CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.
Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W
2018-04-01
CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.
Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.
Abou Asa, S
2017-07-01
MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.
CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.
Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco
2016-10-01
Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.
Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae
2016-04-01
Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required
CD146/MCAM defines functionality of human bone marrow stromal stem cell populations
DEFF Research Database (Denmark)
Harkness, Linda; Zaher, Walid; Ditzel, Nicholas
2016-01-01
BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...
Directory of Open Access Journals (Sweden)
Dimitrios Kouroupis
2014-08-01
Full Text Available Adult stem cells are characterised by longer telomeres compared to mature cells from the same tissue. In this study, candidate CD146+ umbilical cord (UC mesenchymal stem cells (MSCs were purified by cell sorting from UC tissue digests and their telomere lengths were measured in comparison to donor-matched CD146-negative fraction. UC tissue fragments were enzymatically treated with collagenase and the cells were used for cell sorting, colony-forming fibroblast (CFU-F assay or for long-term MSC cultivation. Telomere lengths were measured by qPCR in both culture-expanded MSCs and candidate native UC MSCs. Immunohistochemistry was undertaken to study the topography of CD146+ cells. Culture-expanded UC MSCs had a stable expression of CD73, CD90 and CD105, whereas CD146 declined in later passages which correlated with the shortening of telomeres in the same cultures. In five out of seven donors, telomeres in candidate native UC MSCs (CD45-CD235α-CD31-CD146+ were longer compared to donor-matched CD146- population (CD45-CD235α-CD31-CD146-. The frequency of CD45-CD235α-CD31-CD146+ cells measured by flow cytometry was ~1000-fold above that of CFU-Fs (means 10.4% and 0.01%, respectively. CD146+ cells were also abundant in situ having a broad topography including high levels of positivity in muscle areas in addition to vessels. Although qPCR-based telomere length analysis in sorted populations could be limited in its sensitivity, very high frequency of CD146+ cells in UC tissue suggests that CD146 expression alone is unlikely to be sufficient to identify and purify native MSCs from the UC tissue.
Energy Technology Data Exchange (ETDEWEB)
Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)
2016-11-15
Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146
Nozaki, Toshiko; Takahashi, Kyoko; Ishii, Osamu; Endo, Sachio; Hioki, Kyoji; Mori, Toshihito; Kikukawa, Tadahiro; Boumpas, Dimitrios T; Ozaki, Shoichi; Yamada, Hidehiro
2007-09-01
To establish an ex vivo cellular model of pannus, the aberrant overgrowth of human synovial tissue (ST). Inflammatory cells that infiltrated pannus tissue from patients with rheumatoid arthritis (RA) were collected without enzyme digestion, and designated as ST-derived inflammatory cells. Single-cell suspensions of ST-derived inflammatory cells were cultured in medium alone. Levels of cytokines produced in culture supernatants were measured using enzyme-linked immunosorbent assay kits. ST-derived inflammatory cells were transferred into the joints of immunodeficient mice to explore whether these cells could develop pannus. CD14 and CD2 cells were depleted by negative selection. Culture of ST-derived inflammatory cells from 92 of 111 patients with RA resulted in spontaneous reconstruction of inflammatory tissue in vitro within 4 weeks. Ex vivo tissue contained fibroblasts, macrophages, T cells, and tartrate-resistant acid phosphatase-positive multinucleated cells. On calcium phosphate-coated slides, ST-derived inflammatory cell cultures showed numerous resorption pits. ST-derived inflammatory cell cultures continuously produced matrix metalloproteinase 9 and proinflammatory cytokines associated with osteoclastogenesis, such as tumor necrosis factor alpha, interleukin-8, and macrophage colony-stimulating factor. More importantly, transferring ST-derived inflammatory cells into the joints of immunodeficient mice resulted in the development of pannus tissue and erosive joint lesions. Both in vitro development and in vivo development of pannus tissue by ST-derived inflammatory cells were inhibited by depleting CD14-positive, but not CD2-positive, cells from ST-derived inflammatory cells. These findings suggest that overgrowth of inflammatory cells from human rheumatoid synovium simulates the development of pannus. This may prove informative in the screening of potential antirheumatic drugs.
CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.
Directory of Open Access Journals (Sweden)
Mineo Iwata
Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.
Directory of Open Access Journals (Sweden)
Rebecca C. Schugar
2009-01-01
Full Text Available Human umbilical cord blood is an excellent primitive source of noncontroversial stem cells for treatment of hematologic disorders; meanwhile, new stem cell candidates in the umbilical cord (UC tissue could provide therapeutic cells for nonhematologic disorders. We show novel in situ characterization to identify and localize a panel of some markers expressed by mesenchymal stromal cells (MSCs; CD44, CD105, CD73, CD90 and CD146 in the UC. We describe enzymatic isolation and purification methods of different UC cell populations that do not require manual separation of the vessels and stroma of the coiled, helical-like UC tissue. Unique quantitation of in situ cell frequency and stromal cell counts upon harvest illustrate the potential to obtain high numerical yields with these methods. UC stromal cells can differentiate to the osteogenic and chondrogenic lineages and, under specific culturing conditions, they exhibit high expandability with unique long-term stability of their phenotype. The remarkable stability of the phenotype represents a novel finding for human MSCs, from any source, and supports the use of these cells as highly accessible stromal cells for both basic studies and potentially therapeutic applications such as allogeneic clinical use for musculoskeletal disorders.
Kilinc, Mehmet Okyay; Santidrian, Antonio; Minev, Ivelina; Toth, Robert; Draganov, Dobrin; Nguyen, Duong; Lander, Elliot; Berman, Mark; Minev, Boris; Szalay, Aladar A
2018-02-07
Stromal vascular fraction (SVF) represents an attractive source of adult stem cells and progenitors, holding great promise for numerous cell therapy approaches. In 2017, it was reported that 1524 patients received autologous SVF following the enzymatic digestion of liposuction fat. The treatment was safe and effective and patients showed significant clinical improvement. In a collaborative study, we analyzed SVF obtained from 58 patients having degenerative, inflammatory, autoimmune diseases, and advanced stage cancer. Flow analysis showed that freshly isolated SVF was very heterogeneous and harbored four major subsets specific to adipose tissue; CD34 high CD45 - CD31 - CD146 - adipose-derived stromal/stem cells (ADSCs), CD34 low CD45 + CD206 + CD31 - CD146 - hematopoietic stem cell-progenitors (HSC-progenitors), CD34 high CD45 - CD31 + CD146 + adipose tissue-endothelial cells and CD45 - CD34 - CD31 - CD146 + pericytes. Culturing and expanding of SVF revealed a homogenous population lacking hematopoietic lineage markers CD45 and CD34, but were positive for CD90, CD73, CD105, and CD44. Flow cytometry sorting of viable individual subpopulations revealed that ADSCs had the capacity to grow in adherent culture. The identity of the expanded cells as mesenchymal stem cells (MSCs) was further confirmed based on their differentiation into adipogenic and osteogenic lineages. To identify the potential factors, which may determine the beneficial outcome of treatment, we followed 44 patients post-SVF treatment. The gender, age, clinical condition, certain SVF-dose and route of injection, did not play a role on the clinical outcome. Interestingly, SVF yield seemed to be affected by patient's characteristic to various extents. Furthermore, the therapy with adipose-derived and expanded-mesenchymal stem cells (ADE-MSCs) on a limited number of patients, did not suggest increased efficacies compared to SVF treatment. Therefore, we tested the hypothesis that a certain combination
Directory of Open Access Journals (Sweden)
Sylvie Bouvier
Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in
Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha
2011-01-01
Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267
The effect of stem cell factor on proliferation of human endometrial CD146+ cells
Directory of Open Access Journals (Sweden)
Mehri Fayazi
2016-07-01
Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies
Malara, N.M.
2015-03-01
Aim: Consistent expansion of primary human endothelial cells in vitro is critical in the development of engineered tissue. A variety of complex culture media and techniques developed from different basal media have been reported with alternate success. Incongruous results are further confounded by donor-to-donor variability and cellular source of derivation. Our results demonstrate how to overcome these limitations using soluble CD54 (sCD54) as additive to conventional culture medium. Methods and results: Isolated primary fragment of different vessel types was expanded in Ham\\'s F12 DMEM, enriched with growth factors, Fetal Calf Serum and conditioned medium of Human Umbilical Vein Endothelial Cells (HUVEC) collected at different passages. Cytokine content of culture media was analyzed in order to identify the soluble factors correlating with better proliferation profile. sCD54 was found to induce the in vitro expansion of human endothelial cells (HECs) independently from the vessels source and even in the absence of HUVEC-conditioned medium. The HECs cultivated in the presence of sCD54 (50 ng/ml), resulted positive for the expression of CD146 and negative for CD45, and lower fibroblast contamination. Cells were capable to proliferate with an S phase of 25%, to produce vascular endothelial growth factor, VEGF, (10 ng/ml) and to give origin to vessel-like tubule in vitro. Conclusion: Our results demonstrate that sCD54 is an essential factor for the in-vitro expansion of HECs without donor and vessel-source variability. Resulting primary cultures can be useful, for tissue engineering in regenerative medicine (e.g. artificial micro tissue generation, coating artificial heart valve etc.) and bio-nanotechnology applications. © 2015 The Authors. Published by Elsevier Ireland Ltd.
