing LiDAR-measured leaf area to (1) ‘synthetic’ or computer-generated LiDAR data where the exact area was known, and (2) direct measurements of leaf area in the field using destructive sampling. Overall, agreement between the LiDAR and reference measurements was very good, showing a normalized root-mean-squared-error of about 15% for the synthetic tests, and 13% in the field. (paper)

  9. Inheritance of Resistance to Powdery Mildew Race 1W in Watermelon.

    Science.gov (United States)

    Ben-Naim, Yariv; Cohen, Yigal

    2015-11-01

    Powdery mildew caused by Podosphaera xanthii is a major disease of watermelon in Israel. In this study, 291 accessions of Citrullus spp. were evaluated for resistance against P. xanthii race 1W. Only eight accessions exhibited high level of resistance. Inheritance of resistance against P. xanthii race 1W was studied by crossing three resistant accession of Citrullus lanatus var. citroides BIU 119, PI 189225, or PI 482312 with the susceptible cultivar 'Malali' or 'Sugar Baby'. Parents, F1, F2, and back cross progenies were evaluated for resistance in growth chambers at the cotyledon stage and the 4-leaf stage and in the field, at the 15-leaf stage. Resistance at the cotyledon stage was controlled by a single, partially dominant gene, whereas at the 4-leaf stage or the 15-leaf stage resistance was controlled by three complimentary, partially dominant genes. Crosses made among these resistant accessions revealed that BIU 119 and PI 189225 carry the same genes for resistance, whereas PI 482312 shares two out of three genes with both BIU 119 and PI 189225. A breeding line with high resistance level and good fruit qualities was developed from BIU 119 × HA5500.

  10. Responses of Nasonovia ribisnigri (Homoptera: Aphididae) to susceptible and resistant lettuce.

    Science.gov (United States)

    Liu, Yong-Biao; McCreight, James D

    2006-06-01

    Nymphs and alates of aphid Nasonovia ribisnigri (Mosley) (Homoptera: Aphididae) were tested on 10 lettuce cultivars with N. ribisnigri resistance gene Nr and 18 cultivars without the resistance gene in various bioassays. Bioassays used whole plants, leaf discs, or leaf cages to determine susceptibility of commercial lettuce cultivars to N. ribisnigri infestation and to evaluate screening methods for breeding lettuce resistance to N. ribisnigri. Resistant and susceptible plants were separated in 3 d when using whole plant bioassays. Long-term (> or =7 d) no-choice tests using leaf cages or whole plants resulted in no survival of N. ribisnigri on resistant plants, indicating great promise of the Nr gene for management of N. ribisnigri. Effective screening was achieved in both no-choice tests where resistant or susceptible intact plants were tested separately in groups or individually and in choice tests where susceptible and resistant plants were intermixed. Leaf discs bioassays were not suitable for resistance screening. All lettuce cultivars without the resistance gene were suitable hosts for N. ribisnigri, indicating the great importance of this pest to lettuce production and the urgency in developing resistant lettuce cultivars to manage N. ribisnigri.

  11. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

    Science.gov (United States)

    Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

    2010-03-01

    Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

  12. Developing markers for Sigatoka leaf spot disease (Mycosphaerella ...

    African Journals Online (AJOL)

    Jane

    2011-07-06

    Jul 6, 2011 ... Developing markers for Sigatoka leaf spot disease ... OPERON primer pairs were used to screen genomic DNA from two resistant cultivars: Calcutta 4 ( ..... Blomme G, Eden-Green S, Mustaffa M, Nwauzoma B, Thangavelu R.

  13. Total resistance of native bacteria as an indicator of changes in the water environment

    Energy Technology Data Exchange (ETDEWEB)

    Harnisz, Monika [Department of Environmental Microbiology, University of Warmia and Mazury in Olsztyn, Prawocheńskiego 1, 10-957 Olsztyn (Poland)

    2013-03-15

    This study analyzes changes in the total (intrinsic and acquired) resistance of autochthonous bacteria in a river which is a receiver of treated wastewater. In the analyzed samples, tetracycline contamination levels were low and characteristic of surface water bodies. An increase in the populations of tetracycline-resistant and fluoroquinolone-resistant microorganisms was noted in downstream river water samples in comparison with upstream river water samples, but the above trend was not observed in bacteria resistant to macrolides and β-lactams. The counts of doxycycline-resistant bacteria (DOX{sup R}) were significantly correlated with doxycycline levels. The minimum inhibitory concentrations (MICs) for doxycycline in DOX{sup R} isolates were higher in downstream river water than in upstream river water samples. The discharge of treated wastewater had no effect on the multi-drug resistance of oxytetracycline-resistant and doxycycline-resistant isolates. The results of the experiment indicate that the presence of doxycycline-resistant bacteria is a robust indicator of anthropogenic stress in river water. -- Highlights: ► The total resistance of native bacteria in river which is a receiver of treated wastewater was analyzed. ► Tetracyclines contamination levels were low. ► The counts of doxycycline-resistant bacteria were correlated with doxycycline levels. -- The presence of doxycycline-resistant bacteria in rivers can be a robust indicator of anthropogenic stress.

  14. Total resistance of native bacteria as an indicator of changes in the water environment

    International Nuclear Information System (INIS)

    Harnisz, Monika

    2013-01-01

    This study analyzes changes in the total (intrinsic and acquired) resistance of autochthonous bacteria in a river which is a receiver of treated wastewater. In the analyzed samples, tetracycline contamination levels were low and characteristic of surface water bodies. An increase in the populations of tetracycline-resistant and fluoroquinolone-resistant microorganisms was noted in downstream river water samples in comparison with upstream river water samples, but the above trend was not observed in bacteria resistant to macrolides and β-lactams. The counts of doxycycline-resistant bacteria (DOX R ) were significantly correlated with doxycycline levels. The minimum inhibitory concentrations (MICs) for doxycycline in DOX R isolates were higher in downstream river water than in upstream river water samples. The discharge of treated wastewater had no effect on the multi-drug resistance of oxytetracycline-resistant and doxycycline-resistant isolates. The results of the experiment indicate that the presence of doxycycline-resistant bacteria is a robust indicator of anthropogenic stress in river water. -- Highlights: ► The total resistance of native bacteria in river which is a receiver of treated wastewater was analyzed. ► Tetracyclines contamination levels were low. ► The counts of doxycycline-resistant bacteria were correlated with doxycycline levels. -- The presence of doxycycline-resistant bacteria in rivers can be a robust indicator of anthropogenic stress

  15. Marker-Assisted Selection of Xa21 Conferring Resistance to Bacterial Leaf Blight in indica Rice Cultivar LT2

    Institute of Scientific and Technical Information of China (English)

    Hue Thi NGUYEN; Trung Nguyen DINH; Nakano TOSHITSUGU; Liet Van VU; Quang Hong VU; Tan Van MAI; Thu Thi NGUYEN; Lam Duc VU; Tung Thanh NGUYEN; Long Viet NGUYEN; Hien Thu Thi VU; Hue Thi NONG

    2018-01-01

    Bacterial leaf blight of rice (BLB), caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive diseases in Asian rice fields. A high-quality rice variety, LT2, was used as the recipient parent. IRBB21, which carries the Xa21 gene, was used as the donor parent. The resistance gene Xa21 was introduced into LT2 by marker-assisted backcrossing. Three Xoo races were used to inoculate the improved lines following the clipping method. Eleven BC3F3lines carrying Xa21 were obtained based on molecular markers and agronomic performance. The 11 lines were then inoculated with the three Xoo races. All the 11 improved lines showed better resistance to BLB than the recipient parent LT2. Based on the level of resistance to BLB and their agronomic performance, five lines (BC3F35.1.5.1, BC3F35.1.5.12, BC3F38.5.6.44, BC3F3 9.5.4.1 and BC3F39.5.4.23) were selected as the most promising for commercial release. These improved lines could contribute to rice production in terms of food security.

  16. TLC profiles and antibacterial activity of Glinus oppositifolius L. Aug. DC. (Molluginaceae leaf and stem extracts against bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Juliana Janet R. Martin-Puzon

    2015-07-01

    Full Text Available Objective: To determine the antibacterial activities and the thin-layer chromatography (TLC fingerprint profiles of leaf and stem extracts of Glinus oppositifolius L. Aug. DC (G. oppositifolius. Methods: The leaves and stems were extracted using chloroform, ethanol and methanol as solvents. The antibacterial activity of the extracts were evaluated through disc diffusion, minimum inhibitory concentration and bactericidal concentration assays against methicillinresistant Staphylococcus aureus, vancomycin-resistant Enterococcus, extended spectrum β-lactamase-producing, carbapenem-resistant Enterobacteriaceae, and metallo-β-lactamaseproducing Pseudomonas aeruginosa (P. aeruginosa and Acinetobacter baumanii (A. baumanii. The TLC separation was carried out on leaf and stem ethanol extracts in ethyl acetate: n-hexane solvent system. Distinct spots were examined under visible light, UV 254 nm, UV 366 nm and after spraying with vanillin-sulfuric acid. Results: The leaf extracts revealed antibacterial activities, inhibiting the growth of the nonresistant and multidrug-resistant strains of the Gram-negative bacteria Escherichia coli, P. aeruginosa and A. baumanii. The TLC fingerprint profiles demonstrated the presence of various phytochemicals in leaf and stem extracts. Leaf extracts exhibited more diverse constituents compared to stem extracts, but some constituents were similar in both plant parts. Conclusions: G. oppositifolius leaf extracts can be used as new, alternative sources of antimicrobials against non-resistant and multidrug-resistant strains of the Gram-negative bacteria Escherichia coli, P. aeruginosa and A. baumanii. The TLC profiles represent the chemical integrity of G. oppositifolius leaf and stem extracts which form an important and powerful tool for standardization, authentication, quality control and determination of bioactive components of G. oppositifolius in any formulation and in powder form.

  17. Leaf venation, as a resistor, to optimize a switchable IR absorber.

    Science.gov (United States)

    Alston, M E; Barber, R

    2016-08-24

    Leaf vascular patterns are the mechanisms and mechanical support for the transportation of fluidics for photosynthesis and leaf development properties. Vascular hierarchical networks in leaves have far-reaching functions in optimal transport efficiency of functional fluidics. Embedding leaf morphogenesis as a resistor network is significant in the optimization of a translucent thermally functional material. This will enable regulation through pressure equalization by diminishing flow pressure variation. This paper investigates nature's vasculature networks that exhibit hierarchical branching scaling applied to microfluidics. To enable optimum potential for pressure drop regulation by algorithm design. This code analysis of circuit conduit optimization for transport fluidic flow resistance is validated against CFD simulation, within a closed loop network. The paper will propose this self-optimization, characterization by resistance seeking targeting to determine a microfluidic network as a resistor. To advance a thermally function material as a switchable IR absorber.

  18. Field performance of Populus expressing somaclonal variation in resistance to Septoria musiva

    Science.gov (United States)

    M. E. Ostry; K. T. Ward

    2003-01-01

    Over 1500 trees from two hybrid poplar clones regenerated from tissue culture and expressing somatic variation in leaf disease resistance in a laboratory leaf disk bioassay were field-tested for 5-11 years to examine their resistance to Septoria leaf spot and canker and to assess their growth characteristics compared with the source clones....

  19. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  20. prevalence of angular leaf spot disease and sources of resistance

    African Journals Online (AJOL)

    USER

    2017-02-17

    Feb 17, 2017 ... Angular leaf spot (Pseudocercospora griseola Crous U, Brown) is one of the ..... Incidence of six foliar bean diseases in two agro ecological zones of eastern Democratic Republic of .... use of poor quality farmer-saved seed.

  1. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  2. Peach leaf responses to soil and cement dust pollution.

    Science.gov (United States)

    Maletsika, Persefoni A; Nanos, George D; Stavroulakis, George G

    2015-10-01

    Dust pollution can negatively affect plant productivity in hot, dry and with high irradiance areas during summer. Soil or cement dust were applied on peach trees growing in a Mediterranean area with the above climatic characteristics. Soil and cement dust accumulation onto the leaves decreased the photosynthetically active radiation (PAR) available to the leaves without causing any shade effect. Soil and mainly cement dust deposition onto the leaves decreased stomatal conductance, photosynthetic and transpiration rates, and water use efficiency due possibly to stomatal blockage and other leaf cellular effects. In early autumn, rain events removed soil dust and leaf functions partly recovered, while cement dust created a crust partially remaining onto the leaves and causing more permanent stress. Leaf characteristics were differentially affected by the two dusts studied due to their different hydraulic properties. Leaf total chlorophyll decreased and total phenol content increased with dust accumulation late in the summer compared to control leaves due to intense oxidative stress. The two dusts did not cause serious metal imbalances to the leaves, except of lower leaf K content.

  3. Leaf litter processing and invertebrate assemblages along a pollution gradient in a Maine (USA) headwater stream

    International Nuclear Information System (INIS)

    Woodcock, Thomas S.; Huryn, Alexander D.

    2005-01-01

    During the autumn of 1997 and 1998, leaf litter processing rates and leaf pack invertebrate assemblages were examined at eight stations along a pollution gradient in Goosefare Brook, a first-order coastal plain stream in southern Maine (USA). There was no significant effect on litter softening rate in 1997, and only the most polluted station showed a decrease in 1998. However, litter loss rates showed decreases in both years. The structure of invertebrate assemblages changed in response to the stresses, showing a decline in EPT richness and an increase in the proportion of collecting taxa. However, total shredder biomass was only weakly affected. Shredder biomass at all stations was dominated by Tipula, and biomass of other shredder taxa showed a serial replacement along the gradient of stress related to their pollution tolerance. Rather than the expected relationship with shredder biomass, litter processing rates were directly related to water and sediment quality. Goosefare Brook demonstrates how variable pollution tolerance of community members enables stress resistance and a consequent preservation of ecosystem function. - Variable pollution tolerance of community members provides stress resistance at the ecosystem level in streams

  4. Free Testosterone During Androgen Deprivation Therapy Predicts Castration-Resistant Progression Better Than Total Testosterone.

    Science.gov (United States)

    Regis, Lucas; Planas, Jacques; Carles, Joan; Maldonado, Xavier; Comas, Inma; Ferrer, Roser; Morote, Juan

    2017-01-01

    The optimal degree of testosterone suppression in patients with prostate cancer undergoing androgen deprivation therapy remains in question. Furthermore, serum free testosterone, which is the active form of testosterone, seems to correlate with intraprostatic testosterone. Here we compared free and total serum testosterone as predictors of survival free of castration resistance. Total testosterone (chemiluminescent assay, lower sensitivity 10 ng/dl) and free testosterone (analogue-ligand radioimmunoassay, lower sensitivity 0.05 pg/ml) were determined at 6 months of LHRH agonist treatment in a prospective cohort of 126 patients with prostate cancer. During a mean follow-up of 67 months (9-120), 75 (59.5%) events of castration-resistant progression were identified. Multivariate analysis and survival analysis according to total testosterone cutoffs of 50, 32, and 20 ng/dl, and free testosterone cutoffs of 1.7, 1.1, and 0.7 pg/ml were performed. Metastatic spread was the most powerful predictor of castration resistance, HR: 2.09 (95%CI: 1.18-3.72), P = 0.012. Gleason score, baseline PSA and PSA at 6 months were also independents predictors, but not free and total testosterone. Stratified analysis was conducted on the basis of the status of metastatic diseases and free testosterone was found to be an independent predictor of survival free of castration resistance in the subgroup of patients without metastasis, HR: 2.12 (95%CI: 1.16-3.85), P = 0.014. The lowest threshold of free testosterone which showed significant differences was 1.7 pg/ml, P = 0.003. Free testosterone at 6 months of LHRH agonist treatment seems to be a better surrogate than total testosterone to predict castration resistance in no metastatic prostate cancer patients. Prostate 77:114-120, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  5. Antibacterial activity of mangrove leaf extracts against human pathogens

    Digital Repository Service at National Institute of Oceanography (India)

    Sahoo, G.; Mulla, N.S.S.; Ansari, Z.A.; Mohandass, C.

    ., Salmonella typhi, Proteus vulgaris and Proteus mirabilis. As compared to aqueous, ethanol extract showed broad-spectrum activity. The multidrug-resistant (MDR) bacteria Salmonella typhi was inhibited by the ethanol extract of S. alba leaf whereas the other...

  6. An analytical approach for optimizing the leaf design of a multi-leaf collimator in a linear accelerator

    International Nuclear Information System (INIS)

    Topolnjak, R; Heide, U A van der

    2008-01-01

    In this study, we present an analytical approach for optimizing the leaf design of a multi-leaf collimator (MLC) in a linear accelerator. Because leaf designs vary between vendors, our goal is to characterize and quantify the effects of different compromises which have to be made between performance parameters. Subsequently, an optimal leaf design for an earlier proposed six-bank MLC which combines a high-resolution field-shaping ability with a large field size is determined. To this end a model of the linac is created that includes the following parameters: the source size, the maximum field size, the distance between source and isocenter, and the leaf's design parameters. First, the optimal radius of the leaf tip was found. This optimum was defined by the requirement that the fluence intensity should fall from 80% of the maximum value to 20% in a minimal distance, defining the width of the fluence penumbra. A second requirement was that this penumbra width should be constant when a leaf moves from one side of the field to the other. The geometric, transmission and total penumbra width (80-20%) were calculated depending on the design parameters. The analytical model is in agreement with Elekta, Varian and Siemens collimator designs. For leaves thinner than 4 cm, the transmission penumbra becomes dominant, and for leaves close to the source the geometric penumbra plays a role. Finally, by choosing the leaf thickness of 3.5 cm, 4 cm and 5 cm from the lowest to the highest bank, respectively, an optimal leaf design for a six-bank MLC is achieved

  7. Accumulation of three different sizes of particulate matter on plant leaf surfaces: Effect on leaf traits

    Directory of Open Access Journals (Sweden)

    Chen Xiaoping

    2015-01-01

    Full Text Available Plants not only improve air quality by adsorbing particulate matter (PM on leaf surfaces but can also be affected by their accumulation. In this study, a field investigation was performed in Wuhan, China, into the relationship between seven leaf traits and the accumulation of three different sizes of PM (PM11, PM2.5 and PM0.2 on leaves. The retention abilities of plant leaves with respect to the three sizes of PM differed significantly at different sites and species. The average PM retention capabilities of plant leaves and specific leaf area (SLA were significantly greater in a seriously polluted area, whereas the average values of chlorophyll a (Chl a, chlorophyll b (Chl b, total chlorophyll, carotenoid, pH and relative water content (RWC were greater at the control site. SLA significantly positively correlated with the size of PM, but Chl a, Chl b, total chlorophyll, RWC significantly negatively correlated with the size of PM, whereas the pH did not correlate significantly with the the PM fractions. Additionally, SLA was found to be affected by large particles (PM11, p<0.01; PM2.5 had a more obvious effect on plant leaf traits than the other PM (p<0.05. Overall, the findings from this study provide useful information regarding the selection of plants to reduce atmospheric pollution.

  8. Marker-Assisted Selection of Xa21 Conferring Resistance to Bacterial Leaf Blight in indica Rice Cultivar LT2

    Directory of Open Access Journals (Sweden)

    Hue Thi Nguyen

    2018-01-01

    Full Text Available Bacterial leaf blight of rice (BLB, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive diseases in Asian rice fields. A high-quality rice variety, LT2, was used as the recipient parent. IRBB21, which carries the Xa21 gene, was used as the donor parent. The resistance gene Xa21 was introduced into LT2 by marker-assisted backcrossing. Three Xoo races were used to inoculate the improved lines following the clipping method. Eleven BC3F3 lines carrying Xa21 were obtained based on molecular markers and agronomic performance. The 11 lines were then inoculated with the three Xoo races. All the 11 improved lines showed better resistance to BLB than the recipient parent LT2. Based on the level of resistance to BLB and their agronomic performance, five lines (BC3F3 5.1.5.1, BC3F3 5.1.5.12, BC3F3 8.5.6.44, BC3F3 9.5.4.1 and BC3F3 9.5.4.23 were selected as the most promising for commercial release. These improved lines could contribute to rice production in terms of food security.

  9. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  10. How Does Temperature Impact Leaf Size and Shape in Four Woody Dicot Species? Testing the Assumptions of Leaf Physiognomy-Climate Models

    Science.gov (United States)

    McKee, M.; Royer, D. L.

    2017-12-01

    The physiognomy (size and shape) of fossilized leaves has been used to reconstruct the mean annual temperature of ancient environments. Colder temperatures often select for larger and more abundant leaf teeth—serrated edges on leaf margins—as well as a greater degree of leaf dissection. However, to be able to accurately predict paleotemperature from the morphology of fossilized leaves, leaves must be able to react quickly and in a predictable manner to changes in temperature. We examined the extent to which temperature affects leaf morphology in four tree species: Carpinus caroliniana, Acer negundo, Ilex opaca, and Ostrya virginiana. Saplings of these species were grown in two growth cabinets under contrasting temperatures (17 and 25 °C). Compared to the cool treatment, in the warm treatment Carpinus caroliniana leaves had significantly fewer leaf teeth and a lower ratio of total number of leaf teeth to internal perimeter; and Acer negundo leaves had a significantly lower feret diameter ratio (a measure of leaf dissection). In addition, a two-way ANOVA tested the influence of temperature and species on leaf physiognomy. This analysis revealed that all plants, regardless of species, tended to develop more highly dissected leaves with more leaf teeth in the cool treatment. Because the cabinets maintained equivalent moisture, humidity, and CO2 concentration between the two treatments, these results demonstrate that these species could rapidly adapt to changes in temperature. However, not all of the species reacted identically to temperature changes. For example, Acer negundo, Carpinus caroliniana, and Ostrya virginiana all had a higher number of total teeth in the cool treatment compared to the warm treatment, but the opposite was true for Ilex opaca. Our work questions a fundamental assumption common to all models predicting paleotemperature from the physiognomy of fossilized leaves: a given climate will inevitably select for the same leaf physiognomy

  11. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  12. Betel leaf in stoma care.

    Science.gov (United States)

    Banu, Tahmina; Talukder, Rupom; Chowdhury, Tanvir Kabir; Hoque, Mozammel

    2007-07-01

    Construction of a stoma is a common procedure in pediatric surgical practice. For care of these stomas, commercially available devices such as ostomy bag, either disposable or of longer duration are usually used. These are expensive, particularly in countries like Bangladesh, and proper-sized ones are not always available. We have found an alternative for stoma care, betel leaf, which is suitable for Bangladeshis. We report the outcome of its use. After construction of stoma, at first zinc oxide paste was applied on the peristomal skin. A betel leaf with shiny, smooth surface outwards and rough surface inwards was put over the stoma with a hole made in the center according to the size of stoma. Another intact leaf covers the stomal opening. When bowel movement occurs, the overlying intact leaf was removed and the fecal matter was washed away from both. The leaves were reused after cleaning. Leaves were changed every 2 to 3 days. From June 1998 to December 2005, in the department of pediatric surgery, Chittagong Medical College and Hospital, Chittagong, Bangladesh, a total of 623 patients had exteriorization of bowel. Of this total, 495 stomas were cared for with betel leaves and 128 with ostomy bags. Of 623 children, 287 had sigmoid colostomy, 211 had transverse colostomy, 105 had ileostomy, and 20 had jejunostomy. Of the 495 children under betel leaf stoma care, 13 patients (2.6%) developed skin excoriation. There were no allergic reactions. Of the 128 patients using ostomy bag, 52 (40.65%) had skin excoriation. Twenty-four (18.75%) children developed some allergic reactions to adhesive. Monthly costs for betel leaves were 15 cents (10 BDT), whereas ostomy bags cost about US$24. In the care of stoma, betel leaves are cheap, easy to handle, nonirritant, and nonallergic.

  13. Identification of SSR and RAPD markers linked to a resistance allele for angular leaf spot in the common bean (Phaseolus vulgaris line ESAL 550

    Directory of Open Access Journals (Sweden)

    Gilvan Ferreira da Silva

    2003-12-01

    Full Text Available The objective of this study was to identify RAPD and SSR markers associated with a resistant allele for angular leaf spot (Phaeoisariopsis griseola from the line 'ESAL 550', derived from the Andean 'Jalo EEP 558' cultivar, to assist selection of resistant genotypes. The resistant line 'ESAL 550' and the susceptible cultivar 'Carioca MG' were crossed to generate F1 and F2 populations. One hundred and twenty F2:3 families were evaluated. The DNA of the 12 most resistant families was bulked and the same was done with the DNA of the 10 most susceptible, generating two contrasting bulks. One RAPD and one SSR marker was found to be linked in coupling phase to the resistant allele. The SSR marker was amplified by the primer PV-atct001(282C, and its distance from the resistant allele was 7.6 cM. This is the most useful marker for indirect selection of resistant plants in segregating populations. The RAPD marker was amplified by the primer OPP07(857C linked in coupling phase to the resistant allele, and distant 24.4 cM. Therefore, this RAPD marker is not so useful in assisting selection because it is too far from the resistant allele.

  14. Relationships of leaf dark respiration to leaf nitrogen, specific leaf area and leaf life-span: a test across biomes and functional groups.

    Science.gov (United States)

    Reich, Peter B; Walters, Michael B; Ellsworth, David S; Vose, James M; Volin, John C; Gresham, Charles; Bowman, William D

    1998-05-01

    Based on prior evidence of coordinated multiple leaf trait scaling, we hypothesized that variation among species in leaf dark respiration rate (R d ) should scale with variation in traits such as leaf nitrogen (N), leaf life-span, specific leaf area (SLA), and net photosynthetic capacity (A max ). However, it is not known whether such scaling, if it exists, is similar among disparate biomes and plant functional types. We tested this idea by examining the interspecific relationships between R d measured at a standard temperature and leaf life-span, N, SLA and A max for 69 species from four functional groups (forbs, broad-leafed trees and shrubs, and needle-leafed conifers) in six biomes traversing the Americas: alpine tundra/subalpine forest, Colorado; cold temperate forest/grassland, Wisconsin; cool temperate forest, North Carolina; desert/shrubland, New Mexico; subtropical forest, South Carolina; and tropical rain forest, Amazonas, Venezuela. Area-based R d was positively related to area-based leaf N within functional groups and for all species pooled, but not when comparing among species within any site. At all sites, mass-based R d (R d-mass ) decreased sharply with increasing leaf life-span and was positively related to SLA and mass-based A max and leaf N (leaf N mass ). These intra-biome relationships were similar in shape and slope among sites, where in each case we compared species belonging to different plant functional groups. Significant R d-mass -N mass relationships were observed in all functional groups (pooled across sites), but the relationships differed, with higher R d at any given leaf N in functional groups (such as forbs) with higher SLA and shorter leaf life-span. Regardless of biome or functional group, R d-mass was well predicted by all combinations of leaf life-span, N mass and/or SLA (r 2 ≥ 0.79, P morphological, chemical and metabolic traits.

  15. Leaf-IT: An Android application for measuring leaf area.

    Science.gov (United States)

    Schrader, Julian; Pillar, Giso; Kreft, Holger

    2017-11-01

    The use of plant functional traits has become increasingly popular in ecological studies because plant functional traits help to understand key ecological processes in plant species and communities. This also includes changes in diversity, inter- and intraspecific interactions, and relationships of species at different spatiotemporal scales. Leaf traits are among the most important traits as they describe key dimensions of a plant's life history strategy. Further, leaf area is a key parameter with relevance for other traits such as specific leaf area, which in turn correlates with leaf chemical composition, photosynthetic rate, leaf longevity, and carbon investment. Measuring leaf area usually involves the use of scanners and commercial software and can be difficult under field conditions. We present Leaf-IT, a new smartphone application for measuring leaf area and other trait-related areas. Leaf-IT is free, designed for scientific purposes, and runs on Android 4 or higher. We tested the precision and accuracy using objects with standardized area and compared the area measurements of real leaves with the well-established, commercial software WinFOLIA using the Altman-Bland method. Area measurements of standardized objects show that Leaf-IT measures area with high accuracy and precision. Area measurements with Leaf-IT of real leaves are comparable to those of WinFOLIA. Leaf-IT is an easy-to-use application running on a wide range of smartphones. That increases the portability and use of Leaf-IT and makes it possible to measure leaf area under field conditions typical for remote locations. Its high accuracy and precision are similar to WinFOLIA. Currently, its main limitation is margin detection of damaged leaves or complex leaf morphologies.

  16. The invasive plant Alternanthera philoxeroides was suppressed more intensively than its native congener by a native generalist: implications for the biotic resistance hypothesis.

    Directory of Open Access Journals (Sweden)

    Shufeng Fan

    Full Text Available Prior studies on preferences of native herbivores for native or exotic plants have tested both the enemy release hypothesis and the biotic resistance hypothesis and have reported inconsistent results. The different levels of resistance of native and exotic plants to native herbivores could resolve this controversy, but little attention has been paid to this issue. In this study, we investigated population performance, photosynthesis, leaf nitrogen concentration, and the constitutive and induced resistances of the successful invasive plant, Alternanthera philoxeroides, and its native congener, Alternanthera sessilis, in the presence of three population densities of the grasshopper, Atractomorpha sinensis. When the grasshopper was absent, leaf biomass, total biomass, photosynthesis, and leaf nitrogen concentration of A. philoxeroides were higher than those of A. sessilis. However, the morphological and physiological performances of A. philoxeroides were all decreased more intensively than A. sessilis after herbivory by grasshoppers. Especially as the concentrations of constitutive lignin and cellulose in leaf of A. philoxeroides were higher than A. sessilis, A. philoxeroides exhibited increased leaf lignin concentration to reduce its palatability only at severe herbivore load, whereas, leaf lignin, cellulose, and polyphenolic concentrations of A. sessilis all increased with increasing herbivory pressure, and cellulose and polyphenolic concentrations were higher in A. sessilis than in A. philoxeroides after herbivory. Our study indicated that the capability of the invasive plant to respond to native insect damage was lower than the native plant, and the invasive plant was suppressed more intensively than its native congener by the native insect. Our results support the biotic resistance hypothesis and suggest that native herbivores can constrain the abundance and reduce the adverse effects of invasive species.

  17. AP2/ERF Transcription Factors Involved in Response to Tomato Yellow Leaf Curly Virus in Tomato

    Directory of Open Access Journals (Sweden)

    Ying Huang

    2016-07-01

    Full Text Available Tomato yellow leaf curly virus (TYLCV, transmitted by the whitefly (, causes leaf curling and yellowing, plant dwarfism, and growth inhibition in tomato ( L.. The APETALA2 (AP2 and ethylene response factor (ERF transcription factor (TF family, the largest plant-specific TF family, was identified to function in plant development and pathogen defense. Our study aimed to analyze the mechanism underlying the function of ERF (SlERF TFs in response to TYLCV infection and improve useful information to increase the resistance to TYLCV in tomato. A total of 22 tomato AP2/ERF TFs in response to TYLCV were identified according to transcriptome database. Five ERF-B3 TFs were identified in cultivars Hongbeibei (highly resistant, Zheza-301, Zhefen-702 (both resistant, Jinpeng-1, and Xianke-6 (both susceptible. Interaction network indicated that SlERF TFs could interact with mitogen-activated protein kinase (MAPK. Expression profiles of five ERF-B3 genes (, , , , and were detected by quantitative real-time–polymerase chain reaction (qRT-PCR after TYLCV infection in five tomato cultivars. expression was upregulated in five tomato cultivars. The expressions of three genes (, , and were upregulated in Zheza-301 and Zhefen-702. and expressions were downregulated in Hongbeibei and Xianke-6, respectively. Yeast one-hybrid showed that the GCC-box binding ability of ERF-B3 TFs differed in resistant and susceptible tomato cultivars. Expression profiles were related to the GCC-box binding ability of SlERF TFs in resistant and susceptible tomato cultivars. The defense mechanism underlying the tomato’s response to TYLCV involved a complicated network, which provided important information for us in breeding and genetic analysis.

  18. Cassava brown streak disease effects on leaf metabolites and ...

    African Journals Online (AJOL)

    Cassava brown streak disease effects on leaf metabolites and pigment accumulation. ... Total reducing sugar and starch content also dropped significantly (-30 and -60%, respectively), much as NASE 14 maintained a relatively higher amount of carbohydrates. Leaf protein levels were significantly reduced at a rate of 0.07 ...

  19. Transcriptome reprogramming of resistant and susceptible peach genotypes during Xanthomonas arboricola pv. pruni early leaf infection.

    Directory of Open Access Journals (Sweden)

    Fabio Gervasi

    Full Text Available Bacterial spot caused by Xanthomonas arboricola pv. pruni (Xap is a major threat to Prunus species worldwide. The molecular mechanisms of peach resistance to Xap during early leaf infection were investigated by RNA-Seq analysis of two Prunus persica cultivars, 'Redkist' (resistant, and 'JH Hale' (susceptible at 30 minutes, 1 and 3 hours-post-infection (hpi. Both cultivars exhibited extensive modulation of gene expression at 30 mpi, which reduced significantly at 1 hpi, increasing again at 3 hpi. Overall, 714 differentially expressed genes (DEGs were detected in 'Redkist' (12% at 30 mpi and 1 hpi and 88% at 3 hpi. In 'JH Hale', 821 DEGs were identified (47% at 30 mpi and 1 hpi and 53% at 3 hpi. Highly up-regulated genes (fold change > 100 at 3 hpi exhibited higher fold change values in 'Redkist' than in 'JH Hale'. RNA-Seq bioinformatics analyses were validated by RT-qPCR. In both cultivars, DEGs included genes with putative roles in perception, signal transduction, secondary metabolism, and transcription regulation, and there were defense responses in both cultivars, with enrichment for the gene ontology terms, 'immune system process', 'defense response', and 'cell death'. There were particular differences between the cultivars in the intensity and kinetics of modulation of expression of genes with putative roles in transcriptional activity, secondary metabolism, photosynthesis, and receptor and signaling processes. Analysis of differential exon usage (DEU revealed that both cultivars initiated remodeling their transcriptomes at 30 mpi; however, 'Redkist' exhibited alternative exon usage for a greater number of genes at every time point compared with 'JH Hale'. Candidate resistance genes (WRKY-like, CRK-like, Copper amine oxidase-like, and TIR-NBS-LRR-like are of interest for further functional characterization with the aim of elucidating their role in Prunus spp. resistance to Xap.

  20. RFLP-facilitated investigation of the quantitative resistance of rice to brown planthopper ( Nilaparvata lugens).

    Science.gov (United States)

    Xu, X. F.; Mei, H. W.; Luo, L. J.; Cheng, X. N.; Li, Z. K.

    2002-02-01

    Quantitative trait loci (QTLs), conferring quantitative resistance to rice brown planthopper (BPH), were investigated using 160 F(11) recombinant inbred lines (RILs) from the Lemont/Teqing cross, a complete RFLP map, and replicated phenotyping of seedbox inoculation. The paternal indica parent, Teqing, was more-resistant to BPH than the maternal japonica parent, Lemont. The RILs showed transgressive segregation for resistance to BPH. Seven main-effect QTLs and many epistatic QTL pairs were identified and mapped on the 12 rice chromosomes. Collectively, the main-effect and epistatic QTLs accounted for over 70% of the total variation in damage scores. Teqing has the resistance allele at four main-effect QTLs, and the Lemont allele resulted in resistance at the other three. Of the main-effect QTLs identified, QBphr5b was mapped to the vicinity of gl1, a major gene controlling leaf and stem pubescence. The Teqing allele controlling leaf and stem pubescence was associated with resistance, while the Lemont allele for glabrous stem and leaves was associated with susceptibility, indicating that this gene may have contributed to resistance through antixenosis. Similar to the reported BPH resistance genes, the other six detected main-effect QTLs were all mapped to regions where major disease resistance genes locate, suggesting they might have contributed either to antibiosis or tolerance. Our results indicated that marker-aided pyramiding of major resistance genes and QTLs should provide effective and stable control over this devastating pest.

  1. The dosimetric impact of leaf interdigitation and leaf width on VMAT treatment planning in Pinnacle: comparing Pareto fronts

    International Nuclear Information System (INIS)

    Van Kesteren, Z; Janssen, T M; Damen, E; Van Vliet-Vroegindeweij, C

    2012-01-01

    To evaluate in an objective way the effect of leaf interdigitation and leaf width on volumetric modulated arc therapy plans in Pinnacle. Three multileaf collimators (MLCs) were modeled: two 10 mm leaf width MLCs, with and without interdigitating leafs, and a 5 mm leaf width MLC with interdigitating leafs. Three rectum patients and three prostate patients were used for the planning study. In order to compare treatment techniques in an objective way, a Pareto front comparison was carried out. 200 plans were generated in an automated way, per patient per MLC model, resulting in a total of 3600 plans. From these plans, Pareto-optimal plans were selected which were evaluated for various dosimetric variables. The capability of leaf interdigitation showed little dosimetric impact on the treatment plans, when comparing the 10 mm leaf width MLC with and without leaf interdigitation. When comparing the 10 mm leaf width MLC with the 5 mm leaf width MLC, both with interdigitating leafs, improvement in plan quality was observed. For both patient groups, the integral dose was reduced by 0.6 J for the thin MLC. For the prostate patients, the mean dose to the anal sphincter was reduced by 1.8 Gy and the conformity of the V 95% was reduced by 0.02 using the thin MLC. The V 65% of the rectum was reduced by 0.1% and the dose homogeneity with 1.5%. For rectum patients, the mean dose to the bowel was reduced by 1.4 Gy and the mean dose to the bladder with 0.8 Gy for the thin MLC. The conformity of the V 95% was equivalent for the 10 and 5 mm leaf width MLCs for the rectum patients. We have objectively compared three types of MLCs in a planning study for prostate and rectum patients by analyzing Pareto-optimal plans which were generated in an automated way. Interdigitation of MLC leafs does not generate better plans using the SmartArc algorithm in Pinnacle. Changing the MLC leaf width from 10 to 5 mm generates better treatment plans although the clinical relevance remains to be proven

  2. The dosimetric impact of leaf interdigitation and leaf width on VMAT treatment planning in Pinnacle: comparing Pareto fronts.

    Science.gov (United States)

    van Kesteren, Z; Janssen, T M; Damen, E; van Vliet-Vroegindeweij, C

    2012-05-21

    To evaluate in an objective way the effect of leaf interdigitation and leaf width on volumetric modulated arc therapy plans in Pinnacle. Three multileaf collimators (MLCs) were modeled: two 10 mm leaf width MLCs, with and without interdigitating leafs, and a 5 mm leaf width MLC with interdigitating leafs. Three rectum patients and three prostate patients were used for the planning study. In order to compare treatment techniques in an objective way, a Pareto front comparison was carried out. 200 plans were generated in an automated way, per patient per MLC model, resulting in a total of 3600 plans. From these plans, Pareto-optimal plans were selected which were evaluated for various dosimetric variables. The capability of leaf interdigitation showed little dosimetric impact on the treatment plans, when comparing the 10 mm leaf width MLC with and without leaf interdigitation. When comparing the 10 mm leaf width MLC with the 5 mm leaf width MLC, both with interdigitating leafs, improvement in plan quality was observed. For both patient groups, the integral dose was reduced by 0.6 J for the thin MLC. For the prostate patients, the mean dose to the anal sphincter was reduced by 1.8 Gy and the conformity of the V(95%) was reduced by 0.02 using the thin MLC. The V(65%) of the rectum was reduced by 0.1% and the dose homogeneity with 1.5%. For rectum patients, the mean dose to the bowel was reduced by 1.4 Gy and the mean dose to the bladder with 0.8 Gy for the thin MLC. The conformity of the V(95%) was equivalent for the 10 and 5 mm leaf width MLCs for the rectum patients. We have objectively compared three types of MLCs in a planning study for prostate and rectum patients by analyzing Pareto-optimal plans which were generated in an automated way. Interdigitation of MLC leafs does not generate better plans using the SmartArc algorithm in Pinnacle. Changing the MLC leaf width from 10 to 5 mm generates better treatment plans although the clinical relevance remains

  3. Combining powers of linkage and association mapping for precise dissection of QTL controlling resistance to gray leaf spot disease in maize (Zea mays L.).

