Integrated delivery systems: the cure for fragmentation.
Enthoven, Alain C
2009-12-01
Our healthcare system is fragmented, with a misalignment of incentives, or lack of coordination, that spawns inefficient allocation of resources. Fragmentation adversely impacts quality, cost, and outcomes. Eliminating waste from unnecessary, unsafe care is crucial for improving quality and reducing costs--and making the system financially sustainable. Many believe this can be achieved through greater integration of healthcare delivery, more specifically via integrated delivery systems (IDSs). An IDS is an organized, coordinated, and collaborative network that links various healthcare providers to provide a coordinated, vertical continuum of services to a particular patient population or community. It is also accountable, both clinically and fiscally, for the clinical outcomes and health status of the population or community served, and has systems in place to manage and improve them. The marketplace already contains numerous styles and degrees of integration, ranging from Kaiser Permanente-style full integration, to more loosely organized individual practice associations, to public-private partnerships. Evidence suggests that IDSs can improve healthcare quality, improve outcomes, and reduce costs--especially for patients with complex needs--if properly implemented and coordinated. No single approach or public policy will fix the fragmented healthcare system, but IDSs represent an important step in the right direction.
GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots
International Nuclear Information System (INIS)
Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko
2008-01-01
Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.
About total kinetic energy distribution between fragments of binary fission
International Nuclear Information System (INIS)
Khugaev, A.V.; Koblik, Yu.N.; Pikul, V.P.; Ioannou, P.; Dimovasili, E.
2002-01-01
At the investigation of binary fission reactions one of the main characteristic of process is total kinetic energy (TKE) of fission fragments and it distribution between them. From the values of these characteristics it is possible to extract the information about structure of fission fragments in the break up point of initial fissionable nuclear system. In our work TKE dependence from the deformation parameters of shape and density distribution of charge in the fission fragments are investigated. In the end of paper some generalizations of obtaining results are carried out and presented in the form of tables and figures
Harnessing the privatisation of China's fragmented health-care delivery.
Yip, Winnie; Hsiao, William
2014-08-30
Although China's 2009 health-care reform has made impressive progress in expansion of insurance coverage, much work remains to improve its wasteful health-care delivery. Particularly, the Chinese health-care system faces substantial challenges in its transformation from a profit-driven public hospital-centred system to an integrated primary care-based delivery system that is cost effective and of better quality to respond to the changing population needs. An additional challenge is the government's latest strategy to promote private investment for hospitals. In this Review, we discuss how China's health-care system would perform if hospital privatisation combined with hospital-centred fragmented delivery were to prevail--population health outcomes would suffer; health-care expenditures would escalate, with patients bearing increasing costs; and a two-tiered system would emerge in which access and quality of care are decided by ability to pay. We then propose an alternative pathway that includes the reform of public hospitals to pursue the public interest and be more accountable, with public hospitals as the benchmarks against which private hospitals would have to compete, with performance-based purchasing, and with population-based capitation payment to catalyse coordinated care. Any decision to further expand the for-profit private hospital market should not be made without objective assessment of its effect on China's health-policy goals. Copyright © 2014 Elsevier Ltd. All rights reserved.
Total fragmentation cross section of 158A GeV lead projectiles in Cu target
International Nuclear Information System (INIS)
Mukhtar Ahmed Rana; Shahid Manzoor
2008-01-01
Total fragmentation cross section for the reaction 158A Pb ions + Cu target is measured using the most sensitive track detector CR-39. Measured values are compared with calculations. Exposures of target-detector stack with 158A Pb projectiles are made at CERN-SPS beam facility. Results of calibration of CR-39 detector in a charge region (63≤Z≤83) are also reported, which can be used for high energy particle identification using CR-39 and in determination of partial charge changing cross sections. The charge resolution σ Z achieved by this technique is about 0.2e. A systematic dependence of total fragmentation cross section on target properties is revealed and the corresponding results are presented. (authors)
Pomorski, K.; Nerlo-Pomorska, B.; Bartel, J.; Schmitt, C.
2018-03-01
The fission-fragment mass and total kinetic energy (TKE) distributions are evaluated in a quantum mechanical framework using elongation, mass asymmetry, neck degree of freedom as the relevant collective parameters in the Fourier shape parametrization recently developed by us. The potential energy surfaces (PES) are calculated within the macroscopic-microscopic model based on the Lublin-Strasbourg Drop (LSD), the Yukawa-folded (YF) single-particle potential and a monopole pairing force. The PES are presented and analysed in detail for even-even Plutonium isotopes with A = 236-246. They reveal deep asymmetric valleys. The fission-fragment mass and TKE distributions are obtained from the ground state of a collective Hamiltonian computed within the Born-Oppenheimer approximation, in the WKB approach by introducing a neck-dependent fission probability. The calculated mass and total kinetic energy distributions are found in good agreement with the data.
Total Fragmentation Cross Section of 158A GeV Lead Projectiles in Cu Target
International Nuclear Information System (INIS)
Rana, Mukhtar Ahmed
2008-01-01
Total fragmentation cross section for the reaction 158 A Pb ions + Cu target is measured using the most sensitive track detector CR-39. Measured values are compared with calculations. Exposures of target-detector stack with 158A Pb projectiles are made at CERN-SPS beam facility. Results of calibration of CR-39 detector in a charge region (63 ≤ Z ≤ 83) are also reported, which can be used for high energy particle identification using CR-39 and in determination of partial charge changing cross sections. The charge resolution σ z achieved by this technique is about 0.2e. A systematic dependence of total fragmentation cross section on target properties is revealed and the corresponding results are presented. (nuclear physics)
DEFF Research Database (Denmark)
Nielsen, Thomas E.; Le Quement, Sebastian; Juhl, Martin
2005-01-01
A study on the Stille reaction of alkenyl iodides and starmanes with structural resemblance to retrosynthetic fragments of a projected total synthesis of the marine alkaloid zoanthamine was carried out. A range of reaction conditions was examined, and a protocol developed by Corey utilizing excess...
Directory of Open Access Journals (Sweden)
Bram Kin
2018-02-01
Full Text Available Last mile deliveries in urban areas cause a disproportionate unsustainable impact, while it is also the most expensive part of the supply chain. This is particularly true for freight flows that are characterized by fragmentation. Logistically, this becomes apparent in vehicles that are driving around with a low vehicle fill rate, leading to the unnecessary presence of freight vehicles in our cities. This study focuses on the operational feasibility of utilizing the spare transportation capacity of a service-driven company as a potential solution to supply small independent retailers, or nanostores. The aim is to reduce inefficient vehicle movement. Based on a real-life implementation, we use SYnchronization Model for Belgian Inland Transport (SYMBIT, an agent-based model, to simulate various bundling scenarios. Results show the total vehicle kilometers and lead times to supply nanostores for the service-driven company to serve its customers. There is a potential to utilize spare capacity to supply nanostores while maintaining a decent service level. The number of vehicle kilometers driven highly depends on the location of the distribution center where the service-driven company operates. Based on these results, the conditions that have to be met to replicate this solution in other urban areas are discussed.
Training Requirements and Training Delivery in the Total Army School System
National Research Council Canada - National Science Library
Winkler, John
1999-01-01
This report analyzes training requirements and school delivery of training in the Total Army School System, focusing on the system's ability to meet its training requirements in Reserve Component Training Institutions...
Monitoring total mixed rations and feed delivery systems.
Oelberg, Thomas J; Stone, William
2014-11-01
This article is intended to give practitioners a method to evaluate total mixed ration (TMR) consistency and to give them practical solutions to improve TMR consistency that will improve cattle performance and health. Practitioners will learn how to manage the variation in moisture and nutrients that exists in haylage and corn silage piles and in bales of hay, and methods to reduce variation in the TMR mixing and delivery process. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Walker, K.Z.; Seymour-Munn, K.; Axiak, S.M.; Raison, R.L.; Basten, A.; Towson, J.E.; Bautovitch, G.J.; Morris, J.
1988-01-01
Monoclonal antibody (MoAb) fragments are known to have advantages over intact immunoglobulins for radioimmunoscintigraphy. It is less clear whether they are as effective in the delivery of radioimmunotherapy. The imaging and dosimetric properties of an intact MoAb, K-1-21, reactive against human kappa light chains (LC) were compared with that of its F(ab') 2 and Fab fragments using a normal rat model system. Two days after injection of 131 I-K-1-21 into rats bearing antigen-sepharose implants, gamma camera images showed specific localization of the MoAb to the target (kappa LC) but not to the control (lambda LC) implant. Better images were obtained with K-1-21 F(ab') 2 than with Fab or intact antibody. Mean kappa implant: blood ratios were 8.6 ± 3.9 for Fab, 7.9 ± 1.8 for F(ab') 2 and 2.0 ± 0.3 for intact K-1-21. The improvement associated with the use of 131 I-K-1-21 fragments was, however, achieved at the expense of lower absolute values of activity at the target site. Thus the absorbed dose delivered to the implant by the intact K-1-21 was double that delivered with F(ab') 2 and six times that delivered with Fab. As intact K-1-21 also delivered a greater radiation dose to normal tissues, F(ab') 2 fragments may have the greatest overall advantages for therapy with radionuclide MoAb conjugates. (author)
Khryachkov, Vitaly; Goverdovskii, Andrei; Ketlerov, Vladimir; Mitrofanov, Vecheslav; Sergachev, Alexei
2018-03-01
Binary fission of 232Th and 238U induced by fast neutrons were under intent investigation in the IPPE during recent years. These measurements were performed with a twin ionization chamber with Frisch grids. Signals from the detector were digitized for further processing with a specially developed software. It results in information of kinetic energies, masses, directions and Bragg curves of registered fission fragments. Total statistics of a few million fission events were collected during each experiment. It was discovered that for several combinations of fission fragment masses their total kinetic energy was very close to total free energy of the fissioning system. The probability of such fission events for the fast neutron induced fission was found to be much higher than for spontaneous fission of 252Cf and thermal neutron induced fission of 235U. For experiments with 238U target the energy of incident neutrons were 5 MeV and 6.5 MeV. Close analysis of dependence of fission fragment distribution on compound nucleus excitation energy gave us some explanation of the phenomenon. It could be a process in highly excited compound nucleus which leads the fissioning system from the scission point into the fusion valley with high probability.
Energy Technology Data Exchange (ETDEWEB)
Albinsson, H [Chalmers Univ. of Technology, Goeteborg (SE)
1971-07-01
Fission gamma radiation yields as functions of the total fragment kinetic energy were obtained for 235U thermal-neutron induced fission. The fragments were detected with silicon surface-barrier detectors and the gamma radiation with a Nal(Tl) scintillator. In some of the measurements mass selection was used so that the gamma radiation could also be measured as a function of fragment mass. Time discrimination between the fission gammas and the prompt neutrons released in the fission process was employed to reduce the background. The gamma radiation emitted during different time intervals after the fission event was studied with the help of a collimator, the position of which was changed along the path of the fission fragments. Fission-neutron and gamma-ray data of previous experiments were used for comparisons of the yields, and estimates were made of the variation of the prompt gamma-ray energy with the total fragment kinetic energy
Directory of Open Access Journals (Sweden)
Piotr Laudański
2010-11-01
Full Text Available Preterm labour and prematurity are still a main cause of perinatal morbidity nowadays. The aim of our study was to assess the role of MMP-8 as a predictive marker of preterm delivery. Four groups of patients were involved to the study: I - pregnant women at 24-34 weeks of gestation with any symptoms of threatened preterm labour; II - threatened preterm labour patients between 24-34 weeks of gestation; III - preterm vaginal delivery patients; IV - healthy term vaginal delivery patients. Serum concentration of total MMP-8 was measured using two enzyme-linked immunosorbent assays. There were no significant differences in the median concentrations of total MMP-8 between physiological pregnancy and threatened preterm labour patients with existing uterine contractility. No significant differences of total MMP-8 were either found between healthy term and preterm labouring patients. The studies on a larger population are needed to reject the hypothesis that preterm labour is connected with increased MMP-8 plasma concentrations of women in preterm labour and threatened preterm delivery.
DEFF Research Database (Denmark)
Borris, L.C.; Breindahl, M.; Ryge, C.
2007-01-01
Purpose: Prothrombin fragment 1 + 2 measured in spot urine (uF1 + 2) is an indicator of thrombin generation. We examined whether measured levels of uF1 + 2 can be used to differentiate between patients who do and do not acquire sustained coagulation activation after total hip arthroplasty (THA...
Fission-fragment angular distributions and total kinetic energies for 235U(n,f) from .18 to 8.83 MeV
International Nuclear Information System (INIS)
Meadows, J.W.; Budtz-Joergensen, C.
1982-01-01
A gridded ion chamber was used to measure the fission fragment angular distribution and total kinetic energy for the 235 U(n,f) reaction from 0.18 to 8.81 MeV neutron energy. The anisotropies are in generally good agreement with earlier measurements. The average total kinetic energy is approx. 0.2 MeV greater than the thermal value at neutron energies < 2 MeV and shows a sudden decrease of approx. 0.8 MeV between 4 and 5 MeV neutron energy, well below the (n, n'f) threshold. Possible causes of this decrease are a change in the mass distribution or decreased shell effects in the heavy fragment
Lee, Michael L; Katsuyama, Ângela M; Duge, Leanne S; Sriram, Chaitra; Krushelnytskyy, Mykhaylo; Kim, Jeansok J; de la Iglesia, Horacio O
2016-11-01
Sleep is important for consolidation of hippocampus-dependent memories. It is hypothesized that the temporal sequence of nonrapid eye movement (NREM) sleep and rapid eye movement (REM) sleep is critical for the weakening of nonadaptive memories and the subsequent transfer of memories temporarily stored in the hippocampus to more permanent memories in the neocortex. A great body of evidence supporting this hypothesis relies on behavioral, pharmacological, neural, and/or genetic manipulations that induce sleep deprivation or stage-specific sleep deprivation. We exploit an experimental model of circadian desynchrony in which intact animals are not deprived of any sleep stage but show fragmentation of REM and NREM sleep within nonfragmented sleep bouts. We test the hypothesis that the shortening of NREM and REM sleep durations post-training will impair memory consolidation irrespective of total sleep duration. When circadian-desynchronized animals are trained in a hippocampus-dependent contextual fear-conditioning task they show normal short-term memory but impaired long-term memory consolidation. This impairment in memory consolidation is positively associated with the post-training fragmentation of REM and NREM sleep but is not significantly associated with the fragmentation of total sleep or the total amount of delta activity. We also show that the sleep stage fragmentation resulting from circadian desynchrony has no effect on hippocampus-dependent spatial memory and no effect on hippocampus-independent cued fear-conditioning memory. Our findings in an intact animal model, in which sleep deprivation is not a confounding factor, support the hypothesis that the stereotypic sequence and duration of sleep stages play a specific role in long-term hippocampus-dependent fear memory consolidation. © 2016 Associated Professional Sleep Societies, LLC.
Universal elements of fragmentation
International Nuclear Information System (INIS)
Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.
2010-01-01
A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.
Impact Of Health Care Delivery System Innovations On Total Cost Of Care.
Smith, Kevin W; Bir, Anupa; Freeman, Nikki L B; Koethe, Benjamin C; Cohen, Julia; Day, Timothy J
2017-03-01
Using delivery system innovations to advance health care reform continues to be of widespread interest. However, it is difficult to generalize about the success of specific types of innovations, since they have been examined in only a few studies. To gain a broader perspective, we analyzed the results of forty-three ambulatory care programs funded by the first round of the Center for Medicare and Medicaid Innovation's Health Care Innovations Awards. The innovations' impacts on total cost of care were estimated by independent evaluators using multivariable difference-in-differences models. Through the first two years, most of the innovations did not show a significant effect on total cost of care. Using meta-regression, we assessed the effects on costs of five common components of these innovations. Innovations that used health information technology or community health workers achieved the greatest cost savings. Savings were also relatively large in programs that targeted clinically fragile patients-clinically complex populations at risk for disease progression. While the magnitude of these effects was often substantial, none achieved conventional levels of significance in our analyses. Meta-analyses of a larger number of delivery system innovations are needed to more clearly establish their potential for patient care cost savings. Project HOPE—The People-to-People Health Foundation, Inc.
Energy Technology Data Exchange (ETDEWEB)
Xu, X.P.; Ding, H.; Wang, X.B. [Harvard University, Boston, MA (United States). Dept. of Environmental Health
1995-11-01
The acute effects of air pollution on preterm delivery were examined in a prospective cohort in Beijing, China. From early pregnancy until delivery in 1988, we followed all registered pregnant women who lived in four residential areas of Beijing. Information for both mothers and infants was collected. Daily air pollution and meteorological data were obtained independently. The sample for analysis included 25 370 resident women who gave first live births in 1988. Multiple linear regression and logistic regression were used to estimate the effects of air pollution on gestational age and preterm delivery (i.e. {lt} 37 wk), with adjustment for outdoor temperature and humidity, day of the week, season, maternal age, gender of child, and residential area. Very high concentrations of ambient sulfur dioxide (mean = 102 {mu}g/m{sup 3}), (maximum = 630 {mu}g/m{sup 3}) and total suspended particulates (mean = 375 {mu}g/m{sup 3}), (maximum =1 003 {mu}g/m{sup 3}) were observed in these areas. There was a significant dose-dependent association between gestational age and sulfur dioxide and total suspended particulate concentrations. The estimated reduced duration of gestation was 0.075 wk (12.6 h) and 0.042 wk (7.1 h) for each 100 {mu}g/m{sup 3} increase in sulfur dioxide and total suspended particulates 7-d lagged moving average, respectively. We concluded that high levels of total suspended particulates and sulfur dioxide, or of a more complex pollution mixture associated with these pollutants, appear to contribute to excess risk of preterm delivery in this population. Further work needs to be carried out, with more detailed information on personal exposure and effect modifiers.
Lathrop, Stephen; Movassaghi, Mohammad
2013-01-01
We describe the first application of our methodology for heterodimerization via diazene fragmentation towards the total synthesis of (−)-calycanthidine, meso-chimonanthine, and (+)-desmethyl-meso-chimonanthine. Our syntheses of these alkaloids feature an improved route to C3a-aminocyclotryptamines, an enhanced method for sulfamide synthesis and oxidation, in addition to a late-stage diversification leading to the first enantioselective total synthesis of (+)-desmethyl-meso-chimonanthine and i...
DEFF Research Database (Denmark)
Tanner, David Ackland; Tedenborg, Lars; Somfai, Peter
1997-01-01
This paper describes the construction of three key intermediates for a projected total synthesis of the marine alkaloid zoanthamine. These building blocks, corresponding to the C1-C5, C6-C10 and C11-C24 fragments of the target molecule, are synthesised efficiently form (R)-hydroxymethyl-butyrolac......This paper describes the construction of three key intermediates for a projected total synthesis of the marine alkaloid zoanthamine. These building blocks, corresponding to the C1-C5, C6-C10 and C11-C24 fragments of the target molecule, are synthesised efficiently form (R...
Plutonium-contaminated fragments at the Taranaki site at Maralinga
International Nuclear Information System (INIS)
Burns, P.A.; Cooper, M.B.; Duggleby, J.C.; Mika, J.F.; Williams, G.A.
1986-07-01
A detailed assessment is presented of the distribution of plutonium-contaminated fragments and sub-millimetre particles in the vicinity of the Taranaki site at the former U.K. Atomic Weapons Test Range at Maralinga in South Australia. The area which is contaminated with fragments has been divided into three general regions with the designations 'heavily contaminated', 'moderately contaminated' and 'plumes'. The average surface density, activity and estimated total number of fragments are presented for each region. Average surface densities of all fragments with americium-241 activities greater than 2 kBq are estimated to be 33, 7 and 2 m -2 for the 'heavily contaminated', 'moderately contaminated' and 'plumes' regions respectively. The total number of such fragments is estimated to be in excess of three million which accounts for a total plutonium activity of approximately 0.8 TBq. The implications of these results for a rehabilitation program are discussed
Fragmentation of relativistic nuclei
International Nuclear Information System (INIS)
Cork, B.
1975-06-01
Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)
FRAGMENTATION ISSUE IN MALAYSIAN INDUSTRIALISED BUILDING SYSTEM (IBS PROJECTS
Directory of Open Access Journals (Sweden)
MOHD NASRUN MOHD NAWI
2014-02-01
Full Text Available As a developing country, Malaysian is currently driving for implementing a new or modern construction method, the Industrialised Building System (IBS, as an alternative towards enhancing construction performance. Currently, most of the IBS project developments in Malaysia are still conducted by using the traditional construction process approach. This traditional construction process has been widely criticised for its fragmented approach to project delivery and its failure to form effective teams thus created a number of issues such as reworks, time delay, rising costs, lack of communication and coordination, and wastages. This paper through literature review aims to highlight this fragmentation issue and clarify how far it affects the process of IBS implementation. Suggestions on how an integrated approach in design and construction in order to minimise the fragmentation gaps will be concluded.
Gamma Radiation from Fission Fragments
International Nuclear Information System (INIS)
Higbie, Jack
1969-10-01
The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass
Gamma Radiation from Fission Fragments
Energy Technology Data Exchange (ETDEWEB)
Higbie, Jack
1969-10-15
The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.
Hue, B. M.; Isataev, T.; Erdemchimeg, B.; Artukh, A. G.; Aznabaev, D.; Davaa, S.; Klygin, S. A.; Kononenko, G. A.; Khuukhenkhuu, G.; Kuterbekov, K.; Lukyanov, S. M.; Mikhailova, T. I.; Maslov, V. A.; Mendibaev, K.; Sereda, Yu M.; Penionzhkevich, Yu E.; Vorontsov, A. N.
2017-12-01
Preliminary results of measurements of the total reaction cross sections σR and neutron removal cross section σ-xn for weakly bound 6He, 8Li, 9Be and 10Be nuclei at energy range (20-35) A MeV with 28Si target is presented. The secondary beams of light nuclei were produced by bombardment of the 22Ne (35 A MeV) primary beam on Be target and separated by COMBAS fragment-separator. In dispersive focal plane a horizontal slit defined the momentum acceptance as 1% and a wedge degrader of 200 μm Al was installed. The Bρ of the second section of the fragment-separator was adjusted for measurements in energy range (20-35) A MeV. Two-neutron removal cross sections for 6He and 10Be and one -neutron removal cross sections 8Li and 9Be were measured.
Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Zhang, Y.; Rousseau, P.; Domaracka, A.; Maclot, S.; Delaunay, R.; Adoui, L.; Huber, B. A.; Schlathölter, T.; Schmidt, H. T.; Cederquist, H.; Zettergren, H.
2014-01-01
We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH+) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections
Nicaise, Pablo; Dubois, Vincent; Lorant, Vincent
2014-04-01
Most mental health care delivery systems in welfare states currently face two major issues: deinstitutionalisation and fragmentation of care. Belgium is in the process of reforming its mental health care delivery system with the aim of simultaneously strengthening community care and improving integration of care. The new policy model attempts to strike a balance between hospitals and community services, and is based on networks of services. We carried out a content analysis of the policy blueprint for the reform and performed an ex-ante evaluation of its plan of operation, based on the current knowledge of mental health service networks. When we examined the policy's multiple aims, intermediate goals, suggested tools, and their articulation, we found that it was unclear how the new policy could achieve its goals. Indeed, deinstitutionalisation and integration of care require different network structures, and different modes of governance. Furthermore, most of the mechanisms contained within the new policy were not sufficiently detailed. Consequently, three major threats to the effectiveness of the reform were identified. These were: issues concerning the relationship between network structure and purpose, the continued influence of hospitals despite the goal of deinstitutionalisation, and the heterogeneity in the actual implementation of the new policy. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Tovesson, F.; Duke, D.; Geppert-Kleinrath, V.; Manning, B.; Mayorov, D.; Mosby, S.; Schmitt, K.
2018-03-01
Different aspects of the nuclear fission process have been studied at Los Alamos Neutron Science Center (LANSCE) using various instruments and experimental techniques. Properties of the fragments emitted in fission have been investigated using Frisch-grid ionization chambers, a Time Projection Chamber (TPC), and the SPIDER instrument which employs the 2v-2E method. These instruments and experimental techniques have been used to determine fission product mass yields, the energy dependent total kinetic energy (TKE) release, and anisotropy in neutron-induced fission of U-235, U-238 and Pu-239.
Energy Technology Data Exchange (ETDEWEB)
Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)
2014-06-14
We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.
Fragmentation of 12C nuclei in emulsion at 50 GeV/c
International Nuclear Information System (INIS)
El-Naghy, A.
1981-01-01
A total of 852 12 C-emulsion interactions at 4.2 GeV/nucleon was investigated. In 86% of these events, at least one projectile fragment was oberserved in each. The angular distributions of Z = 1,2, and >= 3 projectile fragments are narrow, and the dispersion of the distribution decreases with the increasing of Z. The production cross section of the reaction 12 C + Em → Li (from the projectile) + anything is about 6 x 10 -3 sigmasub(in). Only the projectile-fragmentation events, nsub(h) = O, were studied in detail; the percentage of these events is 10% of the total inelastic events. The events with the maximum probability are those in which α-fragment is the maximum-charged projectile fragment emitted. This indicates that the projectile nuclear structure plays an important role in the fragmentation process. In 1.2% of the total events, 12 C has been dissociated into 3 α-particles. (orig.)
Cardiopulmonary function and oxygen delivery during total liquid ventilation.
Tsagogiorgas, Charalambos; Alb, Markus; Herrmann, Peter; Quintel, Michael; Meinhardt, Juergen P
2011-10-01
Total liquid ventilation (TLV) with perfluorocarbons has shown to improve cardiopulmonary function in the injured and immature lung; however there remains controversy over the normal lung. Hemodynamic effects of TLV in the normal lung currently remain undetermined. This study compared changes in cardiopulmonary and circulatory function caused by either liquid or gas tidal volume ventilation. In a prospective, controlled study, 12 non-injured anesthetized, adult New Zealand rabbits were primarily conventionally gas-ventilated (CGV). After instrumentation for continuous recording of arterial (AP), central venous (CVP), left artrial (LAP), pulmonary arterial pressures (PAP), and cardiac output (CO) animals were randomized into (1) CGV group and (2) TLV group. In the TLV group partial liquid ventilation was initiated with instillation of perfluoroctylbromide (12 ml/kg). After 15 min, TLV was established for 3 hr applying a volume-controlled, pressure-limited, time-cycled ventilation mode using a double-piston configured TLV. Controls (CGV) remained gas-ventilated throughout the experiment. During TLV, heart rate, CO, PAP, MAP, CVP, and LAP as well as derived hemodynamic variables, arterial and mixed venous blood gases, oxygen delivery, PVR, and SVR did not differ significantly compared to CGV. Liquid tidal volumes suitable for long-term TLV in non-injured rabbits do not significantly impair CO, blood pressure, and oxygen dynamics when compared to CGV. Copyright © 2011 Wiley-Liss, Inc.
Vaccine vial stopper performance for fractional dose delivery of vaccines.
Jarrahian, Courtney; Myers, Daniel; Creelman, Ben; Saxon, Eugene; Zehrung, Darin
2017-07-03
Shortages of vaccines such as inactivated poliovirus and yellow fever vaccines have been addressed by administering reduced-or fractional-doses, as recommended by the World Health Organization Strategic Advisory Group of Experts on Immunization, to expand population coverage in countries at risk. We evaluated 3 kinds of vaccine vial stoppers to assess their performance after increased piercing from repeated withdrawal of doses needed when using fractional doses (0.1 mL) from presentations intended for full-dose (0.5 mL) delivery. Self-sealing capacity and fragmentation of the stopper were assessed via modified versions of international standard protocols. All stoppers maintained self-sealing capacity after 100 punctures. The damage to stoppers measured as the fragmentation rate was within the target of ≤ 10% of punctures resulting in a fragment after as many as 50 punctures. We concluded that stopper failure is not likely to be a concern if existing vaccine vials containing up to 10 regular doses are used up to 50 times for fractional dose delivery.
Directory of Open Access Journals (Sweden)
Renata Pardini
Full Text Available Ecological systems are vulnerable to irreversible change when key system properties are pushed over thresholds, resulting in the loss of resilience and the precipitation of a regime shift. Perhaps the most important of such properties in human-modified landscapes is the total amount of remnant native vegetation. In a seminal study Andrén proposed the existence of a fragmentation threshold in the total amount of remnant vegetation, below which landscape-scale connectivity is eroded and local species richness and abundance become dependent on patch size. Despite the fact that species patch-area effects have been a mainstay of conservation science there has yet to be a robust empirical evaluation of this hypothesis. Here we present and test a new conceptual model describing the mechanisms and consequences of biodiversity change in fragmented landscapes, identifying the fragmentation threshold as a first step in a positive feedback mechanism that has the capacity to impair ecological resilience, and drive a regime shift in biodiversity. The model considers that local extinction risk is defined by patch size, and immigration rates by landscape vegetation cover, and that the recovery from local species losses depends upon the landscape species pool. Using a unique dataset on the distribution of non-volant small mammals across replicate landscapes in the Atlantic forest of Brazil, we found strong evidence for our model predictions--that patch-area effects are evident only at intermediate levels of total forest cover, where landscape diversity is still high and opportunities for enhancing biodiversity through local management are greatest. Furthermore, high levels of forest loss can push native biota through an extinction filter, and result in the abrupt, landscape-wide loss of forest-specialist taxa, ecological resilience and management effectiveness. The proposed model links hitherto distinct theoretical approaches within a single framework
Progress towards construction of a total restriction fragment map of a human chromosome.
H. Vissing; F.G. Grosveld (Frank); E. Solomon; G. Moore; N. Lench; N. Shennan; R. Williamson
1987-01-01
textabstractWe present an approach to the construction of an overlapping restriction fragment map of a single human chromosome. A genomic cosmid library genome was constructed from a mouse-human hybrid cell line containing chromosome 17 as its only human genetic component. Cosmids containing human
Prompt neutrons from {sup 236}U fission fragments
Energy Technology Data Exchange (ETDEWEB)
Boldeman, J W; Musgrove, A.R. de L.; Walsch, R L
1971-03-01
Measurements were made of prompt neutron emission in the thermal neutron fission of {sup 235}U. The mean neutron emission per fragment was obtained for particular values of the fragment mass and total kinetic energy. A direct neutron counting method was employed and a comparison made with data from previous experiments of this type. (author)
Simultaneous measurement of neutrons and fission fragments of thermal neutron fission of U-233
International Nuclear Information System (INIS)
Itsuro Kimura; Katsuhisa Nishio; Yoshihiro Nakagome
2000-01-01
The multiplicity and the energy of prompt neutrons from the fragments for 233 U(n th , f) were measured as functions of fragment mass and total kinetic energy. Average neutron energy against the fragment mass showed a nearly symmetric distribution about the half mass division with two valleys at 98 and 145 u. The slope of the neutron multiplicity with total kinetic energy depended on the fragment mass and showed the minimum at about 130 u. The obtained neutron data were applied to determine the total excitation energy of the system, and the resulting value in the typical asymmetric fission lied between 22 and 25 MeV. The excitation energy agreed with that determined by subtracting the total kinetic energy from the Q-value within 1 MeV, thus satisfied the energy conservation. In the symmetric fission, where the mass yield was drastically suppresses, the total excitation energy is significantly large and reaches to about 40 MeV, suggesting that fragment pairs are preferentially formed in a compact configuration at the scission point [ru
DEFF Research Database (Denmark)
Tanner, David Ackland; Tedenborg, Lars; Somfai, Peter
1997-01-01
This paper describes the construction of three key intermediates for a projected total synthesis of the marine alkaloid zoanthamine. These building blocks, corresponding to the C1-C5, C6-C10 and C11-C24 fragments of the target molecule, are synthesised efficiently form (R...
Application of a GIS-BIOLOCO tool for the design and assessment of biomass delivery chains
Geijzendorffer, I.R.; Annevelink, E.; Elbersen, B.S.; Smidt, R.A.; Mol, de R.M.
2008-01-01
The spatial fragmentation of different biomass sources in one or more regions makes design and assessment of sustainable biomass delivery chains rather complicated. This paper presents a GIS tool that supports the design and facilitates a sustainability assessment of biomass delivery chains at a
Energy Technology Data Exchange (ETDEWEB)
Jang, Mi Yeon; Kim, Jong Woo; Lee, Duck Hyung [Sogang University, Seoul (Korea, Republic of)
2005-10-15
Two ketones and, the C1-C11 fragment of Amphidinolide O, were prepared stereoselectively via 14 and 16 step sequences in 8.7% and 2.0% overall yield, respectively. The amphidinolides were isolated from the marine dinoflagellate Amphidinium sp., which produces a host of secondary metabolites endowed with potent cytotoxicity against various cancer cell lines. Amphidinolide O displayed potent in vitro cytotoxicity against L1210 marine leukemia cells and human epidermoid carcinoma KB cells with 1.7 and 3.6 μg/mL of IC50s, respectively. In addition to our recent reports regarding to the synthesis of C12-C17 and C3-C11 fragments of amphidinolide O, we describe herein a new route to diastereoselective synthesis of C1-C11 fragment of. The retrosynthetic analysis of led to the C1-C11 fragment and C12-C17 fragment. The hemiketal was expected from acyclic precursor 4 which, in turn, would be derived by diastereoselective aldol reaction between ketone and aldehyde.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Fragmentation in central collisions of heavy systems
International Nuclear Information System (INIS)
Claesson, G.; Doss, K.G.R.; Ferguson, R.
1987-01-01
One of the goals of heavy ion reaction studies is to understand the fragmentation of hot nuclei. The LBL/GSI Plastic Ball detector system has been used to achieve a very high solid angle for detection of light and medium-heavy fragments emitted in 200 Mev/A Au + Au and Au + Fe reactions. The simultaneous measurement of almost all of the nucleons and nuclei resulting from each collision allows an estimation of the total charged particle multiplicity and hence the impact parameter. By choosing subsets of the data corresponding to a peripheral or central collision, the assumptions inherent in various models of nuclear fragmentation can be tested. 3 refs., 3 figs
Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments
International Nuclear Information System (INIS)
Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.
1983-11-01
Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)
Safari, Somayyeh; Khalili, Mohammad Ali; Barekati, Zeinab; Halvaei, Iman; Anvari, Morteza; Nottola, Stefania A
2017-09-01
The aim was to study the ultrastructure of cytoplasmic fragments along with the effect of cosmetic micromanipulation (CM) on the morphology and development of vitrified-warmed embryos as well as assisted reproductive technology (ART) outcomes. A total of 96 frozen embryo transfer (FET) cycles were included in this prospective randomized study. They were divided into three groups of CM (n=32), sham (n=32) and control (n=32). In the CM group, the vitrified- warmed embryos were subjected to fragments and coarse granules removal (cosmetic micromanipulation) after laser assisted zona hatching (LAH); sham group subjected only to LAH and no intervention was taken for the control group. Fragmented embryo was evaluated by transmission electron microscopy (TEM). Significant improvement was observed in the morphological parameters, such as fragmentation degrees, evenness of the blastomeres and embryo grade during the subsequent development, after applying cosmetic micromanipulation, when compared to sham or control groups (P=0.00001). However, there were no differences in the clinical outcomes amongst the three studied groups e.g. the rates of clinical, ongoing and multiple pregnancies, implantation, delivery and live birth. In fine structure view, fragments exhibited uniform cytoplasmic texture containing majority of organelles that were observed in normal blastomeres including mitochondria. In conclusion, application of cosmetic micromanipulation in low-grade vitrified-warmed embryos showed significant improvement on embryo morphology parameters; however, did not result in noticeable improvements in clinical outcomes of the patients undergoing ART program. In addition, embryo vitrification had no adverse effects on fine structure of the fragments. Copyright © 2017 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
Targeted habitat restoration can reduce extinction rates in fragmented forests.
Newmark, William D; Jenkins, Clinton N; Pimm, Stuart L; McNeally, Phoebe B; Halley, John M
2017-09-05
The Eastern Arc Mountains of Tanzania and the Atlantic Forest of Brazil are two of the most fragmented biodiversity hotspots. Species-area relationships predict that their habitat fragments will experience a substantial loss of species. Most of these extinctions will occur over an extended time, and therefore, reconnecting fragments could prevent species losses and allow locally extinct species to recolonize former habitats. An empirical relaxation half-life vs. area relationship for tropical bird communities estimates the time that it takes to lose one-half of all species that will be eventually lost. We use it to estimate the increase in species persistence by regenerating a forest connection 1 km in width among the largest and closest fragments at 11 locations. In the Eastern Arc Mountains, regenerating 8,134 ha of forest would create >316,000 ha in total of restored contiguous forest. More importantly, it would increase the persistence time for species by a factor of 6.8 per location or ∼2,272 years, on average, relative to individual fragments. In the Atlantic Forest, regenerating 6,452 ha of forest would create >251,000 ha in total of restored contiguous forest and enhance species persistence by a factor of 13.0 per location or ∼5,102 years, on average, relative to individual fragments. Rapidly regenerating forest among fragments is important, because mean time to the first determined extinction across all fragments is 7 years. We estimate the cost of forest regeneration at $21-$49 million dollars. It could provide one of the highest returns on investment for biodiversity conservation worldwide.
Aligning physics and physiology: Engineering antibodies for radionuclide delivery.
Tsai, Wen-Ting K; Wu, Anna M
2018-03-14
The exquisite specificity of antibodies and antibody fragments renders them excellent agents for targeted delivery of radionuclides. Radiolabeled antibodies and fragments have been successfully used for molecular imaging and radioimmunotherapy (RIT) of cell surface targets in oncology and immunology. Protein engineering has been used for antibody humanization essential for clinical applications, as well as optimization of important characteristics including pharmacokinetics, biodistribution, and clearance. Although intact antibodies have high potential as imaging and therapeutic agents, challenges include long circulation time in blood, which leads to later imaging time points post-injection and higher blood absorbed dose that may be disadvantageous for RIT. Using engineered fragments may address these challenges, as size reduction and removal of Fc function decreases serum half-life. Radiolabeled fragments and pretargeting strategies can result in high contrast images within hours to days, and a reduction of RIT toxicity in normal tissues. Additionally, fragments can be engineered to direct hepatic or renal clearance, which may be chosen based on the application and disease setting. This review discusses aligning the physical properties of radionuclides (positron, gamma, beta, alpha, and Auger emitters) with antibodies and fragments and highlights recent advances of engineered antibodies and fragments in preclinical and clinical development for imaging and therapy. Copyright © 2018 John Wiley & Sons, Ltd.
Scission configurations and their implication in fission-fragment angular momenta
International Nuclear Information System (INIS)
Bonneau, L.; Quentin, P.; Mikhailov, I. N.
2007-01-01
The generation of sizable angular momenta in fragments formed in low-energy nuclear fission is described microscopically within the general quantum-mechanical framework of orientation pumping due to the Heisenberg uncertainty principle. Within this framework, we make use of the results of Skyrme-Hartree-Fock plus BCS-pairing calculations of fragment deformabilities to deduce a distribution of fission-fragment spins as a function of the fragment total excitation energy. We consider a fragmentation corresponding to a pair of deformed fragments and for which fission data are available. The properties of the scission configurations determine to a large extent the fission-fragment spins. This is why we pay particular attention to quantitatively defining the scission configurations and to studying the various implications of such a specific choice. A fair qualitative agreement with data is demonstrated and discussed within the limits of the simple scission-configuration model used here
Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T
2018-06-01
To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically
Neutron multiplicity of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)
1995-10-01
The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.
Energy Technology Data Exchange (ETDEWEB)
Faraggi, H; Garin-Bonnet, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
The measurement of total number of fissiongments emerging from an homogeneous, thick alloy composed of uranium plus another element (the concentration of uranium being known) allows to obtain the range of the fragments in this alloy. By varying the concentration, the range of the fragments in uranium and in the other element can be deduced. (author)Fren. [French] La mesure du nombre total de fragments de fission sortant d'un alliage homogene epais d'uranium et d'un autre element, pour lequel la concentration en uranium est donnee, permet la mesure du parcours des fragments dans cet alliage. En faisant varier la concentration, on peut deduire de ces mesures le parcours des fragments dans l'uranium et dans l'autre element. (auteur)
A high performance totally ordered multicast protocol
Montgomery, Todd; Whetten, Brian; Kaplan, Simon
1995-01-01
This paper presents the Reliable Multicast Protocol (RMP). RMP provides a totally ordered, reliable, atomic multicast service on top of an unreliable multicast datagram service such as IP Multicasting. RMP is fully and symmetrically distributed so that no site bears un undue portion of the communication load. RMP provides a wide range of guarantees, from unreliable delivery to totally ordered delivery, to K-resilient, majority resilient, and totally resilient atomic delivery. These QoS guarantees are selectable on a per packet basis. RMP provides many communication options, including virtual synchrony, a publisher/subscriber model of message delivery, an implicit naming service, mutually exclusive handlers for messages, and mutually exclusive locks. It has commonly been held that a large performance penalty must be paid in order to implement total ordering -- RMP discounts this. On SparcStation 10's on a 1250 KB/sec Ethernet, RMP provides totally ordered packet delivery to one destination at 842 KB/sec throughput and with 3.1 ms packet latency. The performance stays roughly constant independent of the number of destinations. For two or more destinations on a LAN, RMP provides higher throughput than any protocol that does not use multicast or broadcast.
Origin and differentiation of a special fragment from Capra hircus ...
African Journals Online (AJOL)
Administrator
2011-09-07
Sep 7, 2011 ... regions of the special fragment in the GenBank of NCBI. A total number of 80 fragments with identity ... recombined during the long period of evolution within and among species, and might be related to ..... and their association to coat color phenotypes in horses (Equus caballus). Mammalian Genome, 12: ...
Diatomite silica nanoparticles for drug delivery
Ruggiero, Immacolata; Terracciano, Monica; Martucci, Nicola M; De Stefano, Luca; Migliaccio, Nunzia; Tatè, Rosarita; Rendina, Ivo; Arcari, Paolo; Lamberti, Annalisa; Rea, Ilaria
2014-01-01
Diatomite is a natural fossil material of sedimentary origin, constituted by fragments of diatom siliceous skeletons. In this preliminary work, the properties of diatomite nanoparticles as potential system for the delivery of drugs in cancer cells were exploited. A purification procedure, based on thermal treatments in strong acid solutions, was used to remove inorganic and organic impurities from diatomite and to make them a safe material for medical applications. The micrometric diatomite p...
Fragment emission in reactions of 18.5-GeV 12C ions with complex nuclei
International Nuclear Information System (INIS)
Porile, N.T.; Cole, G.D.
1982-01-01
The emission of fragments ranging from 24 Na to 52 Mn in reactions of 18.5 GeV 12 C ions with Cu, Ag, Gd, Ta, Au, and U targets has been studied by means of activation techniques. The experiments involved determination of the fragment production cross sections and thick-target recoil properties. The latter were used to obtain mean fragment kinetic energies and values of β/sub parallel to/, the forward velocity component of the struck nucleus (in units of c). The results are compared with similar data for incident protons of the same total kinetic energy. The data may be used to assess the importance of central collisions in fragment production. Such collisions lead to the near total destruction of both interacting nuclei and the resulting fragments are emitted by a system of intermediate rapidity. In such a process, the factorization hypothesis, which has been shown to be valid for target and projectile fragmentation reactions, should not be obeyed. A test for factorization is performed by means of a relation which states that the ratio of the cross sections for producing fragment /sup A/Z in 12 C reactions to that for producing the same fragment in proton reactions with the same target is unity, provided both cross sections are reduced by the values of the corresponding total reaction cross sections sigma/sub R/, and evaluated for the same total kinetic energy of the projectile. The results of this comparison for the targets studied are presented and discussed
Towards the total synthesis of Stawamycin. Synthesis of C11-C21 fragment
Directory of Open Access Journals (Sweden)
Dias Luiz C.