Directory of Open Access Journals (Sweden)
Wing Pui Tsang
Full Text Available The human umbilical cord perivascular cells (HUCPVCs have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+ pericyte marker. The purified CD146(+ HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+ HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+ HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+ HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+ HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+ HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness
Qadan, Maha A; Piuzzi, Nicolas S; Boehm, Cynthia; Bova, Wesley; Moos, Malcolm; Midura, Ronald J; Hascall, Vincent C; Malcuit, Christopher; Muschler, George F
2018-03-01
Connective tissue progenitors (CTPs) embody the heterogeneous stem and progenitor cell populations present in native tissue. CTPs are essential to the formation and remodeling of connective tissue and represent key targets for tissue-engineering and cell-based therapies. To better understand and characterize CTPs, we aimed to compare the (i) concentration and prevalence, (ii) early in vitro biological behavior and (iii) expression of surface-markers and transcription factors among cells derived from marrow space (MS), trabecular surface (TS), and adipose tissues (AT). Cancellous-bone and subcutaneous-adipose tissues were collected from 8 patients. Cells were isolated and cultured. Colony formation was assayed using Colonyze software based on ASTM standards. Cell concentration ([Cell]), CTP concentration ([CTP]) and CTP prevalence (P CTP ) were determined. Attributes of culture-expanded cells were compared based on (i) effective proliferation rate and (ii) expression of surface-markers CD73, CD90, CD105, SSEA-4, SSEA-3, SSEA-1/CD15, Cripto-1, E-Cadherin/CD324, Ep-CAM/CD326, CD146, hyaluronan and transcription factors Oct3/4, Sox-2 and Nanog using flow cytometry. Mean [Cell], [CTP] and P CTP were significantly different between MS and TS samples (P = 0.03, P = 0.008 and P= 0.0003), respectively. AT-derived cells generated the highest mean total cell yield at day 6 of culture-4-fold greater than TS and more than 40-fold greater than MS per million cells plated. TS colonies grew with higher mean density than MS colonies (290 ± 11 versus 150 ± 11 cell per mm 2 ; P = 0.0002). Expression of classical-mesenchymal stromal cell (MSC) markers was consistently recorded (>95%) from all tissue sources, whereas all the other markers were highly variable. The prevalence and biological potential of CTPs are different between patients and tissue sources and lack variation in classical MSC markers. Other markers are more likely to discriminate differences
Directory of Open Access Journals (Sweden)
Yong-lin XIE
2014-10-01
Full Text Available Adipose tissue-derived stem cells (ADSCs are genetically engineered seed cells with immunomodulatory effects, widely used in the treatment of autoimmune diseases. This article focuses on the immunomodulatory effects of adipose tissue-derived stem cells on CD4+ T cell subsets, including T helper cell (Th 1, 2, 17 and regulatory T cell (Treg, and its clinical significance in the treatment of multiple sclerosis. doi: 10.3969/j.issn.1672-6731.2014.10.005
CD90 (Thy-1)-positive selection enhances osteogenic capacity of human adipose-derived stromal cells.
Chung, Michael T; Liu, Chunjun; Hyun, Jeong S; Lo, David D; Montoro, Daniel T; Hasegawa, Masakazu; Li, Shuli; Sorkin, Michael; Rennert, Robert; Keeney, Michael; Yang, Fan; Quarto, Natalina; Longaker, Michael T; Wan, Derrick C
2013-04-01
Stem cell-based bone tissue engineering with adipose-derived stromal cells (ASCs) has shown great promise for revolutionizing treatment of large bone deficits. However, there is still a lack of consensus on cell surface markers identifying osteoprogenitors. Fluorescence-activated cell sorting has identified a subpopulation of CD105(low) cells with enhanced osteogenic differentiation. The purpose of the present study was to compare the ability of CD90 (Thy-1) to identify osteoprogenitors relative to CD(105). Unsorted cells, CD90(+), CD90(-), CD105(high), and CD105(low) cells were treated with an osteogenic differentiation medium. For evaluation of in vitro osteogenesis, alkaline phosphatase (ALP) staining and alizarin red staining were performed at 7 days and 14 days, respectively. RNA was harvested after 7 and 14 days of differentiation, and osteogenic gene expression was examined by quantitative real-time polymerase chain reaction. For evaluation of in vivo osteogenesis, critical-sized (4-mm) calvarial defects in nude mice were treated with the hydroxyapatite-poly(lactic-co-glycolic acid) scaffold seeded with the above-mentioned subpopulations. Healing was followed using micro-CT scans for 8 weeks. Calvaria were harvested at 8 weeks postoperatively, and sections were stained with Movat's Pentachrome. Transcriptional analysis revealed that the CD90(+) subpopulation was enriched for a more osteogenic subtype relative to the CD105(low) subpopulation. Staining at day 7 for ALP was greatest in the CD90(+) cells, followed by the CD105(low) cells. Staining at day 14 for alizarin red demonstrated the greatest amount of mineralized extracellular matrix in the CD90(+) cells, again followed by the CD105(low) cells. Quantification of in vivo healing at 2, 4, 6, and 8weeks postoperatively demonstrated increased bone formation in defects treated with CD90(+) ASCs relative to all other groups. On Movat's Pentachrome-stained sections, defects treated with CD90(+) cells showed the
Directory of Open Access Journals (Sweden)
David C. Moylan
2017-01-01
Full Text Available Background:Tissue resident memory T cells (TrM provide an enhanced response against infection at mucosal surfaces, yet their function has not been extensively studied in humans, including the female genital tract (FGT. Methods: Using polychromatic flow cytometry, we studied TrM cells, defined as CD62L-CCR7-CD103+CD69+ CD4+ and CD8+ T cells in mucosa-derived T cells from healthy and HIV-positive women. Results: We demonstrate that TrM are present in the FGT of healthy and HIV-positive women. The expression of the mucosal retention receptor, CD103, from HIV-positive women was reduced compared to healthy women and was lowest in women with CD4 counts < 500 cells/mm3. Furthermore, CD103 expression on mucosa-derived CD8+ T cells correlated with antigen-specific IFN-γ production by mucosal CD4+ T cells and was inversely correlated with T-bet from CD8+CD103+ mucosa-derived T cells. Conclusions: These data suggest that CD4+ T cells, known to be impaired during HIV-1 infection and necessary for the expression of CD103 in murine models, may play a role in the expression of CD103 on resident T cells from the human FGT.
Tissue-Resident Memory CD8+ T Cells: From Phenotype to Function
Directory of Open Access Journals (Sweden)
David J. Topham
2018-03-01
Full Text Available Tissue-resident memory CD8+ T cells are an important first line of defense from infection in peripheral non-lymphoid tissues, such as the mucosal tissues of the respiratory, digestive, and urogenital tracts. This memory T cell subset is established late during resolution of primary infection of those tissues, has a distinct genetic signature, and is often defined by the cell surface expression of CD69, CD103, CD49a, and CD44 in both mouse and human studies. The stimuli that program or imprint the unique gene expression and cell surface phenotypes on TRM are beginning to be defined, but much work remains to be done. It is not clear, for example, when and where the TRM precursors receive these signals, and there is evidence that supports imprinting in both the lymph node and the peripheral tissue sites. In most studies, expression of CD49a, CD103, and CD69 on T cells in the tissues appears relatively late in the response, suggesting there are precise environmental cues that are not present at the height of the acute response. CD49a and CD103 are not merely biomarkers of TRM, they confer substrate specificities for cell adhesion to collagen and E-cadherin, respectively. Yet, little attention has been paid to how expression affects the positioning of TRM in the peripheral tissues. CD103 and CD49a are not mutually exclusive, and not always co-expressed, although whether they can compensate for one another is unknown. In fact, they may define different subsets of TRM in certain tissues. For instance, while CD49a+CD8+ memory T cells can be found in almost all peripheral tissues, CD103 appears to be more restricted. In this review, we discuss the evidence for how these hallmarks of TRM affect positioning of T cells in peripheral sites, how CD49a and CD103 differ in expression and function, and why they are important for immune protection conferred by TRM in mucosal tissues such as the respiratory tract.