    Science.gov (United States)

    Mammadov, Jafar; Sun, Xiaochun; Gao, Yanxin; Ochsenfeld, Cherie; Bakker, Erica; Ren, Ruihua; Flora, Jonathan; Wang, Xiujuan; Kumpatla, Siva; Meyer, David; Thompson, Steve

    2015-11-10

    Gray Leaf Spot (GLS causal agents Cercospora zeae-maydis and Cercospora zeina) is one of the most important foliar diseases of maize in all areas where the crop is being cultivated. Although in the USA the situation with GLS severity is not as critical as in sub-Saharan Africa or Brazil, the evidence of climate change, increasing corn monoculture as well as the narrow genetic base of North American resistant germplasm can turn the disease into a serious threat to US corn production. The development of GLS resistant cultivars is one way to control the disease. In this study we combined the high QTL detection power of genetic linkage mapping with the high resolution power of genome-wide association study (GWAS) to precisely dissect QTL controlling GLS resistance and identify closely linked molecular markers for robust marker-assisted selection and trait introgression. Using genetic linkage analysis with a small bi-parental mapping population, we identified four GLS resistance QTL on chromosomes 1, 6, 7, and 8, which were validated by GWAS. GWAS enabled us to dramatically increase the resolution within the confidence intervals of the above-mentioned QTL. Particularly, GWAS revealed that QTLGLSchr8, detected by genetic linkage mapping as a locus with major effect, was likely represented by two QTL with smaller effects. Conducted in parallel, GWAS of days-to-silking demonstrated the co-localization of flowering time QTL with GLS resistance QTL on chromosome 7 indicating that either QTLGLSchr7 is a flowering time QTL or it is a GLS resistance QTL that co-segregates with the latter. As a result, this genetic linkage - GWAS hybrid mapping system enabled us to identify one novel GLS resistance QTL (QTLGLSchr8a) and confirm with more refined positions four more previously mapped QTL (QTLGLSchr1, QTLGLSchr6, QTLGLSchr7, and QTLGLSchr8b). Through the novel Single Donor vs. Elite Panel method we were able to identify within QTL confidence intervals SNP markers that would be

  4. Shrub type dominates the vertical distribution of leaf C : N : P stoichiometry across an extensive altitudinal gradient

    Directory of Open Access Journals (Sweden)

    W. Zhao

    2018-04-01

    Full Text Available Understanding leaf stoichiometric patterns is crucial for improving predictions of plant responses to environmental changes. Leaf stoichiometry of terrestrial ecosystems has been widely investigated along latitudinal and longitudinal gradients. However, very little is known about the vertical distribution of leaf C : N : P and the relative effects of environmental parameters, especially for shrubs. Here, we analyzed the shrub leaf C, N and P patterns in 125 mountainous sites over an extensive altitudinal gradient (523–4685 m on the Tibetan Plateau. Results showed that the shrub leaf C and C : N were 7.3–47.5 % higher than those of other regional and global flora, whereas the leaf N and N : P were 10.2–75.8 % lower. Leaf C increased with rising altitude and decreasing temperature, supporting the physiological acclimation mechanism that high leaf C (e.g., alpine or evergreen shrub could balance the cell osmotic pressure and resist freezing. The largest leaf N and high leaf P occurred in valley region (altitude 1500 m, likely due to the large nutrient leaching from higher elevations, faster litter decomposition and nutrient resorption ability of deciduous broadleaf shrub. Leaf N : P ratio further indicated increasing N limitation at higher altitudes. Interestingly, drought severity was the only climatic factor positively correlated with leaf N and P, which was more appropriate for evaluating the impact of water status than precipitation. Among the shrub ecosystem and functional types (alpine, subalpine, montane, valley, evergreen, deciduous, broadleaf, and conifer, their leaf element contents and responses to environments were remarkably different. Shrub type was the largest contributor to the total variations in leaf stoichiometry, while climate indirectly affected the leaf C : N : P via its interactive effects on shrub type or soil. Collectively, the large heterogeneity in shrub type was the most

  5. Characterisation of glufosinate resistance mechanisms in Eleusine indica.

    Science.gov (United States)

    Jalaludin, Adam; Yu, Qin; Zoellner, Peter; Beffa, Roland; Powles, Stephen B

    2017-06-01

    An Eleusine indica population has evolved resistance to glufosinate, a major post-emergence herbicide of global agriculture. This population was analysed for target-site (glutamine synthetase) and non-target-site (glufosinate uptake, translocation and metabolism) resistance mechanisms. Glutamine synthetase (GS) activity extracted from susceptible (S) and resistant (R*) plants was equally sensitive to glufosinate inhibition, with IC 50 values of 0.85 mm and 0.99 mm, respectively. The extractable GS activity was also similar in S and R* samples. Foliar uptake of [ 14 C]-glufosinate did not differ in S and R* plants, nor did glufosinate net uptake in leaf discs. Translocation of [ 14 C]-glufosinate into untreated shoots and roots was also similar in both populations, with 44% to 47% of the herbicide translocated out from the treated leaf 24 h after treatment. The HPLC and LC-MS analysis of glufosinate metabolism revealed no major metabolites in S or R* leaf tissue. Glufosinate resistance in this resistant population is not due to an insensitive GS, or increased activity, or altered glufosinate uptake and translocation, or enhanced glufosinate metabolism. Thus, target-site resistance is likely excluded and the exact resistance mechanism(s) remain to be determined. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. Transcriptional analyses of natural leaf senescence in maize.

    Directory of Open Access Journals (Sweden)

    Wei Yang Zhang

    Full Text Available Leaf senescence is an important biological process that contributes to grain yield in crops. To study the molecular mechanisms underlying natural leaf senescence, we harvested three different developmental ear leaves of maize, mature leaves (ML, early senescent leaves (ESL, and later senescent leaves (LSL, and analyzed transcriptional changes using RNA-sequencing. Three sets of data, ESL vs. ML, LSL vs. ML, and LSL vs. ESL, were compared, respectively. In total, 4,552 genes were identified as differentially expressed. Functional classification placed these genes into 18 categories including protein metabolism, transporters, and signal transduction. At the early stage of leaf senescence, genes involved in aromatic amino acids (AAAs biosynthetic process and transport, cellular polysaccharide biosynthetic process, and the cell wall macromolecule catabolic process, were up-regulated. Whereas, genes involved in amino acid metabolism, transport, apoptosis, and response to stimulus were up-regulated at the late stage of leaf senescence. Further analyses reveals that the transport-related genes at the early stage of leaf senescence potentially take part in enzyme and amino acid transport and the genes upregulated at the late stage are involved in sugar transport, indicating nutrient recycling mainly takes place at the late stage of leaf senescence. Comparison between the data of natural leaf senescence in this study and previously reported data for Arabidopsis implies that the mechanisms of leaf senescence in maize are basically similar to those in Arabidopsis. A comparison of natural and induced leaf senescence in maize was performed. Athough many basic biological processes involved in senescence occur in both types of leaf senescence, 78.07% of differentially expressed genes in natural leaf senescence were not identifiable in induced leaf senescence, suggesting that differences in gene regulatory network may exist between these two leaf senescence

  7. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    Science.gov (United States)

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  8. Induced multiple disease resistance in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.; Worland, A.J.

    1990-01-01

    Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)

  9. Antibacterial effect of mango (Mangifera indica Linn.) leaf extract against antibiotic sensitive and multi-drug resistant Salmonella typhi.

    Science.gov (United States)

    Hannan, Abdul; Asghar, Samra; Naeem, Tahir; Ikram Ullah, Muhammad; Ahmed, Ijaz; Aneela, Syeda; Hussain, Shabbir

    2013-07-01

    Alternative herbal medicine has been used to treat various infections from centuries. Natural plants contain phytoconstituents having similar chemical properties as of synthetic antibiotics. Typhoid fever is a serious infection and failure of its treatment emerged multi-drug resistant (MDR) bugs of Salmonella typhi. Due to multiple and repeated issues with antibiotics efficacy, it became essential to evaluate biological properties of plants from different geographical origins. Mango leaves have been Reported for various medicinal effects like antioxidant, antimicrobial, antihelminthic, antidiabetic and antiallergic etc. Objective of present study was to investigate anti-typhoid properties of acetone mango leaf extract (AMLE) against antibiotic sensitive and MDR S. typhi isolates. A total of 50 isolates of S. typhi including MDR (n=30) and antibiotic sensitive (n=20) were investigated. Staphylococcus aureus (ATCC 25923) and Salmonella typhimurium (ATCC14028) were used as quality control strains. AMLE was prepared and its antibacterial activity was evaluated by agar well diffusion screening method and minimum inhibitory concentration (MIC), by agar dilution technique. Zone of inhibition (mm) of AMLE against MDR and antibiotic sensitive isolates was 18±1.5mm (Mean±S.D). Zone of S. aureus (ATCC 25923) and S. typhimurium (ATCC14028) was 20±1.5mm (Mean±S.D). MIC of AMLE was Reported in range from 10-50 mg/ml. The present study described the inhibitory effects of mango leaves against S. typhi.

  10. A finger leaf design for dual layer MLCs

    International Nuclear Information System (INIS)

    Cui Weijie; Dai Jianrong

    2010-01-01

    Objective: To introduce a finger leaf design that is applied to dual layer MLCs. Methods: An optimization model was firstly constructed to describe the problem of determining leaf end shapes,and the corresponding problems were then solved by the simplex search method or the simulated annealing technique. Optimal parameters for arc shapes of leaf end projections were obtained, and a comparison was done between optimized MLCs and conventional MLCs in terms of field conformity. The optimization process was based on 634 target fields selected from the patient data base of a treatment planning system. Areas of these fields ranged from 20.0 to 602.7 cm with a mean and its standard deviation of (125.7 ± 0.0) cm 2 . Results: The optimized leaf end shapes projected to the isocenter plane were semicircles. With the finger leaf design, the total area of discrepancy regions between MLC fields and target fields was reduced by 32.3%. Conclusions: The finger leaf design improves the conformity of the MLC shaped fields to the desired target fields. (authors)

  11. Seasonal patterns of leaf gas exchange and water relations in dry rain forest trees of contrasting leaf phenology.

    Science.gov (United States)

    Choat, Brendan; Ball, Marilyn C; Luly, Jon G; Donnelly, Christine F; Holtum, Joseph A M

    2006-05-01

    Diurnal and seasonal patterns of leaf gas exchange and water relations were examined in tree species of contrasting leaf phenology growing in a seasonally dry tropical rain forest in north-eastern Australia. Two drought-deciduous species, Brachychiton australis (Schott and Endl.) A. Terracc. and Cochlospermum gillivraei Benth., and two evergreen species, Alphitonia excelsa (Fenzal) Benth. and Austromyrtus bidwillii (Benth.) Burret. were studied. The deciduous species had higher specific leaf areas and maximum photosynthetic rates per leaf dry mass in the wet season than the evergreens. During the transition from wet season to dry season, total canopy area was reduced by 70-90% in the deciduous species and stomatal conductance (g(s)) and assimilation rate (A) were markedly lower in the remaining leaves. Deciduous species maintained daytime leaf water potentials (Psi(L)) at close to or above wet season values by a combination of stomatal regulation and reduction in leaf area. Thus, the timing of leaf drop in deciduous species was not associated with large negative values of daytime Psi(L) (greater than -1.6 MPa) or predawn Psi(L) (greater than -1.0 MPa). The deciduous species appeared sensitive to small perturbations in soil and leaf water status that signalled the onset of drought. The evergreen species were less sensitive to the onset of drought and g(s) values were not significantly lower during the transitional period. In the dry season, the evergreen species maintained their canopies despite increasing water-stress; however, unlike Eucalyptus species from northern Australian savannas, A and g(s) were significantly lower than wet season values.

  12. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  13. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  14. Defensive Responses of Rice Genotypes for Resistance Against Rice Leaffolder Cnaphalocrocis medinalis

    Directory of Open Access Journals (Sweden)

    M. PUNITHAVALLI

    2013-09-01

    Full Text Available The experiment was carried out to assess the reaction of different categories of rice genotypes viz., resistant, susceptible, hybrid, scented, popular and wild in response to the infestation by rice leaffolder (RLF, Cnaphalocrocis medinalis (Guenee and to explore the possible use of these genotypes in developing RLF-resistant rice varieties. The changes of various biochemical constituents such as leaf soluble protein, phenol, ortho-dihydroxy phenol, tannin and enzymes viz., peroxidase, phenyl alanine ammonia lyase (PAL were assessed spectrophotometrically in all the rice genotypes before and after RLF infestation. The protein profile was analyzed using sodium dodecyl sulphate-poly acrylamide gel electrophoresis (SDS-PAGE method. A significant constituent of biochemical content such as tannin, phenol and ortho-dihydroxy phenol has been increased along with enzyme activities of peroxidase and PAL in the infested resistant (Ptb 33, TKM6 and LFR831311 and wild rice genotypes (Oryza minuta and O. rhizomatis. A decrease in leaf protein content was evident invariably in all the infested rice genotypes. It is also evident that the contents of biochemicals such as phenol, ortho-dihydroxy phenol and tannin were negatively correlated with leaffolder damage. However, leaf protein content was positively correlated with the damage by rice leaffolder. SDS-PAGE analysis for total protein profiling of healthy and C. medinalis-infested genotypes revealed the enhanced expression of a high molecular weight (> 97 kDa protein in all the genotypes. Besides, there was also an increased induction of a 38 kDa protein in C. medinalis infested resistant genotypes, which was absent in uninfested plants. The present investigation proved that the elevated levels of biochemicals and enzymes may play a vital role in rice plants resistance to RLF.

  15. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  16. Total flavonoid and phenolic contents of n-butanol extract of Samanea saman leaf and the antibacterial activity towards Escherichia coli and Staphylococcus aureus

    Science.gov (United States)

    Rita, Wiwik Susanah; Swantara, I. Made Dira; Asih, I. A. Raka Astiti; Sinarsih, Ni Ketut; Suteja, I. Kadek Pater

    2016-03-01

    Total flavonoid and phenolic contents in some natural products was suspected of having a positive correlation to its activity in inhibiting the growth of bacteria. The aim of this study was to determine the total flavonoid and phenolic contents of n-butanol extract of Samanea saman leaf, and to evaluate the antibacterial activity towards Escherechia coli and Staphylococcus aureus. Extraction of compounds was done by ethanol 96%, followed by fractionation into n-hexane, ethyl acetate, and n-butanol. Determination of total flavonoid and phenolic contents was done by UV-Vis Spectrophotometer using standard of quersetin and galic acid respectively. In addition, antibacterial activity was evaluated by agar disc diffusion method. Extraction of 1000 g of Samanea saman leaf was obtained 80 g of ethanol extracts, fractionation of the extract was obtained 8.02 g of n-hexane extracts, 7.11 g of ethyl acetate extracts, 13.5 g of n-butanol extracts, and 14.16 g of aqueous extracts. Phytochemical screening of the n-butanol extracts revealed the presence of flavonoid and phenolic compounds. Total flavonoid and phenolic contents were successively 43.5798 mg QE/100g and 34.0180 mg GAE/100g. The butanol extracts inhibited the growth of S.aureus higher than the growth of E.coli. At the concentration of 2, 4, 6, 8 % (b/v), and positive control (meropenem μg/disc), inhibition zone towards S. aureus was successively 5.67, 9.33, 10.33, 12.00, and 32.33 mm, while the inhibition zone towards E. coli was1.33, 3.33, 4.33, 5.43, and 34.00 mm.

  17. Seleção de famílias de feijoeiro resistente à antracnose e à mancha-angular Selection of common bean families resistant to anthracnose and angular leaf spot

    Directory of Open Access Journals (Sweden)

    Marcelo Geraldo de Morais Silva

    2006-10-01

    Full Text Available O objetivo deste trabalho foi identificar famílias de feijoeiro com resistência a Colletotrichum lindemuthianum e Phaeoisariopsis griseola e com outros fenótipos agronômicos desejáveis. As famílias utilizadas foram obtidas do cruzamento entre a linhagem H91, portadora de três alelos de resistência à antracnose, com três famílias F2:5 resistentes à mancha-angular, derivadas da cultivar Jalo EEP 558. Foi utilizado o delineamento látice quadrado em todos os experimentos. Inicialmente, foram avaliadas 144 famílias F2:3, no inverno de 2004, em Lavras, MG, com base no tipo de grão. Foram selecionadas 80 famílias F2:4 e avaliadas com a testemunha BRSMG Talismã, no período das águas de 2004/2005, no mesmo local. Considerando-se o tipo de grão e a resistência à mancha-angular e antracnose, foram mantidas 48 famílias F2:5, que foram avaliadas na seca de 2005, em Lavras e Lambari, MG. Essas 48 famílias passaram por inoculação das raças 2047, 73 e 1545 de C. lindemuthianum, para verificação da presença dos alelos de resistência Co-4², Co-5 e Co-7, respectivamente. Foram identificados genótipos da maioria das 48 famílias, quanto à reação à antracnose, das quais se destacaram quatro, em relação ao tipo de grão semelhante ao 'Carioca', de porte ereto, produtividade elevada e resistência à mancha-angular.The objective of this work was to select common bean families resistant to Colletotrichum lindemuthianum and Phaeoisariopsis griseola and, also, with superior agronomical traits. Families used were obtained from crosses of H91 lineage, bearer of three alleles resistant to anthracnose, and F2;5 families derived from the cultivar Jalo EEP 558, which is resistant to angular leaf spot. Square lattice design was used in all experiments. Initially the F2:3 families (144 were evaluated in the winter of 2004, in Lavras county, MG, Brazil, based on grain type. Eighty families (F2:4 were selected and evaluated with the check

  18. Dependence of fluence errors in dynamic IMRT on leaf-positional errors varying with time and leaf number

    International Nuclear Information System (INIS)

    Zygmanski, Piotr; Kung, Jong H.; Jiang, Steve B.; Chin, Lee

    2003-01-01

    ALPO is an Average Leaf Pair Opening (the concept of ALPO was previously introduced by us in Med. Phys. 28, 2220-2226 (2001). Therefore, dose errors associated with RLP errors are larger for fields requiring small leaf gaps. For an N-field IMRT plan, we demonstrate that the total fluence error (if we neglect inhomogeneities and scatter) is proportional to 1/√(N), where N is the number of fields, which slightly reduces the impact of RLP errors of individual fields on the total fluence error. We tested and applied the analytical apparatus in the context of commercial inverse treatment planning systems used in our clinics (Helios TM and BrainScan TM ). We determined the actual distribution of leaf-positional errors by studying MLC controller (Varian Mark II and Brainlab Novalis MLCs) log files created by the controller after each field delivery. The analytically derived relationship between fluence error and RLP errors was confirmed by numerical simulations. The equivalence of relative fluence error to relative dose error was verified by a direct dose calculation. We also experimentally verified the truthfulness of fluences derived from the log file data by comparing them to film data

  19. Mutation breeding for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Abdel-Hak, T.M.; Kamel, A.H.

    1977-01-01

    Wheat and broad-bean diseases cause considerable losses under Egyptian conditions; therefore, an attempt was made to induce useful mutations in both crops resistant to diseases which may be of direct or indirect use in breeding programmes. The methodology of artificial inoculation, evaluation, selection, radiation levels used are reported, in addition to the economic importance of the varieties used. This work passed through two phases, the first started in the 1972/73 crop season with a small population, while the second in 1974/75 with a larger one to have a better chance of detecting resistant mutants. In the first phase, a total of 3563M 1 wheat plants was grown in addition to approximately 3600-44,000M 2 and 77,646M 3 plants. Twenty-two M 2 plants were selected as showing lower level of leaf rust development, but further tests showed these plants are not true mutants since they rusted at the same level of their parent varieties. Out of the M 3 plants none showed good resistance. In the second phase, 36,000, 277,080 and 289,492 plants of M 1 , M 2 and M 3 , respectively, were grown and 73M 2 plants were selected as showing complete resistance to leaf and stem rusts. In field beans out of the first phase, a total of 5760, 37,200 and 33,240M 1 , M 2 and M 3 plants, respectively, was grown and none showed a good level of disease resistance although some were less diseased. These were further tested and proved not true mutants for reduced disease development. In the second phase, 8747, 203,520 and 90,285 plants of M 1 , M 2 and M 3 , respectively, were grown and 27M 2 plants were selected as showing a lower level of chocolate spot and rust development. The paper also discusses the use of single versus composite cultures in mutation breeding for disease resistance. (author)

  20. Drought-Induced Leaf Proteome Changes in Switchgrass Seedlings

    Directory of Open Access Journals (Sweden)

    Zhujia Ye

    2016-08-01

    Full Text Available Switchgrass (Panicum virgatum is a perennial crop producing deep roots and thus highly tolerant to soil water deficit conditions. However, seedling establishment in the field is very susceptible to prolonged and periodic drought stress. In this study, a “sandwich” system simulating a gradual water deletion process was developed. Switchgrass seedlings were subjected to a 20-day gradual drought treatment process when soil water tension was increased to 0.05 MPa (moderate drought stress and leaf physiological properties had expressed significant alteration. Drought-induced changes in leaf proteomes were identified using the isobaric tags for relative and absolute quantitation (iTRAQ labeling method followed by nano-scale liquid chromatography mass spectrometry (nano-LC-MS/MS analysis. Additionally, total leaf proteins were processed using a combinatorial library of peptide ligands to enrich for lower abundance proteins. Both total proteins and those enriched samples were analyzed to increase the coverage of the quantitative proteomics analysis. A total of 7006 leaf proteins were identified, and 257 (4% of the leaf proteome expressed a significant difference (p < 0.05, fold change <0.6 or >1.7 from the non-treated control to drought-treated conditions. These proteins are involved in the regulation of transcription and translation, cell division, cell wall modification, phyto-hormone metabolism and signaling transduction pathways, and metabolic pathways of carbohydrates, amino acids, and fatty acids. A scheme of abscisic acid (ABA-biosynthesis and ABA responsive signal transduction pathway was reconstructed using these drought-induced significant proteins, showing systemic regulation at protein level to deploy the respective mechanism. Results from this study, in addition to revealing molecular responses to drought stress, provide a large number of proteins (candidate genes that can be employed to improve switchgrass seedling growth and

  1. Associational resistance protects mangrove leaves from crab herbivory

    Science.gov (United States)

    Erickson, Amy A.; Bell, Susan S.; Dawes, Clinton J.

    2012-05-01

    While associational defenses have been well documented in many plant and algal ecosystems, this study is the first to document associational resistance in mangroves. Mangrove tree crab (Aratus pisonii) density and herbivory on three life-stages of the red mangrove (Rhizophora mangle) were documented in pure red versus mixed-species and predominantly non-red mangrove stands containing black (Avicennia germinans) and white (Laguncularia racemosa) mangroves in 1999-2000 in Tampa Bay, Florida. This study first established that R. mangle is the focal species in the context of associational resistance because it is damaged more than either of the other mangrove species. Next, it was hypothesized that crab density and leaf damage on R. mangle would be lower when in mixed-species and predominantly non-red versus red mangrove stands. A non-significant trend suggested that crab density varies among stands, and crab damage on R. mangle leaves was significantly lower in mixed-species and non-red stands. Mechanisms to explain associational resistance were examined. Positive Pearson correlations between the percent of adult R. mangle in a stand and both crab density and R. mangle leaf damage provided support for the resource concentration hypothesis. Limited support was found for the attractant-decoy hypothesis because the total amount of damaged leaves of all mangrove species combined typically differed among stands, suggesting that crabs were not shifting to alternative mangrove species to offset reduced availability of R. mangle leaves. Finally, while R. mangle seedlings were shorter in non-red stands compared to others, intra-specific differences in R. mangle leaf chemistry and sclerophylly among stands failed to explain associational patterns. These combined results argue for the need for additional experiments to elucidate mechanisms responsible for defensive plant associations in mangrove ecosystems and to determine whether such associations could be of use in mangrove

  2. WHEAT PATHOGEN RESISTANCE AND CHITINASE PROFILE

    Directory of Open Access Journals (Sweden)

    Zuzana Gregorová

    2015-02-01

    Full Text Available The powdery mildew and leaf rust caused by Blumeria graminis and Puccinia recondita (respectively are common diseases of wheat throughout the world. These fungal diseases greatly affect crop productivity. Incorporation of effective and durable disease resistance is an important breeding objective for wheat improvement. We have evaluated resistance of four bread wheat (Triticum aestivum and four spelt wheat (Triticum spelta cultivars. Chitinases occurrence as well as their activity was determined in leaf tissues. There was no correlation between resistance rating and activity of chitinase. The pattern of chitinases reveals four isoforms with different size in eight wheat cultivars. A detailed understanding of the molecular events that take place during a plant–pathogen interaction is an essential goal for disease control in the future.

  3. Using a Chlorophyll Meter to Evaluate the Nitrogen Leaf Content in Flue-Cured Tobacco (Nicotiana tabacum L.

    Directory of Open Access Journals (Sweden)

    Fabio Castelli

    2009-06-01

    Full Text Available In flue-cured tobacco N fertilizer is commonly applied during pre-planting, and very often applied again later as a growth-starter. It is generally held that the efficiency of N-fertilizer use can be improved by evaluating the leaf Nstatus after transplanting and until flowering stage. N use efficiency in this context does not refer merely to the yield but also to the quality, in the meanwhile minimizing the negative effects on the environment. To investigate these aspects, we evaluated the capacity of a Minolta model SPAD-502 chlorophyll meter to estimate the N-status in flue-cured tobacco. The aims was to verify if a relationship exists between SPAD readings and leaf N content, and if a single leaf, in a well defined stalk position, could represent the nitrogen content of the whole plant. During the years 1995 and 1996, a pot experiment was conducted using two flue-cured tobacco varieties. SPAD values, total chlorophyll, total N contents and leaf area were measured throughout the growing season, on each odd leaf stalk position. SPAD values were well-correlated with both total chlorophyll and total N leaf concentration, and the regression coefficients were higher when relationships were calculated on a leaf-area basis. For both relationships, SPAD-total chlorophyll and SPAD-total N, the best fittings were obtained with quadratic equations. One leaf stalk position alone is able to monitor the N-status of the whole plant during the first six weeks after transplanting, without distinction of year and variety effects. The SPAD measurement of one leaf per plant, throughout the vegetative growing season, is therefore a valid tool to test the N-status of the crop in a period when a required N supply is still effective.

  4. Effect of drought stress on leaf soluble sugar content, leaf rolling index and relative water content of proso millet (Panicum miliaceum L. genotypes

    Directory of Open Access Journals (Sweden)

    mohamad javad seghatol eslami

    2009-06-01

    Full Text Available With respect to water shortage in arid and semi- arid regions, the study about drought stress effects on crop plants and selection of resistance cultivars, are among the most important goals in the agricultural researches. In order to examine drought stress effects on millet, an experiment was conducted in Birjand and Sarbisheh, simultaneously. In this experiment, five irrigation treatments (well-watered, drought stress in vegetative stage, in ear emergence stage, in seed filling stage and in vegetative and seed filling stage and five proso millet genotypes (Native, K-C-M.2, K-C-M.4, K-C-M.6 and K-C-M.9 were compared in a split plot design along with three replications. Drought stress increased grain protein content, leaf rolling index and soluble sugars concentration and decreased seed germination and leaf RWC. Although seed protein content and germination percentage of genotypes were not significantly different, there were some differences among leaf rolling index, RWC and soluble sugar content of these genotypes. The results of this study indicated that leaf sugar content, RWC and leaf rolling index can not be considered as the only parameters for selection of high yield genotypes. Therefore, it is recommended that some other factors should also be used apart from the above mentioned ones.

  5. Ethylene Contributes to maize insect resistance1-Mediated Maize Defense against the Phloem Sap-Sucking Corn Leaf Aphid1[OPEN

    Science.gov (United States)

    Louis, Joe; Basu, Saumik; Varsani, Suresh; Castano-Duque, Lina; Jiang, Victoria; Williams, W. Paul; Felton, Gary W.; Luthe, Dawn S.

    2015-01-01

    Signaling networks among multiple phytohormones fine-tune plant defense responses to insect herbivore attack. Previously, it was reported that the synergistic combination of ethylene (ET) and jasmonic acid (JA) was required for accumulation of the maize insect resistance1 (mir1) gene product, a cysteine (Cys) proteinase that is a key defensive protein against chewing insect pests in maize (Zea mays). However, this study suggests that mir1-mediated resistance to corn leaf aphid (CLA; Rhopalosiphum maidis), a phloem sap-sucking insect pest, is independent of JA but regulated by the ET-signaling pathway. Feeding by CLA triggers the rapid accumulation of mir1 transcripts in the resistant maize genotype, Mp708. Furthermore, Mp708 provided elevated levels of antibiosis (limits aphid population)- and antixenosis (deters aphid settling)-mediated resistance to CLA compared with B73 and Tx601 maize susceptible inbred lines. Synthetic diet aphid feeding trial bioassays with recombinant Mir1-Cys Protease demonstrates that Mir1-Cys Protease provides direct toxicity to CLA. Furthermore, foliar feeding by CLA rapidly sends defensive signal(s) to the roots that trigger belowground accumulation of the mir1, signifying a potential role of long-distance signaling in maize defense against the phloem-feeding insects. Collectively, our data indicate that ET-regulated mir1 transcript accumulation, uncoupled from JA, contributed to heightened resistance to CLA in maize. In addition, our results underscore the significance of ET acting as a central node in regulating mir1 expression to different feeding guilds of insect herbivores. PMID:26253737

  6. Maize YABBY genes drooping leaf1 and drooping leaf2 affect agronomic traits by regulating leaf architecture

    Science.gov (United States)

    Leaf architectural traits, such as length, width and angle, directly influence canopy structure and light penetration, photosynthate production and overall yield. We discovered and characterized a maize (Zea mays) mutant with aberrant leaf architecture we named drooping leaf1 (drl1), as leaf blades ...

  7. Leaf structural characteristics are less important than leaf chemical properties in determining the response of leaf mass per area and photosynthesis of Eucalyptus saligna to industrial-age changes in [CO2] and temperature.

    Science.gov (United States)

    Xu, Cheng-Yuan; Salih, Anya; Ghannoum, Oula; Tissue, David T

    2012-10-01

    The rise in atmospheric [CO(2)] is associated with increasing air temperature. However, studies on plant responses to interactive effects of [CO(2)] and temperature are limited, particularly for leaf structural attributes. In this study, Eucalyptus saligna plants were grown in sun-lit glasshouses differing in [CO(2)] (290, 400, and 650 µmol mol(-1)) and temperature (26 °C and 30 °C). Leaf anatomy and chloroplast parameters were assessed with three-dimensional confocal microscopy, and the interactive effects of [CO(2)] and temperature were quantified. The relative influence of leaf structural attributes and chemical properties on the variation of leaf mass per area (LMA) and photosynthesis within these climate regimes was also determined. Leaf thickness and mesophyll size increased in higher [CO(2)] but decreased at the warmer temperature; no treatment interaction was observed. In pre-industrial [CO(2)], warming reduced chloroplast diameter without altering chloroplast number per cell, but the opposite pattern (reduced chloroplast number per cell and unchanged chloroplast diameter) was observed in both current and projected [CO(2)]. The variation of LMA was primarily explained by total non-structural carbohydrate (TNC) concentration rather than leaf thickness. Leaf photosynthetic capacity (light- and [CO(2)]-saturated rate at 28 °C) and light-saturated photosynthesis (under growth [CO(2)] and temperature) were primarily determined by leaf nitrogen contents, while secondarily affected by chloroplast gas exchange surface area and chloroplast number per cell, respectively. In conclusion, leaf structural attributes are less important than TNC and nitrogen in affecting LMA and photosynthesis responses to the studied climate regimes, indicating that leaf structural attributes have limited capacity to adjust these functional traits in a changing climate.

  8. Beyond leaf color: Comparing camera-based phenological metrics with leaf biochemical, biophysical, and spectral properties throughout the growing season of a temperate deciduous forest

    Science.gov (United States)

    Yang, Xi; Tang, Jianwu; Mustard, John F.

    2014-03-01

    Plant phenology, a sensitive indicator of climate change, influences vegetation-atmosphere interactions by changing the carbon and water cycles from local to global scales. Camera-based phenological observations of the color changes of the vegetation canopy throughout the growing season have become popular in recent years. However, the linkages between camera phenological metrics and leaf biochemical, biophysical, and spectral properties are elusive. We measured key leaf properties including chlorophyll concentration and leaf reflectance on a weekly basis from June to November 2011 in a white oak forest on the island of Martha's Vineyard, Massachusetts, USA. Concurrently, we used a digital camera to automatically acquire daily pictures of the tree canopies. We found that there was a mismatch between the camera-based phenological metric for the canopy greenness (green chromatic coordinate, gcc) and the total chlorophyll and carotenoids concentration and leaf mass per area during late spring/early summer. The seasonal peak of gcc is approximately 20 days earlier than the peak of the total chlorophyll concentration. During the fall, both canopy and leaf redness were significantly correlated with the vegetation index for anthocyanin concentration, opening a new window to quantify vegetation senescence remotely. Satellite- and camera-based vegetation indices agreed well, suggesting that camera-based observations can be used as the ground validation for satellites. Using the high-temporal resolution dataset of leaf biochemical, biophysical, and spectral properties, our results show the strengths and potential uncertainties to use canopy color as the proxy of ecosystem functioning.

  9. Water stress-induced modifications of leaf hydraulic architecture in sunflower: co-ordination with gas exchange.

    Science.gov (United States)

    Nardini, Andrea; Salleo, Sebastiano

    2005-12-01

    The hydraulic architecture, water relationships, and gas exchange of leaves of sunflower plants, grown under different levels of water stress, were measured. Plants were either irrigated with tap water (controls) or with PEG600 solutions with osmotic potential of -0.4 and -0.8 MPa (PEG04 and PEG08 plants, respectively). Mature leaves were measured for hydraulic resistance (R(leaf)) before and after making several cuts across minor veins, thus getting the hydraulic resistance of the venation system (R(venation)). R(leaf) was nearly the same in controls and PEG04 plants but it was reduced by about 30% in PEG08 plants. On the contrary, R(venation) was lowest in controls and increased in PEG04 and PEG08 plants as a likely result of reduction in the diameter of the veins' conduits. As a consequence, the contribution of R(venation) to the overall R(leaf) markedly increased from controls to PEG08 plants. Leaf conductance to water vapour (g(L)) was highest in controls and significantly lower in PEG04 and PEG08 plants. Moreover, g(L) was correlated to R(venation) and to leaf water potential (psi(leaf)) with highly significant linear relationships. It is concluded that water stress has an important effect on the hydraulic construction of leaves. This, in turn, might prove to be a crucial factor in plant-water relationships and gas exchange under water stress conditions.

  10. Leaf Surface Effects on Retrieving Chlorophyll Content from Hyperspectral Remote Sensing

    Science.gov (United States)

    Qiu, Feng; Chen, JingMing; Ju, Weimin; Wang, Jun; Zhang, Qian

    2017-04-01

    Light reflected directly from the leaf surface without entering the surface layer is not influenced by leaf internal biochemical content. Leaf surface reflectance varies from leaf to leaf due to differences in the surface roughness features and is relatively more important in strong absorption spectral regions. Therefore it introduces dispersion of data points in the relationship between biochemical concentration and reflectance (especially in the visible region). Separation of surface from total leaf reflection is important to improve the link between leaf pigments content and remote sensing data. This study aims to estimate leaf surface reflectance from hyperspectral remote sensing data and retrieve chlorophyll content by inverting a modified PROSPECT model. Considering leaf surface reflectance is almost the same in the visible and near infrared spectral regions, a surface layer with a reflectance independent of wavelength but varying from leaf to leaf was added to the PROSPECT model. The specific absorption coefficients of pigments were recalibrated. Then the modified model was inverted on independent datasets to check the performance of the model in predicting the chlorophyll content. Results show that differences in estimated surface layer reflectance of various species are noticeable. Surface reflectance of leaves with epicuticular waxes and trichomes is usually higher than other samples. Reconstruction of leaf reflectance and transmittance in the 400-1000 nm wavelength region using the modified PROSPECT model is excellent with low root mean square error (RMSE) and bias. Improvements for samples with high surface reflectance (e.g. maize) are significant, especially for high pigment leaves. Moreover, chlorophyll retrieved from inversion of the modified model is consequently improved (RMSE from 5.9-13.3 ug/cm2 with mean value 8.1 ug/cm2, while mean correlation coefficient is 0.90) compared to results of PROSPECT-5 (RMSE from 9.6-20.2 ug/cm2 with mean value 13

  11. Benzothiadiazole affects the leaf proteome in arctic bramble (Rubus arcticus).

    Science.gov (United States)

    Hukkanen, Anne; Kokko, Harri; Buchala, Antony; Häyrinen, Jukka; Kärenlampi, Sirpa

    2008-11-01

    Benzothiadiazole (BTH) induces resistance to the downy mildew pathogen, Peronospora sparsa, in arctic bramble, but the basis for the BTH-induced resistance is unknown. Arctic bramble cv. Mespi was treated with BTH to study the changes in leaf proteome and to identify proteins with a putative role in disease resistance. First, BTH induced strong expression of one PR-1 protein isoform, which was also induced by salicylic acid (SA). The PR-1 was responsive to BTH and exogenous SA despite a high endogenous SA content (20-25 microg/g fresh weight), which increased to an even higher level after treatment with BTH. Secondly, a total of 792 protein spots were detected in two-dimensional gel electrophoresis, eight proteins being detected solely in the BTH-treated plants. BTH caused up- or down-regulation of 72 and 31 proteins, respectively, of which 18 were tentatively identified by mass spectrometry. The up-regulation of flavanone-3-hydroxylase, alanine aminotransferase, 1-aminocyclopropane-1-carboxylate oxidase, PR-1 and PR-10 proteins may partly explain the BTH-induced resistance against P. sparsa. Other proteins with changes in intensity appear to be involved in, for example, energy metabolism and protein processing. The decline in ATP synthase, triosephosphate isomerase, fructose bisphosphate aldolase and glutamine synthetase suggests that BTH causes significant changes in primary metabolism, which provides one possible explanation for the decreased vegetative growth of foliage and rhizome observed in BTH-treated plants.

  12. Evaluation of Microdesmis puberula leaf meal as feed ingredient in ...

    African Journals Online (AJOL)

    The material was milled using a hammer mill to produce the leaf meal. Microdesmis puberula leaf meal contain 17.32% crude protein, 6.52% ether extract, 12.25% total ash, 24.84% crude fibre, 24.06% NFE and an appreciable percent of minerals. Three broiler starter diets were formulated to contain the meal at dietary ...

  13. Alpha-glucosidase Inhibitory and Antioxidant Potential of Antidiabetic Herb Alternanthera sessilis: Comparative Analyses of Leaf and Callus Solvent Fractions.

    Science.gov (United States)

    Chai, Tsun-Thai; Khoo, Chee-Siong; Tee, Chong-Siang; Wong, Fai-Chu

    2016-01-01

    Alternanthera sessilis is a medicinal herb which is consumed as vegetable and used as traditional remedies of various ailments in Asia and Africa. This study aimed to investigate the antiglucosidase and antioxidant activity of solvent fractions of A. sessilis leaf and callus. Leaf and callus methanol extracts were fractionated to produce hexane, chloroform, ethyl acetate, butanol, and water fractions. Antiglucosidase and 1,1-diphenyl-2-picrylhydrazyl scavenging activities as well as total phenolic (TP), total flavonoid (TF), and total coumarin (TC) contents were evaluated. Lineweaver-Burk plot analysis was performed on leaf and callus fractions with the strongest antiglucosidase activity. Leaf ethyl acetate fraction (LEF) had the strongest antiglucosidase (EC 50 0.55 mg/mL) and radical scavenging (EC 50 10.81 μg/mL) activity among leaf fractions. Callus ethyl acetate fraction (CEF) and chloroform fraction had the highest antiglucosidase (EC 50 0.25 mg/mL) and radical scavenging (EC 50 34.12 μg/mL) activity, respectively, among callus fractions. LEF and CEF were identified as noncompetitive and competitive α-glucosidase inhibitors, respectively. LEF and CEF had greater antiglucosidase activity than acarbose. Leaf fractions had higher phytochemical contents than callus fractions. LEF had the highest TP, TF, and TC contents. Antiglucosidase and antioxidant activities of leaf fractions correlated with phytochemical contents. LEF had potent antiglucosidase activity and concurrent antioxidant activity. CEF had the highest antiglucosidase activity among all fractions. Callus culture is a promising tool for enhancing production of potent α-glucosidase inhibitors. Leaf ethyl acetate fraction (LEF) had the strongest antiglucosidase (EC 50 0.55 mg/mL) and radical scavenging (EC 50 10.81 μg/mL) activity among leaf fractionsCallus ethyl acetate fraction (CEF) and chloroform fraction had the highest antiglucosidase (EC 50 0.25 mg/mL) and radical scavenging (EC 50 34.12

  14. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  15. Regulation and acclimation of leaf gas exchange in a piñon-juniper woodland exposed to three different precipitation regimes.

    Science.gov (United States)

    Limousin, Jean-Marc; Bickford, Christopher P; Dickman, Lee T; Pangle, Robert E; Hudson, Patrick J; Boutz, Amanda L; Gehres, Nathan; Osuna, Jessica L; Pockman, William T; McDowell, Nate G

    2013-10-01

    Leaf gas-exchange regulation plays a central role in the ability of trees to survive drought, but forecasting the future response of gas exchange to prolonged drought is hampered by our lack of knowledge regarding potential acclimation. To investigate whether leaf gas-exchange rates and sensitivity to drought acclimate to precipitation regimes, we measured the seasonal variations of leaf gas exchange in a mature piñon-juniper Pinus edulis-Juniperus monosperma woodland after 3 years of precipitation manipulation. We compared trees receiving ambient precipitation with those in an irrigated treatment (+30% of ambient precipitation) and a partial rainfall exclusion (-45%). Treatments significantly affected leaf water potential, stomatal conductance and photosynthesis for both isohydric piñon and anisohydric juniper. Leaf gas exchange acclimated to the precipitation regimes in both species. Maximum gas-exchange rates under well-watered conditions, leaf-specific hydraulic conductance and leaf water potential at zero photosynthetic assimilation all decreased with decreasing precipitation. Despite their distinct drought resistance and stomatal regulation strategies, both species experienced hydraulic limitation on leaf gas exchange when precipitation decreased, leading to an intraspecific trade-off between maximum photosynthetic assimilation and resistance of photosynthesis to drought. This response will be most detrimental to the carbon balance of piñon under predicted increases in aridity in the southwestern USA. © 2013 John Wiley & Sons Ltd.

  16. The grapevine root-specific aquaporin VvPIP2;4N controls root hydraulic conductance and leaf gas exchange under well-watered conditions but not under water stress.

    Science.gov (United States)

    Perrone, Irene; Gambino, Giorgio; Chitarra, Walter; Vitali, Marco; Pagliarani, Chiara; Riccomagno, Nadia; Balestrini, Raffaella; Kaldenhoff, Ralf; Uehlein, Norbert; Gribaudo, Ivana; Schubert, Andrea; Lovisolo, Claudio

    2012-10-01

    We functionally characterized the grape (Vitis vinifera) VvPIP2;4N (for Plasma membrane Intrinsic Protein) aquaporin gene. Expression of VvPIP2;4N in Xenopus laevis oocytes increased their swelling rate 54-fold. Northern blot and quantitative reverse transcription-polymerase chain reaction analyses showed that VvPIP2;4N is the most expressed PIP2 gene in root. In situ hybridization confirmed root localization in the cortical parenchyma and close to the endodermis. We then constitutively overexpressed VvPIP2;4N in grape 'Brachetto', and in the resulting transgenic plants we analyzed (1) the expression of endogenous and transgenic VvPIP2;4N and of four other aquaporins, (2) whole-plant, root, and leaf ecophysiological parameters, and (3) leaf abscisic acid content. Expression of transgenic VvPIP2;4N inhibited neither the expression of the endogenous gene nor that of other PIP aquaporins in both root and leaf. Under well-watered conditions, transgenic plants showed higher stomatal conductance, gas exchange, and shoot growth. The expression level of VvPIP2;4N (endogenous + transgene) was inversely correlated to root hydraulic resistance. The leaf component of total plant hydraulic resistance was low and unaffected by overexpression of VvPIP2;4N. Upon water stress, the overexpression of VvPIP2;4N induced a surge in leaf abscisic acid content and a decrease in stomatal conductance and leaf gas exchange. Our results show that aquaporin-mediated modifications of root hydraulics play a substantial role in the regulation of water flow in well-watered grapevine plants, while they have a minor role upon drought, probably because other signals, such as abscisic acid, take over the control of water flow.