2001-01-01
Full Text Available The carbocyclic (C11-C21 fragment of Stawamycin has been prepared by a sequence involving 11 steps (10% overall yield from methyl (R-(--3-hydroxy-2-methylpropionate. Key steps are Pd-catalyzed Stille coupling reaction between a vinyl iodide and a vinylstannane followed by an intramolecular Diels-Alder cycloaddition reaction to afford the desired adduct as the major isomer together with three other possible adducts in 78% overall yield.
2001-01-01
As business environments become increasingly competitive, companies seek more comprehensive solutions to the delivery of their projects. "Project Delivery System: Fourth Edition" describes the process-driven project delivery systems which incorporates the best practices from Total Quality and is aligned with the Project Management Institute and ISO Quality Standards is the means by which projects are consistently and efficiently planned, executed and completed to the satisfaction of clients and customers.
White, Julia N; Corker, Jamaica
2016-08-11
Increasing access to the intrauterine device (IUD), as part of a comprehensive method mix, is a key strategy for reducing unintended pregnancy and maternal mortality in low-income countries. To expand access to IUDs within the framework of informed choice, Population Services International (PSI) has historically supported increased IUD service delivery through private providers. In applying a total market lens to better understand the family planning market and address major market gaps, PSI identified a lack of high-quality public provision of IUDs. In 2013, PSI started a pilot in 4 countries (Guatemala, Laos, Mali, and Uganda) to grow public-provider IUD service delivery through increased public-sector engagement while maintaining its ongoing focus on private providers. In collaboration with country governments, PSI affiliates carried out family planning market analyses in the 4 pilot countries to identify gaps in IUD service delivery and create sustainable strategies for scaling up IUD services in the public sector. Country-specific interventions to increase service delivery were implemented across all levels of the public health system, including targeted advocacy at the national level to promote government ownership and program sustainability. Mechanisms to ensure government ownership were built into the program design, including a proof-of-concept approach to convince governments of the feasibility and value of taking over and scaling up interventions. In the first 2 years of the pilot (2013-2014), 102,055 IUD services were provided to women at 417 targeted public-sector facilities. These preliminary results suggest that there is untapped demand for IUD service delivery in the public sector that can be met in part through greater participation of the public sector in family planning and IUD provision. © White et al.
White, Julia N; Corker, Jamaica
2016-01-01
ABSTRACT Increasing access to the intrauterine device (IUD), as part of a comprehensive method mix, is a key strategy for reducing unintended pregnancy and maternal mortality in low-income countries. To expand access to IUDs within the framework of informed choice, Population Services International (PSI) has historically supported increased IUD service delivery through private providers. In applying a total market lens to better understand the family planning market and address major market gaps, PSI identified a lack of high-quality public provision of IUDs. In 2013, PSI started a pilot in 4 countries (Guatemala, Laos, Mali, and Uganda) to grow public-provider IUD service delivery through increased public-sector engagement while maintaining its ongoing focus on private providers. In collaboration with country governments, PSI affiliates carried out family planning market analyses in the 4 pilot countries to identify gaps in IUD service delivery and create sustainable strategies for scaling up IUD services in the public sector. Country-specific interventions to increase service delivery were implemented across all levels of the public health system, including targeted advocacy at the national level to promote government ownership and program sustainability. Mechanisms to ensure government ownership were built into the program design, including a proof-of-concept approach to convince governments of the feasibility and value of taking over and scaling up interventions. In the first 2 years of the pilot (2013–2014), 102,055 IUD services were provided to women at 417 targeted public-sector facilities. These preliminary results suggest that there is untapped demand for IUD service delivery in the public sector that can be met in part through greater participation of the public sector in family planning and IUD provision. PMID:27540122
Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study
Directory of Open Access Journals (Sweden)
Dalia Mohamed Ali
2016-06-01
Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
Element Distribution and Multiplicity of Heavy Fragments
2002-01-01
This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...
Coincidence study of alpha particle fragmentation at E/sub alpha/ = 140 MeV
International Nuclear Information System (INIS)
Koontz, R.W.
1980-01-01
Results of an experimental study of the interaction of 140 MeV alpha particles with 90 Zr nuclei resulting in fragmentation of the alpha particle are reported. The experimental observations of the study are analyzed and are found to show that alpha particle breakup reactions leading to at least 4-body final states, composed of two charged alpha particle fragments, contribute significantly to the singles yield of charged fragments observed at a fixed forward angle. The conclusions are based on coincidence measurements where one charged fragment is detected at a small forward angle which remains fixed, while the second charged fragment is detected at a series of coplanar secondary angles. The largest coincidence charged particle yield for the multiparticle final state events results from 90 Zr(α,pp)X reactions, where both of the measured protons have energy distributions similar to the proton singles energy distributions. The second largest observed coincidence yield involving two charged fragments arises from 90 Zr(α,pd)X reactions, where the p and d fragments, as in the 90 Zr(α,pp)X reactions also have energy distribution similar to the singles energy distributions. Analysis of additional measurements, where alpha particle fragments at the fixed angle are detected in coincidence with evaporation and nonequilibrium particles at many coplanar angles, show that the alpha particle fragmentation reactions are also generally associated with large energy transfer to the target nucleus. A multiple scattering model of the fragmentation reaction is employed, in conjunction with the experimental observations, to estimate the cross sections for alpha particle fragmentation into multi-particle final states resulting in n, 2n, p, pp, d, dn, dp, t and 3 He fragments. The estimated total cross section for all fragmentation reactions is 755 mb or approximately 38% of the total reaction cross section for 140 MeV alpha particle interactions with 90 Zr
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
Binding-site assessment by virtual fragment screening.
Directory of Open Access Journals (Sweden)
Niu Huang
2010-04-01
Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.
International Nuclear Information System (INIS)
Modesto, Montoya
2014-01-01
The Coulomb effects hypothesis is used to interpret even-odd effects of maximum total kinetic energy as a function of mass and charge of fragments from thermal neutron induced fission of 235 U. Assuming spherical fragments at scission, the Coulomb interaction energy between fragments (C sph ) is higher than the Q-value, the available energy. Therefore at scission the fragments must be deformed, so that the Coulomb interaction energy does not exceed the Q-value. The fact that the even-odd effects in the maximum total kinetic energy as a function of the charge and mass, respectively, are lower than the even-odd effects of Q is consistent with the assumption that odd mass fragments are softer than the even-even fragments. Even-odd effects of charge distribution in super asymmetric fragmentation also are interpreted with the Coulomb effect hypothesis. Because the difference between C sph and Q increases with asymmetry, fragmentations require higher total deformation energy to occur. Higher deformation energy of the fragments implies lower free energy to break pairs of nucleons. This explains why in the asymmetric fragmentation region, the even-odd effects of the distribution of proton number and neutron number increases with asymmetry. (author).
DEFF Research Database (Denmark)
Borris, Lars Carl; Breindahl, Morten; Rud-Lassen, Michael
2011-01-01
Prothrombin fragment 1+2 is excreted in urine (uF1+2) as a result of in vivo thrombin generation and can be a marker of coagulation status after an operative procedure. This study compared uF1+2 levels in patients with symptomatic and non-symptomatic venous thromboembolism (VTE) after total knee...... replacement (TKR) and in event-free sex- and age-matched controls. Significantly higher median uF1+2 levels were seen in the VTE patients on days 1, 3, and the day of venography (mostly day 7) after TKR compared with controls. The uF1+2 levels tended to be high in some patients with symptomatic VTE; however...
Residue preference mapping of ligand fragments in the Protein Data Bank.
Wang, Lirong; Xie, Zhaojun; Wipf, Peter; Xie, Xiang-Qun
2011-04-25
The interaction between small molecules and proteins is one of the major concerns for structure-based drug design because the principles of protein-ligand interactions and molecular recognition are not thoroughly understood. Fortunately, the analysis of protein-ligand complexes in the Protein Data Bank (PDB) enables unprecedented possibilities for new insights. Herein, we applied molecule-fragmentation algorithms to split the ligands extracted from PDB crystal structures into small fragments. Subsequently, we have developed a ligand fragment and residue preference mapping (LigFrag-RPM) algorithm to map the profiles of the interactions between these fragments and the 20 proteinogenic amino acid residues. A total of 4032 fragments were generated from 71 798 PDB ligands by a ring cleavage (RC) algorithm. Among these ligand fragments, 315 unique fragments were characterized with the corresponding fragment-residue interaction profiles by counting residues close to these fragments. The interaction profiles revealed that these fragments have specific preferences for certain types of residues. The applications of these interaction profiles were also explored and evaluated in case studies, showing great potential for the study of protein-ligand interactions and drug design. Our studies demonstrated that the fragment-residue interaction profiles generated from the PDB ligand fragments can be used to detect whether these fragments are in their favorable or unfavorable environments. The algorithm for a ligand fragment and residue preference mapping (LigFrag-RPM) developed here also has the potential to guide lead chemistry modifications as well as binding residues predictions.
Towards the total synthesis of stawamycin. Synthesis of C11-C21 fragment.
Dias, LC; Jardim, LSA; Ferreira, AA; Soarez, HU
2001-01-01
The carbocyclic (C11-C21) fragment of Stawamycin has been prepared by a sequence involving 11 steps (10% overall yield) from methyl (R)-(-)-3-hydroxy-2-methylpropionate. Key steps are Pd-catalyzed Stille coupling reaction between a vinyl iodide and a vinylstannane followed by an intramolecular Diels-Alder cycloaddition reaction to afford the desired adduct as the major isomer together with three other possible adducts in 78% overall yield. A porção carbocíclica (C11-C21) da Estavamicina fo...
Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)
International Nuclear Information System (INIS)
Budtz-Joergensen, C.; Knitter, H.H.
1986-01-01
The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)
International Nuclear Information System (INIS)
Vardaci, Emanuele; Kaplan, Morton; Parker, Winifred E.; Moses, David J.; Boger, J.T.; Gilfoyle, G.T.; McMahan, M.A.; Montoya, M.
2000-05-01
A new technique has been applied to coincidence measurements between fission fragments (FF) and intermediate mass fragments (IMF) emitted from the composite system 149 65 Tb at an excitation energy of 224 MeV. The method permits simultaneous observation of IMF emissions along and normal to the FF separation axes. For the integrated total of 0.10 +-0.02 IMF emitted per fission, we find no significant correlation with FF direction, suggesting that IMFs associated with fission reactions are predominantly emitted from the system prior to fission
Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe
2016-05-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.
Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe
2016-01-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825
Charge distribution in the ternary fragmentation of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)
2017-08-15
We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)
Fragment size distribution in viscous bag breakup of a drop
Kulkarni, Varun; Bulusu, Kartik V.; Plesniak, Michael W.; Sojka, Paul E.
2015-11-01
In this study we examine the drop size distribution resulting from the fragmentation of a single drop in the presence of a continuous air jet. Specifically, we study the effect of Weber number, We, and Ohnesorge number, Oh on the disintegration process. The regime of breakup considered is observed between 12 phase Doppler anemometry. Both the number and volume fragment size probability distributions are plotted. The volume probability distribution revealed a bi-modal behavior with two distinct peaks: one corresponding to the rim fragments and the other to the bag fragments. This behavior was suppressed in the number probability distribution. Additionally, we employ an in-house particle detection code to isolate the rim fragment size distribution from the total probability distributions. Our experiments showed that the bag fragments are smaller in diameter and larger in number, while the rim fragments are larger in diameter and smaller in number. Furthermore, with increasing We for a given Ohwe observe a large number of small-diameter drops and small number of large-diameter drops. On the other hand, with increasing Oh for a fixed We the opposite is seen.
Tsvetov, Gloria; Levy, Sigal; Benbassat, Carlos; Shraga-Slutzky, Ilana; Hirsch, Dania
2014-03-01
Pregnancy and lactation have been associated with decline in bone mineral density (BMD). It is not clear if there is a full recovery of BMD to baseline. This study sought to determine if pregnancy or breast-feeding or both have a cumulative effect on BMD in premenopausal and early postmenopausal women. We performed single-center cohort analysis. Five hundred women aged 35-55 years underwent routine BMD screening from February to July 2011 at a tertiary medical center. Patients were questioned about number of total full-term deliveries and duration of breast-feeding and completed a background questionnaire on menarche and menopause, smoking, dairy product consumption, and weekly physical exercise. Weight and height were measured. Dual-energy X-ray absorptiometry was used to measure spinal, dual femoral neck, and total hip BMD. Associations between background characteristics and BMD values were analyzed. Sixty percent of the women were premenopausal. Mean number of deliveries was 2.5 and mean duration of breast-feeding was 9.12 months. On univariate analysis, BMD values were negatively correlated with patient age (p=0.006) and number of births (p=0.013), and positively correlated with body mass index (posteoporosis later in life. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.
2018-03-01
It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.
Topology of White Stars in Relativistic Fragmentation of Light Nuclei
Andreeva, N P; Vokal, S; Vokalova, A; Gaitinov, A Sh; Gerassimov, S G; Goncharova, L A; Dronov, V A; Zarubin, P I; Zarubina, I G; Kovalenko, A D; Kravchakova, A; Larionova, V G; Levitskaja, O V; Lepehin, F G; Malakhov, A I; Moiseenko, A A; Orlova, G I; Peresadko, N G; Polukhina, N G; Rukojatkin, P A; Rusakova, V V; Salmanova, N A; Sarkisian, V R; Simonov, B B; Stan, E; Stanoeva, R; Chernyavsky, M M; Haidue, M; Kharlamov, S P; Tsakov, I; Shchedrina, T V
2004-01-01
In the present paper, experimental observation of the multifragmentation processes of light relativistic nuclei carried out by means of emulsions are reviewed. Events of the type of "white stars" in which the dissociation of relativistic nuclei is not accompanied by the production of mesons and the target-nucleus fragments are considered. A distinctive feature of the charge topology in the dissociation of the Ne, Mg, Si and S nuclei is an almost total suppression of the binary splitting of nuclei to fragments with charges higher than 2. The growth of the nuclear fragmentation degree is revealed in an increase in the multiplicity of singly and doubly charged fragments with decreasing charge of the main non-excited part of the fragmenting nucleus. The processes of dissociation of stable Li, Be, B, C, N, and O isotopes to charged fragments were used to study special features of the formation of systems consisting of the lightest nuclei - alpha, d and t. Clustering of the 3He nucleus can be detected in "white sta...
Lopes, CDF; Gonçalves, NP; Gomes, CP; Saraiva, MJ; Pêgo, AP
2017-01-01
Neuron-targeted gene delivery is a promising strategy to treat peripheral neuropathies. Here we propose the use of polymeric nanoparticles based on thiolated trimethyl chitosan (TMCSH) to mediate targeted gene delivery to peripheral neurons upon a peripheral and minimally invasive intramuscular administration. Nanoparticles were grafted with the non-toxic carboxylic fragment of the tetanus neurotoxin (HC) to allow neuron targeting and were explored to deliver a plasmid DNA encoding for the br...
Fragmentation and Multifragmentation of 10.6 A GeV Gold Nuclei
Adamovich, M I
1999-01-01
We present the results of a study performed on the interactions of 10.6A GeV gold nuclei in nuclear emulsions. In a minimum bias sample of 1311 interac- tions, 5260 helium nuclei and 2622 heavy fragments were observed as Au projec- tile fragments. The experimental data are analyzed with particular emphasis of target separation interactions in emulsions and study of criticalexponents. Multiplicity distributions of the fast-moving projectile fragments are inves- tigated. Charged fragment moments, conditional moments as well as two and three -body asymmetries of the fast moving projectile particles are determined in terms of the total charge remaining bound in the multiply charged projectile fragments. Some differences in the average yields of helium nuclei and heavier fragments are observed, which may be attributed to a target effect. However, two and three-body asymmetries and conditional moments indicate that the breakup mechanism of the projectile seems to be independent of target mass. We looked for evidenc...
Heavy quark fragmentation functions for D-wave quarkonium and charmed beauty mesons
International Nuclear Information System (INIS)
Cheung, K.; Yuan, T.C.
1995-09-01
At the large transverse momentum region, the production of heavy-heavy bound-states such as charmonium, bottomonium, and anti bc mesons in high energy e + e - and hadronic collisions is dominated by parton fragmentation. The authors calculate the heavy quark fragmentation functions into the D-wave quarkonium and anti bc mesons to leading order in the strong coupling constant and in the non-relativistic expansion. In the anti bc meson case, one set of its D-wave states is expected to lie below the open flavor threshold. The total fragmentation probability for a anti b antiquark to split into the D-wave anti bc mesons is about 2 x 10 -5 , which implies that only 2% of the total pseudo-scalar ground state B c comes from the cascades of these orbitally excited states
Release and characteristics of fungal fragments in various conditions
Energy Technology Data Exchange (ETDEWEB)
Mensah-Attipoe, Jacob [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Saari, Sampo [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Veijalainen, Anna-Maria; Pasanen, Pertti [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Keskinen, Jorma [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Leskinen, Jari T.T. [SIB Labs, University of Eastern Finland, Yliopistonranta 1E, P. O. Box 1627, FI-70211, Kuopio (Finland); Reponen, Tiina, E-mail: reponeta@ucmail.uc.edu [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Department of Environmental Health, University of Cincinnati, P.O. Box 670056, Cincinnati, OH 45267-0056 (United States)
2016-03-15
Intact spores and submicrometer size fragments are released from moldy building materials during growth and sporulation. It is unclear whether all fragments originate from fungal growth or if small pieces of building materials are also aerosolized as a result of microbial decomposition. In addition, particles may be formed through nucleation from secondary metabolites of fungi, such as microbial volatile organic compounds (MVOCs). In this study, we used the elemental composition of particles to characterize the origin of submicrometer fragments released from materials contaminated by fungi. Particles from three fungal species (Aspergillus versicolor, Cladosporium cladosporioides and Penicillium brevicompactum), grown on agar, wood and gypsum board were aerosolized using the Fungal Spore Source Strength Tester (FSSST) at three air velocities (5, 16 and 27 m/s). Released spores (optical size, d{sub p} ≥ 0.8 μm) and fragments (d{sub p} ≤ 0.8 μm) were counted using direct-reading optical aerosol instruments. Particles were also collected on filters, and their morphology and elemental composition analyzed using scanning electron microscopes (SEMs) coupled with an Energy-Dispersive X-ray spectroscopy (EDX). Among the studied factors, air velocity resulted in the most consistent trends in the release of fungal particles. Total concentrations of both fragments and spores increased with an increase in air velocity for all species whereas fragment–spore (F/S) ratios decreased. EDX analysis showed common elements, such as C, O, Mg and Ca, for blank material samples and fungal growth. However, N and P were exclusive to the fungal growth, and therefore were used to differentiate biological fragments from non-biological ones. Our results indicated that majority of fragments contained N and P. Because we observed increased release of fragments with increased air velocities, nucleation of MVOCs was likely not a relevant process in the formation of fungal fragments. Based
Durbin, Kenneth R.; Skinner, Owen S.; Fellers, Ryan T.; Kelleher, Neil L.
2015-05-01
Gaseous fragmentation of intact proteins is multifaceted and can be unpredictable by current theories in the field. Contributing to the complexity is the multitude of precursor ion states and fragmentation channels. Terminal fragment ions can be re-fragmented, yielding product ions containing neither terminus, termed internal fragment ions. In an effort to better understand and capitalize upon this fragmentation process, we collisionally dissociated the high (13+), middle (10+), and low (7+) charge states of electrosprayed ubiquitin ions. Both terminal and internal fragmentation processes were quantified through step-wise increases of voltage potential in the collision cell. An isotope fitting algorithm matched observed product ions to theoretical terminal and internal fragment ions. At optimal energies for internal fragmentation of the 10+, nearly 200 internal fragments were observed; on average each of the 76 residues in ubiquitin was covered by 24.1 internal fragments. A pertinent finding was that formation of internal ions occurs at similar energy thresholds as terminal b- and y-ion types in beam-type activation. This large amount of internal fragmentation is frequently overlooked during top-down mass spectrometry. As such, we present several new approaches to visualize internal fragments through modified graphical fragment maps. With the presented advances of internal fragment ion accounting and visualization, the total percentage of matched fragment ions increased from approximately 40% to over 75% in a typical beam-type MS/MS spectrum. These sequence coverage improvements offer greater characterization potential for whole proteins with no needed experimental changes and could be of large benefit for future high-throughput intact protein analysis.
Kinetics of a Migration-Driven Aggregation-Fragmentation Process
Institute of Scientific and Technical Information of China (English)
ZHUANGYou-Yi; LINZhen-Quan; KEJian-Hon~
2003-01-01
We propose a reversible model of the migration-driven aggregation-fragmentation process with the symmetric migration rate kernels K (k; j) = K′(k; j) =λkjv and the constant aggregation rates I1, I2 and fragmentation rates Jl, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions in several cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When Jl = 0 and J2 = O, the aggregate size distributions αk(t) and bk(t) obey the conventional scaling law, while when Jl > 0 and J2 > O, they obey the modified scaling law with an exponential scaling function. The total mass of either species remains conserved.
Rebahi, H; El Adib, A G; Mouaffak, Y; El Hattaoui, M; Chaara, A; Sadek, H; Khouchani, M; Mahmal, L; Younous, S
2015-01-01
Totally implantable venous access port plays a crucial role in the treatment of patients in oncology. However, its use can result sporadically in catheter fracture with catheter tip embolization into pulmonary arteries. We report this unusual but potentially serious complication in four patients. In these patients, the port had been inserted percutaneously into the subclavian vein using the infra-clavicular approach. This side effect occurred late in three patients. In all patients, the catheter fracture was asymptomatic or pauci-symptomatic and was caused by the pinch-off syndrome. The retrieval of the embolized fragments was successfully performed by transcatheter procedure in the cardiac catheterisation laboratory. We reviewed the literature and the newest guidelines and recommendations to detail the clinico-radiological features, the possible causes of this complication and discussed means to recognize, manage and prevent it. Copyright © 2013 Société nationale française de médecine interne (SNFMI). Published by Elsevier SAS. All rights reserved.
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Multiplicity and energy of neutrons from {sup 233}U(n{sub th},f) fission fragments
Energy Technology Data Exchange (ETDEWEB)
Nishio, Katsuhisa; Kimura, Itsuro; Nakagome, Yoshihiro [Kyoto Univ. (Japan)
1998-03-01
The correlation between fission fragments and prompt neutrons from the reaction {sup 233}U(n{sub th},f) was measured with improved accuracy. The results determined the neutron multiplicity and emission energy as a function of fragment mass and total kinetic energy. The average energy as a function of fragment mass followed a nearly symmetric distribution centered about the equal mass-split and formed a remarkable contrast with the saw-tooth distribution of the average neutron multiplicity. The neutron multiplicity from the specified fragment decreases linearly with total kinetic energy, and the slope of multiplicity with kinetic energy had the minimum value at about 130 u. The level density parameter versus mass determined from the neutron data showed a saw-tooth structure with the pronounced minimum at about 128 and generally followed the formula by Gilbert and Cameron, suggesting that the neutron emission process was very much affected by the shell-effect of the fission fragment. (author)
Henrickson Michael
2011-01-01
Abstract The United States pediatric population with chronic health conditions is expanding. Currently, this demographic comprises 12-18% of the American child and youth population. Affected children often receive fragmented, uncoordinated care. Overall, the American health care delivery system produces modest outcomes for this population. Poor, uninsured and minority children may be at increased risk for inferior coordination of services. Further, the United States health care delivery syste...
Human Albumin Fragments Nanoparticles as PTX Carrier for Improved Anti-cancer Efficacy
Directory of Open Access Journals (Sweden)
Liang Ge
2018-06-01
Full Text Available For enhanced anti-cancer performance, human serum albumin fragments (HSAFs nanoparticles (NPs were developed as paclitaxel (PTX carrier in this paper. Human albumins were broken into fragments via degradation and crosslinked by genipin to form HSAF NPs for better biocompatibility, improved PTX drug loading and sustained drug release. Compared with crosslinked human serum albumin NPs, the HSAF-NPs showed relative smaller particle size, higher drug loading, and improved sustained release. Cellular and animal results both indicated that the PTX encapsulated HSAF-NPs have shown good anti-cancer performance. And the anticancer results confirmed that NPs with fast cellular internalization showed better tumor inhibition. These findings will not only provide a safe and robust drug delivery NP platform for cancer therapy, but also offer fundamental information for the optimal design of albumin based NPs.
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
Quantitative evaluation of pregnant women delivery status’ records in Akure, Nigeria
Directory of Open Access Journals (Sweden)
Adebowale O. Adejumo
2018-02-01
Full Text Available In this data article, monthly records (datasets of total delivery, normal delivery, delivery through Caesarean section and number of still births from pregnant women in Akure, the capital city of Ondo state Nigeria, for a period of ten years, between January 2007 and December 2016 were considered. Correlational and time series analyses were conducted on the monthly records of total delivery, normal delivery (delivery through woman virginal, delivery through Caesarean section, and number of still births, in order to observe the patterns each of these indicators follows and to recommend appropriate model for forecasting their future values. The data were obtained in raw form from State Specialist Hospital (SSH, Akure, Ondo state, Nigeria. A clear description and variation in each of these indicators (total delivery, normal delivery, caesarean section, and still births were considered separately using descriptive statistics and box plots. Different models were also proposed for each of these indicators using time series models. Keywords: ARIMA, Caesarean section, Normal delivery, Data, Still birth, Time series, Akure
Universality of fragment shapes.
Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea
2015-03-16
The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.
Forest Fragmentation and Driving Forces in Yingkou, Northeastern China
Directory of Open Access Journals (Sweden)
Lei Zhang
2017-03-01
Full Text Available Forest fragmentation, the process of changing original large and intact forest patches into smaller and isolated areas, significantly influences the balance of surface physical environment, biodiversity, and species richness. Sufficient knowledge of forest fragmentation is necessary to maintain ecological balance and promote sustainable resource utilization. This study combines remote sensing, geographical information systems, and landscape metrics to assess forest fragmentation at landscape and pixel levels during different time periods (2000–2005, 2005–2010, and 2010–2015 in the Yingkou region. Spatial statistical analysis is also used to analyze the relationship between forest landscape fragmentation and its determinants (e.g., natural factors, socioeconomic factors, and proximity factors. Results show that forest patches became smaller, subdivided, and isolated during 2010–2015 at the total landscape level. Local changes occurred in the southwest of the study region or around the development area. Our data also indicate that shrinkage and subdivision were the main forest fragmentation processes during three times, and attrition became the main forest fragmentation process from 2010 to 2015. These changes were significantly influenced by natural factors (e.g., elevation and slope, proximity factors (e.g., distance to city and distance to province roads, and socioeconomic factors (e.g., gross domestic product. Results presented in this study provide valuable insights into the pattern and processes of forest fragmentation and present direct implications for the protection and reasonable utilization of forest resources.
Fission and nuclear fragmentation of silver and bromine nuclei by photons of 1-6 GeV
International Nuclear Information System (INIS)
Pinheiro Filho, J.D.
1983-01-01
The studies of fission and fragmentation of silver and bromine nuclei by Bremsstrahlung photons of 1.6 GeV energy range are presented. The Il ford-KO nuclear emulsion submitted to Bremsstrahlung beams in Deutsches Elektronen Synchrotron (DESY) with total doses of 10'' equivalent photons, was used for nuclear fragment detection. The discrimination of fission and fragmentation events was done analysing angular distribution, range and angles between fragments. The results of fragment range distributions, angular distributions, distributions of angles between fragments, distributions of ratio between range, velocity distributions forward/backward ratio, cross sections of fission and fragmentation, nuclear fissionability and ternary fission frequency are presented and discussed. (M.C.K.)
International Nuclear Information System (INIS)
Karmanov, V.A.
1983-01-01
Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative
Generalized fragment picking in Rosetta: design, protocols and applications.
Directory of Open Access Journals (Sweden)
Dominik Gront
Full Text Available The Rosetta de novo structure prediction and loop modeling protocols begin with coarse grained Monte Carlo searches in which the moves are based on short fragments extracted from a database of known structures. Here we describe a new object oriented program for picking fragments that greatly extends the functionality of the previous program (nnmake and opens the door for new approaches to structure modeling. We provide a detailed description of the code design and architecture, highlighting its modularity, and new features such as extensibility, total control over the fragment picking workflow and scoring system customization. We demonstrate that the program provides at least as good building blocks for ab-initio structure prediction as the previous program, and provide examples of the wide range of applications that are now accessible.
Multi-fold correlations between 252Cf (sf) fragments and fission neutrons/γ-rays
International Nuclear Information System (INIS)
Duering, I.; Jahnke, U.
1993-01-01
Direction-sensitive spectroscopy of fission fragments (twin ionization chamber with Frisch grids) was combined with the measurement of neutron multiplicity distribution (P(ν), average total γ-ray energy (2x2 π Gd-loaded scintillator) as well as energy and angular distribution of neutrons and γ-rays. Based on the careful account for necessary corrections, scission configurations given by mass asymmetry, elongation (total kinetic energy of fragments), and shape asymmetry (ν 1 /ν 2 ) can be studied exclusively in correlation with differential distributions of emission products. The scheme for correcting the neutron multiplicity distribution including its separation into the contributions from the complementary fragments is presented in detail. The mass yield for extreme anti ν 1 / anti ν 2 ratios show fine structures indicating the cold shape-asymmetric fission. (orig.)
Linkage map of the fragments of herpesvirus papio DNA.
Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H
1981-01-01
Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015
International Nuclear Information System (INIS)
Chung, K.C.
1989-01-01
An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)
Primary and secondary fragmentation of crystal-bearing intermediate magma
Jones, Thomas J.; McNamara, Keri; Eychenne, Julia; Rust, Alison C.; Cashman, Katharine V.; Scheu, Bettina; Edwards, Robyn
2016-11-01
Crystal-rich intermediate magmas are subjected to both primary and secondary fragmentation processes, each of which may produce texturally distinct tephra. Of particular interest for volcanic hazards is the extent to which each process contributes ash to volcanic plumes. One way to address this question is by fragmenting pyroclasts under controlled conditions. We fragmented pumice samples from Soufriere Hills Volcano (SHV), Montserrat, by three methods: rapid decompression in a shock tube-like apparatus, impact by a falling piston, and milling in a ball mill. Grain size distributions of the products reveal that all three mechanisms produce fractal breakage patterns, and that the fractal dimension increases from a minimum of 2.1 for decompression fragmentation (primary fragmentation) to a maximum of 2.7 by repeated impact (secondary fragmentation). To assess the details of the fragmentation process, we quantified the shape, texture and components of constituent ash particles. Ash shape analysis shows that the axial ratio increases during milling and that particle convexity increases with repeated impacts. We also quantify the extent to which the matrix is separated from the crystals, which shows that secondary processes efficiently remove adhering matrix from crystals, particularly during milling (abrasion). Furthermore, measurements of crystal size distributions before (using x-ray computed tomography) and after (by componentry of individual grain size classes) decompression-driven fragmentation show not only that crystals influence particular size fractions across the total grain size distribution, but also that free crystals are smaller in the fragmented material than in the original pumice clast. Taken together, our results confirm previous work showing both the control of initial texture on the primary fragmentation process and the contributions of secondary processes to ash formation. Critically, however, our extension of previous analyses to characterisation
Natural aminoacyl tRNA synthetase fragment enhances cardiac function after myocardial infarction.
Directory of Open Access Journals (Sweden)
Margaret E McCormick
Full Text Available A naturally-occurring fragment of tyrosyl-tRNA synthetase (TyrRS has been shown in higher eukaryotes to 'moonlight' as a pro-angiogenic cytokine in addition to its primary role in protein translation. Pro-angiogenic cytokines have previously been proposed to be promising therapeutic mechanisms for the treatment of myocardial infarction. Here, we show that systemic delivery of the natural fragment of TyRS, mini-TyrRS, improves heart function in mice after myocardial infarction. This improvement is associated with reduced formation of scar tissue, increased angiogenesis of cardiac capillaries, recruitment of c-kitpos cells and proliferation of myocardial fibroblasts. This work demonstrates that mini-TyrRS has beneficial effects on cardiac repair and regeneration and offers support for the notion that elucidation of the ever expanding repertoire of noncanonical functions of aminoacyl tRNA synthetases offers unique opportunities for development of novel therapeutics.
Diatomite silica nanoparticles for drug delivery
Ruggiero, Immacolata; Terracciano, Monica; Martucci, Nicola M.; De Stefano, Luca; Migliaccio, Nunzia; Tatè, Rosarita; Rendina, Ivo; Arcari, Paolo; Lamberti, Annalisa; Rea, Ilaria
2014-07-01
Diatomite is a natural fossil material of sedimentary origin, constituted by fragments of diatom siliceous skeletons. In this preliminary work, the properties of diatomite nanoparticles as potential system for the delivery of drugs in cancer cells were exploited. A purification procedure, based on thermal treatments in strong acid solutions, was used to remove inorganic and organic impurities from diatomite and to make them a safe material for medical applications. The micrometric diatomite powder was reduced in nanoparticles by mechanical crushing, sonication, and filtering. Morphological analysis performed by dynamic light scattering and transmission electron microscopy reveals a particles size included between 100 and 300 nm. Diatomite nanoparticles were functionalized by 3-aminopropyltriethoxysilane and labeled by tetramethylrhodamine isothiocyanate. Different concentrations of chemically modified nanoparticles were incubated with cancer cells and confocal microscopy was performed. Imaging analysis showed an efficient cellular uptake and homogeneous distribution of nanoparticles in cytoplasm and nucleus, thus suggesting their potentiality as nanocarriers for drug delivery.
Diatomite silica nanoparticles for drug delivery.
Ruggiero, Immacolata; Terracciano, Monica; Martucci, Nicola M; De Stefano, Luca; Migliaccio, Nunzia; Tatè, Rosarita; Rendina, Ivo; Arcari, Paolo; Lamberti, Annalisa; Rea, Ilaria
2014-01-01
Diatomite is a natural fossil material of sedimentary origin, constituted by fragments of diatom siliceous skeletons. In this preliminary work, the properties of diatomite nanoparticles as potential system for the delivery of drugs in cancer cells were exploited. A purification procedure, based on thermal treatments in strong acid solutions, was used to remove inorganic and organic impurities from diatomite and to make them a safe material for medical applications. The micrometric diatomite powder was reduced in nanoparticles by mechanical crushing, sonication, and filtering. Morphological analysis performed by dynamic light scattering and transmission electron microscopy reveals a particles size included between 100 and 300 nm. Diatomite nanoparticles were functionalized by 3-aminopropyltriethoxysilane and labeled by tetramethylrhodamine isothiocyanate. Different concentrations of chemically modified nanoparticles were incubated with cancer cells and confocal microscopy was performed. Imaging analysis showed an efficient cellular uptake and homogeneous distribution of nanoparticles in cytoplasm and nucleus, thus suggesting their potentiality as nanocarriers for drug delivery. 87.85.J81.05.Rm; 61.46. + w.
International Nuclear Information System (INIS)
Cauvin, B.; Jared, R.C.; Russo, P.; Schmitt, R.P.; Babinet, R.; Moretto, L.G.
1978-01-01
Deep inelastic fragments from the reaction sup(nat)Ag+340MeV 40 Ar have been studied in coincidence. Charged particles (10<=Z<=32) were detected and indentified in Z by means of a ΔE-E telescope, while the complementary fragments were detected in a one-dimensional solid-state position-sensitive detector. Both in-plane and out-of-plane correlations were measured. The results confirm the binary nature of the deep inelastic process for this reaction. From the measured energies and angles of the fragments and the atomic number of one of the fragments, it was possible to determine the total mass loss due to the de-excitation of the fragments as well as the total evaporated charge at symmetry. An iterative procedure is discussed which enables one to determine the masses and kinetic energies of the fragments before evaporation, as well as the total number of particles evaporated by each fragment. The widths of the in-plane and out-of-plane correlations agree with the results of the iterative calculations, as do evaporation calculations which are based on the charge equilibrium model. The experimental results support the charge equilibrium model and indicate that thermal equilibrium is achieved between the fragments at fixed mass asymmetry. (Auth.)
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Preliminary results of total kinetic energy modelling for neutron-induced fission
International Nuclear Information System (INIS)
Visan, I.; Giubega, G.; Tudora, A.
2015-01-01
The total kinetic energy as a function of fission fragments mass TKE(A) is an important quantity entering in prompt emission calculations. The experimentally distributions of TKE(A) are referring to a limited number of fission systems and incident energies. In the present paper, a preliminary model for TKE calculation in neutron induced fission system is presented. The range of fission fragments is chosen as in the Point by Point treatment. The model needs as input only mass excesses and deformation parameters taken from available nuclear databases being based on the following approximations: total excitation energy of fully accelerated fission fragments TXE is calculated from energy balance of neutron-induced fission systems as sum of the total excitation energy at scission E*sciss and deformation energy Edef. The deformation energy at scission is given by minimizing the potential energy at the scission configuration. At the scission point, the fission system is described by two spheroidal fragments nearly touching by a pre-scission distance or neck caused by the nuclear forces between fragments. Therefore, the Columbian repulsion depending on neck and, consequently, on the fragments deformation at scission, is essentially in TKE determination. An approximation is made based on the fission modes. For the very symmetric fission, the dominant super long channel is characterized by long distance between fragments leading to low TKE values. Due to magic and double-magic shells closure, the dominant S1 fission mode for pairs with heavy fragment mass AH around 130-134 is characterized by spherical heavy fragment shape and easily deformed light fragment. The nearly spherical shape of the complementary fragments are characterized by minimum distance, and consequently to maximum TKE values. The results obtained for TKE(A) are in good agreement with existing experimental data for many neutron induced fission systems, e.g. ''2''3''3&apos
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
Renal targeted delivery of triptolide by conjugation to the fragment peptide of human serum albumin.
Yuan, Zhi-xiang; Wu, Xiao-juan; Mo, Jingxin; Wang, Yan-li; Xu, Chao-qun; Lim, Lee Yong
2015-08-01
We have previously demonstrated that peptide fragments (PFs) of the human serum albumin could be developed as potential renal targeting carriers, in particular, the peptide fragment, PF-A299-585 (A299-585 representing the amino acid sequence of the human serum albumin). In this paper, we conjugated triptolide (TP), the anti-inflammatory Chinese traditional medicine, to PF-A299-585 via a succinic acid spacer to give TPS-PF-A299-585 (TP loading 2.2% w/w). Compared with the free TP, TPS-PF-A299-585 exhibited comparable anti-inflammatory activity in the lipopolysaccharide stimulated MDCK cells, but was significantly less cytotoxic than the free drug. Accumulation of TPS-PF-A299-585 in the MDCK cells in vitro and in rodent kidneys in vivo was demonstrated using FITC-labeled TPS-PF-A299-585. Renal targeting was confirmed in vivo in a membranous nephropathic (MN) rodent model, where optical imaging and analyses of biochemical markers were combined to show that TPS-PF-A299-585 was capable of alleviating the characteristic symptoms of MN. The collective data affirm PF-A299-585 to be a useful carrier for targeting TP to the kidney. Copyright © 2015 Elsevier B.V. All rights reserved.
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
Protocol for Monitoring Gulf War Veterans with Imbedded Fragments of Depleted Uranium
1993-03-01
interest is evidence of total or partial fibrotic encapsulation ; local tissue necrosis; growing granuloma; or if there is evidence of a breakdown, a...formed fibrotic capsule. - If the fragment is encapsulated , remove and save the intact capsule (with the fragment still inside) if possible. If the...0704-0188 Public reporng burden for this owllectlon of infotmation iS estimated to average 1 hour par response , ircluding the time for revewing
Changes in seed rain across Atlantic Forest fragments in Northeast Brazil
Freitas, Cíntia Gomes; Dambros, Cristian; Camargo, José Luís Campana
2013-11-01
The objectives of this study were to characterize the distribution of seeds in remnant fragments of the Atlantic Coastal Forest and to determine whether the species diversity, seed weight, and species composition of plant communities are altered by forest fragmentation. A transect of 100 m was established in the core of each of nine fragments of Atlantic Coastal Forest in a private sugarcane plantation in the state of Alagoas, NE Brazil, and ten seed-traps were distributed at intervals of 10 m each along the transects. For 12 consecutive months seeds were collected, dried, counted, weighed, and identified to species. Seeds were assigned to categories according to their size, dispersal mode, and shade tolerance. Multiple regression models and Mantel correlation tests were used to detect the effects of fragment size, percent forest cover nearby, distance from the source area, and distance from the nearest fragment on species diversity, mean seed weight, and species similarity. Analyses were carried out for all species and for subsets corresponding to each seed category. A total of 21,985 diaspores of 190 species were collected. Most seeds were small, shade-intolerant, and zoochoric, which corroborates other studies of fragmented forest landscapes and reflects the high disturbance levels in isolated forest remnants. Our data indicate that fragmentation processes such as habitat loss can alter species diversity and species composition by reducing habitat availability and increasing fragment isolation. We also found that large-seeded species are more affected by fragment isolation, possibly because their seed dispersers rarely cross non-forested areas between fragments, while zoochoric species are more strongly affected by fragment size and apparently more strongly associated with local edaphic conditions than with distance from seed sources.
Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory
Energy Technology Data Exchange (ETDEWEB)
Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)
2016-11-15
The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)
Population structure of Salmonella investigated by amplified fragment length polymorphism
DEFF Research Database (Denmark)
Torpdahl, M.; Ahrens, Peter
2004-01-01
Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...
Feasibility study of helical tomotherapy for total body or total marrow irradiation
International Nuclear Information System (INIS)
Hui, Susanta K.; Kapatoes, Jeff; Fowler, Jack; Henderson, Douglas; Olivera, Gustavo; Manon, Rafael R.; Gerbi, Bruce; Mackie, T. R.; Welsh, James S.
2005-01-01
Total body radiation (TBI) has been used for many years as a preconditioning agent before bone marrow transplantation. Many side effects still plague its use. We investigated the planning and delivery of total body irradiation (TBI) and selective total marrow irradiation (TMI) and a reduced radiation dose to sensitive structures using image-guided helical tomotherapy. To assess the feasibility of using helical tomotherapy (A) we studied variations in pitch, field width, and modulation factor on total body and total marrow helical tomotherapy treatments. We varied these parameters to provide a uniform dose along with a treatment times similar to conventional TBI (15-30 min). (B) We also investigated limited (head, chest, and pelvis) megavoltage CT (MVCT) scanning for the dimensional pretreatment setup verification rather than total body MVCT scanning to shorten the overall treatment time per treatment fraction. (C) We placed thermoluminescent detectors (TLDs) inside a Rando phantom to measure the dose at seven anatomical sites, including the lungs. A simulated TBI treatment showed homogeneous dose coverage (±10%) to the whole body. Doses to the sensitive organs were reduced by 35%-70% of the target dose. TLD measurements on Rando showed an accurate dose delivery (±7%) to the target and critical organs. In the TMI study, the dose was delivered conformally to the bone marrow only. The TBI and TMI treatment delivery time was reduced (by 50%) by increasing the field width from 2.5 to 5.0 cm in the inferior-superior direction. A limited MVCT reduced the target localization time 60% compared to whole body MVCT. MVCT image-guided helical tomotherapy offers a novel method to deliver a precise, homogeneous radiation dose to the whole body target while reducing the dose significantly to all critical organs. A judicious selection of pitch, modulation factor, and field size is required to produce a homogeneous dose distribution along with an acceptable treatment time. In
International Nuclear Information System (INIS)
Sihver, L.; Kanai, T.