Directory of Open Access Journals (Sweden)
Vishnubalaji Radhakrishnan
2012-01-01
Full Text Available Abstract Background Multipotent stem cells have been successfully isolated from various tissues and are currently utilized for tissue-engineering and cell-based therapies. Among the many sources, skin has recently emerged as an attractive source for multipotent cells because of its abundance. Recent literature showed that skin stromal cells (SSCs possess mesoderm lineage differentiation potential; however, the endothelial differentiation and angiogenic potential of SSC remains elusive. In our study, SSCs were isolated from human neonatal foreskin (hNFSSCs and adult dermal skin (hADSSCs using explants cultures and were compared with bone marrow (hMSC-TERT and adipose tissue-derived mesenchymal stem cells (hADMSCs for their potential differentiation into osteoblasts, adipocytes, and endothelial cells. Results Concordant with previous studies, both MSCs and SSCs showed similar morphology, surface protein expression, and were able to differentiate into osteoblasts and adipocytes. Using an endothelial induction culture system combined with an in vitro matrigel angiogenesis assay, hNFSSCs and hADSSCs exhibited the highest tube-forming capability, which was similar to those formed by human umbilical vein endothelial cells (HUVEC, with hNFSSCs forming the most tightly packed, longest, and largest diameter tubules among the three cell types. CD146 was highly expressed on hNFSSCs and HUVEC followed by hADSSCs, and hMSC-TERT, while its expression was almost absent on hADMSCs. Similarly, higher vascular density (based on the expression of CD31, CD34, vWF, CD146 and SMA was observed in neonatal skin, followed by adult dermal skin and adipose tissue. Thus, our preliminary data indicated a plausible relationship between vascular densities, and the expression of CD146 on multipotent cells derived from those tissues. Conclusions Our data is the first to demonstrate that human dermal skin stromal cells can be differentiated into endothelial lineage. Hence, SSCs
International Nuclear Information System (INIS)
Qi Jun; Chen Anmin; You Hongbo; Li Kunpeng; Zhang Di; Guo Fengjing
2011-01-01
Stem cell-based tissue engineering has provided an alternative strategy to treat cartilage lesions, and synovium-derived mesenchymal stem cells (SMSCs) are considered as a promising cell source for cartilage repair. In this study, the SMSCs were isolated from rat synovium, and CD105-positive (CD105 + ) cells were enriched using magnetic activated cell sorting. Sorted cells were subsequently seeded onto the chitosan-alginate composite three-dimensional (3D) porous scaffolds and cultured in chondrogenic culture medium in the presence of TGF-β 3 and BMP-2 for 2 weeks in vitro. After 2 weeks in culture, scanning electron microscopy results showed that cells attached and proliferated well on scaffolds, and secreted extracellular matrix were also observed. From day 7 to day 14, the total DNA and glucosaminoglycan content of the cells cultured in scaffolds were found to have increased significantly, and cell cycle analyses revealed that the percentage of cells in the S and G2/M phases increased and the percentage of cells in the G0/G1 phase decreased. Compared with non-sorted cells, the sorted cells cultured in scaffolds underwent more chondrogenic differentiation, as evidenced by higher expression of type II collagen and Sox9 at the protein and mRNA levels. The results suggest that CD105 + enriched SMSCs may be a potential cell source for cartilage tissue engineering, and the chitosan-alginate composite 3D porous scaffold could provide a favorable microenvironment for supporting proliferation and chondrogenic differentiation of cells.
Mangum, Lauren H.; Stone, Randolph; Wrice, Nicole L.; Larson, David A.; Florell, Kyle F.; Christy, Barbara A.; Herzig, Maryanne C.; Cap, Andrew P.
2017-01-01
Stem cells derived from the subcutaneous adipose tissue of debrided burned skin represent an appealing source of adipose-derived stem cells (ASCs) for regenerative medicine. Traditional tissue culture uses fetal bovine serum (FBS), which complicates utilization of ASCs in human medicine. Human platelet lysate (hPL) is one potential xeno-free, alternative supplement for use in ASC culture. In this study, adipogenic and osteogenic differentiation in media supplemented with 10% FBS or 10% hPL was compared in human ASCs derived from abdominoplasty (HAP) or from adipose associated with debrided burned skin (BH). Most (95–99%) cells cultured in FBS were stained positive for CD73, CD90, CD105, and CD142. FBS supplementation was associated with increased triglyceride content and expression of adipogenic genes. Culture in hPL significantly decreased surface staining of CD105 by 31% and 48% and CD142 by 27% and 35% in HAP and BH, respectively (p < 0.05). Culture of BH-ASCs in hPL also increased expression of markers of osteogenesis and increased ALP activity. These data indicate that application of ASCs for wound healing may be influenced by ASC source as well as culture conditions used to expand them. As such, these factors must be taken into consideration before ASCs are used for regenerative purposes. PMID:29138638
Directory of Open Access Journals (Sweden)
Lauren H. Mangum
2017-01-01
Full Text Available Stem cells derived from the subcutaneous adipose tissue of debrided burned skin represent an appealing source of adipose-derived stem cells (ASCs for regenerative medicine. Traditional tissue culture uses fetal bovine serum (FBS, which complicates utilization of ASCs in human medicine. Human platelet lysate (hPL is one potential xeno-free, alternative supplement for use in ASC culture. In this study, adipogenic and osteogenic differentiation in media supplemented with 10% FBS or 10% hPL was compared in human ASCs derived from abdominoplasty (HAP or from adipose associated with debrided burned skin (BH. Most (95–99% cells cultured in FBS were stained positive for CD73, CD90, CD105, and CD142. FBS supplementation was associated with increased triglyceride content and expression of adipogenic genes. Culture in hPL significantly decreased surface staining of CD105 by 31% and 48% and CD142 by 27% and 35% in HAP and BH, respectively (p<0.05. Culture of BH-ASCs in hPL also increased expression of markers of osteogenesis and increased ALP activity. These data indicate that application of ASCs for wound healing may be influenced by ASC source as well as culture conditions used to expand them. As such, these factors must be taken into consideration before ASCs are used for regenerative purposes.
CD13-positive bone marrow-derived myeloid cells promote angiogenesis, tumor growth, and metastasis.
Dondossola, Eleonora; Rangel, Roberto; Guzman-Rojas, Liliana; Barbu, Elena M; Hosoya, Hitomi; St John, Lisa S; Molldrem, Jeffrey J; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata
2013-12-17
Angiogenesis is fundamental to tumorigenesis and an attractive target for therapeutic intervention against cancer. We have recently demonstrated that CD13 (aminopeptidase N) expressed by nonmalignant host cells of unspecified types regulate tumor blood vessel development. Here, we compare CD13 wild-type and null bone marrow-transplanted tumor-bearing mice to show that host CD13(+) bone marrow-derived cells promote cancer progression via their effect on angiogenesis. Furthermore, we have identified CD11b(+)CD13(+) myeloid cells as the immune subpopulation directly regulating tumor blood vessel development. Finally, we show that these cells are specifically localized within the tumor microenvironment and produce proangiogenic soluble factors. Thus, CD11b(+)CD13(+) myeloid cells constitute a population of bone marrow-derived cells that promote tumor progression and metastasis and are potential candidates for the development of targeted antiangiogenic drugs.
Energy Technology Data Exchange (ETDEWEB)
Qi Jun; Chen Anmin; You Hongbo; Li Kunpeng; Zhang Di; Guo Fengjing, E-mail: fjguo@tjh.tjmu.edu.cn [Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030 (China)
2011-02-15
Stem cell-based tissue engineering has provided an alternative strategy to treat cartilage lesions, and synovium-derived mesenchymal stem cells (SMSCs) are considered as a promising cell source for cartilage repair. In this study, the SMSCs were isolated from rat synovium, and CD105-positive (CD105{sup +}) cells were enriched using magnetic activated cell sorting. Sorted cells were subsequently seeded onto the chitosan-alginate composite three-dimensional (3D) porous scaffolds and cultured in chondrogenic culture medium in the presence of TGF-{beta}{sub 3} and BMP-2 for 2 weeks in vitro. After 2 weeks in culture, scanning electron microscopy results showed that cells attached and proliferated well on scaffolds, and secreted extracellular matrix were also observed. From day 7 to day 14, the total DNA and glucosaminoglycan content of the cells cultured in scaffolds were found to have increased significantly, and cell cycle analyses revealed that the percentage of cells in the S and G2/M phases increased and the percentage of cells in the G0/G1 phase decreased. Compared with non-sorted cells, the sorted cells cultured in scaffolds underwent more chondrogenic differentiation, as evidenced by higher expression of type II collagen and Sox9 at the protein and mRNA levels. The results suggest that CD105{sup +} enriched SMSCs may be a potential cell source for cartilage tissue engineering, and the chitosan-alginate composite 3D porous scaffold could provide a favorable microenvironment for supporting proliferation and chondrogenic differentiation of cells.