  17. Induced mutation for disease resistance in rice with special reference to blast, bacterial blight and tungro

    International Nuclear Information System (INIS)

    Mathur, S.C.

    1983-01-01

    Rice varieties Ratna, Pusa 2-21, Vijaya and Pankaj have been treated with gamma rays, EMS or sodium azide to improve their resistance against blast, bacterial leaf blight or tungro virus. For blast and tungro, mutants with improved resistance were selected. Variation in reaction to bacterial leaf blight has been used in crossbreeding to accumulate genes for resistance. (author)

  18. Antibacterial and antioxidant activities of Vaccinium corymbosum L. leaf extract

    Directory of Open Access Journals (Sweden)

    Mehnaz Pervin

    2013-12-01

    Full Text Available Objective: To investigate antibacterial and antioxidant activity of the leaf extract of tropical medicinal herb and food plant Vaccinium corymbosum L. (V. corymbosum . Methods: Free radical scavenging activity on DPPH, ABTS, and nitrites were used to analyse phenolic and flavonoid contents of leaf extract. Other focuses included the determination of antioxidant enzymatic activity (SOD, CAT and GPx, metal chelating activity, reduction power, lipid peroxidation inhibition and the prevention of oxidative DNA damage. Antibacterial activity was determined by using disc diffusion method against seven strains of bacteria. Results: Results found that V. corymbosum leaf extract had significant antibacterial activity. The tested extract displayed the highest activity (about 23.18 mm inhibition zone against Salmonella typhymurium and the lowest antibacterial activity was observed against Enterococcus faecalis (about 14.08 mm inhibition zone at 10 mg/ disc. The IC 50 values for DPPH, ABTS and radical scavenging activity were 0.120, 0.049 and 1.160 mg/mL, respectively. V. corymbosum leaf extract also showed dose dependent reduction power, lipid peroxidation, DNA damage prevention and significant antioxidant enzymatic activity. Conclusions: These findings demonstrate that leaf extract of V. corymbosum could be used as an alternative therapy for antibiotic-resistant bacteria and help prevent various free radical related diseases.

  19. Antibacterial and antioxidant activities of Vaccinium corymbosum L. leaf extract

    Science.gov (United States)

    Pervin, Mehnaz; Hasnat, Md Abul; Lim, Beong Ou

    2013-01-01

    Objective To investigate antibacterial and antioxidant activity of the leaf extract of tropical medicinal herb and food plant Vaccinium corymbosum L. (V. corymbosum). Methods Free radical scavenging activity on DPPH, ABTS, and nitrites were used to analyse phenoic and flavonoid contents of leaf extract. Other focuses included the determination of antioxidant enzymatic activity (SOD, CAT and GPx), metal chelating activity, reduction power, lipid peroxidation inhibition and the prevention of oxidative DNA damage. Antibacterial activity was determined by using disc diffusion for seven strains of bacteria. Results Results found that V. corymbosum leaf extract had significant antibacterial activity. The tested extract displayed the highest activity (about 23.18 mm inhibition zone) against Salmonella typhymurium and the lowest antibacterial activity was observed against Enterococcus faecalis (about 14.08 mm inhibition zone) at 10 mg/ disc. The IC50 values for DPPH, ABTS and radical scavenging activity were 0.120, 0.049 and 1.160 mg/mL, respectively. V. corymbosum leaf extract also showed dose dependent reduction power, lipid peroxidation, DNA damage prevention and significant antioxidant enzymatic activity. Conclusions These findings demonstrate that leaf extract of V. corymbosum could be used as an alternative therapy for antibiotic-resistant bacteria and help prevent various free radical related diseases.

  20. Extraction of antioxidant pigments from dye sorghum leaf sheaths

    NARCIS (Netherlands)

    Kayode, A.P.P.; Bara, C.A.; Dalode-Vieira, G.; Linnemann, A.R.; Nout, M.J.R.

    2012-01-01

    Extraction of antioxidant biocolorant pigments from leaf sheaths of dye sorghum was optimized. Effects of temperature and ethanol concentration of the extraction solvent on the concentrations of the 3-deoxyanthocyanidins, total phenolics and total anthocyanins, and the colour parameters of the

  1. Measurement of leaf hydraulic conductance and stomatal conductance and their responses to irradiance and dehydration using the Evaporative Flux Method (EFM).

    Science.gov (United States)

    Sack, Lawren; Scoffoni, Christine

    2012-12-31

    Water is a key resource, and the plant water transport system sets limits on maximum growth and drought tolerance. When plants open their stomata to achieve a high stomatal conductance (gs) to capture CO2 for photosynthesis, water is lost by transpiration(1,2). Water evaporating from the airspaces is replaced from cell walls, in turn drawing water from the xylem of leaf veins, in turn drawing from xylem in the stems and roots. As water is pulled through the system, it experiences hydraulic resistance, creating tension throughout the system and a low leaf water potential (Ψ(leaf)). The leaf itself is a critical bottleneck in the whole plant system, accounting for on average 30% of the plant hydraulic resistance(3). Leaf hydraulic conductance (K(leaf) = 1/ leaf hydraulic resistance) is the ratio of the water flow rate to the water potential gradient across the leaf, and summarizes the behavior of a complex system: water moves through the petiole and through several orders of veins, exits into the bundle sheath and passes through or around mesophyll cells before evaporating into the airspace and being transpired from the stomata. K(leaf) is of strong interest as an important physiological trait to compare species, quantifying the effectiveness of the leaf structure and physiology for water transport, and a key variable to investigate for its relationship to variation in structure (e.g., in leaf venation architecture) and its impacts on photosynthetic gas exchange. Further, K(leaf) responds strongly to the internal and external leaf environment(3). K(leaf) can increase dramatically with irradiance apparently due to changes in the expression and activation of aquaporins, the proteins involved in water transport through membranes(4), and K(leaf) declines strongly during drought, due to cavitation and/or collapse of xylem conduits, and/or loss of permeability in the extra-xylem tissues due to mesophyll and bundle sheath cell shrinkage or aquaporin deactivation(5

  2. Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

  3. Relationship between the Al resistance of grasses and their adaptation to an infertile habitat.

    Science.gov (United States)

    Poozesh, Vahid; Cruz, Pablo; Choler, Philippe; Bertoni, Georges

    2007-05-01

    Original data on Al resistance, relative growth rate and leaf traits of five European grasses as well as literature data on Al resistance, habitat preference and traits of grasses were considered to determine whether (a) Al resistance is correlated to a growth conservative strategy and (b) species occurrence could be useful to assess Al toxicity in meadows on acid soils. The Al resistance of 15 species was represented by the Al activity in nutrient solution that resulted in a 50 % decrease in root length, [Al(3+)](50), or, for published values, in root or plant biomass. The correlations between Al resistance and acidity or nitrogen indices and the correlation between Al resistance and selected traits (relative growth rate, leaf dry matter content, specific leaf area and leaf thickness) were calculated. Principal component analysis was used for the characterization of the relationships between Al resistance and measured traits. The [Al(3+)](50) values of the resistant species Molinia caerulea and Sieglingia decumbens were 13 and 26 microm [Al(3+)](50), respectively. The known Al resistance of 15 species that were mainly of the intermediate strategy competitor-stress tolerator-ruderal (C-S-R) type and of the S type was correlated with Ellenberg's nitrogen and acidity indices. For the whole set of species, the correlation between Al resistance and traits was not significant. The Al resistance of the C-S-R species was variable and independent of their traits. S-type species, adapted to acid soils and with traits of conservative strategy, displayed Al resistance. The large difference in Al resistance between grasses may help assess Al soil toxicity by using the abundance of grasses.

  4. From leaf to whole-plant water use efficiency (WUE in complex canopies: Limitations of leaf WUE as a selection target

    Directory of Open Access Journals (Sweden)

    Hipólito Medrano

    2015-06-01

    Full Text Available Plant water use efficiency (WUE is becoming a key issue in semiarid areas, where crop production relies on the use of large volumes of water. Improving WUE is necessary for securing environmental sustainability of food production in these areas. Given that climate change predictions include increases in temperature and drought in semiarid regions, improving crop WUE is mandatory for global food production. WUE is commonly measured at the leaf level, because portable equipment for measuring leaf gas exchange rates facilitates the simultaneous measurement of photosynthesis and transpiration. However, when those measurements are compared with daily integrals or whole-plant estimates of WUE, the two sometimes do not agree. Scaling up from single-leaf to whole-plant WUE was tested in grapevines in different experiments by comparison of daily integrals of instantaneous water use efficiency [ratio between CO2 assimilation (AN and transpiration (E; AN/E] with midday AN/E measurements, showing a low correlation, being worse with increasing water stress. We sought to evaluate the importance of spatial and temporal variation in carbon and water balances at the leaf and plant levels. The leaf position (governing average light interception in the canopy showed a marked effect on instantaneous and daily integrals of leaf WUE. Night transpiration and respiration rates were also evaluated, as well as respiration contributions to total carbon balance. Two main components were identified as filling the gap between leaf and whole plant WUE: the large effect of leaf position on daily carbon gain and water loss and the large flux of carbon losses by dark respiration. These results show that WUE evaluation among genotypes or treatments needs to be revised.

  5. Leaf size indices and structure of the peat swamp forest

    Directory of Open Access Journals (Sweden)

    L.G. Aribal

    2017-12-01

    Full Text Available Leaf size indices of the tree species in the peatland of Agusan del Sur in Mindanao in Philippines was examined to deduce the variation of forest structure and observed forest zonation.  Using raunkiaer and webb’s leaf size classification, the leaf morphometrics of seven tree species consistently found on the established sampling plots were determined.  The species includes Ternstroemia philippinensis Merr., Polyscias aherniana Merr. Lowry and G.M. Plunkett, Calophyllum sclerophyllum Vesque, Fagraea racemosa Jack, Ilex cymosa Blume, Syzygium tenuirame (Miq. Merr. and Tristaniopsis micrantha Merr. Peter G.Wilson and J.T.Waterh.The LSI were correlated against the variables of the peat physico-chemical properties (such as bulk density, acrotelm thickness, peat depth, total organic carbon, nitrogen, phosphorus, and potassium, pH; water (pH, ammonium, nitrate, phosphate; and leaf tissue elements (nitrogen, phosphorus and potassium.  Result showed a decreasing leaf size indices and a three leaf size category consisting of mesophyllous, mesophyllous-notophyllous and microphyllous were observed which corresponds to the structure of vegetation i.e., from the tall-pole forest having the biggest average leaf area of 6,142.29 mm2 to the pygmy forest with average leaf area of 1,670.10 mm2.  Such decreased leaf size indices were strongly correlated to soil nitrogen, acrotelm thickness, peat depth, phosphate in water, nitrogen and phosphorus in the plant tissue.

  6. Assessment of antibacterial activity of crude leaf and root extracts of ...

    African Journals Online (AJOL)

    ... whether crude leaf and root extracts of Cassia alata (Caesalpiniaceae) have antimicrobial activity against clinically resistant Neisseria gonorrhoeae bacteria. To determine and compare the MICs of their ether and methanol extracts. Materials and methods: Ether and methanol extracts were prepared from the plant parts.

  7. Leaf protein and mineral concentrations across the "miracle tree" genus Moringa

    Science.gov (United States)

    The moringa tree Moringa oleifera is a fast-growing, drought-resistant tree cultivated across the lowland dry tropics worldwide for its nutritious leaves. Despite its nutritious reputation, there has been no systematic survey of the variation in leaf nutritional quality across M. oleifera grown worl...

  8. identification of common bean genotypes with dual leaf and pod ...

    African Journals Online (AJOL)

    ACSS

    2018-02-08

    Feb 8, 2018 ... IDENTIFICATION OF COMMON BEAN GENOTYPES WITH DUAL LEAF AND. POD RESISTANCE TO COMMON BACTERIAL BLIGHT DISEASE IN UGANDA. B.M.E. ALLADASSI, S.T. NKALUBO1, C. MUKANKUSI2, H.N. KAYAGA, P. GIBSON, R. EDEMA,. C.A. URREA3, J.D. KELLY4 and P.R. RUBAIHAYO.

  9. "Breath figures" on leaf surfaces-formation and effects of microscopic leaf wetness.

    Science.gov (United States)

    Burkhardt, Juergen; Hunsche, Mauricio

    2013-01-01

    "Microscopic leaf wetness" means minute amounts of persistent liquid water on leaf surfaces which are invisible to the naked eye. The water is mainly maintained by transpired water vapor condensing onto the leaf surface and to attached leaf surface particles. With an estimated average thickness of less than 1 μm, microscopic leaf wetness is about two orders of magnitude thinner than morning dewfall. The most important physical processes which reduce the saturation vapor pressure and promote condensation are cuticular absorption and the deliquescence of hygroscopic leaf surface particles. Deliquescent salts form highly concentrated solutions. Depending on the type and concentration of the dissolved ions, the physicochemical properties of microscopic leaf wetness can be considerably different from those of pure water. Microscopic leaf wetness can form continuous thin layers on hydrophobic leaf surfaces and in specific cases can act similar to surfactants, enabling a strong potential influence on the foliar exchange of ions. Microscopic leaf wetness can also enhance the dissolution, the emission, and the reaction of specific atmospheric trace gases e.g., ammonia, SO2, or ozone, leading to a strong potential role for microscopic leaf wetness in plant/atmosphere interaction. Due to its difficult detection, there is little knowledge about the occurrence and the properties of microscopic leaf wetness. However, based on the existing evidence and on physicochemical reasoning it can be hypothesized that microscopic leaf wetness occurs on almost any plant worldwide and often permanently, and that it significantly influences the exchange processes of the leaf surface with its neighboring compartments, i.e., the plant interior and the atmosphere. The omission of microscopic water in general leaf wetness concepts has caused far-reaching, misleading conclusions in the past.

  10. Capacidade combinatória para resistência àmancha branca em linhagens endogâmicas de milho

    Directory of Open Access Journals (Sweden)

    Paula de Souza Guimarães

    2009-12-01

    Dialelo B, showed more resistances to disease. The diallel analyses showed significant effects (P<0.01 for crosses, GCA in the set I, GCA in the set II, only for Dialelo A and SCA for resistance to white leaf spot. Based on the magnitude of GCA related to the total variation it was concluded that the resistence to white leaf spot is predominantly additive and significant SCA indicated dominance effects as well.

  11. The leaf size-twig size spectrum in evergreen broadleaved forest of ...

    African Journals Online (AJOL)

    Compared to deciduous broad-leaved species, the evergreen broad-leaved species were smaller in total leaf area for a given cross-sectional area or stem mass. This suggests that the species would support less leaf area at a given twig cross-sectional area with increasing environmental stress. And the life form can modify ...

  12. Sheep fed with banana leaf hay reduce ruminal protozoa population.

    Science.gov (United States)

    Freitas, Cláudio Eduardo Silva; Duarte, Eduardo Robson; Alves, Dorismar David; Martinele, Isabel; D'Agosto, Marta; Cedrola, Franciane; de Moura Freitas, Angélica Alves; Dos Santos Soares, Franklin Delano; Beltran, Makenzi

    2017-04-01

    A ciliate protozoa suppression can reduce methane production increasing the energy efficiency utilization by ruminants. The physicochemical characteristics of rumen fluid and the profile of the rumen protozoa populations were evaluated for sheep fed banana leaf hay in replacement of the Cynodon dactylon cv. vaqueiro hay. A total of 30 male sheep were raised in intensive system during 15 days of adaptation and 63 days of experimental period. The animals were distributed in a completely randomized design that included six replicates of five treatments with replacement levels (0, 25, 50, 75, and 100%) of the grass vaquero for the banana leaf hay. Samples of fluid were collected directly from the rumen with sterile catheters. Color, odor, viscosity, and the methylene blue reduction potential (MBRP) were evaluated and pH estimated using a digital potentiometer. After decimal dilutions, counts of genus protozoa were performed in Sedgewick Rafter chambers. The averages of pH, MBRP, color, odor, and viscosity were not influenced by the inclusion of the banana leaf hay. However, the total number of protozoa and Entodinium spp. population significantly decreased at 75 and 100% inclusions of banana leaf hay as roughage.

  13. Effect of Plant Growth Regulators on Leaf Number, Leaf Area and Leaf Dry Matter in Grape

    Directory of Open Access Journals (Sweden)

    Zahoor Ahmad BHAT

    2011-03-01

    Full Text Available Influence of phenylureas (CPPU and brassinosteriod (BR along with GA (gibberellic acid were studied on seedless grape vegetative characteristics like leaf number, leaf area and leaf dry matter. Growth regulators were sprayed on the vines either once (7 days after fruit set or 15 days after fruit set or twice (7+15 days after fruit set. CPPU 2 ppm+BR 0.4 ppm+GA 25 ppm produced maximum number of leaves (18.78 while as untreated vines produced least leaf number (16.22 per shoot. Maximum leaf area (129.70 cm2 and dry matter content (26.51% was obtained with higher CPPU (3 ppm and BR (0.4 ppm combination along with GA 25 ppm. Plant growth regulators whether naturally derived or synthetic are used to improve the productivity and quality of grapes. The relatively high value of grapes justifies more expensive inputs. A relatively small improvement in yield or fruit quality can justify the field application of a very costly product. Application of new generation growth regulators like brassinosteroids and phenylureas like CPPU have been reported to increase the leaf number as well as leaf area and dry matter thereby indirectly influencing the fruit yield and quality in grapes.

  14. Models for leaf area estimation in dwarf pigeon pea by leaf dimensions

    Directory of Open Access Journals (Sweden)

    Rafael Vieira Pezzini

    2018-03-01

    Full Text Available ABSTRACT This study aims to determine the most suitable model to estimate the leaf area of dwarf pigeon pea in function of the leaf central leaflet dimension. Six samplings of 200 leaves were performed in the first experiment, at 36, 42, 50, 56, 64, and 72 days after emergence (DAE. In the second experiment, seven samplings of 200 leaves were performed at 29, 36, 43, 49, 57, 65, and 70 DAE, totaling 2600 leaves. The length (L and width (W of the central leaflet were measured in all leaves composed by left, central, and right leaflets, the product of length times width (LW was calculated, and the leaf area (Y – sum of left, central, and right leaflet areas was determined by digital images. Linear, power, quadratic, and cubic models of Y as function of L, W, and LW were built using data from the second experiment. Leaves from the first experiment were used to validate the models. In dwarf pigeon pea, the linear (Ŷ = – 0.4088 + 1.6669x, R2 = 0.9790 is preferable, but power (Ŷ = 1.6097x1.0065, R2 = 0.9766, quadratic (Ŷ = – 0.3625 + 1.663x + 0.00007x2, R2 = 0.9790, and cubic (Ŷ = 0.7216 + 1.522x + 0.005x2 – 5E–05x3, R2 = 0.9791 models in function of LW are also suitable to estimate the leaf area obtained by digital images. The power model (Ŷ = 5.2508x1.7868, R2 = 0.95 based on the central leaflet width is less laborious because requires only one variable, but it presents accuracy reduction.

  15. The effect of air pollution and other environmental stressors on leaf fluctuating asymmetry and specific leaf area of Salix alba L

    Energy Technology Data Exchange (ETDEWEB)

    Wuytack, Tatiana, E-mail: tatiana.wuytack@ua.ac.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Wuyts, Karen, E-mail: karen.wuyts@ugent.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Laboratory of Forestry, Department of Forest and Water Management, Ghent University, Geraardsbergsesteenweg 267, B-9090 Gontrode (Melle) (Belgium); Van Dongen, Stefan, E-mail: stefan.vandongen@ua.ac.be [Department of Biology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Baeten, Lander, E-mail: lander.baeten@ugent.be [Laboratory of Forestry, Department of Forest and Water Management, Ghent University, Geraardsbergsesteenweg 267, B-9090 Gontrode (Melle) (Belgium); Kardel, Fatemeh, E-mail: fatemeh.kardel@ua.ac.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); Verheyen, Kris, E-mail: kris.verheyen@ugent.be [Laboratory of Forestry, Department of Forest and Water Management, Ghent University, Geraardsbergsesteenweg 267, B-9090 Gontrode, Melle (Belgium); Samson, Roeland, E-mail: roeland.samson@ua.ac.be [Department of Bioscience Engineering, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium)

    2011-10-15

    We aimed at evaluating the effect of low-level air pollution on leaf area fluctuating asymmetry (FAA) and specific leaf area (SLA) of Salix alba L., taking into account other environmental factors. Cuttings were grown in standardized conditions in the near vicinity of air quality measuring stations in Belgium. Variability of SLA and FAA between measuring stations explained 83% and 7.26%, respectively, of the total variability. FAA was not influenced by air pollution or environmental factors such as shading, herbivory, air temperature and humidity. SLA was increased by an increase in shadow, while NO{sub x} and O{sub 3} concentrations had only a marginal influence. The influence of SO{sub 2} concentration was negligible. Although our data analysis suggests a relationship between SLA and NO{sub x}/O{sub 3} concentration, the absence of a straightforward relationship between FAA and SLA and air pollution still questions the usefulness of these bio-indicators for monitoring air pollution. - Highlights: > Leaf characteristics of white willow as possible bio-indicators for air quality. > Fluctuating asymmetry is not a good bio-indicator for monitoring the air quality. > Shadow increases specific leaf area. > NO{sub x} and O{sub 3} change specific leaf area of white willow. - Specific leaf area of S. alba increased with increasing shade and, in less extent, with increasing NO{sub x} and decreasing O{sub 3} concentration, while leaf asymmetry did not respond to air pollution

  16. The effect of air pollution and other environmental stressors on leaf fluctuating asymmetry and specific leaf area of Salix alba L

    International Nuclear Information System (INIS)

    Wuytack, Tatiana; Wuyts, Karen; Van Dongen, Stefan; Baeten, Lander; Kardel, Fatemeh; Verheyen, Kris; Samson, Roeland

    2011-01-01

    We aimed at evaluating the effect of low-level air pollution on leaf area fluctuating asymmetry (FAA) and specific leaf area (SLA) of Salix alba L., taking into account other environmental factors. Cuttings were grown in standardized conditions in the near vicinity of air quality measuring stations in Belgium. Variability of SLA and FAA between measuring stations explained 83% and 7.26%, respectively, of the total variability. FAA was not influenced by air pollution or environmental factors such as shading, herbivory, air temperature and humidity. SLA was increased by an increase in shadow, while NO x and O 3 concentrations had only a marginal influence. The influence of SO 2 concentration was negligible. Although our data analysis suggests a relationship between SLA and NO x /O 3 concentration, the absence of a straightforward relationship between FAA and SLA and air pollution still questions the usefulness of these bio-indicators for monitoring air pollution. - Highlights: → Leaf characteristics of white willow as possible bio-indicators for air quality. → Fluctuating asymmetry is not a good bio-indicator for monitoring the air quality. → Shadow increases specific leaf area. → NO x and O 3 change specific leaf area of white willow. - Specific leaf area of S. alba increased with increasing shade and, in less extent, with increasing NO x and decreasing O 3 concentration, while leaf asymmetry did not respond to air pollution

  17. Leucocyte profile and offspring production of guinea pig (Cavia cobaya given Anredera cordifolia leaf extract

    Directory of Open Access Journals (Sweden)

    D. Wijayanti

    2018-03-01

    Full Text Available The objective of this study was to determine leucocyte and offspring production of guinea pig (Cavia cobaya giving Anredera cordifolia leaf extract. Materials used were female 16 heads of guinea pig with body weight of 425g. The treatments were an extract of A. cordifolia leaf at doses of 0, 10, 50 and 90 mg/head, designated as T0, T1, T2 and T3, respectively. A. cordifolia leaf extract was administered orally from 10 days prepartum to 10 days postpartum. Blood was taken at 10 days prepartum and 10 days postpartum. Total birth of the offspring was observed. Data were analyzed by analysis of variance and if there was effect of treatment, then continued with Duncan multiple range test and Chi-Square test for fetal production between the given A. cordifolia leaf extract and control. The result showed that there was no significant difference for 10 days prepartum after addition of A cordifolia leaf extract treatment. The postpartum treated showed a total 50 mg/head level increaed for monocytes than that of level 0, 10 and 90 mg/head. Ten days postpartum treatment showed the total increase for leucocyte and monocytes total were 50 and 90 mg/head, respectively compared to 10 mg/head level. Total lymphocyte of 90 mg/head increased compared to level 10 and 50 mg/head. The highest total neutrophil as found at level of 50 mg/head which increased compared to the level of 0 and 10 mg/head. ProvisioningA. cordifolialeaf extract at doses level of 50 and 90 mg/head could increase litter size (P<0.05; χ2=9.267 and decreased offspring mortality (P<0.05; χ2=6.4. In conclusion, by giving 50 mg/head A. cordifolia leaf extract could increase leucocyte profile and offspring production of guinea pig.

  18. Leaf Physiological and Morphological Responses to Shade in Grass-Stage Seedlings and Young Trees of Longleaf Pine

    Directory of Open Access Journals (Sweden)

    Lisa J. Samuelson

    2012-08-01

    Full Text Available Longleaf pine has been classified as very shade intolerant but leaf physiological plasticity to light is not well understood, especially given longleaf pine’s persistent seedling grass stage. We examined leaf morphological and physiological responses to light in one-year-old grass-stage seedlings and young trees ranging in height from 4.6 m to 6.3 m to test the hypothesis that young longleaf pine would demonstrate leaf phenotypic plasticity to light environment. Seedlings were grown in a greenhouse under ambient levels of photosynthetically active radiation (PAR or a 50% reduction in ambient PAR and whole branches of trees were shaded to provide a 50% reduction in ambient PAR. In seedlings, shading reduced leaf mass per unit area (LMA, the light compensation point, and leaf dark respiration (RD, and increased the ratio of light-saturated photosynthesis to RD and chlorophyll b and total chlorophyll expressed per unit leaf dry weight. In trees, shading reduced LMA, increased chlorophyll a, chlorophyll b and total chlorophyll on a leaf dry weight basis, and increased allocation of total foliar nitrogen to chlorophyll nitrogen. Changes in leaf morphological and physiological traits indicate a degree of shade tolerance that may have implications for even and uneven-aged management of longleaf pine.

  19. Timing and duration of autumn leaf development in Sweden

    Science.gov (United States)

    Bolmgren, Kjell

    2014-05-01

    The growing season is changing in both ends and autumn phases seem to be responding in more diverse ways than spring events. Indeed, we know little about autumn leaf phenological strategies and how they are correlated with fitness components or ecosystem properties, and how they vary between species and over bioclimatic gradients. In this study more than 10 000 students were involved in observing autumn leaf development at 378 sites all over Sweden (55-68°N). They followed an image based observation protocol classifying autumn leaf development into five levels, from summer green (level 0) to 100% autumn leaf colored (level 4) canopy. In total, they submitted almost 12 000 observations between August 9 and November 15. 75% of the observations were made on the common species of Populus tremula, Betula pendula/pubescens and Sorbus aucuparia. The expected (negative) correlation between latitude and start of leaf senescence (level 2) was found in Populus and Betula, but not in Sorbus. The duration of the leaf senescence period, defined as the period between 1/3 (level 2) and 100% (level 4) of the canopy autumn leaf colored, was negatively correlated with latitude in Populus and Betula, but not in Sorbus. There was also a strong (negative) correlation of the start (level 2) and the duration of the leaf senescence in the early senescing Sorbus and Betula, while this effect was weaker in the late senescing Populus.

  20. Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

    Energy Technology Data Exchange (ETDEWEB)

    Bouriaud, O. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France); Soudani, K. [Univ. Paris-Sud XI, Dept. d' Ecophysiologie Vegetale, Lab. Ecologie Systematique et Evolution, Orsay Cedex (France); Breda, N. [Inst. National de la Recherche Agronomique, Centre de Recherches Forestieres de Nancy, Champenoux (France)

    2003-06-01

    Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m{sup 2}{center_dot}g{sup -1}) is used to convert dry leaf litter biomass (g .m{sup -}2) into leaf area per ground unit area (m{sup 2}{center_dot}m{sup -2}). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m{sup 2}) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm{sup 2}{center_dot}g{sup -1}. Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant

  1. Leaf area index from litter collection: impact of specific leaf area variability within a beech stand

    International Nuclear Information System (INIS)

    Bouriaud, O.; Soudani, K.; Breda, N.

    2003-01-01

    Litter fall collection is a direct method widely used to estimate leaf area index (LAI) in broad-leaved forest stands. Indirect measurements using radiation transmittance and gap fraction theory are often compared and calibrated against litter fall, which is considered as a reference method, but few studies address the question of litter specific leaf area (SLA) measurement and variability. SLA (leaf area per unit of dry weight, m 2 ·g -1 ) is used to convert dry leaf litter biomass (g .m - 2) into leaf area per ground unit area (m 2 ·m -2 ). We paid special attention to this parameter in two young beech stands (dense and thinned) in northeastern France. The variability of both canopy (closure, LAI) and site conditions (soil properties, vegetation) was investigated as potential contributing factors to beech SLA variability. A systematic description of soil and floristic composition was performed and three types of soil were identified. Ellenberg's indicator values were averaged for each plot to assess nitrogen soil content. SLA of beech litter was measured three times during the fall in 23 plots in the stands (40 ha). Litter was collected bimonthly in square-shaped traps (0.5 m 2 ) and dried. Before drying, 30 leaves per plot and for each date were sampled, and leaf length, width, and area were measured with the help of a LI-COR areameter. SLA was calculated as the ratio of cumulated leaf area to total dry weight of the 30 leaves. Leaves characteristics per plot were averaged for the three dates of litter collection. Plant area index (PAI), estimated using the LAI-2000 plant canopy analyser and considering only the upper three rings, ranged from 2.9 to 8.1. Specific leaf area of beech litter was also highly different from one plot to the other, ranging from 150 to 320 cm 2 ·g -1 . Nevertheless, no relationship was found between SLA and stand canopy closure or PAI On the contrary, a significant relationship between SLA and soil properties was observed. Both SLA

  2. Characteristics of spring wheat genotypes exhibiting high resistance to FHB in terms of their resistance to other fungal diseases

    Directory of Open Access Journals (Sweden)

    Danuta Kurasiak-Popowska

    2016-09-01

    Full Text Available The field experiment was carried out in 2010–2012 at the Dłoń Agricultural Research Station, the Poznań University of Life Sciences, Poland. The study was designed to evaluate the degree of infection by powdery mildew, brown rust, and septoria leaf blotch in 61 spring wheat genotypes differing in their resistance to Fusarium ssp. The vast majority of spring wheat genotypes in the collection of gene resources in the USA defined as resistant to Fusarium ssp. confirmed their resistance under Polish climatic conditions. The B .graminis infection rate of genotypes that are considered to be resistant to Fusarium head blight was high. The resistance ranged from 7 for Sumai 3 (PL2 up to 8.8 for Ning 8331 (in a 9-point scale. Most of the genotypes (56.5% were infected by Puccinia recondita at a level of 1–3 (in a 9-point scale. The genotypes of Sumai 3 exhibited high resistance to septoria leaf blotch, amounting to 1–2 in a 9-point scale; the resistance of Frontana ranged from 1 to 3.5, while the genotypes of Ning were infected by Mycosphaerella graminicola at 5–6.

  3. Development of a New BRDF-Resistant Vegetation Index for Improving the Estimation of Leaf Area Index

    Directory of Open Access Journals (Sweden)

    Su Zhang

    2016-11-01

    Full Text Available The leaf area index (LAI is one of the most important Earth surface parameters used in the modeling of ecosystems and their interaction with climate. Numerous vegetation indices have been developed to estimate the LAI. However, because of the effects of the bi-directional reflectance distribution function (BRDF, most of these vegetation indices are also sensitive to the effect of BRDF. In this study, we aim to present a new BRDF-resistant vegetation index (BRVI, which is sensitive to the LAI but insensitive to the effect of BRDF. Firstly, the BRDF effects of different bands were investigated using both simulated data and in-situ measurements of winter wheat made at different growth stages. We found bi-directional shape similarity in the solar principal plane between the green and the near-infrared (NIR bands and between the blue and red bands for farmland soil conditions and with medium chlorophyll content level. Secondly, the consistency of the shape of the BRDF across different bands was employed to develop a new BRDF-resistant vegetation index for estimating the LAI. The reflectance ratios of the NIR band to the green band and the blue band to the red band were reasonably assumed to be resistant to the BRDF effects. Nevertheless, the variation amplitude of the bi-directional reflectance in the solar principal plane was different for different bands. The divisors in the two reflectance ratios were improved by combining the reflectances at the red and green bands. The new BRVI was defined as a normalized combination of the two improved reflectance ratios. Finally, the potential of the proposed BRVI for estimation of the LAI was evaluated using both simulated data and in-situ measurements and also compared to other popular vegetation indices. The results showed that the influence of the BRDF on the BRVI was the weakest and that the BRVI retrieved LAI values well, with a coefficient of determination (R2 of 0.84 and an RMSE of 0.83 for the field

  4. Phytochemical Analysis, Antifungal and Antioxidant Activity of Leaf ...

    African Journals Online (AJOL)

    Science, Technology and Arts Research Journal ... of total phenolics, antifungal and antioxidant activity of leaf and fruit extract of Zizyphus xylopyrus (Retz.) ... Flavonoids, saponins, terpenoids, tannins and phenols were found in both extracts.

  5. Comparative Study on the Antioxidant Activity of Leaf Extract and Carotenoids Extract from Ipomoea batatas var. Oren (Sweetpotato) Leaves

    OpenAIRE

    Seow-Mun Hue; Amru Nasrulhaq Boyce; Chandran Somasundram

    2011-01-01

    Ipomoea batatas (Sweetpotato) is currently ranked sixth in the total world food production and are planted mainly for their storage roots. The present study was undertaken to evaluate and compare the antioxidant properties of the leaf and carotenoids extract from the Ipomoea batatas var. Oren leaves. Total flavonoids in the leaf extract was 144.6 ± 40.5 μg/g compared to 114.86 ± 4.35 μg/g catechin equivalent in the carotenoids extract. Total polyphenols in the leaf extrac...

  6. Effect of Excoecaria agallocha on non-specific immune responses and disease resistance of Oreochromis niloticus against Streptococcus agalactiae.

    Science.gov (United States)

    Laith, A A; Mazlan, A G; Effendy, A W; Ambak, M A; Nurhafizah, W W I; Alia, A S; Jabar, A; Najiah, M

    2017-06-01

    The current study was designed to evaluate the effects of Excoecaria agallocha leaf extracts on immune mechanisms and resistance of tilapia, Oreochromis niloticus, after challenge with Streptococcus agalactiae. Fish were divided into 6 groups; groups 1-5 fed with E. agallocha leaf extracts at 10, 20, 30, 40 and 50mgkg -1 level, respectively. Group 6 were fed without extract addition and acted as control. E. agallocha extracts were administered as feed supplement in fish diet for 28days and the hematological, immunological, and growth performance studies were conducted. Fish were infected with S. agalactiae at a dose of 15×105CFUmL -1 and the total white blood cell (WBC), phagocytosis and respiratory burst activities of leukocytes, serum bactericidal activity, lysozyme, total protein, albumin, and globulin levels were monitored and mortalities recorded for 15days post infection. Results revealed that feeding O. niloticus with 50mgkg -1 of E. agallocha enhanced WBC, phagocytic, respiratory burst, serum bactericidal and lysozyme activities on day 28 pre-challenge and on 3rd, 6th, 9th, 12th and 15th day post-challenge as compared to control. Total protein and albumin were not enhanced by E. agallocha diet. E. agallocha increased the survival of fish after challenge with S. agalactiae. The highest mortality rate (97%) was observed in control fish and the lowest mortality (27%) was observed with group fed with 50mgkg -1 extract. The results indicate that dietary intake of E. agallocha methanolic leaf extract in O. niloticus enhances the non-specific immunity and disease resistance against S. agalactiae pathogen. Copyright © 2017. Published by Elsevier Ltd.

  7. Why do leaf-tying caterpillars abandon their leaf ties?

    Directory of Open Access Journals (Sweden)

    Michelle Sliwinski

    2013-09-01

    Full Text Available Leaf-tying caterpillars act as ecosystem engineers by building shelters between overlapping leaves, which are inhabited by other arthropods. Leaf-tiers have been observed to leave their ties and create new shelters (and thus additional microhabitats, but the ecological factors affecting shelter fidelity are poorly known. For this study, we explored the effects of resource limitation and occupant density on shelter fidelity and assessed the consequences of shelter abandonment. We first quantified the area of leaf material required for a caterpillar to fully develop for two of the most common leaf-tiers that feed on white oak, Quercus alba. On average, Psilocorsis spp. caterpillars consumed 21.65 ± 0.67 cm2 leaf material to complete development. We also measured the area of natural leaf ties found in a Maryland forest, to determine the distribution of resources available to caterpillars in situ. Of 158 natural leaf ties examined, 47% were too small to sustain an average Psilocorsis spp. caterpillar for the entirety of its development. We also manipulated caterpillar densities within experimental ties on potted trees to determine the effects of cohabitants on the likelihood of a caterpillar to leave its tie. We placed 1, 2, or 4 caterpillars in ties of a standard size and monitored the caterpillars twice daily to track their movement. In ties with more than one occupant, caterpillars showed a significantly greater propensity to leave their tie, and left sooner and at a faster rate than those in ties as single occupants. To understand the consequences of leaf tie abandonment, we observed caterpillars searching a tree for a site to build a shelter in the field. This is a risky behavior, as 17% of the caterpillars observed died while searching for a shelter site. Caterpillars that successfully built a shelter traveled 110 ± 20 cm and took 28 ± 7 min to find a suitable site to build a shelter. In conclusion, leaf-tying caterpillars must frequently

  8. Development of abiotic-stress resistant warm season trufgrasses by proton-beam irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Y. W.; Kim, J. Y.; Jeong, S. H. [Korea Univ., Seoul (Korea, Republic of)

    2007-04-15

    The direct use of mutation is a valuable approach to generate genetic variation in crop species by altering agronomically useful major traits. The proton beam, as a mutagen, was applied to improve resistance traits of Zoysia grass under various abiotic stresses. Proton beam was irradiated to mature dry seeds of Zenith (Zoysia grass), which is well-adapted to Korean climate, using a proton- accelerator with seven different doses (50, 100, 150, 200, 250, 300, 400 Gy). Individual seedling of M1 plant was transplanted from the seed bed and allowed to reach appropriate plant mass. Clones that showed superior growth were chosen and transplanted to pots for further clone propagation and field evaluation. Growth characteristics of turfgrass, such as plant height, leaf length, leaf width, number of tiller were evaluated ninety days after sowing. Although large variation within each dose, noticeable differences were found among different irradiated doses. Most of the mutant clones derived from the irradiation treatment showed more vigorous growth than the control plants. RAPD (Random Amplified Polymorphic DNA) and AFLP (Amplified Fragment Length Polymorphism) methods were conducted to analyze genomic variations associated with proton beam irradiation. In order to establish selection criteria for selection of salt-stress resistance plants, an in vitro method that is able to select salt-stress resistant mutants in liquid media without ambient disturbances. Total 647 predominance clones that were considered as abiotic stress resistant mutants were transplanted to the field for further evaluation.

  9. Climatic Controls on Leaf Nitrogen Content and Implications for Biochemical Modeling.

    Science.gov (United States)

    Tcherednichenko, I. A.; White, M.; Bastidas, L.

    2007-12-01

    Leaf nitrogen (N) content, expressed as percent total nitrogen per unit of leaf dry mass, is a widely used parameter in biochemical modeling, due mainly to its role as a potentially limiting factor for photosynthesis. The amount of nitrogen, however, does not occur in a fixed amount in every leaf, but rather varies continuously with the leaf life cycle, in constant response to soil-root-stem-leaf-climate interactions and demand for growth. Moreover, while broad data on leaf N has become available it is normally measured under ambient conditions with consequent difficulty for distinguishing between genetic and time specific environmental effects. In the present work we: 1) Investigate the theoretical variation of leaf mass, specific heat capacity and leaf thickness of full sun-expanded leaves as a regulatory mechanism to ensure thermal survival along with long-term climatic radiation/temperature gradient; and discuss nitrogen and carbon controls on leaf thickness. 2) Based on possible states of partition between nitrogenous and non-nitrogenous components of a leaf we further derive probability density functions (PDFs) of nitrogen and carbon content and assess the effect of water and nutrient uptake on the PDFs. 3) Translate the results to spatially explicit representation over the conterminous USA at 1 km spatial resolution by providing maximum potential values of leaf N of fully expanded leaf optimally suited for long term climatic averages values and soils conditions. Implications for potential presence of inherently slow/fast growing species are discussed along with suitability of results for use by biochemical models.

  10. Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...

    African Journals Online (AJOL)

    Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...

  11. Anatomical indications of fume resistance in certain woody plants

    Energy Technology Data Exchange (ETDEWEB)

    Ninova, D.

    1970-01-01

    An attempt is made to describe studies on seven species of fruit and forest trees close to or far from a Bulgarian factory emitting fumes containing S. The most resistant species (Quercus borealis, Gleditsia triacanthos, Morus alba) had the smallest stomata and the greatest number of stomata per unit leaf area. Changes observed in leaf anatomy as a result of exposure to the fumes were: decreased leaf aeration, elongated palisade cells, thicker cuticles, and more stomata.