1992-07-01
We have developed a computer code for calculations of energy loss (dE/dx) and range distributions for heavy ions in any media. The results from our calculations are in very good agreement with previous calculations. We have developed semiempirical total reaction cross section formulae for proton-nucleus (with Z p ≤26) and nucleus-nucleus (with Z p and Z t ≤26) reactions. These formulae apply for incident energies above 15 MeV and 100 MeV/nucleon respectively. From the total reaction cross sections, we can calculate the mean free paths and the fluence distributions of protons and heavy ions in any media. We have compared all the calculated reaction cross sections and the mean free paths with experimental data, and the agreement is good. We have also constructed a procedure for calculating projectile fragment production cross sections, by scaling semiempirical proton-nucleus partial cross section systematics. The scaling is performed using a scaling parameter deduced from our reaction cross sections formulae, and additional enhancements factors. All products with atomic number ranging from that of the projectile (Z p ) down to Z=2 can be calculated. The agreement between the calculated cross sections and the experimental data is better than earlier published results. (author)
International Nuclear Information System (INIS)
Przybylski, Cédric; Benito, Juan M.; Bonnet, Véronique; Mellet, Carmen Ortiz; García Fernández, José M.
2016-01-01
Polycationic carbohydrates represent an attractive class of biomolecules for several applications and particularly as non viral gene delivery vectors. In this case, the establishment of structure-biological activity relationship requires sensitive and accurate characterization tools to both control and achieve fine structural deciphering. Electrospray-tandem mass spectrometry (ESI-MS/MS) appears as a suitable approach to address these questions. In the study herein, we have investigated the usefulness of electron transfer dissociation (ETD) to get structural data about five polycationic carbohydrates demonstrated as promising gene delivery agents. A particular attention was paid to determine the influence of charge states as well as both fluoranthene reaction time and supplementary activation (SA) on production of charge reduced species, fragmentation yield, varying from 2 to 62%, as well as to obtain the most higher both diversity and intensity of fragments, according to charge states and targeted compounds. ETD fragmentation appeared to be mainly directed toward pending group rather than carbohydrate cyclic scaffold leading to a partial sequencing for building blocks when amino groups are close to carbohydrate core, but allowing to complete structural deciphering of some of them, such as those including dithioureidocysteaminyl group which was not possible with CID only. Such findings clearly highlight the potential to help the rational choice of the suitable analytical conditions, according to the nature of the gene delivery molecules exhibiting polycationic features. Moreover, our ETD-MS/MS approach open the way to a fine sequencing/identification of grafted groups carried on various sets of oligo-/polysaccharides in various fields such as glycobiology or nanomaterials, even with unknown or questionable extraction, synthesis or modification steps. - Highlights: • The first ETD-MS/MS characterization of polycationic carbohydrate based non-viral gene delivery
Energy Technology Data Exchange (ETDEWEB)
Przybylski, Cédric, E-mail: cedric.przybylski@upmc.fr [Université d’Evry-Val-d’Essonne, Laboratoire Analyse et Modélisation pour la Biologie et l’Environnement, CNRS UMR 8587, Bâtiment Maupertuis, Bld F. Mitterrand, F-91025 Evry (France); Benito, Juan M. [Instituto de Investigaciones Químicas (IIQ), CSIC−Universidad de Sevilla, Américo Vespucio 49, Isla de la Cartuja, E-41092 Sevilla (Spain); Bonnet, Véronique [Université de Picardie Jules Verne, Laboratoire de Glycochimie, des Antimicrobiens et des Agroressources, CNRS UMR 7378, 80039 Amiens (France); Mellet, Carmen Ortiz [Departamento de Química Orgánica, Facultad de Química, Universidad de Sevilla, E-41012 Sevilla (Spain); García Fernández, José M. [Instituto de Investigaciones Químicas (IIQ), CSIC−Universidad de Sevilla, Américo Vespucio 49, Isla de la Cartuja, E-41092 Sevilla (Spain)
2016-12-15
Polycationic carbohydrates represent an attractive class of biomolecules for several applications and particularly as non viral gene delivery vectors. In this case, the establishment of structure-biological activity relationship requires sensitive and accurate characterization tools to both control and achieve fine structural deciphering. Electrospray-tandem mass spectrometry (ESI-MS/MS) appears as a suitable approach to address these questions. In the study herein, we have investigated the usefulness of electron transfer dissociation (ETD) to get structural data about five polycationic carbohydrates demonstrated as promising gene delivery agents. A particular attention was paid to determine the influence of charge states as well as both fluoranthene reaction time and supplementary activation (SA) on production of charge reduced species, fragmentation yield, varying from 2 to 62%, as well as to obtain the most higher both diversity and intensity of fragments, according to charge states and targeted compounds. ETD fragmentation appeared to be mainly directed toward pending group rather than carbohydrate cyclic scaffold leading to a partial sequencing for building blocks when amino groups are close to carbohydrate core, but allowing to complete structural deciphering of some of them, such as those including dithioureidocysteaminyl group which was not possible with CID only. Such findings clearly highlight the potential to help the rational choice of the suitable analytical conditions, according to the nature of the gene delivery molecules exhibiting polycationic features. Moreover, our ETD-MS/MS approach open the way to a fine sequencing/identification of grafted groups carried on various sets of oligo-/polysaccharides in various fields such as glycobiology or nanomaterials, even with unknown or questionable extraction, synthesis or modification steps. - Highlights: • The first ETD-MS/MS characterization of polycationic carbohydrate based non-viral gene delivery
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
Isegawa, Miho; Gao, Jiali; Truhlar, Donald G
2011-08-28
Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
The Importance of Maize Management on Dung Beetle Communities in Atlantic Forest Fragments.
Directory of Open Access Journals (Sweden)
Renata Calixto Campos
Full Text Available Dung beetle community structures changes due to the effects of destruction, fragmentation, isolation and decrease in tropical forest area, and therefore are considered ecological indicators. In order to assess the influence of type of maize cultivated and associated maize management on dung beetle communities in Atlantic Forest fragments surrounded by conventional and transgenic maize were evaluated 40 Atlantic Forest fragments of different sizes, 20 surrounded by GM maize and 20 surrounded by conventional maize, in February 2013 and 2014 in Southern Brazil. After applying a sampling protocol in each fragment (10 pitfall traps baited with human feces or carrion exposed for 48 h, a total of 3454 individuals from 44 species were captured: 1142 individuals from 38 species in GM maize surrounded fragments, and 2312 from 42 species in conventional maize surrounded fragments. Differences in dung beetle communities were found between GM and conventional maize communities. As expected for fragmented areas, the covariance analysis showed a greater species richness in larger fragments under both conditions; however species richness was greater in fragments surrounded by conventional maize. Dung beetle structure in the forest fragments was explained by environmental variables, fragment area, spatial distance and also type of maize (transgenic or conventional associated with maize management techniques. In Southern Brazil's scenario, the use of GM maize combined with associated agricultural management may be accelerating the loss of diversity in Atlantic Forest areas, and consequently, important ecosystem services provided by dung beetles may be lost.
The Importance of Maize Management on Dung Beetle Communities in Atlantic Forest Fragments.
Campos, Renata Calixto; Hernández, Malva Isabel Medina
2015-01-01
Dung beetle community structures changes due to the effects of destruction, fragmentation, isolation and decrease in tropical forest area, and therefore are considered ecological indicators. In order to assess the influence of type of maize cultivated and associated maize management on dung beetle communities in Atlantic Forest fragments surrounded by conventional and transgenic maize were evaluated 40 Atlantic Forest fragments of different sizes, 20 surrounded by GM maize and 20 surrounded by conventional maize, in February 2013 and 2014 in Southern Brazil. After applying a sampling protocol in each fragment (10 pitfall traps baited with human feces or carrion exposed for 48 h), a total of 3454 individuals from 44 species were captured: 1142 individuals from 38 species in GM maize surrounded fragments, and 2312 from 42 species in conventional maize surrounded fragments. Differences in dung beetle communities were found between GM and conventional maize communities. As expected for fragmented areas, the covariance analysis showed a greater species richness in larger fragments under both conditions; however species richness was greater in fragments surrounded by conventional maize. Dung beetle structure in the forest fragments was explained by environmental variables, fragment area, spatial distance and also type of maize (transgenic or conventional) associated with maize management techniques. In Southern Brazil's scenario, the use of GM maize combined with associated agricultural management may be accelerating the loss of diversity in Atlantic Forest areas, and consequently, important ecosystem services provided by dung beetles may be lost.
Baud, Maxime O; Parafita, Julia; Nguyen, Audrey; Magistretti, Pierre J; Petit, Jean-Marie
2016-10-01
Sleep is viewed as a fundamental restorative function of the brain, but its specific role in neural energy budget remains poorly understood. Sleep deprivation dampens brain energy metabolism and impairs cognitive functions. Intriguingly, sleep fragmentation, despite normal total sleep duration, has a similar cognitive impact, and in this paper we ask the question of whether it may also impair brain energy metabolism. To this end, we used a recently developed mouse model of 2 weeks of sleep fragmentation and measured 2-deoxy-glucose uptake and glycogen, glucose and lactate concentration in different brain regions. In order to homogenize mice behaviour during metabolic measurements, we exposed them to a novel environment for 1 h. Using an intra-hippocampal electrode, we first showed that hippocampal electroencephalograph (EEG) response to exploration was unaltered by 1 or 14 days of sleep fragmentation. However, after 14 days, sleep fragmented mice exhibited a lower uptake of 2-deoxy-glucose in cortex and hippocampus and lower cortical lactate levels than control mice. Our results suggest that long-term sleep fragmentation impaired brain metabolism to a similar extent as total sleep deprivation without affecting the neuronal responsiveness of hippocampus to a novel environment. © 2016 European Sleep Research Society.
Baud, Maxime O.
2016-05-03
© 2016 European Sleep Research Society. Sleep is viewed as a fundamental restorative function of the brain, but its specific role in neural energy budget remains poorly understood. Sleep deprivation dampens brain energy metabolism and impairs cognitive functions. Intriguingly, sleep fragmentation, despite normal total sleep duration, has a similar cognitive impact, and in this paper we ask the question of whether it may also impair brain energy metabolism. To this end, we used a recently developed mouse model of 2 weeks of sleep fragmentation and measured 2-deoxy-glucose uptake and glycogen, glucose and lactate concentration in different brain regions. In order to homogenize mice behaviour during metabolic measurements, we exposed them to a novel environment for 1 h. Using an intra-hippocampal electrode, we first showed that hippocampal electroencephalograph (EEG) response to exploration was unaltered by 1 or 14 days of sleep fragmentation. However, after 14 days, sleep fragmented mice exhibited a lower uptake of 2-deoxy-glucose in cortex and hippocampus and lower cortical lactate levels than control mice. Our results suggest that long-term sleep fragmentation impaired brain metabolism to a similar extent as total sleep deprivation without affecting the neuronal responsiveness of hippocampus to a novel environment.
Directory of Open Access Journals (Sweden)
S. C. Oukouomi Noutchie
2014-01-01
Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.
Land fragmentation and production diversification
Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.
2018-01-01
We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver
Fragmentation processes in nuclear reactions
International Nuclear Information System (INIS)
Legrain, R.
1984-08-01
Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed
[Detection of UGT1A1*28 Polymorphism Using Fragment Analysis].
Huang, Ying; Su, Jian; Huang, Xiaosui; Lu, Danxia; Xie, Zhi; Yang, Suqing; Guo, Weibang; Lv, Zhiyi; Wu, Hongsui; Zhang, Xuchao
2017-12-20
Uridine-diphosphoglucuronosyl transferase 1A1 (UGT1A1), UGT1A1*28 polymorphism can reduce UGT1A1 enzymatic activity, which may lead to severe toxicities in patients who receive irinotecan. This study tries to build a fragment analysis method to detect UGT1A1*28 polymorphism. A total of 286 blood specimens from the lung cancer patients who were hospitalized in Guangdong General Hospital between April 2014 to May 2015 were detected UGT1A1*28 polymorphism by fragment analysis method. Comparing with Sanger sequencing, precision and accuracy of the fragment analysis method were 100%. Of the 286 patients, 236 (82.5% harbored TA6/6 genotype, 48 (16.8%) TA 6/7 genotype and 2 (0.7%) TA7/7 genotype. Our data suggest hat the fragment analysis method is robust for detecting UGT1A1*28 polymorphism in clinical practice. It's simple, time-saving, and easy-to-carry.
Total Synthesis of balanol, Part 2
DEFF Research Database (Denmark)
Tanner, David Ackland; Kelly, Nicholas; Tedenborg, Lars
1997-01-01
A convergent enantioselective total synthesis of the natural product (-)-balanol (1) is described. In addition to benzophenone fragment 8, key intermediates are chiral bicyclic aziridine 3 and the corresponding epoxide 4, both of which undergo highly regio- and stereoselective nucleophilic ring...
Directory of Open Access Journals (Sweden)
Gerald L. Bruns
2014-10-01
Full Text Available This is a short (fragmentary history of fragmentary writing from the German Romantics (F. W. Schlegel, Friedrich Hölderlin to modern and contemporary concrete or visual poetry. Such writing is (often deliberately a critique of the logic of subsumption that tries to assimilate whatever is singular and irreducible into totalities of various categorical or systematic sorts. Arguably, the fragment (parataxis is the distinctive feature of literary Modernism, which is a rejection, not of what precedes it, but of what Max Weber called “the rationalization of the world” (or Modernity whose aim is to keep everything, including all that is written, under surveillance and control.
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
McFearin, Cathryn L; Sankaranarayanan, Jagadis; Almutairi, Adah
2011-05-15
A fiber-optic coupled attenuated total reflection (ATR)-FT-IR spectroscopy technique was applied to the study of two different therapeutic delivery systems, acid degradable hydrogels and nanoparticles. Real time exponential release of a model protein, human serum albumin (HSA), was observed from two different polymeric hydrogels formulated with a pH sensitive cross-linker. Spectroscopic examination of nanoparticles formulated with an acid degradable polymer shell and encapsulated HSA exhibited vibrational signatures characteristic of both particle and payload when exposed to lowered pH conditions, demonstrating the ability of this methodology to simultaneously measure phenomena arising from a system with a mixture of components. In addition, thorough characterization of these pH sensitive delivery vehicles without encapsulated protein was also accomplished in order to separate the effects of the payload during degradation. When in situ, real time detection in combination with the ability to specifically identify different components in a mixture without involved sample preparation and minimal sample disturbance is provided, the versatility and suitability of this type of experiment for research in the pharmaceutical field is demonstrated.
Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H
2011-01-01
Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.
Fragment informatics and computational fragment-based drug design: an overview and update.
Sheng, Chunquan; Zhang, Wannian
2013-05-01
Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.
Long bone reconstruction using multilevel lengthening of bone defect fragments.
Borzunov, Dmitry Y
2012-08-01
This paper presents experimental findings to substantiate the use of multilevel bone fragment lengthening for managing extensive long bone defects caused by diverse aetiologies and shows its clinical introduction which could provide a solution for the problem of reducing the total treatment time. Both experimental and clinical multilevel lengthening to bridge bone defect gaps was performed with the use of the Ilizarov method only. The experimental findings and clinical outcomes showed that multilevel defect fragment lengthening could provide sufficient bone formation and reduction of the total osteosynthesis time in one stage as compared to traditional Ilizarov bone transport. The method of multilevel regeneration enabled management of critical-size defects that measured on average 13.5 ± 0.7 cm in 78 patients. The experimental and clinical results proved the efficiency of the Ilizarov non-free multilevel bone plasty that can be recommended for practical use.
Rotationally induced fragmentation in the prestellar core L1544
Energy Technology Data Exchange (ETDEWEB)
Klapp, Jaime; Zavala, Miguel [Departamento de Física, Instituto Nacional de Investigaciones Nucleares (ININ), Km. 36.5, Carretera México-Toluca, La Marquesa 52750, Estado de México (Mexico); Sigalotti, Leonardo Di G.; Peña-Polo, Franklin; Troconis, Jorge [Centro de Física, Instituto Venezolano de Investigaciones Científicas (IVIC), Apartado Postal 20632, Caracas 1020A (Venezuela, Bolivarian Republic of)
2014-01-10
Recent observations indicate that there is no correlation between the level of turbulence and fragmentation in detected protostellar cores, suggesting that turbulence works mainly before gravitationally bound prestellar cores form and that their inner parts are likely to be velocity coherent. Based on this evidence, we simulate the collapse and fragmentation of an isolated, initially centrally condensed, uniformly rotating core of total mass M = 5.4 M {sub ☉}, using the smoothed particle hydrodynamics code GADGET-2 modified with the inclusion of sink particles, in order to compare the statistical properties of the resulting stellar ensembles with previous gravoturbulent fragmentation models. The initial conditions are intended to fit the observed properties of the prestellar core L1544. We find that for ratios of the rotational to the gravitational energy β ≥ 0.05, a massive disk is formed at the core center from which a central primary condenses after ∼50 kyr. Soon thereafter the disk fragments into secondary protostars, consistent with an intermediate mode of star formation in which groups of 10-100 stars form from a single core. The models predict peak accretion rates between ∼10{sup –5} and 10{sup –4} M {sub ☉} yr{sup –1} for all stars and reproduce many of the statistical properties predicted from gravoturbulent fragmentation, suggesting that on the small scales of low-mass, dense cores these are independent of whether the contracting gas is turbulent or purely rotating.
Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio
2014-08-30
The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971
Lirman
2000-08-23
Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.
Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.
Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N
2016-01-01
Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.
The fragmentation of Pangaea and Mesozoic terrestrial vertebrate biodiversity.
Vavrek, Matthew J
2016-09-01
During the Mesozoic (242-66 million years ago), terrestrial regions underwent a massive shift in their size, position and connectivity. At the beginning of the era, the land masses were joined into a single supercontinent called Pangaea. However, by the end of the Mesozoic, terrestrial regions had become highly fragmented, both owing to the drifting apart of the continental plates and the extremely high sea levels that flooded and divided many regions. How terrestrial biodiversity was affected by this fragmentation and large-scale flooding of the Earth's landmasses is uncertain. Based on a model using the species-area relationship (SAR), terrestrial vertebrate biodiversity would be expected to nearly double through the Mesozoic owing to continental fragmentation, despite a decrease of 24% in total terrestrial area. Previous studies of Mesozoic vertebrates have generally found increases in terrestrial diversity towards the end of the era, although these increases are often attributed to intrinsic or climatic factors. Instead, continental fragmentation over this time may largely explain any observed increase in terrestrial biodiversity. This study demonstrates the importance that non-intrinsic effects can have on the taxonomic success of a group, and the importance of geography to understanding past biodiversity. © 2016 The Author(s).
Fractal statistics of brittle fragmentation
Directory of Open Access Journals (Sweden)
M. Davydova
2013-04-01
Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Directory of Open Access Journals (Sweden)
M.R. Wijesinghe
2012-06-01
Full Text Available This paper examines the impact of forest fragmentation on small mammals inhabiting the rainforests of Sri Lanka. Fifteen forests ranging in size from 145 to 11000 ha were live-trapped for five to eight nights each in both interior and edge habitats, yielding a total of 18400 trap nights. A total of 444 individuals belonging to 10 species of small mammals were captured. Multiple-regression analysis incorporating three indicators of fragmentation: patch area, shape index (perimeter/area and degree of isolation, showed no significant effects on overall species richness of small mammals. This is likely because the decline of forest-adapted species from small forest fragments was accompanied by an increase in more tolerant and adaptive species. Patch size, however, had a significant positive effect on the abundance of small mammals. Of the two dominant species, the endemic Mus mayori was positively affected by patch area whilst Rattus rattus was not affected. Although no differences were evident between interior and edge habitats with respect to total species richness and abundance, endemics were more abundant in core areas while the reverse was true for the non-endemics. Core forest areas were significantly different from forest edges with respect to canopy cover, density of herbaceous vegetation, large trees and litter cover. These results suggest that forest fragmentation is detrimental to some forest specialists and beneficial to some generalists.
I. Turcotte (Isabelle); G.M. Gómez (Georgina)
2012-01-01
textabstractWaste picking has become a prominent activity in the urban landscape, bridging the gap between shortfalls in service delivery and personal income generation in virtually all cities of the developing world. Overcoming previous stigmatization and work fragmentation through organization and
Health Care Reform: Impact on Total Joint Replacement.
Chambers, Monique C; El-Othmani, Mouhanad M; Saleh, Khaled J
2016-10-01
The US health care system has been fragmented for more than 40 years; this model created a need for modification. Sociopoliticomedical system-related factors led to the Affordable Care Act (ACA) and a restructuring of health care provision/delivery. The ACA increases access to high-quality "affordable care" under cost-effective measures. This article provides a comprehensive review of health reform and the motivating factors that drive policy to empower arthroplasty providers to effectively advocate for the field of orthopedics as a whole, and the patients served. Copyright © 2016 Elsevier Inc. All rights reserved.
BcL-xL Conformational Changes upon Fragment Binding Revealed by NMR
Aguirre, Clémentine; ten Brink, Tim; Walker, Olivier; Guillière, Florence; Davesne, Dany; Krimm, Isabelle
2013-01-01
Protein-protein interactions represent difficult but increasingly important targets for the design of therapeutic compounds able to interfere with biological processes. Recently, fragment-based strategies have been proposed as attractive approaches for the elaboration of protein-protein surface inhibitors from fragment-like molecules. One major challenge in targeting protein-protein interactions is related to the structural adaptation of the protein surface upon molecular recognition. Methods capable of identifying subtle conformational changes of proteins upon fragment binding are therefore required at the early steps of the drug design process. In this report we present a fast NMR method able to probe subtle conformational changes upon fragment binding. The approach relies on the comparison of experimental fragment-induced Chemical Shift Perturbation (CSP) of amine protons to CSP simulated for a set of docked fragment poses, considering the ring-current effect from fragment binding. We illustrate the method by the retrospective analysis of the complex between the anti-apoptotic Bcl-xL protein and the fragment 4′-fluoro-[1,1′-biphenyl]-4-carboxylic acid that was previously shown to bind one of the Bcl-xL hot spots. The CSP-based approach shows that the protein undergoes a subtle conformational rearrangement upon interaction, for residues located in helices 2, 3 and the very beginning of 5. Our observations are corroborated by residual dipolar coupling measurements performed on the free and fragment-bound forms of the Bcl-xL protein. These NMR-based results are in total agreement with previous molecular dynamic calculations that evidenced a high flexibility of Bcl-xL around the binding site. Here we show that CSP of protein amine protons are useful and reliable structural probes. Therefore, we propose to use CSP simulation to assess protein conformational changes upon ligand binding in the fragment-based drug design approach. PMID:23717610
Energy Technology Data Exchange (ETDEWEB)
Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)
2014-02-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.
International Nuclear Information System (INIS)
Brax, Philippe; Upadhye, Amol
2014-01-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments
Fragmentation of forest communities in the eastern United States
Kurt Riitters; John Coulston; James Wickham
2011-01-01
Forest fragmentation threatens the sustainability of forest communities in the eastern United States. Forest communities exhibiting either a low total area or low percentage of intact forest are subject to relatively higher risk of shifts in stand composition towards edge-adapted and invasive species. Such changes in stand composition could result in local extirpation...
Fragmentation and reactivity of energy-selected ferrocenium ions
International Nuclear Information System (INIS)
Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.
2002-01-01
In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e
Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L
2015-01-01
Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.
International Nuclear Information System (INIS)
Tsuruta, Takaharu; Saito, Shinzo; Ochiai, Masaaki
1985-01-01
The fuel fragmentation is one of important subjects to be studied, since it is one of basic processes of molten fuel-coolant interaction (MFCI) and it has not yet been made clear enough. Accordingly, UO 2 fuel fragmentation was studied in the NSRR experiments simulating a reactivity initiated accident (RIA). As results of the experiments, the distribution of the size of fuel fragments was obtained and the mechanism of fuel fragmentation was discussed as described below. It was revealed that the distribution was well displayed in the form of logarithmic Rosin-Rammler's distribution law. It was shown that the conversion ratio from thermal energy to mechanical in the experiment was in inverse propotion to the volume-surface mean diameter defined as a ratio of the total volume of fragments to the total surface. Consequently, it was confirmed that the mean diameter was proper as an index for the degree of the fuel fragmentation. It was also pointed out that the Weber-type hydraulic instability model for fragmentation was consistent with the experimental results. The mechanism of the fuel fragmentation is understood as follows. Cladding tube is ruptured due to the increase in rod pressure when fuel is molten, and then molten fuel spouts through the openings in the form of jet. As a result of molten fuel spouting, fuel is fragmented by the Weber-type of hydraulic instability. The model well explains the effects of experimental parameters as heat deposition, subcooling of cooling water and capsule diameter, on the fuel fragmentation. According to the model, fuel fragments have to be spherical. There were many spherical particles which had hollow and burst crack. This may be due to internal burst during solidification process. The items which should be studied further are also described in the end of this report. (author)
Universality of projectile fragmentation model
International Nuclear Information System (INIS)
Chaudhuri, G.; Mallik, S.; Das Gupta, S.
2012-01-01
Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation
Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.
Dubinets, Nikita; Slipchenko, Lyudmila V
2017-07-20
Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.
Robust Object Tracking Using Valid Fragments Selection.
Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang
Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.
Political fragmentation and widening disparities in African-American and white mortality, 1972-1988.
Kim, Yonsu; Bruckner, Tim A
2016-12-01
During the 1970s and 1980s in the U.S., population movement, urban sprawl and urban governance reform led to a proliferation of local, autonomous jurisdictions. Prior literature examines how this creation of local governments, also referred to as political fragmentation, contributes to economic growth and social inequality. We examine the impact of political fragmentation on health equity by testing the hypothesis that the mortality disparity between whites and African-Americans varies positively with political fragmentation. We retrieved mortality data from the multiple cause-of-death file and calculated total number of local governments per 1000 residents in a county to measure the degree of political fragmentation. We focused on 226 U.S. counties with population size greater than 200,000 and restricted the analysis to four distinct periods with overlapping government and mortality data (1972-73, 1977-78, 1982-83, and 1987-88). We applied generalized estimating equation methods that permit analysis of clustered data over time. Methods also controlled for the age structure of the population, reductions in mortality over time, and confounding by county-level sociodemographic variables. Adjusted coefficients of fragmentation are positive and statistically significant for both whites (coef: 2.60, SE: 0.60, p politically fragmented urban counties and/or time periods. From 1972 to 1988, political fragmentation in large urban counties moves positively with the racial/ethnic gap in mortality between whites and African-Americans. We discuss intervening mechanisms through which political fragmentation may disproportionately affect mortality among African-Americans.
Self-organized criticality in fragmenting
DEFF Research Database (Denmark)
Oddershede, L.; Dimon, P.; Bohr, J.
1993-01-01
The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...
Fragmentation of Pb-Projectiles at SPS Energies
2002-01-01
% EMU17 \\\\ \\\\ We have exposed stacks consisting of solid state nuclear track detectors (CR-39 plastic and BP-1 glass) and different target materials at the SPS to beams of Pb projectiles. Our detectors record tracks of relativistic nuclei with charge numbers of Z~$\\geq$~6 for CR-39 and Z~$\\geq$75 for BP-1. After development of the tracks by etching they are detected and measured using completely automated microscope systems. Thus experiments with high statistics are possible. \\\\ \\\\BP-1 detectors were exposed to measure total charge changing cross sections and elemental production cross sections for heavy projectile fragments. These experiments were performed for different targets CH$ _{2} $, C, Al, Cu, Ag and Pb. Comparison of the results for different targets allows to investigate contributions to charge changing reactions by electromagnetic dissociation. Multifragmentation events in which several intermediate mass fragments are emitted from the heavy Pb projectile are studied using stacks containing CR-39 d...
Kinetics of a Migration-Driven Aggregation-Fragmentation Process
Institute of Scientific and Technical Information of China (English)
ZHUANG You-Yi; LIN Zhen-Quan; KE Jian-Hong
2003-01-01
We propose a reversible model of the migration-driven aggregation-fragmentation process with the sym-metric migration rate kernels K(k;j) = K'(k;j) = λkjv and the constant aggregation rates I1, I2 and fragmentationrates J1, J2. Based on the mean-field theory, we investigate the evolution behavior of the aggregate size distributions inseveral cases with different values of index v. We find that the fragmentation reaction plays a more important role in the kinetic behaviors of the system than the aggregation and migration. When J1 = 0 and J2 = 0, the aggregate sizedistributions ak(t) and bk(t) obey the conventional scaling law, while when J1 > 0 and J2 > 0, they obey the modifiedscaling law with an exponential scaling function. The total mass of either species remains conserved.
Energy production using fission fragment rockets
International Nuclear Information System (INIS)
Chapline, G.; Matsuda, Y.
1991-08-01
Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs
DEFF Research Database (Denmark)
Kokotovic, Branko; Angen, Øystein
2007-01-01
Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...
Energy Technology Data Exchange (ETDEWEB)
Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-07-01
This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de
Thermodynamics of the fuel fragmentation gas
International Nuclear Information System (INIS)
Perez, R.B.; Alsmiller, R.G. Jr.
1977-01-01
In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Models of fragmentation with composite power laws
Tavassoli, Z.; Rodgers, G. J.
1999-06-01
Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.
Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.
2005-06-01
For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)
Kinetics of fragmentation-annihilation processes
Filipe, JAN; Rodgers, GJ
1996-01-01
We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...
Fission fragment spins and spectroscopy
International Nuclear Information System (INIS)
Durell, J.L.
1988-01-01
Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission
Li, Huiyan; Wan, Huiying; Xia, Tian; Chen, Maohua; Zhang, Yun; Luo, Xiaoming; Li, Xiaohong
2015-07-01
Therapeutic angiogenesis remains the most effective method to re-establish a proper blood flow in ischemic tissues. There is a great clinical need to identify an injectable format to achieve a well accumulation following local administration and a sustained delivery of biological factors at the ischemic sites. In the current study, fragmented nanofibers with loaded traditional Chinese medicines, astragaloside IV (AT), the main active ingredient of astragalus, and ferulic acid (FA), the main ingredient of angelica, were proposed to promote the microvessel formation after intramuscular injection into ischemic hindlimbs. Fragmented fibers with average lengths of 5 (FF-5), 20 (FF-20) and 80 μm (FF-80) were constructed by the cryocutting of aligned electrospun fibers. Their dispersion in sodium alginate solution (0.2%) indicated good injectability. After injection into the quadriceps muscles of the hindlimbs, FF-20 and FF-80 fiber fragments showed higher tissue retentions than FF-5, and around 90% of the injected doses were determined after 7 days. On a hindlimb ischemia model established by ligating the femoral arteries, intramuscular injection of the mixtures of FA-loaded and AT-loaded FF-20 fiber fragments substantially reduced the muscle degeneration with minimal fibrosis formation, significantly enhanced the neovessel formation and hindlimb perfusion in the ischemic tissues, and efficiently promoted the limb salvage with few limb losses. Along with the easy manipulation and lower invasiveness for in vivo administration, fragmented fibers should become potential drug carriers for disease treatment, wound recovery and tissue repair after local injection.
Coutard, Bruno; Decroly, Etienne; Li, Changqing; Sharff, Andrew; Lescar, Julien; Bricogne, Gérard; Barral, Karine
2014-06-01
Seasonal and pandemic flaviviruses continue to be leading global health concerns. With the view to help drug discovery against Dengue virus (DENV), a fragment-based experimental approach was applied to identify small molecule ligands targeting two main components of the flavivirus replication complex: the NS3 helicase (Hel) and the NS5 mRNA methyltransferase (MTase) domains. A library of 500 drug-like fragments was first screened by thermal-shift assay (TSA) leading to the identification of 36 and 32 fragment hits binding Hel and MTase from DENV, respectively. In a second stage, we set up a fragment-based X-ray crystallographic screening (FBS-X) in order to provide both validated fragment hits and structural binding information. No fragment hit was confirmed for DENV Hel. In contrast, a total of seven fragments were identified as DENV MTase binders and structures of MTase-fragment hit complexes were solved at resolution at least 2.0Å or better. All fragment hits identified contain either a five- or six-membered aromatic ring or both, and three novel binding sites were located on the MTase. To further characterize the fragment hits identified by TSA and FBS-X, we performed enzymatic assays to assess their inhibition effect on the N7- and 2'-O-MTase enzymatic activities: five of these fragment hits inhibit at least one of the two activities with IC50 ranging from 180μM to 9mM. This work validates the FBS-X strategy for identifying new anti-flaviviral hits targeting MTase, while Hel might not be an amenable target for fragment-based drug discovery (FBDD). This approach proved to be a fast and efficient screening method for FBDD target validation and discovery of starting hits for the development of higher affinity molecules that bind to novel allosteric sites. Copyright © 2014 Elsevier B.V. All rights reserved.
Binding-Site Compatible Fragment Growing Applied to the Design of β2-Adrenergic Receptor Ligands.
Chevillard, Florent; Rimmer, Helena; Betti, Cecilia; Pardon, Els; Ballet, Steven; van Hilten, Niek; Steyaert, Jan; Diederich, Wibke E; Kolb, Peter
2018-02-08
Fragment-based drug discovery is intimately linked to fragment extension approaches that can be accelerated using software for de novo design. Although computers allow for the facile generation of millions of suggestions, synthetic feasibility is however often neglected. In this study we computationally extended, chemically synthesized, and experimentally assayed new ligands for the β 2 -adrenergic receptor (β 2 AR) by growing fragment-sized ligands. In order to address the synthetic tractability issue, our in silico workflow aims at derivatized products based on robust organic reactions. The study started from the predicted binding modes of five fragments. We suggested a total of eight diverse extensions that were easily synthesized, and further assays showed that four products had an improved affinity (up to 40-fold) compared to their respective initial fragment. The described workflow, which we call "growing via merging" and for which the key tools are available online, can improve early fragment-based drug discovery projects, making it a useful creative tool for medicinal chemists during structure-activity relationship (SAR) studies.
Fragment formation in GeV-energy proton and light heavy-ion induced reactions
International Nuclear Information System (INIS)
Murakami, T.; Haga, M.; Haseno, M.
2002-01-01
We have investigated similarities and differences among the fragment formation processes in GeV-energy light-ion and light heavy-ion induced reactions. We have newly measured inclusive and exclusive energy spectra of intermediate mass fragments (3 ≤ Z ≤ 30; IMFs) for 8-GeV 16 O and 20 Ne and 12-GeV 20 Ne induced target multifragmentations (TMFs) in order to compare them with those previously measured for 8- and 12-GeV proton induced TMFs. We fond noticeable difference in their spectrum shapes and magnitudes but all of them clearly indicate the existence of sideward-peaked components, indicating fragment formations are mainly dictated not by a incident energy per nucleon but by a total energy of the projectile. (author)
Fragmentation of atomic clusters: A theoretical study
International Nuclear Information System (INIS)
Lopez, M.J.; Jellinek, J.
1994-01-01
Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time
Cyclic delivery scheduling to customers with different priorities
Directory of Open Access Journals (Sweden)
Katarzyna Zofia Gdowska
2013-12-01
Full Text Available Background: In this paper a cyclic delivery scheduling problem for customers with different priorities is presented. Shops, which are provided with deliveries, are occasionally located in places which are crucial for the proper flow of traffic. In such places coordination of deliveries is crucial; therefore it allows to completely eliminate the phenomenon of the simultaneous arrivals of suppliers. Methods: In this paper the cyclic delivery scheduling problem for customers with different priorities was presented. To this theoretical problem a mix integer programming model was developed. Specific approach to the cyclic delivery scheduling problem is inspired by timetabling problem for urban public transport. Results: Mixed integer programming model was employed for solving four cases of cyclic delivery scheduling problem for customers with different priorities. When the value of the synchronization priority assigned to a single customer raised then the total number of synchronizations in the whole network decreased. In order to compare solutions a synchronization rate was utilized. A simple factor was utilized - the proportion of number of synchronizations of deliveries to a given customer to the total number of synchronizations obtained for the whole network. When the value of synchronization priority raised then the value of synchronization rate of this customer improved significantly. Conclusions: The mixed integer programming model for the cyclic delivery scheduling problem for customers with different priorities presented in this paper can be utilized for generating schedules of serving customers located in places where only one delivery can be received and unloaded at one go and where there is no space for other suppliers to wait in a queue. Such a schedule can be very useful for organizing deliveries to small shops united in a franchising network, since they operate in a way that is very similar to the network presented in this paper
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
Super: a web server to rapidly screen superposable oligopeptide fragments from the protein data bank
Collier, James H.; Lesk, Arthur M.; Garcia de la Banda, Maria; Konagurthu, Arun S.
2012-01-01
Searching for well-fitting 3D oligopeptide fragments within a large collection of protein structures is an important task central to many analyses involving protein structures. This article reports a new web server, Super, dedicated to the task of rapidly screening the protein data bank (PDB) to identify all fragments that superpose with a query under a prespecified threshold of root-mean-square deviation (RMSD). Super relies on efficiently computing a mathematical bound on the commonly used structural similarity measure, RMSD of superposition. This allows the server to filter out a large proportion of fragments that are unrelated to the query; >99% of the total number of fragments in some cases. For a typical query, Super scans the current PDB containing over 80 500 structures (with ∼40 million potential oligopeptide fragments to match) in under a minute. Super web server is freely accessible from: http://lcb.infotech.monash.edu.au/super. PMID:22638586
Photon-hadron fragmentation: theoretical situation
International Nuclear Information System (INIS)
Peschanski, R.
1983-07-01
Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory
Recent progress on perturbative QCD fragmentation functions
International Nuclear Information System (INIS)
Cheung, K.
1995-05-01
The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons
Molecular-Simulation-Driven Fragment Screening for the Discovery of New CXCL12 Inhibitors.
Martinez-Rosell, Gerard; Harvey, Matt J; De Fabritiis, Gianni
2018-03-26
Fragment-based drug discovery (FBDD) has become a mainstream approach in drug design because it allows the reduction of the chemical space and screening libraries while identifying fragments with high protein-ligand efficiency interactions that can later be grown into drug-like leads. In this work, we leverage high-throughput molecular dynamics (MD) simulations to screen a library of 129 fragments for a total of 5.85 ms against the CXCL12 monomer, a chemokine involved in inflammation and diseases such as cancer. Our in silico binding assay was able to recover binding poses, affinities, and kinetics for the selected library and was able to predict 8 mM-affinity fragments with ligand efficiencies higher than 0.3. All of the fragment hits present a similar chemical structure, with a hydrophobic core and a positively charged group, and bind to either sY7 or H1S68 pockets, where they share pharmacophoric properties with experimentally resolved natural binders. This work presents a large-scale screening assay using an exclusive combination of thousands of short MD adaptive simulations analyzed with a Markov state model (MSM) framework.
Energy Technology Data Exchange (ETDEWEB)
Meslin, C.
1995-01-01
A study of the formation and the decay of hot nuclear fragments produced in the reactions Xe+Au and Xe+Ag at an energy of 44 A.MeV is presented in this thesis. The 4{pi} experimental setup consisted of four multidetectors -two for the detection of the fragments (Z>7; DELF and XYZT) and two for the detection of the charged particles (Z<6; MUR and TONNEAU) and allowed an analysis using ``complete events`` (80 % of the total charge and the total parallel linear momentum of the entrance channel) to be carried out. The reaction mechanism is binary with as observed at low energy an almost complete relaxation of the incident energy. The collision results in two hot fragments at the beginning of the exit channel which decay by evaporation and/or fragmentation. In addition of these two body events, we have identified a new dynamic mechanism where we detect a small fragment, called the neck, coming form the overlap of the nuclei during the interaction, in coincidence with a projectile-like fragment and a target-like fragment. For the most dissipative collisions, the deep inelastic collision have allowed an estimation of the lifetime of the hot nuclear fragments to be made. This is possible using proximity effects and fragment-fragment space-time correlations of the decay of one or two primary partners from the deep inelastic collisions. This method is seen to reach its limits in the case of the reactions studied here. (authors). 61 refs.
Fragmentation and flow in central collisions
International Nuclear Information System (INIS)
Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.
1987-01-01
Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs
David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda
2010-01-01
Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...
Mass spectrometry for fragment screening.
Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris
2017-11-08
Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Mei, B.; Tu, X. L.; Wang, M.
2018-04-01
An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.
Neonatal clavicle fracture in cesarean delivery: incidence and risk factors.
Choi, Hyun Ah; Lee, Yeon Kyung; Ko, Sun Young; Shin, Son Moon
2017-07-01
Neonatal clavicle fracture in cesarean delivery is rare and has not been extensively studied. We performed a retrospective review of cesarean deliveries with neonatal clavicle fracture during a 12-year period. Maternal and neonatal factors as well as surgical factors related to cesarean delivery for the fracture were determined and compared to the control group to analyze their significance. Among a total 89 367 deliveries during the study period, 36 286 babies were born via cesarean section. Nineteen cases of clavicle fractures in cesarean section were identified (0.05% of total live births via cesarean section). In the analysis of maternal and neonatal risk factors, birthweight, birthweight ≥ 4000 g and maternal age were significantly associated with clavicle fracture in cesarean section. However, clavicle fractures were not correlated with the selected surgical factors such as indication for cesarean section, skin incision to delivery time and incision type of skin and uterus. Logistic regression analysis showed that birthweight was the major risk factor for clavicle fracture. Clavicle fractures complicated 0.05% of cesarean deliveries. The main risk factor related to a clavicle fracture in cesarean section was the birthweight of an infant. As reported in previous studies associated with vaginal delivery, clavicle fracture is considered to be an unavoidable event and may not be eliminated, even in cesarean delivery.
CHANGING TRENDS IN CAESAREAN DELIVERY - A CLINICAL STUDY
Directory of Open Access Journals (Sweden)
Annappa Shetty
2016-10-01
Full Text Available BACKGROUND Today, there is a concern over the rising caesarean delivery both in the developed and developing countries across the world. It has been observed that both primary and repeat caesarean deliveries have been increasing at an alarming rate. Indications for caesarean deliveries also shows changing trends in the present scenario. The main aim of this study is to compare the caesarean delivery rates over the last one decade. The objective behind the study is to understand the contributing factors for the new trends. MATERIALS AND METHODS For this study, the data was collected in a retrospective manner from all the deliveries that occurred between July 1, 2005, to June 30, 2006, and July 2015 to June 30, 2016, in the Department of Obstetrics and Gynaecology, Karwar Institute of Medical Science, Karwar. A cohort of 2752 delivered women were studied. Among the caesarean births, the indications for both the primary and repeat caesarean sections were studied. After analysing the caesarean births from total live births, the rate for both primary and repeat caesarean were calculated. RESULTS The caesarean delivery rate is increased from 167 to 263 for 1000 live births with increase in primary caesarean delivery rate from 101 (10.1% to 187 (18.7% per 1000 live births in last one decade. Foetal distress, cephalopelvic disproportion, arrest of descent, multiple gestations, breech presentation contributed to this increase. CONCLUSION There is an increase in the total caesarean rate with significant rise in the primary caesarean rate in the last one decade.
International Nuclear Information System (INIS)
Tudora, A.