Burn-injury affects gut-associated lymphoid tissues derived CD4+ T cells.
Fazal, Nadeem; Shelip, Alla; Alzahrani, Alhusain J
2013-01-01
After scald burn-injury, the intestinal immune system responds to maintain immune balance. In this regard CD4+T cells in Gut-Associated Lymphoid Tissues (GALT), like mesenteric lymph nodes (MLN) and Peyer's patches (PP) respond to avoid immune suppression following major injury such as burn. Therefore, we hypothesized that the gut CD4+T cells become dysfunctional and turn the immune homeostasis towards depression of CD4+ T cell-mediated adaptive immune responses. In the current study we show down regulation of mucosal CD4+ T cell proliferation, IL-2 production and cell surface marker expression of mucosal CD4+ T cells moving towards suppressive-type. Acute burn-injury lead to up-regulation of regulatory marker (CD25+), down regulation of adhesion (CD62L, CD11a) and homing receptor (CD49d) expression, and up-regulation of negative co-stimulatory (CTLA-4) molecule. Moreover, CD4+CD25+ T cells of intestinal origin showed resistance to spontaneous as well as induced apoptosis that may contribute to suppression of effector CD4+ T cells. Furthermore, gut CD4+CD25+ T cells obtained from burn-injured animals were able to down-regulate naïve CD4+ T cell proliferation following adoptive transfer of burn-injured CD4+CD25+ T cells into sham control animals, without any significant effect on cell surface activation markers. Together, these data demonstrate that the intestinal CD4+ T cells evolve a strategy to promote suppressive CD4+ T cell effector responses, as evidenced by enhanced CD4+CD25+ T cells, up-regulated CTLA-4 expression, reduced IL-2 production, tendency towards diminished apoptosis of suppressive CD4+ T cells, and thus lose their natural ability to regulate immune homeostasis following acute burn-injury and prevent immune paralysis.
Analysis of CD83 antigen expression in human breast fibroadenoma and adjacent tissue
Directory of Open Access Journals (Sweden)
Marcus Nascimento Borges
Full Text Available CONTEXT AND OBJECTIVE: Dendritic cell maturation is considered essential for starting an immune response. The CD83 antigen is an important marker of dendritic cell maturation. The objectives here were to analyze CD83 antigen expression in human breast fibroadenoma and breast tissue adjacent to the lesion and to identify clinical factors that might influence this expression. DESIGN AND SETTING: This was a retrospective study at a public university hospital, in which 29 histopathological samples of breast fibroadenoma and adjacent breast tissue, from 28 women of reproductive age, were analyzed. METHODS: The immunohistochemistry method was used to analyze the cell expression of the antigen. The antigen expression in the cells was evaluated by means of random manual counting using an optical microscope. RESULTS: Positive expression of the CD83 antigen in the epithelial cells of the fibroadenoma (365.52; standard deviation ± 133.13 in relation to the adjacent breast tissue cells (189.59; standard deviation ± 140.75 was statistically larger (P < 0.001. Several clinical features were analyzed, but only parity was shown to influence CD83 antigen expression in the adjacent breast tissue, such that positive expression was more evident in nulliparous women (P = 0.042. CONCLUSIONS: The expression of the CD83 antigen in the fibroadenoma was positive and greater than in the adjacent breast tissue. Positive expression of the antigen in the adjacent breast tissue was influenced by parity, and was significantly more evident in nulliparous women.
Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer
Directory of Open Access Journals (Sweden)
Wang P
2015-01-01
Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle
Day, Yuan-Ji; Huang, Liping; Ye, Hong; Li, Li; Linden, Joel; Okusa, Mark D
2006-03-01
A(2A) adenosine receptor (A(2A)R)-expressing bone marrow (BM)-derived cells contribute to the renal protective effect of A(2A) agonists in renal ischemia-reperfusion injury (IRI). We performed IRI in mice lacking T and B cells to determine whether A(2A)R expressed in CD4+ cells mediate protection from IRI. Rag-1 knockout (KO) mice were protected in comparison to wild-type (WT) mice when subjected to IRI. ATL146e, a selective A(2A) agonist, did not confer additional protection. IFN-gamma is an important early signal in IRI and is thought to contribute to reperfusion injury. Because IFN-gamma is produced by kidney cells and T cells we performed IRI in BM chimeras in which the BM of WT mice was reconstituted with BM from IFN-gamma KO mice (IFN-gamma KO-->WT chimera). We observed marked reduction in IRI in comparison to WT-->WT chimeras providing additional indirect support for the role of T cells. To confirm the role of CD4+ A(2A)R in mediating protection from IRI, Rag-1 KO mice were subjected to ischemia-reperfusion. The protection observed in Rag-1 KO mice was reversed in Rag-1 KO mice that were adoptively transferred WT CD4+ cells (WT CD4+-->Rag-1 KO) or A(2A) KO CD4+ cells (A(2A) KO CD4+-->Rag-1 KO). ATL146e reduced injury in WT CD4+-->Rag-1 KO mice but not in A(2A) KO CD4+-->Rag-1 KO mice. Rag-1 KO mice reconstituted with CD4+ cells derived from IFN-gamma KO mice (IFN-gamma CD4+-->Rag-1 KO) were protected from IRI; ATL146e conferred no additional protection. These studies demonstrate that CD4+ IFN-gamma contributes to IRI and that A(2A) agonists mediate protection from IRI through action on CD4+ cells.
Directory of Open Access Journals (Sweden)
José María Moreno-Navarrete
Full Text Available BACKGROUND: Alternative macrophages (M2 express the cluster differentiation (CD 206 (MCR1 at high levels. Decreased M2 in adipose tissue is known to be associated with obesity and inflammation-related metabolic disturbances. Here we aimed to investigate MCR1 relative to CD68 (total macrophages gene expression in association with adipogenic and mitochondrial genes, which were measured in human visceral [VWAT, n = 147] and subcutaneous adipose tissue [SWAT, n = 76] and in rectus abdominis muscle (n = 23. The effects of surgery-induced weight loss were also longitudinally evaluated (n = 6. RESULTS: MCR1 and CD68 gene expression levels were similar in VWAT and SWAT. A higher proportion of CD206 relative to total CD68 was present in subjects with less body fat and lower fasting glucose concentrations. The ratio MCR1/CD68was positively associated with IRS1gene expression and with the expression of lipogenic genes such as ACACA, FASN and THRSP, even after adjusting for BMI. The ratio MCR1/CD68 in SWAT increased significantly after the surgery-induced weight loss (+44.7%; p = 0.005 in parallel to the expression of adipogenic genes. In addition, SWAT MCR1/CD68ratio was significantly associated with muscle mitochondrial gene expression (PPARGC1A, TFAM and MT-CO3. AT CD206 was confirmed by immunohistochemistry to be specific of macrophages, especially abundant in crown-like structures. CONCLUSION: A decreased ratio MCR1/CD68 is linked to adipose tissue and muscle mitochondrial dysfunction at least at the level of expression of adipogenic and mitochondrial genes.
Evaluation of a dental pulp-derived cell sheet cultured on amniotic membrane substrate.
Honjo, Ken-ichi; Yamamoto, Toshiro; Adachi, Tetsuya; Amemiya, Takeshi; Mazda, Osam; Kanamura, Narisato; Kita, Masakazu
2015-01-01
Mesenchymal stem cells (MSC) are transplanted for periodontal tissue regeneration, and the periodontal ligament (PDL) is regenerated using a cultured cell sheet. This cultured cell sheet is prepared using PDL-derived cells, growth factors, and amniotic membrane (AM). Dental pulp (DP)-derived cells can be easily obtained from extracted wisdom teeth, proliferate rapidly, and are less susceptible to bacterial infection than PDL-derived cells. Thus, to prepare a novel cell sheet, DP-derived cells were cultured on AM as a culture substrate for immunohistochemical examination. Wisdom teeth extracted from three adults were cut along the cement-enamel border. DP tissue was collected, minced, and primarily cultured. After three or four passage cultures, DP-derived cells were cultured on AM, followed by hematoxylin-eosin (H-E) and immunofluorescence staining. DP-derived cells cultured on AM formed a layered structure. Cells positive for vimentin, Ki-67, ZO-1, desmoplakin, CD29, 44, 105 or 146, STRO-1, collagen IV or VII or laminin 5 or α5 chain were localized. DP-derived cells proliferated on AM, while retaining the properties of DP, which allowed the cultured cell sheet to be prepared. In addition, the cultured cell sheet contained MSC, which suggests its potential application in periodontal tissue regeneration.
CD105 promotes chondrogenesis of synovium-derived mesenchymal stem cells through Smad2 signaling.