  12. Resistance to stem canker, frogeye leaf spot and powdery mildew of soybean lines lacking lipoxigenases in the seeds Resistência ao cancro-da-haste, à cercosporiose e ao oídio de linhagens de soja sem lipoxigenases nas sementes

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Osório Martins

    2002-12-01

    Full Text Available The soybean [Glycine max (L. Merrill] crop holds a prominent position in the Brazilian economy because of the extension of the planted area and volume of grain production, but the beany flavor has been a limiting factor for soybean derivatives consumption by western population. This flavor is produced mainly by action of lipoxygenase enzymes (Lox1, Lox2 and Lox3, present in some commercial varieties. The genetic elimination of the alleles that codify these enzymes is the most appropriate way to avoid problems associated to this deleterious flavor. To elucidate the effect of seed lipoxygenase elimination on the resistance to plant pathogens, normal varieties of soybean (FT-Cristalina RCH, Doko RC and IAC-12 and their backcross-derived lines, both with the three lipoxygenases present in their seeds (triple-positive, TP and without the three lipoxygenases (triple-null, TN, were tested for their resistance to stem canker (Diaporthe phaseolorum f.sp. meridionalis, frogeye leaf spot (Cercospora sojina Hara, and powdery mildew (Microsphaera diffusa Cke. & Pk.. All genetic materials studied were resistant to stem canker. FT-Cristalina RCH and Doko-RC and their TP and TN lines were resistant to frogeye leaf spot. IAC-12 and its derived lines not only presented a higher disease index, but also the derived lines, TP and TN, were more susceptible, indicating the loss of genes for disease resistance in the backcrosses. There was no association between the elimination of lipoxygenases from the seeds with the resistance to frogeye leaf spot. In relation to the powdery mildew, TP or TN lines presented similar or higher resistance than their respective recurrent parents whose susceptibility appeared in the following order: IAC-12, less susceptible, Doko-RC, intermediate and FT-Cristalina RCH, more susceptible.A cultura da soja [Glycine max (L. Merrill] ocupa lugar de destaque na economia brasileira, tanto em termos de área plantada, quanto de produção de gr

  13. Does oolong tea (Camellia sinensis) made from a combination of leaf and stem smell more aromatic than leaf-only tea? Contribution of the stem to oolong tea aroma.

    Science.gov (United States)

    Zeng, Lanting; Zhou, Ying; Fu, Xiumin; Mei, Xin; Cheng, Sihua; Gui, Jiadong; Dong, Fang; Tang, Jinchi; Ma, Shengzhou; Yang, Ziyin

    2017-12-15

    The raw materials used to make oolong tea (Camellia sinensis) are a combination of leaf and stem. Oolong tea made from leaf and stem is thought to have a more aromatic smell than leaf-only tea. However, there is no available evidence to support the viewpoint. In this study, sensory evaluation and detailed characterization of emitted and internal volatiles (not readily emitted, but stored in samples) of dry oolong teas and infusions indicated that the presence of stem did not significantly improve the total aroma characteristics. During the enzyme-active processes, volatile monoterpenes and theanine were accumulated more abundantly in stem than in leaf, while jasmine lactone, indole, and trans-nerolidol were lower in stem than in leaf. Tissue-specific aroma-related gene expression and availability of precursors of aroma compounds resulted in different aroma distributions in leaf and stem. This study presents the first determination of the contribution of stem to oolong tea aroma. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Identification of mutations associated with pyrethroid resistance in the voltage-gated sodium channel of the tomato leaf miner (Tuta absoluta).

    Science.gov (United States)

    Haddi, Khalid; Berger, Madeleine; Bielza, Pablo; Cifuentes, Dina; Field, Linda M; Gorman, Kevin; Rapisarda, Carmelo; Williamson, Martin S; Bass, Chris

    2012-07-01

    The tomato leaf miner, Tuta absoluta (Lepidoptera) is a significant pest of tomatoes that has undergone a rapid expansion in its range during the past six years and is now present across Europe, North Africa and parts of Asia. One of the main means of controlling this pest is through the use of chemical insecticides. In the current study insecticide bioassays were used to determine the susceptibility of five T. absoluta strains established from field collections from Europe and Brazil to pyrethroids. High levels of resistance to λ cyhalothrin and tau fluvalinate were observed in all five strains tested. To investigate whether pyrethroid resistance was mediated by mutation of the para-type sodium channel in T. absoluta the IIS4-IIS6 region of the para gene, which contains many of the mutation sites previously shown to confer knock down (kdr)-type resistance to pyrethroids across a range of different arthropod species, was cloned and sequenced. This revealed that three kdr/super-kdr-type mutations (M918T, T929I and L1014F), were present at high frequencies within all five resistant strains at known resistance 'hot-spots'. This is the first description of these mutations together in any insect population. High-throughput DNA-based diagnostic assays were developed and used to assess the prevalence of these mutations in 27 field strains from 12 countries. Overall mutant allele frequencies were high (L1014F 0.98, M918T 0.35, T929I 0.60) and remarkably no individual was observed that did not carry kdr in combination with either M918T or T929I. The presence of these mutations at high frequency in T. absoluta populations across much of its range suggests pyrethroids are likely to be ineffective for control and supports the idea that the rapid expansion of this species over the last six years may be in part mediated by the resistance of this pest to chemical insecticides. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  15. Effect of litter, leaf cover and cover of basal internodes of the dominant species Molinia caerulea on seedling recruitment and established vegetation

    Science.gov (United States)

    Janeček, Štěpán; Lepš, Jan

    2005-09-01

    The effects of litter removal, leaf cover of established plants and cover of basal internodes of a dominant species Molinia caerulea on seedling germination and the dynamics of established plants were studied in a field experiment in an oligotrophic wet meadow. Although the negative influence of litter on total seedling number and seedling species composition was non-significant, litter significantly affected the dynamics of the established vegetation and caused inhibition of total leaf cover development. The effects of total leaf cover of established plants on seedling establishment changed during the vegetation season. Whereas the effect of total leaf cover was positive at the start and in the middle of the vegetation season, at the end the total leaf cover negatively affected seedling establishment. Both total leaf cover and cover of basal internodes affected seedling composition. Effects of these two variables were statistically separable suggesting that they are based on different mechanisms. The response of seedling establishment to these factors was species specific and, consequently, our data support the hypothesis that that biotically generated spatial heterogeneity can promote species co-existence through the differentiation of species regeneration niches.

  16. Moringa Oleifera aqueous leaf extract down-regulates nuclear factor-kappaB and increases cytotoxic effect of chemotherapy in pancreatic cancer cells.

    Science.gov (United States)

    Berkovich, Liron; Earon, Gideon; Ron, Ilan; Rimmon, Adam; Vexler, Akiva; Lev-Ari, Shahar

    2013-08-19

    Fewer than 6% patients with adenocarcinoma of the pancreas live up to five years after diagnosis. Chemotherapy is currently the standard treatment, however, these tumors often develop drug resistance over time. Agents for increasing the cytotoxic effects of chemotherapy or reducing the cancer cells' chemo-resistance to the drugs are required to improve treatment outcome. Nuclear factor kappa B (NF-kB), a pro-inflammatory transcription factor, reportedly plays a significant role in the resistance of pancreatic cancer cells to apoptosis-based chemotherapy. This study investigated the effect of aqueous Moringa Oleifera leaf extract on cultured human pancreatic cancer cells - Panc-1, p34, and COLO 357, and whether it can potentiates the effect of cisplatin chemotherapy on these cells. The effect of Moringa Oleifera leaf extract alone and in combination with cisplatin on the survival of cultured human pancreatic cancer cells was evaluated by XTT-based colorimetric assay. The distribution of Panc-1 cells in the cell cycle following treatment with Moringa leaf extract was evaluated by flow cytometry, and evaluations of protein levels were via immunoblotting. Data of cell survival following combined treatments were analyzed with Calcusyn software. Moringa Oleifera leaf extract inhibited the growth of all pancreatic cell lines tested. This effect was significant in all cells following exposure to ≥0.75 mg/ml of the extract. Exposure of Panc-1 cells to Moringa leaf extract induced an elevation in the sub-G1 cell population of the cell-cycle, and reduced the expression of p65, p-IkBα and IkBα proteins in crude cell extracts. Lastly, Moringa Oleifera leaf extract synergistically enhanced the cytotoxic effect of cisplatin on Panc-1 cells. Moringa Oleifera leaf extract inhibits the growth of pancreatic cancer cells, the cells NF-κB signaling pathway, and increases the efficacy of chemotherapy in human pancreatic cancer cells.

  17. A comparison of step-and-shoot leaf sequencing algorithms that eliminate tongue-and-groove effects

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States)

    2004-07-21

    The performances of three recently published leaf sequencing algorithms for step-and-shoot intensity-modulated radiation therapy delivery that eliminates tongue-and-groove underdosage are evaluated. Proofs are given to show that the algorithm of Que et al (2004 Phys. Med. Biol. 49 399-405) generates leaf sequences free of tongue-and-groove underdosage and interdigitation. However, the total beam-on times could be up to n times those of the sequences generated by the algorithms of Kamath et al (2004 Phys. Med. Biol. 49 N7-N19), which are optimal in beam-on time for unidirectional leaf movement under the same constraints, where n is the total number of involved leaf pairs. Using 19 clinical fluence matrices and 100 000 randomly generated 15 x 15 matrices, the average monitor units and number of segments of the leaf sequences generated using the algorithm of Que et al are about two to four times those generated by the algorithm of Kamath et al.

  18. A comparison of step-and-shoot leaf sequencing algorithms that eliminate tongue-and-groove effects

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Ranka, Sanjay; Li, Jonathan; Palta, Jatinder

    2004-01-01

    The performances of three recently published leaf sequencing algorithms for step-and-shoot intensity-modulated radiation therapy delivery that eliminates tongue-and-groove underdosage are evaluated. Proofs are given to show that the algorithm of Que et al (2004 Phys. Med. Biol. 49 399-405) generates leaf sequences free of tongue-and-groove underdosage and interdigitation. However, the total beam-on times could be up to n times those of the sequences generated by the algorithms of Kamath et al (2004 Phys. Med. Biol. 49 N7-N19), which are optimal in beam-on time for unidirectional leaf movement under the same constraints, where n is the total number of involved leaf pairs. Using 19 clinical fluence matrices and 100 000 randomly generated 15 x 15 matrices, the average monitor units and number of segments of the leaf sequences generated using the algorithm of Que et al are about two to four times those generated by the algorithm of Kamath et al

  19. Pre-Infection Stages of Austropuccinia psidii in the Epidermis of Eucalyptus Hybrid Leaves with Different Resistance Levels

    Directory of Open Access Journals (Sweden)

    Renata Ruiz Silva

    2017-10-01

    Full Text Available Rust is a major Eucalyptus spp. disease, which is especially damaging for early-stage plants. The aim of this study was to verify the pre-infection process of Austropuccinia psidii (A. psidii in the leaves of three phenological stages of Eucalyptus clones with different resistance levels. Plants from the hybrids of Eucalyptus urophylla × Eucalyptus grandis (E. grandis with variable levels of resistance to this disease were used. The pathogen was inoculated in vitro on abaxial leaf discs of first, third, and fifth leaf stages and maintained under conditions suitable for disease development. Subsequently, samples from these discs were collected 24 and 120 h after inoculation and processed using scanning electron microscopy analysis. No symptoms were seen in any leaf stage of the resistant clone. Additionally, a low incidence of A. psidii germination (1.3–2% and appressoria (0–0.5% in three leaf stages was observed. However, the first leaf stage of the susceptible clone presented germination of large numbers of urediniospores (65% with appressoria (55% and degradation of the cuticle and wax. From the third stage, the percentage of germinated urediniospores (<15% and appressoria (<2% formation of this clone decreased. Protrusions on the leaf surface, associated with the pathogen, were observed on the first and third leaf stages of the resistant clone and on the fifth stage of the susceptible clone, suggesting a possible defensive plant reaction.

  20. [Relationships among leaf traits and their expression in different vegetation zones in Yanhe River basin, Northwest China].

    Science.gov (United States)

    Guo, Ru; Wen, Zhong-ming; Wang, Hong-xia; Qi, De-hui

    2015-12-01

    This article selected zonal plant communities as the research objects in different vegetation zones in Yanhe River basin. We measured six leaf traits of the dominant species and main accompanying species in each community, and then analyzed the relationships and their changes along with environmental gradients between these traits in order to understand the plant adaptation strategies to the environment changes. The results showed that the specific leaf area was significantly negatively correlated to leaf tissue density, area-based leaf nitrogen and phosphorus concentrations, and significantly positively correlated to mass-based leaf phosphorus concentration. Both the scaling relationships among these traits and plant life strategies were different among the three vegetation zones, the scaling-dependent relationship between leaf tissue density and specific leaf area was stronger in steppe and forest-steppe zones than in forest zone, but the correlations among area-based leaf nitrogen/phosphorus concentrations and specific leaf area and leaf tissue density were more significant in forest zone than in steppe zone. In the arid grassland and forest-steppe zone, plants give priority to defensive and stress resistance strategies, and in relatively moist nutrient-rich forest zone, plants give priority to fast growth and resource optimization allocation strategies.

  1. Estimating leaf photosynthetic pigments information by stepwise multiple linear regression analysis and a leaf optical model

    Science.gov (United States)

    Liu, Pudong; Shi, Runhe; Wang, Hong; Bai, Kaixu; Gao, Wei

    2014-10-01

    Leaf pigments are key elements for plant photosynthesis and growth. Traditional manual sampling of these pigments is labor-intensive and costly, which also has the difficulty in capturing their temporal and spatial characteristics. The aim of this work is to estimate photosynthetic pigments at large scale by remote sensing. For this purpose, inverse model were proposed with the aid of stepwise multiple linear regression (SMLR) analysis. Furthermore, a leaf radiative transfer model (i.e. PROSPECT model) was employed to simulate the leaf reflectance where wavelength varies from 400 to 780 nm at 1 nm interval, and then these values were treated as the data from remote sensing observations. Meanwhile, simulated chlorophyll concentration (Cab), carotenoid concentration (Car) and their ratio (Cab/Car) were taken as target to build the regression model respectively. In this study, a total of 4000 samples were simulated via PROSPECT with different Cab, Car and leaf mesophyll structures as 70% of these samples were applied for training while the last 30% for model validation. Reflectance (r) and its mathematic transformations (1/r and log (1/r)) were all employed to build regression model respectively. Results showed fair agreements between pigments and simulated reflectance with all adjusted coefficients of determination (R2) larger than 0.8 as 6 wavebands were selected to build the SMLR model. The largest value of R2 for Cab, Car and Cab/Car are 0.8845, 0.876 and 0.8765, respectively. Meanwhile, mathematic transformations of reflectance showed little influence on regression accuracy. We concluded that it was feasible to estimate the chlorophyll and carotenoids and their ratio based on statistical model with leaf reflectance data.

  2. The relationship between leaf water status, gas exchange, and spectral reflectance in cotton leaves

    Science.gov (United States)

    Bowman, William D.

    1989-01-01

    Measurements of leaf spectral reflectance, the components of water potential, and leaf gas exchanges as a function of leaf water content were made to evaluate the use of NIR reflectance as an indicator of plant water status. Significant correlations were determined between spectral reflectance at 810 nm, 1665 nm, and 2210 nm and leaf relative water content, total water potential, and turgor pressure. However, the slopes of these relationships were relatively shallow and, when evaluated over the range of leaf water contents in which physiological activity occurs (e.g., photosynthesis), had lower r-squared values, and some relationships were not statistically significant. NIR reflectance varied primarily as a function of leaf water content, and not independently as a function of turgor pressure, which is a sensitive indicator of leaf water status. The limitations of this approach to measuring plant water stress are discussed.

  3. Sulfonamide and tetracycline resistance genes in total- and culturable-bacterial assemblages in South African aquatic environments

    Directory of Open Access Journals (Sweden)

    Satoru eSuzuki

    2015-08-01

    Full Text Available Antibiotic resistant bacteria (ARB are ubiquitous in the natural environment. The introduction of effluent derived antibiotic resistance genes (ARGs into aquatic environments is of concern in the spreading of genetic risk. This study showed the prevalence of sulfonamide and tetracycline resistance genes, sul1, sul2, sul3 and tet(M, in the total bacterial assemblage and colony forming bacterial assemblage in river and estuarine water and sewage treatment plants (STP in South Africa. There was no correlation between antibiotic concentrations and ARGs, suggesting the targeted ARGs are spread in a wide area without connection to selection pressure. Among sul genes, sul1 and sul2 were major genes in the total (over 10-2 copies/16S and colony forming bacteria assemblages (approx 10-1 copies/16S. In urban waters, the sul3 gene was mostly not detectable in total and culturable assemblages, suggesting sul3 is not abundant. tet(M was found in natural assemblages with 10-3 copies/16S level in STP, but was not detected in colony forming bacteria, suggesting the non-culturable (yet-to-be cultured bacterial community in urban surface waters and STP effluent possess the tet(M gene. Sulfamethoxazole resistant (SMXr and oxytetracycline resistant (OTCr bacterial communities in urban waters possessed not only sul1 and sul2 but also sul3 and tet(M genes. These genes are widely distributed in SMXr and OTCr bacteria. In conclusion, urban river and estuarine water and STP effluent in the Durban area were highly contaminated with ARGs, and the yet-to-be cultured bacterial community may act as a non-visible ARG reservoir in certain situations.

  4. Role of secondary metabolites biosynthesis in resistance to cotton ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.

  5. Can Leaf Spectroscopy Predict Leaf and Forest Traits Along a Peruvian Tropical Forest Elevation Gradient?

    Science.gov (United States)

    Doughty, Christopher E.; Santos-Andrade, P. E.; Goldsmith, G. R.; Blonder, B.; Shenkin, A.; Bentley, L. P.; Chavana-Bryant, C.; Huaraca-Huasco, W.; Díaz, S.; Salinas, N.; Enquist, B. J.; Martin, R.; Asner, G. P.; Malhi, Y.

    2017-11-01

    High-resolution spectroscopy can be used to measure leaf chemical and structural traits. Such leaf traits are often highly correlated to other traits, such as photosynthesis, through the leaf economics spectrum. We measured VNIR (visible-near infrared) leaf reflectance (400-1,075 nm) of sunlit and shaded leaves in 150 dominant species across ten, 1 ha plots along a 3,300 m elevation gradient in Peru (on 4,284 individual leaves). We used partial least squares (PLS) regression to compare leaf reflectance to chemical traits, such as nitrogen and phosphorus, structural traits, including leaf mass per area (LMA), branch wood density and leaf venation, and "higher-level" traits such as leaf photosynthetic capacity, leaf water repellency, and woody growth rates. Empirical models using leaf reflectance predicted leaf N and LMA (r2 > 30% and %RMSE < 30%), weakly predicted leaf venation, photosynthesis, and branch density (r2 between 10 and 35% and %RMSE between 10% and 65%), and did not predict leaf water repellency or woody growth rates (r2<5%). Prediction of higher-level traits such as photosynthesis and branch density is likely due to these traits correlations with LMA, a trait readily predicted with leaf spectroscopy.

  6. Molecular interactions between tomato and the leaf mold pathogen Cladosporium fulvum.

    Science.gov (United States)

    Rivas, Susana; Thomas, Colwyn M

    2005-01-01

    The interaction between tomato and the leaf mold pathogen Cladosporium fulvum is controlled in a gene-for-gene manner. This interaction has provided useful insights to the molecular basis of recognition specificity in plant disease resistance (R) proteins, disease resistance (R) gene evolution, R-protein mediated signaling, and cellular responses to pathogen attack. Tomato Cf genes encode type I membrane-associated receptor-like proteins (RLPs) comprised predominantly of extracellular leucine-rich repeats (eLRRs) and which are anchored in the plasma membrane. Cf proteins recognize fungal avirulence (Avr) peptides secreted into the leaf apoplast during infection. A direct interaction of Cf proteins with their cognate Avr proteins has not been demonstrated and the molecular mechanism of Avr protein perception is not known. Following ligand perception Cf proteins trigger a hypersensitive response (HR) and the arrest of pathogen development. Cf proteins lack an obvious signaling domain, suggesting that defense response activation is mediated through interactions with other partners. Avr protein perception results in the rapid accumulation of active oxygen species (AOS), changes in cellular ion fluxes, activation of protein kinase cascades, changes in gene expression and, possibly, targeted protein degradation. Here we review our current understanding of Cf-mediated responses in resistance to C. fulvum.

  7. Inheritance of Resistance to Turcicum Leaf Blight in Sorghum ...

    African Journals Online (AJOL)

    Breeding for such complex traits is often compounded by genotype by environment interactions and as such, marker assisted selection could hasten the process. Further characterisation of resistance loci and mapping of quantitative trait loci will support effective more resistance breeding. Keywords: Exserohilum turcicum ...

  8. Leaf size and leaf display of thirty-eight tropical tree species

    NARCIS (Netherlands)

    Poorter, L.; Rozendaal, D.M.A.

    2008-01-01

    Trees forage for light through optimal leaf display. Effective leaf display is determined by metamer traits (i.e., the internode, petiole, and corresponding leaf), and thus these traits strongly co-determine carbon gain and as a result competitive advantage in a light-limited environment. We

  9. Removal of nutrient limitations in forest gaps enhances growth rate and resistance to cavitation in subtropical canopy tree species differing in shade tolerance.

    Science.gov (United States)

    Villagra, Mariana; Campanello, Paula I; Montti, Lia; Goldstein, Guillermo

    2013-03-01

    A 4-year fertilization experiment with nitrogen (N) and phosphorus (P) was carried out in natural gaps of a subtropical forest in northeastern Argentina. Saplings of six dominant canopy species differing in shade tolerance were grown in five control and five N + P fertilized gaps. Hydraulic architectural traits such as wood density, the leaf area to sapwood area ratio (LA : SA), vulnerability to cavitation (P50) and specific and leaf-specific hydraulic conductivity were measured, as well as the relative growth rate, specific leaf area (SLA) and percentage of leaf damage by insect herbivores. Plant growth rates and resistance to drought-induced embolisms increased when nutrient limitations were removed. On average, the P50 of control plants was -1.1 MPa, while the P50 of fertilized plants was -1.6 MPa. Wood density and LA : SA decreased with N + P additions. A trade-off between vulnerability to cavitation and efficiency of water transport was not observed. The relative growth rate was positively related to the total leaf surface area per plant and negatively related to LA : SA, while P50 was positively related to SLA across species and treatments. Plants with higher growth rates and higher total leaf area in fertilized plots were able to avoid hydraulic dysfunction by becoming less vulnerable to cavitation (more negative P50). Two high-light-requiring species exhibited relatively low growth rates due to heavy herbivore damage. Contrary to expectations, shade-tolerant plants with relatively high resistance to hydraulic dysfunction and reduced herbivory damage were able to grow faster. These results suggest that during the initial phase of sapling establishment in gaps, species that were less vulnerable to cavitation and exhibited reduced herbivory damage had faster realized growth rates than less shade-tolerant species with higher potential growth rates. Finally, functional relationships between hydraulic traits and growth rate across species and treatments

  10. Plant traits and environment: floating leaf blade production and turnover of waterlilies.

    Science.gov (United States)

    Klok, Peter F; van der Velde, Gerard

    2017-01-01

    Floating leaf blades of waterlilies fulfill several functions in wetland ecosystems by production, decomposition and turnover as well as exchange processes. Production and turnover rates of floating leaf blades of three waterlily species, Nuphar lutea (L.) Sm., Nymphaea alba L. and Nymphaea candida Presl, were studied in three freshwater bodies, differing in trophic status, pH and alkalinity. Length and percentages of leaf loss of marked leaf blades were measured weekly during the growing season. Area and biomass were calculated based on leaf length and were used to calculate the turnover rate of floating leaf blades. Seasonal changes in floating leaf production showed that values decreased in the order: Nymphaea alba , Nuphar lutea , Nymphaea candida . The highest production was reached for Nuphar lutea and Nymphaea alba in alkaline, eutrophic water bodies. The production per leaf was relatively high for both species in the acid water body. Nymphaea candida showed a very short vegetation period and low turnover rates. The ratio Total potential leaf biomass/Maximum potential leaf biomass (P/B max ) of the three species ranged from 1.35-2.25. The ratio Vegetation period (Period with floating leaves)/Mean leaf life span ranged from 2.94-4.63, the ratio Growth period (Period with appearance of new floating leaves)/Vegetation period from 0.53-0.73. The clear differences between Nymphaea candida versus Nuphar lutea and Nymphaea alba , may be due to adaptations of Nymphaea candida to an Euro-Siberic climate with short-lasting summer conditions.

  11. Simultaneous minimizing monitor units and number of segments without leaf end abutment for segmental intensity modulated radiation therapy delivery

    International Nuclear Information System (INIS)

    Li Kaile; Dai Jianrong; Ma Lijun

    2004-01-01

    Leaf end abutment is seldom studied when delivering segmental intensity modulated radiation therapy (IMRT) fields. We developed an efficient leaf sequencing method to eliminate leaf end abutment for segmental IMRT delivery. Our method uses simple matrix and sorting operations to obtain a solution that simultaneously minimizes total monitor units and number of segments without leaf end abutment between segments. We implemented and demonstrated our method for multiple clinical cases. We compared the results of our method with the results from exhaustive search method. We found that our solution without leaf end abutment produced equivalent results to the unconstrained solutions in terms of minimum total monitor units and minimum number of leaf segments. We conclude that the leaf end abutment fields can be avoided without affecting the efficiency of segmental IMRT delivery. The major strength of our method is its simplicity and high computing speed. This potentially provides a useful means for generating segmental IMRT fields that require high spatial resolution or complex intensity distributions

  12. Evaluation of Methane from Sisal Leaf Residue and Palash Leaf Litter

    Science.gov (United States)

    Arisutha, S.; Baredar, P.; Deshpande, D. M.; Suresh, S.

    2014-12-01

    The aim of this study is to evaluate methane production from sisal leaf residue and palash leaf litter mixed with different bulky materials such as vegetable market waste, hostel kitchen waste and digested biogas slurry in a laboratory scale anaerobic reactor. The mixture was prepared with 1:1 proportion. Maximum methane content of 320 ml/day was observed in the case of sisal leaf residue mixed with vegetable market waste as the feed. Methane content was minimum (47 ml/day), when palash leaf litter was used as feed. This was due to the increased content of lignin and polyphenol in the feedstock which were of complex structure and did not get degraded directly by microorganisms. Sisal leaf residue mixtures also showed highest content of volatile fatty acids (VFAs) as compared to palash leaf litter mixtures. It was observed that VFA concentration in the digester first increased, reached maximum (when pH was minimum) and then decreased.

  13. Resistive vs. total power depositions by Alfven modes in pre-heated low aspect ratio tokamaks

    International Nuclear Information System (INIS)

    Cuperman, S.; Bruma, C.; Komoshvili, K.

    2004-01-01

    The power deposition of fast waves launched by a LFS located antenna in a pre-heated, strongly non-uniform low aspect ratio tokamak (START) is investigated. The rigorous computational results indicate a total power deposition by far larger than that predicted for Alfven continuum eigenmodes in cylindrical plasmas. For toroidal wave numbers |N| > 1, the resistive and total power depositions are almost equal. (author)

  14. CO2 and temperature effects on leaf area production in two annual plant species

    International Nuclear Information System (INIS)

    Ackerly, D.D.; Coleman, J.S.; Morse, S.R.; Bazzaz, F.A.

    1992-01-01

    The authors studied leaf area production in two annual plant species, Abutilon theophrasti and Amaranthus retroflexus, under three day/night temperature regimes and two concentrations of carbon dioxide. The production of whole-plant leaf area during the first 30 d of growth was analyzed in terms of the leaf initiation rate, leaf expansion, individual leaf area, and, in Amaranthus, production of branch leaves. Temperature and CO 2 influenced leaf area production through effects on the rate of development, determined by the production of nodes on the main stem, and through shifts in the relationship between whole-plant leaf area and the number of main stem nodes. In Abutilon, leaf initiation rate was highest at 38 degree, but area of individual leaves was greatest at 28 degree. Total leaf area was greatly reduced at 18 degree due to slow leaf initiation rates. Elevated CO 2 concentration increased leaf initiation rate at 28 degree, resulting in an increase in whole-part leaf area. In Amaranthus, leaf initiation rate increased with temperature, and was increased by elevated CO 2 at 28 degree. Individual leaf area was greatest at 28 degree, and was increased by elevated CO 2 at 28 degree but decreased at 38 degree. Branch leaf area displayed a similar response to CO 2 , butt was greater at 38 degree. Overall, wholeplant leaf area was slightly increased at 38 degree relative to 28 degree, and elevated CO 2 levels resulted in increased leaf area at 28 degree but decreased leaf area at 38 degree

  15. ‘Breath figures’ on leaf surfaces – formation and effects of microscopic leaf wetness

    Directory of Open Access Journals (Sweden)

    Jürgen eBurkhardt

    2013-10-01

    Full Text Available ‘Microscopic leaf wetness’ means minute amounts of persistent liquid water on leaf surfaces which are invisible to the naked eye. The water is mainly maintained by transpired water vapor condensing onto the leaf surface and to attached leaf surface particles. With an estimated average thickness of less than 1 µm, microscopic leaf wetness it is about 2 orders of magnitude thinner than morning dewfall. The most important physical processes which reduce the saturation vapor pressure and promote condensation are cuticular absorption and the deliquescence of hygroscopic leaf surface particles. Deliquescent salts form highly concentrated solutions. Depending on the amount and concentration of the dissolved ions, the physicochemical properties of microscopic leaf wetness can be considerably different from those of pure water. Microscopic leaf wetness can form continuous thin layers on hydrophobic leaf surfaces and in specific cases can act similar to surfactants, enabling a strong potential influence on the foliar exchange of ions. Microscopic leaf wetness can also enhance the dissolution, the emission, and the reaction of specific atmospheric trace gases e.g. ammonia, SO2, or ozone, leading to a strong potential role for microscopic leaf wetness in plant/atmosphere interaction. Due to its difficult detection, there is little knowledge about the occurrence and the properties of microscopic leaf wetness. However, based on the existing evidence and on physicochemical reasoning it can be hypothesized that microscopic leaf wetness occurs on almost any plant worldwide and often permanently, and that it significantly influences the exchange processes of the leaf surface with its neighboring compartments, i.e., the plant interior and the atmosphere. The omission of microscopic water in general leaf wetness concepts has caused far-reaching, misleading conclusions in the past.

  16. Nutritional evaluation of bitter leaf meal ( Vernonia amygdalina ...

    African Journals Online (AJOL)

    Nutritional evaluation of bitter leaf meal ( Vernonia amygdalina ): effects on ... A total of 72 one-day-old broiler chicks of Abor-acre breed were used for the trial and ... reduced the level of cholesterol, triglyceride, glucose, low density lipoprotein, ...

  17. Antimalarial activity of methanolic leaf extract of Piper betle L.

    Science.gov (United States)

    Al-Adhroey, Abdulelah H; Nor, Zurainee M; Al-Mekhlafi, Hesham M; Amran, Adel A; Mahmud, Rohela

    2010-12-28

    The need for new compounds active against malaria parasites is made more urgent by the rapid spread of drug-resistance to available antimalarial drugs. The crude methanol extract of Piper betle leaves (50-400 mg/kg) was investigated for its antimalarial activity against Plasmodium berghei (NK65) during early and established infections. The phytochemical and antioxidant potentials of the crude extract were evaluated to elucidate the possibilities of its antimalarial effects. The safety of the extract was also investigated in ICR mice of both sexes by the acute oral toxicity limit test. The leaf extract demonstrated significant (P Piper betle leaves is toxicologically safe by oral administration. The results suggest that the Malaysian folklorical medicinal application of the extract of Piper betle leaf has a pharmacological basis.

  18. Leaf Morphological Characters Can Be a Factor for Intra-Varietal Preference of Whitefly Bemisia tabaci (Hemiptera: Aleyrodidae among Eggplant Varieties.

    Directory of Open Access Journals (Sweden)

    Abu Tayeb Mohammad Hasanuzzaman

    Full Text Available The sweetpotato whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae MEAM1, is considered a serious pest of horticultural and many other crops. While eggplant (Solanum melongena is one of the most favored host plants, the whiteflies exhibit preferences among different varieties. We hypothesized that certain morphological leaf characteristics of different varieties, like leaf trichome density, trichome length, leaf lamina thickness and leaf color, may affect whitefly landing, feeding and oviposition. In this study, we investigated the variation in leaf morphological characters among selected eggplant varieties and evaluated the effect of these leaf characteristics in rendering eggplant varieties either susceptible or resistant to B. tabaci. We evaluated eight eggplant varieties in choice feeding tests, and we found that the varieties JinSheng Zilongchangqie (JSZ and H149 were the highly preferred varieties with the highest numbers of whitefly adults and eggs. Significantly lower numbers of whitefly adult eggs were found on the resistant variety Tuo Lu Bamu (TLB. The varieties JinGuangbo Luqie (JGL, JinGuangbo Ziquanqie (JGZ, DaYang Ziguanqie (DYZ, QinXing Ziguanqie (QXZ, and QinXing Niuxinqie (QXN were moderately favored by B. tabaci. Leaf trichome density, trichome length and leaf lamina thickness were positively correlated with numbers of whitefly adults and eggs. B. tabaci was less attracted to the leaves that reflect long and middle wavelength light (higher R and G values than to the bright green leaves (medium G value, but the short wavelength light (higher B value had no significant effect on whitefly preference. The degree of hue had a positive effect, and saturation and brightness had a negative effect on whitefly attraction.

  19. Phytochemical analysis and gastroprotective activity of an olive leaf extract

    Directory of Open Access Journals (Sweden)

    IVANA ARSIĆ

    2009-04-01

    Full Text Available Some medicinal features of olive leaf have been known for centuries. It has been traditionally used as an antimicrobial and to prevent and treat diabetes mellitus and heart disease. Whether olive leaf, a natural antioxidant, influences the gastric defense mechanism and exhibits gastroprotection against experimentally-induced gastric lesions remains unknown. In this study, the content of total phenols, total flavonoids and tannins in olive leaf extract (OLE were determined. Seven phenolic compounds were identified and quantified (oleuropein, caffeic acid, luteolin, luteolin-7-O-glucoside, apigenin-7-O-glucoside, quercetin, and chryseriol. Furthermore, the protective activity of the OLE in gastric mucosal injury induced by a corrosive concentration of ethanol was investigated. In relation to the control group, pretreatment with OLE (40, 80 and 120 mg kg-1 significantly (p < 0.001 attenuated the gastric lesions induced by absolute ethanol. The protective effect of the OLE was similar to that obtained with a reference drug, ranitidine. The results obtained indicate that OLE possesses significant gastroprotective activity, and that the presence of compounds with antioxidative properties would probably explain this effect.

  20. Effect of subchronic administration of ethanolic leaf extract of croton ...

    African Journals Online (AJOL)

    The biochemical effcts of ethanolic leaf extract of Croton zambesicus on serum alkaline phosphatase(SAP),aspartate aminotransferase (AST) ,alanine aminotransferase(ALT),serum total protein and albumin were studied.The levels of these enzymes and that of total protein and albumin in the extract treated rats were not ...

  1. Discovering Host Genes Involved in the Infection by the Tomato Yellow Leaf Curl Virus Complex and in the Establishment of Resistance to the Virus Using Tobacco Rattle Virus-based Post Transcriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Rosa Lozano-Durán

    2013-03-01

    Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the

  2. Assessment of hepatoprotective role of Eucalyptus tereticornis leaf extract in Rattus norvegicus after vanadium intoxication

    International Nuclear Information System (INIS)

    Saxena, Prabhu N.; Shukla, Aparna; Saxena, Nishi; Arya, Jyoti

    2010-01-01

    The protective effect of Eucalyptus tereticornis leaf extract and its potency has been compared with Liv.52 following V 2 O 5 , induced hepatotoxicity in albino rats. LD 50 estimated for V 2 O 5 , was 69.6 mg/kg b.wt. The administered doses of V 2 O 5 , were LD 50 /10 th for acute and 1/7 th , 1/14 th and 1/21 th of sublethal dose for subacute (7, 14 and 21 ds) respectively. Body weight, liver weight and hepatosomatic index were assessed. Hepatotoxicity was assessed in terms of hepatic total proteins, total lipids and total cholesterol. V 2 O 5 intoxication significantly increased liver weight, hepatosomatic index, total lipids and total cholesterol, while significantly decreased body weight and total proteins. Pretreatment with dose of 100 mg/kg b.wt of Eucalyptus tereticornis leaf extract and 0.125 ml/kg b.wt. of Liv.52 syrup restored the increased liver weight, hepatosomatic index, total lipids and total cholesterol and decreased parameters like body weight and total proteins toward normalcy. The results reveal that Eucalyptus tereticornis leaf extract modulates V 2 O 5 toxicity like well known hepatoprotectant, however the modulation is less than Liv.52. (author)

  3. Antimalarial Activity of Methanolic Leaf Extract of Piper betle L.

    Directory of Open Access Journals (Sweden)

    Adel A. Amran

    2010-12-01

    Full Text Available The need for new compounds active against malaria parasites is made more urgent by the rapid spread of drug-resistance to available antimalarial drugs. The crude methanol extract of Piper betle leaves (50–400 mg/kg was investigated for its antimalarial activity against Plasmodium berghei (NK65 during early and established infections. The phytochemical and antioxidant potentials of the crude extract were evaluated to elucidate the possibilities of its antimalarial effects. The safety of the extract was also investigated in ICR mice of both sexes by the acute oral toxicity limit test. The leaf extract demonstrated significant (P < 0.05 schizonticidal activity in all three antimalarial evaluation models. Phytochemical screening showed that the leaf extract contains some vital antiplasmodial chemical constituents. The extract also exhibited a potent ability to scavenge the free radicals. The results of acute toxicity showed that the methanol extract of Piper betle leaves is toxicologically safe by oral administration. The results suggest that the Malaysian folklorical medicinal application of the extract of Piper betle leaf has a pharmacological basis.

  4. Mango leaf gall formation: varietal susceptibility and within tree distribution

    International Nuclear Information System (INIS)

    Khan, H.A.; Akram, W.; Khan, M.A.

    2012-01-01

    The present study was carried out to screen most commonly cultivated mango, Mangifera indica L., cultivars for their susceptibility to gall formation. Sarooli cultivar proved to be the most resistant one by having a minimum number of galls per 100 leaves. The abundance of galls in four quadrants of the tree i.e., east, west, north and south, was also studied which revealed that east quadrant had maximum number of galls while the abundance of galls in the remaining quadrants was variable. Gall formation on mango leaves seemed to increase gradually with increasing height from the ground level, reached a maximum at the height 12 ft to 16 ft and then declined. Leaf area measurements and nutrient analysis of the leaves were also done to see their impact on gall formation. Correlation analysis revealed that gall formation was positively linked with leaf area and the amount of Zn (ppm), P (%), K (%) while N (%) had negative correlation (P<0.05) with gall formation. In conclusion, the findings of the present study could be helpful in the management of mango leaf gall formation. (author)

  5. Influence of spectral properties on cassava leaf development and ...

    African Journals Online (AJOL)

    sunny t

    2014-02-12

    Feb 12, 2014 ... changes in leaf spectral characteristics were studied using Digimizer ... main wavelengths used by plants (blue, green and red) with the blue being the most preferred. Total ...... differences observed allude to plant behavior.

  6. Summer freezing resistance: a critical filter for plant community assemblies in Mediterranean high mountains

    Directory of Open Access Journals (Sweden)

    David Sánchez Pescador

    2016-02-01

    Full Text Available Assessing freezing community response and whether freezing resistance is related to other functional traits is essential for understanding alpine community assemblages, particularly in Mediterranean environments where plants are exposed to freezing temperatures and summer droughts. Thus, we characterized the leaf freezing resistance of 42 plant species in 38 plots at Sierra de Guadarrama (Spain by measuring their ice nucleation temperature, freezing point (FP, and low-temperature damage (LT50, as well as determining their freezing resistance mechanisms (i.e., tolerance or avoidance. The community response to freezing was estimated for each plot as community weighted means (CWMs and functional diversity, and we assessed their relative importance with altitude. We established the relationships between freezing resistance, growth forms, and four key plant functional traits (i.e., plant height, specific leaf area, leaf dry matter content, and seed mass. There was a wide range of freezing resistance responses and more than in other alpine habitats. At the community level, the CWMs of FP and LT50 responded negatively to altitude, whereas the functional diversity of both traits increased with altitude. The proportion of freezing-tolerant species also increased with altitude. The ranges of FP and LT50 varied among growth forms, and only the leaf dry matter content correlated negatively with freezing-resistance traits. Summer freezing events represent important abiotic filters for assemblies of Mediterranean high mountain communities, as suggested by the CWMs. However, a concomitant summer drought constraint may also explain the high freezing resistance of species that thrive in these areas and the lower functional diversity of freezing resistance traits at lower altitudes. Leaves with high dry matter contents may maintain turgor at lower water potential and enhance drought tolerance in parallel to freezing resistance. This adaptation to drought seems to

  7. Coordination of leaf and stem water transport properties in tropical forest trees

    Science.gov (United States)

    Frederick C. Meinzer; David R. Woodruff; Jean-Christophe Domec; Guillermo Goldstein; Paula I. Campanello; Genoveva M. Gatti; Randol Villalobos-Vega

    2008-01-01

    Stomatal regulation of transpiration constrains leaf water potential (ψ l) within species-specific ranges that presumably avoid excessive tension and embolism in the stem xylem upstream. However, the hydraulic resistance of leaves can be highly variable over short time scales, uncoupling tension in the xylem of leaves from that in the...

  8. Supplementation of Red Betel Leaf (Piper crocatum in Dairy Cattle Feed on Fermentation Characteristics by in Vitro

    Directory of Open Access Journals (Sweden)

    Caribu Hadi Prayitno

    2016-05-01

    Full Text Available The aim of this study was to assess the impact and efficiency of red betel leaf’s extract supplementation in the diet of dairy cattle on fermentation characteristics by in vitro.  The research method was experiment by using completely randomized design.  The treatments that were tested were R1: basal feed, R2:  R1 + 15 ppm of  red betel  leaf (Piper crocatum extract, R3: R1 + 30 ppm of  red betel leaf (Piper crocatum extract, R4: R1 + 45 ppm of red betel leaf (Piper crocatum extract, R5: R1 + 60 ppm of red betel leaf (Piper crocatum extract. The parameters measured in this study were (1Dry MatterDigestibility (DMD,(2Organic Matter Digestibility (OMD  (3 total gas production  (4 methane production (CH4 and (5  total Volatille Fatty Acid (VFA.  The data were analyzed using analysis of variance followed Orthogonal Polynomial Test.The results showed that the suplementation red batel extract in the diet of dairy cow was significant (P < 0.01 on DMD, OMD, total gas production, methane production (CH4  and total VFA.Orthogonal Polynomial test showed the effect of treatment on Dry MatterDigestibility (DMD, total gas and CH4 gas production were in the form of cubic curve, as well as Organic Matter Digestibility (OMD and Volatille Fatty Acid (VFA in the form of quadrate curvewith supplementation of red betel leaf.