2013-01-01
The experimental data of average prompt neutron multiplicity as a function of total kinetic energy of fragments <ν>(TKE) exhibit, especially in the case of 252 Cf(SF), different slopes dTKE/dν and different behaviours at low TKE values. The Point-by-Point (PbP) model can describe these different behaviours. The higher slope dTKE/dν and the flattening of <ν> at low TKE exhibited by a part of experimental data sets is very well reproduced when the PbP multi-parametric matrix ν(A,TKE) is averaged over a double distribution Y(A,TKE). The lower slope and the almost linear behaviour over the entire TKE range exhibited by other data sets is well described when the same matrix ν(A,TKE) is averaged over a single distribution Y(A). In the case of average prompt neutron energy in SCM as a function of TKE, different dTKE/dε slopes are also obtained by averaging the same PbP matrix ε(A,TKE) over Y(A,TKE) and over Y(A). The results are exemplified for 3 fissioning systems benefiting of experimental data as a function of TKE: 252 Cf(SF), 235 U(n th ,f) and 239 Pu(n th ,f). In the case of 234 U(n,f) for the first time it was possible to calculate <ν>(TKE) and <ε>(TKE) at many incident energies by averaging the PbP multi-parametric matrices over the experimental Y(A,TKE) distributions recently measured at IRMM for 14 incident energies in the range 0.3- 5 MeV. The results revealed that the slope dTKE/dν does not vary with the incident energy and the flattening of <ν> at low TKE values is more pronounced at low incident energies. The average model parameters dependences on TKE resulted from the PbP treatment allow the use of the most probable fragmentation approach, having the great advantage to provide results at many TKE values in a very short computing time compared to PbP and Monte Carlo treatments. (author)
Physics of projectile fragments
International Nuclear Information System (INIS)
Minamisono, Tadanori
1982-01-01
This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)
International Nuclear Information System (INIS)
Sowinski, M.
1975-05-01
The energy distributions and relative intensities of protons, deuterons, tritons and alpha-particles emitted along the fission axis during thermal neutron fission of 236 U are measured simultaneously with the energies of the two fission fragments. The mass distributions of the fragments, the total kinetic energy (TKE), the dependence of the mean TKE on the fragment mass, as well as the mean kinetic energy dependence of polar particles on the fragment mass and energy are deduced from these data. Although some experimental results agree remarkably well with the hypothesis that polar particles are evaporated in-flight from fission fragments, the general conclusion is that these particles are emitted according to some other mechanism
Fission and fragmentation of silver and bromine nuclei by 1-6 GeV energy photons
International Nuclear Information System (INIS)
Pinheiro Filho, J. de D.
1983-01-01
Fission and fragmentation of silver and bromine nuclei induced by bremsstrahlung photons in the maximum energy range of 1-6 GeV are studied. A special technique of nuclear emulsion for the highly ionizing nuclear fragment detection is used in the discrimination between nuclear fission and fragmentation events. Films of Ilford-KO nuclear emulsion (approximatelly 10 20 atoms/cm 2 of Ag, Br) which had been exposed to bremsstrahlung beams in 'Deutsches Elektronen Synchrotron' (DESY, Hamburg) with total doses of approximatelly 10 11 equivalent photons are used. Through a detailed analysis of range, angular and angle between fragment distributions, and empirical relations which permit to estimate nuclear fragment energy, range and velocity, the discrimination between fission and fragmentation events is made. Results related to fragment range distribution, angular distribution, distribution of angle between fragments, distribution of ratio between ranges, velocity distributions, forward/backward ratio, fission and fragmentation cross sections, nuclear fissionability and ternary fission frequency are presented and discussed. The results show that the mean photofragmentation cross section in the internal 1-6 GeV (0,09+-0,02mb) is significant when compared to the photofission (0,29+-0,05mb). It is also shown that the mean photofission cross section between 1 and 6 GeV is great by a factor of approximatelly 10 when compared to the foreseen by the cascade-evaporation nuclear model for monoenergetic photons of 0,6 GeV. (L.C.) [pt
Resuscitation of newborn in high risk deliveries
International Nuclear Information System (INIS)
Yousaf, U.F.; Hayat, S.
2015-01-01
High risk deliveries are usually associated with increased neonatal mortality and morbidity. Neonatal resuscitation can appreciably affect the outcome in these types of deliveries. Presence of personnel trained in basic neonatal resuscitation at the time of delivery can play an important role in reducing perinatal complications in neonates at risk. The study was carried out to evaluate the effects of newborn resuscitation on neonatal outcome in high risk deliveries. Methods: This descriptive case series was carried out at the Department of Obstetrics and Gynecology, Jinnah Hospital, Lahore. Ninety consecutive high risk deliveries were included and attended by paediatricians trained in newborn resuscitation. Babies delivered by elective Caesarean section, normal spontaneous vaginal deliveries and still births were excluded. Neonatal resuscitation was performed in babies who failed to initiate breathing in the first minute after birth. Data was analyzed using SPSS-16.0. Results: A total of 90 high risk deliveries were included in the study. Emergency caesarean section was the mode of delivery in 94.4% (n=85) cases and spontaneous vaginal delivery in 5.6% (n=5). Preterm pregnancy was the major high risk factor. Newborn resuscitation was required in 37.8% (n=34) of all high risk deliveries (p=0.013). All the new-borns who required resuscitation survived. Conclusion: New-born resuscitation is required in high risk pregnancies and personnel trained in newborn resuscitation should be available at the time of delivery. (author)
MRI of displaced meniscal fragments
International Nuclear Information System (INIS)
Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal
2012-01-01
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
MRI of displaced meniscal fragments
Energy Technology Data Exchange (ETDEWEB)
Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)
2012-01-15
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
Dimensional crossover in fragmentation
Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.
2000-11-01
Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.
PAIN RELIEF MEDIATED BY IMPLANTABLE DRUG-DELIVERY DEVICES
HOEKSTRA, A
Various totally implantable drug delivery systems from single access ports to micropumps are now available for administration of repeated boluses, and continuous or programmable infusions. In this respect, emphasis is given to a relatively cheap, totally implantable system for self-administering
Energy Technology Data Exchange (ETDEWEB)
Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)
2013-09-21
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.
International Nuclear Information System (INIS)
Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.
2013-01-01
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections
EARLY STAGES OF CLUSTER FORMATION: FRAGMENTATION OF MASSIVE DENSE CORES DOWN TO ∼< 1000 AU
International Nuclear Information System (INIS)
Palau, Aina; Girart, Josep M.; Fuente, Asunción; Estalella, Robert; Ho, Paul T. P.; Zhang, Qizhou; Sánchez-Monge, Álvaro; Fontani, Francesco; Cesaroni, Riccardo; Busquet, Gemma; Commerçon, Benoit; Hennebelle, Patrick; Boissier, Jérémie; Zapata, Luis A.
2013-01-01
In order to study the fragmentation of massive dense cores, which constitute the cluster cradles, we observed the continuum at 1.3 mm and the CO (2-1) emission of four massive cores with the Plateau de Bure Interferometer in the most extended configuration. We detected dust condensations down to ∼0.3 M ☉ and separate millimeter sources down to 0.''4 or ∼ 4 millimeter sources. We compiled a list of properties for the 18 massive dense cores, such as bolometric luminosity, total mass, and mean density, and found no correlation of any of these parameters with the fragmentation level. In order to investigate the combined effects of the magnetic field, radiative feedback, and turbulence in the fragmentation process, we compared our observations to radiation magnetohydrodynamic simulations and found that the low-fragmented regions are reproduced well in the magnetized core case, while the highly fragmented regions are consistent with cores where turbulence dominates over the magnetic field. Overall, our study suggests that the fragmentation in massive dense cores could be determined by the initial magnetic field/turbulence balance in each particular core.
Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen
2009-01-30
In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.
Yorke, Elizabeth H.; Judy, Carter E.; Saveraid, Travis C.; McGowan, Conor P.; Caldwell, Fred J.
2014-01-01
Distal border fragments of the navicular bone are increasingly being detected due to the improved capabilities of magnetic resonance imaging (MRI), but their clinical significance remains unclear. The purpose of this retrospective study was to describe the location, size, and frequency of fragments in a cohort of horses presented for MRI of the foot and to compare MRI findings with severity of lameness. Archived MRI studies and medical records were searched from March 2006 to June 2008. Horses were included if a distal border fragment of the navicular bone was visible in MRI scans. Confidence interval comparisons and linear regression analyses were used to test hypotheses that fragments were associated with lameness and lameness severity was positively correlated with fragment volume and biaxial location. A total of 453 horses (874 limbs) were included. Fragments were identified in 60 horses (13.25%) and 90 limbs (10.3%). Fifty percent of the horses had unilateral fragments and 50% had bilateral fragments. Fragments were located at the lateral (62.2%), medial (8.89%), or medial and lateral (28.9%) angles of the distal border of the navicular bone. There was no increased probability of being categorized as lame if a fragment was present. There was no significant difference in fragment volume across lameness severity categorizations. Confidence intervals indicated a slightly increased probability of being classified as lame if both medial and lateral fragments were present. Findings indicated that distal border fragments of the navicular bone in equine MRI studies are unlikely to be related to existing lameness.
Reframing landscape fragmentation's effects on ecosystem services.
Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R
2015-04-01
Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fragment Size Distribution of Blasted Rock Mass
Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris
2017-12-01
Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.
Bird diversity along a gradient of fragmented habitats of the Cerrado.
Jesus, Shayana DE; Pedro, Wagner A; Bispo, Arthur A
2018-01-01
Understanding the factors that affect biodiversity is of central interest to ecology, and essential to species conservation and ecosystems management. We sampled bird communities in 17 forest fragments in the Cerrado biome, the Central-West region of Brazil. We aimed to know the communities structure pattern and the influence of geographical distance and environmental variables on them, along a gradient of fragmented habitats at both local and landscape scales. Eight structural variables of the fragments served as an environmental distance measurement at the local scale while five metrics served as an environmental distance measurement at the landscape scale. Species presence-absence data were used to calculate the dissimilarity index. Beta diversity was calculated using three indices (βsim, βnes and βsor), representing the spatial species turnover, nestedness and total beta diversity, respectively. Spatial species turnover was the predominant pattern in the structure of the communities. Variations in beta diversity were explained only by the environmental variables of the landscape with spatial configuration being more important than the composition. This fact indicates that, in Cerrado of Goiás avian communities structure, deterministic ecological processes associated to differences in species responses to landscape fragmentation are more important than stochastic processes driven by species dispersal.
DEFF Research Database (Denmark)
Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø
1997-01-01
A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...
International Nuclear Information System (INIS)
Alonso Martinez, L. M.; Xiques Castillo, A.; Leyva Montanna, R.; Perez-Malo Cruz, M.; Zamora Barrabi, M.; Manresa Sanchez, Y.
2013-01-01
Antibody-based targeted delivery of radioisotopes to malignant tissues is a promising approach in cancer diagnostics and therapy. However, intact antibody molecules are large glycoproteins (∼150 kDa) that have limited application in molecular imaging and therapy due to their relatively slow clearance from the circulation leading to a high background signal rather both cases the sensitivity can be increased with the use of enzymatically produced Fab' fragments. In this work, the ability to get labeled with 62 Ga and 90 Y of a monoclonal antibody (mAb) Fab' fragment against the transmembrane receptor tyrosine kinase HER-1 was studied for future applications in PET imaging and radioimmunotherapy of tumors. In order to obtain the Fab' fragment the mAb was cleaved with pepsin in molar excess. After separating the reaction mixture in two steps using affinity and ion-exchange chromatography, the Fab' fragment was finally obtained by reduction of the F(ab') 2 with a molar excess of 2-mercaptoethanol followed by a size exclusion purification step. The Fab' fragment was derivatized with 1,4,7,10-tetraaza cyclododecane-1,4,7,10-tetraacetic acid mono N-hydroxysuccinimide commercial ester (DOTA-NHS-ester) applying a simple procedure and the number of DOTA groups linked to Fab' were determinate. The labeling of the conjugate with 68 Ga and 90 Y from 'in-house generators yielded radiochemically pure probes that can become a suitable radioimmunoconjugated in a near future. (Author)
Medium-scale melt-sodium fragmentation experiments
International Nuclear Information System (INIS)
Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.
1979-01-01
The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments
Dual Fragment Impact of PBX Charges
Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team
2017-06-01
Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.
Multiscale benchmarking of drug delivery vectors.
Summers, Huw D; Ware, Matthew J; Majithia, Ravish; Meissner, Kenith E; Godin, Biana; Rees, Paul
2016-10-01
Cross-system comparisons of drug delivery vectors are essential to ensure optimal design. An in-vitro experimental protocol is presented that separates the role of the delivery vector from that of its cargo in determining the cell response, thus allowing quantitative comparison of different systems. The technique is validated through benchmarking of the dose-response of human fibroblast cells exposed to the cationic molecule, polyethylene imine (PEI); delivered as a free molecule and as a cargo on the surface of CdSe nanoparticles and Silica microparticles. The exposure metrics are converted to a delivered dose with the transport properties of the different scale systems characterized by a delivery time, τ. The benchmarking highlights an agglomeration of the free PEI molecules into micron sized clusters and identifies the metric determining cell death as the total number of PEI molecules presented to cells, determined by the delivery vector dose and the surface density of the cargo. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James
2014-01-01
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)
2014-04-10
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Gallstone fragmentation by control electrohydraulic lithotripsy
International Nuclear Information System (INIS)
Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.
1989-01-01
The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy
Fragmentation functions approach in pQCD fragmentation phenomena
International Nuclear Information System (INIS)
Rolli, S.
1996-07-01
Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines
Fragmentation of neck-like structures
International Nuclear Information System (INIS)
Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI
1994-01-01
Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)
Directory of Open Access Journals (Sweden)
Paula Eveline Ribeiro D’Anunciação
2013-01-01
Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.
Fragmentation of Ceramics in Rapid Expansion Mode
Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan
The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.
International Nuclear Information System (INIS)
Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin
1990-01-01
The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)
Tests of spinning turbine fragment impact on casing models
International Nuclear Information System (INIS)
Wilbeck, J.S.
1984-01-01
Ten 1/11-scale model turbine missile impact tests were conducted at a Naval spin chamber test facility to assess turbine missile effects in nuclear plant design. The objective of the tests was to determine the effects of missile spin, blade crush, and target edge conditions on the impact of turbine disk fragments on the steel casing. The results were intended for use in making realistic estimates for the initial conditions of fragments that might escape the casing in the event of a disk burst in a nuclear plant. The burst of a modified gas turbine rotor in a high-speed spin chamber provided three missiles with the proper rotational and translational velocities of actual steam turbine fragments. Tests of bladed, spinning missiles were compared with previous tests of unbladed, nonspinning missiles. The total residual energy of the spinning missiles, as observed from high-speed photographs of disk burst, was the same as that of the nonspinning missiles launched in a piercing orientation. Tests with bladed missiles showed that for equal burst speeds, the residual energy of bladed missiles is less than that of unbladed missiles. Impacts of missiles near the edge of targets resulted in residual missile velocities greater than for central impact. (orig.)
The formation of planets by disc fragmentation
Directory of Open Access Journals (Sweden)
Stamatellos Dimitris
2013-04-01
Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.
Extraction of 16th Century Calender Fragments
DEFF Research Database (Denmark)
Holck, Jakob Povl; Etheridge, Christian
at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....
Secretion of intact proteins and peptide fragments by lysosomal pathways of protein degradation
International Nuclear Information System (INIS)
Isenman, L.D.; Dice, J.F.
1989-01-01
We report that degradation of proteins microinjected into human fibroblasts is accompanied by release into the culture medium of peptide fragments and intact proteins as well as single amino acids. For the nine proteins and polypeptides microinjected, acid-precipitable radioactivity, i.e. peptide fragments and/or intact proteins, ranged from 10 to 67% of the total released radioactivity. Peptide fragments and/or intact protein accounted for 60% of the radioactivity released into the medium by cells microinjected with ribonuclease A. Two major radiolabeled peptide fragments were found, and one was of an appropriate size to function as an antigen in antigen-presenting cells. The peptides released from microinjected ribonuclease A were derived from lysosomal pathways of proteolysis based on several lines of evidence. Previous studies have shown that microinjected ribonuclease A is degraded to single amino acids entirely within lysosomes. We show that release of free amino acids and peptide fragments and/or intact protein was equivalently stimulated by serum deprivation and equivalently inhibited by NH4Cl. We also show that lysosomal degradation of endocytosed [3H]ribonuclease A was accompanied by the release of two peptide fragments similar in size and charge to those from microinjected [ 3 H]ribonuclease A. These findings demonstrate that degradation within lysosomes occurs in a manner that spares specific peptides; they also suggest a previously unsuspected pathway by which cells can secrete cytosol-derived polypeptides
Knörr, U C; Gottsberger, G
2012-09-01
Tropical forests are seriously threatened by fragmentation and habitat loss. The impact of fragment size and forest configuration on the composition of seed rain is insufficiently studied. For the present study, seed rain composition of small and large forest fragments (8-388 ha) was assessed in order to identify variations in seed abundance, species richness, seed size and dispersal mode. Seed rain was documented during a 1-year period in three large and four small Atlantic Forest fragments that are isolated by a sugarcane matrix. Total seed rain included 20,518 seeds of 149 species of trees, shrubs, palms, lianas and herbs. Most species and seeds were animal-dispersed. A significant difference in the proportion of seeds and species within different categories of seed size was found between small and large fragments. Small fragments received significantly more very small-sized seeds (1.5 cm) that were generally very rare, with only one species in small and eight in large fragments. We found a negative correlation between the inflow of small-sized seeds and the percentage of forest cover. Species richness was lower in small than in large fragments, but the difference was not very pronounced. Given our results, we propose changing plant species pools through logging, tree mortality and a high inflow of pioneer species and lianas, especially in small forest fragments and areas with low forest cover. Connecting forest fragments through corridors and reforestation with local large-seeded tree species may facilitate the maintenance of species diversity. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.
Shepherd, Dawn; Booth, Sarah; Waithe, Dominic; Reis e Sousa, Caetano
2015-01-01
TLR7 mediates innate immune responses to viral RNA in endocytic compartments. Mouse and human (h)TLR7 undergo proteolytic cleavage, resulting in the generation of a C-terminal fragment that accumulates in endosomes and associates with the signaling adaptor MyD88 upon receptor triggering by TLR7 agonists. Although mouse TLR7 is cleaved in endosomes by acidic proteases, hTLR7 processing can occur at neutral pH throughout the secretory pathway through the activity of furin-like proprotein convertases. However, the mechanisms by which cleaved hTLR7 reaches the endosomal compartment remain unclear. In this study, we demonstrate that, after hTLR7 proteolytic processing, the liberated amino (N)-terminal fragment remains bound to the C terminus through disulfide bonds and provides key trafficking information that ensures correct delivery of the complex to endosomal compartments. In the absence of the N-terminal fragment, the C-terminal fragment is redirected to the cell surface, where it is functionally inactive. Our data reveal a novel role for the N terminus of hTLR7 as a molecular chaperone that provides processed hTLR7 with the correct targeting instructions to reach the endosomal compartment, hence ensuring its biological activity and preventing inadvertent cell surface responses to self-RNA. PMID:25917086
Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E
2017-02-01
A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.
Jones, Jason J; Chu, Jeffrey; Graham, Jacob; Zaluski, Serge; Rocha, Guillermo
2016-01-01
The aim of this study was to evaluate the operational impact of using preloaded intraocular lens (IOL) delivery systems compared with manually loaded IOL delivery processes during routine cataract surgeries. Time and motion data, staff and surgery schedules, and cost accounting reports were collected across three sites located in the US, France, and Canada. Time and motion data were collected for manually loaded IOL processes and preloaded IOL delivery systems over four surgery days. Staff and surgery schedules and cost accounting reports were collected during the 2 months prior and after introduction of the preloaded IOL delivery system. The study included a total of 154 routine cataract surgeries across all three sites. Of these, 77 surgeries were performed using a preloaded IOL delivery system, and the remaining 77 surgeries were performed using a manual IOL delivery process. Across all three sites, use of the preloaded IOL delivery system significantly decreased mean total case time by 6.2%-12.0% (Psystem also decreased surgeon lens time, surgeon delays, and eliminated lens touches during IOL preparation. Compared to a manual IOL delivery process, use of a preloaded IOL delivery system for cataract surgery reduced total case time, total surgeon lens time, surgeon delays, and eliminated IOL touches. The time savings provided by the preloaded IOL delivery system provide an opportunity for sites to improve routine cataract surgery throughput without impacting surgeon or staff capacity.
Santos, Alexandre Rosa Dos; Antonio Alvares Soares Ribeiro, Carlos; de Oliveira Peluzio, Telma Machado; Esteves Peluzio, João Batista; de Queiroz, Vagner Tebaldi; Figueira Branco, Elvis Ricardo; Lorenzon, Alexandre Simões; Domingues, Getulio Fonseca; Marcatti, Gustavo Eduardo; de Castro, Nero Lemos Martins; Teixeira, Thaisa Ribeiro; Dos Santos, Gleissy Mary Amaral Dino Alves; Santos Mota, Pedro Henrique; Ferreira da Silva, Samuel; Vargas, Rozimelia; de Carvalho, José Romário; Macedo, Leandro Levate; da Silva Araújo, Cintia; de Almeida, Samira Luns Hatum
2016-12-01
The Atlantic Forest biome is recognized for its biodiversity and is one of the most threatened biomes on the planet, with forest fragmentation increasing due to uncontrolled land use, land occupation, and population growth. The most serious aspect of the forest fragmentation process is the edge effect and the loss of biodiversity. In this context, the aim of this study was to evaluate the dynamics of forest fragmentation and select potential forest fragments with a higher degree of conservation for seed harvesting in the Itapemirim river basin, Espírito Santo State, Brazil. Image classification techniques, forest landscape ecology, and multi-criteria analysis were used to evaluate the evolution of forest fragmentation to develop the landscape metric indexes, and to select potential forest fragments for seed harvesting for the years 1985 and 2013. According to the results, there was a reduction of 2.55% of the occupancy of the fragments in the basin between the years 1985 and 2013. For the years 1985 and 2013, forest fragment units 2 and 3 were spatialized with a high potential for seed harvesting, representing 6.99% and 16.01% of the total fragments, respectively. The methodology used in this study has the potential to be used to support decisions for the selection of potential fragments for seed harvesting because selecting fragments in different environments by their spatial attributes provides a greater degree of conservation, contributing to the protection and conscious management of the forests. The proposed methodology can be adapted to other areas and different biomes of the world. Copyright © 2016 Elsevier Ltd. All rights reserved.
Fluctuations in the fragmentation process
International Nuclear Information System (INIS)
Botet, R.; Ploszajczak, M.
1993-01-01
Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs
The spectroscopy of fission fragments
International Nuclear Information System (INIS)
Phillips, W.R.
1998-01-01
High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)
[Fragment-based drug discovery: concept and aim].
Tanaka, Daisuke
2010-03-01
Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.
Shell closure at the touching point of nuclear fragments
International Nuclear Information System (INIS)
Poenaru, D.N.; Greiner, W.; Gherghescu, R.A.
1998-01-01
Shell correction energy of the fission fragments remains practically unchanged when the separation distance increases from the sum of their radii up to infinity. The variation with mass asymmetry of the total deformation energy at the touching point configuration shows the valleys corresponding to different decay modes, which are produced when the two proton and/or the two neutron numbers are magic or almost magic. We present a contour plot of the deformation energy of the proton-rich α-emitter 106 Te, showing for the first time the α-decay valley. Different valleys mainly due to the doubly magic nuclei 100,132 Sn, 208 Pb, and other magic numbers, are illustrated by plotting the deformation energy at the touching point versus the proton number of the fragment, for the following parent nuclei: 106 Te; 116 Ce; 212 Po; 228 Th; 258 Fm, and 264 Fm. (author). Letter-to-the-editor
Velocity distribution of fragments of catastrophic impacts
Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi
1992-01-01
Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator
Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.
2018-04-01
The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.
Richness and Abundance of Ichneumonidae in a Fragmented Tropical Rain Forest.
Ruiz-Guerra, B; Hanson, P; Guevara, R; Dirzo, R
2013-10-01
Because of the magnitude of land use currently occurring in tropical regions, the local loss of animal species due to habitat fragmentation has been widely studied, particularly in the case of vertebrates. Many invertebrate groups and the ichneumonid wasps in particular, however, have been poorly studied in this context, despite the fact that they are one of the most species-rich groups and play an important role as regulators of other insect populations. Here, we recorded the taxonomic composition of ichneumonid parasitoids and assessed their species richness, abundance, similarity, and dominance in the Los Tuxtlas tropical rain forest, Mexico. We compared two forest types: a continuous forest (640 ha) and a forest fragment (19 ha). We sampled ichneumonids using four malaise traps in both forest types during the dry (September-October) and rainy (March-April) seasons. A total of 104 individuals of Ichneumonidae belonging to 11 subfamilies, 18 genera, and 42 species were collected in the continuous forest and 11 subfamilies, 15 genera, and 24 species were collected in the forest fragment. Species richness, abundance, and diversity of ichneumonids were greater in the continuous forest than in the forest fragment. We did not detect differences between seasons. Species rank/abundance curves showed that the ichneumonid community between the forest types was different. Species similarity between forest types was low. The most dominant species in continuous forest was Neotheronia sp., whereas in the forest fragment, it was Orthocentrus sp. Changes in the ichneumonid wasp community may compromise important tropical ecosystem processes.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
Origin of complex fragments from 32S + natAg reaction at 37.5 A.MeV
International Nuclear Information System (INIS)
Benchekroun, D.; Cheynis, B.; Demeyer, A.; Gerlic, E.; Guinet, D.; Lautesse, P.; Lebreton, L.; Magda, M.T.; Stern, M.; Chabane, A.; Desesquelles, P.; Giorni, A.; Heuer, D.; Lleres, A.; Viano, J.B.
1996-08-01
Fragment emission from collisions of 32 S with nat Ag at 37.5 A.MeV has been studied with the 4π multidetector AMPHORA. Production of intermediate mass and heavy fragments as well as of light charged particles has been measured. The total charged particle multiplicity and polar angular distributions have been used to select various classes of collisions. Analysis of angular and energy distributions of fragments and light particles in central collisions indicates the formation of a hot source (excitation energy of ∼ 4.4 A.MeV) with an additional contribution from a preequilibrium process at more forward angles. Azimuthal angle correlations of He - Li, Li - Li, B - B, and C - C pairs have been used as a tool to study the origin of complex fragments. Data at backward angles are well described by considering a thermalized emitter with an angular momentum around 70 h and a fragment emission time of the order of 200 fm/c. A microscopic approach of BNV type confirms these emission times and angular momenta indicating the persistence of an incomplete fusion process responsible for the emission of complex fragments at backward angles
GlobeLand30 shows little cropland area loss but greater fragmentation in China
Yu, Qiangyi; Hu, Qiong; van Vliet, Jasper; Verburg, Peter H.; Wu, Wenbin
2018-04-01
Understanding of cropland dynamics in a large geographical extent is mostly based on observations of area change, while the changes in landscape pattern are hardly assessed. The total amount of cropland in China has remained relatively stable in recent years, which might suggest there was little change. In this analysis, we combine the number of cropland patches (NP) with the total cropland area (TA) for a more comprehensive characterization of cropland change in China. We use GlobeLand30-a global land cover dataset with a 30 m resolution for the years 2000 and 2010-and characterize changes in TA and NP for each county as increase, stable, or decrease. This characterization shows that 703 out of 2420 counties experienced both cropland loss and increased fragmentation. The predominant cropland loss in these areas, especially in the North China Plain, is converted to artificial land. Another 212 are characterized by the opposite developments: an increase in cropland and decreased fragmentation. These counties, are mainly characterized by a conversion of forest areas and grassland areas. It suggests that the cropland conservation policy in China effectively protected the total cropland area in overall, but the consequences in terms of fragmentation might be underestimated. Counties with no obvious change in both indicators, measuring 279 counties, are mainly located in the Southeast. Our results are further compared with local level case studies: the fair consistency indicates alternatives of applying GlobeLand30 for analyzing landscape changes across scales and for cross-site comparisons.
Fragment emission from modestly excited nuclear systems
Energy Technology Data Exchange (ETDEWEB)
Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.
1996-07-08
Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).
The spectroscopy of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)
1998-12-31
High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.
International Nuclear Information System (INIS)
Knott, Jeff; Gilbert, Jo; Hoccom, David G.; Green, Rhys E.
2010-01-01
Lead poisoning caused by ingested spent lead shotgun pellets has long been known to be a cause of unnecessary mortality in waterfowl and has led to legislation limiting its use in many countries. Recent evidence has shown that the problem extends to terrestrial ecosystems and to fragmented rifle bullets eaten by scavengers as well as shotgun pellets. Dietary exposure of human consumers to lead from spent ammunition in game meat also poses potential risks to human health. To assess the degree of fragmentation of lead bullets used to kill wild deer, twelve deer were shot in the thorax using copper-jacketed lead-cored bullets, as part of planned deer management operations. The thoracic region of the eviscerated carcasses and the abdominal viscera of each deer were X-rayed. An average of 356 metal fragments was visible on radiographs of the carcass and 180 fragments in the viscera. The weight of fragments was estimated by reference to an X-rayed scale of fragments of known weight. The average total weight of metal fragments, likely to be mostly lead, was estimated to be 1.2 g for the carcass and 0.2 g for the viscera. The total estimated weight of fragments in the entire carcass was estimated to be 17% of the weight of the bullet. Most fragments were small in size, with those in the viscera being smaller than those in the carcass. Metal fragments in the viscera were sufficiently small that at least 80% of the metallic bullet-derived lead in the viscera would be expected to be ingested by scavenging birds, such as buzzards and eagles, which feed on them.
Energy Technology Data Exchange (ETDEWEB)
Knott, Jeff, E-mail: jeff.knott@rspb.org.uk [Royal Society for the Protection of Birds, The Lodge, Sandy, Bedfordshire SG19 2DL (United Kingdom); Gilbert, Jo; Hoccom, David G. [Royal Society for the Protection of Birds, The Lodge, Sandy, Bedfordshire SG19 2DL (United Kingdom); Green, Rhys E. [Royal Society for the Protection of Birds, The Lodge, Sandy, Bedfordshire SG19 2DL (United Kingdom); Conservation Science Group, Department of Zoology, University of Cambridge, Downing Street, Cambridge CB2 3EJ (United Kingdom)
2010-12-01
Lead poisoning caused by ingested spent lead shotgun pellets has long been known to be a cause of unnecessary mortality in waterfowl and has led to legislation limiting its use in many countries. Recent evidence has shown that the problem extends to terrestrial ecosystems and to fragmented rifle bullets eaten by scavengers as well as shotgun pellets. Dietary exposure of human consumers to lead from spent ammunition in game meat also poses potential risks to human health. To assess the degree of fragmentation of lead bullets used to kill wild deer, twelve deer were shot in the thorax using copper-jacketed lead-cored bullets, as part of planned deer management operations. The thoracic region of the eviscerated carcasses and the abdominal viscera of each deer were X-rayed. An average of 356 metal fragments was visible on radiographs of the carcass and 180 fragments in the viscera. The weight of fragments was estimated by reference to an X-rayed scale of fragments of known weight. The average total weight of metal fragments, likely to be mostly lead, was estimated to be 1.2 g for the carcass and 0.2 g for the viscera. The total estimated weight of fragments in the entire carcass was estimated to be 17% of the weight of the bullet. Most fragments were small in size, with those in the viscera being smaller than those in the carcass. Metal fragments in the viscera were sufficiently small that at least 80% of the metallic bullet-derived lead in the viscera would be expected to be ingested by scavenging birds, such as buzzards and eagles, which feed on them.
Delivery type not associated with global methylation at birth
Directory of Open Access Journals (Sweden)
Virani Shama
2012-06-01
Full Text Available Abstract Background Birth by cesarean delivery (CD as opposed to vaginal delivery (VD is associated with altered health outcomes later in life, including respiratory disorders, allergies and risk of developing type I diabetes. Epigenetic gene regulation is a proposed mechanism by which early life exposures affect later health outcomes. Previously, type of delivery has been found to be associated with differences in global methylation levels, but the sample sizes have been small. We measured global methylation in a large birth cohort to identify whether type of delivery is associated with epigenetic changes. Methods DNA was isolated from cord blood collected from the University of Michigan Women’s & Children Hospital and bisulfite-converted. The Luminometric Methylation Assay (LUMA and LINE-1 methylation assay were run on all samples in duplicate. Results Global methylation data at CCGG sites throughout the genome, as measured by LUMA, were available from 392 births (52% male; 65% CD, and quantitative methylation levels at LINE-1 repetitive elements were available for 407 births (52% male; 64% CD. LUMA and LINE-1 methylation measurements were negatively correlated in this population (Spearman’s r = −0.13, p =0.01. LUMA measurements were significantly lower for total CD and planned CD, but not emergency CD when compared to VD (median VD = 74.8, median total CD = 74.4, p = 0.03; median planned CD = 74.2, p = 0.02; median emergency CD = 75.3, p = 0.39. However, this association did not persist when adjusting for maternal age, maternal smoking and infant gender. Furthermore, total CD deliveries, planned CD and emergency CD deliveries were not associated with LINE-1 measurements as compared to VD (median VD = 82.2, median total CD = 81.9, p = 0.19; median planned CD = 81.9, p = 0.19; median emergency CD = 82.1, p = 0.52. This lack of association held when adjusting for maternal age
Evolution of a practical total synthesis of ciguatoxin CTX3C.
Inoue, Masayuki; Hirama, Masahiro
2004-12-01
More than 20 000 people suffer annually from ciguatera seafood poisoning in subtropical and tropical regions. The extremely low content of the causative neurotoxins, designated as ciguatoxins, in fish has hampered their isolation, detailed biological study, and preparation of anti-ciguatoxin antibodies for detecting these toxins. Ciguatoxins consist of 12 trans-fused polycyclic ethers, ranging from six- to nine-membered, and include a spirally attached five-membered cyclic ether at one end. The large (3 nm in length) and complicated molecular structure of ciguatoxins has impeded chemists from completing their total synthesis. In 2001, we achieved the first total synthesis of ciguatoxin CTX3C by assembly of four structural fragments. Since then, protocols to combine the fragments have significantly improved in terms of overall stereoselectivity, efficiency, and practicality. In this Account, we describe recently evolved methodologies for the total synthesis of CTX3C.
Directory of Open Access Journals (Sweden)
Zhifeng Liu
Full Text Available Urbanization results in habitat loss and habitat fragmentation concurrently, both influencing biodiversity and ecological processes. To evaluate these impacts, it is important to understand the relationships between habitat loss and habitat fragmentation per se (HLHF during urbanization. The objectives of this study were two-fold: 1 to quantify the different forms of the HLHF relationship during urbanization using multiple landscape metrics, and 2 to test the validity of the HLHF relations reported in the literature. Our analysis was based on a long-term urbanization dataset (1800-2000 of 16 large cities from around the world. Habitat area was represented as the percentage of non-built-up area in the landscape, while habitat fragmentation was measured using several landscape metrics. Our results show that the relationship between habitat loss and habitat fragmentation during urbanization is commonly monotonic-linear, exponential, or logarithmic, indicating that the degree of habitat fragmentation per se increases with habitat loss in general. We compared our results with 14 hypothesized HLHF relationships based on simulated landscapes found in the literature, and found that four of them were consistent with those of urbanization, whereas the other ten were not. Also, we identified six new HLHF relationships when fragmentation was measured by total core area, normalized total core area, patch density, edge density and landscape shape index, respectively. In addition, our study demonstrated that the "space-for-time" approach, frequently used in ecology and geography, generated specious HLHF relationships, suggesting that this approach is largely inappropriate for analyses of urban landscapes that are highly heterogeneous in space and unusually contingent in dynamics. Our results show both generalities and idiosyncrasies of the HLHF relationship, providing new insights for assessing ecological effects of urbanization.
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
Baculoviral delivery of CRISPR/Cas9 facilitates efficient genome editing in human cells.
Directory of Open Access Journals (Sweden)
Sanne Hindriksen
Full Text Available The CRISPR/Cas9 system is a highly effective tool for genome editing. Key to robust genome editing is the efficient delivery of the CRISPR/Cas9 machinery. Viral delivery systems are efficient vehicles for the transduction of foreign genes but commonly used viral vectors suffer from a limited capacity in the genetic information they can carry. Baculovirus however is capable of carrying large exogenous DNA fragments. Here we investigate the use of baculoviral vectors as a delivery vehicle for CRISPR/Cas9 based genome-editing tools. We demonstrate transduction of a panel of cell lines with Cas9 and an sgRNA sequence, which results in efficient knockout of all four targeted subunits of the chromosomal passenger complex (CPC. We further show that introduction of a homology directed repair template into the same CRISPR/Cas9 baculovirus facilitates introduction of specific point mutations and endogenous gene tags. Tagging of the CPC recruitment factor Haspin with the fluorescent reporter YFP allowed us to study its native localization as well as recruitment to the cohesin subunit Pds5B.
Baculoviral delivery of CRISPR/Cas9 facilitates efficient genome editing in human cells.
Hindriksen, Sanne; Bramer, Arne J; Truong, My Anh; Vromans, Martijn J M; Post, Jasmin B; Verlaan-Klink, Ingrid; Snippert, Hugo J; Lens, Susanne M A; Hadders, Michael A
2017-01-01
The CRISPR/Cas9 system is a highly effective tool for genome editing. Key to robust genome editing is the efficient delivery of the CRISPR/Cas9 machinery. Viral delivery systems are efficient vehicles for the transduction of foreign genes but commonly used viral vectors suffer from a limited capacity in the genetic information they can carry. Baculovirus however is capable of carrying large exogenous DNA fragments. Here we investigate the use of baculoviral vectors as a delivery vehicle for CRISPR/Cas9 based genome-editing tools. We demonstrate transduction of a panel of cell lines with Cas9 and an sgRNA sequence, which results in efficient knockout of all four targeted subunits of the chromosomal passenger complex (CPC). We further show that introduction of a homology directed repair template into the same CRISPR/Cas9 baculovirus facilitates introduction of specific point mutations and endogenous gene tags. Tagging of the CPC recruitment factor Haspin with the fluorescent reporter YFP allowed us to study its native localization as well as recruitment to the cohesin subunit Pds5B.
Fragger: a protein fragment picker for structural queries.
Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J
2017-01-01
Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.
Kaon fragmentation function from NJL-jet model
International Nuclear Information System (INIS)
Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang
2010-01-01
The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.
Fragmentation of rotating protostellar clouds
International Nuclear Information System (INIS)
Tohline, J.E.
1980-01-01
We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution
Fragment-based approaches to TB drugs.
Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris
2018-02-01
Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.
The Zero-Degree Detector system for fragmentation studies
International Nuclear Information System (INIS)
Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.
2007-01-01
The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan
Introduction to fragment-based drug discovery.
Erlanson, Daniel A
2012-01-01
Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.
Mechanisms Affecting Population Density in Fragmented Habitat
Directory of Open Access Journals (Sweden)
Lutz Tischendorf
2005-06-01
Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation
Borysko, Petro; Moroz, Yurii S; Vasylchenko, Oleksandr V; Hurmach, Vasyl V; Starodubtseva, Anastasia; Stefanishena, Natalia; Nesteruk, Kateryna; Zozulya, Sergey; Kondratov, Ivan S; Grygorenko, Oleksandr O
2018-05-09
A combination approach of a fragment screening and "SAR by catalog" was used for the discovery of bromodomain-containing protein 4 (BRD4) inhibitors. Initial screening of 3695-fragment library against bromodomain 1 of BRD4 using thermal shift assay (TSA), followed by initial hit validation, resulted in 73 fragment hits, which were used to construct a follow-up library selected from available screening collection. Additionally, analogs of inactive fragments, as well as a set of randomly selected compounds were also prepared (3 × 3200 compounds in total). Screening of the resulting sets using TSA, followed by re-testing at several concentrations, counter-screen, and TR-FRET assay resulted in 18 confirmed hits. Compounds derived from the initial fragment set showed better hit rate as compared to the other two sets. Finally, building dose-response curves revealed three compounds with IC 50 = 1.9-7.4 μM. For these compounds, binding sites and conformations in the BRD4 (4UYD) have been determined by docking. Copyright © 2018 Elsevier Ltd. All rights reserved.
Quark fragmentation in e+e- collisions
International Nuclear Information System (INIS)
Oddone, P.
1984-12-01
This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman
An Analysis of the FY-1C, Iridium 33, and Cosmos 2251 Fragments
Liou, J.-C.
2014-01-01
The beginning of the year 2013 marks the sixth anniversary of the destruction of the Fengyun-1C (FY-1C) weather satellite as the result of an anti-satellite test conducted by China in January 2007 and the fourth anniversary of the accidental collision between Cosmos 2251 and the operational Iridium 33 in February 2009. These two events represent the worst satellite breakups in history. A total of 5579 fragments have been cataloged by the U.S. Space Surveillance Network (SSN), and almost 5000 of them were still in orbit in January 2013. In addition to these cataloged objects, hundreds of thousands (or more) of fragments down to the millimeter size regime were also generated during the breakups. These fragments are too small to be tracked by the SSN, but are large enough to be a safety concern for human space activities and robotic missions in low Earth orbit (LEO, the region below 2000 km altitude). Like their cataloged siblings, many of them remain in orbit today. These two breakup events dramatically changed the landscape of the orbital debris environment in LEO. The spatial density of the cataloged population in January 2013 is shown as the top blue curve. The combined FY-1C, Iridium 33, and Cosmos 2251 fragments (black curve) account for about 50 percent of the cataloged population below an altitude of 1000 km. They are also responsible for the concentrations at 770 km and 850 km, altitudes at which the collisions occurred. The effects of the FY-1C, Iridium 33, and Cosmos 2251 fragments will continue to be felt for decades to come. For example, approximately half of the generated FY-1C fragments will remain in orbit 20 years from now. In general, the Iridium 33 and Cosmos 2251 fragments will decay faster than the FY-1C fragments because of their lower altitudes. Of the Iridium 33 and Cosmos 2251 fragments, the former have much shorter orbital lifetimes than the latter, because lightweight composite materials were heavily used in the construction of the Iridium
Formulation and Evaluation of Two-Pulse Drug Delivery System of ...
African Journals Online (AJOL)
Purpose: To develop a pH-controlled two-pulse drug delivery system of amoxicillin in order to overcome ... delivery have lately been applied in developing a .... Note: Each tablet contained 2 mg each of magnesium stearate and colloidal silicon dioxide; total weight of each ..... and Manufacture of Medicines, 3rd edn, Elsevier,.
Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator
International Nuclear Information System (INIS)
Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.
1993-10-01
Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
Stochastic dynamics of spatial effects in fragmentation of clusters
International Nuclear Information System (INIS)
Salinas-Rodriguez, E.; Rodriguez, R.F.; Zamora, J.M.
1991-01-01
We use a stochastic approach to study the effects of spatial in homogeneities in the kinetics of a fragmentation model which occurs in cluster breakup and polymer degradation. The analytical form of the cluster size distribution function is obtained for both the discrete and continuous limits. From it we calculate numerically the average size and volume of the clusters, their total concentration and the total scattering of the dispersion in both limits. The influence of spatial effects is explicitly shown in the last two quantities. From our description the equations for the equal-time and the two times density correlation functions are also derived in the continuous limit. Finally, the perspectives and limitations of our approach are discussed (Author)
DEFF Research Database (Denmark)
Bang, Jacob Sebastian
2018-01-01
I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....