Fan, Wenshuai; Li, Jinghuan; Wang, Yiming; Pan, Jianfeng; Li, Shuo; Zhu, Liang; Guo, Changan; Yan, Zuoqin
2016-05-27
Mesenchymal stem cells (MSCs) are considered to be suitable for cell-based tissue regeneration. Expressions of different cell surface markers confer distinct differentiation potential to different sub-populations of MSCs. Understanding the effect of cell surface markers on MSC differentiation is essential to their targeted application in different tissues. Although CD105 positive MSCs possess strong chondrogenic capacity, the underlying mechanisms are not clear. In this study, we observed a considerable heterogeneity with respect to CD105 expression among MSCs isolated from synovium. The CD105(+) and CD105(-) synovium-derived MSCs (SMSCs) were sorted to compare their differentiation capacities and relative gene expressions. CD105(+) subpopulation had higher gene expressions of AGG, COL II and Sox9, and showed a stronger affinity for Alcian blue and immunofluorescent staining for aggrecan and collagenase II, as compared to those in CD105(-) cells. However, no significant difference was observed with respect to gene expressions of ALP, Runx2, LPL and PPARγ. CD105(+) SMSCs showed increased levels of Smad2 phosphorylation, while total Smad2 levels were similar between the two groups. There was no difference in activation of Smad1/5. These results were further confirmed by CD105-knockdown in SMSCs. Our findings suggest a stronger chondrogenic potential of CD105(+) SMSCs in comparison to that of CD105(-) SMSCs and that CD105 enhances chondrogenesis of SMSCs by regulating TGF-β/Smad2 signaling pathway, but not Smad1/5. Our study provides a better understanding of CD105 with respect to chondrogenic differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.
Analysis of CD83 antigen expression in human breast fibroadenoma and adjacent tissue.
Borges, Marcus Nascimento; Facina, Gil; Silva, Ismael Dale Cotrin Guerreiro; Waitzberg, Angela Flávia Logullo; Nazario, Afonso Celso Pinto
2011-12-01
Dendritic cell maturation is considered essential for starting an immune response. The CD83 antigen is an important marker of dendritic cell maturation. The objectives here were to analyze CD83 antigen expression in human breast fibroadenoma and breast tissue adjacent to the lesion and to identify clinical factors that might influence this expression. This was a retrospective study at a public university hospital, in which 29 histopathological samples of breast fibroadenoma and adjacent breast tissue, from 28 women of reproductive age, were analyzed. The immunohistochemistry method was used to analyze the cell expression of the antigen. The antigen expression in the cells was evaluated by means of random manual counting using an optical microscope. Positive expression of the CD83 antigen in the epithelial cells of the fibroadenoma (365.52; standard deviation ± 133.13) in relation to the adjacent breast tissue cells (189.59; standard deviation ± 140.75) was statistically larger (P fibroadenoma was positive and greater than in the adjacent breast tissue. Positive expression of the antigen in the adjacent breast tissue was influenced by parity, and was significantly more evident in nulliparous women.
International Nuclear Information System (INIS)
Kao, C.-L.; Huang, P.-I; Tsai, P.-H.; Tsai, M.-L.; Lo, J.-F.; Lee, Y.-Y.; Chen, Y.-J.; Chen, Y.-W.; Chiou, S.-H.
2009-01-01
Purpose: CD133 has recently been proposed as a marker for cancer stem-like cells (CSC) in brain tumors. The aim of the present study was to investigate the possible role of resveratrol (RV) in radiosensitivity of CD133-positive/-negative cells derived from atypical teratoid/rhabdoid tumors (AT/RT-CD133 +/- ). Materials and Methods: AT/RT-CD133 +/- were isolated and characterized by flow cytometry and quantitative real-time reverse transcription-polymerase chain reaction, and then treated with RV at different doses. Migratory ability, colony formation, apoptotic activity, and xenotransplantation were assessed for RV alone, ionizing radiation (IR) alone, and IR with RV conditions. Results: AT/RT-CD133 + displayed enhanced self-renewal and highly coexpressed 'stem cell' genes and drug-resistant genes, in addition to showing significant resistance to chemotherapeutic agents and radiotherapy as compared with CD133 - cells. After treatment with 200 μM RV, the in vitro proliferation rates and in vivo tumor restoration abilities of ATRT-CD133 + were dramatically inhibited. Importantly, treatment with 150 μM RV can effectively inhibit the expression of drug-resistant genes in AT/RT-CD133 + , and further facilitate to the differentiation of CD133 + into CD133 - . In addition, treatment with 150 μM RV could significantly enhance the radiosensitivity and IR-mediated apoptosis in RV-treated ATRT-CD133 +/- . Kaplan-Meier survival analysis indicated that the mean survival rate of mice with ATRT-CD133 + that were treated with IR could be significantly improved when IR was combined with 150 μM RV treatment. Conclusions: AT/RT-CD133 + exhibit CSC properties and are refractory to IR treatment. Our results suggest that RV treatment plays crucial roles in antiproliferative, proapoptotic, and radiosensitizing effects on treated-CD133 +/- ; RV may therefore improve the clinical treatment of AT/RT.
Expression and Significance of gp96 and Immune-related Gene CTLA-4, CD8 in Lung Cancer Tissues
Directory of Open Access Journals (Sweden)
Haiyan ZHENG
2010-08-01
Full Text Available Background and objective It has been proven that gp96 plays an important role in specific cytotoxic immune response which is involved in anti-tumor effect in the body. The aim of this study is to investigate the biological significance of heat shock protein gp96 and immune-related gene CTLA-4, CD8 expressions in lung cancer tissues of different progressive stages. Methods We used Envision immunohistochemistry method to detect the levels of expression of gp96, CTLA-4, CD8 in tissue microarray, which contained 89 primary lung cancer tissues, 12 lymph node metastasis lung cancer tissues, 12 precancerous lesions and 10 normal lung tissues, and analyzed the relationship between their expressions and clinicopathological parameters. Results (1 The positive rate of gp96 in primary lung cancer was remarkably higher than that in precancerous lesion and normal lung tissue (P < 0.05. The positive rate of CTLA-4 in primary lung cancer tissue and precancerous lesion was significantly higher than that in normal lung tissue (P < 0.05. The positive rate of CD8 in primary lung cancer tissue was significantly higher than that in normal lung tissue (P < 0.05. The positive rate of gp96 in CD8-positive lymphocytes in the high expression group was less than that in the low group (P < 0.05. (2 The positive rate of gp96 was closely related to sex, differentiation and clinical stage (P < 0.05, but not to age, gross type, histological type and lymph node metastasis (P > 0.05. The positive rate of CTLA-4 was closely related to age and differentiation (P < 0.05, but not to sex, gross type, histological type, clinical stage and lymph node metastasis (P > 0.05. CD8 expression was related to clinical stage (P < 0.05, but not to sex, age, gross type, histological type, differentiation and lymph node metastasis (P > 0.05. The positive rates of gp96, CTLA-4 were higher than that of CD8 in squamous cell carcinoma and SCLC, respectively. (3 There was positive correlation between gp
DEFF Research Database (Denmark)
Andersen, Ditte Caroline; Kristiansen, Gitte Qvistgaard; Jensen, Line
2011-01-01
transcripts associated with endothelial cells, Notch signaling and myogenic precursors. By comparing the mRNA signatures of mSPs with those of adipose tissue-derived SP populations, a common endothelial component seemed to reside in both muscle and fat-derived SPCD45(-) entities. However, each SP subset......The skeletal muscle-derived side population (mSP) which highly excludes Hoechst 33342 is composed of CD45(+) and CD45(-) subpopulations; yet, rareness of mSP cells in general has complicated extensive quantitative analysis of gene expression profiles in primarily isolated mSP cells. Here, we...... describe the isolation of adult mouse normal skeletal muscle residing SPCD45(+) and SPCD45(-) cells from a parent mononuclear muscle-derived cell (MDC) population. Relative quantitative real time PCR (RT-PCR) of 64 genes revealed that mSPCD45(-) compared with mSPCD45(+) was enriched for cells expressing...
Characterization of mesenchymal stem cells derived from equine adipose tissue
Directory of Open Access Journals (Sweden)
A.M. Carvalho
2013-08-01
Full Text Available Stem cell therapy has shown promising results in tendinitis and osteoarthritis in equine medicine. The purpose of this work was to characterize the adipose-derived mesenchymal stem cells (AdMSCs in horses through (1 the assessment of the capacity of progenitor cells to perform adipogenic, osteogenic and chondrogenic differentiation; and (2 flow cytometry analysis using the stemness related markers: CD44, CD90, CD105 and MHC Class II. Five mixed-breed horses, aged 2-4 years-old were used to collect adipose tissue from the base of the tail. After isolation and culture of AdMSCs, immunophenotypic characterization was performed through flow cytometry. There was a high expression of CD44, CD90 and CD105, and no expression of MHC Class II markers. The tri-lineage differentiation was confirmed by specific staining: adipogenic (Oil Red O, osteogenic (Alizarin Red, and chondrogenic (Alcian Blue. The equine AdMSCs are a promising type of adult progenitor cell for tissue engineering in veterinary medicine.