  9. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  10. Plant traits and environment: floating leaf blade production and turnover of waterlilies

    Directory of Open Access Journals (Sweden)

    Peter F. Klok

    2017-04-01

    Full Text Available Floating leaf blades of waterlilies fulfill several functions in wetland ecosystems by production, decomposition and turnover as well as exchange processes. Production and turnover rates of floating leaf blades of three waterlily species, Nuphar lutea (L. Sm., Nymphaea alba L. and Nymphaea candida Presl, were studied in three freshwater bodies, differing in trophic status, pH and alkalinity. Length and percentages of leaf loss of marked leaf blades were measured weekly during the growing season. Area and biomass were calculated based on leaf length and were used to calculate the turnover rate of floating leaf blades. Seasonal changes in floating leaf production showed that values decreased in the order: Nymphaea alba, Nuphar lutea, Nymphaea candida. The highest production was reached for Nuphar lutea and Nymphaea alba in alkaline, eutrophic water bodies. The production per leaf was relatively high for both species in the acid water body. Nymphaea candida showed a very short vegetation period and low turnover rates. The ratio Total potential leaf biomass/Maximum potential leaf biomass (P/Bmax of the three species ranged from 1.35–2.25. The ratio Vegetation period (Period with floating leaves/Mean leaf life span ranged from 2.94–4.63, the ratio Growth period (Period with appearance of new floating leaves/Vegetation period from 0.53–0.73. The clear differences between Nymphaea candida versus Nuphar lutea and Nymphaea alba, may be due to adaptations of Nymphaea candida to an Euro-Siberic climate with short-lasting summer conditions.

  11. Effects of combination of leaf resources on competition in container mosquito larvae.

    Science.gov (United States)

    Reiskind, M H; Zarrabi, A A; Lounibos, L P

    2012-08-01

    Resource diversity is critical to fitness in many insect species, and may determine the coexistence of competitive species and the function of ecosystems. Plant material provides the nutritional base for numerous aquatic systems, yet the consequences of diversity of plant material have not been studied in aquatic container systems important for the production of mosquitoes. To address how diversity in leaf detritus affects container-inhabiting mosquitoes, we examined how leaf species affect competition between two container inhabiting mosquito larvae, Aedes aegypti and Aedes albopictus, that co-occur in many parts of the world. We tested the hypotheses that leaf species changes the outcome of intra- and interspecific competition between these mosquito species, and that combinations of leaf species affect competition in a manner not predictable based upon the response to each leaf species alone (i.e. the response to leaf combinations is non-additive). We find support for our first hypothesis that leaf species can affect competition, evidence that, in general, leaf combination alters competitive interactions, and no support that leaf combination impacts interspecific competition differently than intraspecific competition. We conclude that combinations of leaves increase mosquito production non-additively such that combinations of leaves act synergistically, in general, and result in higher total yield of adult mosquitoes in most cases, although certain leaf combinations for A. albopictus are antagonistic. We also conclude that leaf diversity does not have a different effect on interspecific competition between A. aegypti and A. albopictus, relative to intraspecific competition for each mosquito.

  12. A review on threat of gray leaf spot disease of maize in Asia

    Directory of Open Access Journals (Sweden)

    Narayan Bahadur Dhami

    2015-12-01

    Full Text Available Biotic and biotic constraints are yield limiting factors in maize producing regions. Among these gray leaf spot is a yield limiting foliar disease of maize in high land regions of Asia. This review is done from related different national and international journals, thesis, books, research papers etc. The objectives of this review are to become familiar with genetics and inheritance, epidemiology, symptoms and disease management strategies etc. High relative humidity, temperature, minimum tillage and maize monoculture are important factors responsible for disease development. The sibling species of Cercospora zeae-maydis (Tehon and Daniels, 1925 Group I and Group II and Cercospora sorghai var. maydis (Chupp, 1954 are associated with this disease. Pathogens colonize in maize debris. Conidia are the source of inoculums for disease spread. Severe blighting of leaves reduces sugars, stalk lodging and causes premature death of plants resulting in yield losses of up to 100%. Disease management through cultural practices is provisional. The use of fungicides for emergencies is effective however; their prohibitive cost and detrimental effects on the environment are negative consequences. The inheritance of tolerance is quantitative with small additive effects. The introgression of resistant genes among the crosses of resistant germplasm enhances the resistance. The crosses of resistant and susceptible germplasm possess greater stability than the crosses of susceptible and resistant germplasm. The development of gray leaf spot tolerant populations through tolerance breeding principle is an economical and sustainable approach to manage the disease.

  13. Effect of Addition of Moringa Leaf By-Product (Leaf-Waste) on ...

    African Journals Online (AJOL)

    The effects of incorporation of Moringa leaf fibre (a by-product of leaf processing which contains 24% Crude Fibre by dry weight at 0, 5 and 10 % substitution of wheat flour in cookies was investigated. Three products containing wheat flour: Moringa leaf fibre ratios of 100:0, 95:5, and 90:10 respectively were prepared, and a ...

  14. Age-related Resistance and the Defense Signaling Pathway of Ph-3 Gene Against Phytophthora infestans in Tomatoes

    Directory of Open Access Journals (Sweden)

    Sayed Rashad Ali Shah

    2015-09-01

    Full Text Available Resistance (R genes against plant pathogens often have age-related resistance (ARR effects. However, the mechanism involved in this phenomenon remains unknown. In this paper, Solanum lycopersicum ‘CLN2037B’ and S. pimpinellifolium ‘L3708’ harboring the Ph-3 gene, as well as S. habrochaites ‘LA2099’, ‘LA1777’ and ‘LA1033’ harboring quantitative trait loci (QTLs, were tested to investigate age-related resistance against late blight (LB; caused by Phytophthora infestans in the three-leaf stage of the plants. The results demonstrated that the QTL-related LB resistance showed the same age-related resistance as the Ph-3-mediated resistance at the six- and nine-leaf stages compared with the three-leaf stage. This indicated that there is a common defense mechanism in tomatoes against P. infestans via ARR. In addition, we combined ethylene (ET, salicylic acid (SA and jasmonic acid (JA mutants with virus-induced gene silencing (VIGS to study the Ph-3-dependent resistance signaling pathway. The results showed that ethylene and salicylic acid, but not jasmonic acid, are involved in the LB resistance mediated by the Ph-3 gene.

  15. Global variability in leaf respiration in relation to climate and leaf traits

    Science.gov (United States)

    Atkin, Owen K.

    2015-04-01

    Leaf respiration plays a vital role in regulating ecosystem functioning and the Earth's climate. Because of this, it is imperative that that Earth-system, climate and ecosystem-level models be able to accurately predict variations in rates of leaf respiration. In the field of photosynthesis research, the F/vC/B model has enabled modellers to accurately predict variations in photosynthesis through time and space. By contrast, we lack an equivalent biochemical model to predict variations in leaf respiration. Consequently, we need to rely on phenomenological approaches to model variations in respiration across the Earth's surface. Such approaches require that we develop a thorough understanding of how rates of respiration vary among species and whether global environmental gradients play a role in determining variations in leaf respiration. Dealing with these issues requires that data sets be assembled on rates of leaf respiration in biomes across the Earth's surface. In this talk, I will use a newly-assembled global database on leaf respiration and associated traits (including photosynthesis) to highlight variation in leaf respiration (and the balance between respiration and photosynthesis) across global gradients in growth temperature and aridity.

  16. Performance of cotton leaf curl virus resistant intrahirsutum f/sub 1/ hybrids

    International Nuclear Information System (INIS)

    Baloch, M.J.

    2004-01-01

    The first and foremost effort to combat the devastating cotton leaf curl virus (clcv) disease would be to utilize those clcv resistant germplasm in a hybridization programme which can enhance the possibilities of selecting desirable progenies from segregating populations. In this connection, 16 clcv intrahirsutum F1 hybrids were developed and evaluated for their performance. The hybrids, on an average gave an increase of 26.02 % in seed cotton yield; 11.52 % in bolls per plant; 14.23 % in boll weight; 4.28 % in lint; 3.89 % in fibre length and 8.21 % in earliness against the average of parents. However, among the hybrids, the top three scoring for yield were, BH.121 x Cyto.9/91, Cyto.9/91 x CRIS-226 and VH-137 x CRIS-226. The number of bolls per plant was found to be a major contributing factor for increased yield because the hybrids which set higher bolls correspondingly gave higher yields. Boll weight was not regarded as an important attribute to increase yield because hybrids with moderate boll sizes were among the top three high yielders. For lint %, the hybrids CRIS-129 x LRA-5166 and FH-901 x VH-137 were first for fibre length, whereas CRIS-121 x Cyto.51 and BH-124 x CIM-448 were among the top two rankers. Regarding earliness, the hybrids CRIS-121 x Cyto. 51 gave the highest boll opening percent and next in order was the hybrid VH-137 x DNH-49. Our results thus generally suggest that although the best three hybrids were desirable for other traits, the choice of the hybrids may be made on the priority for characters to be bred. (author)

  17. Effect of nitrogen supply on leaf appearance, leaf growth, leaf nitrogen economy and photosynthetic capacity in maize (Zea mays L.)

    NARCIS (Netherlands)

    Vos, J.; Putten, van der P.E.L.; Birch, C.J.

    2005-01-01

    Leaf area growth and nitrogen concentration per unit leaf area, Na (g m-2 N) are two options plants can use to adapt to nitrogen limitation. Previous work indicated that potato (Solanum tuberosum L.) adapts the size of leaves to maintain Na and photosynthetic capacity per unit leaf area. This paper

  18. Coordination of Leaf Photosynthesis, Transpiration, and Structural Traits in Rice and Wild Relatives (Genus Oryza).

    Science.gov (United States)

    Giuliani, Rita; Koteyeva, Nuria; Voznesenskaya, Elena; Evans, Marc A; Cousins, Asaph B; Edwards, Gerald E

    2013-07-01

    The genus Oryza, which includes rice (Oryza sativa and Oryza glaberrima) and wild relatives, is a useful genus to study leaf properties in order to identify structural features that control CO(2) access to chloroplasts, photosynthesis, water use efficiency, and drought tolerance. Traits, 26 structural and 17 functional, associated with photosynthesis and transpiration were quantified on 24 accessions (representatives of 17 species and eight genomes). Hypotheses of associations within, and between, structure, photosynthesis, and transpiration were tested. Two main clusters of positively interrelated leaf traits were identified: in the first cluster were structural features, leaf thickness (Thick(leaf)), mesophyll (M) cell surface area exposed to intercellular air space per unit of leaf surface area (S(mes)), and M cell size; a second group included functional traits, net photosynthetic rate, transpiration rate, M conductance to CO(2) diffusion (g(m)), stomatal conductance to gas diffusion (g(s)), and the g(m)/g(s) ratio.While net photosynthetic rate was positively correlated with gm, neither was significantly linked with any individual structural traits. The results suggest that changes in gm depend on covariations of multiple leaf (S(mes)) and M cell (including cell wall thickness) structural traits. There was an inverse relationship between Thick(leaf) and transpiration rate and a significant positive association between Thick(leaf) and leaf transpiration efficiency. Interestingly, high g(m) together with high g(m)/g(s) and a low S(mes)/g(m) ratio (M resistance to CO(2) diffusion per unit of cell surface area exposed to intercellular air space) appear to be ideal for supporting leaf photosynthesis while preserving water; in addition, thick M cell walls may be beneficial for plant drought tolerance.

  19. SU-F-T-350: Continuous Leaf Optimization (CLO) for IMRT Leaf Sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Long, T; Chen, M; Jiang, S; Lu, W [UT Southwestern Medical Center, Dallas, TX (United States)

    2016-06-15

    Purpose: To study a new step-and-shoot IMRT leaf sequencing model that avoids the two main pitfalls of conventional leaf sequencing: (1) target fluence being stratified into a fixed number of discrete levels and/or (2) aperture leaf positions being restricted to a discrete set of locations. These assumptions induce error into the sequence or reduce the feasible region of potential plans, respectively. Methods: We develop a one-dimensional (single leaf pair) methodology that does not make assumptions (1) or (2) that can be easily extended to a multi-row model. The proposed continuous leaf optimization (CLO) methodology takes in an existing set of apertures and associated intensities, or solution “seed,” and improves the plan without the restrictiveness of 1or (2). It then uses a first-order descent algorithm to converge onto a locally optimal solution. A seed solution can come from models that assume (1) and (2), thus allowing the CLO model to improve upon existing leaf sequencing methodologies. Results: The CLO model was applied to 208 generated target fluence maps in one dimension. In all cases for all tested sequencing strategies, the CLO model made improvements on the starting seed objective function. The CLO model also was able to keep MUs low. Conclusion: The CLO model can improve upon existing leaf sequencing methods by avoiding the restrictions of (1) and (2). By allowing for more flexible leaf positioning, error can be reduced when matching some target fluence. This study lays the foundation for future models and solution methodologies that can incorporate continuous leaf positions explicitly into the IMRT treatment planning model. Supported by Cancer Prevention & Research Institute of Texas (CPRIT) - ID RP150485.

  20. Evaluation of banana hybrids for tolerance to black leaf streak (Mycosphaerella fijiensis Morelet) in Puerto Rico

    Science.gov (United States)

    In Puerto Rico, bananas (including plantains) are important agricultural commodities; their combined production totaled 133,500 tons in 2008. Black leaf streak (BLS) and Sigatoka leaf spot diseases, caused by Mycosphaerella fijiensis and M. musicola, respectively, are responsible for significant los...

  1. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology.

    Directory of Open Access Journals (Sweden)

    Feng Qin

    Full Text Available Common leaf spot (caused by Pseudopeziza medicaginis, rust (caused by Uromyces striatus, Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana and Cercospora leaf spot (caused by Cercospora medicaginis are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis. After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection, disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features was the optimal model. For this SVM model, the

  2. Identification of Alfalfa Leaf Diseases Using Image Recognition Technology

    Science.gov (United States)

    Qin, Feng; Liu, Dongxia; Sun, Bingda; Ruan, Liu; Ma, Zhanhong; Wang, Haiguang

    2016-01-01

    Common leaf spot (caused by Pseudopeziza medicaginis), rust (caused by Uromyces striatus), Leptosphaerulina leaf spot (caused by Leptosphaerulina briosiana) and Cercospora leaf spot (caused by Cercospora medicaginis) are the four common types of alfalfa leaf diseases. Timely and accurate diagnoses of these diseases are critical for disease management, alfalfa quality control and the healthy development of the alfalfa industry. In this study, the identification and diagnosis of the four types of alfalfa leaf diseases were investigated using pattern recognition algorithms based on image-processing technology. A sub-image with one or multiple typical lesions was obtained by artificial cutting from each acquired digital disease image. Then the sub-images were segmented using twelve lesion segmentation methods integrated with clustering algorithms (including K_means clustering, fuzzy C-means clustering and K_median clustering) and supervised classification algorithms (including logistic regression analysis, Naive Bayes algorithm, classification and regression tree, and linear discriminant analysis). After a comprehensive comparison, the segmentation method integrating the K_median clustering algorithm and linear discriminant analysis was chosen to obtain lesion images. After the lesion segmentation using this method, a total of 129 texture, color and shape features were extracted from the lesion images. Based on the features selected using three methods (ReliefF, 1R and correlation-based feature selection), disease recognition models were built using three supervised learning methods, including the random forest, support vector machine (SVM) and K-nearest neighbor methods. A comparison of the recognition results of the models was conducted. The results showed that when the ReliefF method was used for feature selection, the SVM model built with the most important 45 features (selected from a total of 129 features) was the optimal model. For this SVM model, the

  3. Tolerance of Glyphosate-Resistant Maize to Glyphosate Plus MCPA Amine Is Influenced by Dose and Timing

    Directory of Open Access Journals (Sweden)

    Nader Soltani

    2015-01-01

    Full Text Available There is little information on tolerance of glyphosate-resistant maize to glyphosate plus MCPA amine as influenced by dose and timing under Ontario environmental conditions. A total of seven field trials were conducted at various locations in Ontario, Canada, in 2011–2013 to evaluate tolerance of field maize to tank mixes of glyphosate (900 g a.e./ha plus MCPA amine (79, 158, 315, 630, 1260, 2520, or 5040 g a.e./ha at either the 4- or 8-leaf stage. The predicted dose of MCPA amine that caused 5, 10, and 20% injury was 339, 751, and 1914 g a.e./ha when applied to 4-leaf maize but only 64, 140, and 344 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% reduction in shoot dry weight of maize was 488, 844, and 1971 g a.e./ha when applied to 4-leaf maize and only 14, 136, and 616 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% yield reduction was 2557, 4247, and >5040 g a.e./ha when applied to 4-leaf maize and 184, 441, and 1245 g a.e./ha when applied to 8-leaf maize, respectively. Based on these results, glyphosate plus MCPA amine applied at the manufacturer’s recommended dose of 630 g a.e./ha applied to 4-leaf maize has potential to cause injury but the injury is transient with no significant reduction in yield. However, when glyphosate plus MCPA amine is applied to 8-leaf maize it has the potential to cause significant injury and yield loss in maize.

  4. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    Science.gov (United States)

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  5. Effect of progressive drought stress on growth, leaf gas exchange, and antioxidant production in two maize cultivars.

    Science.gov (United States)

    Anjum, Shakeel Ahmad; Tanveer, Mohsin; Ashraf, Umair; Hussain, Saddam; Shahzad, Babar; Khan, Imran; Wang, Longchang

    2016-09-01

    Drought stress is one of the major environmental factors responsible for reduction in crop productivity. In the present study, responses of two maize cultivars (Rung Nong 35 and Dong Dan 80) were examined to explicate the growth, yield, leaf gas exchange, leaf water contents, osmolyte accumulation, membrane lipid peroxidation, and antioxidant activity under progressive drought stress. Maize cultivars were subjected to varying field capacities (FC) viz., well-watered (80 % FC) and drought-stressed (35 % FC) at 45 days after sowing. The effects of drought stress were analyzed at 5, 10, 15, 20, ad 25 days after drought stress (DAS) imposition. Under prolonged drought stress, Rung Nong 35 exhibited higher reduction in growth and yield as compared to Dong Dan 80. Maize cultivar Dong Dan 80 showed higher leaf relative water content (RWC), free proline, and total carbohydrate accumulation than Run Nong 35. Malondialdehyde (MDA) and superoxide anion were increased with prolongation of drought stress, with higher rates in cultivar Run Nong 35 than cultivar Dong Dan 80. Higher production of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) and glutathione reductase (GR) resulted in improved growth and yield in Dong Dan 80. Overall, the cultivar Dong Dan 80 was better able to resist the detrimental effects of progressive drought stress as indicated by better growth and yield due to higher antioxidant enzymes, reduced lipid peroxidation, better accumulation of osmolytes, and maintenance of tissue water contents.

  6. Antimicrobial compounds from leaf extracts of Jatropha curcas, Psidium guajava, and Andrographis paniculata.

    Science.gov (United States)

    Rahman, M M; Ahmad, S H; Mohamed, M T M; Ab Rahman, M Z

    2014-01-01

    The present research was conducted to discover antimicrobial compounds in methanolic leaf extracts of Jatropha curcas and Andrographis paniculata and ethanolic leaf extract of Psidium guajava and the effectiveness against microbes on flower preservative solution of cut Mokara Red orchid flowers was evaluated. The leaves were analyzed using gas chromatography-mass spectrometry. A total of nine, 66, and 29 compounds were identified in J. curcas, P. guajava, and A. paniculata leaf extracts, with five (88.18%), four (34.66%), and three (50.47%) having unique antimicrobial compounds, respectively. The experimental design on vase life was conducted using a completely randomized design with 10 replications. The flower vase life was about 6 days in the solution containing the P. guajava and A. paniculata leaf extracts at 15 mg/L. Moreover, solution with leaf extracts of A. paniculata had the lowest bacterial count compared to P. guajava and J. curcas. Thus, these leaf extracts revealed the presence of relevant antimicrobial compounds. The leaf extracts have the potential as a cut flower solution to minimize microbial populations and extend flower vase life. However, the activities of specific antimicrobial compounds and double or triple combination leaf extracts to enhance the effectiveness to extend the vase life need to be tested.

  7. Evaluation of maize genotypes for Turcicum leaf blight (Exserohilum turcicum in Terai and inner terai of Nepal

    Directory of Open Access Journals (Sweden)

    Tirtha Raj Rijal

    2016-12-01

    Full Text Available Thirty maize genotypes in 2014-2015 at Dumarwana, Nijgadh, Keureni and Rampur and ten genotypes in 2015-2016 at Anandpur, Shitalnagar, Dumarwana, Nijgadh and Rampur were evaluated for resistance to Turcicum leaf blight (Exserohilum turcicum under farmers field conditions. The scale used for disease severity ranged from 1-5 scale based on the proportionate leaf area affected by the disease. The combined analysis over locations in 2014-2015 showed that among the 30 genotypes 25 genotypes were resistant (1.0-2.0 scale, and 5 genotypes were moderately resistant (2.1-3.0 scale. Similarly the pooled analysis over locations in 2015-2016 showed that 7 genotypes were resistant (1.0-2.0 scale and 3 genotypes were moderately resistant (2.1-3.0 scale. The maize genotypes namely Z376-26, Z478-3, Z433-99, Z464-5, Z478-2, Z466-1, CAH1513, RML-95/RML-96, CAH1515, CAH1521, CAH1515, CAH151, CAH153, ZH114228 , Z376-9, Z466-3, Z376-5, RML-32/RML-17, RML-86/RML-96 and 900MGold were resistant with disease severity scale of 1.5 and with higher grain yield in both the years. Thus above genotypes were identified as promising sources of resistance against E. turcicum and they can be used to develop disease resistant and high yielding varieties to enhance maize productivity in terai and inner terai of Nepal.

  8. Photosynthate partitioning in basal zones of tall fescue leaf blades

    International Nuclear Information System (INIS)

    Allard, G.; Nelson, C.J.

    1991-01-01

    Elongating grass leaves have successive zones of cell division, cell elongation, and cell maturation in the basal portion of the blade and are a strong sink for photosynthate. Our objective was to determine dry matter (DM) deposition and partitioning in basal zones of elongating tall fescue (Festuca arundinacea Schreb.) leaf blades. Vegetative tall fescue plants were grown in continuous light (350 micromoles per square meter per second photosynthetic photon flux density) to obtain a constant spatial distribution of elongation growth with time. Content and net deposition rates of water-soluble carbohydrates (WSC) and DM along elongating leaf blades were determined. These data were compared with accumulation of 14 C in the basal zones following leaf-labeling with 14 CO 2 . Net deposition of DM was highest in the active cell elongation zone, due mainly to deposition of WSC. The maturation zone, just distal to the elongation zone, accounted for 22% of total net deposition of DM in elongating leaves. However, the spatial profile of 14 C accumulation suggested that the elongation zone and the maturation zone were sinks of equal strength. WSC-free DM accounted for 55% of the total net DM deposition in elongating leaf blades, but only 10% of incoming 14 C-photosynthate accumulated in the water-insoluble fraction (WIF ∼ WSC-free DM) after 2 hours. In the maturation zone, more WSC was used for synthesis of WSC-free DM than was imported as recent photosynthate

  9. Effect of Wind on the Relation of Leaf N, P Stoichiometry with Leaf Morphology in Quercus Species

    Directory of Open Access Journals (Sweden)

    Peng Zhang

    2018-02-01

    Full Text Available Leaf nitrogen (N and phosphorus (P stoichiometry correlates closely to leaf morphology, which is strongly impacted by wind at multiple scales. However, it is not clear how leaf N, P stoichiometry and its relationship to leaf morphology changes with wind load. We determined the leaf N and P concentrations and leaf morphology—including specific leaf area (SLA and leaf dissection index (LDI—for eight Quercus species under a simulated wind load for seven months. Leaf N and P concentrations increased significantly under these conditions for Quercus acutissima, Quercus rubra, Quercus texana, and Quercus palustris—which have elliptic leaves—due to their higher N, P requirements and a resultant leaf biomass decrease, which is a tolerance strategy for Quercus species under a wind load. Leaf N:P was relatively stable under wind for all species, which supports stoichiometric homeostasis. Leaf N concentrations showed a positive correlation to SLA, leaf N and P concentrations showed positive correlations to LDI under each wind treatment, and the slope of correlations was not affected by wind, which indicates synchronous variations between leaf stoichiometry and leaf morphology under wind. However, the intercept of correlations was affected by wind, and leaf N and P use efficiency decreased under the wind load, which suggests that the Quercus species changes from “fast investment-return” in the control to “slow investment-return” under windy conditions. These results will be valuable to understanding functional strategies for plants under varying wind loads, especially synchronous variations in leaf traits along a wind gradient.

  10. Response Surface Optimized Extraction of Total Triterpene Acids ...

    African Journals Online (AJOL)

    Purpose: To optimize extraction of total triterpene acids from loquat leaf and evaluate their in vitro antioxidant activities. Methods: The independent variables were ethanol concentration, extraction time, and solvent ratio, while the dependent variable was content of total triterpene acids. Composite design and response ...

  11. Are leaf physiological traits related to leaf water isotopic enrichment in restinga woody species?

    Directory of Open Access Journals (Sweden)

    BRUNO H.P. ROSADO

    2013-09-01

    Full Text Available During plant-transpiration, water molecules having the lighter stable isotopes of oxygen and hydrogen evaporate and diffuse at a faster rate through the stomata than molecules having the heavier isotopes, which cause isotopic enrichment of leaf water. Although previous models have assumed that leaf water is well-mixed and isotopically uniform, non-uniform stomatal closure, promoting different enrichments between cells, and different pools of water within leaves, due to morpho-physiological traits, might lead to inaccuracies in isotopic models predicting leaf water enrichment. We evaluate the role of leaf morpho-physiological traits on leaf water isotopic enrichment in woody species occurring in a coastal vegetation of Brazil known as restinga. Hydrogen and oxygen stable isotope values of soil, plant stem and leaf water and leaf traits were measured in six species from restinga vegetation during a drought and a wet period. Leaf water isotopic enrichment relative to stem water was more homogeneous among species during the drought in contrast to the wet period suggesting convergent responses to deal to temporal heterogeneity in water availability. Average leaf water isotopic enrichment relative to stem water during the drought period was highly correlated with relative apoplastic water content. We discuss this observation in the context of current models of leaf water isotopic enrichment as a function of the Péclet effect. We suggest that future studies should include relative apoplastic water content in isotopic models.

  12. Are leaf physiological traits related to leaf water isotopic enrichment in restinga woody species?

    Science.gov (United States)

    Rosado, Bruno H P; De Mattos, Eduardo A; Sternberg, Leonel Da S L

    2013-09-01

    During plant-transpiration, water molecules having the lighter stable isotopes of oxygen and hydrogen evaporate and diffuse at a faster rate through the stomata than molecules having the heavier isotopes, which cause isotopic enrichment of leaf water. Although previous models have assumed that leaf water is well-mixed and isotopically uniform, non-uniform stomatal closure, promoting different enrichments between cells, and different pools of water within leaves, due to morpho-physiological traits, might lead to inaccuracies in isotopic models predicting leaf water enrichment. We evaluate the role of leaf morpho-physiological traits on leaf water isotopic enrichment in woody species occurring in a coastal vegetation of Brazil known as restinga. Hydrogen and oxygen stable isotope values of soil, plant stem and leaf water and leaf traits were measured in six species from restinga vegetation during a drought and a wet period. Leaf water isotopic enrichment relative to stem water was more homogeneous among species during the drought in contrast to the wet period suggesting convergent responses to deal to temporal heterogeneity in water availability. Average leaf water isotopic enrichment relative to stem water during the drought period was highly correlated with relative apoplastic water content. We discuss this observation in the context of current models of leaf water isotopic enrichment as a function of the Péclet effect. We suggest that future studies should include relative apoplastic water content in isotopic models.

  13. Tuning Transpiration by Interfacial Solar Absorber-Leaf Engineering.

    Science.gov (United States)

    Zhuang, Shendong; Zhou, Lin; Xu, Weichao; Xu, Ning; Hu, Xiaozhen; Li, Xiuqiang; Lv, Guangxin; Zheng, Qinghui; Zhu, Shining; Wang, Zhenlin; Zhu, Jia

    2018-02-01

    Plant transpiration, a process of water movement through a plant and its evaporation from aerial parts especially leaves, consumes a large component of the total continental precipitation (≈48%) and significantly influences global water distribution and climate. To date, various chemical and/or biological explorations have been made to tune the transpiration but with uncertain environmental risks. In recent years, interfacial solar steam/vapor generation is attracting a lot of attention for achieving high energy transfer efficiency. Various optical and thermal designs at the solar absorber-water interface for potential applications in water purification, seawater desalination, and power generation appear. In this work, the concept of interfacial solar vapor generation is extended to tunable plant transpiration by showing for the first time that the transpiration efficiency can also be enhanced or suppressed through engineering the solar absorber-leaf interface. By tuning the solar absorption of membrane in direct touch with green leaf, surface temperature of green leaf will change accordingly because of photothermal effect, thus the transpiration efficiency as well as temperature and relative humidity in the surrounding environment will be tuned. This tunable transpiration by interfacial absorber-leaf engineering can open an alternative avenue to regulate local atmospheric temperature, humidity, and eventually hydrologic cycle.

  14. Tuning Transpiration by Interfacial Solar Absorber‐Leaf Engineering

    Science.gov (United States)

    Zhuang, Shendong; Zhou, Lin; Xu, Weichao; Xu, Ning; Hu, Xiaozhen; Li, Xiuqiang; Lv, Guangxin; Zheng, Qinghui; Zhu, Shining

    2017-01-01

    Abstract Plant transpiration, a process of water movement through a plant and its evaporation from aerial parts especially leaves, consumes a large component of the total continental precipitation (≈48%) and significantly influences global water distribution and climate. To date, various chemical and/or biological explorations have been made to tune the transpiration but with uncertain environmental risks. In recent years, interfacial solar steam/vapor generation is attracting a lot of attention for achieving high energy transfer efficiency. Various optical and thermal designs at the solar absorber–water interface for potential applications in water purification, seawater desalination, and power generation appear. In this work, the concept of interfacial solar vapor generation is extended to tunable plant transpiration by showing for the first time that the transpiration efficiency can also be enhanced or suppressed through engineering the solar absorber–leaf interface. By tuning the solar absorption of membrane in direct touch with green leaf, surface temperature of green leaf will change accordingly because of photothermal effect, thus the transpiration efficiency as well as temperature and relative humidity in the surrounding environment will be tuned. This tunable transpiration by interfacial absorber‐leaf engineering can open an alternative avenue to regulate local atmospheric temperature, humidity, and eventually hydrologic cycle. PMID:29619300

  15. The disease prevalence and severity of Cercospora leaf spot in sugar beet cultivations in Kayseri

    Directory of Open Access Journals (Sweden)

    Hacer Handan ALTINOK

    2012-12-01

    Full Text Available Cercospora leaf spot disease (Cercospora beticola Sacc., is one of the most economically important fungal diseases in sugar beet growing. Under appropriate climatic conditions, the disease can reach epidemic levels. Although some fungicides exist for disease control, resistance development by pathogen against fungicides is creating difficulties. Besides, use of resistant varieties which is considered as the most efficient and environment-friendly method is adversely affected by pathogen’s ability to exhibit high genetic variations and varying resistance levels against different races of pathogen restricts the success of resistance breeding studies. In order to reveal status of this disease in Kayseri province, surveys were conducted in 2010 and 2011 in sugar beet growing areas and disease prevalence and severity were determined. Approximately, 1500 da area in 90 fields were examined and about 700 da of this area found as infected with Cercospora leaf spot disease in both years of the survey. Highest disease prevalence and severity were found as 80 % and 45 %, respectively, in Sarıoğlan district, which is followed by central district, Develi and Bünyan. Among surveyed districts, lowest prevalence and severity were detected as approx. 65 % and 35 %, respectively, in Yeşilhisar.

  16. Effect of root and leaf applications of soluble silicon on blast development in rice

    Directory of Open Access Journals (Sweden)

    Isaias Severino Cacique

    2013-01-01

    Full Text Available Blast, caused by Pyricularia oryzae, is the most important fungal disease of rice worldwide. This study aimed to compare root and foliar supply of soluble silicon (Si on rice resistance to blast. The application of soluble Si to the roots increased Si concentration in leaf tissues as compare to plants grown in soil amended with calcium silicate. There was no increase in leaf Si concentration after soluble Si spray, regardless if the leaves were washed or not before analysis. X-ray microanalysis revealed that Si deposition was very similar on the leaf epidermis of plants sprayed with soluble Si, root amended with soluble Si or grown in soil amended with calcium silicate. The lesion size, the number of lesions per cm² of leaf and the area under blast progress curve were reduced for rice plants grown in soil that received the application of soluble Si or was amended with calcium silicate. The results of this study showed that the supply of soluble Si to the roots or its spray onto to the rice leaves can decrease blast symptoms.

  17. How do leaf veins influence the worldwide leaf economic spectrum? Review and synthesis.

    Science.gov (United States)

    Sack, Lawren; Scoffoni, Christine; John, Grace P; Poorter, Hendrik; Mason, Chase M; Mendez-Alonzo, Rodrigo; Donovan, Lisa A

    2013-10-01

    Leaf vein traits are implicated in the determination of gas exchange rates and plant performance. These traits are increasingly considered as causal factors affecting the 'leaf economic spectrum' (LES), which includes the light-saturated rate of photosynthesis, dark respiration, foliar nitrogen concentration, leaf dry mass per area (LMA) and leaf longevity. This article reviews the support for two contrasting hypotheses regarding a key vein trait, vein length per unit leaf area (VLA). Recently, Blonder et al. (2011, 2013) proposed that vein traits, including VLA, can be described as the 'origin' of the LES by structurally determining LMA and leaf thickness, and thereby vein traits would predict LES traits according to specific equations. Careful re-examination of leaf anatomy, published datasets, and a newly compiled global database for diverse species did not support the 'vein origin' hypothesis, and moreover showed that the apparent power of those equations to predict LES traits arose from circularity. This review provides a 'flux trait network' hypothesis for the effects of vein traits on the LES and on plant performance, based on a synthesis of the previous literature. According to this hypothesis, VLA, while virtually independent of LMA, strongly influences hydraulic conductance, and thus stomatal conductance and photosynthetic rate. We also review (i) the specific physiological roles of VLA; (ii) the role of leaf major veins in influencing LES traits; and (iii) the role of VLA in determining photosynthetic rate per leaf dry mass and plant relative growth rate. A clear understanding of leaf vein traits provides a new perspective on plant function independently of the LES and can enhance the ability to explain and predict whole plant performance under dynamic conditions, with applications towards breeding improved crop varieties.

  18. Effect of Puccinia silphii on Yield Components and Leaf Physiology in Silphium integrifolium: Lessons for the Domestication of a Perennial Oilseed Crop

    Directory of Open Access Journals (Sweden)

    M. Kathryn Turner

    2018-03-01

    Full Text Available New crops with greater capacity for delivering ecosystem services are needed to increase agricultural sustainability. However, even in these crops, seed yield is usually the main criteria for grain domestication. This focus on yield can cause unintended structural and functional changes. Leaves of selected plants tend to be more vulnerable to infection, which can reduce performance, assimilates, and ultimately yield. Our objectives were to determine the impact of rust (caused by Puccinia silphii on yield and leaf function in selected Silphium integrifolium (Asteraceae plants. We tested the effect of a fungicide treatment on rust severity and yield, compared the rust infection of individuals in a population selected for yield, and related this to chemical changes at the leaf level. We also estimated heritability for rust resistance. We found that productivity indicators (head number and weight, leaf weight and leaf processes (photosynthetic capacity, water use efficiency were reduced when silphium leaves and stems were more heavily infected by P. silphii. Leaf resin content increased when susceptible plants were infected. Fungicide treatments were effective at reducing rust infection severity, but were ineffective at preventing yield losses. We propose that disease resistance should be included early in the selection process of new perennial crops.

  19. Effect of selected local medicinal plants on the asexual blood stage of chloroquine resistant Plasmodium falciparum.

    Science.gov (United States)

    Mohd Abd Razak, Mohd Ridzuan; Afzan, Adlin; Ali, Rosnani; Amir Jalaluddin, Nur Fasihah; Wasiman, Mohd Isa; Shiekh Zahari, Siti Habsah; Abdullah, Noor Rain; Ismail, Zakiah

    2014-12-15

    The development of resistant to current antimalarial drugs is a major challenge in achieving malaria elimination status in many countries. Therefore there is a need for new antimalarial drugs. Medicinal plants have always been the major source for the search of new antimalarial drugs. The aim of this study was to screen selected Malaysian medicinal plants for their antiplasmodial properties. Each part of the plants were processed, defatted by hexane and sequentially extracted with dichloromethane, methanol and water. The antiplasmodial activities of 54 plant extracts from 14 species were determined by Plasmodium falciparum Histidine Rich Protein II ELISA technique. In order to determine the selectivity index (SI), all plant extracts demonstrating a good antiplasmodial activity were tested for their cytotoxicity activity against normal Madin-Darby Bovine Kidney (MDBK) cell lines by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. Twenty three extracts derived from Curcuma zedoaria (rhizome), Curcuma aeruginosa (rhizome), Alpinia galanga (rhizome), Morinda elliptica (leaf), Curcuma mangga (rhizome), Elephantopus scaber (leaf), Vitex negundo (leaf), Brucea javanica (leaf, root and seed), Annona muricata (leaf), Cinnamomun iners (leaf) and Vernonia amygdalina (leaf) showed promising antiplasmodial activities against the blood stage chloroquine resistant P. falciparum (EC50 toxicity effect to MDBK cells in vitro (SI ≥10). The extracts belonging to eleven plant species were able to perturb the growth of chloroquine resistant P. falciparum effectively. The findings justified the bioassay guided fractionation on these plants for the search of potent antimalarial compounds or formulation of standardized extracts which may enhance the antimalarial effect in vitro and in vivo.

  20. A study on the stomata mutation of peanut leaves and its relationship with drought resistance

    International Nuclear Information System (INIS)

    Qiu Qingshu; Li Zhengchao; Hu Wenguang; Wu Lanrong

    1999-12-01

    Stomata mutation of leaves and its relationship with drought resistance were studied with four peanut mutants as well as original variety Baisha 1016. Results showed that irradiation was able to cause peanut leaf stoma to mutate. By comparing with original variety Baisha 1016, some of the mutants have more stomas, and some have less ones; some mutants have bigger stomas, some have smaller ones. The stomata numbers of peanut leaf have close relation to the drought resistance, while the stomata size seems to have no relation to it. It's possible that more drought-resistant variety or line could be elected among peanut mutants

  1. Azadirachta indica (neem) leaf dietary effects on the immunity response and disease resistance of Asian seabass, Lates calcarifer challenged with Vibrio harveyi.

    Science.gov (United States)

    Talpur, Allah Dad; Ikhwanuddin, Mhd

    2013-01-01

    The present study was aimed to address the possible evaluation of Azadirachta indica (neem) leaf-supplemented diets on innate immune response in Asian seabass, Lates calcarifer fingerlings against Vibrio harveyi infection. Fish were fed for two weeks diets containing six graded levels of neem leaf at 0 g, 1 g, 2 g, 3 g, 4 g and 5 g per kg feed. Fish fed neem leaf-supplemented diet displayed significant differences (p growth rate (SGR) and feed conversion ratio (FCR) compared to the control group fed without neem leaf-supplemented diet. Various innate immune parameters were examined pre-challenge and post-challenge. Fish was injected intraperitoneally with a lethal dose of V. harveyi containing 10(8) cells mL(-1). Supplementation of neem leaf diet significantly increased phagocytic activity, superoxide anion production, serum lysozyme, serum bactericidal activity, serum anti-protease activity throughout the experimental period when compared with the control group. Dietary doses of neem leaf diet significantly influenced the immune parameters, haematological parameters and blood biochemical indices of treated fish. The results suggested that fish fed neem leaf-supplemented diet improved the immune system and increased survival rate in L. calcarifer fingerlings against V. harveyi infection. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. An evolutionary perspective on leaf economics : Phylogenetics of leaf mass per area in vascular plants

    NARCIS (Netherlands)

    Flores, Olivier; Garnier, Eric; Wright, Ian J.; Reich, Peter B.; Pierce, Simon; Diaz, Sandra; Pakeman, Robin J.; Rusch, Graciela M.; Bernard-Verdier, Maud; Testi, Baptiste; Bakker, Jan P.; Bekker, Renee M.; Cerabolini, Bruno E. L.; Ceriani, Roberta M.; Cornu, Guillaume; Cruz, Pablo; Delcamp, Matthieu; Dolezal, Jiri; Eriksson, Ove; Fayolle, Adeline; Freitas, Helena; Golodets, Carly; Gourlet-Fleury, Sylvie; Hodgson, John G.; Brusa, Guido; Kleyer, Michael; Kunzmann, Dieter; Lavorel, Sandra; Papanastasis, Vasilios P.; Perez-Harguindeguy, Natalia; Vendramini, Fernanda; Weiher, Evan

    In plant leaves, resource use follows a trade-off between rapid resource capture and conservative storage. This "worldwide leaf economics spectrum" consists of a suite of intercorrelated leaf traits, among which leaf mass per area, LMA, is one of the most fundamental as it indicates the cost of leaf

  3. Spectroscopic determination of leaf water content using linear ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-02-02

    Feb 2, 2012 ... characteristics, this study measured 33 groups of peach tree leaf ... spectral absorption values were obtained from a total of 33 groups of leaves .... using the trial and error method, based on the following empirical ... be used as indicators for evaluation of prediction models. .... Comparison of the methods of.