Measurement of charm fragmentation fractions in photoproduction at HERA
Energy Technology Data Exchange (ETDEWEB)
Abramowicz, H. [Tel Aviv Univ. (Israel). School of Physics; Max-Planck-Institute for Physics, Munich (Germany); Abt, I. [Max-Planck-Institute for Physics, Muinch (Germany); Adamczyk, L. [AGH-Univ. of Science and Technology, Krakow (Poland). Faculty of Physics and Applied Computer Science] [and others; Collaboration: ZEUS Collaboration
2013-06-15
The production of D{sup 0}, D{sup *+}, D{sup +}, D{sub s}{sup +} and {Lambda}{sub c}{sup +} charm hadrons and their antiparticles in ep scattering at HERA has been studied with the ZEUS detector, using a total integrated luminosity of 372 pb{sup -1}. The fractions of charm quarks hadronising into a particular charm hadron were derived. In addition, the ratio of neutral to charged D-meson production rates, the fraction of charged D mesons produced in a vector state, and the strangeness-suppression factor have been determined. The measurements have been performed in the photoproduction regime. The charm hadrons were reconstructed in the range of transverse momentum p{sub T} > 3.8GeV and pseudorapidity vertical stroke {eta} vertical stroke <1.6. The charm fragmentation fractions are compared to previous results from HERA and from e{sup +}e{sup -} experiments. The data support the hypothesis that fragmentation is independent of the production process.
Chemical Production using Fission Fragments
International Nuclear Information System (INIS)
Dawson, J. K.; Moseley, F.
1960-01-01
Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr
The dynamics of fragment formation
International Nuclear Information System (INIS)
Keane, D.
1994-09-01
We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy
Hands as markers of fragmentation
Directory of Open Access Journals (Sweden)
A. Barnard
2005-07-01
Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.
The Kosice meteorite fall: atmospheric trajectory and fragmentation from videos and radiometers
Borovicka, J.
2012-01-01
On 28 February 2010, 22h24m46s UT, a huge bolide of absolute magnitude -18 appeared over eastern Slovakia. Although this country is covered by the European Fireball Network (EN) and the Slovak Video Network, bad weather prevented direct imaging of the bolide by dedicated meteor cameras. Fortunately, three surveillance video cameras in Hungary recorded, at least partly, the event. These recordings allowed us to reconstruct the trajectory of the bolide and recover the meteorites. In addition, the light curve of the bolide was recorded by several EN camera radiometers, and sonic booms were registered by seismic stations in the region. The meteorites were classified as ordinary chondrites of type H5 (see Meteoritical Bulletin 100). I developed a model of atmospheric meteoroid fragmentation to fit the observed light curve. The model is based on the fact that meteoroid fragmentation leads to a sudden increase of a bolide's brightness, because the total meteoroid surface area increases after the fragmentation. A bright flare is produced if large numbers of small fragments or dust particles are released. I tried to model the whole light curve rigorously by setting up the mass distribution of fragments and/or dust particles released at each fragmentation point. The dust particles were allowed to be released either instantaneously or gradually. The ablation and radiation of individual particles were computed independently, and the summary light curve was computed. The deceleration at the end of the trajectory was taken into account as well. Based on the approximate calibration of the light curve, the initial mass of the meteoroid was estimated to 3500 kg (corresponding to diameter of 1.2 m). The major fragmentation occurred at a height of 39 km. Only few (probably three) large compact fragments of masses 20-100 kg survived this disruption. All of them fragmented again at lower heights below 30 km, producing minor flares on the light curve. In summary, Kosice was a weak
The effects of the mode of delivery on oxidative-antioxidative balance.
Mutlu, Birgul; Aksoy, Nurten; Cakir, Hale; Celik, Hakim; Erel, Ozcan
2011-11-01
The purpose of this study was to investigate the effects of the mode of delivery on the oxidant and antioxidant systems in mothers and infants and to demonstrate which mode leads more oxidative stress. The participants were divided into two groups according to the mode of their labour and delivery: group 1 (n = 33) women with normal labour and delivery and group 2 (n = 33) with scheduled caesarean section (C/S) and delivery. The maternal, cord, and infant blood samples in both groups were collected. The serum total antioxidant capacity (TAC) and the total oxidant status (TOS) were evaluated by using an automated colorimetric measurement method. The parameters indicating oxidative stress (TOS, oxidative stress index, and lipid hydroperoxide) in maternal, cord, and newborn blood samples were higher in patients delivering with C/S than those normal spontaneous vaginal deliveries (NSVD) patient group, while it was vice versa for TAC. It may be concluded that both the mothers and neonates in C/S group are exposed to higher oxidative stress as compared with those in NSVD group and the antioxidant mechanisms are insufficient to cope with this stress during C/S. This result indicates that the normal delivery through the physiological route is healthier for the bodies of mothers and infants.
International Nuclear Information System (INIS)
Silisteanu, I.
1991-06-01
The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs
An Algebra for Program Fragments
DEFF Research Database (Denmark)
Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger
1985-01-01
Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...
Energy Technology Data Exchange (ETDEWEB)
Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-09-05
The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.
A model for projectile fragmentation
International Nuclear Information System (INIS)
Chaudhuri, G; Mallik, S; Gupta, S Das
2013-01-01
A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.
Outcomes of Operative Vaginal Delivery during Trial of Labor after Cesarean Delivery.
Brock, Clifton O; Govindappagari, Shravya; Gyamfi-Bannerman, Cynthia
2017-07-01
Objective The objective of this study is to determine the maternal and neonatal morbidity associated with attempting operative vaginal delivery (OVD) compared with the alternative of a laboring repeat cesarean delivery (LRCD) in women attempting a trial of labor after cesarean delivery (TOLAC). Methods This is a secondary analysis of a multicenter prospective study designed to assess perinatal outcomes of OVD in women with a prior uterine scar. The study includes women who attempted TOLAC and reached +2 station with a fully dilated cervix. Composites on neonatal and maternal morbidity were compared between women in whom OVD was attempted and those who underwent LRCD by fitting multivariate logistic regression models. Results In total, 6,489 women attempting TOLAC reached 2+ station with a fully dilated cervix. Of these, 5,640 (86.9%) had a spontaneous vaginal delivery, 762 (11.7%) underwent attempted OVD, and 87 (1.3%) had an LRCD. Compared with attempting OVD, LRCD was associated with greater neonatal morbidity (odds ratio [OR]: 2.41; 95% confidence interval [CI]: 1.13-5.15) and less maternal morbidity (OR: 0.28; 95% CI: 0.14-0.55). Maternal morbidity of OVD is driven by perineal injury. Conclusion In laboring women with a previous uterine scar, attempting OVD is associated with greater maternal and less neonatal morbidity than LRCD. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Evaluation of health care delivery integration: the case of the Russian Federation.
Sheiman, Igor; Shevski, Vladimir
2014-04-01
Fragmentation in organization and discontinuities in the provision of medical care are problems in all health systems, whether it is the mixed public-private one in the USA, national health services in the UK, or insurance based one in Western Europe and Russia. In all of these countries a major challenge is to strengthen integration in order to enhance efficiency and health outcomes. This article assesses issues related to fragmentation and integration in conceptual terms and argues that key attributes of integration are teamwork, coordination and continuity of care. It then presents a summary of service integration problems in Russia and the results of a large survey of physicians concerning the attributes of integration. It is argued that characteristics of the national service delivery model don't ensure integration. The Semashko model is not an equivalent to the integrated model. Big organizational forms of service provision, like polyclinics and integrated hospital-polyclinics, don't have higher scores of integration indicators than smaller ones. Proposals to improve integration in Russia are presented with the focus on the regular evaluation of integration/fragmentation, regulation of integration activities, enhancing the role of PHC providers, economic incentives. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
High energy nuclear collisions in the few GeV/nucleon region: projectile and target fragmentation
International Nuclear Information System (INIS)
Schroeder, L.S.
1980-06-01
A general review of nucleon-nucleus and nucleus-nucleus collisions for incident energies <10 GeV/nucleon is presented. The division of these interactions into peripheral and central collisions is briefly discussed. Subjects treated include the following: target and projectile fragmentation systematics, production of exotic nuclear fragments, studies of multiparticle final states, total cross section measurements, results from an experiment that indicate the production of projectile fragments with an anomalously short reaction mean free path, high-energy particle production at backward angles beyond simple N-N kinematic limits, and recent results on backward particle emission in studies with the Berkeley streamer chamber. Both the particle and nuclear physics aspects that are present are considered. A brief discussion of future trends in this energy range ends the presentation. 65 references, 37 figures
Remarks about the hypothesis of limiting fragmentation
International Nuclear Information System (INIS)
Chou, T.T.; Yang, C.N.
1987-01-01
Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs
Polarization and alignment of nucleus fission fragments
International Nuclear Information System (INIS)
Barabanov, A.L.; Grechukhin, D.P.
1987-01-01
Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists
Nuclear energy release from fragmentation
Energy Technology Data Exchange (ETDEWEB)
Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)
2016-08-15
It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.
Dihadron fragmentation function and its evolution
International Nuclear Information System (INIS)
Majumder, A.; Wang Xinnian
2004-01-01
Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
Dean, David S.; Majumdar, Satya N.
2002-08-01
We study a fragmentation problem where an initial object of size x is broken into m random pieces provided x > x0 where x0 is an atomic cut-off. Subsequently, the fragmentation process continues for each of those daughter pieces whose sizes are bigger than x0. The process stops when all the fragments have sizes smaller than x0. We show that the fluctuation of the total number of splitting events, characterized by the variance, generically undergoes a nontrivial phase transition as one tunes the branching number m through a critical value m = mc. For m mc they are anomalously large and non-Gaussian. We apply this general result to analyse two different search algorithms in computer science.
Evolution equations for extended dihadron fragmentation functions
International Nuclear Information System (INIS)
Ceccopieri, F.A.; Bacchetta, A.
2007-03-01
We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)
Quantitative experimental modelling of fragmentation during explosive volcanism
Thordén Haug, Ø.; Galland, O.; Gisler, G.
2012-04-01
Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of
Using In Silico Fragmentation to Improve Routine Residue Screening in Complex Matrices
Kaufmann, Anton; Butcher, Patrick; Maden, Kathryn; Walker, Stephan; Widmer, Mirjam
2017-12-01
Targeted residue screening requires the use of reference substances in order to identify potential residues. This becomes a difficult issue when using multi-residue methods capable of analyzing several hundreds of analytes. Therefore, the capability of in silico fragmentation based on a structure database ("suspect screening") instead of physical reference substances for routine targeted residue screening was investigated. The detection of fragment ions that can be predicted or explained by in silico software was utilized to reduce the number of false positives. These "proof of principle" experiments were done with a tool that is integrated into a commercial MS vendor instrument operating software (UNIFI) as well as with a platform-independent MS tool (Mass Frontier). A total of 97 analytes belonging to different chemical families were separated by reversed phase liquid chromatography and detected in a data-independent acquisition (DIA) mode using ion mobility hyphenated with quadrupole time of flight mass spectrometry. The instrument was operated in the MSE mode with alternating low and high energy traces. The fragments observed from product ion spectra were investigated using a "chopping" bond disconnection algorithm and a rule-based algorithm. The bond disconnection algorithm clearly explained more analyte product ions and a greater percentage of the spectral abundance than the rule-based software (92 out of the 97 compounds produced ≥1 explainable fragment ions). On the other hand, tests with a complex blank matrix (bovine liver extract) indicated that the chopping algorithm reports significantly more false positive fragments than the rule based software. [Figure not available: see fulltext.
Impact failure and fragmentation properties of metals
Energy Technology Data Exchange (ETDEWEB)
Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)
1998-03-01
In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.
Predicting "Hot" and "Warm" Spots for Fragment Binding.
Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L
2017-05-11
Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .
Breech at term--mode of delivery? A register-based study
DEFF Research Database (Denmark)
Krebs, L; Langhoff-Roos, J; Weber, Tom
1995-01-01
) when compared to those delivered by elective cesarean section. In vaginal deliveries, parity was not correlated with outcome, but infants with a birth weight above 4000 grams had significantly higher rates of low Apgar scores. CONCLUSIONS. Register data on singleton term breech deliveries imply......BACKGROUND. The present study was designed to determine neonatal mortality and morbidity in non-malformed singleton term infants delivered in breech presentation and identify a possible correlation between outcome on the one hand and mode of delivery, parity and birth weight on the other. METHODS....... Register-based cohort study of all (n = 15718) singleton term breech deliveries of non-malformed infants in Denmark 1982-1990. Process and outcome measures: mode of delivery, gestational age, birth weight, congenital malformations, intrapartum death, Apgar scores and early neonatal death. RESULTS. A total...
The grain-size distribution of pyroclasts: Primary fragmentation, conduit sorting or abrasion?
Kueppers, U.; Schauroth, J.; Taddeucci, J.
2013-12-01
Explosive volcanic eruptions expel a mixture of pyroclasts and lithics. Pyroclasts, fragments of the juvenile magma, record the state of the magma at fragmentation in terms of porosity and crystallinity. The grain size distribution of pyroclasts is generally considered to be a direct consequence of the conditions at magma fragmentation that is mainly driven by gas overpressure in bubbles, high shear rates, contact with external water or a combination of these factors. Stress exerted by any of these processes will lead to brittle fragmentation by overcoming the magma's relaxation timescale. As a consequence, most pyroclasts exhibit angular shapes. Upon magma fragmentation, the gas pyroclast mixture is accelerated upwards and eventually ejected from the vent. The total grain size distribution deposited is a function of fragmentation conditions and transport related sorting. Porous pyroclasts are very susceptible to abrasion by particle-particle or particle-conduit wall interaction. Accordingly, pyroclastic fall deposits with angular clasts should proof a low particle abrasion upon contact to other surfaces. In an attempt to constrain the degree of particle interaction during conduit flow, monomodal batches of washed pyroclasts have been accelerated upwards by rapid decompression and subsequently investigated for their grain size distribution. In our set-up, we used a vertical cylindrical tube without surface roughness as conduit. We varied grain size (0.125-0.25; 0.5-1; 1-2 mm), porosity (0; 10; 30 %), gas-particle ratio (10 and 40%), conduit length (10 and 28 cm) and conduit diameter (2.5 and 6 cm). All ejected particles were collected after settling at the base of a 3.3 m high tank and sieved at one sieve size below starting size (half-Φ). Grain size reduction showed a positive correlation with starting grain size, porosity and overpressure at the vent. Although milling in a volcanic conduit may take place, porous pyroclasts are very likely to be a primary product
Scaling and critical behaviour in nuclear fragmentation
International Nuclear Information System (INIS)
Campi, X.
1990-09-01
These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling
The politics of municipal fragmentation in Ghana
Directory of Open Access Journals (Sweden)
Abdulai Kuyini Mohammed
2015-06-01
Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.
Lack of Population Genetic Structuring in Ocelots (Leopardus pardalis in a Fragmented Landscape
Directory of Open Access Journals (Sweden)
Marina G. Figueiredo
2015-07-01
Full Text Available Habitat fragmentation can promote patches of small and isolated populations, gene flow disruption between those populations, and reduction of local and total genetic variation. As a consequence, these small populations may go extinct in the long-term. The ocelot (Leopardus pardalis, originally distributed from Texas to southern Brazil and northern Argentina, has been impacted by habitat fragmentation throughout much of its range. To test whether habitat fragmentation has already induced genetic differentiation in an area where this process has been documented for a larger felid (jaguars, we analyzed molecular variation in ocelots inhabiting two Atlantic Forest fragments, Morro do Diabo (MD and Iguaçu Region (IR. Analyses using nine microsatellites revealed mean observed and expected heterozygosity of 0.68 and 0.70, respectively. The MD sampled population showed evidence of a genetic bottleneck under two mutational models (TPM = 0.03711 and SMM = 0.04883. Estimates of genetic structure (FST = 0.027; best fit of k = 1 with STRUCTURE revealed no meaningful differentiation between these populations. Thus, our results indicate that the ocelot populations sampled in these fragments are still not significantly different genetically, a pattern that strongly contrasts with that previously observed in jaguars for the same comparisons. This observation is likely due to a combination of two factors: (i larger effective population size of ocelots (relative to jaguars in each fragment, implying a slower effect of drift-induced differentiation; and (ii potentially some remaining permeability of the anthropogenic matrix for ocelots, as opposed to the observed lack of permeability for jaguars. The persistence of ocelot gene flow between these areas must be prioritized in long-term conservation planning on behalf of these felids.
Heart Rate Fragmentation: A Symbolic Dynamical Approach
Directory of Open Access Journals (Sweden)
Madalena D. Costa
2017-11-01
Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
Directory of Open Access Journals (Sweden)
Thomas Püttker
Full Text Available BACKGROUND: The total amount of native vegetation is an important property of fragmented landscapes and is known to exert a strong influence on population and metapopulation dynamics. As the relationship between habitat loss and local patch and gap characteristics is strongly non-linear, theoretical models predict that immigration rates should decrease dramatically at low levels of remaining native vegetation cover, leading to patch-area effects and the existence of species extinction thresholds across fragmented landscapes with different proportions of remaining native vegetation. Although empirical patterns of species distribution and richness give support to these models, direct measurements of immigration rates across fragmented landscapes are still lacking. METHODOLOGY/PRINCIPAL FINDINGS: Using the Brazilian Atlantic forest marsupial Gray Slender Mouse Opossum (Marmosops incanus as a model species and estimating demographic parameters of populations in patches situated in three landscapes differing in the total amount of remaining forest, we tested the hypotheses that patch-area effects on population density are apparent only at intermediate levels of forest cover, and that immigration rates into forest patches are defined primarily by landscape context surrounding patches. As expected, we observed a positive patch-area effect on M. incanus density only within the landscape with intermediate forest cover. Density was independent of patch size in the most forested landscape and the species was absent from the most deforested landscape. Specifically, the mean estimated numbers of immigrants into small patches were lower in the landscape with intermediate forest cover compared to the most forested landscape. CONCLUSIONS/SIGNIFICANCE: Our results reveal the crucial importance of the total amount of remaining native vegetation for species persistence in fragmented landscapes, and specifically as to the role of variable immigration rates in
Molten aluminum alloy fuel fragmentation experiments
International Nuclear Information System (INIS)
Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.
1992-01-01
Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water
Simulations of High Speed Fragment Trajectories
Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis
2017-11-01
Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.
Genda, Hidenori; Iizuka, Tsuyoshi; Sasaki, Takanori; Ueno, Yuichiro; Ikoma, Masahiro
2017-07-01
The Earth was born in violence. Many giant collisions of protoplanets are thought to have occurred during the terrestrial planet formation. Here we investigated the giant impact stage by using a hybrid code that consistently deals with the orbital evolution of protoplanets around the Sun and the details of processes during giant impacts between two protoplanets. A significant amount of materials (up to several tens of percent of the total mass of the protoplanets) is ejected by giant impacts. We call these ejected fragments the giant-impact fragments (GIFs). In some of the erosive hit-and-run and high-velocity collisions, metallic iron is also ejected, which comes from the colliding protoplanets' cores. From ten numerical simulations for the giant impact stage, we found that the mass fraction of metallic iron in GIFs ranges from ∼1 wt% to ∼25 wt%. We also discussed the effects of the GIFs on the dynamical and geochemical characteristics of formed terrestrial planets. We found that the GIFs have the potential to solve the following dynamical and geochemical conflicts: (1) The Earth, currently in a near circular orbit, is likely to have had a highly eccentric orbit during the giant impact stage. The GIFs are large enough in total mass to lower the eccentricity of the Earth to its current value via their dynamical friction. (2) The concentrations of highly siderophile elements (HSEs) in the Earth's mantle are greater than what was predicted experimentally. Re-accretion of the iron-bearing GIFs onto the Earth can contribute to the excess of HSEs. In addition, Iron-bearing GIFs provide significant reducing agent that could transform primitive CO2-H2O atmosphere and ocean into more reducing H2-bearing atmosphere. Thus, GIFs are important for the origin of Earth's life and its early evolution.
Zhang, Lin; Chang, Jin-hua; Zhang, Bao-qi; Liu, Xi-gang; Liu, Pei; Xue, He-fei; Liu, Li-yan; Fu, Qiang; Zhu, Meng; Liu, Cui-zhe
2015-07-01
Rhubarb is commonly used as laxatives in Asian countries, of which anthraquinones are the major active ingredients, but there are an increased number of concerns regarding the nephrotoxicity of anthraquinones. In this study, we compared the pharmacokinetic characteristics of rhubarb anthraquinones in rats after orally administered with rhubarb and rhubarb total free anthraquinone oral colon-specific drug delivery granules (RTFA-OCDD-GN), and then explained why these granules could reduce the nephrotoxicity of anthraquinones when they produced purgative efficacy. A sensitive and reliable high performance liquid chromatography (HPLC) method has been fully validated for simultaneous determination of the five active components of rhubarb, and successfully applied to investigate and compare the remarkable differences in pharmacokinetic study of rhubarb anthraquinones after orally administered with rhubarb and RTFA-OCDD-GN. The results showed that, compared with rhubarb group, the AUC, Cmax, t1/2z and Vz/F of aloe-emodin, rhein, emodin and chrysophanol in rats receiving the RTFA-OCDD-GN were significantly decreased, and the Tmax of the four analytes was prolonged. Moreover, the Tmax of rhein, the Cmax of chrysophanol and emodin all have significant differences (Panthraquinone prototype excretion rates in urine and feces of aloe-emodin, rhein, emodin, chrysophanol and physcion were all increased. These findings suggested that oral colon-specific drug delivery technology made anthraquinone aglycone to colon-specific release after oral administration. This allowed anthraquinones to not only play the corresponding purgative effect but also avoid intestinal absorption and promote excretion. And thereby greatly reduced the nephrotoxicity of rhubarb. The result is a new breakthrough in rhubarb toxicity attenuated research. Copyright © 2015 Elsevier B.V. All rights reserved.
Microstructural characterization of pipe bomb fragments
International Nuclear Information System (INIS)
Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher
2010-01-01
Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.
Renewable energy delivery systems and methods
Walker, Howard Andrew
2013-12-10
A system, method and/or apparatus for the delivery of energy at a site, at least a portion of the energy being delivered by at least one or more of a plurality of renewable energy technologies, the system and method including calculating the load required by the site for the period; calculating the amount of renewable energy for the period, including obtaining a capacity and a percentage of the period for the renewable energy to be delivered; comparing the total load to the renewable energy available; and, implementing one or both of additional and alternative renewable energy sources for delivery of energy to the site.
Cryobiology of coral fragments.
Hagedorn, Mary; Farrell, Ann; Carter, Virginia L
2013-02-01
Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.
MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.
The, Matthew; Käll, Lukas
2016-03-04
Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).
Fragment approaches in structure-based drug discovery
International Nuclear Information System (INIS)
Hubbard, Roderick E.
2008-01-01
Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets
Synthesis of click-reactive HPMA copolymers using RAFT polymerization for drug delivery applications
DEFF Research Database (Denmark)
Ebbesen, Morten F; Schaffert, D.H.; Crowley, Michael L
2013-01-01
This study describes a versatile strategy combining reversible addition fragmentation transfer (RAFT) polymerization and click chemistry to synthesize well-defined, reactive copolymers of N-(2-hydroxypropyl)methacrylamide (HPMA) for drug delivery applications. A novel azide containing monomer N-(3......-azidopropyl)methacrylamide (AzMA) was synthesized and copolymerized with HPMA using RAFT polymerization to provide p(HPMA-co-AzMA) copolymers with high control of molecular weight (∼10–54 kDa) and polydispersity (≤1.06). The utility of the side-chain azide functionality by Cu(I)-catalyzed azide...
Fragmentation properties of 6Li
International Nuclear Information System (INIS)
Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.
1987-01-01
The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs
Geometrical scaling of jet fragmentation photons
Energy Technology Data Exchange (ETDEWEB)
Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)
2016-12-15
We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.
DEFF Research Database (Denmark)
Kruse Aagaard, Anders
2017-01-01
The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...
Fracture mechanics model of fragmentation
International Nuclear Information System (INIS)
Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.
1986-01-01
A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates
Polymer fragmentation in extensional flow
Energy Technology Data Exchange (ETDEWEB)
Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech
2001-06-01
In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.
Directory of Open Access Journals (Sweden)
Guillermo J. Fajardo Sotelo
2018-01-01
Full Text Available The author analyzes the late work of Mexican writer Carlos Fuentes to think about the Mexican political system and its transformations. Also, the author uses the figure of Pedro Paramo as an example of total sovereignty in comparison with the state fragmentation and the multi-sovereign forms that Carlos Fuentes uses in his novels as tools to demonstrate how the transformations have operated in Mexico: from a strong state to a fragmented government surrounded by other forms of control such as globalization, crime, and necroempowerment.
Heavy-Quark Production in the Target Fragmentation Region
Graudenz, Dirk
1997-01-01
Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...
[Maternal and neonatal outcomes of unplanned deliveries].
Nguyen, M-L; Lefèvre, P; Dreyfus, M
2016-01-01
Know the impact of the unplanned deliveries in a town of medium size, the characteristics of these women and maternal and neonatal risks. This was a retrospective study conducted between January 2002 and December 2009. Unexpected delivery was defined as any delivery taking place outside of a non-elective way maternity. Each unexpected delivery was matched at nearest delivery of equivalent term, at the CHU maternity, with an onset of spontaneous labour. Ninety-four women gave birth unexpectedly for a total of 48,721 births (incidence of 0.19%). There was a significant difference between cases and controls for parity (1.8 versus 0.9), the lack of follow-up of pregnancy (21.3% versus 1.1%), tobacco (57.4% versus 25.5%), the socio-economic level, the type of feeding (artificial: 61.7% versus 30.6%), the home-hospital distance and obstetric follow-up. We found a significant increase in perinatal mortality (6.4% versus 1%) and stay in Neonatal ICU (19.1% versus 9.2%). The main neonatal morbidity was hypothermia. It is difficult to target a population at risk because the type of these women is non-specific. Prevention of unplanned deliveries and their morbidities through information of patients on the grounds of urgent consultation and support of the newborn to limit hypothermia. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgos, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K. H.
2016-01-01
Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for
Experimental modelling of fragmentation applied to volcanic explosions
Haug, Øystein Thordén; Galland, Olivier; Gisler, Galen R.
2013-12-01
Explosions during volcanic eruptions cause fragmentation of magma and host rock, resulting in fragments with sizes ranging from boulders to fine ash. The products can be described by fragment size distributions (FSD), which commonly follow power laws with exponent D. The processes that lead to power-law distributions and the physical parameters that control D remain unknown. We developed a quantitative experimental procedure to study the physics of the fragmentation process through time. The apparatus consists of a Hele-Shaw cell containing a layer of cohesive silica flour that is fragmented by a rapid injection of pressurized air. The evolving fragmentation of the flour is monitored with a high-speed camera, and the images are analysed to obtain the evolution of the number of fragments (N), their average size (A), and the FSD. Using the results from our image-analysis procedure, we find transient empirical laws for N, A and the exponent D of the power-law FSD as functions of the initial air pressure. We show that our experimental procedure is a promising tool for unravelling the complex physics of fragmentation during phreatomagmatic and phreatic eruptions.
International Nuclear Information System (INIS)
Chandra, Subhash; Kaur, Manpreet; Midha, Shuchi; Bhatnagar, Rakesh; Banerjee-Bhatnagar, Nirupama
2006-01-01
We report the ability of N-terminal fragment of lethal factor of Bacillus anthracis to deliver genetically fused ESAT-6 (early secretory antigen target), a potent T cell antigen of Mycobacterium tuberculosis, into cytosol to elicit Cytotoxic T lymphocyte (CTL) response. In vitro Th1 cytokines data and CTL assay proved that efficient delivery of LFn.ESAT-6 occurs in cytosol, in the presence of protective antigen (PA), and leads to generation of effective CTL response. Since CTL response is essential for protection against intracellular pathogens and, it is well known that only single T cell epitope or single antigenic protein is not sufficient to elicit protective CTL response due to variation or polymorphism in MHC-I alleles among the individuals, we suggest that as a fusion protein LFn can be used to deliver multiepitopes of T cells or multiproteins which can generate effective CTLs against intracellular pathogens like M. tuberculosis. It can be used to enhance the protective efficacy of BCG vaccine
Energy Technology Data Exchange (ETDEWEB)
Nishio, Katsuhisa; Yamamoto, Hideki; Kimura, Itsuro; Nakagome, Yoshihiro [Kyoto Univ. (Japan)
1997-03-01
Simultaneous measurement of fission fragments and prompt neutrons following the thermal neutron induced fission of U-235 has been performed in order to obtain the neutron multiplicity (v) and its emission energy ({eta}) against the specified mass (m{sup *}) and the total kinetic energy (TKE). The obtained value of -dv/dTKE(m{sup *}) showed a saw-tooth distribution. The average neutron energy <{eta}>(m{sup *}) had a distribution with a reflection symmetry around the half mass division. The measurement also gave the level density parameters of the specified fragment, a(m{sup *}), and this parameters showed a saw-tooth trend too. The analysis by a phenomenological description of this parameters including the shell and collective effects suggested the existence of a collective motion of the fission fragments. (author)
Macroscopic model description of heavy-ion induced complex-fragment emission
International Nuclear Information System (INIS)
Carjan, N.
1988-01-01
The Yukawa-plus-exponential finite-range model and the standard liquid-drop model are shortly reviewed and compared. The dependence of the barrier heights and of the saddle-point shapes on mass-asymmetry and on angular momentum is studied for the compound nuclei 110 Sn, 149 Tb and 194 Hg. The predicted asymmetric-fission barriers, charge yields and total kinetic energies are compared with experimental data obtained from the deexcitation of compound nuclei by complex-fragment emission
Neighbouring charge fragmentations in low energy fission
International Nuclear Information System (INIS)
Montoya, M.
1986-10-01
Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs
Directory of Open Access Journals (Sweden)
Gaigysh Irina Sergeevna
2012-06-01
Full Text Available The main characteristics of epiphytic lichen cover on pine trunks depending on the area of natural pine forest in Kostomuksha (north Karelia were analysed. The town of Kostomuksha was built so that to provide the conservation of forest sites. 56 fragments with the area of 0.04 - 6.13 ha were studied. The average area of fragment is 0.62 ha, with 49 fragments (88% having the area less than 1 ha. Biodiversity and lichen cover were studied in the each fragment with using framework 10x20 cm. 1792 sample plots were made on 448 trees. The total lichens cover varies from 0 to 85%,averaging 10%. 25 species of lichens were found. The number of species in the sample plots varies from 0 to 9. Dominant species found are Hypogymnia physodes, Parmeliopsis ambigua, P. hyperopta, Imshaugia aleurites, Cladonia. Species Alectoria sarmentosa, Cladonia macilenta, Pseudevernia fufruraceae, Bryoria fremontii were less common. It was shown that the main parameters of lichen cover are closely related to the size of the area left in the city forest fragments. The maximum values of species diversity and cover of lichens were found in the fragments of more 1-2 hectares.
Aspect Ratio Dependence of Impact Fragmentation
International Nuclear Information System (INIS)
Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.
1997-01-01
A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society
Hidden Costs of Hospital Based Delivery from Two Tertiary Hospitals in Western Nepal.
Directory of Open Access Journals (Sweden)
Jeevan Acharya
Full Text Available Hospital based delivery has been an expensive experience for poor households because of hidden costs which are usually unaccounted in hospital costs. The main aim of this study was to estimate the hidden costs of hospital based delivery and determine the factors associated with the hidden costs.A hospital based cross-sectional study was conducted among 384 post-partum mothers with their husbands/house heads during the discharge time in Manipal Teaching Hospital and Western Regional Hospital, Pokhara, Nepal. A face to face interview with each respondent was conducted using a structured questionnaire. Hidden costs were calculated based on the price rate of the market during the time of the study.The total hidden costs for normal delivery and C-section delivery were 243.4 USD (US Dollar and 321.6 USD respectively. Of the total maternity care expenditures; higher mean expenditures were found for food & drinking (53.07%, clothes (9.8% and transport (7.3%. For postpartum women with their husband or house head, the total mean opportunity cost of "days of work loss" were 84.1 USD and 81.9 USD for normal delivery and C-section respectively. Factors such as literate mother (p = 0.007, employed house head (p = 0.011, monthly family income more than 25,000 NRs (Nepalese Rupees (p = 0.014, private hospital as a place of delivery (p = 0.0001, C-section as a mode of delivery (p = 0.0001, longer duration (>5days of stay in hospital (p = 0.0001, longer distance (>15km from house to hospital (p = 0.0001 and longer travel time (>240 minutes from house to hospital (p = 0.007 showed a significant association with the higher hidden costs (>25000 NRs.Experiences of hidden costs on hospital based delivery and opportunity costs of days of work loss were found high. Several socio-demographic factors, delivery related factors (place and mode of delivery, length of stay, distance from hospital and travel time were associated with hidden costs. Hidden costs can be a
Hidden Costs of Hospital Based Delivery from Two Tertiary Hospitals in Western Nepal.
Acharya, Jeevan; Kaehler, Nils; Marahatta, Sujan Babu; Mishra, Shiva Raj; Subedi, Sudarshan; Adhikari, Bipin
2016-01-01
Hospital based delivery has been an expensive experience for poor households because of hidden costs which are usually unaccounted in hospital costs. The main aim of this study was to estimate the hidden costs of hospital based delivery and determine the factors associated with the hidden costs. A hospital based cross-sectional study was conducted among 384 post-partum mothers with their husbands/house heads during the discharge time in Manipal Teaching Hospital and Western Regional Hospital, Pokhara, Nepal. A face to face interview with each respondent was conducted using a structured questionnaire. Hidden costs were calculated based on the price rate of the market during the time of the study. The total hidden costs for normal delivery and C-section delivery were 243.4 USD (US Dollar) and 321.6 USD respectively. Of the total maternity care expenditures; higher mean expenditures were found for food & drinking (53.07%), clothes (9.8%) and transport (7.3%). For postpartum women with their husband or house head, the total mean opportunity cost of "days of work loss" were 84.1 USD and 81.9 USD for normal delivery and C-section respectively. Factors such as literate mother (p = 0.007), employed house head (p = 0.011), monthly family income more than 25,000 NRs (Nepalese Rupees) (p = 0.014), private hospital as a place of delivery (p = 0.0001), C-section as a mode of delivery (p = 0.0001), longer duration (>5days) of stay in hospital (p = 0.0001), longer distance (>15km) from house to hospital (p = 0.0001) and longer travel time (>240 minutes) from house to hospital (p = 0.007) showed a significant association with the higher hidden costs (>25000 NRs). Experiences of hidden costs on hospital based delivery and opportunity costs of days of work loss were found high. Several socio-demographic factors, delivery related factors (place and mode of delivery, length of stay, distance from hospital and travel time) were associated with hidden costs. Hidden costs can be a
Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S
2016-01-01
Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gluon fragmentation in T(1S) decays
International Nuclear Information System (INIS)
Bienlein, J.K.
1983-05-01
In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)
Limiting Accretion onto Massive Stars by Fragmentation-Induced Starvation
Energy Technology Data Exchange (ETDEWEB)
Peters, Thomas; /ZAH, Heidelberg; Klessen, Ralf S.; /ZAH, Heidelberg /KIPAC, Menlo Park; Mac Low, Mordecai-Mark; /Amer. Museum Natural Hist.; Banerjee, Robi; /ZAH, Heidelberg
2010-08-25
Massive stars influence their surroundings through radiation, winds, and supernova explosions far out of proportion to their small numbers. However, the physical processes that initiate and govern the birth of massive stars remain poorly understood. Two widely discussed models are monolithic collapse of molecular cloud cores and competitive accretion. To learn more about massive star formation, we perform simulations of the collapse of rotating, massive, cloud cores including radiative heating by both non-ionizing and ionizing radiation using the FLASH adaptive mesh refinement code. These simulations show fragmentation from gravitational instability in the enormously dense accretion flows required to build up massive stars. Secondary stars form rapidly in these flows and accrete mass that would have otherwise been consumed by the massive star in the center, in a process that we term fragmentation-induced starvation. This explains why massive stars are usually found as members of high-order stellar systems that themselves belong to large clusters containing stars of all masses. The radiative heating does not prevent fragmentation, but does lead to a higher Jeans mass, resulting in fewer and more massive stars than would form without the heating. This mechanism reproduces the observed relation between the total stellar mass in the cluster and the mass of the largest star. It predicts strong clumping and filamentary structure in the center of collapsing cores, as has recently been observed. We speculate that a similar mechanism will act during primordial star formation.
Fragmentation of Relativistic 56Fe Nuclei in Emulsion
International Nuclear Information System (INIS)
Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.
1983-03-01
Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)
Paonessa, Jessica E; Williams, James C; Lingeman, James E
2018-04-01
We hypothesized that adding sodium bicarbonate (bicarb) to normal saline (NS) irrigation during ureteroscopy in patients with uric acid (UA) nephrolithiasis may assist in dissolving small stone fragments produced during laser lithotripsy. In vitro testing was performed to determine whether dissolution of UA fragments could be accomplished within 1 hour. In total 100% UA renal calculi were fragmented, filtered, and separated by size. Fragment sizes were <0.5 mm and 0.5 to 1 mm. Similar amounts of stone material were agitated in solution at room temperature. Four solutions were tested (NS, NS +1 ampule bicarb/L, NS +2, NS +3). Both groups were filtered to remove solutions after fixed periods. Filtered specimens were dried and weighed. Fragment dissolution rates were calculated as percent removed per hour. Additional testing was performed to determine whether increasing the temperature of solution affected dissolution rates. For fragments <0.5 mm, adding 2 or 3 bicarb ampules/L NS produced a dissolution rate averaging 91% ± 29% per hour. This rate averaged 226% faster than NS alone. With fragments 0.5 to 1 mm, addition of 2 or 3 bicarb ampules/L NS yielded a dissolution rate averaging 22% ± 7% per hour, which was nearly five times higher than NS alone. There was a trend for an increase in mean dissolution rate with higher temperature but this increase was not significant (p = 0.30). The addition of bicarbonate to NS more than doubles the dissolution rate of UA stone fragments and fragments less than 0.5 mm can be completely dissolved within 1 hour. Addition of bicarb to NS irrigation is a simple and inexpensive approach that may assist in the dissolution of UA fragments produced during ureteroscopic laser lithotripsy. Further studies are needed to determine whether a clinical benefit exists.
Percutaneous transhepatic fragmentation of gall stones and extraction of fragments
International Nuclear Information System (INIS)
Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.
1983-01-01
Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de
Total synthesis, structure, and oral absorption of a thiazole cyclic peptide, sanguinamide A
DEFF Research Database (Denmark)
Nielsen, Daniel S; Hoang, Huy N; Lohman, Rink-Jan
2012-01-01
The first total synthesis and three-dimensional solution structure are reported for sanguinamide A, a thiazole-containing cyclic peptide from the sea slug H. sanguineus. Solution phase fragment synthesis, solid phase fragment assembly, and solution macrocyclization were combined to give (1) in 10......% yield. Spectral properties were identical for the natural product, requiring revision of its structure from (2) to (1). Intramolecular transannular hydrogen bonds help to bury polar atoms, which enables oral absorption from the gut....
The role of fragmentation mechanism in large-scale vapor explosions
International Nuclear Information System (INIS)
Liu, Jie
2003-01-01
A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)
Memory effects in nuclear fragmentation?
International Nuclear Information System (INIS)
Colonna, M.; Di Toro, M.; Guarnera, A.
1994-01-01
A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))
EARLY STAGES OF CLUSTER FORMATION: FRAGMENTATION OF MASSIVE DENSE CORES DOWN TO {approx}< 1000 AU
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciencies, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Fuente, Asuncion [Observatorio Astronomico Nacional, P.O. Box 112, E-28803 Alcala de Henares, Madrid (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciencies del Cosmos, Universitat de Barcelona, Marti Franques, 1, E-08028 Barcelona (Spain); Ho, Paul T. P.; Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Sanchez-Monge, Alvaro; Fontani, Francesco; Cesaroni, Riccardo [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Commercon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, Ecole Normale Superieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Boissier, Jeremie [Istituto di Radioastronomia, INAF, Via Gobetti 101, I-40129 Bologna (Italy); Zapata, Luis A., E-mail: palau@ieec.uab.es [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, P.O. Box 3-72, 58090 Morelia, Michoacan (Mexico)
2013-01-10
In order to study the fragmentation of massive dense cores, which constitute the cluster cradles, we observed the continuum at 1.3 mm and the CO (2-1) emission of four massive cores with the Plateau de Bure Interferometer in the most extended configuration. We detected dust condensations down to {approx}0.3 M {sub Sun} and separate millimeter sources down to 0.''4 or {approx}< 1000 AU, comparable to the sensitivities and separations reached in optical/infrared studies of clusters. The CO (2-1) high angular resolution images reveal high-velocity knots usually aligned with previously known outflow directions. This, in combination with additional cores from the literature observed at similar mass sensitivity and spatial resolution, allowed us to build a sample of 18 protoclusters with luminosities spanning three orders of magnitude. Among the 18 regions, {approx}30% show no signs of fragmentation, while 50% split up into {approx}> 4 millimeter sources. We compiled a list of properties for the 18 massive dense cores, such as bolometric luminosity, total mass, and mean density, and found no correlation of any of these parameters with the fragmentation level. In order to investigate the combined effects of the magnetic field, radiative feedback, and turbulence in the fragmentation process, we compared our observations to radiation magnetohydrodynamic simulations and found that the low-fragmented regions are reproduced well in the magnetized core case, while the highly fragmented regions are consistent with cores where turbulence dominates over the magnetic field. Overall, our study suggests that the fragmentation in massive dense cores could be determined by the initial magnetic field/turbulence balance in each particular core.
Origin of fragments in multifragmentation reactions
International Nuclear Information System (INIS)
Zbiri, K.; Aichelin, J.
2003-01-01
Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)
Gluon fragmentation into 3 PJ quarkonium
International Nuclear Information System (INIS)
Ma, J.P.
1995-01-01
The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs
Origin of fragments in multifragmentation reactions
International Nuclear Information System (INIS)
Zbiri, K.; Aichelin, J.
2005-01-01
Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)
Directory of Open Access Journals (Sweden)
Jones JJ
2016-06-01
Full Text Available Jason J Jones,1 Jeffrey Chu,2 Jacob Graham,2 Serge Zaluski,3 Guillermo Rocha4 1Jones Eye Clinic, Sioux City, IA, 2Quorum Consulting Inc., San Francisco, CA, USA; 3VISIS, Perpignan, France; 4Ocular Microsurgery & Laser Centre, Brandon, MB, Canada Purpose: The aim of this study was to evaluate the operational impact of using preloaded intraocular lens (IOL delivery systems compared with manually loaded IOL delivery processes during routine cataract surgeries. Methods: Time and motion data, staff and surgery schedules, and cost accounting reports were collected across three sites located in the US, France, and Canada. Time and motion data were collected for manually loaded IOL processes and preloaded IOL delivery systems over four surgery days. Staff and surgery schedules and cost accounting reports were collected during the 2 months prior and after introduction of the preloaded IOL delivery system. Results: The study included a total of 154 routine cataract surgeries across all three sites. Of these, 77 surgeries were performed using a preloaded IOL delivery system, and the remaining 77 surgeries were performed using a manual IOL delivery process. Across all three sites, use of the preloaded IOL delivery system significantly decreased mean total case time by 6.2%–12.0% (P<0.001 for data from Canada and the US and P<0.05 for data from France. Use of the preloaded delivery system also decreased surgeon lens time, surgeon delays, and eliminated lens touches during IOL preparation. Conclusion: Compared to a manual IOL delivery process, use of a preloaded IOL delivery system for cataract surgery reduced total case time, total surgeon lens time, surgeon delays, and eliminated IOL touches. The time savings provided by the preloaded IOL delivery system provide an opportunity for sites to improve routine cataract surgery throughput without impacting surgeon or staff capacity. Keywords: time and motion, provider impact, surgical throughput, IOL
Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P
2013-10-01
Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The
Model analysis of local oxygen delivery with liposome-encapsulated hemoglobin.