Tang, Jinle; Li, Jialu; Zhu, Xuejun; Yu, Yuan; Chen, Dan; Yuan, Lei; Gu, Zhenyang; Zhang, Xingding; Qi, Lin; Gong, Zhishu; Jiang, Pengjun; Yu, Juhua; Meng, Huimin; An, Gangli; Zheng, Huyong; Yang, Lin
2016-06-07
Various CD7-targeting immunotoxins have been tested for its potential in treating CD7+ malignant patients but none of those immunotoxins was approved clinically because of lacking enough efficacy and safety. Here we successfully constructed the monovalent and bivalent CD7 nanobody-based immunotoxins PG001 and PG002, both conjugated with a truncated derivative of Pseudomonas exotoxin A respectively. The prokaryotic system expressed immunotoxins not only maintained their binding specificity for CD7-positive cells with a Kd of 16.74 nM and 3.6 nM for PG001 and PG002 respectively, but also efficiently promoted antigen-restricted apoptosis of the CD7-positive leukemia cell lines Jurkat and CEM, and primary T-cell acute lymphoblastic leukemia (T-ALL) and acute myeloid leukemia (AML) cells with an in vitro cytotoxic activity (EC50) in the range of 23-30 pM for PG002. In NOD/SCID mice transplanted with CEM cells, PG001 and PG002 prevented engraftment of the cells and markedly prolonged mouse survival. Owing to the efficient antigen-restricted anti-leukemic activity of PG002, this CD7 nanobody-based immunotoxin exhibited a superior anti-CD7 positive malignancies activity than previously reported immunotoxins, and may represent a promising therapeutic strategy in treating CD7-positive leukemia and lymphoma, which still remain a significant clinical challenge.
Häussler, S; Germeroth, D; Laubenthal, L; Ruda, L F; Rehage, J; Dänicke, S; Sauerwein, H
2017-01-01
With the onset of lactation energy from feed intake is mostly insufficient to meet the requirements of dairy cows. Lipid mobilization from adipose tissue (AT) could lead to a compromised inflammatory response enhancing the incidence for diseases. In addition, tissue alterations can occur, displaying areas of necrosis and inflammation. Furthermore, over-conditioned cows mobilizing more lipids from AT than thin cows are prone to develop metabolic disorders. This might lead to an increased infiltration of phagocytic immune cells into AT. In the present study, CD68 positive cells were localized in AT from 10 early lactating Holstein cows displaying different grades of AT alterations. Biopsies were sampled from visceral and subcutaneous AT and the number of CD68 positive cells was immunohistochemically determined. In addition, AT biopsies from over-conditioned, non-pregnant, non-lactating cows (n=8) were immunohistochemically analyzed for CD68 positive cells. The percentage of CD68 positive cells was less than 2% in AT biopsies with tissue alterations and in AT from over-conditioned cows. Therefore, immune cell infiltration demonstrated via the localization of CD68 positive cells seems to play only a minor role in AT from over-conditioned cows as well as in different bovine AT depots with tissue alterations. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Gemma Chiva-Blanch
Full Text Available Circulating microparticles (cMPs are phospholipid-rich vesicles released from cells when activated or injured, and contribute to the formation of intracoronary thrombi. Tissue factor (TF, CD142 is the main trigger of fibrin formation and TF-carrying cMPs are considered one of the most procoagulant cMPs. Similar types of atherosclerotic lesions may lead to different types of AMI, although the mechanisms behind are unresolved. Therefore, we aimed to investigate the phenotype of cMPs found in plasma of ACS patients and its relation to AMI severity and thrombotic burden.In a cross-sectional study, two hundred patients aged 75±4 years were included in the study 2-8 weeks after suffering an AMI. Annexin V positive (AV+-cMPs derived from blood and vascular cells were measured by flow cytometry. Plasma procoagulant activity (TF-PCA was measured through a chromogenic assay.STEMI patients (n = 75 showed higher levels of platelet-derived cMPs [CD61+/AV+, CD31+/AV+, CD42b+/AV+ and CD31+/CD42b+/AV+, P = 0.048, 0.038, 0.009 and 0.006, respectively], compared to NSTEMI patients (n = 125. Patients who suffered a heart failure during AMI (n = 17 had increased levels of platelet (CD61+-and monocyte (CD14+-derived cMPs carrying TF (CD142+ (P<0.0001 and 0.004, respectively. Additionally, NYHA class III (n = 23 patients showed higher levels of CD142+/AV+, CD14+/AV+ and CD14+/CD142+/AV+ cMPs than those in class I/II (P = 0.001, 0.015 and 0.014, respectively. The levels of these cMPs positively correlated with TF-PCA (r≥0.166, P≤0.027, all.Platelets and monocytes remain activated in AMI patients treated as per guidelines and release cMPs that discriminate AMI severity. Therefore, TF-MPs, and platelet- and monocyte-MPs may reflect thrombotic burden in AMI patients.
Luo, Dahu; Lou, Weihua
2017-07-01
Objective To study the expressions of RNA-binding Ras-GAP SH3 binding protein (G3BP) and tumor stem cell marker CD44v6 in laryngeal squamous cell carcinoma and their correlations with angiogenesis. Methods We collected the cancer tissues and corresponding paracancerous tissues from 56 patients with laryngeal squamous cell carcinoma. The expressions of G3BP and CD44v6 proteins were detected by Western blotting in cancer tissues and corresponding paracancerous tissues; the expressions of G3BP, CD44v6 and vascular endothelial growth factor A (VEGF-A) were tested by immunohistochemistry. Thereafter, we compared the positive expression rates of G3BP and CD44v6 between in cancer tissues and in normal tissues, analyzed the correlations between the expressions of G3BP, CD44v6 and the laryngeal squamous cell carcinoma features as well as their correlations with microvessel density (MVD) that was determined by FVIIIAg immunohistochemistry. Results Western blotting showed that the expressions of G3BP and CD44v6 proteins in the laryngeal squamous cell carcinoma were higher than those in the paracancerous tissues. Immunohistochemistry showed that compared with the paracancerous tissues, G3BP, CD44v6 and VEGF-A expressions (the positive rates are 58.9%, 53.6%, 46.4%, respectively) were higher in cancer tissues. The positive rates of G3BP and CD44v6 in cancer tissues were related with the clinical stage, recurrence or metastasis, and lymph node metastasis of laryngeal squamous cell carcinoma, but had nothing to do with patients' age and tumor size. Pearson correlation analysis showed the expressions of both G3BP and CD44v6 were positively correlated with VEGF-A (r=0.741, r=0.756). MVD values were significantly higher in the G3BP and CD44v6 positive cases than in paracancerous tissues, but there was no difference in MVD between those without G3BP and CD44v6 positive expressions and the paracancerous tissues. Conclusion The positive expression rates of G3BP and CD44v6 in laryngeal
Wang, Huan; Kwak, Dongmin; Fassett, John; Liu, Xiaohong; Yao, Wu; Weng, Xinyu; Xu, Xin; Xu, Yawei; Bache, Robert J; Mueller, Daniel L; Chen, Yingjie
2017-05-01
Inflammatory responses play an important role in the development of left ventricular (LV) hypertrophy and dysfunction. Recent studies demonstrated that increased T-cell infiltration and T-cell activation contribute to LV hypertrophy and dysfunction. Dendritic cells (DCs) are professional antigen-presenting cells that orchestrate immune responses, especially by modulating T-cell function. In this study, we investigated the role of bone marrow-derived CD11c + DCs in transverse aortic constriction (TAC)-induced LV fibrosis and hypertrophy in mice. We observed that TAC increased the number of CD11c + cells and the percentage of CD11c + MHCII + (major histocompatibility complex class II molecule positive) DCs in the LV, spleen and peripheral blood in mice. Using bone marrow chimeras and an inducible CD11c + DC ablation model, we found that depletion of bone marrow-derived CD11c + DCs significantly attenuated LV fibrosis and hypertrophy in mice exposed to 24 weeks of moderate TAC. CD11c + DC ablation significantly reduced TAC-induced myocardial inflammation as indicated by reduced myocardial CD45 + cells, CD11b + cells, CD8 + T cells and activated effector CD8 + CD44 + T cells in LV tissues. Moreover, pulsing of autologous DCs with LV homogenates from TAC mice promoted T-cell proliferation. These data indicate that bone marrow-derived CD11c + DCs play a maladaptive role in hemodynamic overload-induced cardiac inflammation, hypertrophy and fibrosis through the presentation of cardiac self-antigens to T cells.