  4. Procedures for extraction and purification of leaf wax biomarkers from peats

    Directory of Open Access Journals (Sweden)

    J.E. Nichols

    2011-12-01

    Full Text Available Palaeoecological and palaeoclimate reconstruction, using leaf wax biomarkers, is a relatively new sub-discipline of peatland science. The ability to process large numbers of samples rapidly for biomarkers makes this type of analysis particularly appealing. This review is a guide to the preparation of leaf waxes for analysis by gas chromatography. The main phases of preparation are extraction of soluble organic compounds from sediment, separation of the total extract into fractions of differing polarity, and the derivatisation of polar functional groups. The procedures described here are not meant be exhaustive of all organic geochemical possibilities in peatlands, but a distillation of methods for the preparation of leaf waxes that are commonly and increasingly being used in palaeoecological and palaeoclimatological studies.

  5. Soja: queima das folhas como critério de seleção para resistência à acidez do solo Leaf scorching as a criteria to select soybean for resistance to soil acidity

    Directory of Open Access Journals (Sweden)

    Manoel Albino Coelho de Miranda

    1988-01-01

    duplicated simple lattice design. Soil concentrations of Al, P and K were high. A single row plot two meters long was used with spacing of 60 centimeters between rows and 20 plants per meter. The soybean cultivars were seeded in November in order to insure the maximum vegetative growth. The parameters measured were: dry matter weight, plant height, primary root length and scores of root coloration and leaf scorching at 60 days after planting. The cultivars IAC-9, Biloxi, IAC-Santa Maria 702, IAC-2 and PI 274.454 had higher dry matter weight, plant heigth and lower scores on leaf scorching, aluminum and manganese contents and better indices than other genotypes. Althought the root lenght and scores on root color showed differences, they were not as good as the former parameters. There was a significant correlation between dry matter weight and leaf scorching suggesting the utilization of this criteria in soybean breeding for resistance to soil acidity. This method also takes into account the importance of symbiotic nitrogen fixation in the increase of dry matter weight of those cultivars resistant to leaf scorching since the plants were grown in natural environment.

  6. Hypolipidemic Effect of Psidium guajava Leaf Extract Against Hepatotoxicity in Rats.

    Science.gov (United States)

    Vijayakumar, K; Rengarajan, R L; Radhakrishnan, R; Anand, A Vijaya

    2018-01-01

    Plant-based natural extracts cure several diseases in human. However, the extract of Psidium guajava leaf is not yet evaluated on changes of lipid profile in hepatic disease affected rats. The present study was aimed to evaluate the mitigation effect of the ethanolic extract of P. guajava leaf and its isolated quercetin fraction on hepatotoxic rats. Carbon tetrachloride (CCl 4 ) was injected to rats for hepatic disease induction and silymarin drug was used as positive control to compare plant ethanolic extract. The lipid profiles were assessed in both plasma and liver tissue of diseased and control rats. Levels of total cholesterol, triglycerides, free fatty acids, phospholipids, and low-density lipoprotein cholesterol were increased and the level of high-density lipoprotein cholesterol (HDL-C) was decreased in CCl 4 -induced hepatotoxic rats. The treatment of P. guajava (100, 200, and 300 mg/kg, bw) and isolated quercetin fraction (20 mg/kg, bw) doses decreased the elevated levels of all these parameters in diseased rats and restored the normal concentration of HDL-C. The results of the present study concluded that the P. guajava leaf and its isolated quercetin fraction can significantly regulate lipid metabolism in CCl 4 -induced hepatotoxic rats and decrease the disease rate. Psidium guajava leaf extract reduces the hepatotoxicity and disease rate in ratsQuercetin fraction of leaf extract significantly regulates lipid profile in hepatic diseased rats. Abbreviations used: CCl 4 : Carbon tetrachloride; FFA: Free fatty acids; HDL-C: High-density lipoprotein cholesterol; LCAT: Lecithin cholesterol acyltransferase; LDL-C: Low-density lipoprotein cholesterol; PL: Phospholipids; TC: Total cholesterol; TG: Triglycerides; VLDL-C: Very low-density lipoprotein cholesterol.

  7. Effects of Psidium guajava Leaf Infusion on Streptococci viridans

    Directory of Open Access Journals (Sweden)

    Hing Yi Chen

    2016-09-01

    Full Text Available Background: Dental caries is recognized as the most important oral burden. It is caused by the formation of lactate acid formed through reaction of bacteria and carbohydrates. Streptococci viridans has been proven as the primary etiologic agents for dental caries. Low accessibility in oral care services leads the Indonesian community to use plants in order to prevent dental caries. One of those plants is Psidium guajava (pink guava. The leaves were suggested to have antimicrobial effects on some gram-positive bacteria. When the organism is resistant to specific substance tested on media, a circular/inhibition zone around a disc containing antimicrobial substance was formed. The purpose of this study was to identify the presence of inhibition zones by infusion of Psidium guajava leaf on Streptococci viridians in vitro. Methods: This laboratory experiment was carried out in September to October 2014 at the Microbiology Laboratory, Faculty of Medicine, Universitas Padjadjaran. Infusions of Psidium guajava leaf were made into four different concentrations (10%, 25%, 50% and 100%, respectively and the identification of inhibition zones on Streptococci viridans obtained from the laboratory was tested using modified disk diffusion test. Distilled water acted as negative control. The results were then interpreted after 24 hours of incubation. Every procedure was repeated three times. Results: All four concentrations of Psidium guajava leaf infusions have formed inhibition zones on the media, with the highest concentration (100% producing largest average diameter. Conclusions: The infusion of Psidium guajava leaf produces inhibition zones on Streptococci virdans in vitro.

  8. Easy Leaf Area: Automated digital image analysis for rapid and accurate measurement of leaf area.

    Science.gov (United States)

    Easlon, Hsien Ming; Bloom, Arnold J

    2014-07-01

    Measurement of leaf areas from digital photographs has traditionally required significant user input unless backgrounds are carefully masked. Easy Leaf Area was developed to batch process hundreds of Arabidopsis rosette images in minutes, removing background artifacts and saving results to a spreadsheet-ready CSV file. • Easy Leaf Area uses the color ratios of each pixel to distinguish leaves and calibration areas from their background and compares leaf pixel counts to a red calibration area to eliminate the need for camera distance calculations or manual ruler scale measurement that other software methods typically require. Leaf areas estimated by this software from images taken with a camera phone were more accurate than ImageJ estimates from flatbed scanner images. • Easy Leaf Area provides an easy-to-use method for rapid measurement of leaf area and nondestructive estimation of canopy area from digital images.

  9. Leaf anatomical traits determine the 18O enrichment of leaf water in coastal halophytes

    Science.gov (United States)

    Liang, J.; Lin, G., Sr.; Sternberg, L. O.

    2017-12-01

    Foliar anatomical adaptations to high-salinity environment in mangroves may be recorded by leaf water isotopes. Recent studies observed that a few mangrove species have lower 18O enrichment of leaf water (ΔL) relative to source water than the adjacent terrestrial trees, but what factors actually control this phenomenon is still disputable at present. To resolve this issue, we collected 15 species of true mangrove plants, 14 species of adjacent freshwater trees and 4 species of semi-mangrove plants at five study sites on the southeastern coast of China. Leaf stomatal density and pore size, water content, ΔL and other related leaf physiological traits were determined for the selected leaves of these plants. Our results confirmed that ΔL values of mangroves were generally 3 4 ‰ lower than those of the adjacent freshwater or semi-mangrove species. Higher leaf water per area (LWC) and lower leaf stomatal density (LS) of mangroves played co-dominant roles in lowering ΔL through elongating effective leaf mixing length by about 20%. The Péclet model incorporated by LWC and LS performed well in predicting ΔL. The demonstrated general law between leaf anatomy and ΔL in this paper based on a large pool of species bridges the gap between leaf functional traits and metabolic proxies derived ΔL, which will have considerable potential applications in vegetation succession and reconstruction of paleoclimate research.

  10. Etoxazole resistance in predatory mite Phytoseiulus persimilis A.-H. (Acari: Phytoseiidae): Cross-resistance, inheritance and biochemical resistance mechanisms.

    Science.gov (United States)

    Yorulmaz Salman, Sibel; Aydınlı, Fatma; Ay, Recep

    2015-07-01

    Phytoseiulus persimilis of the family Phytoseiidae is an effective predatory mite species that is used to control pest mites. The LC50 and LC60 values of etoxazole were determined on P. persimilis using a leaf-disc method and spraying tower. A laboratory selection population designated ETO6 was found to have a 111.63-fold resistance to etoxazole following 6 selection cycles. This population developed low cross-resistance to spinosad, spiromesifen, acetamiprid, indoxacarb, chlorantraniliprole, milbemectin and moderate cross-resistance to deltamethrin. PBO, IBP and DEM synergised resistance 3.17-, 2.85- and 3.60-fold respectively. Crossing experiments revealed that etoxazole resistance in the ETO6 population was an intermediately dominant and polygenic. In addition, detoxifying enzyme activities were increased 2.71-fold for esterase, 3.09-fold for glutathione S-transferase (GST) and 2.76-fold for cytochrome P450 monooxygenase (P450) in the ETO6 population. Selection for etoxazole under laboratory conditions resulted in the development of etoxazole resistance in the predatory mite P. persimilis that are resistant to pesticides are considered valuable for use in resistance management programmes within integrated pest control strategies. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Occurrence of barley leaf disease and control strategies in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten

    Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...

  12. Algorithm for retrieving vegetative canopy and leaf parameters from multi- and hyperspectral imagery

    Science.gov (United States)

    Borel, Christoph

    2009-05-01

    In recent years hyper-spectral data has been used to retrieve information about vegetative canopies such as leaf area index and canopy water content. For the environmental scientist these two parameters are valuable, but there is potentially more information to be gained as high spatial resolution data becomes available. We developed an Amoeba (Nelder-Mead or Simplex) based program to invert a vegetative canopy radiosity model coupled with a leaf (PROSPECT5) reflectance model and modeled for the background reflectance (e.g. soil, water, leaf litter) to a measured reflectance spectrum. The PROSPECT5 leaf model has five parameters: leaf structure parameter Nstru, chlorophyll a+b concentration Cab, carotenoids content Car, equivalent water thickness Cw and dry matter content Cm. The canopy model has two parameters: total leaf area index (LAI) and number of layers. The background reflectance model is either a single reflectance spectrum from a spectral library() derived from a bare area pixel on an image or a linear mixture of soil spectra. We summarize the radiosity model of a layered canopy and give references to the leaf/needle models. The method is then tested on simulated and measured data. We investigate the uniqueness, limitations and accuracy of the retrieved parameters on canopy parameters (low, medium and high leaf area index) spectral resolution (32 to 211 band hyperspectral), sensor noise and initial conditions.

  13. Calibrations between chlorophyll meter values and chlorophyll contents vary as the result of differences in leaf structure

    Science.gov (United States)

    In order to relate leaf chlorophyll meter values with total leaf chlorophyll contents (µg cm-2), calibration equations are established with measured data on leaves. Many studies have documented differences in calibration equations using different species and using different growing conditions for th...

  14. Antimicrobial potential of leaf and fruit extracts and oils of wild and cultivated edible olive

    International Nuclear Information System (INIS)

    Hussain, A.; Qurshi, I.A.; Liaqat, R.; Akhtar, S.; Aziz, I.

    2014-01-01

    Olive tree is the first botanical noted in the Bible. Leaves and fruits of olive are rich sources of Phenols, triterpenes, and flavanoids. Oleuropein obtained from the leaves extract is believed to be important therapeutic compound. Olive leaf and oils are used for the treatment of different diseases as folklore medicines by different ethnic groups in different countries of the world. The present study aims to investigate the potential antimicrobial activities of wild (Olea ferruginea) and edible (Olea europaea) olive leaf crude extracts, crude oils from ripe and unripe fruits and extra virgin oils against the selected gram positive and gram negative bacterial strains. The results show that olive leaf and oil have potential antibacterial activities against some of the gram positive and gram negative bacterial strains. However, certain strains were resistant to the extracts. It was also found that the activities were higher for the gram negative strains as compared to gram positive strains. The methanolic and ethanolic extracts were found to be more efficient in extraction than the other solvents used. Leaf extracts were more effective than the oil extracted from ripe and unripe fruits. There was no significant difference in the activities of extra virgin oils and crude leaf extracts. From the results it is concluded that the leaf extract is a cheap and effective antibacterial agent that can be used as alternative to purified oil. (author)

  15. Total body fat, pro-inflammatory cytokines and insulin resistance in Indian subjects

    Energy Technology Data Exchange (ETDEWEB)

    Yajnik, C S [Diabetes Unit, KEM Hospital Research Centre, Pune (India); Yudkin, J S [Whittington Hospital, University College of London, London (United Kingdom); Shetty, P S [London School of Hygiene and Tropical Medicine, London (United Kingdom); Kurpad, A [St. John' s Medical College, Bangalore (India)

    1999-07-01

    There is a growing epidemic of insulin resistance syndrome (IRS) in Indians. We postulate that increased susceptibility of the urban Indians to insulin resistance is a result of a tendency to increased fat deposition from the time of intrauterine life (thrifty phenotype), exaggerated in the urban environment by a positive energy balance. The pro-inflammatory cytokines secreted by the inflammatory cells as well by the adipose tissue could aggravate insulin resistance and endothelial damage and therefore, increase the susceptibility to type 2 diabetes and coronary heart disease (CHD) independent of the previously proposed glucose fatty acid cycle mechanism. In a preliminary study, we propose to make detailed measurements of the proposed mechanisms in a selected population from 3 geographical locations in and near the city of Pune, India and also validate simple 'epidemiologic' measurements of body composition with 'reference' measurements. One hundred men (30 to 50y) each from the three geographical locations (rural, urban slum-dwellers and urban middle class in Pune) will be studied for: (i) Body composition: Anthropometric and bioimpedance measurement of total body fat (to be calibrated against deuterated water in 30 subjects from each location), and muscle mass by anthropometry and urinary creatinine excretion; (ii) Body fat distribution by subscapular- triceps ratio, waist-hip ratio; (iii) Metabolic: Glucose tolerance and insulin resistance variables (insulin, lipids, NEFA) and leptin; (iv) Endothelial markers: e-Selectin and von Willebrand Factor (vWF); (v) Inflammatory markers and pro-inflammatory cytokines: C-reactive protein (CRP), Interleukin-6 (IL-6) and tumour necrosis factor (TNF- {alpha}); (vi) Energy Balance: Assessment of nutritional intake (calories, carbohydrates, proteins and fats, n3 and n6 fatty acids) and physical activity by a questionnaire. Insulin resistance variables, endothelial markers, cytokines and obesity parameters will be compared in

  16. Total body fat, pro-inflammatory cytokines and insulin resistance in Indian subjects

    International Nuclear Information System (INIS)

    Yajnik, C.S.; Yudkin, J.S.; Shetty, P.S.; Kurpad, A.

    1999-01-01

    There is a growing epidemic of insulin resistance syndrome (IRS) in Indians. We postulate that increased susceptibility of the urban Indians to insulin resistance is a result of a tendency to increased fat deposition from the time of intrauterine life (thrifty phenotype), exaggerated in the urban environment by a positive energy balance. The pro-inflammatory cytokines secreted by the inflammatory cells as well by the adipose tissue could aggravate insulin resistance and endothelial damage and therefore, increase the susceptibility to type 2 diabetes and coronary heart disease (CHD) independent of the previously proposed glucose fatty acid cycle mechanism. In a preliminary study, we propose to make detailed measurements of the proposed mechanisms in a selected population from 3 geographical locations in and near the city of Pune, India and also validate simple 'epidemiologic' measurements of body composition with 'reference' measurements. One hundred men (30 to 50y) each from the three geographical locations (rural, urban slum-dwellers and urban middle class in Pune) will be studied for: (i) Body composition: Anthropometric and bioimpedance measurement of total body fat (to be calibrated against deuterated water in 30 subjects from each location), and muscle mass by anthropometry and urinary creatinine excretion; (ii) Body fat distribution by subscapular- triceps ratio, waist-hip ratio; (iii) Metabolic: Glucose tolerance and insulin resistance variables (insulin, lipids, NEFA) and leptin; (iv) Endothelial markers: e-Selectin and von Willebrand Factor (vWF); (v) Inflammatory markers and pro-inflammatory cytokines: C-reactive protein (CRP), Interleukin-6 (IL-6) and tumour necrosis factor (TNF- α); (vi) Energy Balance: Assessment of nutritional intake (calories, carbohydrates, proteins and fats, n3 and n6 fatty acids) and physical activity by a questionnaire. Insulin resistance variables, endothelial markers, cytokines and obesity parameters will be compared in the 3

  17. Crescimento diferencial de biótipos de Conyza SPP. resistente e suscetível ao herbicida glifosato Differential growth of glyphosate-resistant and susceptible biotypes of Conyza SPP

    Directory of Open Access Journals (Sweden)

    Murilo Sala Moreira

    2010-01-01

    Full Text Available Este trabalho foi realizado com o objetivo de comparar, em condição controlada e não-competitiva, o crescimento de biótipos de Conyza canadensis e C. bonariensis resistente e suscetível ao herbicida glifosato, a fim de quantificar os efeitos da pressão de seleção para resistência nos biótipos. Dois experimentos foram desenvolvidos com tratamentos organizados em esquema fatorial 9 x 2, com nove avaliações periódicas de crescimento e dois biótipos de cada espécie. As variáveis avaliadas por planta foram: área foliar; massa seca da parte aérea, das raízes e total, obtendo-se, a partir desta última, a taxa de crescimento absoluto. O biótipo de C. canadensis resistente ao glifosato possui crescimento mais lento, menor acúmulo de área foliar e de massa seca que o biótipo suscetível. Menores áreas foliar e massa seca também foram registradas para o biótipo de C. bonariensis resistente ao glifosato quando comparado ao suscetível, porém com diferenças mais sutis que aquelas constatadas para C. canadensis. O crescimento absoluto do biótipo suscetível foi superior ao do resistente em ambas as espécies. A pressão de seleção para resistência ao glifosato teve impactos negativos na habilidade de crescimento dos biótipos.This work was carried out with the objective of comparing, under controlled and non-competitive condition, the growth of glyphosate-resistant and susceptible biotypes of Conyza canadensis and C. bonariensis; to quantify the effects of resistance selection pressure on the biotypes. Two trials were developed with treatments organized according to a factorial scheme 9 x 2, where nine were periodical growth evaluations and two were biotypes of each species. The variables evaluated per plant were: leaf area and dry mass (shoot, root and total; to determine absolute growth rate from the total dry mass. The glyphosate-resistant biotype of C. canadensis exhibits slower growth and smaller accumulation of leaf area

  18. Resistência genética à mancha-bacteriana em genótipos de pimentão Genetic resistance to bacterial leaf spot on sweet pepper genotypes

    Directory of Open Access Journals (Sweden)

    Roberto Alexandre Costa

    2002-03-01

    Full Text Available A mancha-bacteriana, principal doença bacteriana do pimentão causa desfolha intensa quando em condições favoráveis, deixando os frutos expostos ao sol, depreciando-os e diminuindo a produção. Para estimar, nas condições de Campos dos Goytacazes, os efeitos genéticos da reação do hospedeiro ao patógeno, tanto em folhas como em frutos, foram obtidos híbridos F1, sem recíprocos, a partir de cruzamentos dialélicos entre cinco genótipos de pimentão, sendo três suscetíveis ('UENF 1420', 'UENF 1421' e 'UENF 1422' e dois resistentes ('UENF 1381' e 'UENF 1382'. A inoculação com Xanthomonas campestris pv. vesicatoria constou de infiltração no mesófilo foliar, utilizando-se a concentração de 10³ células/ml, ajustada com auxílio de espectrofotômetro. Os efeitos de variedade e de heterose média foram significativos para resistência em folhas, indicando que efeitos aditivos e de dominância estão envolvidos no controle genético deste caráter. Para resistência em frutos, apenas os efeitos de variedade foram significativos, indicando a presença de efeitos aditivos no controle desta característica. A partir das análises puderam ser selecionados os parentais para RMB em folhas: 'UENF 1381' e 'UENF 1382'. Para RMB em frutos 'UENF 1381' e 'UENF 1421' foram os melhores parentais. Os melhores híbridos para RMB em folhas foram: 'UENF 1420' x 'UENF 1421', 'UENF 1382' x 'UENF 1420', 'UENF 1381' x 'UENF 1420', 'UENF 1381' x 'UENF 1421', 'UENF 1381' x 'UENF 1422' e 'UENF 1381' x 'UENF 1382'.Bacterial leaf spot (BLS is the most important bacterial disease in sweet pepper, causing intense defoliation under favorable conditions, leaving the exposed fruits to sunburn and decreasing the yield. To estimate genetic effects of the reaction to BLS on leaves and fruits, under the conditions of Campos dos Goytacazes (Brazil, hybrids F1, without reciprocals, were obtained from diallel crosses among five pepper genotypes, three susceptible

  19. Interactive influence of leaf age, light intensity, and girdling on green ash foliar chemistry and emerald ash borer development.

    Science.gov (United States)

    Chen, Yigen; Poland, Therese M

    2009-07-01

    Biotic and abiotic environmental factors affect plant nutritional quality and defensive compounds that confer plant resistance to herbivory. Influence of leaf age, light availability, and girdling on foliar nutrition and defense of green ash (Fraxinus pennsylvanica Marsh) was examined in this study. Longevity of the emerald ash borer, Agrilus planipennis Fairmaire (Coleoptera: Buprestidae), adults reared on green ash foliage subjected to these factors was assayed. Mature leaves generally were more nutritious with greater amino acids and a greater ratio of protein to non-structural carbohydrate (P:C) than young leaves, in particular when trees were grown in shade. On the other hand, mature leaves had lower amounts of trypsin and chymotrypsin inhibitors, and total phenolics compared to young leaves. Lower defense of mature leaves alone, or along with higher nutritional quality may lead to increased survival and longevity of emerald ash borer feeding on mature leaves. Sunlight reduced amino acids and P:C ratio, irrespective of leaf age and girdling, and elevated total protein of young foliage, but not protein of mature leaves. Sunlight also dramatically increased all investigated defensive compounds of young, but not mature leaves. Girdling reduced green ash foliar nutrition, especially, of young leaves grown in shade and of mature leaves grown in sun. However emerald ash borer performance did not differ when fed leaves from trees grown in sun or shade, or from girdled or control trees. One explanation is that emerald ash borer reared on lower nutritional quality food may compensate for nutrient deficiency by increasing its consumption rate. The strong interactions among leaf age, light intensity, and girdling on nutrition and defense highlight the need for caution when interpreting data without considering possible interactions.

  20. Leaf chemical composition of twenty-one Populus hybrid clones grown under intensive culture

    Science.gov (United States)

    Richard E. Dickson; Philip R. Larson

    1976-01-01

    Leaf material from 21 nursery-grown Populus hybrid clones was analyzed for three nitrogen fractions (total N, soluble protein, and soluble amino acids) and three carbhydrate fractions (reducing sugars, total soluble sugars, and total nonstructural carbohydrates-TNC). In addition, nursery-grown green ash and silver maple, field-grown bigtooth and trembling aspen, and...

  1. Leaf endophyte load influences fungal garden development in leaf-cutting ants

    Directory of Open Access Journals (Sweden)

    Van Bael Sunshine A

    2012-11-01

    Full Text Available Abstract Background Previous work has shown that leaf-cutting ants prefer to cut leaf material with relatively low fungal endophyte content. This preference suggests that fungal endophytes exact a cost on the ants or on the development of their colonies. We hypothesized that endophytes may play a role in their host plants’ defense against leaf-cutting ants. To measure the long-term cost to the ant colony of fungal endophytes in their forage material, we conducted a 20-week laboratory experiment to measure fungal garden development for colonies that foraged on leaves with low or high endophyte content. Results Colony mass and the fungal garden dry mass did not differ significantly between the low and high endophyte feeding treatments. There was, however, a marginally significant trend toward greater mass of fungal garden per ant worker in the low relative to the high endophyte treatment. This trend was driven by differences in the fungal garden mass per worker from the earliest samples, when leaf-cutting ants had been foraging on low or high endophyte leaf material for only 2 weeks. At two weeks of foraging, the mean fungal garden mass per worker was 77% greater for colonies foraging on leaves with low relative to high endophyte loads. Conclusions Our data suggest that the cost of endophyte presence in ant forage material may be greatest to fungal colony development in its earliest stages, when there are few workers available to forage and to clean leaf material. This coincides with a period of high mortality for incipient colonies in the field. We discuss how the endophyte-leaf-cutter ant interaction may parallel constitutive defenses in plants, whereby endophytes reduce the rate of colony development when its risk of mortality is greatest.

  2. Phenotypic Plasticity of Leaf Shape along a Temperature Gradient in Acer rubrum

    Science.gov (United States)

    Royer, Dana L.; Meyerson, Laura A.; Robertson, Kevin M.; Adams, Jonathan M.

    2009-01-01

    Both phenotypic plasticity and genetic determination can be important for understanding how plants respond to environmental change. However, little is known about the plastic response of leaf teeth and leaf dissection to temperature. This gap is critical because these leaf traits are commonly used to reconstruct paleoclimate from fossils, and such studies tacitly assume that traits measured from fossils reflect the environment at the time of their deposition, even during periods of rapid climate change. We measured leaf size and shape in Acer rubrum derived from four seed sources with a broad temperature range and grown for two years in two gardens with contrasting climates (Rhode Island and Florida). Leaves in the Rhode Island garden have more teeth and are more highly dissected than leaves in Florida from the same seed source. Plasticity in these variables accounts for at least 6–19 % of the total variance, while genetic differences among ecotypes probably account for at most 69–87 %. This study highlights the role of phenotypic plasticity in leaf-climate relationships. We suggest that variables related to tooth count and leaf dissection in A. rubrum can respond quickly to climate change, which increases confidence in paleoclimate methods that use these variables. PMID:19893620

  3. Easy Leaf Area: Automated Digital Image Analysis for Rapid and Accurate Measurement of Leaf Area

    Directory of Open Access Journals (Sweden)

    Hsien Ming Easlon

    2014-07-01

    Full Text Available Premise of the study: Measurement of leaf areas from digital photographs has traditionally required significant user input unless backgrounds are carefully masked. Easy Leaf Area was developed to batch process hundreds of Arabidopsis rosette images in minutes, removing background artifacts and saving results to a spreadsheet-ready CSV file. Methods and Results: Easy Leaf Area uses the color ratios of each pixel to distinguish leaves and calibration areas from their background and compares leaf pixel counts to a red calibration area to eliminate the need for camera distance calculations or manual ruler scale measurement that other software methods typically require. Leaf areas estimated by this software from images taken with a camera phone were more accurate than ImageJ estimates from flatbed scanner images. Conclusions: Easy Leaf Area provides an easy-to-use method for rapid measurement of leaf area and nondestructive estimation of canopy area from digital images.

  4. Effect of Packaging Materials on Orthosiphon Stamineus Dried-Leaf Quality During Storage

    Science.gov (United States)

    Norawanis, A. R.; Shaari, A. R.; Leng, L. Y.

    2018-03-01

    The experiment was conducted to determine the effects on the total phenolic content, antioxidant capacity, moisture content and total different color (ΔE) when the O. stamineus dried whole-leaf were packed in different packaging materials (plastic bag, paper bag and glass container) and stored under room temperature (±25 °C) and relative humidity (±65 %RH) for 8 weeks. The total phenolic compounds and antioxidant activity were measured using the Folin-Ciocalteu method and 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging activity assay respectively, and analyzed using UV/VIS Spectrophotometer. The moisture content changes were examined using a moisture analyzer and the color changes were analyzed using colorimeter. The results showed that packing O. stamineus dried whole-leaf in different packaging materials significantly affected the herbal leaves quality. After 8 weeks of storage period, the total phenolic content and antioxidant capacity exhibited the increase values during storage. Meanwhile, the moisture content of the samples decreased by storage period for the samples packed in plastic bag and glass container. The moisture content of the samples packed in the paper bag fluctuated along the 8 weeks of storage period. The total different color (ΔE) of the O. stamineus dried whole-leaf increased by storage period. The highest changes of ΔE belonged to the samples packed in the glass container, followed by paper and plastic bags. The selection of the packaging materials can be considered as an important element to control the quality of raw herbal materials for further processing and the herbal finished products.

  5. ACTIVITY TEST OF GUAVA (Psidium guajava L. LEAF METHANOL EXTRACT AS CONTRACEPTION ANTIFERTILITY TO WHITE MICE (Rattus norvegicus

    Directory of Open Access Journals (Sweden)

    Sri Retno Dwi Ariani

    2010-06-01

    Full Text Available The aim of this research is to know about if the guava (Psidium guajava L. leaf methanol extract on 10.5 mg/mL and 21.0 mg/mL dossages indicate a positive test as contraception antifertility to white mice (Rattus norvegicus. The sample is guava leaf from Mungkid, Magelang Central of Java Indonesia. The animals experiment are the white mice on 140-300 g for female, 200-250 g for male and about 3 months of age in average. The steps of this research are : (1 preparing  sample, i.e. washing, drying on to indirect sunlight and make the sample into powder, (2 isolation the guava leaf powder in soxhlet instrument with hexane, (3 evaporation the sample with rotary evaporator until guava leaf hexane extract produced, (4 maseration the sample with methanol, (5 evaporation the sample with rotary evaporator until guava leaf methanol extract produced, (6 conducting contraception antifertility activity test to guave leaf methanol extract on 10.5 mg/mL and 21.0 mg/mL dossages to mice white. The results of this research are guava leaf methanol extract on 10.5 mg/mL and 21.0 mg/mL dossages indicate a negative contraception antifertility test to white mice but in these dossages have indicated that an antiimplantation effect (the total natality of fetus is less than the total implantation site in mice white.   Keywords: Guava leaf, contraseption antifertility, methanol extract, white mice, implantation

  6. Optimizing Transcriptome Assemblies for Eleusine indica Leaf and Seedling by Combining Multiple Assemblies from Three De Novo Assemblers

    Directory of Open Access Journals (Sweden)

    Shu Chen

    2015-03-01

    Full Text Available Due to rapid advances in sequencing technology, increasing amounts of genomic and transcriptomic data are available for plant species, presenting enormous challenges for biocomputing analysis. A crucial first step for a successful transcriptomics-based study is the building of a high-quality assembly. Here, we utilized three different de novo assemblers (Trinity, Velvet, and CLC and the EvidentialGene pipeline tr2aacds to assemble two optimized transcript sets for the notorious weed species, . Two RNA sequencing (RNA-seq datasets from leaf and aboveground seedlings were processed using three assemblers, which resulted in 20 assemblies for each dataset. The contig numbers and N50 values of each assembly were compared to study the effect of read number, k-mer size, and in silico normalization on assembly output. The 20 assemblies were then processed through the tr2aacds pipeline to remove redundant transcripts and to select the transcript set with the best coding potential. Each assembly contributed a considerable proportion to the final transcript combination with the exception of the CLC-k14. Thus each assembler and parameter set did assemble better contigs for certain transcripts. The redundancy, total contig number, N50, fully assembled contig number, and transcripts related to target-site herbicide resistance were evaluated for the EvidentialGene and Trinity assemblies. Comparing the EvidentialGene set with the Trinity assembly revealed improved quality and reduced redundancy in both leaf and seedling EvidentialGene sets. The optimized transcriptome references will be useful for studying herbicide resistance in and the evolutionary process in the three allotetraploid offspring.

  7. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  8. Comparisons of Herbicide Treated and Cultivated Herbicide-Resistant Corn

    OpenAIRE

    H. Arnold Bruns; Hamed K. Abbas

    2010-01-01

    Four glyphosate resistant corn (Zea mays L.) hybrids, a glufosinate-ammonium resistant hybrid, and a conventional atrazine resistant hybrid gown at Stoneville, MS in 2005, 2006, and 2007 with furrow irrigation were treated with their respective herbicides and their growth, yield, and mycotoxin incidence were compared with untreated cultivated plots. Leaf area index (LAI) and dry matter accumulation (DMA) were collected on a weekly basis beginning at growth stage V3 and terminating at anthesi...

  9. Resistance in Cucumis sativus L. to Tetranychus urticae Koch

    OpenAIRE

    Ponti, de, O.M.B.

    1980-01-01


    Chapter 1
    The role of plant breeding and particularly of host plant resistance in integrated control is discussed. Host plant resistance to insects and mites, especially to Tetranychus urticae is reviewed. A standard terminology for disease and pest resistance is recommended.

    Chapter 2
    The relationship between the twospotted spider mite and cucumber has been studied on plants and on leaf disks of a number of varieties with different...

  10. Calcium oxalate druses affect leaf optical properties in selenium-treated Fagopyrum tataricum.

    Science.gov (United States)

    Golob, Aleksandra; Stibilj, Vekoslava; Nečemer, Marijan; Kump, Peter; Kreft, Ivan; Hočevar, Anja; Gaberščik, Alenka; Germ, Mateja

    2018-03-01

    Plants of the genus Fagopyrum contain high levels of crystalline calcium oxalate (CaOx) deposits, or druses, that can affect the leaf optical properties. As selenium has been shown to modify the uptake and accumulation of metabolically important elements such as calcium, we hypothesised that the numbers of druses can be altered by selenium treatment, and this would affect the leaf optical properties. Tartary buckwheat (Fagopyrum tataricum Gaertn.) was grown outdoors in an experimental field. At the beginning of flowering, plants were foliarly sprayed with sodium selenate solution at 10 mg selenium L -1 or only with water. Plant morphological, biochemical, physiological and optical properties were examined, along with leaf elemental composition and content. Se spraying did not affect leaf biochemical and functional properties. However, it increased leaf thickness and the contents of Se in the leaves, and decreased the density of calcium oxalate druses in the leaves. Except Se content, Se spraying did not affect contents of other elements in leaves, including total calcium per dry mass of leaf tissue. Redundancy analysis showed that of all parameters tested, only the calcium oxalate druses parameters were significant in explaining the variability of the leaf reflectance and transmittance spectra. The density of CaOx druses positively correlated with the reflectance in the blue, green, yellow and UV-B regions of the spectrum, while the area of CaOx druses per mm 2 of leaf transection area positively correlated with the transmittance in the green and yellow regions of the spectrum. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Automated Leaf Tracking using Multi-view Image Sequences of Maize Plants for Leaf-growth Monitoring

    Science.gov (United States)

    Das Choudhury, S.; Awada, T.; Samal, A.; Stoerger, V.; Bashyam, S.

    2017-12-01

    Extraction of phenotypes with botanical importance by analyzing plant image sequences has the desirable advantages of non-destructive temporal phenotypic measurements of a large number of plants with little or no manual intervention in a relatively short period of time. The health of a plant is best interpreted by the emergence timing and temporal growth of individual leaves. For automated leaf growth monitoring, it is essential to track each leaf throughout the life cycle of the plant. Plants are constantly changing organisms with increasing complexity in architecture due to variations in self-occlusions and phyllotaxy, i.e., arrangements of leaves around the stem. The leaf cross-overs pose challenges to accurately track each leaf using single view image sequence. Thus, we introduce a novel automated leaf tracking algorithm using a graph theoretic approach by multi-view image sequence analysis based on the determination of leaf-tips and leaf-junctions in the 3D space. The basis of the leaf tracking algorithm is: the leaves emerge using bottom-up approach in the case of a maize plant, and the direction of leaf emergence strictly alternates in terms of direction. The algorithm involves labeling of the individual parts of a plant, i.e., leaves and stem, following graphical representation of the plant skeleton, i.e., one-pixel wide connected line obtained from the binary image. The length of the leaf is measured by the number of pixels in the leaf skeleton. To evaluate the performance of the algorithm, a benchmark dataset is indispensable. Thus, we publicly release University of Nebraska-Lincoln Component Plant Phenotyping dataset-2 (UNL-CPPD-2) consisting of images of the 20 maize plants captured by visible light camera of the Lemnatec Scanalyzer 3D high throughout plant phenotyping facility once daily for 60 days from 10 different views. The dataset is aimed to facilitate the development and evaluation of leaf tracking algorithms and their uniform comparisons.

  12. Identification of lead-resistant endophytic bacteria isolated from rice

    International Nuclear Information System (INIS)

    Perez-Cordero, Alexander; Barraza-Roman, Zafiro; Martinez-Pacheco, Dalila

    2015-01-01

    Resistance of endophytic bacteria in vitro was evaluated at different lead concentrations. The tissue samples of commercial rice varieties at tillering stage were collected during the first half of 2013, in Monteria, Cordoba, Colombia. Each tissue was subjected to surface cleaning. Endophytic bacteria were isolated in agar R_2A medium. The population density (CFU/g tissue) was determined from each tissue by direct counting of R_2A medium surface. Morphotypes were classified by shape, color, size and appearance. A total of 168 morphotypes were isolated from root, tillers and leaf of different commercial varieties of rice. The lead resistance test is performed in vitro, The lead resistance test was performed in vitro, by the suspensions of endophytic bacteria in log phase and inoculation in minimal medium with five concentrations of lead as Pb (NO_3)_2. The experiment was incubated at 32 degrees celsius and agitated at 150 rpm for five days. The measure of turbidimetry at 600 nm was conduced every hour afterstarting the test. Endophytic bacteria showed the ability to grow at concentrations of 100% of Pb as Pb (NO_3) _2. The presence of Burkholderia cepacia and Pseudomonas putida, which showed resistance to differents lead concentration was confirmed as result of the identification with kit API20E. (author) [es

  13. Cytohistological study of the leaf structures of Panax ginseng Meyer and Panax quinquefolius L.

    Directory of Open Access Journals (Sweden)

    Ok Ran Lee

    2017-10-01

    Conclusion: The anatomical leaf structure of both P. ginseng and P. quinquefolius shows that they are typical shade-loving sciophytes. Slight differences in chloroplast structure suggests that the two different species can be authenticated using transmission electron microscopy images, and light-resistant cultivar breeding can be performed via controlling photosynthesis efficiency.

  14. Evaluation of dried vegetables residues for poultry: II. Effects of feeding cabbage leaf residues on broiler performance, ileal digestibility and total tract nutrient digestibility.

    Science.gov (United States)

    Mustafa, A F; Baurhoo, B

    2017-03-01

    A study was conducted to investigate the effects of partial replacing corn and soybean meal with dried cabbage leaf residues (DCR) on broiler growth performance, apparent ileal nutrient digestibility, and apparent total tract nutrient utilization. Dietary treatments include 4 levels of DCR (0, 3, 6, and 9%). Two hundred and twenty-four day-old male broilers were randomly assigned to one of 4 groups (8 cage replicates; 7 birds/cage) and grown over a 35-d experimental period. Results showed that feeding DCR had no effects on daily body weigh gain (average 53.4 g/d), daily feed intake (average 94.9 g/d), and feed conversion ratio (average 1.78 g of feed/g of gain). Inclusion of DCR reduced apparent ileal DM (quadratic effect, P digestibility of younger birds (d 21) while incremental levels of DCR had no effect on apparent ileal nutrient digestibilities of older birds (d 35). Apparent total tract digestibility of DM, OM, and CP increased (linear effect, P digestibility of older birds and improved apparent total tract nutrient digestibility. © 2016 Poultry Science Association Inc.

  15. Effects of dietary sweet potato leaf meal on the growth, non-specific immune responses, total phenols and antioxidant capacity in channel catfish (Ictalurus punctatus).

    Science.gov (United States)

    Lochmann, Rebecca T; Islam, Shahidul; Phillips, Harold; Adam, Zelalem; Everette, Jace

    2013-04-01

    Traditional energy sources in catfish diets have become costly, and economical alternatives are needed. Sweet potato leaves are underutilised agricultural by-products that provide energy and substantial amounts of phenols, which affect animal and human health. There is little information on the effects of these compounds on catfish, or the capacity of catfish to accumulate dietary phenols. Catfish enriched with phenols have marketing potential as functional foods. This study investigated the effects of diets with sweet potato leaf meal (SPLM) on growth performance, health and total phenolic compounds in catfish. SPLM was substituted for wheat middlings in three diets fed to groups of juvenile catfish for 10 weeks. Weight gain, feed conversion, survival, alternative complement activity and lysozyme activity were similar among diets. Haematocrit was lower in fish fed diets with SPLM, but within the normal range. Total phenols and antioxidant capacity in the whole body were similar among treatments. SPLM was an effective energy source for catfish up to the maximum level tested (230 g kg(-1) diet). SPLM did not enhance total phenols in catfish, but there were no apparent antinutritional effects of the meal on catfish growth, health or survival. © 2012 Society of Chemical Industry.

  16. Metabolic responses and β-carotene production by the unicellular green alga Dunaliella salina exposed to leaf extracts

    Directory of Open Access Journals (Sweden)

    Alireza Einali

    Full Text Available ABSTRACT The present work investigated the effects of aqueous extracts of eucalyptus ( Eucalyptus globulus and elderberry ( Sambucus ebulus leaves on β-carotene productivity in Dunaliella salina, a green microalga. Leaf extracts from eucalyptus have greater amounts of phenolics and flavonoids, as well as greater ferric reducing antioxidant potential than elderberry. The extracts of both species greatly inhibited growth of algal suspensions. However, chlorophyll and β-carotene concentration increased in cells treated with leaf extracts, and the highest values were detected in 1 % eucalyptus and 2 % elderberry extracts. Fresh weight, total sugar, and protein content significantly increased following exposure of cells to different doses of leaf extracts. However, in doses containing more than 2 % eucalyptus, the upward trend for total sugar and protein ceased and remained statistically unchanged. These results suggest that metabolic modifications enable D. salina cells to tolerate the stress induced by the leaf extracts through allocating carbon flux to the synthesis of osmolytes and putative antioxidant molecules (e.g. sugars and β-carotene. Therefore, the use of leaf extracts holds potential to be a promising and effective way to improve D. salina cultivation for β-carotene production and other biotechnological and industrial applications.

  17. Removal of total and antibiotic resistant bacteria in advanced wastewater treatment by ozonation in combination with different filtering techniques.