Matsumoto, Takeshi; Mano, Katsuhiko; Ueha, Ryohei; Naito, Hisashi; Tanaka, Masao
2009-03-01
Liposome-encapsulated hemoglobins (LHs) are comparable to red blood cells (RBCs) in terms of oxygen (O(2))-carrying capacity. The smaller particle size of LHs than of platelets allows their homogeneous dispersion in circulating plasma. In this study, we evaluated the effect of LH transfusion on arterial O(2) delivery through vascular trees by simulation. A mathematical model was established on the basis of the coronary arterial anatomy, the conservation of flow and RBC flux, and Poiseuille's law. The Fåhraeus-Lindqvist, Fåhraeus, and phase separation effects were considered in the model. By assuming steady perfusion, the arterial flow and O(2) delivery were calculated for five model trees undergoing the isovolumic replacement of RBCs (0.3 mg hemoglobin (Hb)/mL) with LHs (0.2 mg Hb/mL) or a plasma volume expander (PVE). The RBC-LH exchange increased both the total flow and the total O(2) flux but had almost no effect on the relative distribution of O(2) flux. In contrast, the RBC-PVE exchange decreased the total O(2) flux and increased the proportion of regions receiving a relatively low O(2) supply. Thus, LH transfusion may compensate for an enhanced bias in RBC-associated O(2) flux under hemodilution and is expected to be beneficial for both total and local O(2) delivery.
Fuel fragmentation data review and separate effects testing
International Nuclear Information System (INIS)
Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.
2014-01-01
A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)
High-throughput fragment screening by affinity LC-MS.
Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten
2013-02-01
Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.
Biological effectiveness of high-energy protons - Target fragmentation
International Nuclear Information System (INIS)
Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.
1991-01-01
High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs
Bootstrap embedding: An internally consistent fragment-based method
Energy Technology Data Exchange (ETDEWEB)
Welborn, Matthew; Tsuchimochi, Takashi; Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)
2016-08-21
Strong correlation poses a difficult problem for electronic structure theory, with computational cost scaling quickly with system size. Fragment embedding is an attractive approach to this problem. By dividing a large complicated system into smaller manageable fragments “embedded” in an approximate description of the rest of the system, we can hope to ameliorate the steep cost of correlated calculations. While appealing, these methods often converge slowly with fragment size because of small errors at the boundary between fragment and bath. We describe a new electronic embedding method, dubbed “Bootstrap Embedding,” a self-consistent wavefunction-in-wavefunction embedding theory that uses overlapping fragments to improve the description of fragment edges. We apply this method to the one dimensional Hubbard model and a translationally asymmetric variant, and find that it performs very well for energies and populations. We find Bootstrap Embedding converges rapidly with embedded fragment size, overcoming the surface-area-to-volume-ratio error typical of many embedding methods. We anticipate that this method may lead to a low-scaling, high accuracy treatment of electron correlation in large molecular systems.
Directory of Open Access Journals (Sweden)
Andréa O. Mesquita
2012-09-01
Full Text Available Habitat fragmentation leads to isolation and reduce habitat areas, in addition to a series of negative effects on natural populations, affecting richness, abundance and distribution of animal species. In such a text, habitat corridors serve as an alternative for connectivity in fragmented landscapes, minimizing the effects of structural isolation of different habitat areas. This study evaluated the richness, composition and abundance of small mammal communities in forest fragments and in the relevant vegetation corridors that connect these fragments, located in Southern Minas Gerais, Southeastern Brazil. Ten sites were sampled (five forest fragments and five vegetation corridors using the capture-mark-recapture method, from April 2007-March 2008. A total sampling effort of 6 300 trapnights resulted in 656 captures of 249 individuals. Across the 10 sites sampled, 11 small mammal species were recorded. Multidimensional scaling (MDS ordinations and ANOSIM based on the composition of small mammal communities within the corridor and fragment revealed a qualitative difference between the two environments. Regarding abundance, there was no significant difference between corridors and fragments. In comparing mean values of abundance per species in each environment, only Cerradomys subflavus showed a significant difference, being more abundant in the corridor environment. Results suggest that the presence of several small mammal species in the corridor environment, in relatively high abundances, could indicate corridors use as habitat, though they might also facilitate and/or allow the movement of individuals using different habitat patches (fragments.
Fragmentation of molten core material by sodium
International Nuclear Information System (INIS)
Chu, T.Y.
1982-01-01
A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed
Quark fragmentation functions in NJL-jet model
Bentz, Wolfgang; Matevosyan, Hrayr; Thomas, Anthony
2014-09-01
We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. Supported by Grant in Aid for Scientific Research, Japanese Ministry of Education, Culture, Sports, Science and Technology, Project No. 20168769.
Fragment-based drug discovery using rational design.
Jhoti, H
2007-01-01
Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.
Peptide and protein delivery using new drug delivery systems.
Jain, Ashish; Jain, Aviral; Gulbake, Arvind; Shilpi, Satish; Hurkat, Pooja; Jain, Sanjay K
2013-01-01
Pharmaceutical and biotechnological research sorts protein drug delivery systems by importance based on their various therapeutic applications. The effective and potent action of the proteins/peptides makes them the drugs of choice for the treatment of numerous diseases. Major research issues in protein delivery include the stabilization of proteins in delivery devices and the design of appropriate target-specific protein carriers. Many efforts have been made for effective delivery of proteins/peptidal drugs through various routes of administrations for successful therapeutic effects. Nanoparticles made of biodegradable polymers such as poly lactic acid, polycaprolactone, poly(lactic-co-glycolic acid), the poly(fumaric-co-sebacic) anhydride chitosan, and modified chitosan, as well as solid lipids, have shown great potential in the delivery of proteins/peptidal drugs. Moreover, scientists also have used liposomes, PEGylated liposomes, niosomes, and aquasomes, among others, for peptidal drug delivery. They also have developed hydrogels and transdermal drug delivery systems for peptidal drug delivery. A receptor-mediated delivery system is another attractive strategy to overcome the limitation in drug absorption that enables the transcytosis of the protein across the epithelial barrier. Modification such as PEGnology is applied to various proteins and peptides of the desired protein and peptides also increases the circulating life, solubility and stability, pharmacokinetic properties, and antigenicity of protein. This review focuses on various approaches for effective protein/peptidal drug delivery, with special emphasis on insulin delivery.
STRUCTURAL CHARACTERIZATION OF A SEMIDECIDUOUS FOREST FRAGMENT IN IBITURUNA COUNTY, MG
Directory of Open Access Journals (Sweden)
Vagner Fernandes da Silva
2003-01-01
Full Text Available A survey describing the physiognomic structure and the species composition and diversityof the tree community was carried out in a fragment of tropical semideciduous forest. The forestfragment, with an area of 57ha, is situated at 21 °09’S of latitude and 44 °50’W of longitude, in Ibiturunacounty, Minas Gerais state, Brazil. The surveys were carried out in two sectors of the fragment,Slope and Valley, where 26 (20 ×20m plots were located. All trees with diameter at breast height dbh ≥ 5 cm were identified and measured (diameter and height. The survey registered 1008 tree,distributed in 191 species, 128 genera and 54 families; 20 species were added to this total andregistered during incursions outside the plots. The Fabaceae (Leguminosae family stood out for itsrichness of species (30 and genera (18, representing 15,7% of the total species registered. In secondplace, the Myrtaceae family presented 20 species and 9 genera, followed by the Lauraceae family,with 17 species and 7 genera. Other families that contributed with an expressive number of specieswere: Meliaceae, with 11; Euphorbiaceae, with 8; Malvaceae and Rubiaceae, both with 7 species.This floristic profile may be considered typical of the semideciduous forests of the region.
Critical Features of Fragment Libraries for Protein Structure Prediction.
Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel
2017-01-01
The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.
Developments in SPR Fragment Screening.
Chavanieu, Alain; Pugnière, Martine
2016-01-01
Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.
Comet Assay: A Method to Evaluate Genotoxicity of Nano-Drug Delivery System
Vandghanooni, Somayeh; Eskandani, Morteza
2011-01-01
Introduction Drug delivery systems could induce cellular toxicity as side effect of nanomaterials. The mechanism of toxicity usually involves DNA damage. The comet assay or single cell gel electrophoresis (SCGE) is a sensitive method for detecting strand damages in the DNA of a cell with applications in genotoxicity testing and molecular epidemiology as well as fundamental research in DNA damage and repair. Methods In the current study, we reviewed recent drug delivery researches related to SCGE. Results We found that one preference for choosing the assay is that comet images may result from apoptosis-mediated nuclear fragmentation. This method has been widely used over the last decade in several different areas. Overall cells, such as cultured cells are embedded in agarose on a microscope slide, lysed with detergent, and treated with high salt. Nucleoids are supercoiled DNA form. When the slide is faced to alkaline electrophoresis any breakages present in the DNA cause the supercoiling to relax locally and loops of DNA extend toward the anode as a ‘‘comet tail’’. Conclusion This article provides a relatively comprehensive review upon potentiality of the comet assay for assessment of DNA damage and accordingly it can be used as an informative platform in genotoxicity studies of drug delivery systems. PMID:23678412
Directory of Open Access Journals (Sweden)
Felipe M. Nuvoloni
2011-12-01
Full Text Available Mites associated to Xylopia aromatica (Lam. Mart. (Annonaceae in urban and rural fragments of semidecidual forest. Native plants can shelter a great diversity of mites. Notwithstanding, the conservation of the forest fragments where the plants are located can influence the structure of the mites community. Generally, in homogenous environments the diversity is lower due to the dominance of one or a few species. In this work, we studied the mite community on Xylopia aromatica (Lam. Mart. (Annonaceae in two fragments of semidecidual forest: one on rural and other on urban area. Seven individuals of X. aromatica were monthly sampled from April 2007 to March 2008, in each of these fragments. Descriptive indexes of diversity, dominance and evenness were applied to verify the ecological patterns of the mite community, besides the Student's t-test to compare the abundance between the fragments. We collected 27,365 mites of 37 species belonging to 11 families. Calacarus sp. (Eriophyidae was the most abundant species, representing 73% of the total sampled. The abundance was greater in the urban fragment (67.7%, with the diversity index reaching only 25% of the theoretical maximum expected. Probably, these values might have been influenced by the location of this fragment in the urban area, being more homogeneous and submitted directly to the presence of atmospheric pollution. In this manner, X. aromatica is able to shelter a higher diversity of mites when inserted in preserved ecosystems, since the highest diversity of available resources allows the establishment of richer and most diverse mite community.
Risk of stress urinary incontinence twelve years after the first pregnancy and delivery.
Viktrup, Lars; Rortveit, Guri; Lose, Gunnar
2006-08-01
To estimate the impact of onset of stress urinary incontinence in first pregnancy or postpartum period, for the risk of symptoms 12 years after the first delivery. In a longitudinal cohort study, 241 women answered validated questions about stress urinary incontinence after first delivery and 12 years later. Twelve years after first delivery the prevalence of stress urinary incontinence was 42% (102 of 241). The 12-year incidence was 30% (44 of 146). The prevalence of stress urinary incontinence 12 years after first pregnancy and delivery was significantly higher (Ppregnancy (56%, 37 of 66) and in women with onset shortly after delivery (78%, 14 of 18) compared with those without initial symptoms (30%, 44 of 146). In 70 women who had onset of symptoms during first pregnancy or shortly after the delivery but remission 3 months postpartum, a total of 40 (57%) had stress urinary incontinence 12 years later. In 11 women with onset of symptoms during the first pregnancy or shortly after delivery but no remission 3 months postpartum, a total of 10 (91%) had stress urinary incontinence 12 years later. Cesarean during first delivery was significantly associated with a lower risk of incontinence. Other obstetric factors were not significantly associated with the risk of incontinence 12 years later. Patients who were overweight before their first pregnancy were at increased risk. Onset of stress urinary incontinence during first pregnancy or puerperal period carries an increased risk of long-lasting symptoms.
The VERDI fission fragment spectrometer
Directory of Open Access Journals (Sweden)
Frégeau M.O.
2013-12-01
Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.
Energy Technology Data Exchange (ETDEWEB)
Duke, Dana Lynn [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2015-11-12
This Ph.D. dissertation describes a measurement of the change in mass distributions and average total kinetic energy (TKE) release with increasing incident neutron energy for fission of 235U and 238U. Although fission was discovered over seventy-five years ago, open questions remain about the physics of the fission process. The energy of the incident neutron, En, changes the division of energy release in the resulting fission fragments, however, the details of energy partitioning remain ambiguous because the nucleus is a many-body quantum system. Creating a full theoretical model is difficult and experimental data to validate existing models are lacking. Additional fission measurements will lead to higher-quality models of the fission process, therefore improving applications such as the development of next-generation nuclear reactors and defense. This work also paves the way for precision experiments such as the Time Projection Chamber (TPC) for fission cross section measurements and the Spectrometer for Ion Determination in Fission (SPIDER) for precision mass yields.
Directory of Open Access Journals (Sweden)
Krystal Cole
Full Text Available High throughput screening technologies such as acoustic droplet ejection (ADE greatly increase the rate at which X-ray diffraction data can be acquired from crystals. One promising high throughput screening application of ADE is to rapidly combine protein crystals with fragment libraries. In this approach, each fragment soaks into a protein crystal either directly on data collection media or on a moving conveyor belt which then delivers the crystals to the X-ray beam. By simultaneously handling multiple crystals combined with fragment specimens, these techniques relax the automounter duty-cycle bottleneck that currently prevents optimal exploitation of third generation synchrotrons. Two factors limit the speed and scope of projects that are suitable for fragment screening using techniques such as ADE. Firstly, in applications where the high throughput screening apparatus is located inside the X-ray station (such as the conveyor belt system described above, the speed of data acquisition is limited by the time required for each fragment to soak into its protein crystal. Secondly, in applications where crystals are combined with fragments directly on data acquisition media (including both of the ADE methods described above, the maximum time that fragments have to soak into crystals is limited by evaporative dehydration of the protein crystals during the fragment soak. Here we demonstrate that both of these problems can be minimized by using small crystals, because the soak time required for a fragment hit to attain high occupancy depends approximately linearly on crystal size.
Prakash, Celine; Haeseler, Arndt Von
2017-03-01
RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.
Jomaa, S.; Barry, D. A.; Brovelli, A.; Heng, B. C. P.; Sander, G. C.; Parlange, J.-Y.
2012-04-01
It is well known that the presence of rock fragments on the soil surface and the soil's initial characteristics (moisture content, surface roughness, bulk density, etc.) are key factors influencing soil erosion dynamics and sediment delivery. In addition, the interaction of these factors increases the complexity of soil erosion patterns and makes predictions more difficult. The aim of this study was (i) to investigate the effect of soil initial conditions and rock fragment coverage on soil erosion yields and effluent particle size distribution and (ii) to evaluate to what extent the rock fragment coverage controls this relationship. Three laboratory flume experiments with constant precipitation rate of 74 mm/h on a loamy soil parcel with a 2% slope were performed. Experiments with duration of 2 h were conducted using the 6-m × 2-m EPFL erosion flume. During each experiment two conditions were considered, a bare soil and a rock fragment-protected (with 40% coverage) soil. The initial soil surface state was varied between the three experiments, from a freshly re-ploughed and almost dry condition to a compacted soil with a well-developed shield layer and high moisture content. Experiments were designed so that rain splash was the primary driver of soil erosion. Results showed that the amount of eroded mass was highly controlled by the initial soil conditions and whether the steady-state equilibrium was un-, partially- or fully- developed during the previous event. Additionally, results revealed that sediment yields and particle size composition in the initial part of an erosion event are more sensitive to the erosion history than the long-time behaviour. This latter appears to be mainly controlled by rainfall intensity. If steady-state was achieved for a previous event, then the next event consistently produced concentrations for each size class that peaked rapidly, and then declined gradually to steady-state equilibrium. If steady state was not obtained, then
Spatial genetic structure in continuous and fragmented populations of Pinus pinaster Aiton.
De-Lucas, A I; González-Martínez, S C; Vendramin, G G; Hidalgo, E; Heuertz, M
2009-11-01
Habitat fragmentation, i.e., the reduction of populations into small isolated remnants, is expected to increase spatial genetic structure (SGS) in plant populations through nonrandom mating, lower population densities and potential aggregation of reproductive individuals. We investigated the effects of population size reduction and genetic isolation on SGS in maritime pine (Pinus pinaster Aiton) using a combined experimental and simulation approach. Maritime pine is a wind-pollinated conifer which has a scattered distribution in the Iberian Peninsula as a result of forest fires and habitat fragmentation. Five highly polymorphic nuclear microsatellites were genotyped in a total of 394 individuals from two population pairs from the Iberian Peninsula, formed by one continuous and one fragmented population each. In agreement with predictions, SGS was significant and stronger in fragments (Sp = 0.020 and Sp = 0.026) than in continuous populations, where significant SGS was detected for one population only (Sp = 0.010). Simulations suggested that under fat-tailed dispersal, small population size is a stronger determinant of SGS than genetic isolation, while under normal dispersal, genetic isolation has a stronger effect. SGS was always stronger in real populations than in simulations, except if unrealistically narrow dispersal and/or high variance of reproductive success were modelled (even when accounting for potential overestimation of SGS in real populations as a result of short-distance sampling). This suggests that factors such as nonrandom mating or selection not considered in the simulations were additionally operating on SGS in Iberian maritime pine populations.
Least loaded and route fragmentation aware RSA strategies for elastic optical networks
Batham, Deepak; Yadav, Dharmendra Singh; Prakash, Shashi
2017-12-01
Elastic optical networks (EONs) provide flexibility to assign wide range of spectral resources to the connection requests. In this manuscript, we address two issues related to spectrum assignment in EONs: the non uniform spectrum assignment along different links of the route and the spectrum fragmentation in the network. To address these issues, two routing and spectrum assignment (RSA) strategies have been proposed: Least Loaded RSA (LLRSA) and Route Fragmentation Aware RSA (RFARSA). The LLRSA allocates spectrum homogeneously along different links in the network, where as RFARSA accords priority to the routes which are less fragmented. To highlight the salient features of the two strategies, two new metrics, route fragmentation index (RFI) and standard deviation (SD) are introduced. RFI is defined as the ratio of non-contiguous FSs to the total available free FSs on the route, and SD relates to the measure of non-uniformity in the allocation of resources on the links in the network. A simulation program has been developed to evaluate the performance of the proposed (LLRSA and RFARSA) strategies, and the existing strategies of shortest path RSA (SPRSA) and spectrum compactness based defragmentation (SCD) strategies, on the metric of RFI, bandwidth blocking probability (BBP), network capacity utilized, and SD. The variation in the metrics on the basis of number of requests and the bandwidth (number of FSs) requested has been studied. It has been conclusively established that the proposed strategies (LLRSA and RFARSA) outperform the existing strategies in terms of all the metrics.
Effective Fragmentation and Flyrock Control Strategies at Quarries
Directory of Open Access Journals (Sweden)
Sedat Esen
2017-01-01
Full Text Available This paper presents the effective fragmentation and flyrock control strategies that could be applied at quarries to improve the productivity and safety. Fragmentation measurement and modelling as well as a comprehensive drill and blast audit are essential for improving the fragmentation. Face profiling and bore tracking are good tools to manage the ―as-designed‖ and ―as-drilled‖ conditions to get reasonable fragmentation from face burden zone and minimise the flyrock risk. In general, a large scatter in fragmentation data was observed at sites and the causes should be analysed by a detailed root-cause analysis technique. Two case studies were presented in this paper showing some of the effective fragmentation strategies. Finally, a flyrock model was shown to determine the safe blast exclusion zone for the mining equipment and personnel. Some key guidelines were suggested to minimise the occurrence of the flyrock.
Double-energy double-velocity measurement system for fission fragments and its application
International Nuclear Information System (INIS)
Kanno, Ikuo
1987-10-01
A new system of double-energy double-velocity (DEDV) measurement for fission fragments has been developed. In this system, the energies of fission fragments are measured by silicon surface barrier detectors (SSB) and the velocities by the time-of-flight (TOF) method utilizing thin film detectors (TFD) as start detectors and SSBs as stop detectors of TOF. Theoretical and experimental studies on TFDs and SSBs have been performed before the construction of the DEDV measurement system. The TFD consists of a thin plastic scintillator film and light guide. The author proposes a new model of the luminescence production in a scintillator film. This model takes into account the thickness of the scintillator film and uses only one parameter. The calculated TFD response to charged particles shows good agreement with other experiments. The dependence of the TFD response to the thickness of the scintillator film has been studied experimentally and analyzed by the luminescence production model. The results of this analysis shows the validity of the luminescence production model. The time resolution of the DEDV measurement system using TFDs and SSBs was 133 ps. As an application of this system, the DEDV measurement for the thermal neutron-induced fission of 233 U has been carried out at the super mirror neutron guide tube facility of Kyoto University Reactor (KUR). The energy and velocity of each fission fragment have been stored on magnetic disk event by event in a list mode. The analyzed results of masses, energies and velocities of light and heavy fragments agree well with other authors' works. The value of the total neutron emission number is 2.53 and shows good agreement within experimental error, with the JENDL-2 value, 2.49. The light fragment shows a slightly greater number of neutrons emitted than the other works. This suggests the possibility of larger deformation of light fragments at the scission point. (author)
Graph Theory. 1. Fragmentation of Structural Graphs
Directory of Open Access Journals (Sweden)
Lorentz JÄNTSCHI
2002-12-01
Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.
Route to three-dimensional fragments using diversity-oriented synthesis.
Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W
2011-04-26
Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.
Longest, P Worth; Walenga, Ross L; Son, Yoen-Ju; Hindle, Michael
2013-10-01
Previous studies have demonstrated the delivery of pharmaceutical aerosols through nasal cannula and the feasibility of enhanced condensational growth (ECG) with a nasal interface. The objectives of this study were to develop a device for generating submicrometer aerosols with minimal depositional loss in the formation process and to improve aerosol delivery efficiencies through nasal cannulas. A combination of in vitro experiments and computational fluid dynamics (CFD) simulations that used the strengths of each method was applied. Aerosols were formed using a conventional mesh nebulizer, mixed with ventilation gas, and heated to produce submicrometer sizes. An improved version of the mixer and heater unit was developed based on CFD simulations, and performance was verified with experiments. Aerosol delivery was considered through a commercial large-bore adult cannula, a divided (D) design for use with ECG, and a divided and streamlined (DS) design. The improved mixer design reduced the total deposition fraction (DF) of drug within the mixer by a factor of 3 compared with an initial version, had a total DF of approximately 10%, and produced submicrometer aerosols at flow rates of 10 and 15 L/min. Compared with the commercial and D designs for submicrometer aerosols, the DS cannula reduced depositional losses by a factor of 2-3 and retained only approximately 5% or less of the nebulized dose at all flow rates considered. For conventional-sized aerosols (3.9 and 4.7 μm), the DS device provided delivery efficiencies of approximately 80% and above at flow rates of 2-15 L/min. Submicrometer aerosols can be formed using a conventional mesh nebulizer and delivered through a nasal cannula with total delivery efficiencies of 80-90%. Streamlining the nasal cannula significantly improved the delivery efficiency of both submicrometer and micrometer aerosols; however, use of submicrometer particles with ECG delivery resulted in overall lower depositional losses.
Fragment-based discovery of a potent NAMPT inhibitor.
Korepanova, Alla; Longenecker, Kenton L; Pratt, Steve D; Panchal, Sanjay C; Clark, Richard F; Lake, Marc; Gopalakrishnan, Sujatha M; Raich, Diana; Sun, Chaohong; Petros, Andrew M
2017-12-12
NAMPT expression is elevated in many cancers, making this protein a potential target for anticancer therapy. We have carried out both NMR based and TR-FRET based fragment screens against human NAMPT and identified six novel binders with a range of potencies. Co-crystal structures were obtained for two of the fragments bound to NAMPT while for the other four fragments force-field driven docking was employed to generate a bound pose. Based on structural insights arising from comparison of the bound fragment poses to that of bound FK866 we were able to synthetically elaborate one of the fragments into a potent NAMPT inhibitor. Copyright © 2017 Elsevier Ltd. All rights reserved.
Light fragment formation at intermediate energies
International Nuclear Information System (INIS)
Boal, D.H.
1982-03-01
This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model
Conservation value of a native forest fragment in a region of extensive agriculture.
Chiarello
2000-05-01
A survey of mammals and birds was carried out in a semi-deciduous forest fragment of 150 ha located in a zone of intensive agriculture in Ribeirão Preto, State of São Paulo, south-eastern Brazil. Line transect sampling was used to census mammals and birds during six days, totalling 27.8 km of trails and 27.8 hours of observation. Twenty mammal species were confirmed in the area (except bats and small mammals), including rare or endangered species, such as the mountain lion (Puma concolor), the maned wolf (Chrysocyon brachyurus), and the ocelot (Leopardus pardalis). The brown capuchin monkey (Cebus apella) and the black-tufted-ear marmoset (Callithrix penicillata) were found frequently, suggesting high population density in the fragment. Regarding the avifauna, 49 bird species were recorded, most of them typical of open areas or forest edges. Some confirmed species, however, are becoming increasingly rare in the region, as for example the muscovy duck (Cairina moschata) and the toco toucan (Ramphastos toco). The results demonstrate that forest fragment of this size are refuges for native fauna in a region dominated almost exclusively by sugar-cane plantations. Besides faunal aspects, the conservation of these fragments is of great importance for the establishment of studies related to species preservation in the long term, including reintroduction and translocation projects, as well as studies related to genetic health of isolated populations.
Measuring the temperature of hot nuclear fragments
International Nuclear Information System (INIS)
Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.
2010-01-01
A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.
QGP and Modified Jet Fragmentation
International Nuclear Information System (INIS)
Wang, Xin-Nian
2005-01-01
Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed
Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgós, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K H
2016-08-01
Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for biological targets. We report the synergistic combination of fragment linking and DCC to identify inhibitors of the aspartic protease endothiapepsin. Based on X-ray crystal structures of endothiapepsin in complex with fragments, we designed a library of bis-acylhydrazones and used DCC to identify potent inhibitors. The most potent inhibitor exhibits an IC50 value of 54 nm, which represents a 240-fold improvement in potency compared to the parent hits. Subsequent X-ray crystallography validated the predicted binding mode, thus demonstrating the efficiency of the combination of fragment linking and DCC as a hit-identification strategy. This approach could be applied to a range of biological targets, and holds the potential to facilitate hit-to-lead optimization. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Fragmentation of dimethyl ether in femtosecond intense field
Zhu, Jingyi; Guo, Wei; Wang, Yanqiu; Wang, Li
2006-08-01
The fragmentation of dimethyl ether (DME) in intense femtosecond laser field has been studied at 810, 405 and 270 nm with intensities up to 2.48 × 10 15, 3.86 × 10 15 and 1.62 × 10 14 W/cm 2, respectively. At 405 nm, DME is possibly firstly ionized by multiphoton absorption, and then parent ion DME + dissociates into fragments via filed-induced dissociation. For 810 and 270 nm laser fields, DME firstly dissociates into CH 3O and CH 3 fragments and then these neutral fragments are ionized by field tunneling. Another possible way for DME to dissociate at 810 and 270 nm is that DME is ionized by intense field ejection of inner valance electron and then the excited DME + dissociates into fragment ions. Ultrafast rearrangement of DME or DME + in intense field may be responsible to the unpredictable fragment ions, CHO+/C2H5+andH2+.
Health care expenditure for hospital-based delivery care in Lao PDR
Directory of Open Access Journals (Sweden)
Douangvichit Daovieng
2012-01-01
Full Text Available Abstract Background Delivery by a skilled birth attendant (SBA in a hospital is advocated to improve maternal health; however, hospital expenses for delivery care services are a concern for women and their families, particularly for women who pay out-of-pocket. Although health insurance is now implemented in Lao PDR, it is not universal throughout the country. The objectives of this study are to estimate the total health care expenses for vaginal delivery and caesarean section, to determine the association between health insurance and family income with health care expenditure and assess the effect of health insurance from the perspectives of the women and the skilled birth attendants (SBAs in Lao PDR. Methods A cross-sectional study was carried out in two provincial hospitals in Lao PDR, from June to October 2010. Face to face interviews of 581 women who gave birth in hospital and 27 SBAs was carried out. Both medical and non-medical expenses were considered. A linear regression model was used to assess influencing factors on health care expenditure and trends of medical and non-medical expenditure by monthly family income stratified by mode of delivery were assessed. Results Of 581 women, 25% had health care insurance. Health care expenses for delivery care services were significantly higher for caesarean section (270 USD than for vaginal delivery (59 USD. After adjusting for the effect of hospital, family income was significantly associated with all types of expenditure in caesarean section, while it was associated with non-medical and total expenditures in vaginal delivery. Both delivering women and health providers thought that health insurance increased the utilisation of delivery care. Conclusions Substantially higher delivery care expenses were incurred for caesarean section compared to vaginal delivery. Three-fourths of the women who were not insured needed to be responsible for their own health care payment. Women who had higher family
Mode of delivery and Pelvic floor disorder
International Nuclear Information System (INIS)
Noor, R.; Neelam, H.; Bashir, M.S.
2017-01-01
Objective: To compare pelvic floor dysfunction in non pregnant women who had delivered vaginally versus those with cesarean delivery. Methodology: The prevalence of pelvic floor disorders among non pregnant women was assesses by using a standardized tool pelvic floor distress inventory short form (PFDI-20). Data was collected from Jinnah Hospital Lahore, Pakistan. Results: Total numbers of participants were 278. 47.12% subjects had moderate, 36.69% miner and 16.19% had severe pelvic floor dysfunction. The symptoms of pelvic organ prolapse were more prevalent (mean value is 59.1876) than Urinary Distress (mean value is 40.5426), while the Colorectal-Anal Distress (mean value is 35.9150) were least prevalent. Conclusion: Pelvic floor disorders are very common among females and are strongly associated with mode of delivery. Although spontaneous vaginal birth was extensively associated with pelvic floor disorders the instrumental delivery affects most. (author)
Pregnancy - delivery presentation; Labor - delivery presentation; Occiput posterior; Occiput anterior; Brow presentation ... The mother can walk, rock, and try different delivery positions during labor to help encourage the baby ...
Trosman, Julia R.; Carlos, Ruth C.; Simon, Melissa A.; Madden, Debra L.; Gradishar, William J.; Benson, Al B.; Rapkin, Bruce D.; Weiss, Elisa S.; Gareen, Ilana F.; Wagner, Lynne I.; Khan, Seema A.; Bunce, Mikele M.; Small, Art; Weldon, Christine B.
2016-01-01
Cancer care is highly complex and suffers from fragmentation and lack of coordination across provider specialties and clinical domains. As a result, patients often find that they must coordinate care on their own. Coordinated delivery teams may address these challenges and improve quality of cancer care. Task interdependence is a core principle of rigorous teamwork and is essential to addressing the complexity of cancer care, which is highly interdependent across specialties and modalities. W...
DEFF Research Database (Denmark)
Christiansen, Steen Ledet
Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...
Lee, Joong-Myung; Cho, Yongsuk; Kim, Junhyun; Kim, Dong-Won
2017-03-01
Femoral intertrochanteric fractures are common in the elderly. Appropriate surgical fixation of trochanteric fracture fragments can restore normal anatomical structure and ambulation, and can aid in the recovery of biomechanical function of the hip. We evaluated clinical outcomes of bipolar hemiarthroplasty using a wiring technique for trochanteric fracture fragment fixation. From September 2006 to February 2015, a total of 260 cases underwent simultaneous bipolar hemiarthroplasty and wire fixation. A total of 65 patients (69 hips) with an average age of 78 years and more than one year of follow-up was included in the study. Using pre-, postoperative and follow-up radiograms, we evaluated wire fixation failure and also assessed changes in walking ability. Loosening or osteolysis around the stem was not observed; however, we did observe bone growth around the stem (54 cases), cortical hypertrophy (6 cases), a wide range of sclerotic lines but no stem subsidence (1 case), wire breakage (9 cases), and fracture fragment migration with no significant functional deficiency (2 cases). Our study showed that additional wiring for trochanteric fracture fragment fixation following bipolar hemiarthroplasty can help restore normal anatomy. The added stability results in faster rehabilitation, and good clinical and radiographic outcomes. We recommend this procedure in this type of fracture.
Identifying Interactions that Determine Fragment Binding at Protein Hotspots.
Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L
2016-05-12
Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.
Breech at term--mode of delivery? A register-based study
DEFF Research Database (Denmark)
Krebs, L; Langhoff-Roos, J; Weber, Tom
1995-01-01
. Register-based cohort study of all (n = 15718) singleton term breech deliveries of non-malformed infants in Denmark 1982-1990. Process and outcome measures: mode of delivery, gestational age, birth weight, congenital malformations, intrapartum death, Apgar scores and early neonatal death. RESULTS. A total...... of 3247 (20.7%) term infants were delivered vaginally, 7106 (45.3%) by elective and 5356 (34.1%) by emergency cesarean section. Infants delivered vaginally and by emergency cesarean section had significantly higher rates of mortality (intrapartum and early neonatal death) and morbidity (low Apgar scores......) when compared to those delivered by elective cesarean section. In vaginal deliveries, parity was not correlated with outcome, but infants with a birth weight above 4000 grams had significantly higher rates of low Apgar scores. CONCLUSIONS. Register data on singleton term breech deliveries imply...
T cell receptor-like recognition of tumor in vivo by synthetic antibody fragment.
Directory of Open Access Journals (Sweden)
Keith R Miller
Full Text Available A major difficulty in treating cancer is the inability to differentiate between normal and tumor cells. The immune system differentiates tumor from normal cells by T cell receptor (TCR binding of tumor-associated peptides bound to Major Histocompatibility Complex (pMHC molecules. The peptides, derived from the tumor-specific proteins, are presented by MHC proteins, which then serve as cancer markers. The TCR is a difficult protein to use as a recombinant protein because of production issues and has poor affinity for pMHC; therefore, it is not a good choice for use as a tumor identifier outside of the immune system. We constructed a synthetic antibody-fragment (Fab library in the phage-display format and isolated antibody-fragments that bind pMHC with high affinity and specificity. One Fab, fE75, recognizes our model cancer marker, the Human Epidermal growth factor Receptor 2 (HER2/neu peptide, E75, bound to the MHC called Human Leukocyte Antigen-A2 (HLA-A2, with nanomolar affinity. The fE75 bound selectively to E75/HLA-A2 positive cancer cell lines in vitro. The fE75 Fab conjugated with (64Cu selectively accumulated in E75/HLA-A2 positive tumors and not in E75/HLA-A2 negative tumors in an HLA-A2 transgenic mouse as probed using positron emission tomography/computed tomography (PET/CT imaging. Considering that hundreds to thousands of different peptides bound to HLA-A2 are present on the surface of each cell, the fact that fE75 arrives at the tumor at all shows extraordinary specificity. These antibody fragments have great potential for diagnosis and targeted drug delivery in cancer.
Tooth fragment reattachment techniques-A systematic review.
Garcia, Fernanda Cristina P; Poubel, Déborah L N; Almeida, Júlio César F; Toledo, Isabela P; Poi, Wilson R; Guerra, Eliete N S; Rezende, Liliana V M L
2018-03-07
Several strategies have been developed for tooth fragment reattachment following fracture. Although many techniques have been reported, there is no consensus on which one has the best results in terms of the bond strength between the fragment and the dentin over time. The aim of this study was to assess the currently reported tooth fragment reattachment techniques for fractured crowns of anterior teeth. The PubMed, LILACS, Web of Science, Cochrane, and Scopus databases were searched in October 2016, and the search was updated in February 2017. A search of the gray literature was performed in Google Scholar and OpenGrey. Reference lists of eligible studies were cross-checked to identify additional studies; gray literature and ongoing trials were investigated. Two authors assessed studies to determine inclusion and undertook data extraction. Case reports/series of three or more cases, cross-sectional studies, cohort studies, and in vivo clinical trials in all languages were included. Five articles remained after screening. These studies predominantly reported on fragment reattachment with composite resin and resin cement. There was little consistency among the studies in regard to the technique used for tooth fragment reattachment and length of the follow-up period. According to the evidence found in the studies included in this review, simple tooth fragment reattachment was the preferred reattachment technique. An increase in the bond strength between tooth fragment and dentin was observed when an intermediate material was used. Further investigation is needed, using standard follow-up periods and larger samples. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Gao, Ning; Bozeman, Erica N; Qian, Weiping; Wang, Liya; Chen, Hongyu; Lipowska, Malgorzata; Staley, Charles A; Wang, Y Andrew; Mao, Hui; Yang, Lily
2017-01-01
The major obstacles in intraperitoneal (i.p.) chemotherapy of peritoneal tumors are fast absorption of drugs into the blood circulation, local and systemic toxicities, inadequate drug penetration into large tumors, and drug resistance. Targeted theranostic nanoparticles offer an opportunity to enhance the efficacy of i.p. therapy by increasing intratumoral drug delivery to overcome resistance, mediating image-guided drug delivery, and reducing systemic toxicity. Herein we report that i.p. delivery of urokinase plasminogen activator receptor (uPAR) targeted magnetic iron oxide nanoparticles (IONPs) led to intratumoral accumulation of 17% of total injected nanoparticles in an orthotopic mouse pancreatic cancer model, which was three-fold higher compared with intravenous delivery. Targeted delivery of near infrared dye labeled IONPs into orthotopic tumors could be detected by non-invasive optical and magnetic resonance imaging. Histological analysis revealed that a high level of uPAR targeted, PEGylated IONPs efficiently penetrated into both the peripheral and central tumor areas in the primary tumor as well as peritoneal metastatic tumor. Improved theranostic IONP delivery into the tumor center was not mediated by nonspecific macrophage uptake and was independent from tumor blood vessel locations. Importantly, i.p. delivery of uPAR targeted theranostic IONPs carrying chemotherapeutics, cisplatin or doxorubicin, significantly inhibited the growth of pancreatic tumors without apparent systemic toxicity. The levels of proliferating tumor cells and tumor vessels in tumors treated with the above theranostic IONPs were also markedly decreased. The detection of strong optical signals in residual tumors following i.p. therapy suggested the feasibility of image-guided surgery to remove drug-resistant tumors. Therefore, our results support the translational development of i.p. delivery of uPAR-targeted theranostic IONPs for image-guided treatment of peritoneal tumors.
International Nuclear Information System (INIS)
Connell, T; Papaconstadopoulos, P; Alexander, A; Serban, M; Devic, S; Seuntjens, J
2014-01-01
Modulated electron radiation therapy (MERT) offers the potential to improve healthy tissue sparing through increased dose conformity. Challenges remain, however, in accurate beamlet dose calculation, plan optimization, collimation method and delivery accuracy. In this work, we investigate the accuracy and efficiency of an end-to-end MERT plan and automated-delivery workflow for the electron boost portion of a previously treated whole breast irradiation case. Dose calculations were performed using Monte Carlo methods and beam weights were determined using a research-based treatment planning system capable of inverse optimization. The plan was delivered to radiochromic film placed in a water equivalent phantom for verification, using an automated motorized tertiary collimator. The automated delivery, which covered 4 electron energies, 196 subfields and 6183 total MU was completed in 25.8 minutes, including 6.2 minutes of beam-on time with the remainder of the delivery time spent on collimator leaf motion and the automated interfacing with the accelerator in service mode. The delivery time could be reduced by 5.3 minutes with minor electron collimator modifications and the beam-on time could be reduced by and estimated factor of 2–3 through redesign of the scattering foils. Comparison of the planned and delivered film dose gave 3%/3 mm gamma pass rates of 62.1, 99.8, 97.8, 98.3, and 98.7 percent for the 9, 12, 16, 20 MeV, and combined energy deliveries respectively. Good results were also seen in the delivery verification performed with a MapCHECK 2 device. The results showed that accurate and efficient MERT delivery is possible with current technologies
Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...
Habitat Fragmentation and Native Bees: a Premature Verdict?
Directory of Open Access Journals (Sweden)
James H. Cane
2001-06-01
Full Text Available Few studies directly address the consequences of habitat fragmentation for communities of pollinating insects, particularly for the key pollinator group, bees (Hymenoptera: Apiformes. Bees typically live in habitats where nesting substrates and bloom are patchily distributed and spatially dissociated. Bee studies have all defined habitat fragments as remnant patches of floral hosts or forests, overlooking the nesting needs of bees. Several authors conclude that habitat fragmentation is broadly deleterious, but their own data show that some native species proliferate in sampled fragments. Other studies report greater densities and comparable diversities of native bees at flowers in some fragment size classes relative to undisrupted habitats, but find dramatic shifts in species composition. Insightful studies of habitat fragmentation and bees will consider fragmentation, alteration, and loss of nesting habitats, not just patches of forage plants, as well as the permeability of the surrounding matrix to interpatch movement. Inasmuch as the floral associations and nesting habits of bees are often attributes of species or subgenera, ecological interpretations hinge on authoritative identifications. Study designs must accommodate statistical problems associated with bee community samples, especially non-normal data and frequent zero values. The spatial scale of fragmentation must be appreciated: bees of medium body size can regularly fly 1-2 km from nest site to forage patch. Overall, evidence for prolonged persistence of substantial diversity and abundances of native bee communities in habitat fragments of modest size promises practical solutions for maintaining bee populations. Provided that reserve selection, design, and management can address the foraging and nesting needs of bees, networks of even small reserves may hold hope for sustaining considerable pollinator diversity and the ecological services pollinators provide.
Fragmentation Point Detection of JPEG Images at DHT Using Validator
Mohamad, Kamaruddin Malik; Deris, Mustafa Mat
File carving is an important, practical technique for data recovery in digital forensics investigation and is particularly useful when filesystem metadata is unavailable or damaged. The research on reassembly of JPEG files with RST markers, fragmented within the scan area have been done before. However, fragmentation within Define Huffman Table (DHT) segment is yet to be resolved. This paper analyzes the fragmentation within the DHT area and list out all the fragmentation possibilities. Two main contributions are made in this paper. Firstly, three fragmentation points within DHT area are listed. Secondly, few novel validators are proposed to detect these fragmentations. The result obtained from tests done on manually fragmented JPEG files, showed that all three fragmentation points within DHT are successfully detected using validators.
Dynamical effects in the Colomb expansion following nuclear fragmentation
International Nuclear Information System (INIS)
Chung, K.C.; Donangelo, R.J.; Schechter, H.
1987-01-01
The effects of the Colomb expansion on the fragment Kinetic energy spectrum for a fragmentating hot nuclear system is investigated. In particular, 12 C fragment spectra are calculated and compared with those predicted by the uniform expansion approximation. The results indicate that energy spectra of fragments are quite sensitive to the details of the Coulomb expansion treatment. (Author) [pt
Bone fragments a body can make
Energy Technology Data Exchange (ETDEWEB)
Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))
1991-05-01
Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.
HETC-3STEP included fragmentation process
Energy Technology Data Exchange (ETDEWEB)
Shigyo, Nobuhiro; Iga, Kiminori; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering
1997-03-01
High Energy Transport Code (HETC) based on the cascade-evaporation model is modified to calculate the fragmentation cross section. For the cascade process, nucleon-nucleon cross sections are used for collision computation; effective in-medium-corrected cross sections are adopted instead of the original free-nucleon collision. The exciton model is adopted for improvement of backward nucleon-emission cross section for low-energy nucleon-incident events. The fragmentation reaction is incorporated into the original HETC as a subroutine set by the use of the systematics of the reaction. The modified HETC (HETC-3STEP/FRG) reproduces experimental fragment yields to a reasonable degree. (author)
Integration of fragment screening and library design.