Osteogenic differentiation capacity of human skeletal muscle-derived progenitor cells.
Directory of Open Access Journals (Sweden)
Teruyo Oishi
Full Text Available Heterotopic ossification (HO is defined as the formation of ectopic bone in soft tissue outside the skeletal tissue. HO is thought to result from aberrant differentiation of osteogenic progenitors within skeletal muscle. However, the precise origin of HO is still unclear. Skeletal muscle contains two kinds of progenitor cells, myogenic progenitors and mesenchymal progenitors. Myogenic and mesenchymal progenitors in human skeletal muscle can be identified as CD56(+ and PDGFRα(+ cells, respectively. The purpose of this study was to investigate the osteogenic differentiation potential of human skeletal muscle-derived progenitors. Both CD56(+ cells and PDGFRα(+ cells showed comparable osteogenic differentiation potential in vitro. However, in an in vivo ectopic bone formation model, PDGFRα(+ cells formed bone-like tissue and showed successful engraftment, while CD56(+ cells did not form bone-like tissue and did not adapt to an osteogenic environment. Immunohistological analysis of human HO sample revealed that many PDGFRα(+ cells were localized in proximity to ectopic bone formed in skeletal muscle. MicroRNAs (miRNAs are known to regulate many biological processes including osteogenic differentiation. We investigated the participation of miRNAs in the osteogenic differentiation of PDGFRα(+ cells by using microarray. We identified miRNAs that had not been known to be involved in osteogenesis but showed dramatic changes during osteogenic differentiation of PDGFRα(+ cells. Upregulation of miR-146b-5p and -424 and downregulation of miR-7 during osteogenic differentiation of PDGFRα(+ cells were confirmed by quantitative real-time RT-PCR. Inhibition of upregulated miRNAs, miR-146b-5p and -424, resulted in the suppression of osteocyte maturation, suggesting that these two miRNAs have the positive role in the osteogenesis of PDGFRα(+ cells. Our results suggest that PDGFRα(+ cells may be the major source of HO and that the newly identified mi
Directory of Open Access Journals (Sweden)
Ramsland Paul A
2011-06-01
Full Text Available Abstract Background CD4-binding site (CD4bs alterations in gp120 contribute to HIV-1 envelope (Env mediated fusogenicity and the ability of gp120 to utilize low levels of cell-surface CD4. In a recent study, we constructed three-dimensional models of gp120 to illustrate CD4bs conformations associated with enhanced fusogenicity and enhanced CD4-usage of a modestly-sized panel of blood-derived HIV-1 Envs (n = 16. These conformations were characterized by a wider aperture of the CD4bs cavity, as constrained by the inner-most atoms at the gp120 V1V2 stem and the V5 loop. Here, we sought to provide further validation of the utility of these models for understanding mechanisms that influence Env function, by characterizing the structure-function relationships of a larger panel of Envs derived from brain and other tissues (n = 81. Findings Three-dimensional models of gp120 were generated by our recently validated homology modelling protocol. Analysis of predicted CD4bs structures showed correlations between the aperture width of the CD4bs cavity and ability of the Envs to mediate cell-cell fusion, scavenge low-levels of cell-surface CD4, bind directly to soluble CD4, and bind to the Env mAb IgG1b12 whose epitope overlaps the gp120 CD4bs. These structural alterations in the CD4bs cavity were associated with repositioning of the V5 loop. Conclusions Using a large, independent panel of Envs, we can confirm the utility of three-dimensional gp120 structural models for illustrating CD4bs alterations that can affect Env function. Furthermore, we now provide new evidence that these CD4bs alterations augment the ability of gp120 to interact with CD4 by increasing the exposure of the CD4bs.
International Nuclear Information System (INIS)
Nanduri, Lalitha S.Y.; Lombaert, Isabelle M.A.; Zwaag, Marianne van der; Faber, Hette; Brunsting, Jeanette F.; Os, Ronald P. van; Coppes, Robert P.
2013-01-01
Introduction: During radiotherapy salivary glands of head and neck cancer patients are unavoidably co-irradiated, potentially resulting in life-long impairment. Recently we showed that transplantation of salisphere-derived c-Kit expressing cells can functionally regenerate irradiated salivary glands. This study aims to select a more potent subpopulation of c-Kit + cells, co-expressing stem cell markers and to investigate whether long-term tissue homeostasis is restored after stem cell transplantation. Methods and results: Salisphere derived c-Kit + cells that co-expressed CD24 and/or CD49f markers, were intra-glandularly injected into 15 Gy irradiated submandibular glands of mice. Particularly, c-Kit + /CD24 + /CD49f + cell transplanted mice improved saliva production (54.59 ± 11.1%) versus the irradiated control group (21.5 ± 8.7%). Increase in expression of cells with differentiated duct cell markers like, cytokeratins (CK8, 18, 7 and 14) indicated functional recovery of this compartment. Moreover, ductal stem cell marker expression like c-Kit, CD133, CD24 and CD49f reappeared after transplantation indicating long-term functional maintenance potential of the gland. Furthermore, a normalization of vascularization as indicated by CD31 expression and reduction of fibrosis was observed, indicative of normalization of the microenvironment. Conclusions: Our results show that stem cell transplantation not only rescues hypo-salivation, but also restores tissue homeostasis of the irradiated gland, necessary for long-term maintenance of adult tissue
Autologous Adipose-Derived Tissue Matrix Part I: Biologic Characteristics.
Schendel, Stephen A
2017-10-01
Autologous collagen is an ideal soft tissue filler and may serve as a matrix for stem cell implantation and growth. Procurement of autologous collagen has been limited, though, secondary to a sufficient source. Liposuction is a widely performed and could be a source of autologous collagen. The amount of collagen and its composition in liposuctioned fat remains unknown. The purpose of this research was to characterize an adipose-derived tissue-based product created using ultrasonic cavitation and cryo-grinding. This study evaluated the cellular and protein composition of the final product. Fat was obtained from individuals undergoing routine liposuction and was processed by a 2 step process to obtain only the connective tissue. The tissue was then evaluated by scanning electronic microscope, Western blot analysis, and flow cytometry. Liposuctioned fat was obtained from 10 individuals with an average of 298 mL per subject. After processing an average of 1 mL of collagen matrix was obtained from each 100 mL of fat. Significant viable cell markers were present in descending order for adipocytes > CD90+ > CD105+ > CD45+ > CD19+ > CD144+ > CD34+. Western blot analysis showed collagen type II, III, IV, and other proteins. Scanning electronic microscope study showed a regular pattern of cross-linked, helical collagen. Additionally, vital staing demonstrated that the cells were still viable after processing. Collagen and cells can be easily obtained from liposuctioned fat by ultrasonic separation without alteration of the overall cellular composition of the tissue. Implantation results in new collagen and cellular growth. Collagen matrix with viable cells for autologous use can be obtained from liposuctioned fat and may provide long term results. 5. © 2017 The American Society for Aesthetic Plastic Surgery, Inc. Reprints and permission: journals.permissions@oup.com
Shoae-Hassani, Alireza; Sharif, Shiva; Seifalian, Alexander M; Mortazavi-Tabatabaei, Seyed Abdolreza; Rezaie, Sassan; Verdi, Javad
2013-10-01
To investigate manufacturing smooth muscle cells (SMCs) for regenerative bladder reconstruction from differentiation of endometrial stem cells (EnSCs), as the recent discovery of EnSCs from the lining of women's uteri, opens up the possibility of using these cells for tissue engineering applications, such as building up natural tissue to repair prolapsed pelvic floors as well as building urinary bladder wall. Human EnSCs that were positive for cluster of differentiation 146 (CD146), CD105 and CD90 were isolated and cultured in Dulbecco's modified Eagle/F12 medium supplemented with myogenic growth factors. The myogenic factors included: transforming growth factor β, platelet-derived growth factor, hepatocyte growth factor and vascular endothelial growth factor. Differentiated SMCs on bioabsorbable polyethylene-glycol and collagen hydrogels were checked for SMC markers by real-time reverse-transcriptase polymerase chain reaction (RT-PCR), western blot (WB) and immunocytochemistry (ICC) analyses. Histology confirmed the growth of SMCs in the hydrogel matrices. The myogenic growth factors decreased the proliferation rate of EnSCs, but they differentiated the human EnSCs into SMCs more efficiently on hydrogel matrices and expressed specific SMC markers including α-smooth muscle actin, desmin, vinculin and calponin in RT-PCR, WB and ICC experiments. The survival rate of cultures on the hydrogel-coated matrices was significantly higher than uncoated cultures. Human EnSCs were successfully differentiated into SMCs, using hydrogels as scaffold. EnSCs may be used for autologous bladder wall regeneration without any immunological complications in women. Currently work is in progress using bioabsorbable nanocomposite materials as EnSC scaffolds for developing urinary bladder wall tissue. © 2013 The Authors. BJU International © 2013 BJU International.