    Science.gov (United States)

    Lüddeke, Frauke; Heß, Stefanie; Gallert, Claudia; Winter, Josef; Güde, Hans; Löffler, Herbert

    2015-02-01

    Elimination of bacteria by ozonation in combination with charcoal or slow sand filtration for advanced sewage treatment to improve the quality of treated sewage and to reduce the potential risk for human health of receiving surface waters was investigated in pilot scale at the sewage treatment plant Eriskirch, Baden-Wuerttemberg/Germany. To determine the elimination of sewage bacteria, inflowing and leaving wastewater of different treatment processes was analysed in a culture-based approach for its content of Escherichia coli, enterococci and staphylococci and their resistance against selected antibiotics over a period of 17 month. For enterococci, single species and their antibiotic resistances were identified. In comparison to the established flocculation filtration at Eriskirch, ozonation plus charcoal or sand filtration (pilot-scale) reduced the concentrations of total and antibiotic resistant E. coli, enterococci and staphylococci. However, antibiotic resistant E. coli and staphylococci apparently survived ozone treatment better than antibiotic sensitive strains. Neither vancomycin resistant enterococci nor methicillin resistant Staphylococcus aureus (MRSA) were detected. The decreased percentage of antibiotic resistant enterococci after ozonation may be explained by a different ozone sensitivity of species: Enterococcus faecium and Enterococcus faecalis, which determined the resistance-level, seemed to be more sensitive for ozone than other Enterococcus-species. Overall, ozonation followed by charcoal or sand filtration led to 0.8-1.1 log-units less total and antibiotic resistant E. coli, enterococci and staphylococci, as compared to the respective concentrations in treated sewage by only flocculation filtration. Thus, advanced wastewater treatment by ozonation plus charcoal or sand filtration after common sewage treatment is an effective tool for further elimination of microorganisms from sewage before discharge in surface waters. Copyright © 2014 Elsevier

  18. Sample preparation for total reflection X-ray fluorescence analysis using resist pattern technique

    Science.gov (United States)

    Tsuji, K.; Yomogita, N.; Konyuba, Y.

    2018-06-01

    A circular resist pattern layer with a diameter of 9 mm was prepared on a glass substrate (26 mm × 76 mm; 1.5 mm thick) for total reflection X-ray fluorescence (TXRF) analysis. The parallel cross pattern was designed with a wall thickness of 10 μm, an interval of 20 μm, and a height of 1.4 or 0.8 μm. This additional resist layer did not significantly increase background intensity on the XRF peaks in TXRF spectra. Dotted residue was obtained from a standard solution (10 μL) containing Ti, Cr, Ni, Pb, and Ga, each at a final concentration of 10 ppm, on a normal glass substrate with a silicone coating layer. The height of the residue was more than 100 μm, where self-absorption in the large residue affected TXRF quantification (intensity relative standard deviation (RSD): 12-20%). In contrast, from a droplet composed of a small volume of solution dropped and cast on the resist pattern structure, the obtained residue was not completely film but a film-like residue with a thickness less than 1 μm, where self-absorption was not a serious problem. In the end, this sample preparation was demonstrated to improve TXRF quantification (intensity RSD: 2-4%).

  19. Genetic diversity of flavonoid content in leaf of hawthorn resources

    International Nuclear Information System (INIS)

    Zhao, Y.; Wang, G.; Liu, Z.

    2014-01-01

    Hawthorn (Cratageus spp.) are important medicinal plants. Flavonoids are the main active ingredient in hawthorn. With the help of hawthorn leaf flavonoids efficient detection system, vitexin, rhamnosylvitexin, hyperin, rutin and quercetin of 122 hawthorn resources was precisely measured.The flavonoid contents of 10 hawthorn species were explicited. The comparation of flavonoids revealed the abundant genetic diversity of hawthorn flavones. Large variable coefficient has been observed among 5 flavonoid monomer traits. The coefficients of variation were 44.17%, 132.2%, 157.08%, 113.91% and 31.05 for Vitexin, Rhamnosylvitexin, Hyperoside, Rutin and Quercetin respectively. The sum of these 5 flavonoid monomer contents represented the total flavonoids in hawthorn. The total coefficients of variation was 44.01%. Some high-content-flavone and valuable leaf resources were found. This research could provide accurate date for further production, breeding and the effective use of medicinal resources. (author)

  20. Evaluation of some varieties and breeding lines of tomato (Lycopersison sp) against tomato yellow leaf curl disease in the Greater Accra Region (Ghana)

    International Nuclear Information System (INIS)

    Kusi-Adjei, R.

    2011-01-01

    A series of experiments were conducted to evaluate ten (10) tomato varieties and breeding lines against tomato yellow leaf curl virus disease in Ghana. The research was undertaken at the research farm of the Biotechnology and Nuclear Agriculture Research Institute of the Ghana Atomic Energy Commission. Ten tomato varieties and breeding lines were evaluated in the field under natural whitefly inoculation in insect-proof cages. The field trial was done in the dry season from October, 2010 to February, 2011 and wet season from March, 2011 to July, 2011. Plants in the fields and in the cage exhibited varied symptoms such as leaf curling, leaf yellowing and reduced leaf sizes. Assessment of disease incidence and symptom severity using a four point scale (0-4) showed that, in the field there was higher disease incidence in the dry season as compared to the wet season. This was attributed to the higher number of whiteflies in the dry season as demonstrated through a whitefly population survey conducted in the field. Differences among means for disease incidence and whitefly surveys on the ten tomato varieties and breeding lines were statistically significant (p≤ 0.05). Wild Tomato (Solanum pimpinellifollium) and two hybrids, Wosowoso x Wild Tomato and Cherry Red x Wild Tomato exhibited signs of resistance in the field and did not show any symptoms of TYLCV disease symptoms. All the commercial varieties were highly susceptible and showed severe symptoms. Evaluation of fruit yield in the field revealed that the commercial variety Tomato Advanta had the heaviest fruit weight (42 g/ fruit) whilst Wosowoso had the highest total fruit yield (5.74 t/ha) in the wet season. Wild Tomato and the hybrids produced higher number of fruits compared to the commercial varieties. There were highly significant differences in the means of number of fruits, fruit weight (g) and total fruit yield (t/ha) among the ten tomato varieties and breeding lines in both the wet and dry seasons

  1. Changes in DNA Methylation Pattern at Two Seedling Stages in Water Saving and Drought-Resistant Rice Variety after Drought Stress Domestication

    Directory of Open Access Journals (Sweden)

    Xiao-guo ZHENG

    2014-09-01

    Full Text Available Recent studies revealed that DNA methylation plays an important role in plant growth and development. In this study, a water-saving and drought-resistant rice variety Huhan 3 was subjected to drought stress from tillering to grain-filling stages in six successive growth cycles. The variations in DNA methylation pattern between the original generation (G0 and the sixth generation (G6 were analyzed by using methylation sensitive amplification polymorphism method. The results revealed that the methylated loci accounted for 34.3% to 34.8% of the total loci. Among these methylated loci, 83.1% to 84.8% were full- and hyper-methylated and 15.2% to 16.9% were hemi-methylated. The DNA methylation level decreased from the three-leaf to four-leaf stages in Huhan 3. Differentially methylated loci (DML between generations or/and between different developmental stages accounted for 4.0% of the total loci, most of which were only related to plant development (57.9%. Compared to G0, the DNA methylation pattern of G6 changed after drought domestication, at the three-leaf stage, de-methylation accounting for 59.1%, while at the four-leaf stage, re-methylation for 47.9%. Genome-wide alternations of DNA methylation were observed between the two seedling stages, and DML mainly occurred on the gene's promoter and exon region. The genes related to DML involved in a wide range of functional biology and participated in many important biological processes.

  2. Geometric leaf placement strategies

    International Nuclear Information System (INIS)

    Fenwick, J D; Temple, S W P; Clements, R W; Lawrence, G P; Mayles, H M O; Mayles, W P M

    2004-01-01

    Geometric leaf placement strategies for multileaf collimators (MLCs) typically involve the expansion of the beam's-eye-view contour of a target by a uniform MLC margin, followed by movement of the leaves until some point on each leaf end touches the expanded contour. Film-based dose-distribution measurements have been made to determine appropriate MLC margins-characterized through an index d 90 -for multileaves set using one particular strategy to straight lines lying at various angles to the direction of leaf travel. Simple trigonometric relationships exist between different geometric leaf placement strategies and are used to generalize the results of the film work into d 90 values for several different strategies. Measured d 90 values vary both with angle and leaf placement strategy. A model has been derived that explains and describes quite well the observed variations of d 90 with angle. The d 90 angular variations of the strategies studied differ substantially, and geometric and dosimetric reasoning suggests that the best strategy is the one with the least angular variation. Using this criterion, the best straightforwardly implementable strategy studied is a 'touch circle' approach for which semicircles are imagined to be inscribed within leaf ends, the leaves being moved until the semicircles just touch the expanded target outline

  3. Yielding of leaf celery Apium graveolens L. var. secalinum Alef. depending on the number of harvests and irrigation

    Directory of Open Access Journals (Sweden)

    Ewa Rożek

    2013-04-01

    Full Text Available Leaf celery (Apium graveolensvar. secalinum is a vegetable with medicinal and spicy properties. Its numerous intensely fragrant leaves can be cut several times during the plant growing period. The aim of this study was to evaluate the effect of irrigation and number of harvests on leaf celery yield of the cultivars ‘Afina’ and‘Gewone Snij’. Plant irrigation significantly increased leaf yield and plant height of leaf celery. Higher total yield was obtained from non-irrigated plants when leaves were harvested three times, whereas for irrigated plants yield was higher in the case of two leaf harvests. Irrespective of the experimental factors, higher yield was obtained from the cultivar ‘Gewone Snij’.

  4. Potential of Tissue Culture for Breeding Root-Knot Nematode Resistance into Vegetables

    OpenAIRE

    Fassuliotis, G.; Bhatt, D. P.

    1982-01-01

    Plant protoplast technology is being investigated as a means of transferring root-knot nematode resistance factors from Solanum sisymbriifolium into the susceptible S. melongena. Solanum sisymbriifolium plants regenerated from callus lost resistance to Meloidogyne javanica but retained resistance to M. incognita. Tomato plants cloned from leaf discs of the root-knot nematode resistant 'Patriot' were completely susceptible to M. incognita, while sections of stems and leaves rooted in sand in t...

  5. Faba Bean Can Adapt to Chocolate Spot Disease by Pretreatment with Shikimic and Salicylic Acids through Osmotic Adjustment, Solutes Allocation and Leaf Turgidity

    Directory of Open Access Journals (Sweden)

    Heshmat S. Aldesuquy

    2014-03-01

    Full Text Available This study investigated the effect of shikimic and salicylic acids at the concentrations of 0.4 and 0.7 mM, respectively, or their combination as phenolic compounds and Ridomil MZ at the concentration of 250 g/100 L as a fungicide on osmotic pressure (OP, solutes allocation, organic acids, inorganic ions and relative water content were quantified in Vicia faba leaves infected by Botrytis fabae. Pathogen induced noticeable decrease in osmotic pressure, total soluble sugar (TSS and inorganic osmolytes (i.e. Na+, K+, Ca2+, Mg2+ and Cl- while caused obvious increase in proline, total soluble nitrogen (TSN and organic acids (i.e. Keto and citric acids in water extract of the leaf of faba bean plants. Furthermore, pathogen caused marked decrease in relative water content (RWC of infected leaves and as a consequence the saturation water deficit (SWD was increased. Exogenous application of shikimic acid, salicylic acid or their combination could counteract the adverse effects of B. fabae on osmotic adjustment by inducing additional increase in proline, total soluble sugars, total soluble nitrogen and organic acids which in turn increase the osmotic pressure as well as relative water content in leaves of infected plants. Recovery of osmotic adjustment as well as leaf turgidity of infected host by using these chemical inducers may encourage the using of them as protective control means. The results of the present study showed also that the application of chemical inducers such as shikimic and salicylic acids or their interaction increased the resistance of Vicia faba against the chocolate spot disease.

  6. Limited acclimation in leaf anatomy to experimental drought in tropical rainforest trees.

    Science.gov (United States)

    Binks, Oliver; Meir, Patrick; Rowland, Lucy; da Costa, Antonio Carlos Lola; Vasconcelos, Steel Silva; de Oliveira, Alex Antonio Ribeiro; Ferreira, Leandro; Mencuccini, Maurizio

    2016-12-01

    Dry periods are predicted to become more frequent and severe in the future in some parts of the tropics, including Amazonia, potentially causing reduced productivity, higher tree mortality and increased emissions of stored carbon. Using a long-term (12 year) through-fall exclusion (TFE) experiment in the tropics, we test the hypothesis that trees produce leaves adapted to cope with higher levels of water stress, by examining the following leaf characteristics: area, thickness, leaf mass per area, vein density, stomatal density, the thickness of palisade mesophyll, spongy mesophyll and both of the epidermal layers, internal cavity volume and the average cell sizes of the palisade and spongy mesophyll. We also test whether differences in leaf anatomy are consistent with observed differential drought-induced mortality responses among taxa, and look for relationships between leaf anatomy, and leaf water relations and gas exchange parameters. Our data show that trees do not produce leaves that are more xeromorphic in response to 12 years of soil moisture deficit. However, the drought treatment did result in increases in the thickness of the adaxial epidermis (TFE: 20.5 ± 1.5 µm, control: 16.7 ± 1.0 µm) and the internal cavity volume (TFE: 2.43 ± 0.50 mm 3 cm -2 , control: 1.77 ± 0.30 mm 3 cm -2 ). No consistent differences were detected between drought-resistant and drought-sensitive taxa, although interactions occurred between drought-sensitivity status and drought treatment for the palisade mesophyll thickness (P = 0.034) and the cavity volume of the leaves (P = 0.025). The limited response to water deficit probably reflects a tight co-ordination between leaf morphology, water relations and photosynthetic properties. This suggests that there is little plasticity in these aspects of plant anatomy in these taxa, and that phenotypic plasticity in leaf traits may not facilitate the acclimation of Amazonian trees to the predicted future reductions in dry

  7. Apparent over-investment in leaf venation relaxes leaf morphological constraints on photosynthesis in arid habitats

    Science.gov (United States)

    de Boer, Hugo; Drake, Paul; Veneklaas, Erik

    2017-04-01

    The close relationship between leaf water status and stomatal conductance implies that the hydraulic architecture of leaves poses an important constraint on transpiration, specifically in arid environments with high evaporative demands. However, it remains uncertain how morphological, hydraulic and photosynthetic traits are coordinated to achieve optimal leaf functioning in arid environments. Critical is that leaf veins supply the mesophyll with water that evaporates when stomata are open to allow CO2 uptake for photosynthesis. Theoretical analyses suggest that water is optimally distributed in the mesophyll when the lateral distance between veins (dx) is equal to the distance from these veins to the epidermis (dy), expressed as dx:dy≈1. Although this theory is supported by observations on many derived angiosperms, we hypothesize that plants in arid environments may reduce dx:dy below unity owing to climate-specific functional adaptations of increased leaf thickness and increased vein density. To test our hypothesis we assembled leaf hydraulic, morphological and photosynthetic traits of 68 species from the Eucalyptus and Corymbia genera (termed eucalypts) along an aridity gradient in southwestern Australia. We inferred the potential gas exchange advantage of reducing dx beyond dy using a model that links leaf morphology and hydraulics to photosynthesis. Our observations reveal that eucalypts in arid environments have thick amphistomatous leaves with high vein densities, resulting in dx:dy ratios that range from 1.6 to 0.15 along the aridity gradient. Our model suggests that as leaves become thicker, the effect of reducing dx beyond dy is to offset the reduction in leaf gas exchange that would result from maintaining dx:dy at unity. This apparent over-investment in leaf venation may be explained from the selective pressure of aridity, under which traits associated with long leaf lifespan, high hydraulic and thermal capacitances, and high potential rates of leaf

  8. Antibacterial, Antibiofilm Effect of Burdock (Arctium lappa L.) Leaf Fraction and Its Efficiency in Meat Preservation.

    Science.gov (United States)

    Lou, Zaixiang; Li, Cheng; Kou, Xingran; Yu, Fuhao; Wang, Hongxin; Smith, Gary M; Zhu, Song

    2016-08-01

    First, the antibacterial, antibiofilm effect and chemical composition of burdock (Arctium lappa L.) leaf fractions were studied. Then, the efficiency of burdock leaf fractions in pork preservation was evaluated. The results showed that burdock leaf fraction significantly inhibited the growth and biofilm development of Escherichia coli and Salmonella Typhimurium. MICs of burdock leaf fractions on E. coli and Salmonella Typhimurium were both 2 mg/ml. At a concentration of 2.0 mg/ml, the inhibition rates of the fraction on growth and development of E. coli and Salmonella Typhimurium biofilms were 78.7 and 69.9%, respectively. During storage, the log CFU per gram of meat samples treated with burdock leaf fractions decreased 2.15, compared with the samples without treatment. The shelf life of pork treated with burdock leaf fractions was extended 6 days compared with the pork without treatment, and the sensory property was obviously improved. Compared with the control group, burdock leaf fraction treatment significantly decreased the total volatile basic nitrogen value and pH of the meat samples. Chemical composition analysis showed that the burdock leaf fraction consisted of chlorogenic acid, caffeic acid, p-coumaric acid, rutin, cynarin, crocin, luteolin, arctiin, and quercetin. As a vegetable with an abundant source, burdock leaf is safe, affordable, and efficient in meat preservation, indicating that burdock leaf fraction is a promising natural preservative for pork.

  9. Assessing urban habitat quality based on specific leaf area and stomatal characteristics of Plantago lanceolata L

    International Nuclear Information System (INIS)

    Kardel, F.; Wuyts, K.; Babanezhad, M.; Vitharana, U.W.A.; Wuytack, T.; Potters, G.; Samson, R.

    2010-01-01

    This study has evaluated urban habitat quality by studying specific leaf area (SLA) and stomatal characteristics of the common herb Plantago lanceolata L. SLA and stomatal density, pore surface and resistance were measured at 169 locations in the city of Gent (Belgium), distributed over four land use classes, i.e., sub-urban green, urban green, urban and industry. SLA and stomatal density significantly increased from sub-urban green towards more urbanised land use classes, while the reverse was observed for stomatal pore surface. Stomatal resistance increased in the urban and industrial land use class in comparison with the (sub-) urban green, but differences between land use classes were less pronounced. Spatial distribution maps for these leaf characteristics showed a high spatial variation, related to differences in habitat quality within the city. Hence, stomatal density and stomatal pore surface are assumed to be potentially good bio-indicators for urban habitat quality. - Stomatal characteristics of Plantago lanceolata can be used for biomonitoring of urban habitat quality.

  10. SP-LL-37, human antimicrobial peptide, enhances disease resistance in transgenic rice.

    Science.gov (United States)

    Lee, In Hye; Jung, Yu-Jin; Cho, Yong Gu; Nou, Ill Sup; Huq, Md Amdadul; Nogoy, Franz Marielle; Kang, Kwon-Kyoo

    2017-01-01

    Human LL-37 is a multifunctional antimicrobial peptide of cathelicidin family. It has been shown in recent studies that it can serve as a host's defense against influenza A virus. We now demonstrate in this study how signal peptide LL-37 (SP-LL-37) can be used in rice resistance against bacterial leaf blight and blast. We synthesized LL-37 peptide and subcloned in a recombinant pPZP vector with pGD1 as promoter. SP-LL-37 was introduced into rice plants by Agrobacterium mediated transformation. Stable expression of SP-LL-37 in transgenic rice plants was confirmed by RT-PCR and ELISA analyses. Subcellular localization of SP-LL-37-GFP fusion protein showed evidently in intercellular space. Our data on testing for resistance to bacterial leaf blight and blast revealed that the transgenic lines are highly resistant compared to its wildtype. Our results suggest that LL-37 can be further explored to improve wide-spectrum resistance to biotic stress in rice.

  11. Effect of Olive Leaf ( Powder on Laying Hens Performance, Egg Quality and Egg Yolk Cholesterol Levels

    Directory of Open Access Journals (Sweden)

    H. Cayan

    2015-04-01

    Full Text Available This experiment was conducted to measure the effects of olive leaf powder on performance, egg yield, egg quality and yolk cholesterol level of laying hens. A total of 120 Lohmann Brown laying hens of 22 weeks old were used in this experiment. The birds were fed on standard layer diets containing 0, 1%, 2%, or 3% olive leaf powder for 8 weeks. Egg weight and yield were recorded daily; feed intake weekly; egg quality and cholesterol content at the end of the trial. Olive leaf powder had no effect on feed intake, egg weight, egg yield and feed conversion ratio (p>0.05 while olive leaf powder increased final body weight of hens (p0.05. To conclude, olive leaf powder can be used for reducing egg yolk cholesterol content and egg yolk coloring agent in layer diets.

  12. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  13. NARROW LEAF 7 controls leaf shape mediated by auxin in rice

    NARCIS (Netherlands)

    Fujino, Kenji; Matsuda, Yasuyuki; Ozawa, Kenjirou; Nishimura, Takeshi; Koshiba, Tomokazu; Fraaije, Marco W.; Sekiguchi, Hiroshi

    Elucidation of the genetic basis of the control of leaf shape could be of use in the manipulation of crop traits, leading to more stable and increased crop production. To improve our understanding of the process controlling leaf shape, we identified a mutant gene in rice that causes a significant

  14. Leaf anatomy of the South African Danthonieae (Poaceae. XIII. Pentameris macrocalycina and P. obtusifolia

    Directory of Open Access Journals (Sweden)

    R. P. Ellis

    1984-12-01

    Full Text Available The leaf blade anatomy of Peniameris macrocalycina (Steud. Schweick. and P. obtusifolia (Hochst, Schweick. is described and illustrated. The leaf anatomy of these two species shows many similarities suggesting a close relationship between them. A slight problem appears to exist with the circumscription of P. obtusifolia and a minor taxonomic adjustment may result in a classification which agrees totally with that based on leaf anatomy. This would result in details of the leaf outline being diagnostic for these two taxa. The nomenclature of P. obtusifolia is also very confusing and clarification is needed by reference to the relevant type specimens. P. macrocalycina and P. obtusifolia together with  P. longiglumis (Nees Stapf, appear to form a distinct genus and do not bear close anatomical resemblances to either P. thuarri Beauv. or P. dregeana Stapf.

  15. Relation between Silver Nanoparticle Formation Rate and Antioxidant Capacity of Aqueous Plant Leaf Extracts

    Directory of Open Access Journals (Sweden)

    Azat Akbal

    2016-01-01

    Full Text Available Correlation between the antioxidant capacity and silver nanoparticle formation rates of pomegranate (Punica granatum, quince (Cydonia oblonga, chestnut (Castanea sativa, fig (Ficus carica, walnut (Juglans cinerea, black mulberry (Morus nigra, and white mulberry (Morus alba leaf extracts is investigated at a fixed illumination. Silver nanoparticles formed in all plant leaf extracts possess round shapes with average particle size of 15 to 25 nm, whereas corresponding surface plasmon resonance peak wavelengths vary between 422 nm and 451 nm. Cupric reducing antioxidant capacity technique is used as a reference method to determine total antioxidant capacity of the plant leaf extracts. Integrated absorbance over the plasmon resonance peaks exhibits better linear relation with antioxidant capacities of various plant leaf extracts compared to peak absorbance values, with correlation coefficient values of 0.9333 and 0.7221, respectively.

  16. Novel Digital Features Discriminate Between Drought Resistant and Drought Sensitive Rice Under Controlled and Field Conditions

    Directory of Open Access Journals (Sweden)

    Lingfeng Duan

    2018-04-01

    Full Text Available Dynamic quantification of drought response is a key issue both for variety selection and for functional genetic study of rice drought resistance. Traditional assessment of drought resistance traits, such as stay-green and leaf-rolling, has utilized manual measurements, that are often subjective, error-prone, poorly quantified and time consuming. To relieve this phenotyping bottleneck, we demonstrate a feasible, robust and non-destructive method that dynamically quantifies response to drought, under both controlled and field conditions. Firstly, RGB images of individual rice plants at different growth points were analyzed to derive 4 features that were influenced by imposition of drought. These include a feature related to the ability to stay green, which we termed greenness plant area ratio (GPAR and 3 shape descriptors [total plant area/bounding rectangle area ratio (TBR, perimeter area ratio (PAR and total plant area/convex hull area ratio (TCR]. Experiments showed that these 4 features were capable of discriminating reliably between drought resistant and drought sensitive accessions, and dynamically quantifying the drought response under controlled conditions across time (at either daily or half hourly time intervals. We compared the 3 shape descriptors and concluded that PAR was more robust and sensitive to leaf-rolling than the other shape descriptors. In addition, PAR and GPAR proved to be effective in quantification of drought response in the field. Moreover, the values obtained in field experiments using the collection of rice varieties were correlated with those derived from pot-based experiments. The general applicability of the algorithms is demonstrated by their ability to probe archival Miscanthus data previously collected on an independent platform. In conclusion, this image-based technology is robust providing a platform-independent tool for quantifying drought response that should be of general utility for breeding and functional

  17. Safety evaluation of Sapindus laurifolius leaf extract in Wistar rats

    Directory of Open Access Journals (Sweden)

    C. N. Santhosh Kumar

    2013-10-01

    Full Text Available Objectives:The present work was aimed to study the phytochemical composition of the Sapindus laurifolius leaves andtoxicological effect of the Sapindus laurifolius leaf extract in a systematic way using Wistar albino rats as a model animal.Materials and Methods :The identification of phytoconstituents present in the leaf extract was performed using Highperformance thin layer chromatography (HPTLC. In toxicity studies, the acute oral toxicity study was conducted as per theguidelines of Organization for Economic Co-operation and Development (OECD 423 Acute Toxic Class Method for testingof chemicals. In repeated dose 28-day oral toxicity study (OECD 407, methanolic leaf extract administered at the dose of 50,200 and 800 mg/kg BWand limit dose of 1000 mg/kg BW.Results: Saponins, flavanoids, glycosides and bitter principles were the major phytoconstituents identified. In acute toxicitystudy, the LD cut-off values were found to be more than 2g/kg in leaf extract. In repeated dose 28-day oral toxicity, significant 50(P<0.05 increase in AST, ALT, BUN and creatinine, significant (P<0.05 increase in total protein was noticed. Thehistopathological changes confined to liver, kidney and intestine, revealed mild to moderate hepatotoxicity, severenephrotoxicity and increased goblet cell activity. The changes were found to correlate with increased dose of leaf extract.Conclusion:The phytochemical analysis of Sapindus laurifolius revealed the presence of saponins, glycosides, flavonoidsand bitter principles.The acute oral toxicity study of S. laurifolius methanolic leaf extract in rats resulted in no toxicity even atthe highest dose, but in repeated 28-day oral toxicity study revealed mild to moderate hepatotoxicity, severe nephrotoxicityand intestinal damage.

  18. Comparisons of Herbicide Treated and Cultivated Herbicide-Resistant Corn

    Directory of Open Access Journals (Sweden)

    H. Arnold Bruns

    2010-01-01

    Full Text Available Four glyphosate resistant corn (Zea mays L. hybrids, a glufosinate-ammonium resistant hybrid, and a conventional atrazine resistant hybrid gown at Stoneville, MS in 2005, 2006, and 2007 with furrow irrigation were treated with their respective herbicides and their growth, yield, and mycotoxin incidence were compared with untreated cultivated plots. Leaf area index (LAI and dry matter accumulation (DMA were collected on a weekly basis beginning at growth stage V3 and terminating at anthesis. Crop growth rates (CRGs and relative growth rates (RGRs were calculated. Plots were later harvested, yield and yield component data collected, and kernel samples analyzed for aflatoxin and fumonisin. Leaf area index, DMA, CRG, and RGR were not different among the herbicide treated plots and from those that were cultivated. Curves for LAI and DMA were similar to those previously reported. Aflatoxin and fumonisin were relatively low in all plots. Herbicide application or the lack thereof had no negative impact on the incidence of kernel contamination by these two mycotoxins. Herbicides, especially glyphosate on resistant hybrids, have no negative effects on corn yields or kernel quality in corn produced in a humid subtropical environment.

  19. Endocrine factors related to changes in total peripheral vascular resistance after treatment of thyrotoxic and hypothyroid patients

    NARCIS (Netherlands)

    Diekman, M. J.; Harms, M. P.; Endert, E.; Wieling, W.; Wiersinga, W. M.

    2001-01-01

    Total peripheral vascular resistance (TPR) decreases in thyrotoxicosis and increases in hypothyroidism. Several mechanisms may be involved, including adaptation to changes in heat production and direct non-genomic effects of tri-iodothyronine (T3) on vascular smooth muscle cells. The aim of this

  20. Intraspecific variation in aphid resistance and constitutive phenolics exhibited by the wild blueberry Vaccinium darrowi.

    Science.gov (United States)

    Ranger, C M; Singh, A P; Johnson-Cicalese, J; Polavarapu, S; Vorsa, N

    2007-04-01

    Illinoia pepperi (MacGillivray) infests cultivated highbush blueberries, Vaccinium corymbosum L., in the Northeastern United States. Allopatric resistance to I. pepperi was examined in Vaccinium darrowi Camp, which evolved in the absence of I. pepperi in the Southeastern U.S. V. corymbosum cv. "Elliott", was used as a susceptible control. Between population variability in I. pepperi resistance was assessed by measuring length of the prereproductive period, fecundity, and survivorship on 14 V. darrowi accessions representing 11 discrete wild populations. Length of I. pepperi's prereproductive period and survivorship were not significantly affected. However, differences were detected in fecundity and the intrinsic rate of increase (r ( m )). Within population variability in resistance was measured by confining first instars to 24 accessions from a single wild population of V. darrowi (NJ88-06). Significant differences in the mean total number of aphids occurring after 20 d were only detected between 2 of the 24 V. darrowi accessions. A greater degree of diversity in I. pepperi resistance exists between populations of V. darrowi compared to within a population. Constitutive leaf and stem polyphenolics were identified by HPLC-MS and quantified from 14 of the V. darrowi accessions. The accessions varied in concentrations of five phenolic acids and seven flavonol glycosides, but a correlation was not found between individual or total phenolics and aphid performance. Overall, screening within and between populations of V. darrowi identified promising sources of aphid resistance, but phenolic acid and flavonol glycoside profiles did not predict resistance levels. The mechanism of resistance remains to be identified.

  1. Scaling up stomatal conductance from leaf to canopy using a dual-leaf model for estimating crop evapotranspiration.

    Directory of Open Access Journals (Sweden)

    Risheng Ding

    Full Text Available The dual-source Shuttleworth-Wallace model has been widely used to estimate and partition crop evapotranspiration (λET. Canopy stomatal conductance (Gsc, an essential parameter of the model, is often calculated by scaling up leaf stomatal conductance, considering the canopy as one single leaf in a so-called "big-leaf" model. However, Gsc can be overestimated or underestimated depending on leaf area index level in the big-leaf model, due to a non-linear stomatal response to light. A dual-leaf model, scaling up Gsc from leaf to canopy, was developed in this study. The non-linear stomata-light relationship was incorporated by dividing the canopy into sunlit and shaded fractions and calculating each fraction separately according to absorbed irradiances. The model includes: (1 the absorbed irradiance, determined by separately integrating the sunlit and shaded leaves with consideration of both beam and diffuse radiation; (2 leaf area for the sunlit and shaded fractions; and (3 a leaf conductance model that accounts for the response of stomata to PAR, vapor pressure deficit and available soil water. In contrast to the significant errors of Gsc in the big-leaf model, the predicted Gsc using the dual-leaf model had a high degree of data-model agreement; the slope of the linear regression between daytime predictions and measurements was 1.01 (R2 = 0.98, with RMSE of 0.6120 mm s-1 for four clear-sky days in different growth stages. The estimates of half-hourly λET using the dual-source dual-leaf model (DSDL agreed well with measurements and the error was within 5% during two growing seasons of maize with differing hydrometeorological and management strategies. Moreover, the estimates of soil evaporation using the DSDL model closely matched actual measurements. Our results indicate that the DSDL model can produce more accurate estimation of Gsc and λET, compared to the big-leaf model, and thus is an effective alternative approach for estimating and

  2. High-throughput phenotyping of plant resistance to aphids by automated video tracking.

    Science.gov (United States)

    Kloth, Karen J; Ten Broeke, Cindy Jm; Thoen, Manus Pm; Hanhart-van den Brink, Marianne; Wiegers, Gerrie L; Krips, Olga E; Noldus, Lucas Pjj; Dicke, Marcel; Jongsma, Maarten A

    2015-01-01

    Piercing-sucking insects are major vectors of plant viruses causing significant yield losses in crops. Functional genomics of plant resistance to these insects would greatly benefit from the availability of high-throughput, quantitative phenotyping methods. We have developed an automated video tracking platform that quantifies aphid feeding behaviour on leaf discs to assess the level of plant resistance. Through the analysis of aphid movement, the start and duration of plant penetrations by aphids were estimated. As a case study, video tracking confirmed the near-complete resistance of lettuce cultivar 'Corbana' against Nasonovia ribisnigri (Mosely), biotype Nr:0, and revealed quantitative resistance in Arabidopsis accession Co-2 against Myzus persicae (Sulzer). The video tracking platform was benchmarked against Electrical Penetration Graph (EPG) recordings and aphid population development assays. The use of leaf discs instead of intact plants reduced the intensity of the resistance effect in video tracking, but sufficiently replicated experiments resulted in similar conclusions as EPG recordings and aphid population assays. One video tracking platform could screen 100 samples in parallel. Automated video tracking can be used to screen large plant populations for resistance to aphids and other piercing-sucking insects.

  3. The wheat homolog of putative nucleotide-binding site-leucine-rich repeat resistance gene TaRGA contributes to resistance against powdery mildew.

    Science.gov (United States)

    Wang, Defu; Wang, Xiaobing; Mei, Yu; Dong, Hansong

    2016-03-01

    Powdery mildew, one of the most destructive wheat diseases worldwide, is caused by Blumeria graminis f. sp. tritici (Bgt), a fungal species with a consistently high mutation rate that makes individual resistance (R) genes ineffective. Therefore, effective resistance-related gene cloning is vital for breeding and studying the resistance mechanisms of the disease. In this study, a putative nucleotide-binding site-leucine-rich repeat (NBS-LRR) R gene (TaRGA) was cloned using a homology-based cloning strategy and analyzed for its effect on powdery mildew disease and wheat defense responses. Real-time reverse transcription-PCR (RT-PCR) analyses revealed that a Bgt isolate 15 and salicylic acid stimulation significantly induced TaRGA in the resistant variety. Furthermore, the silencing of TaRGA in powdery mildew-resistant plants increased susceptibility to Bgt15 and prompted conidia propagation at the infection site. However, the expression of TaRGA in leaf segments after single-cell transient expression assay highly increased the defense responses to Bgt15 by enhancing callose deposition and phenolic autofluorogen accumulation at the pathogen invading sites. Meanwhile, the expression of pathogenesis-related genes decreased in the TaRGA-silenced plants and increased in the TaRGA-transient-overexpressing leaf segments. These results implied that the TaRGA gene positively regulates the defense response to powdery mildew disease in wheat.

  4. Spectral measurements at different spatial scales in potato: relating leaf, plant and canopy nitrogen status

    Science.gov (United States)

    Jongschaap, Raymond E. E.; Booij, Remmie

    2004-09-01

    Chlorophyll contents in vegetation depend on soil nitrogen availability and on crop nitrogen uptake, which are important management factors in arable farming. Crop nitrogen uptake is important, as nitrogen is needed for chlorophyll formation, which is important for photosynthesis, i.e. the conversion of absorbed radiance into plant biomass. The objective of this study was to estimate leaf and canopy nitrogen contents by near and remote sensing observations and to link observations at leaf, plant and canopy level. A theoretical base is presented for scaling-up leaf optical properties to whole plants and crops, by linking different optical recording techniques at leaf, plant and canopy levels through the integration of vertical nitrogen distribution. Field data come from potato experiments in The Netherlands in 1997 and 1998, comprising two potato varieties: Eersteling and Bintje, receiving similar nitrogen treatments (0, 100, 200 and 300 kg N ha -1) in varying application schemes to create differences in canopy nitrogen status during the growing season. Ten standard destructive field samplings were performed to follow leaf area index and crop dry weight evolution. Samples were analysed for inorganic nitrogen and total nitrogen contents. At sampling dates, spectral measurements were taken both at leaf level and at canopy level. At leaf level, an exponential relation between SPAD-502 readings and leaf organic nitrogen contents with a high correlation factor of 0.91 was found. At canopy level, an exponential relation between canopy organic nitrogen contents and red edge position ( λrep, nm) derived from reflectance measurements was found with a good correlation of 0.82. Spectral measurements (SPAD-502) at leaf level of a few square mm were related to canopy reflectance measurements (CropScan™) of approximately 0.44 m 2. Statistical regression techniques were used to optimise theoretical vertical nitrogen profiles that allowed scaling-up leaf chlorophyll measurements

  5. Seasonality of Leaf Carbon Isotopic Composition and Leaf Water Isotopic Enrichment in a Mixed Evergreen Forest in Southern California

    Science.gov (United States)

    Santiago, L. S.; Sickman, J. O.; Goulden, M.; DeVan, C.; Pasquini, S. C.; Pivovaroff, A. L.

    2011-12-01

    Leaf carbon isotopic composition and leaf water isotopic enrichment reflect physiological processes and are important for linking local and regional scale processes to global patterns. We investigated how seasonality affects the isotopic composition of bulk leaf carbon, leaf sugar carbon, and leaf water hydrogen under a Mediterranean climate. Leaf and stem samples were collected monthly from four tree species (Calocedrus decurrens, Pinus lambertiana, Pinus ponderosa, and Quercus chrysolepis) at the James San Jacinto Mountain Reserve in southern California. Mean monthly bulk leaf carbon isotopic composition varied from -34.5 % in P. ponderosa to -24.7 % in P. lambertiana and became more depleted in 13C from the spring to the summer. Mean monthly leaf sugar varied from -29.3 % in P. ponderosa to -21.8 % in P. lambertiana and was enriched in 13C during the winter, spring and autumn, but depleted during the mid-summer. Leaf water hydrogen isotopic composition was 28.4 to 68.8 % more enriched in deuterium than source water and this enrichment was greater as seasonal drought progressed. These data indicate that leaf carbon and leaf water hydrogen isotopic composition provide sensitive measures that connect plant physiological processes to short-term climatic variability.

  6. Leaf Protein and Mineral Concentrations across the "Miracle Tree" Genus Moringa.

    Science.gov (United States)

    Olson, Mark E; Sankaran, Renuka P; Fahey, Jed W; Grusak, Michael A; Odee, David; Nouman, Wasif

    2016-01-01

    The moringa tree Moringa oleifera is a fast-growing, drought-resistant tree cultivated across the lowland dry tropics worldwide for its nutritious leaves. Despite its nutritious reputation, there has been no systematic survey of the variation in leaf nutritional quality across M. oleifera grown worldwide, or of the other species of the genus. To guide informed use of moringa, we surveyed protein, macro-, and micro- nutrients across 67 common garden samples of 12 Moringa taxa, including 23 samples of M. oleifera. Moringa oleifera, M. concanensis, M. stenopetala, an M. concanensis X oleifera hybrid, and M. longituba were highest in protein, with M. ruspoliana having the highest calcium levels. A protein-dry leaf mass tradeoff may preclude certain breeding possibilities, e.g. maximally high protein with large leaflets. These findings identify clear priorities and limitations for improved moringa varieties with traits such as high protein, calcium, or ease of preparation.

  7. Leaf sequencing algorithms for segmented multileaf collimation

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Li, Jonathan; Palta, Jatinder; Ranka, Sanjay

    2003-01-01

    The delivery of intensity-modulated radiation therapy (IMRT) with a multileaf collimator (MLC) requires the conversion of a radiation fluence map into a leaf sequence file that controls the movement of the MLC during radiation delivery. It is imperative that the fluence map delivered using the leaf sequence file is as close as possible to the fluence map generated by the dose optimization algorithm, while satisfying hardware constraints of the delivery system. Optimization of the leaf sequencing algorithm has been the subject of several recent investigations. In this work, we present a systematic study of the optimization of leaf sequencing algorithms for segmental multileaf collimator beam delivery and provide rigorous mathematical proofs of optimized leaf sequence settings in terms of monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation constraint and leaf interdigitation constraint. Our analytical analysis shows that leaf sequencing based on unidirectional movement of the MLC leaves is as MU efficient as bidirectional movement of the MLC leaves

  8. Leaf sequencing algorithms for segmented multileaf collimation

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States)

    2003-02-07

    The delivery of intensity-modulated radiation therapy (IMRT) with a multileaf collimator (MLC) requires the conversion of a radiation fluence map into a leaf sequence file that controls the movement of the MLC during radiation delivery. It is imperative that the fluence map delivered using the leaf sequence file is as close as possible to the fluence map generated by the dose optimization algorithm, while satisfying hardware constraints of the delivery system. Optimization of the leaf sequencing algorithm has been the subject of several recent investigations. In this work, we present a systematic study of the optimization of leaf sequencing algorithms for segmental multileaf collimator beam delivery and provide rigorous mathematical proofs of optimized leaf sequence settings in terms of monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation constraint and leaf interdigitation constraint. Our analytical analysis shows that leaf sequencing based on unidirectional movement of the MLC leaves is as MU efficient as bidirectional movement of the MLC leaves.

  9. The narrow-leaf syndrome: a functional and evolutionary approach to the form of fog-harvesting rosette plants.

    Science.gov (United States)

    Martorell, Carlos; Ezcurra, Exequiel

    2007-04-01

    Plants that use fog as an important water-source frequently have a rosette growth habit. The performance of this morphology in relation to fog interception has not been studied. Some first-principles from physics predict that narrow leaves, together with other ancillary traits (large number and high flexibility of leaves, caudices, and/or epiphytism) which constitute the "narrow-leaf syndrome" should increase fog-interception efficiency. This was tested using aluminum models of rosettes that differed in leaf length, width and number and were exposed to artificial fog. The results were validated using seven species of Tillandsia and four species of xerophytic rosettes. The total amount of fog intercepted in rosette plants increased with total leaf area, while narrow leaves maximized interception efficiency (measured as interception per unit area). The number of leaves in the rosettes is physically constrained because wide-leafed plants can only have a few blades. At the limits of this constraint, net fog interception was independent of leaf form, but interception efficiency was maximized by large numbers of narrow leaves. Atmospheric Tillandsia species show the narrow-leaf syndrome. Their fog interception efficiencies were correlated to the ones predicted from aluminum-model data. In the larger xerophytic rosette species, the interception efficiency was greatest in plants showing the narrow-leaf syndrome. The adaptation to fog-harvesting in several narrow-leaved rosettes was tested for evolutionary convergence in 30 xerophytic rosette species using a comparative method. There was a significant evolutionary tendency towards the development of the narrow-leaf syndrome the closer the species grew to areas where fog is frequently available. This study establishes convergence in a very wide group of plants encompassing genera as contrasting as Tillandsia and Agave as a result of their dependence on fog.