Siegal, Gregg; Ab, Eiso; Schultz, Jan
2007-12-01
With more than 10 years of practical experience and theoretical analysis, fragment-based drug discovery (FBDD) has entered the mainstream of the pharmaceutical and biotech industries. An array of biophysical techniques has been used to detect the weak interaction between a fragment and the target. Each technique presents its own requirements regarding the fragment collection and the target; therefore, in order to optimize the potential of FBDD, the nature of the target should be a driving factor for simultaneous development of both the library and the screening technology. A roadmap is now available to guide fragment-to-lead evolution when structural information is available. The next challenge is to apply FBDD to targets for which high-resolution structural information is not available.
Energy Technology Data Exchange (ETDEWEB)
Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)
1976-01-01
Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)
Light particles emitted with the fission fragments of thorium
Energy Technology Data Exchange (ETDEWEB)
San-Tsiang, T; Faraggi, H
1947-01-01
The traces produced by the fission of thorium with fast neutrons have been recorded photographically and studied. The formation of a light fragment of long range by either quadripartition or tripartition was not observed. The release of a short-range light fragment by bipartition was observed about one hundred times more frequently than was the release of such a fragment by tripartition. The ratio of the range of the two heavy fragments produced by tripartition was 1:2; this compares with a ratio of 1:3 for the heavy fragments produced by bipartition.
Complex fragment emission from hot compound nuclei
International Nuclear Information System (INIS)
Moretto, L.G.
1986-03-01
The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs
Delivery room triage of large for gestational age infants of diabetic mothers.
Cordero, Leandro; Rath, Krista; Zheng, Katherine; Landon, Mark B; Nankervis, Craig A
2014-01-01
To review our 4-year experience (2008-2011) with delivery room triage of large for gestational age infants of diabetic mothers. Retrospective cohort investigation of 311 large for gestational age infants of diabetic mothers (White's Class A1 (77), A2 (87), B (77), and C-R (70)). Of 311 women, 31% delivered at 34-36 weeks gestational age and 69% at term. While 70% were delivered by cesarean, 30% were vaginal deliveries. A total of 160 asymptomatic infants were triaged from the delivery room to the well baby nursery. Of these, 55 (34%) developed hypoglycemia. In 43 cases, the hypoglycemia was corrected by early feedings; in the remaining 12, intravenous dextrose treatment was required. A total of 151 infants were triaged from the delivery room to the neonatal intensive care unit. Admission diagnoses included respiratory distress (51%), prevention of hypoglycemia (27%), prematurity (21%), and asphyxia (1%). Hypoglycemia affected 66 (44%) of all neonatal intensive care unit infants. Safe triage of asymptomatic large for gestational age infants of diabetic mothers from the delivery room to well baby nursery can be accomplished in the majority of cases. Those infants in need of specialized care can be accurately identified and effectively treated in the neonatal intensive care unit setting.
Advancement of magma fragmentation by inhomogeneous bubble distribution.
Kameda, M; Ichihara, M; Maruyama, S; Kurokawa, N; Aoki, Y; Okumura, S; Uesugi, K
2017-12-01
Decompression times reported in previous studies suggest that thoroughly brittle fragmentation is unlikely in actual explosive volcanic eruptions. What occurs in practice is brittle-like fragmentation, which is defined as the solid-like fracture of a material whose bulk rheological properties are close to those of a fluid. Through laboratory experiments and numerical simulation, the link between the inhomogeneous structure of bubbles and the development of cracks that may lead to brittle-like fragmentation was clearly demonstrated here. A rapid decompression test was conducted to simulate the fragmentation of a specimen whose pore morphology was revealed by X-ray microtomography. The dynamic response during decompression was observed by high-speed photography. Large variation was observed in the responses of the specimens even among specimens with equal bulk rheological properties. The stress fields of the specimens under decompression computed by finite element analysis shows that the presence of satellite bubbles beneath a large bubble induced the stress concentration. On the basis of the obtained results, a new mechanism for brittle-like fragmentation is proposed. In the proposed scenario, the second nucleation of bubbles near the fragmentation surface is an essential process for the advancement of fragmentation in an upward magma flow in a volcanic conduit.
Global-Scale Patterns of Forest Fragmentation
Directory of Open Access Journals (Sweden)
Kurt Riitters
2000-12-01
Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.
Global-scale patterns of forest fragmentation
Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.
2000-01-01
We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.
Directory of Open Access Journals (Sweden)
Shen LN
2014-07-01
Full Text Available Li-Na Shen,1 Yong-Tai Zhang,1 Qin Wang,2 Ling Xu,2 Nian-Ping Feng11Department of Pharmaceutical Sciences, 2Department of Oncology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, People’s Republic of ChinaAbstract: The aims of the present study were to investigate the skin permeation and cellular uptake of a microemulsion (ME containing total flavone of rhizoma arisaematis (TFRA, and to evaluate its effects on skin structure. Pseudo-ternary phase diagrams were constructed to evaluate ME regions with various surfactants and cosurfactants. Eight formulations of oil-in-water MEs were selected as vehicles, and in vitro skin-permeation experiments were performed to optimize the ME formulation and to evaluate its permeability, in comparison to that of an aqueous suspension. Laser scanning confocal microscopy and fluorescent-activated cell sorting were used to explore the cellular uptake of rhodamine 110-labeled ME in human epidermal keratinocytes (HaCaT and human embryonic skin fibroblasts (CCC-ESF-1. The structure of stratum corneum treated with ME was observed using a scanning electron microscope. Furthermore, skin irritation was tested to evaluate the safety of ME. ME formulated with 4% ethyl oleate (weight/weight, 18% Cremophor EL® (weight/weight, and 18% Transcutol® P, with 1% Azone to enhance permeation, showed good skin permeability. ME-associated transdermal fluxes of schaftoside and isoschaftoside, two major effective constituents of TFRA, were 3.72-fold and 5.92-fold higher, respectively, than those achieved using aqueous suspensions. In contrast, in vitro studies revealed that uptake by HaCaT and CCC-ESF-1 cells was lower with ME than with an aqueous suspension. Stratum corneum loosening and shedding was observed in nude mouse skin treated with ME, although ME produced no observable skin irritation in rabbits. These findings indicated that ME enhanced transdermal TFRA delivery effectively and showed
Fragman: an R package for fragment analysis.
Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan
2016-04-21
Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.
Advances in fragment-based drug discovery platforms.
Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya
2009-11-01
Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.
Temperatures of fragment kinetic energy spectra
International Nuclear Information System (INIS)
Bauer, W.
1995-01-01
Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework
The ways and means of fragment-based drug design.
Doak, Bradley C; Norton, Raymond S; Scanlon, Martin J
2016-11-01
Fragment-based drug design (FBDD) has emerged as a mainstream approach for the rapid and efficient identification of building blocks that can be used to develop high-affinity ligands against protein targets. One of the strengths of FBDD is the relative ease and low cost of the primary screen to identify fragments that bind. However, the fragments that emerge from primary screens often have low affinities, with K D values in the high μM to mM range, and a significant challenge for FBDD is to develop the initial fragments into more potent ligands. Successful fragment elaboration often requires co-structures of the fragments bound to their target proteins, as well as a range of biophysical and biochemical assays to track potency and efficacy. These challenges have led to the development of specific chemical strategies for the elaboration of weakly-binding fragments into more potent "hits" and lead compounds. In this article we review different approaches that have been employed to meet these challenges and describe some of the strategies that have resulted in several fragment-derived compounds entering clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.
Temporal change in fragmentation of continental US forests
James D. Wickham; Kurt H. Riitters; Timothy G. Wade; Collin Homer
2008-01-01
Changes in forest ecosystem function and condition arise from changes in forest fragmentation. Previous studies estimated forest fragmentation for the continental United States (US). In this study, new temporal land-cover data from the National Land Cover Database (NLCD) were used to estimate changes in forest fragmentation at multiple scales for the continental US....
International Nuclear Information System (INIS)
Nilsen, B.S.; Waddington, C.J.; Cummings, J.R.; Garrard, T.L.; Klarmann, J.
1995-01-01
With the addition of krypton and silver projectiles we have extended our previous studies of the fragmentation of heavy relativistic nuclei in targets ranging in mass from hydrogen to lead. These projectiles were studied at a number of discrete energies between 450 and 1500A MeV. The total and partial charge-changing cross sections were determined for each energy, target, and projectile, and the values compared with previous predictions. A new parametrization of the dependence of the total charge-changing cross sections on the target and projectile is introduced, based on nuclear charge radii derived from electron scattering. We have also parametrized the energy dependence of the total cross sections over the range of energies studied. New parameters were found for a previous representation of the partial charge-changing cross sections in hydrogen and a new parametrization has been introduced for the nonhydrogen targets. The evidence that limiting fragmentation has been attained for these relatively light projectile nuclei at Bevalac energies is shown to be inconclusive, and further measurements at higher energies will be needed to address this question
Inclusive breakup of three-fragment weakly bound nuclei
International Nuclear Information System (INIS)
Carlson, B.V.; Frederico, T.; Hussein, M.S.
2017-01-01
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Inclusive breakup of three-fragment weakly bound nuclei
Energy Technology Data Exchange (ETDEWEB)
Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)
2017-04-10
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
International Nuclear Information System (INIS)
Itkis, M.G.; Kalpakchieva, R.; Okolovich, V.N.; Penionzhkevich, Yu.Eh.; Tolstikov, V.N.
1982-01-01
To study characteristics of fissioning nucleus fragments, investigated were reactiiiiiiiiiiiiiiiH8Pt+ 12 C → 210 Po in the 12 C ion energy range of 86-110.5 MeV, of 192 Os+ 16 O → 208 Po in 90-131 MeV range, 204 Pb+ 3 He → 207 Po, 206 Pb+ 3 He → 209 Po, 207 Pb+ 3 He → 210 Po with 60 MeV 3 He ion energy. Using a correlation technique for measuring energies of two fragments mass and energy distributions of fission fragments of 208 Po and 210 Po compound nuclei produced in the reactions have been studied. Mass and energy distributions of fragments from fission of 208 Po and 210 Po in the reactions with ions 16 O, 12 C and 3 He were investigated in an ample energy range, using the correlational techniques for measurement of energies of two fragments. An increase in the total kinetic energy with rise of the angular momentum was observed, the fact indicating a weak coupling of one-particle and collective modes of motion in the fissile nucleus resulting in that the rolational energy is transfered mainly to translation energies of the fragments
The holistic 3M modality of drug delivery nanosystems for cancer therapy
Sun, Jin; Luo, Cong; Wang, Yongjun; He, Zhonggui
2013-01-01
Cancer has become the leading cause of human death worldwide. There are many challenges in the treatment of cancer and the rapidly developing area of nanotechnology has shown great potential to open a new era in cancer therapy. This article, rather than being exhaustive, focuses on the striking progress in the drug delivery nanosystems (DDNS) for cancer therapy and selects typical examples to point out the emerging mode of action of DDNS from our perspective. Among the outstanding advances in DDNS for cancer therapy is the development of ``multicomponent delivery systems'', ``multifunctional nanocarriers'' and ``multistage delivery systems''. However, these represent only one aspect of DDNS research. In addition, nature is the best teacher and natural evolution pressure has meant that virions conform to the ``multitarget, multistage and multicomponent'' (3M) mode of action. Amazingly, traditional Chinese medicine (TCM), used for over 4000 years in China, also displays the same mode of action. Integrating the previous notable progress in nanoparticle technology, learned from the building mode of natural virions and the action concept of TCM, we propose an integrity-based 3M mode DDNS for cancer therapy: multitarget, multistage and multicomponent, which are not fragmented parts but an interconnected integrity. Based on the physiological multitarget and the pharmacokinetic multistage, multicomponent DDNS are rationally designed, where different components with individual specific functions act in a synergistic manner against each target at each disposition stage to maximize the targeted delivery effectiveness. In this article, we introduce each component of 3M DDNS in detail and describe some typical cases to realize the tumor-homing purposes.
Agricultural matrices affect ground ant assemblage composition inside forest fragments.
Directory of Open Access Journals (Sweden)
Diego Santana Assis
Full Text Available The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates; sugarcane (3; and pasture (3. At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart. Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.
Agricultural matrices affect ground ant assemblage composition inside forest fragments.
Assis, Diego Santana; Dos Santos, Iracenir Andrade; Ramos, Flavio Nunes; Barrios-Rojas, Katty Elena; Majer, Jonathan David; Vilela, Evaldo Ferreira
2018-01-01
The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices) on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates); sugarcane (3); and pasture (3). At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart). Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.
The impact of habitat fragmentation on tsetse abundance on the plateau of eastern Zambia.
Ducheyne, E; Mweempwa, C; De Pus, C; Vernieuwe, H; De Deken, R; Hendrickx, G; Van den Bossche, P
2009-09-01
Tsetse-transmitted human or livestock trypanosomiasis is one of the major constraints to rural development in sub-Saharan Africa. The epidemiology of the disease is determined largely by tsetse fly density. A major factor, contributing to tsetse population density is the availability of suitable habitat. In large parts of Africa, encroachment of people and their livestock resulted in a destruction and fragmentation of such suitable habitat. To determine the effect of habitat change on tsetse density a study was initiated in a tsetse-infested zone of eastern Zambia. The study area represents a gradient of habitat change, starting from a zone with high levels of habitat destruction and ending in an area where livestock and people are almost absent. To determine the distribution and density of the fly, tsetse surveys were conducted throughout the study area in the dry and in the rainy season. Landsat ETM+ imagery covering the study area were classified into four land cover classes (munga, miombo, agriculture and settlements) and two auxiliary spectral classes (clouds and shadow) using a Gaussian Maximum Likelihood Classifier. The classes were regrouped into natural vegetation and agricultural zone. The binary images were overlaid with hexagons to obtain the spatial spectrum of spatial pattern. Hexagonal coverage was selected because of its compact and regular form. To identify scale-specific spatial patterns and associated entomological phenomena, the size of the hexagonal coverage was varied (250 and 500 m). Per coverage, total class area, mean patch size, number of patches and patch size standard deviation were used as fragmentation indices. Based on the fragmentation index values, the study zone was classified using a Partitioning Around Mediods (PAM) method. The number of classes was determined using the Wilks' lambda coefficient. To determine the impact of habitat fragmentation on tsetse abundance, the correlation between the fragmentation indices and the index
Shell effects at the touching point of nuclear fragments
International Nuclear Information System (INIS)
Poenaru, D.N.; Gherghescu, R.A.; Greiner, W.
1999-01-01
Shell correction energy of the fission fragments remains practically unchanged when the separation distance increases from the sum of their radii up to infinity. The variation with mass asymmetry of the total deformation energy at the touching point configuration shows the valleys corresponding to different decay modes, which are produced when the two proton and/or the two neutron numbers are magic or almost magic. We present a potential energy surface of the proton-rich α-emitter 106 Te, showing the α-decay valley, obtained with a phenomenological shell correction. We discuss the difficulties to produce such a valley on a potential energy surface of 236 Pu, calculated with the macroscopic-microscopic method, in which the nuclear level scheme is found within the two center shell model. The valleys mainly due to the double magic nuclei 100,132 Sn, 208 Pb, and other magic numbers, are illustrated by plotting the deformation energy at the touching point versus the proton number of the fragment, for the following parent nuclei: 106 Te, 116 Ce, 212 Po, 238 Th, 258 Fm and 264 Fm. For ternary fission the gain in energy of compact configurations as compared to aligned ones is analysed. (authors)
Fragmentation and structure of silicon microclusters
International Nuclear Information System (INIS)
Feuston, B.P.; Kalia, R.K.; Vashishta, P.
1987-01-01
It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature
Modelling of the PELE fragmentation dynamics
Verreault, J.
2014-05-01
The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.
Modelling of the PELE fragmentation dynamics
International Nuclear Information System (INIS)
Verreault, J
2014-01-01
The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Landscape structure affects specialists but not generalists in naturally fragmented grasslands
Miller, Jesse E.D.; Damschen, Ellen Ingman; Harrison, Susan P.; Grace, James B.
2015-01-01
Understanding how biotic communities respond to landscape spatial structure is critically important for conservation management as natural landscapes become increasingly fragmented. However, empirical studies of the effects of spatial structure on plant species richness have found inconsistent results, suggesting that more comprehensive approaches are needed. In this study, we asked how landscape structure affects total plant species richness and the richness of a guild of specialized plants in a multivariate context. We sampled herbaceous plant communities at 56 dolomite glades (insular, fire-adapted grasslands) across the Missouri Ozarks, and used structural equation modeling (SEM) to analyze the relative importance of landscape structure, soil resource availability, and fire history for plant communities. We found that landscape spatial structure-defined as the area-weighted proximity of glade habitat surrounding study sites (proximity index)-had a significant effect on total plant species richness, but only after we controlled for environmental covariates. Richness of specialist species, but not generalists, was positively related to landscape spatial structure. Our results highlight that local environmental filters must be considered to understand the influence of landscape structure on communities, and that unique species guilds may respond differently to landscape structure than the community as a whole. These findings suggest that both local environment and landscape context should be considered when developing management strategies for species of conservation concern in fragmented habitats.
Delivery of chemotherapeutic drugs in tumour cell-derived microparticles.
Tang, Ke; Zhang, Yi; Zhang, Huafeng; Xu, Pingwei; Liu, Jing; Ma, Jingwei; Lv, Meng; Li, Dapeng; Katirai, Foad; Shen, Guan-Xin; Zhang, Guimei; Feng, Zuo-Hua; Ye, Duyun; Huang, Bo
2012-01-01
Cellular microparticles are vesicular plasma membrane fragments with a diameter of 100-1,000 nanometres that are shed by cells in response to various physiological and artificial stimuli. Here we demonstrate that tumour cell-derived microparticles can be used as vectors to deliver chemotherapeutic drugs. We show that tumour cells incubated with chemotherapeutic drugs package these drugs into microparticles, which can be collected and used to effectively kill tumour cells in murine tumour models without typical side effects. We describe several mechanisms involved in this process, including uptake of drug-containing microparticles by tumour cells, synthesis of additional drug-packaging microparticles by these cells that contribute to the cytotoxic effect and the inhibition of drug efflux from tumour cells. This study highlights a novel drug delivery strategy with potential clinical application.
Projectile rapidity dependence in target fragmentation
International Nuclear Information System (INIS)
Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.
1979-01-01
The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references
The split comets: gravitational interaction between the fragments
International Nuclear Information System (INIS)
Sekanina, Z.
1979-01-01
The n-body computer program by Schubart and Stumpff (1966) has been slightly modified to study the gravitational interaction between two fragments of a split comet nucleus in the sun's gravitational field. All calculations refer to the orbit of Comet West (1976 VI), the velocity of separation of the fragments is assumed to be equal in magnitude to the velocity of escape from the parent nucleus, and the numerical integration of the relative motion of one fragment (called the companion) with respect to the other (principal fragment) is carried over the period of 200 days from separation. (Auth.)
Prausnitz, Mark R.; Langer, Robert
2009-01-01
Transdermal drug delivery has made an important contribution to medical practice, but has yet to fully achieve its potential as an alternative to oral delivery and hypodermic injections. First-generation transdermal delivery systems have continued their steady increase in clinical use for delivery of small, lipophilic, low-dose drugs. Second-generation delivery systems using chemical enhancers, non-cavitational ultrasound and iontophoresis have also resulted in clinical products; the ability of iontophoresis to control delivery rates in real time provides added functionality. Third-generation delivery systems target their effects to skin’s barrier layer of stratum corneum using microneedles, thermal ablation, microdermabrasion, electroporation and cavitational ultrasound. Microneedles and thermal ablation are currently progressing through clinical trials for delivery of macromolecules and vaccines, such as insulin, parathyroid hormone and influenza vaccine. Using these novel second- and third-generation enhancement strategies, transdermal delivery is poised to significantly increase impact on medicine. PMID:18997767
The immediate effect of vaginal and caesarean delivery on anal sphincter measurements.
Karcaaltincaba, Deniz; Erkaya, Salim; Isik, Hatice; Haberal, Ali
2016-08-01
This study evaluated the effects of vaginal and caesarean delivery on internal and external anal sphincter muscle thickness using translabial ultrasonography (TL-US). This prospective cohort study enrolled nulliparous women who either had vaginal or caesarean deliveries. The thickness of the hypoechoic internal anal sphincter (IAS) and hyperechoic external anal sphincter (EAS) at the 12, 3, 6, and 9 o'clock positions at the distal level were measured before delivery and within 24-48 h after delivery. A total 105 consecutive women were enrolled in the study: 60 in the vaginal delivery group and 45 in the caesarean delivery group. The IAS muscle thickness at the 12 o'clock position in the vaginal delivery group was significantly thicker before compared with after delivery (mean ± SD: 2.31 ± 0.74 mm versus 1.81 ± 0.64 mm, respectively). The EAS muscle thickness at the 12 o'clock position in the vaginal delivery group was significantly thicker before compared with after delivery (mean ± SD: 2.42 ± 0.64 mm versus 1.97 ± 0.85, respectively). There was significant muscle thinning of both the IAS and EAS at the 12 o'clock position after vaginal delivery, but not after caesarean delivery. © The Author(s) 2016.
Momentum sum rules for fragmentation functions
International Nuclear Information System (INIS)
Meissner, S.; Metz, A.; Pitonyak, D.
2010-01-01
Momentum sum rules for fragmentation functions are considered. In particular, we give a general proof of the Schaefer-Teryaev sum rule for the transverse momentum dependent Collins function. We also argue that corresponding sum rules for related fragmentation functions do not exist. Our model-independent analysis is supplemented by calculations in a simple field-theoretical model.
Rock fragmentation control in opencast blasting
Directory of Open Access Journals (Sweden)
P.K. Singh
2016-04-01
Full Text Available The blasting operation plays a pivotal role in the overall economics of opencast mines. The blasting sub-system affects all the other associated sub-systems, i.e. loading, transport, crushing and milling operations. Fragmentation control through effective blast design and its effect on productivity are the challenging tasks for practicing blasting engineer due to inadequate knowledge of actual explosive energy released in the borehole, varying initiation practice in blast design and its effect on explosive energy release characteristic. This paper describes the result of a systematic study on the impact of blast design parameters on rock fragmentation at three mines in India. The mines use draglines and shovel–dumper combination for removal of overburden. Despite its pivotal role in controlling the overall economics of a mining operation, the expected blasting performance is often judged almost exclusively on the basis of poorly defined parameters such as powder factor and is often qualitative which results in very subjective assessment of blasting performance. Such an approach is very poor substitutes for accurate assessment of explosive and blasting performance. Ninety one blasts were conducted with varying blast designs and charging patterns, and their impacts on the rock fragmentation were documented. A high-speed camera was deployed to record the detonation sequences of the blasts. The efficiency of the loading machines was also correlated with the mean fragment size obtained from the fragmentation analyses.
... Education & Events Advocacy For Patients About ACOG Assisted Vaginal Delivery Home For Patients Search FAQs Assisted Vaginal ... Vaginal Delivery FAQ192, February 2016 PDF Format Assisted Vaginal Delivery Labor, Delivery, and Postpartum Care What is ...
ACFIS: a web server for fragment-based drug discovery
Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu
2016-01-01
In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown ‘chemical space’ to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for ‘chemical space’, which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. PMID:27150808
DEFF Research Database (Denmark)
Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe
2005-01-01
subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...
The effective fragment molecular orbital method for fragments connected by covalent bonds.
Directory of Open Access Journals (Sweden)
Casper Steinmann
Full Text Available We extend the effective fragment molecular orbital method (EFMO into treating fragments connected by covalent bonds. The accuracy of EFMO is compared to FMO and conventional ab initio electronic structure methods for polypeptides including proteins. Errors in energy for RHF and MP2 are within 2 kcal/mol for neutral polypeptides and 6 kcal/mol for charged polypeptides similar to FMO but obtained two to five times faster. For proteins, the errors are also within a few kcal/mol of the FMO results. We developed both the RHF and MP2 gradient for EFMO. Compared to ab initio, the EFMO optimized structures had an RMSD of 0.40 and 0.44 Å for RHF and MP2, respectively.
arXiv Generalized Fragmentation Functions for Fractal Jet Observables
Elder, Benjamin T.; Thaler, Jesse; Waalewijn, Wouter J.; Zhou, Kevin
2017-06-15
We introduce a broad class of fractal jet observables that recursively probe the collective properties of hadrons produced in jet fragmentation. To describe these collinear-unsafe observables, we generalize the formalism of fragmentation functions, which are important objects in QCD for calculating cross sections involving identified final-state hadrons. Fragmentation functions are fundamentally nonperturbative, but have a calculable renormalization group evolution. Unlike ordinary fragmentation functions, generalized fragmentation functions exhibit nonlinear evolution, since fractal observables involve correlated subsets of hadrons within a jet. Some special cases of generalized fragmentation functions are reviewed, including jet charge and track functions. We then consider fractal jet observables that are based on hierarchical clustering trees, where the nonlinear evolution equations also exhibit tree-like structure at leading order. We develop a numeric code for performing this evolution and study its phen...
Impact fragmentation of a brittle metal compact
Tang, Megan; Hooper, Joseph P.
2018-05-01
The fragmentation behavior of a metal powder compact which is ductile in compression but brittle in tension is studied via impact experiments and analytical models. Consolidated metal compacts were prepared via cold-isostatic pressing of powder at 380 MPa followed by moderate annealing at 365 °C. The resulting zinc material is ductile and strain-hardening in high-rate uniaxial compression like a traditional metal, but is elastic-brittle in tension with a fracture toughness comparable to a ceramic. Cylindrical samples were launched up to 800 m/s in a gas gun into thin aluminum perforation targets, subjecting the projectile to a complex multiaxial and time-dependent stress state that leads to catastrophic fracture. A soft-catch mechanism using low-density artificial snow was developed to recover the impact debris, and collected fragments were analyzed to determine their size distribution down to 30 μm. Though brittle fracture occurs along original particle boundaries, no power-law fragmentation behavior was observed as is seen in other low-toughness materials. An analytical theory is developed to predict the characteristic fragment size accounting for both the sharp onset of fragmentation and the effect of increasing impact velocity.
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
An improved algorithm for MFR fragment assembly
International Nuclear Information System (INIS)
Kontaxis, Georg
2012-01-01
A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.
Outcomes and risk factors for unplanned delivery at home and before arrival to the hospital.
Lazić, Zlatko; Takač, Iztok
2011-01-01
The aim of this study was to analyze the outcomes and risk factors for unplanned delivery at home and before arrival to the hospital in Maribor region, Slovenia. We used data from medical records of all deliveries in Maribor region from the year 1997 to the year 2005. We analysed a total of 17,846 births from annual reports of the Maribor University Hospital. Among the total of 17,846 births, there were 58 (3.2‰) unplanned births at home and on the way to the hospital. The study based on the data from medical records on safety of unplanned home birth reveals that hospital delivery is approximately 7 times safer than unplanned home delivery. This conclusion is reached by comparing perinatal mortality, which was 68‰ for unplanned deliveries at home versus 8.8‰ for deliveries at hospital. The prematurity was more common in unplanned home deliveries: 13 (22%) versus 1399 (8%) for hospital deliveries. Unplanned deliveries at home and on the way to the hospital were more common in multiparous women (ratio 4:1 compared to 1:1 for hospital births). When for all hospital deliveries the pregnancies were followed, for one third of unplanned deliveries at home or on the way to the hospital the pregnancies were not monitored. Mothers who gave birth at home or on the way to the hospital were without higher education (i.e. 55.2%) and mothers who gave birth in hospital were with higher education (i.e. 87.4%). There was higher rate of perinatal morbidity for unplanned home deliveries compared to hospital deliveries. Factors that make unplanned home deliveries more common are high parity, absence or inadequacy of antenatal care, marital status and lower education. Some conditions in newborn, such as hypothermia, were clearly the result of unplanned birth at home. Additional effort to improve antenatal care and also identifying social vulnerabilities would possibly decrease the number of unplanned deliveries and improve the perinatal outcomes.
Analysis of architect’s performance indicators in project delivery process
Marisa, A.
2018-03-01
Architect as a professional in the construction industry should possess a good performance in project delivery process. As a design professional, architect has an important role to ensure that the process is well-conducted by delivering a high-quality product for the clients. Thus, analyzing architect’s performance indicators is crucial in the project delivery process. This study aims to analyze the relative importance of architect performance indicators in project delivery process among registered architects in North Sumatera, Indonesia. A total of five indicators that measure architect performance in project delivery process were identified and 110 completed questionnaires were obtained and used for data analysis. A relative importance index is used to rank the relative importance of architect performance indicators. Results indicate that focus on the clients is the most important indicator of architect performance in project delivery process. This study demonstrates project communication as one of crucial indicators perceived by the architects for measuring their performance, and fills a knowledge gap on the importance of identifying the most important indicator for measuring architect performance from their own perspectives which previous studies have overlooked to improve performance assessment in project delivery process.
Extracellular matrix fragmentation in young, healthy cartilaginous tissues.
Craddock, R J; Hodson, N W; Ozols, M; Shearer, T; Hoyland, J A; Sherratt, M J
2018-02-09
Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC) and the nucleus pulposus (NP) of the intervertebral disc (IVD). Whilst structural heterogeneity of intact aggrecan ( containing three globular domains) is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months), bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 %) were fragmented (lacking one or more globular domains). Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa) comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis). As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2) as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2), it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally) and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.
Local Delivery of a Synthetic Endostatin Fragment for the Treatment of Experimental Gliomas
Pradilla, Gustavo; Legnani, Federico G.; Petrangolini, Giovanna; Francescato, Pierangelo; Chillemi, Francesco; Tyler, Betty M.; Gaini, Sergio M.; Brem, Henry; Olivi, Alessandro; DiMeco, Francesco
2006-01-01
OBJECTIVE: Endostatin is an anti-angiogenic agent that blocks matrix-metalloproteinase-2 and inhibits endothelial cell proliferation. Currently, endostatin is available through recombinant technology, which limits its broader use. In this study, a synthetic endostatin fragment (EF) was analyzed to determine its anti-angiogenic properties when locally delivered by controlled-release polymers and to establish its effect as a treatment for experimental gliomas. METHODS: Cytotoxicity of EF against 9L gliosarcoma and F98 glioma was determined in vitro. EF was loaded into polyanhydride-poly-(bis-[carboxyphenoxy-propane]-sebacic-acid) (pCPP:SA) polymers at increasing concentrations. Pharmacokinetics of the EF/polymer formulations were defined in vitro. Anti-angiogenic properties of the EF/polymer formulations were evaluated in the rat-cornea micropocket assay. Toxicity and efficacy of locally delivered EF polymers either alone or combined with systemic bischloroethylnitrosourea (carmustine) were determined in rats intracranially challenged with 9L gliosarcoma. RESULTS: EF showed scarce cytotoxicity against 9L and F98 in vitro. EF/pCPP:SA formulations showed sustained release by day 19. Mean corneal angiogenesis index 20 days after tumor implantation was 4.5 ± 0.7 for corneas implanted with 40% EF/pCPP:SA compared with controls (8.5 ± 1.3, P = 0.02). Intracranial efficacy studies showed that EF polymers alone did not prolong animal survival. Combination of 40% EF/pCPP:SA polymers with systemic bischloroethylnitrosourea (carmustine) prolonged survival (median survival of 44 d, P = 0.001) and generated 33% long-term survivors. CONCLUSION: Controlled-release polymers can effectively deliver a biologically active EF in a sustained fashion. EF inhibits angiogenesis in vitro and in vivo, and even though EF does not prolong survival as a single agent, it exhibits a synergistic effect when combined with systemic bischloroethylnitrosourea (carmustine) in the intracranial 9L
Modelling the fragmentation mechanisms
International Nuclear Information System (INIS)
Bougault, R.; Durand, D.; Gulminelli, F.
1998-01-01
We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way
Limestone fragmentation and attrition during fluidized bed oxyfiring
Energy Technology Data Exchange (ETDEWEB)
Fabrizio Scala; Piero Salatino [Istituto di Ricerche sulla Combustione - CNR, Napoli (Italy)
2010-04-15
Attrition/fragmentation of limestone under simulated fluidized bed oxyfiring conditions was investigated by means of an experimental protocol that had been previously developed for characterization of attrition/fragmentation of sorbents in air-blown atmospheric fluidized bed combustors. The protocol was based on the use of different and mutually complementary techniques. The extent and pattern of attrition by surface wear in the dense phase of a fluidized bed were assessed in experiments carried out with a bench scale fluidized bed combustor under simulated oxyfiring conditions. Sorbent samples generated during simulated oxyfiring tests were further characterized from the standpoint of fragmentation upon high velocity impact by means of a purposely designed particle impactor. Results showed that under calcination-hindered conditions attrition and fragmentation patterns are much different from those occurring under air-blown atmospheric combustion conditions. Noteworthy, attrition/fragmentation enhanced particle sulfation by continuously regenerating the exposed particle surface. 13 refs., 8 figs.
K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale
1994-01-01
A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...
Carmalt, James L; Borg, Hanna; Näslund, Hans; Waldner, Cheryl
2014-10-01
The aim of this study was to determine whether horses with a proximal palmar/plantar first phalangeal osteochondral fragment (POF) had comparable racing careers (prior to and following surgery) to horses without this fracture. A retrospective cohort study included 174 Swedish Standardbred trotters with osteochondral fragmentation in the palmar/plantar fetlock joint and 613 radiographically negative control horses presented for prepurchase examinations. Medical records and radiographs were examined for each horse. Racing data were retrieved from online Swedish Standardbred harness racing records. The effect of having a POF on race speed compared to radiographically negative control horses was examined using generalised estimating equations. Multivariable regression was used to examine differences in money earned and career longevity. The horses raced a total of 16,448 races. Horses gained speed as a function of race number. There was no difference in racing speed between horses with POF fractures that raced before surgery and control horses. Horses did not slow before, nor speed up after, surgery. There was no difference in the number of days between the last race prior to, or the first race after, the hospital visit between POF and control horses. Career earnings and lifetime starts were not significantly different between groups. The results of this study suggest the need to reevaluate the previously reported benefits of surgical intervention for POF. Copyright © 2014 Elsevier Ltd. All rights reserved.
Fragmentation of Continental United States Forests
Kurt H. Riitters; James D. Wickham; Robert V. O' Neill; K. Bruce Jones; Elizabeth R. Smith; John W. Coulston; Timothy G. Wade; Jonathan H. Smith
2002-01-01
We report a multiple-scale analysis of forest fragmentation based on 30-m (0.09 ha pixel-1) land- cover maps for the conterminous United States. Each 0.09-ha unit of forest was classified according to fragmentation indexes measured within the surrounding landscape, for five landscape sizes including 2.25, 7.29, 65.61, 590.49, and 5314.41 ha....
Geospatial analysis of forest fragmentation in Uttara Kannada District, India
Directory of Open Access Journals (Sweden)
Ramachandra T V
2016-04-01
Full Text Available Background: Landscapes consist of heterogeneous interacting dynamic elements with complex ecological, economic and cultural attributes. These complex interactions help in the sustenance of natural resources through bio-geochemical and hydrological cycling. The ecosystem functions are altered with changes in the landscape structure. Fragmentation of large contiguous forests to small and isolated forest patches either by natural phenomena or anthropogenic activities leads to drastic changes in forest patch sizes, shape, connectivity and internal heterogeneity, which restrict the movement leading to inbreeding among Meta populations with extirpation of species. Methods: Landscape dynamics are assessed through land use analysis by way of remote sensing data acquired at different time periods. Forest fragmentation is assessed at the pixel level through computation of two indicators, i.e., Pf (the ratio of pixels that are forested to the total non-water pixels in the window and Pff (the proportion of all adjacent (cardinal directions only pixel pairs that include at least one forest pixel, for which both pixels are forested. Results: Uttara Kannada District has the distinction of having the highest forest cover in Karnataka State, India. This region has been experiencing changes in its forest cover and consequent alterations in functional abilities of its ecosystem. Temporal land use analyses show the trend of deforestation, evident from the reduction of evergreen - semi evergreen forest cover from 57.31 % (1979 to 32.08 % (2013 Forest fragmentation at the landscape level shows a decline of interior forests 64.42 % (1979 to 25.62 % (2013 and transition of non-forest categories such as crop land, plantations and built-up areas, amounting now to 47.29 %. PCA prioritized geophysical and socio variables responsible for changes in the landscape structure at local levels. Conclusion: Terrestrial forest ecosystems in Uttara Kannada District of Central
High efficiency hydrodynamic DNA fragmentation in a bubbling system
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling
2017-01-01
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling
The relationship between occupational fatigue and preterm delivery
Directory of Open Access Journals (Sweden)
Mahbod Ebrahimi
2014-05-01
Full Text Available Background: The presense of women in workplace is an unavoiding issue in modern world. The women work in different media. Occupational activities are suspected of having an adverse impact on outcomes of pregnancy. Premature delivery is a catastrophic event in course of pregnancy. The aim of the study was to define the incidence of premature delivery in occupationally involved pregnant women. Material and Methods: A total of 287 primigravida women in an urban society with singleton pregnancies at 22 to 24 weeks gestation were enrolled in a prospective study. They worked in industrial manufactures. The patients reported the number of hours worked per week and answered specific questions designed to determine the following 5 sources of occupational fatigue including:1- posture ,2- work with industrial machines 3- physical exertion 4-mental stress and 5- environmental stress. Results: The risk of preterm delivery increased with standing more than 3 hours during activities in work place (p.value=0/019. There was not a statistically significant relationship between premature delivery and other sources of occupational fatigue. There was not a statically significant relationship between premature rupture of fetal membranes and the sources of occupational fatigue. There was not a statistically significant relationship between premature delivery and increasing number of hours worked per week. Conclusion: The relationship between premature delivery and occupational fatigue may provide guidelines according to pregnant women and their employers can be advised.
Integrating total quality management in a library setting
Jurow, Susan
2013-01-01
Improve the delivery of library services by implementing total quality management (TQM), a system of continuous improvement employing participative management and centered on the needs of customers. Although TQM was originally designed for and successfully applied in business and manufacturing settings, this groundbreaking volume introduces strategies for translating TQM principles from the profit-based manufacturing sector to the library setting. Integrating Total Quality Management in a Library Setting shows librarians how to improve library services by implementing strategies such as employ
Self-nanoemulsifying drug delivery systems for oral insulin delivery
DEFF Research Database (Denmark)
Li, Ping; Tan, Angel; Prestidge, Clive A
2014-01-01
This study aims at evaluating the combination of self-nanoemulsifying drug delivery systems (SNEDDS) and enteric-coated capsules as a potential delivery strategy for oral delivery of insulin. The SNEDDS preconcentrates, loaded with insulin-phospholipid complex at different levels (0, 2.5 and 10% w...
Verreault, J.; Hinsberg, N.P. van; Abadjieva, E.
2013-01-01
An analytical model that describes the PELE fragmentation dynamics is presented and compared with experimental results from literature. The model accounts for strong shock effects and detailed interactions taking place between the filling – the inner core of the ammunition – and the target
DEFF Research Database (Denmark)
Humle, Didde Maria; Reff Pedersen, Anne
2015-01-01
stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...
Energy Technology Data Exchange (ETDEWEB)
Picard, Y
1999-04-15
The goal of this work is the complete analysis of the fragmentation of alkali clusters (Na{sub n}{sup +} (n < 10), NaK{sup +} and K{sub 2}{sup +}) induced by collision with light atomic (He) or molecular (H{sub 2}) targets. The main point is to study how the energy is transmitted to the cluster during the collision and how this energy is shared among the various degrees of freedom of the system and leads to its fragmentation. Two types of interactions govern the collision induced dissociation processes: on one hand, the electronic mechanisms where the target perturbs the electronic cloud and brings the molecule into a dissociative state, and on the other hand, the impulsive mechanisms where the momentum transferred to the atomic cores leads to the rotational-vibrational dissociation of the molecule. The experimental procedure is based on the measurement of the velocity vectors of the outgoing fragments detected in coincidence. This allows to reconstruct the full kinematics of the fragmentation and to separate and characterize for the first time the two types of interactions. The two basic mechanisms of collision induced dissociation are then clearly resolved for the diatomic molecule Na{sub 2}{sup +}. For the heteronuclear molecular ion NaK{sup +}, it is shown that the dissociation process is due to a combination of electronic and impulsive mechanisms in some of the dissociation pathways. The extension to the study of metallic clusters Na{sub n}{sup +} (n < 10) fragmentation shows the role and the relative importance of the electronic and impulsive mechanisms and their evolution with the cluster size. The complete analysis of Na{sub 3}{sup +} multi-fragmentation is also presented. (author)
Liu, Shi; Wu, Yu; Wooten, H Omar; Green, Olga; Archer, Brent; Li, Harold; Yang, Deshan
2016-03-08
A software tool is developed, given a new treatment plan, to predict treatment delivery time for radiation therapy (RT) treatments of patients on ViewRay magnetic resonance image-guided radiation therapy (MR-IGRT) delivery system. This tool is necessary for managing patient treatment scheduling in our clinic. The predicted treatment delivery time and the assessment of plan complexities could also be useful to aid treatment planning. A patient's total treatment delivery time, not including time required for localization, is modeled as the sum of four components: 1) the treatment initialization time; 2) the total beam-on time; 3) the gantry rotation time; and 4) the multileaf collimator (MLC) motion time. Each of the four components is predicted separately. The total beam-on time can be calculated using both the planned beam-on time and the decay-corrected dose rate. To predict the remain-ing components, we retrospectively analyzed the patient treatment delivery record files. The initialization time is demonstrated to be random since it depends on the final gantry angle of the previous treatment. Based on modeling the relationships between the gantry rotation angles and the corresponding rotation time, linear regression is applied to predict the gantry rotation time. The MLC motion time is calculated using the leaves delay modeling method and the leaf motion speed. A quantitative analysis was performed to understand the correlation between the total treatment time and the plan complexity. The proposed algorithm is able to predict the ViewRay treatment delivery time with the average prediction error 0.22min or 1.82%, and the maximal prediction error 0.89 min or 7.88%. The analysis has shown the correlation between the plan modulation (PM) factor and the total treatment delivery time, as well as the treatment delivery duty cycle. A possibility has been identified to significantly reduce MLC motion time by optimizing the positions of closed MLC pairs. The accuracy of
Microbial platform technology for recombinant antibody fragment production: A review.
Gupta, Sanjeev Kumar; Shukla, Pratyoosh
2017-02-01
Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.
Prausnitz, Mark R.; Langer, Robert
2008-01-01
Transdermal drug delivery has made an important contribution to medical practice, but has yet to fully achieve its potential as an alternative to oral delivery and hypodermic injections. First-generation transdermal delivery systems have continued their steady increase in clinical use for delivery of small, lipophilic, low-dose drugs. Second-generation delivery systems using chemical enhancers, non-cavitational ultrasound and iontophoresis have also resulted in clinical products; the ability ...
A fragment separator at LBL for beta-NMR experiment
International Nuclear Information System (INIS)
Matsuta, K.; Ozawa, A.; Nojiri, Y.; Minamisono, T.; Fukuda, M.; Kitagawa, A.; Ohtsubo, T.; Momota, S.; Fukuda, S.; Matsuo, Y.; Takechi, H.; Minami, I.; Sugimoto, K.; Tanihata, I.; Omata, K.; Alonso, J.R.; Krebs, G.F.; Symons, T.J.M.
1992-03-01
The Beam 44 fragment separator was built at the Bevalac of LBL for NMR studies of beta emitting nuclei. 37 K, 39 Ca, and 43 Ti fragments originating from 40 Ca and 46 Ti primary beams were separated by the separator for NMR studies on these nuclei. Nuclear spin polarization was created in 39 Ca and 43 Ti using the tilted foil technique (TFT), and the magnetic moment of 43 Ti was deduced. Fragment polarization was measured for 37 K and 39 Ca emitted to finite deflection angles. The Beam 44 fragment separator in combination with a proper polarization technique, such as TFT or fragment polarization, has been very effective for such NMR studies
Pollen and gene flow in fragmented habitats
Kwak, Manja M.; Velterop, Odilia; van Andel, Jelte
. Habitat fragmentation affects both plants and pollinators. Habitat fragmentation leads to changes in species richness, population number and size, density, and shape, thus to changes in the spatial arrangement of flowers. These changes influence the amount of food for flower-visiting insects and
ACFIS: a web server for fragment-based drug discovery.
Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu
2016-07-08
In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown 'chemical space' to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for 'chemical space', which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Searching Fragment Spaces with feature trees.
Lessel, Uta; Wellenzohn, Bernd; Lilienthal, Markus; Claussen, Holger
2009-02-01
Virtual combinatorial chemistry easily produces billions of compounds, for which conventional virtual screening cannot be performed even with the fastest methods available. An efficient solution for such a scenario is the generation of Fragment Spaces, which encode huge numbers of virtual compounds by their fragments/reagents and rules of how to combine them. Similarity-based searches can be performed in such spaces without ever fully enumerating all virtual products. Here we describe the generation of a huge Fragment Space encoding about 5 * 10(11) compounds based on established in-house synthesis protocols for combinatorial libraries, i.e., we encode practically evaluated combinatorial chemistry protocols in a machine readable form, rendering them accessible to in silico search methods. We show how such searches in this Fragment Space can be integrated as a first step in an overall workflow. It reduces the extremely huge number of virtual products by several orders of magnitude so that the resulting list of molecules becomes more manageable for further more elaborated and time-consuming analysis steps. Results of a case study are presented and discussed, which lead to some general conclusions for an efficient expansion of the chemical space to be screened in pharmaceutical companies.
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
Laser-assisted shape selective fragmentation of nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Kazakevich, P.V. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation); Simakin, A.V. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation); Shafeev, G.A. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation)]. E-mail: shafeev@kapella.gpi.ru; Viau, G. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France); Soumare, Y. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France); Bozon-Verduraz, F. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France)
2007-07-31
Experimental results are presented on laser-assisted fragmentation of gold-containing nanoparticles suspended in liquids (either ethanol or water). Two kinds of nanoparticles are considered: (i) elongated Au nanorods synthesized by laser ablation of a gold target immersed in liquid phase; (ii) gold-covered NiCo nanorods with high aspect ratio ({theta} {approx} 10) synthesized by wet chemistry processes. The shape selectivity induced by laser fragmentation of these nanorods is gained via tuning the wavelength of laser radiation into different parts of the spectrum of their plasmon resonance corresponding to different aspect ratios {theta}. Fragmentation is performed using three laser wavelengths, involving a Cu vapour laser (510 and 578 nm) and a Nd:YAG (1064 nm). Nanoparticles are characterized by UV-vis spectrometry, Transmission Electron Microscopy (TEM). The effect of laser pulse duration (nanosecond against picosecond range) is also studied in the case of fragmentation with an IR laser radiation.
NJL-jet model for quark fragmentation functions
International Nuclear Information System (INIS)
Ito, T.; Bentz, W.; Cloeet, I. C.; Thomas, A. W.; Yazaki, K.
2009-01-01
A description of fragmentation functions which satisfy the momentum and isospin sum rules is presented in an effective quark theory. Concentrating on the pion fragmentation function, we first explain why the elementary (lowest order) fragmentation process q→qπ is completely inadequate to describe the empirical data, although the crossed process π→qq describes the quark distribution functions in the pion reasonably well. Taking into account cascadelike processes in a generalized jet-model approach, we then show that the momentum and isospin sum rules can be satisfied naturally, without the introduction of ad hoc parameters. We present results for the Nambu-Jona-Lasinio (NJL) model in the invariant mass regularization scheme and compare them with the empirical parametrizations. We argue that the NJL-jet model, developed herein, provides a useful framework with which to calculate the fragmentation functions in an effective chiral quark theory.
Fragment screening by SPR and advanced application to GPCRs.
Shepherd, Claire A; Hopkins, Andrew L; Navratilova, Iva
2014-01-01
Surface plasmon resonance (SPR) is one of the primary biophysical methods for the screening of low molecular weight 'fragment' libraries, due to its low protein consumption and 'label-free' methodology. SPR biosensor interaction analysis is employed to both screen and confirm the binding of compounds in fragment screening experiments, as it provides accurate information on the affinity and kinetics of molecular interactions. The most advanced application of the use of SPR for fragment screening is against membrane protein drug targets, such G-protein coupled receptors (GPCRs). Biophysical GPCR assays using SPR have been validated with pharmacological measurements approximate to cell-based methods, yet provide the advantage of biophysical methods in their ability to measure the weak affinities of low molecular weight fragments. A number of SPR fragment screens against GPCRs have now been disclosed in the literature. SPR fragment screening is proving versatile to screen both thermostabilised GPCRs and solubilised wild type receptors. In this chapter, we discuss the state-of-the-art in GPCR fragment screening by SPR and the technical considerations in performing such experiments. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Clustering document fragments using background color and texture information
Chanda, Sukalpa; Franke, Katrin; Pal, Umapada
2012-01-01
Forensic analysis of questioned documents sometimes can be extensively data intensive. A forensic expert might need to analyze a heap of document fragments and in such cases to ensure reliability he/she should focus only on relevant evidences hidden in those document fragments. Relevant document retrieval needs finding of similar document fragments. One notion of obtaining such similar documents could be by using document fragment's physical characteristics like color, texture, etc. In this article we propose an automatic scheme to retrieve similar document fragments based on visual appearance of document paper and texture. Multispectral color characteristics using biologically inspired color differentiation techniques are implemented here. This is done by projecting document color characteristics to Lab color space. Gabor filter-based texture analysis is used to identify document texture. It is desired that document fragments from same source will have similar color and texture. For clustering similar document fragments of our test dataset we use a Self Organizing Map (SOM) of dimension 5×5, where the document color and texture information are used as features. We obtained an encouraging accuracy of 97.17% from 1063 test images.
Observation for really cold fragmentation of heavy nucleus
International Nuclear Information System (INIS)
Goverdovskij, A.A.; Ketlerov, V.V.; Mitrofanov, V.F.; Ostapenko, Yu.B.; Khryachkov, V.A.
1998-01-01
The results of the detailed study on mass-energy charged correlations of the thorium-232 fission fragments, produced by the 5 MeV neutrons are presented. The event of the thorium nucleus really cold fragmentation into tellurium-134 and strontium-99 at the basic quantum states is identified. It is shown that the whole reaction energy is exhausted by the motion kinetic energy of the fragments in the mutual field
Extracellular matrix fragmentation in young, healthy cartilaginous tissues
Directory of Open Access Journals (Sweden)
RJ Craddock
2018-02-01
Full Text Available Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC and the nucleus pulposus (NP of the intervertebral disc (IVD. Whilst structural heterogeneity of intact aggrecan ( containing three globular domains is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months, bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 % were fragmented (lacking one or more globular domains. Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p < 0.0001. In contrast, fibrillar collagen appeared structurally intact and tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis. As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2 as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2, it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.
FRAGSION: ultra-fast protein fragment library generation by IOHMM sampling.
Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin
2016-07-01
Speed, accuracy and robustness of building protein fragment library have important implications in de novo protein structure prediction since fragment-based methods are one of the most successful approaches in template-free modeling (FM). Majority of the existing fragment detection methods rely on database-driven search strategies to identify candidate fragments, which are inherently time-consuming and often hinder the possibility to locate longer fragments due to the limited sizes of databases. Also, it is difficult to alleviate the effect of noisy sequence-based predicted features such as secondary structures on the quality of fragment. Here, we present FRAGSION, a database-free method to efficiently generate protein fragment library by sampling from an Input-Output Hidden Markov Model. FRAGSION offers some unique features compared to existing approaches in that it (i) is lightning-fast, consuming only few seconds of CPU time to generate fragment library for a protein of typical length (300 residues); (ii) can generate dynamic-size fragments of any length (even for the whole protein sequence) and (iii) offers ways to handle noise in predicted secondary structure during fragment sampling. On a FM dataset from the most recent Critical Assessment of Structure Prediction, we demonstrate that FGRAGSION provides advantages over the state-of-the-art fragment picking protocol of ROSETTA suite by speeding up computation by several orders of magnitude while achieving comparable performance in fragment quality. Source code and executable versions of FRAGSION for Linux and MacOS is freely available to non-commercial users at http://sysbio.rnet.missouri.edu/FRAGSION/ It is bundled with a manual and example data. chengji@missouri.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Quantifying Urban Fragmentation under Economic Transition in Shanghai City, China
Directory of Open Access Journals (Sweden)
Heyuan You
2015-12-01
Full Text Available Urban fragmentation affects sustainability through multiple impacts on economic, social, and environmental cost. Characterizing the dynamics of urban fragmentation in relation to economic transition should provide implications for sustainability. However, rather few efforts have been made in this issue. Using the case of Shanghai (China, this paper quantifies urban fragmentation in relation to economic transition. In particular, urban fragmentation is quantified by a time-series of remotely sensed images and a set of landscape metrics; and economic transition is described by a set of indicators from three aspects (globalization, decentralization, and marketization. Results show that urban fragmentation presents an increasing linear trend. Multivariate regression identifies positive linear correlation between urban fragmentation and economic transition. More specifically, the relative influence is different for the three components of economic transition. The relative influence of decentralization is stronger than that of globalization and marketization. The joint influences of decentralization and globalization are the strongest for urban fragmentation. The demonstrated methodology can be applicable to other places after making suitable adjustment of the economic transition indicators and fragmentation metrics.
Refolding Technologies for Antibody Fragments
Directory of Open Access Journals (Sweden)
Tsutomu Arakawa
2014-05-01
Full Text Available Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppressor or folding-assisting agents, including arginine hydrochloride, ionic liquids and detergents or denaturants at low concentrations, are included in the refolding solvent to enhance refolding yield.
Parton fragmentation in the vacuum and in the medium
Albino, S.; Arleo, F.; Besson, Dave Z.; Brooks, William K.; Buschbeck, B.; Cacciari, M.; Christova, E.; Corcella, G.; D'Enterria, David G.; Dolejsi, Jiri; Domdey, S.; Estienne, M.; Hamacher, Klaus; Heinz, M.; Hicks, K.; Kettler, D.; Kumano, S.; Moch, S.O.; Muccifora, V.; Pacetti, S.; Perez-Ramos, R.; Pirner, H.J.; Pronko, Alexandre Pavlovich; Radici, M.; Rak, J.; Roland, C.; Rudolph, Gerald; Rurikova, Z.; Salgado, C.A.; Sapeta, S.; Saxon, David H.; Seidl, Ralf-Christian; Seuster, R.; Stratmann, M.; Tannenbaum, Michael J.; Tasevsky, M.; Trainor, T.; Traynor, D.; Werlen, M.; Zhou, C.
2008-01-01
We present the mini-proceedings of the workshop on ``Parton fragmentation in the vacuum and in the medium'' held at the European Centre for Theoretical Studies in Nuclear Physics and Related Areas (ECT*, Trento) in February 2008. The workshop gathered both theorists and experimentalists to discuss the current status of investigations of quark and gluon fragmentation into hadrons at different accelerator facilities (LEP, B-factories, JLab, HERA, RHIC, and Tevatron) as well as preparations for extension of these studies at the LHC. The main physics topics covered were: (i) light-quark and gluon fragmentation in the vacuum including theoretical (global fits analyses and MLLA) and experimental (data from e+e-, p-p, e-p collisions) aspects, (ii) strange and heavy-quark fragmentation, (iii) parton fragmentation in cold QCD matter (nuclear DIS), and (iv) medium-modified fragmentation in hot and dense QCD matter (high-energy nucleus-nucleus collisions). These mini-proceedings consist of an introduction and short summ...
Energy Technology Data Exchange (ETDEWEB)
Gastegger, Michael; Kauffmann, Clemens; Marquetand, Philipp, E-mail: philipp.marquetand@univie.ac.at [Institute of Theoretical Chemistry, Faculty of Chemistry, University of Vienna, Währinger Straße 17, Vienna (Austria); Behler, Jörg [Lehrstuhl für Theoretische Chemie, Ruhr-Universität Bochum, Universitätsstraße 150, Bochum (Germany)
2016-05-21
Many approaches, which have been developed to express the potential energy of large systems, exploit the locality of the atomic interactions. A prominent example is the fragmentation methods in which the quantum chemical calculations are carried out for overlapping small fragments of a given molecule that are then combined in a second step to yield the system’s total energy. Here we compare the accuracy of the systematic molecular fragmentation approach with the performance of high-dimensional neural network (HDNN) potentials introduced by Behler and Parrinello. HDNN potentials are similar in spirit to the fragmentation approach in that the total energy is constructed as a sum of environment-dependent atomic energies, which are derived indirectly from electronic structure calculations. As a benchmark set, we use all-trans alkanes containing up to eleven carbon atoms at the coupled cluster level of theory. These molecules have been chosen because they allow to extrapolate reliable reference energies for very long chains, enabling an assessment of the energies obtained by both methods for alkanes including up to 10 000 carbon atoms. We find that both methods predict high-quality energies with the HDNN potentials yielding smaller errors with respect to the coupled cluster reference.
International Nuclear Information System (INIS)
Gastegger, Michael; Kauffmann, Clemens; Marquetand, Philipp; Behler, Jörg
2016-01-01
Many approaches, which have been developed to express the potential energy of large systems, exploit the locality of the atomic interactions. A prominent example is the fragmentation methods in which the quantum chemical calculations are carried out for overlapping small fragments of a given molecule that are then combined in a second step to yield the system’s total energy. Here we compare the accuracy of the systematic molecular fragmentation approach with the performance of high-dimensional neural network (HDNN) potentials introduced by Behler and Parrinello. HDNN potentials are similar in spirit to the fragmentation approach in that the total energy is constructed as a sum of environment-dependent atomic energies, which are derived indirectly from electronic structure calculations. As a benchmark set, we use all-trans alkanes containing up to eleven carbon atoms at the coupled cluster level of theory. These molecules have been chosen because they allow to extrapolate reliable reference energies for very long chains, enabling an assessment of the energies obtained by both methods for alkanes including up to 10 000 carbon atoms. We find that both methods predict high-quality energies with the HDNN potentials yielding smaller errors with respect to the coupled cluster reference.
Universal Rim Thickness in Unsteady Sheet Fragmentation
Wang, Y.; Dandekar, R.; Bustos, N.; Poulain, S.; Bourouiba, L.
2018-05-01
Unsteady fragmentation of a fluid bulk into droplets is important for epidemiology as it governs the transport of pathogens from sneezes and coughs, or from contaminated crops in agriculture. It is also ubiquitous in industrial processes such as paint, coating, and combustion. Unsteady fragmentation is distinct from steady fragmentation on which most theoretical efforts have been focused thus far. We address this gap by studying a canonical unsteady fragmentation process: the breakup from a drop impact on a finite surface where the drop fluid is transferred to a free expanding sheet of time-varying properties and bounded by a rim of time-varying thickness. The continuous rim destabilization selects the final spray droplets, yet this process remains poorly understood. We combine theory with advanced image analysis to study the unsteady rim destabilization. We show that, at all times, the rim thickness is governed by a local instantaneous Bond number equal to unity, defined with the instantaneous, local, unsteady rim acceleration. This criterion is found to be robust and universal for a family of unsteady inviscid fluid sheet fragmentation phenomena, from impacts of drops on various surface geometries to impacts on films. We discuss under which viscous and viscoelastic conditions the criterion continues to govern the unsteady rim thickness.
Analysis of single hyphal growth and fragmentation in submerged cultures using a population model
DEFF Research Database (Denmark)
Krabben, Preben; Nielsen, Søren; Michelsen, Michael Locht
1997-01-01
Descriptions of population dynamics in submerged cultures are important when studying the mechanisms of growth and fragmentation of filamentous microorganisms. Population models are traditionally formulated as population balance equations. Population models of filamentous morphology are difficult...... to solve because of random fragmentation, which introduces an integral term into the population balance equations. Balances for the systemic properties, e.g. concentration of hyphal elements, substrate concentration, average total hyphal length, and average number of growing tips, are set up. Based...... on these balances one can solve the inverse problem, i.e. determination of kinetic parameters directly from measurements of the hyphal morphology. Both a Monte Carlo method and a discretization method have been used to calculate the steady-state population distribution. The two methods are compared and the Monte...
Oral lead bullet fragment exposure in northern bobwhite (Colinus virginianus).
Kerr, Richard; Holladay, Jeremy; Holladay, Steven; Tannenbaum, Lawrence; Selcer, Barbara; Meldrum, Blair; Williams, Susan; Jarrett, Timothy; Gogal, Robert
2011-11-01
Lead (Pb) is a worldwide environmental contaminant known to adversely affect multiple organ systems in both mammalian and avian species. In birds, a common route of exposure is via oral ingestion of lead particles. Data are currently lacking for the retention and clearance of Pb bullet fragments in gastrointestinal (GI) tract of birds while linking toxicity with blood Pb levels. In the present study, northern bobwhite quail fed a seed-based diet were orally gavaged with Pb bullet fragments (zero, one or five fragments/bird) and evaluated for rate of fragment clearance, and changes in peripheral blood, renal, immune, and gastrointestinal parameters. Based on radiographs, the majority of the birds cleared or absorbed the fragments by seven days, with the exception of one five-fragment bird which took between 7 and 14 days. Blood Pb levels were higher in males than females, which may be related to egg production in females. In males but not females, feed consumption, body weight gain, packed cell volume (PCV), plasma protein concentration, and δ-aminolevulinic acid dehydratase (δ-ALAD) activity were all adversely affected by five Pb fragments. Birds of both sexes that received a single Pb fragment displayed depressed δ-ALAD, suggesting altered hematologic function, while all birds dosed with five bullet fragments exhibited greater morbidity.
In situ fragmentation and rock particle sorting on arid hills
McGrath, Gavan S.; Nie, Zhengyao; Dyskin, Arcady; Byrd, Tia; Jenner, Rowan; Holbeche, Georgina; Hinz, Christoph
2013-03-01
Transport processes are often proposed to explain the sorting of rock particles on arid hillslopes, where mean rock particle size often decreases in the downslope direction. Here we show that in situ fragmentation of rock particles can also produce similar patterns. A total of 93,414 rock particles were digitized from 880 photographs of the surface of three mesa hills in the Great Sandy Desert, Australia. Rock particles were characterized by the projected Feret's diameter and circularity. Distance from the duricrust cap was found to be a more robust explanatory variable for diameter than the local hillslope gradient. Mean diameter decreased exponentially downslope, while the fractional area covered by rock particles decreased linearly. Rock particle diameters were distributed lognormally, with both the location and scale parameters decreasing approximately linearly downslope. Rock particle circularity distributions showed little change; only a slight shift in the mode to more circular particles was noted to occur downslope. A dynamic fragmentation model was used to assess whether in situ weathering alone could reproduce the observed downslope fining of diameters. Modeled and observed size distributions agreed well and both displayed a preferential loss of relatively large rock particles and an apparent approach to a terminal size distribution of the rocks downslope. We show this is consistent with a size effect in material strength, where large rocks are more susceptible to fatigue failure under stress than smaller rocks. In situ fragmentation therefore produces qualitatively similar patterns to those that would be expected to arise from selective transport.
Energy Technology Data Exchange (ETDEWEB)
Alard, J P; Bastid, N; Crouau, M; Dupieux, P; Fraysse, L; Jorio, M; Montarou, G; Morel, P [Laboratoire de Physique Corpusculaire, 63 - Clermont-Ferrand (France); Basrak, Z; Caplar, R; Cindro, N; Hoelbling, S [Rudjer Boskovic Inst., Zagreb (Yugoslavia); Belayev, I M; Frolov, S; Korchagin, Y; Lebedev, A; Smolyankin, S; Zhilin, A V [Institute for Experimental and Theoretical Physics, Moscow (Russia); Bini, M; Olmi, A; Pasquali, G; Poggi, G; Taccetti, N [Florence Univ. (Italy); [INFN, Florence (Italy); Blaich, T [Mainz Univ. (Germany); Buta, A; Legrand, I; Moisa, D; Petrovici, M; Simion, V [Institute for Physics and Nuclear Engineering, Bucharest (Romania); Cerruti, C; Coffin, J P; Fintz, P; Guillaume, G; Houari, O; Jundt, F; Kuhn, C; Maguire, C; Rami, F; Tezkratt, R; Wagner, P [Centre de Recherches Nucleaires, 67 - Strasbourg (France); [Strasbourg Univ., 67 (France); Eroe, J; Fodor, Z; Kecskemeti, J; Koncz, P; Seres, Z [Central Research Inst. for Physics, Budapest (Hungary); Grigoriyan, Y; Manko, V; Mgebrishvili, G; Sadchikov, A; Vasiliev, M A [Kurchatov Inst. for Atomic Energy, Moscow (Russia); Herrmann, N; Pelte, D; Trzaska, M; Wienold, T [Heidelberg Univ. (Germany). Physikalisches Inst.; Kotte, R; Moesner, J; Neubert, W; Wohlfarth, D [Forschungszentrum Rossendorf (Germany); Matulewicz, T; Sikora, B; Wilhelmi, Z [Warsaw Univ. (Poland). Inst. of Experimental Physics; Bock, R; Fan, Z G; Freifelder, R; Gobbi, A; Hildenbrand, K D; Jeong, S C; Kraemer, M; Reisdorf, W; Schuell, D; Sodan, U; Teh, K; Wessels, J P; FOPI Collaboration at GSI
1992-02-01
Charged particles have been observed in collisions of Au on Au at incident energy of 150 A MeV using a high-granularity detector system covering approximatley the forward hemisphere in the center-of-mass system. Highly central collisions have been studied using a double selection criterion which combines large charged particle multiplicities with small transverse momentum directivities. In this class of events about one quarter of the total nuclear charge emerges as intermediate mass fragments with nuclear charges Z>2. These fragments are centred at midrapidity and are produced with large transverse velocities. (orig.).
International Nuclear Information System (INIS)
Alard, J.P.; Bastid, N.; Crouau, M.; Dupieux, P.; Fraysse, L.; Jorio, M.; Montarou, G.; Morel, P.; Basrak, Z.; Caplar, R.; Cindro, N.; Hoelbling, S.; Belayev, I.M.; Frolov, S.; Korchagin, Y.; Lebedev, A.; Smolyankin, S.; Zhilin, A.V.; Bini, M.; Olmi, A.; Pasquali, G.; Poggi, G.; Taccetti, N.; Blaich, T.; Buta, A.; Legrand, I.; Moisa, D.; Petrovici, M.; Simion, V.; Cerruti, C.; Coffin, J.P.; Fintz, P.; Guillaume, G.; Houari, O.; Jundt, F.; Kuhn, C.; Maguire, C.; Rami, F.; Tezkratt, R.; Wagner, P.; Eroe, J.; Fodor, Z.; Kecskemeti, J.; Koncz, P.; Seres, Z.; Grigoriyan, Y.; Manko, V.; Mgebrishvili, G.; Sadchikov, A.; Vasiliev, M.A.; Herrmann, N.; Pelte, D.; Trzaska, M.; Wienold, T.; Matulewicz, T.; Sikora, B.; Wilhelmi, Z.; Bock, R.; Fan, Z.G.; Freifelder, R.; Gobbi, A.; Hildenbrand, K.D.; Jeong, S.C.; Kraemer, M.; Reisdorf, W.; Schuell, D.; Sodan, U.; Teh, K.; Wessels, J.P.
1992-02-01
Charged particles have been observed in collisions of Au on Au at incident energy of 150 A MeV using a high-granularity detector system covering approximatley the forward hemisphere in the center-of-mass system. Highly central collisions have been studied using a double selection criterion which combines large charged particle multiplicities with small transverse momentum directivities. In this class of events about one quarter of the total nuclear charge emerges as intermediate mass fragments with nuclear charges Z>2. These fragments are centred at midrapidity and are produced with large transverse velocities. (orig.)
Meta-analysis of the effects of forest fragmentation on interspecific interactions.
Magrach, Ainhoa; Laurance, William F; Larrinaga, Asier R; Santamaria, Luis
2014-10-01
Forest fragmentation dramatically alters species persistence and distribution and affects many ecological interactions among species. Recent studies suggest that mutualisms, such as pollination and seed dispersal, are more sensitive to the negative effects of forest fragmentation than antagonisms, such as predation or herbivory. We applied meta-analytical techniques to evaluate this hypothesis and quantified the relative contributions of different components of the fragmentation process (decreases in fragment size, edge effects, increased isolation, and habitat degradation) to the overall effect. The effects of fragmentation on mutualisms were primarily driven by habitat degradation, edge effects, and fragment isolation, and, as predicted, they were consistently more negative on mutualisms than on antagonisms. For the most studied interaction type, seed dispersal, only certain components of fragmentation had significant (edge effects) or marginally significant (fragment size) effects. Seed size modulated the effect of fragmentation: species with large seeds showed stronger negative impacts of fragmentation via reduced dispersal rates. Our results reveal that different components of the habitat fragmentation process have varying impacts on key mutualisms. We also conclude that antagonistic interactions have been understudied in fragmented landscapes, most of the research has concentrated on particular types of mutualistic interactions such as seed dispersal, and that available studies of interspecific interactions have a strong geographical bias (arising mostly from studies carried out in Brazil, Chile, and the United States). © 2014 Society for Conservation Biology.
Recombinant Kinase Production and Fragment Screening by NMR Spectroscopy.
Han, Byeonggu; Ahn, Hee-Chul
2016-01-01
During the past decade fragment-based drug discovery (FBDD) has rapidly evolved and several drugs or drug candidates developed by FBDD approach are clinically in use or in clinical trials. For example, vemurafenib, a V600E mutated BRAF inhibitor, was developed by utilizing FBDD approach and approved by FDA in 2011. In FBDD, screening of fragments is the starting step for identification of hits and lead generation. Fragment screening usually relies on biophysical techniques by which the protein-bound small molecules can be detected. NMR spectroscopy has been extensively used to study the molecular interaction between the protein and the ligand, and has many advantages in fragment screening over other biophysical techniques. This chapter describes the practical aspects of fragment screening by saturation transfer difference NMR.
Howland, Renata E; Angley, Meghan; Won, Sang Hee; Wilcox, Wendy; Searing, Hannah; Tsao, Tsu-Yu
2018-02-01
To quantify the average and total hospital delivery costs associated with severe maternal morbidity in excess of nonsevere maternal morbidity deliveries over a 5-year period in New York City adjusting for other sociodemographic and clinical factors. We conducted a population-based cross-sectional study using linked birth certificates and hospital discharge data for New York City deliveries from 2008 to 2012. Severe maternal morbidity was defined using a published algorithm of International Classification of Diseases, 9 Revision, Clinical Modification disease and procedure codes. Hospital costs were estimated by converting hospital charges using factors specific to each year and hospital and to each diagnosis. These estimates approximate what it costs the hospital to provide services (excluding professional fees) and were used in all subsequent analyses. To estimate adjusted mean costs associated with severe maternal morbidity, we used multivariable regression models with a log link, gamma distribution, robust standard errors, and hospital fixed effects, controlling for age, race and ethnicity, neighborhood poverty, primary payer, number of deliveries, method of delivery, comorbidities, and year. We used the adjusted mean cost to determine the average and total hospital delivery costs associated with severe maternal morbidity in excess of nonsevere maternal morbidity deliveries from 2008 to 2012. Approximately 2.3% (n=13,502) of all New York City delivery hospitalizations were complicated by severe maternal morbidity. Compared with nonsevere maternal morbidity deliveries, these hospitalizations were clinically complicated, required more and intensive clinical services, and had a longer stay in the hospital. The average cost of delivery with severe maternal morbidity was $14,442 (95% CI $14,128-14,756), compared with $7,289 (95% CI $7,276-7,302) among deliveries without severe maternal morbidity. After adjusting for other factors, the difference between deliveries
International Nuclear Information System (INIS)
Ethvignot, T.; Ajitanand, N.N.; Alexander, J.M.; Bauge, E.; Elmaani, A.; Kowalski, L.; Lopez, M.; Magda, M.T.; Desesquelles, P.; Elhage, H.; Giorni, A.; Heuer, D.; Kox, S.; Lleres, A.; Merchez, F.; Morand, C.; Rebreyend, D.; Stassi, P.; Viano, J.B.; Benrachi, F.; Chambon, B.; Cheynis, B.; Drain, D.; Pastor, C.
1992-01-01
In-plane and out-of-plane angular correlations have been measured between fragments of Z>3, Li fragments, 3,4 He, and 1,2,3 H. The changing patterns for 40 Ar induced reactions of 7A, 17A, 27A, and 34A MeV give an overview of the decreasing importance of mass-symmetric fissionlike reactions at the expense of a broad range of more mass-asymmetric breakups. Evidence is given that these fragments come from a central collision group of reactions that have similar violence and from which many combinations of fragments and particles are ejected. Very similar azimuthal angular correlations are observed for particles with a Li fragment and for particles with a pair of heavier fragments (Z>3). This similarity suggests comparable strengths of association with the reaction plane for single Li fragments and for fragment pairs of Z>3. Azimuthal angular correlations for Li-Li pairs exhibit distinct asymmetries; their interpretation via trajectory-model calculations indicates mean delay times of ∼5x10 -22 s
International Nuclear Information System (INIS)
Van Kempen, T. A.; Longmore, S. N.; Johnstone, D.; Pillai, T.; Fuente, A.
2012-01-01
Intermediate-mass (IM) protostars, the bridge between the very common solar-like protostars and the more massive, but rarer, O and B stars, can only be studied at high physical spatial resolutions in a handful of clouds. In this paper, we present and analyze the continuum results from an observing campaign at the Submillimeter Array (SMA) targeting two well-studied IM protostars in Orion, NGC 2071 and L1641 S3 MMS 1. The extended SMA (eSMA) probes structure at angular resolutions up to 0.''2, revealing protostellar disks on scales of ∼200 AU. Continuum flux measurements on these scales indicate that a significant amount of mass, a few tens of M ☉ , is present. Envelope, stellar, and disk masses are derived using compact, extended, and eSMA configurations and compared against spectral energy distribution fitting models. We hypothesize that fragmentation into three components occurred within NGC 2071 at an early time, when the envelopes were less than 10% of their current masses, e.g., ☉ . No fragmentation occurred for L1641 S3 MMS 1. For NGC 2071, evidence is given that the bulk of the envelope material currently around each source was accreted after the initial fragmentation. In addition, about 30% of the total core mass is not yet associated to one of the three sources. A global accretion model is favored and a potential accretion history of NGC 2071 is presented. It is shown that the relatively low level of fragmentation in NGC 2071 was stifled compared to the expected fragmentation from a Jeans argument. Similarly, the lack of fragmentation in L1641 S3 MMS 1 is likely due to similar arguments.
The comparison of deliveries in the center of Kahramanmaras in 2004 and 2006
Directory of Open Access Journals (Sweden)
Ayhan Coskun
2007-09-01
Full Text Available OBJECTIVE: To compare total delivery numbers and cesarean rates in Kahramanmaras city center during 2004 and 2006.\tDesign: Delivery records have been reviewed retrospectively.\tSetting: All hospitals in Kahramanmaras city center.\tPatients: Delivered pregnants. Interventions: None.\tMain Outcome Measures: Demographic characteritics, delivery routes of the pregnants and newborn birthweights. RESULTS: Cesarean section was performed in 3994 out of the 11611 deliveries (34.4 % in 2004 and 5573 out of the 13684 deliveries (40.2 % in 2006. There was an increase in both delivery number and cesarean rates in 2006 when compared with 2004. Delivery rates were increased from 10.3 % and 8.8 % in 2004 to 17.7 % and 12.9 % in 2006 for high risk groups like under 20 and above 35 year-old pregnants, respectively. Also, premature neonates below 2500 and macrosomic babies above 4000 g were increased in 2006 when compared with 2004. It may be thought that, an increase in delivery numbers, high risk pregnancies and cesarean rates could be inevitably cause a higher delivery complication ratios as years run.\tCONCLUSIONS: Obstetrician should be careful before a cesarean decision because previous cesarean is leading cesarean indication.
Resilient networks of ant-plant mutualists in Amazonian forest fragments.
Passmore, Heather A; Bruna, Emilio M; Heredia, Sylvia M; Vasconcelos, Heraldo L
2012-01-01
The organization of networks of interacting species, such as plants and animals engaged in mutualisms, strongly influences the ecology and evolution of partner communities. Habitat fragmentation is a globally pervasive form of spatial heterogeneity that could profoundly impact the structure of mutualist networks. This is particularly true for biodiversity-rich tropical ecosystems, where the majority of plant species depend on mutualisms with animals and it is thought that changes in the structure of mutualist networks could lead to cascades of extinctions. We evaluated effects of fragmentation on mutualistic networks by calculating metrics of network structure for ant-plant networks in continuous Amazonian forests with those in forest fragments. We hypothesized that networks in fragments would have fewer species and higher connectance, but equal nestedness and resilience compared to forest networks. Only one of the nine metrics we compared differed between continuous forest and forest fragments, indicating that networks were resistant to the biotic and abiotic changes that accompany fragmentation. This is partially the result of the loss of only specialist species with one connection that were lost in forest fragments. We found that the networks of ant-plant mutualists in twenty-five year old fragments are similar to those in continuous forest, suggesting these interactions are resistant to the detrimental changes associated with habitat fragmentation, at least in landscapes that are a mosaic of fragments, regenerating forests, and pastures. However, ant-plant mutualistic networks may have several properties that may promote their persistence in fragmented landscapes. Proactive identification of key mutualist partners may be necessary to focus conservation efforts on the interactions that insure the integrity of network structure and the ecosystems services networks provide.
Resilient networks of ant-plant mutualists in Amazonian forest fragments.
Directory of Open Access Journals (Sweden)
Heather A Passmore
Full Text Available The organization of networks of interacting species, such as plants and animals engaged in mutualisms, strongly influences the ecology and evolution of partner communities. Habitat fragmentation is a globally pervasive form of spatial heterogeneity that could profoundly impact the structure of mutualist networks. This is particularly true for biodiversity-rich tropical ecosystems, where the majority of plant species depend on mutualisms with animals and it is thought that changes in the structure of mutualist networks could lead to cascades of extinctions.We evaluated effects of fragmentation on mutualistic networks by calculating metrics of network structure for ant-plant networks in continuous Amazonian forests with those in forest fragments. We hypothesized that networks in fragments would have fewer species and higher connectance, but equal nestedness and resilience compared to forest networks. Only one of the nine metrics we compared differed between continuous forest and forest fragments, indicating that networks were resistant to the biotic and abiotic changes that accompany fragmentation. This is partially the result of the loss of only specialist species with one connection that were lost in forest fragments.We found that the networks of ant-plant mutualists in twenty-five year old fragments are similar to those in continuous forest, suggesting these interactions are resistant to the detrimental changes associated with habitat fragmentation, at least in landscapes that are a mosaic of fragments, regenerating forests, and pastures. However, ant-plant mutualistic networks may have several properties that may promote their persistence in fragmented landscapes. Proactive identification of key mutualist partners may be necessary to focus conservation efforts on the interactions that insure the integrity of network structure and the ecosystems services networks provide.
Increasing low birth weight rates: deliveries in a tertiary hospital in istanbul.
Akin, Yasemin; Cömert, Serdar; Turan, Cem; Unal, Orhan; Piçak, Abdülkadir; Ger, Lale; Telatar, Berrin
2010-09-01
Prevalence of low birth weight deliveries may vary across different environments. The necessity of determination of regional data prompted this study. Information of all deliveries from January 2004 to December 2008 was obtained from delivery registry records retrospectively. Initial data including birth weight, vital status, sex, maternal age and mode of delivery were recorded using medical files. The frequency of low birth weight, very low birth weight, extremely low birth weight and stillbirth deliveries were determined. Among 19,533 total births, there were 450 (23.04 per 1000) stillbirths. Low birth weight rate was 10.61%. A significant increase in yearly distribution of low birth weight deliveries was observed (Pbirth weight and extremely low birth weight delivery rates were 3.14% and 1.58% respectively. Among 2073 low birth weight infants, 333 (16.06%) were stillbirths. The stillbirth delivery rate and the birth of a female infant among low birth weight deliveries were significantly higher than infants with birth weight ≥2500g (Pbirth weight and maternal age. The rate of cesarean section among low birth weight infants was 49.4%. High low birth weight and stillbirth rates, as well as the increase in low birth weight deliveries over the past five years in this study are striking. For reduction of increased low birth weight rates, appropriate intervention methods should be initiated.
The free delivery and caesarean policy in Morocco: how much do households still pay?
Boukhalfa, C; Abouchadi, S; Cunden, N; Witter, S
2016-02-01
The Free Deliveries and Caesarean Policy (FDCP) entitles all women in Morocco to deliver free of charge within public hospitals. This study assesses the policy's effectiveness by analysing household expenditures related to childbirth, by delivery type and quintile. Structured exit survey of 973 women in six provinces at five provincial hospitals, two regional hospitals, two university hospitals and three primary health centres with maternity units. Households reported spending a median of US$ 59 in total for costs inside and outside of hospitals. Women requiring caesareans payed more than women with uncomplicated deliveries (P < 0.0001). The median cost was US$45 for a uncomplicated delivery, US$50 for a complicated delivery and US$65 for a caesarean section. The prescription given upon exiting the hospital comprised 62% of the total costs. Eighty-eight per cent of women from the poorest quintiles faced catastrophic expenditures. The women's perception of their hospital stay and the FDCP policy was overwhelmingly positive, but differences were noted at the various sites. The policy has been largely but not fully effective in removing financial barriers for delivery care in Morocco. More progress should also be made on increasing awareness of the policy and on easing the financial burden, which is still borne by households with lower incomes. © 2015 John Wiley & Sons Ltd.
Sub-fragmentation of structural-reactive-material casings under explosion
Zhang, Fan
2015-06-01
The sub-fragmentation of structural reactive material (SRM) thick-casings is to generate fine fragments during casing fragmentation under explosive loading for their efficient energy release to enhance air blast. This has been investigated using a cylindrical casing made from either rich Al-MoO3 or Al-W-based granular composites. The former composite was to study the concept of reactive hot spots where the reaction of reactive particles, which were distributed into base SRM in a fuel-rich equivalence ratio, created heat and gas products during SRM fragmentation. The expansion of these distributed hot spots initiated local fractures of the casing, leading to fine fragments. The Al-W-based composite investigated the concept of impedance mismatch, where shock dynamics at the interfaces of different impedance ingredients resulted in non-uniform, high local temperatures and stresses and late in times the dissimilar inertia resulted in different accelerations, leading to material separation and fine fragments. The casings were manufactured through both hot iso-static pressing and cold gas dynamic spray deposition. Explosion experiments were conducted in a 3 m diameter, 23 m3 cylindrical chamber for these cased charges in a casing-to-explosive mass ratio of 1.75. The results demonstrated the presence of fine fragments and more efficient fragment combustion, compared with previous results, and indicated the effectiveness of both concepts. This work was jointly funded by Defence R&D Canada and the Advanced Energetics Program of DTRA (Dr. William H. Wilson).
Simulation of natural fragmentation of rings cut from warheads
Directory of Open Access Journals (Sweden)
John F. Moxnes
2015-12-01
Full Text Available Natural fragmentation of warheads that detonates causes the casing of the warhead to split into various sized fragments through shear or radial fractures depending on the toughness, density, and grain size of the material. The best known formula for the prediction of the size distribution is the Mott formulae, which is further examined by Grady and Kipp by investigating more carefully the statistical most random way of portioning a given area into a number of entities. We examine the fragmentation behavior of radially expanding steel rings cut from a 25 mm warhead by using an in house smooth particle hydrodynamic (SPH simulation code called REGULUS. Experimental results were compared with numerical results applying varying particle size and stochastic fracture strain. The numerically obtained number of fragments was consistent with experimental results. Increasing expansion velocity of the rings increases the number of fragments. Statistical variation of the material parameters influences the fragment characteristics, especially for low expansion velocities. A least square regression fit to the cumulative number of fragments by applying a generalized Mott distribution shows that the shape parameter is around 4 for the rings, which is in contrast to the Mott distribution with a shape parameter of ½. For initially polar distributed particles, we see signs of a bimodal cumulative fragment distribution. Adding statistical variation in material parameters of the fracture model causes the velocity numerical solutions to become less sensitive to changes in resolution for Cartesian distributed particles.
Studies of complex fragment emission in heavy ion reactions
International Nuclear Information System (INIS)
Sobotka, L.G.
1989-01-01
The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report
Kowalski, Piotr; Kasina, Monika; Michalik, Marek
2017-04-01
70%, 15% and 5% of the total amount of fragments. Fe occurred mainly as component of metallic inclusions and separate grains. Al was mostly present in metallic fragments on grains boundaries and also and as separate grains (often oxidised), moreover Al was important component of aluminosilicates and amorphous phase. Zn-rich metallic fragments were mostly in the form of separate grains. In complex composition of metallic fragments some regularities in elements co-occurrences were observed: Fe often co-existed with Si, Ca, P, Al and Ti; Al co-occurred with Fe, Si and Ca; Zn co-existed with Ca, Al and Si. Forms and composition of metallic fragments allows to evaluate them as potential polymetallic resource, however an economically reasonable extraction techniques must be applied. Acknowledgment Research was funded by Polish National Science Centre (NCN). Scientific grant No. UMO-2014/15/B/ST10/04171. Reference Kowalski, P.R., Kasina, M. and Michalik M.: Metallic elements fractionation in municipal solid waste incineration residues, Energy Procedia, 97, 31-36, doi: 10.1016/j.egypro.2016.10.013, 2016.
Efficiency performance of China's health care delivery system.
Zhang, Luyu; Cheng, Gang; Song, Suhang; Yuan, Beibei; Zhu, Weiming; He, Li; Ma, Xiaochen; Meng, Qingyue
2017-07-01
Improving efficiency performance of the health care delivery system has been on the agenda for the health system reform that China initiated in 2009. This study examines the changes in efficiency performance and determinants of efficiency after the reform to provide evidence to assess the progress of the reform from the perspective of efficiency. Descriptive analysis, Data Envelopment Analysis, the Malmquist Index, and multilevel regressions are used with data from multiple sources, including the World Bank, the China Health Statistical Yearbook, and routine reports. The results indicate that over the last decade, health outcomes compared with health investment were relatively higher in China than in most other countries worldwide, and the trend was stable. The overall efficiency and total factor productivity increased after the reform, indicating that the reform was likely to have had a positive impact on the efficiency performance of the health care delivery system. However, the health care delivery structure showed low system efficiency, mainly attributed to the weakened primary health care system. Strengthening the primary health care system is central to enhancing the future performance of China's health care delivery system. Copyright © 2017 John Wiley & Sons, Ltd.