  10. Leaf development of soybean and bean crops and weeds

    International Nuclear Information System (INIS)

    Procopio, Sergio de Oliveira; Santos, Jose Barbosa do; Silva, Antonio Alberto da; Costa, Luiz Claudio

    2003-01-01

    The objective of this study was to compare the emission rate and expansion of the leaves, duration of the leaf area (DLA) and the extinction coefficient (k) for the crops soybean and of the bean, and for the weeds Euphorbia heterophylla sensitive and Euphorbia heterophylla resistant to the herbicides inhibiting of the ALS enzyme, Bidens pilosa and Desmodium tortuosum. The experiment was developed in the field, in soil classified as Red-Yellow Claysoil, in the period of october of 2000 to march of 2001. Each plant species consisted of a treatment. The treatments were arranged in a randomized complete block design with four replications. The mensurations of the photosynthetically active radiation (PAR) were accomplished in two points of the plants: above and bellow the canopy, by means of a light ceptometer. The emission rate and the expansion of leaves was calculated at the end of the cycle of the crops. The DLA and k were calculated before and after the plant flowering. It was not observed differences in the development of the biotypes of E. heterophylla with relation to the rate of appearance of leaves, expansion rate, DLA or k. Among the cultures, the bean presented smaller leaf emission rate (0.591 / day) compared to the soybean (0.933 / day). Among the weeds, the largest leaf emission rate was with D. tortuosum (0.699 / day). The leaf expansion rate observed by the soybean was superior to all the other species (6.77 cm 2 .day-1). All plant species presented larger value for DLA after the flowering compared before flowering. The soybean presented larger value of k (before and after the flowering 0.52 and 0.93, respectively) compared to the other species, demonstrating high potential of interception of solar radiation. (author)

  11. Study on creation of an indocalamus leaf flavor

    Directory of Open Access Journals (Sweden)

    Guangyong ZHU

    2015-01-01

    Full Text Available AbstractFlavors represent a small but significant segment of food industry. Sensory characteristics play an important role in the process of consumer acceptance and preference. Indocalamus leaf takes on a pleasant odor and indocalamus leaf flavor can be used in many products. However, indocalamus leaf flavor formula has not been reported. Therefore, developing an indocalamus leaf flavor is of significant interests. Note is a distinct flavor or odor characteristic. This paper concentrates on preparation and creation of indocalamus leaf flavor according to the notes of indocalamus leaf. The notes were obtained by smelling indocalamus leaf, and the results showed that the notes of indocalamus leaf flavor can be classified as: green-leafy note, sweet note, beany note, aldehydic note, waxy note, woody note, roast note, creamy note, and nutty note. According to the notes of indocalamus leaf odor, a typical indocalamus leaf flavor formula was obtained. The indocalamus leaf flavor blended is pleasant, harmonious, and has characteristics of indocalamus leaf odor.

  12. Effects of feeding different proportions of silver leaf desmodium (Dismodium uncinatum) with banana (Musa paradisiaca) leaf on nutrient utilization in Horro sheep fed a basal diet of natural grass hay.

    Science.gov (United States)

    Chali, Diriba; Nurfeta, Ajebu; Banerjee, Sandip; Eik, Lars Olav

    2018-03-02

    The objective was to evaluate feed intake, digestibility, body weight change and carcass characteristics of sheep fed a basal diet of hay supplemented with banana leaves and silver leaf desmodium. Thirty yearling lambs with an average initial body weight of 15.85 ± 1.6 kg were grouped into six blocks of five rams in each block. The treatments were: hay alone (T1), hay + 100% banana leaf (T2), hay + 67% banana leaf + 33% desmodium leaf (T3), hay + 33% banana leaf + 67% desmodium leaf (T4) and hay + 100% desmodium leaf (T5). Three hundred grams of treatment diets were offered daily on as fed basis. The feeding and digestibility trial lasted for 84 and 7 days, respectively, followed by carcass evaluation. The total dry matter (DM) intake for T3, T4 and T5 were greater (P T4 > T3 > T2 > T1. Rams lambs receiving supplementary diets had higher (P<0.05) DM, OM, CP, neutral detergent fiber and acid detergent fiber digestibility compared with the control diet. The empty body weight and slaughter weight was highest (P<0.05) in rams receiving T3, T4 and T5 diets. The average daily gain and feed conversion efficiency was highest (P<0.05) in rams receiving the supplementary diets. The DP on the basis of hot carcass weight linearly increased with increasing levels of desmodium. Rams reared on supplementary diet had higher (P<0.05) rib eye area compared with the control diet. In conclusion, when banana leaf is used as a supplement to poor quality grass, better response was obtained when fed in combination with desmodium.

  13. Association between QTLs and morphological traits toward sheath blight resistance in rice (Oryza sativa L.)

    Science.gov (United States)

    Hossain, Md Kamal; Jena, Kshirod Kumar; Bhuiyan, Md Atiqur Rahman; Wickneswari, Ratnam

    2016-01-01

    Sheath blight is considered the most significant disease of rice and causes enormous yield losses over the world. Breeding for resistant varieties is the only viable option to combat the disease efficiently. Seventeen diverged rice genotypes along with 17 QTL-linked SSR markers were evaluated under greenhouse conditions. Pearson’s correlation showed only the flag leaf angle had a significant correlation with sheath blight resistance under greenhouse screening. Multivariate analysis based on UPGMA clustering and principal component analysis (PCA) indicated that the flag leaf angle, flag leaf length, and plant compactness were significantly associated with the following SSR marker alleles: RM209 (116,130), RM202 (176), RM224 (126), RM257 (156), RM426 (175), and RM6971 (196), which are linked to the SB QTLs: QRlh11, qSBR11-3, qSBR11-1, qSBR9-1, qShB3-2, and qSB-9. A Mantel test suggested a weak relationship between the observed phenotypes and allelic variation patterns, implying the independent nature of morphological and molecular variations. Teqing and Tetep were found to be the most resistant cultivars. IR65482-4-136-2-2, MR219-4, and MR264 showed improved resistance potentials. These results suggest that the morphological traits and QTLs which have been found to associate with sheath blight resistance are a good choice to enhance resistance through pyramiding either 2 QTLs or QTLs and traits in susceptible rice cultivars. PMID:27795687

  14. A model-based approach to preplanting risk assessment for gray leaf spot of maize.

    Science.gov (United States)

    Paul, P A; Munkvold, G P

    2004-12-01

    ABSTRACT Risk assessment models for gray leaf spot of maize, caused by Cercospora zeae-maydis, were developed using preplanting site and maize genotype data as predictors. Disease severity at the dough/dent plant growth stage was categorized into classes and used as the response variable. Logistic regression and classification and regression tree (CART) modeling approaches were used to predict severity classes as a function of planting date (PD), amount of maize soil surface residue (SR), cropping sequence, genotype maturity and gray leaf spot resistance (GLSR) ratings, and longitude (LON). Models were development using 332 cases collected between 1998 and 2001. Thirty cases collected in 2002 were used to validate the models. Preplanting data showed a strong relationship with late-season gray leaf spot severity classes. The most important predictors were SR, PD, GLSR, and LON. Logistic regression models correctly classified 60 to 70% of the validation cases, whereas the CART models correctly classified 57 to 77% of these cases. Cases misclassified by the CART models were mostly due to overestimation, whereas the logistic regression models tended to misclassify cases by underestimation. Both the CART and logistic regression models have potential as management decision-making tools. Early quantitative assessment of gray leaf spot risk would allow for more sound management decisions being made when warranted.

  15. Ampalaya (Momordica Charantia Leaf Extract Against Gastro-Intestinal Parasites of Native Chicken

    Directory of Open Access Journals (Sweden)

    Glynda F. Pariñas

    2017-05-01

    Full Text Available The general objective of the study is to determine the effectiveness of ampalaya leaf extract against gastrointestinal parasites of native chicken. Specifically, it aimed to:(1to evaluate the anthelmintic property of ampalaya leaf extract in the treatment of gastro-intestinal parasites of native chicken;(2 find out the most effective variety of ampalaya leaves as purgatives for native chicken; and(3 to compare the efficacy of ampalaya leaf extract with commercial purgative in the treatment of gastro-intestinal parasites. A total of fifteen (15 experimental native chickens were used in each study which was distributed into five (5 treatments. For study 1 and 2, Commercial purgative (Piperazine dihydrocloride and commercial purgative (mebendasole, niclosamide and levamisole were used respectively as positive control. Based on the result of the study, ampalaya leaf extract shows comparable effect to positive control (Piperazine dihydrochloride in treating and controlling gastro-intestinal parasites of native chicken. However, commercial purgative with triple ingredient (mebendasole, niclosamide and levamisole shows more effective than the ampalaya extract. The researcher concludes that efficacy of ampalaya leaf extract as purgative is comparable to the effect of commercial purgative with single active ingreadient (Piperazine dihydrochloride, commercial purgative with triple active ingredients ( mebendasole, niclosamide and levamisole excelled over the ampalaya extract because of its multi-ingredients.

  16. Enhancement of Biogas Yield of Poplar Leaf by High-Solid Codigestion with Swine Manure.

    Science.gov (United States)

    Wangliang, Li; Zhikai, Zhang; Guangwen, Xu

    2016-05-01

    The aim of this work was to examine the improvement of anaerobic biodegradability of organic fractions of poplar leaf from codigestion with swine manure (SM), thus biogas yield and energy recovery. When poplar leaf was used as a sole substrate, the cumulative biogas yield was low, about 163 mL (g volatile solid (VS))(-1) after 45 days of digestion with a substrate/inoculum ratio of 2.5 and a total solid (TS) of 22 %. Under the same condition, the cumulative biogas yield of poplar leaf reached 321 mL (g VS)(-1) when SM/poplar leaf ratio was 2:5 (based on VS). The SM/poplar leaf ratio can determine C/N ratio of the cosubstrate and thus has significant influence on biogas yield. When the SM/poplar leaf ratio was 2:5, C/N ratio was calculated to be 27.02, and the biogas yield in 45 days of digestion was the highest. The semi-continuous digestion of poplar leaf was carried out with the organic loading rate of 1.25 and 1.88 g VS day(-1). The average daily biogas yield was 230.2 mL (g VS)(-1) and 208.4 mL (g VS)(-1). The composition analysis revealed that cellulose and hemicellulose contributed to the biogas production.

  17. Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field.

    Science.gov (United States)

    Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat

    2018-04-01

    The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.

  18. Resistance Inheritance of Plutellaxylostella Population to Residual of Emamectin Benzoat

    OpenAIRE

    Udi Tarwotjo; Rully Rahardian

    2017-01-01

    Excessive use of insecticides drives the increasing ability of pests to become resistant. The objectives of this research were to study the susceptibility and the resistance inheritance of the eleven population of P. xylostella to emamectin benzoate. The leaf-dip bioassay was applied to determine the sensitivity of P. xylostella to emamectin benzoate. The offspring of backcrossed F2 were tested whether the resistance was controlled by monogenic. The results showed that the LC50 of the Selo po...

  19. Eradication of multidrug-resistant Acinetobacter baumannii in a female patient with total hip arthroplasty, with debridement and retention: a case report

    Directory of Open Access Journals (Sweden)

    Beieler Alison M

    2009-02-01

    Full Text Available Abstract Introduction Multidrug-resistant Acinetobacter baumannii has become a significant cause of healthcare-associated infections, but few reports have addressed Acinetobacter baumannii infections associated with orthopedic devices. The current recommended treatment for complicated infections due to orthopedic devices, including resistant gram-negative rods, consists of antimicrobial therapy with debridement and removal of implants. Case presentation The patient, a 47-year-old woman, had previously had a prior total hip arthroplasty at 16 years of age for a complex femoral neck fracture, and multiple subsequent revisions. This time, she underwent a fifth revision secondary to pain. Surgery was complicated by hypotension resulting in transfer to the intensive care unit and prolonged respiratory failure. She received peri-operative cefazolin but postoperatively developed surgical wound drainage requiring debridement of a hematoma. Cultures of this grew ampicillin-sensitive Enterococcus and Acinetobacter baumannii (sensitive only to amikacin and imipenem. The patient was started on imipenem. Removal of the total hip arthroplasty was not recommended because of the recent surgical complications, and the patient was eventually discharged home. She was seen weekly for laboratory tests and examinations and, after 4 months of therapy, the imipenem was discontinued. She did well clinically for 7 months before recurrent pain led to removal of the total hip arthroplasty. Intra-operative cultures grew ampicillin-sensitive Enterococcus and coagulase-negative Staphylococcus but no multidrug-resistant Acinetobacter baumannii. The patient received ampicillin for 8 weeks and had not had recurrent infection at the time of writing, 37 months after discontinuing imipenem. Conclusion We describe the successful treatment of an acute infection from multidrug-resistant Acinetobacter baumannii with debridement and retention of the total hip arthroplasty, using

  20. Assessing the ratio of leaf carbon to nitrogen in winter wheat and spring barley based on hyperspectral data

    Science.gov (United States)

    Xu, Xin-gang; Gu, Xiao-he; Song, Xiao-yu; Xu, Bo; Yu, Hai-yang; Yang, Gui-jun; Feng, Hai-kuan

    2016-10-01

    The metabolic status of carbon (C) and nitrogen (N) as two essential elements of crop plants has significant influence on the ultimate formation of yield and quality in crop production. The ratio of carbon to nitrogen (C/N) from crop leaves, defined as ratio of LCC (leaf carbon concentration) to LNC (leaf nitrogen concentration), is an important index that can be used to diagnose the balance between carbon and nitrogen, nutrient status, growth vigor and disease resistance in crop plants. Thus, it is very significant for effectively evaluating crop growth in field to monitor changes of leaf C/N quickly and accurately. In this study, some typical indices aimed at N estimation and chlorophyll evaluation were tested to assess leaf C/N in winter wheat and spring barley. The multi-temporal hyperspectral measurements from the flag-leaf, anthesis, filling, and milk-ripe stages were used to extract these selected spectral indices to estimate leaf C/N in wheat and barley. The analyses showed that some tested indices such as MTCI, MCARI/OSAVI2, and R-M had the better performance of assessing C/N for both of crops. Besides, a mathematic algorithm, Branch-and-Bound (BB) method was coupled with the spectral indices to assess leaf C/N in wheat and barley, and yielded the R2 values of 0.795 for winter wheat, R2 of 0.727 for spring barley, 0.788 for both crops combined. It demonstrates that using hyperspectral data has a good potential for remote assessment of leaf C/N in crops.

  1. DIFFERENCES IN LEAF GAS EXCHANGE AND LEAF CHARACTERISTICS BETWEEN TWO ALMOND CULTIVARS

    Directory of Open Access Journals (Sweden)

    George D. Nanos

    2013-12-01

    Full Text Available Leaf chlorophyll content, specific leaf weight (SLW, photosynthetic and transpiration rates, stomatal functioning, water use efficiency and quantum yield were assessed during the kernel filling period for two consecutive years in order to understand tissue-centered physiological profile differences between two commercial almond cultivars, ‘Ferragnès’ and ‘Texas’. Similar SLWs were observed on the studied cultivars; however, chlorophyll content, net photosynthetic and transpiration rates and stomatal functioning demonstrated statistically significant differences. In both cultivars, an overall decline in the examined parameters towards fruit maturation (i.e. end of the summer was recorded. ‘Ferragnès’ leaves were found to be more efficient in leaf photosynthesis related performance during kernel filling, when irrigated sufficiently, in comparison to ‘Texas’ leaves. Low average values of leaf conductance during summer in ‘Texas’ leaves revealed its potential for adaptation in cool climates and increased carbon assimilation therein for high kernel yield.

  2. Influence of heat stress on leaf morphology and nitrogen–carbohydrate metabolisms in two wucai (Brassica campestris L. genotypes

    Directory of Open Access Journals (Sweden)

    Lingyun Yuan

    2017-06-01

    Full Text Available Heat stress is a major environmental stress that limits plant growth and yield worldwide. The present study was carried out to explore the physiological mechanism of heat tolerant to provide the theoretical basis for heat-tolerant breeding. The changes of leaf morphology, anatomy, nitrogen assimilation, and carbohydrate metabolism in two wucai genotypes (WS-1, heat tolerant; WS-6, heat sensitive grown under heat stress (40°C/30°C for 7 days were investigated. Our results showed that heat stress hampered the plant growth and biomass accumulation in certain extent in WS-1 and WS-6. However, the inhibition extent of WS-1 was significantly smaller than WS-6. Thickness of leaf lamina, upper epidermis, and palisade mesophyll were increased by heat in WS-1, which might be contributed to the higher assimilation of photosynthates. During nitrogen assimilation, WS-1 possessed the higher nitrogen-related metabolic enzyme activities, including nitrate reductase (NR, glutamine synthetase (GS, glutamate synthase (GOGAT, and glutamate dehydrogenase (GDH, which were reflected by higher photosynthetic nitrogen-use efficiency (PNUE with respect to WS-6. The total amino acids level had no influence in WS-1, whereas it was reduced in WS-6 by heat. And the proline contents of both wucai genotypes were all increased to respond the heat stress. Additionally, among all treatments, the total soluble sugar content of WS-1 by heat got the highest level, including higher contents of sucrose, fructose, and starch than those of WS-6. Moreover, the metabolism efficiency of sucrose to starch in WS-1 was greater than WS-6 under heat stress, proved by higher activities of sucrose phosphate synthase (SPS, sucrose synthase (SuSy, acid invertase (AI, and amylase. These results demonstrated that leaf anatomical alterations resulted in higher nitrogen and carbon assimilation in heat-tolerant genotype WS-1, which exhibited a greater performance to resist heat stress.

  3. An evolutionary attractor model for sapwood cross section in relation to leaf area.

    Science.gov (United States)

    Westoby, Mark; Cornwell, William K; Falster, Daniel S

    2012-06-21

    Sapwood cross-sectional area per unit leaf area (SA:LA) is an influential trait that plants coordinate with physical environment and with other traits. We develop theory for SA:LA and also for root surface area per leaf area (RA:LA) on the premise that plants maximizing the surplus of revenue over costs should have competitive advantage. SA:LA is predicted to increase in water-relations environments that reduce photosynthetic revenue, including low soil water potential, high water vapor pressure deficit (VPD), and low atmospheric CO(2). Because sapwood has costs, SA:LA adjustment does not completely offset difficult water relations. Where sapwood costs are large, as in tall plants, optimal SA:LA may actually decline with (say) high VPD. Large soil-to-root resistance caps the benefits that can be obtained from increasing SA:LA. Where a plant can adjust water-absorbing surface area of root per leaf area (RA:LA) as well as SA:LA, optimal RA:SA is not affected by VPD, CO(2) or plant height. If selection favours increased height more so than increased revenue-minus-cost, then height is predicted to rise substantially under improved water-relations environments such as high-CO(2) atmospheres. Evolutionary-attractor theory for SA:LA and RA:LA complements models that take whole-plant conductivity per leaf area as a parameter. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Estimating leaf functional traits by inversion of PROSPECT: Assessing leaf dry matter content and specific leaf area in mixed mountainous forest

    Science.gov (United States)

    Ali, Abebe Mohammed; Darvishzadeh, Roshanak; Skidmore, Andrew K.; Duren, Iris van; Heiden, Uta; Heurich, Marco

    2016-03-01

    Assessments of ecosystem functioning rely heavily on quantification of vegetation properties. The search is on for methods that produce reliable and accurate baseline information on plant functional traits. In this study, the inversion of the PROSPECT radiative transfer model was used to estimate two functional leaf traits: leaf dry matter content (LDMC) and specific leaf area (SLA). Inversion of PROSPECT usually aims at quantifying its direct input parameters. This is the first time the technique has been used to indirectly model LDMC and SLA. Biophysical parameters of 137 leaf samples were measured in July 2013 in the Bavarian Forest National Park, Germany. Spectra of the leaf samples were measured using an ASD FieldSpec3 equipped with an integrating sphere. PROSPECT was inverted using a look-up table (LUT) approach. The LUTs were generated with and without using prior information. The effect of incorporating prior information on the retrieval accuracy was studied before and after stratifying the samples into broadleaf and conifer categories. The estimated values were evaluated using R2 and normalized root mean square error (nRMSE). Among the retrieved variables the lowest nRMSE (0.0899) was observed for LDMC. For both traits higher R2 values (0.83 for LDMC and 0.89 for SLA) were discovered in the pooled samples. The use of prior information improved accuracy of the retrieved traits. The strong correlation between the estimated traits and the NIR/SWIR region of the electromagnetic spectrum suggests that these leaf traits could be assessed at canopy level by using remotely sensed data.

  5. A novel botanical formula prevents diabetes by improving insulin resistance.

    Science.gov (United States)

    Kan, Juntao; Velliquette, Rodney A; Grann, Kerry; Burns, Charlie R; Scholten, Jeff; Tian, Feng; Zhang, Qi; Gui, Min

    2017-07-05

    Type 2 diabetes mellitus (T2DM) is a major risk factor for cardiovascular disease, and the prevalence has increased significantly in recent decades to epidemic proportions in China. Individually, fenugreek (Trigonella foenum graecum) seed, mulberry (Morus alba L.) leaf and American ginseng (Panax quinquefolius) root can improve glycemia in various animal models and humans with impaired glucose metabolism and T2DM. The aim of this study was to design an optimized botanical formula containing these herbal extracts as a nutritional strategy for the prevention of insulin resistance and T2DM. Cell-free α-amylase and α-glucosidase enzyme assays were used to determine inhibitory potential of extracts. Glucose uptake was examined in differentiated human adipocytes using radiolabeled 2-deoxyglucose. Male Sprague Dawley rats were divided and glycemia balanced into 5 groups: two controls (naïve and model) and three doses of the botanical test formula containing standardized fenugreek seed, mulberry leaf and American ginseng extracts (42.33, 84.66 and 169.33 mg/kg BW). Insulin resistance and T2DM was induced by feeding animals a high fat diet and with an alloxan injection. Glucose tolerance was examined by measuring serum glucose levels following an oral glucose load. Fenugreek seed and mulberry leaf dose dependently inhibited α-amylase (IC50 = 73.2 μg/mL) and α-glucosidase (IC50 = 111.8 ng/mL), respectively. All three botanical extracts improved insulin sensitivity and glucose uptake in human adipocytes, which lead to the design of an optimized botanical test formula. In a rat model of insulin resistance and T2DM, the optimized botanical test formula improved fasting serum glucose levels, fasting insulin resistance and the development of impaired glucose tolerance. The reduction in epididymal adipose tissue GLUT4 and PDK1 expression induced by high fat diet and alloxan was blunted by the botanical test formula. A novel botanical formula containing standardized

  6. The leaf-litter earthworm fauna (Annelida: Oligochaeta) of forests in ...

    African Journals Online (AJOL)

    A qualitative survey of the leaf-litter earthworm fauna of 11 selected indigenous forests in Limpopo Province, South Africa, was conducted to identify the species present, to describe the communities and to assess the relationship between indigenous and exotic species. A total of 8185 individuals from 17 species (five ...

  7. Bioactive screening and in vitro antioxidant assessment of Nauclea latifolia leaf decoction

    Science.gov (United States)

    Iheagwam, Franklyn Nonso; Nsedu, Emmanuel Israel; Kayode, Kazeem Oyindamola; Emiloju, Opeyemi Christianah; Ogunlana, Olubanke Olujoke; Chinedu, Shalom Nwodo

    2018-04-01

    The phytochemical constituents and antioxidant properties of Nauclea latifolia leaf decoction were investigated. Dried leaves were extracted in ethanol. Qualitative and quantitative phytochemical analysis was determined spectrometrically. The antioxidant activities were examined in vitro using 2,2-diphenyl-1-picrylhydrazyl radical, total antioxidant capacity and ferric reducing antioxidant power assays. Phytochemical screening confirmed the presence of flavonoids, alkaloids, anthocyanins, betacyanins, phenols, saponins, terpenoids, cardiac glycosides and quinones. The total lycopene, β-carotene, phenolics, flavonoid and alkaloid content were found to be 0.038 ± 0.01 mg CAE/g, 0.120 ± 0.04 mg CAE/g, 58.08 ± 0.58 mg GAE/g, 10.75 ± 0.17 mg RE/g and 0.32 ± 0.08% respectively. N. latifolia ethanol leaf extract demonstrated effective antioxidant activity against 2,2-diphenyl-1-picrylhydrazyl with an IC50 of 2.58 ± 0.08 mg/mL compared to 0.86 ± 0.02 mg/mL and < 0.01 ± 0.01 mg/mL for butylated hydroxytoluene and ascorbic acid respectively. Total antioxidant capacity and ferric reducing antioxidant power of the extract were 73.81 ± 2.27 and 1314.45 ± 197.64 mg AAE/g respectively. Excellent positive correlations between the phenolic content and antioxidant activities of the extract were observed. The leaf of N. latifolia is of therapeutic value and may be exploited for its rich antioxidant components.

  8. MicroRNA profiling of tomato leaf curl new delhi virus (tolcndv infected tomato leaves indicates that deregulation of mir159/319 and mir172 might be linked with leaf curl disease

    Directory of Open Access Journals (Sweden)

    Haq Qazi MR

    2010-10-01

    Full Text Available Abstract Background Tomato leaf curl virus (ToLCV, a constituent of the genus Begomovirus, infects tomato and other plants with a hallmark disease symptom of upward leaf curling. Since microRNAs (miRs are known to control plants developmental processes, we evaluated the roles of miRNAs in Tomato leaf curl New Delhi virus (ToLCNDV induced leaf curling. Results Microarray analyses of miRNAs, isolated from the leaves of both healthy and ToLCNDV agroinfected tomato cv Pusa Ruby, revealed that ToLCNDV infection significantly deregulated various miRNAs representing ~13 different conserved families (e.g., miR319, miR172, etc.. The precursors of these miRNAs showed similar deregulated patterns, indicating that the transcription regulation of respective miRNA genes was perhaps the cause of deregulation. The expression levels of the miRNA-targeted genes were antagonistic with respect to the amount of corresponding miRNA. Such deregulation was tissue-specific in nature as no analogous misexpression was found in flowers. The accumulation of miR159/319 and miR172 was observed to increase with the days post inoculation (dpi of ToLCNDV agroinfection in tomato cv Pusa Ruby. Similarly, these miRs were also induced in ToLCNDV agroinfected tomato cv JK Asha and chilli plants, both exhibiting leaf curl symptoms. Our results indicate that miR159/319 and miR172 might be associated with leaf curl symptoms. This report raises the possibility of using miRNA(s as potential signature molecules for ToLCNDV infection. Conclusions The expression of several host miRNAs is affected in response to viral infection. The levels of the corresponding pre-miRs and the predicted targets were also deregulated. This change in miRNA expression levels was specific to leaf tissues and observed to be associated with disease progression. Thus, certain host miRs are likely indicator of viral infection and could be potentially employed to develop viral resistance strategies.

  9. Spectral reflectance relationships to leaf water stress

    Science.gov (United States)

    Ripple, William J.

    1986-01-01

    Spectral reflectance data were collected from detached snapbean leaves in the laboratory with a multiband radiometer. Four experiments were designed to study the spectral response resulting from changes in leaf cover, relative water content of leaves, and leaf water potential. Spectral regions included in the analysis were red (630-690 nm), NIR (760-900 nm), and mid-IR (2.08-2.35 microns). The red and mid-IR bands showed sensitivity to changes in both leaf cover and relative water content of leaves. The NIR was only highly sensitive to changes in leaf cover. Results provided evidence that mid-IR reflectance was governed primarily by leaf moisture content, although soil reflectance was an important factor when leaf cover was less than 100 percent. High correlations between leaf water potentials and reflectance were attributed to covariances with relative water content of leaves and leaf cover.

  10. Comparison of leaf-on and leaf-off ALS data for mapping riparian tree species

    Science.gov (United States)

    Laslier, Marianne; Ba, Antoine; Hubert-Moy, Laurence; Dufour, Simon

    2017-10-01

    Forest species composition is a fundamental indicator of forest study and management. However, describing forest species composition at large scales and of highly diverse populations remains an issue for which remote sensing can provide significant contribution, in particular, Airborne Laser Scanning (ALS) data. Riparian corridors are good examples of highly valuable ecosystems, with high species richness and large surface areas that can be time consuming and expensive to monitor with in situ measurements. Remote sensing could be useful to study them, but few studies have focused on monitoring riparian tree species using ALS data. This study aimed to determine which metrics derived from ALS data are best suited to identify and map riparian tree species. We acquired very high density leaf-on and leaf-off ALS data along the Sélune River (France). In addition, we inventoried eight main riparian deciduous tree species along the study site. After manual segmentation of the inventoried trees, we extracted 68 morphological and structural metrics from both leaf-on and leaf-off ALS point clouds. Some of these metrics were then selected using Sequential Forward Selection (SFS) algorithm. Support Vector Machine (SVM) classification results showed good accuracy with 7 metrics (0.77). Both leaf-on and leafoff metrics were kept as important metrics for distinguishing tree species. Results demonstrate the ability of 3D information derived from high density ALS data to identify riparian tree species using external and internal structural metrics. They also highlight the complementarity of leaf-on and leaf-off Lidar data for distinguishing riparian tree species.

  11. Corrosion resistance of API 5L grade B steel with taro leaf (Colocasia esculenta) addition as corrosion inhibitor in HCl 0.1 M

    Science.gov (United States)

    Lestari, Yulinda; Priyotomo, Gadang

    2018-05-01

    Taro leaf (Colocasia esculenta) has the potential to be used as a corrosion inhibitor because it has a substance called polyphenol that binds to the hydroxyl group and essential amino acids. Taro leaf extract is taken by maceration method. In this study, the specimen was steel API 5L grade B that would measured the corosivity in 0.1 M HCl solution + taro leaf extract with a specific concentration (in ppm). Tests conducted by FTIR method taro leaves, potentiodynamic polarization (Tafel) and Electrochemical Impedance Spectroscopy (EIS). Based on the results revealed that there is a phenolic group in taro leaves, which has polyphenol content 0.053 % (mg/100 mg). The optimum composition of taro leaf extract is 4000 ppm which generate corrosion rate value of 30.22 mpy and efficiency inhibitor performance of 72.7 %. In this study, the Kads value of taro leaf extract ranged from 0.885 to greater than Kads value of ginger extract in hydrochloric acid solution. The high Kads values indicate a more efficient process of adsorption and better value of inhibition efficiency.

  12. Fruit production and branching density affect shoot and whole-tree wood to leaf biomass ratio in olive.

    Science.gov (United States)

    Rosati, Adolfo; Paoletti, Andrea; Al Hariri, Raeed; Famiani, Franco

    2018-02-14

    The amount of shoot stem (i.e., woody part of the shoot) dry matter per unit shoot leaf dry matter (i.e., the shoot wood to leaf biomass ratio) has been reported to be lower in short shoots than in long ones, and this is related to the greater and earlier ability of short shoots to export carbon. This is important in fruit trees, since the greater and earlier carbon export ability of shoots with a lower wood to leaf biomass ratio improves fruit production. This ratio may vary with cultivars, training systems or plant age, but no study has previously investigated the possible effect of fruit production. In this study on two olive cultivars (i.e., Arbequina, with low growth rate, and Frantoio, with high growth rate) subject to different fruit production treatments, we found that at increasing fruit production, shoot length and shoot wood to leaf biomass ratio were proportionally reduced in the new shoots growing at the same time as the fruit. Specifically, fruit production proportionally reduced total new-shoot biomass, length, leaf area and average shoot length. With decreasing shoot length, shoot diameter, stem mass, internode length, individual leaf area and shoot wood to leaf biomass ratio also decreased. This may be viewed as a plant strategy to better support fruit growth in the current year, given the greater and earlier ability of short shoots to export carbon. Moreover, at the whole-tree level, the percentage of total tree biomass production invested in leaves was closely correlated with branching density, which differed significantly across cultivars. By branching more, Arbequina concentrates more shoots (thus leaves) per unit of wood (trunk, branches and root) mass, decreasing wood to leaf biomass ratio at the whole-tree level. Therefore, while, at the shoot level, shoot length determines shoot wood to leaf biomass ratio, at the canopy level branching density is also an important determinant of whole-tree wood to leaf biomass ratio. Whole-tree wood to leaf

  13. Specific leaf area estimation from leaf and canopy reflectance through optimization and validation of vegetation indices

    NARCIS (Netherlands)

    Ali, A.M.; Darvishzadeh, R.; Skidmore, A.K.; van Duren, I.C.

    2017-01-01

    Specific leaf area (SLA), which is defined as the leaf area per unit of dry leaf mass is an important component when assessing functional diversity and plays a key role in ecosystem modeling, linking plant carbon and water cycles as well as quantifying plant physiological processes. However, studies

  14. AKTIVITAS ANTIBAKTERI EKSTRAK DAUN SALAM (Syzgium Polyanta DAN DAUN PANDAN (Pandanus Amaryllifolius [Antibacterial Activity Of (Syzygium Polyanta And Amaryllifolius Leaf Extracts

    Directory of Open Access Journals (Sweden)

    Murhadi

    2007-06-01

    Full Text Available The objectives of this research were to study antibacterial activities of syzgium polyanta (“Salam” and Pandanus amaryllifolius (“Pandan” leaf extracts and the effect of wet heating (1000, up to 60 min on their antibacterial activities against staphylococcus aureus, bacillus subtillis, pseudomonas aeruginosa and Escherichia coli. Salam and pandan leaves powder was extracted using hot water (700C, 2 h, ethanol, ethanol/ethylacetate (1:1, v/v, and ethlacetate bt soxhlet (3x8 h separately. Each residue was further extracted using the same solvent by shaker (250 rpm, 24 h. finally filtrates were mixed and evaporated to produce the extract. Salam leaf ethanol extract (yield 11.50% showed highest antibacterial activity especially towards P. aeruginosa (diameter of inhibitor 6.5 mm/mg and B. subtilis (6.3 mm/mg. Pandan leaf erhanol/ethylacetate extract (yield 15.61 % also showed antibacterial activity towards P. aeruginosa (4.25 mm/mg and B. subtilis (3.2 mm/mg. In general, salam leaf extracts showed higher antibacterial activity than pandan leaf extracts. Pandan and salam leaf water extracts had no antibacterial activity. Escerichia coli was more resistant to the extracts compared Staphylococcus aureus, bacillus subtilis, and pseudomonas aeruginosa. Antibacterial activity of salam leaf ethylacetate extract decreased 6.55%, lower than that of pandan leaf ethylacetate extract (18.48% after heating 1000C for 10up to 60 min.

  15. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  16. Leaf hydraulic conductance declines in coordination with photosynthesis, transpiration and leaf water status as soybean leaves age regardless of soil moisture

    Science.gov (United States)

    Locke, Anna M.; Ort, Donald R.

    2014-01-01

    Photosynthesis requires sufficient water transport through leaves for stomata to remain open as water transpires from the leaf, allowing CO2 to diffuse into the leaf. The leaf water needs of soybean change over time because of large microenvironment changes over their lifespan, as leaves mature in full sun at the top of the canopy and then become progressively shaded by younger leaves developing above. Leaf hydraulic conductance (K leaf), a measure of the leaf’s water transport capacity, can often be linked to changes in microenvironment and transpiration demand. In this study, we tested the hypothesis that K leaf would decline in coordination with transpiration demand as soybean leaves matured and aged. Photosynthesis (A), stomatal conductance (g s) and leaf water potential (Ψleaf) were also measured at various leaf ages with both field- and chamber-grown soybeans to assess transpiration demand. K leaf was found to decrease as soybean leaves aged from maturity to shading to senescence, and this decrease was strongly correlated with midday A. Decreases in K leaf were further correlated with decreases in g s, although the relationship was not as strong as that with A. Separate experiments investigating the response of K leaf to drought demonstrated no acclimation of K leaf to drought conditions to protect against cavitation or loss of g s during drought and confirmed the effect of leaf age in K leaf observed in the field. These results suggest that the decline of leaf hydraulic conductance as leaves age keeps hydraulic supply in balance with demand without K leaf becoming limiting to transpiration water flux. PMID:25281701

  17. Correlation between agronomic and stem borer resistant traits in ...

    African Journals Online (AJOL)

    SARAH

    2015-06-30

    Jun 30, 2015 ... Resistant traits had negative correlations with most agronomic traits including grain yield. (GY). .... on a scale of 1-9 with 1 = clean plant without leaf defoliation and 9 .... Negative signs indicate direction of relationship. Table 3 ...

  18. Natural membranes of Hevea brasiliensis latex as delivery system for Casearia sylvestris leaf components

    Directory of Open Access Journals (Sweden)

    Flávio A. Carvalho

    Full Text Available ABSTRACT Natural latex from Hevea brasiliensis (Wild. ex A.Juss Müll.Arg., Euphorbiaceae, showed angiogenic action and Casearia sylvestris Sw., Salicaceae, leaf derivatives presented anti-inflammatory and wound healing activities. Therefore, an association of these effects was interesting for wound healing applications. The aims of this study were the development of membranes of natural latex incorporated with C. sylvestris leaf derivatives (ethanolic extract, diterpene concentrated fraction and casearin J, their chemical and physical characterization, and the evaluation of in vitro skin permeation and retention of C. sylvestris bioactive secondary metabolites (diterpenes and phenolic compounds. The membranes were developed mixing hydroethanolic solutions of C. sylvestris derivatives with latex and drying them in a desiccator. They were characterized by infrared spectroscopy, scanning electron microscopy, water vapor permeability and mechanical resistance assays, demonstrating that all membranes were permeable, resistant and homogeneous in surfaces. The permeation and retention assays demonstrated dermal penetration of phenolic compounds for ethanolic extract membrane and of casearin-like clerodane diterpenes for all membranes, indicating that these membranes have great potential for therapeutical application as a topical system for C. sylvestris components releasing.

  19. Seagrass leaf element content

    NARCIS (Netherlands)

    Vonk, J.A.; Smulders, Fee O.H.; Christianen, Marjolijn J.A.; Govers, Laura L.

    2017-01-01

    Knowledge on the role of seagrass leaf elements and in particular micronutrients and their ranges is limited. We present a global database, consisting of 1126 unique leaf values for ten elements, obtained from literature and unpublished data, spanning 25 different seagrass species from 28 countries.

  20. Pretreatment of albino rats with aqueous leaf extract of Ziziphus ...

    African Journals Online (AJOL)

    Purpose: The effect of the aqueous extract of Ziziphus mauritiana leaf on hepatic lipid peroxidation, reduced glutathione and total antioxidant status was studied in chronic alcohol-induced liver damage. Method: Alcohol-induced liver toxicity was created by oral administration of 40% alcohol solution (v/v, 1ml/100g) to rats for ...

  1. Estimating leaf area and leaf biomass of open-grown deciduous urban trees

    Science.gov (United States)

    David J. Nowak

    1996-01-01

    Logarithmic regression equations were developed to predict leaf area and leaf biomass for open-grown deciduous urban trees based on stem diameter and crown parameters. Equations based on crown parameters produced more reliable estimates. The equations can be used to help quantify forest structure and functions, particularly in urbanizing and urban/suburban areas.

  2. Prophylactic effect of paw-paw leaf and bitter leaf extracts on the ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-18

    Aug 18, 2008 ... (ANOVA) and significant means separated using FLSD = LSD procedure as outlined in Obi (2002). RESULTS AND DISCUSSION. In pre-soaking, paw-paw leaf (PL) extract had no significant effect (P > 0.05) on the disease incidence at. 50% anthesis. Bitter leaf (BL) extract had a high signifi- cant effect (P ...

  3. Feasibility of Early-Initiated Progressive Resistance Training after Total Hip Replacement

    DEFF Research Database (Denmark)

    Mikkelsen, Lone Ramer; Mechlenburg, Inger; Petersen, Annemette Krintel

    during the exercises were measured at each training session. Isometric muscle strength was measured before and 4 weeks after the THR. Findings / Results: Pain during exercises and resting pain before and after each training session was unchanged or decreased during the 4 weeks of training. Averaged...... across exercises pain during training decreased from 3.6 (sd: 2.8) at the first session to 1.52 (sd: 1.8) VAS-mm at the last session, ptraining load increased progressively for all 4 exercises during the 4 weeks of training. For example: 2nd, 5th and 8th training session. Hip......Background: Muscle atrophy, reduced hip muscle strength and function are documented within the first weeks after Total Hip Replacement (THR). Purpose / Aim of Study: The purpose of this study was to evaluate the feasibility of early-initiated progressive resistance training (PRT) after THR...

  4. The effect of electron collimator leaf shape on the build-up dose in narrow electron MLC fields

    International Nuclear Information System (INIS)

    Vatanen, T; Vaeaenaenen, A; Lahtinen, T; Traneus, E

    2009-01-01

    Previously, we have found that the build-up dose from abutting narrow electron beams formed with unfocussed electron multi-leaf collimator (eMLC) steal leaves was higher than with the respective open field. To investigate more closely the effect of leaf material and shape on dose in the build-up region, straight, round (radius 1.5 cm) and leaf ends with a different front face angle of α (leaf front face pointing towards the beam axis at an angle of 90 - α) made of steel, brass and tungsten were modelled using the BEAMnrc code. Based on a treatment head simulation of a Varian 2100 C/D linac, depth-dose curves and profiles in water were calculated for narrow 6, 12 and 20 MeV eMLC beams (width 1.0 cm, length 10 cm) at source-to-surface distances (SSD) of 102 and 105 cm. The effects of