International Nuclear Information System (INIS)
Pan, Jian-Feng; Li, Shuo; Guo, Chang-An; Zhang, Feng; Yan, Zuo-Qin; Xu, Du-Liang; Mo, Xiu-Mei
2015-01-01
Stem cells and scaffolds play a very important role in tissue engineering. Here, we isolated synovium-derived mesenchymal stem cells (SMSCs) from synovial membrane tissue and characterized stem-cell properties. Gelatin nanoparticles (NP) were prepared using a two-step desolvation method and then pre-mixed into different host matrix (silk fibroin (SF), gelatin (Gel), or SF–Gel mixture) to generate various 3D printed nanocomposite scaffolds (NP/SF, NP/SF–Gel, NP/Gel-1, and NP/Gel-2). The microstructure was examined by scanning electron microscopy. Biocompatibility assessment was performed through CCK-8 assay by coculturing with SMSCs at 1, 3, 7 and 14 days. According to the results, SMSCs are similar to other MSCs in their surface epitope expression, which are negative for CD45 and positive for CD44, CD90, and CD105. After incubation in lineage-specific medium, SMSCs could differentiate into chondrocytes, osteocytes and adipocytes. 3D printed nanocomposite scaffolds exhibited a good biocompatibility in the process of coculturing with SMSCs and had no negative effect on cell behavior. The study provides a strategy to obtain SMSCs and fabricate 3D printed nanocomposite scaffolds, the combination of which could be used for practical applications in tissue engineering. (paper)
An Abundant Perivascular Source of Stem Cells for Bone Tissue Engineering
James, Aaron W.; Zara, Janette N.; Corselli, Mirko; Askarinam, Asal; Zhou, Ann M.; Hourfar, Alireza; Nguyen, Alan; Megerdichian, Silva; Asatrian, Greg; Pang, Shen; Stoker, David; Zhang, Xinli; Wu, Benjamin
2012-01-01
Adipose tissue is an ideal mesenchymal stem cell (MSC) source, as it is dispensable and accessible with minimal morbidity. However, the stromal vascular fraction (SVF) of adipose tissue is a heterogeneous cell population, which has disadvantages for tissue regeneration. In the present study, we prospectively purified human perivascular stem cells (PSCs) from n = 60 samples of human lipoaspirate and documented their frequency, viability, and variation with patient demographics. PSCs are a fluorescence-activated cell sorting-sorted population composed of pericytes (CD45−, CD146+, CD34−) and adventitial cells (CD45−, CD146−, CD34+), each of which we have previously reported to have properties of MSCs. Here, we found that PSCs make up, on average, 43.2% of SVF from human lipoaspirate (19.5% pericytes and 23.8% adventitial cells). These numbers were minimally changed by age, gender, or body mass index of the patient or by length of refrigerated storage time between liposuction and processing. In a previous publication, we observed that human PSCs (hPSCs) formed significantly more bone in vivo in comparison with unsorted human SVF (hSVF) in an intramuscular implantation model. We now extend this finding to a bone injury model, observing that purified hPSCs led to significantly greater healing of mouse critical-size calvarial defects than hSVF (60.9% healing as opposed to 15.4% healing at 2 weeks postoperative by microcomputed tomography analysis). These studies suggest that adipose-derived hPSCs are a new cell source for future efforts in skeletal regenerative medicine. Moreover, hPSCs are a stem cell-based therapeutic that is readily approvable by the U.S. Food and Drug Administration, with potentially increased safety, purity, identity, potency, and efficacy. PMID:23197874
Energy Technology Data Exchange (ETDEWEB)
Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)
2015-07-10
Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.
Directory of Open Access Journals (Sweden)
Yohei Fujita
Full Text Available PURPOSE: We investigated whether serum interleukin (IL-8 reflects the tumor microenvironment and has prognostic value in patients with oral squamous cell carcinoma (OSCC. EXPERIMENTAL DESIGN: Fifty OSCC patients who received radical resection of their tumor(s were enrolled. Preoperative sera were measured for IL-8 by ELISA. Expression of IL-8 and the infiltration of immune cells in tumor tissues were analyzed by an immunohistochemical staining of surgical specimens. RESULTS: We found that disease-free survival (DFS was significantly longer in the Stage I/II OSCC patients with low serum IL-8 levels compared to those with high levels (p = 0.001. The tumor expression of IL-8, i.e., IL-8(T and the density of CD163-positive cells in the tumor invasive front, i.e., CD163(IF were correlated with the serum IL-8 level (p = 0.033 and p = 0.038, respectively, and they were associated with poor clinical outcome (p = 0.007 and p = 0.002, respectively, in DFS in all patients. A multivariate analysis revealed that N status, IL-8(T and CD163(IF significantly affected the DFS of the patients. Further analysis suggested that combination of N status with serum IL-8, IL-8(T or CD163(IF may be a new criterion for discriminating between OSCC patients at high and low risk for tumor relapse. Interestingly, the in vitro experiments demonstrated that IL-8 enhanced generation of CD163-positive M2 macrophages from peripheral blood monocytes, and that the cells produced IL-10. CONCLUSIONS: These findings indicate that IL-8 may be involved in poor clinical outcomes via generation of CD163-positive M2 macrophages, and that these factors in addition to N status may have prognostic value in patients with resectable OSCSS.
Bourin, Philippe; Bunnell, Bruce A; Casteilla, Louis; Dominici, Massimo; Katz, Adam J; March, Keith L; Redl, Heinz; Rubin, J Peter; Yoshimura, Kotaro; Gimble, Jeffrey M
2013-06-01
Adipose tissue is a rich and very convenient source of cells for regenerative medicine therapeutic approaches. However, a characterization of the population of adipose-derived stromal and stem cells (ASCs) with the greatest therapeutic potential remains unclear. Under the authority of International Federation of Adipose Therapeutics and International Society for Cellular Therapy, this paper sets out to establish minimal definitions of stromal cells both as uncultured stromal vascular fraction (SVF) and as an adherent stromal/stem cells population. Phenotypic and functional criteria for the identification of adipose-derived cells were drawn from the literature. In the SVF, cells are identified phenotypically by the following markers: CD45-CD235a-CD31-CD34+. Added value may be provided by both a viability marker and the following surface antigens: CD13, CD73, CD90 and CD105. The fibroblastoid colony-forming unit assay permits the evaluation of progenitor frequency in the SVF population. In culture, ASCs retain markers in common with other mesenchymal stromal/stem cells (MSCs), including CD90, CD73, CD105, and CD44 and remain negative for CD45 and CD31. They can be distinguished from bone-marrow-derived MSCs by their positivity for CD36 and negativity for CD106. The CFU-F assay is recommended to calculate population doublings capacity of ASCs. The adipocytic, chondroblastic and osteoblastic differentiation assays serve to complete the cell identification and potency assessment in conjunction with a quantitative evaluation of the differentiation either biochemically or by reverse transcription polymerase chain reaction. The goal of this paper is to provide initial guidance for the scientific community working with adipose-derived cells and to facilitate development of international standards based on reproducible parameters. Copyright © 2013 International Society for Cellular Therapy. All rights reserved.
[Expression and clinical significance of CD45RO in laryngeal carcinoma tissue].
Li, Manyi; Liu, Jishengi; Zhou, Hui; Wu, Wenying; Xiao, Gensheng; Yu, Yafeng; Guo, Lingchuan
2014-03-01
To investigate the role and significance of CD45RO in occurance and development in laryngeal squamous carcinoma, and to provide some valuable clues for searching new approaches to assess prognosis and theoretical basis for tumor biotherapy. The expression of CD45RO protein in 50 cases of laryngeal squamous carcinoma and 10 cases normal mucos was detected by immunohistochemical S-P method. The positive rate of CD45RO was 30% and 86% respectively in normal tissue and laryngeal squamous cell carcinoma tissue. The expresion of CD45RO was significantly and negatively associated with local metastatic of lymph nodes 0.713, P < 0.05) and tumor sites (r = -0.750, P < 0.05), but it have no notable difference with pathology differentiation, age, infiltrating depth and clinical stages in 50 cases of laryngeal squamous cell cancer. (1) The expresion of CD45RO in laryngeal squamous cell cancer is more than that in normal tissue. (2) It is possible that overexpresion of CD45RO in laryngeal squamous cell carcinoma cut local metastatic lymph nodes. (3) It is probable that overexpresion of CD45RO in laryngeal squamous cell cancer made for prognosis of patients. (4) Other than UICC-TNM stage, pathology differentiation, it provide valuable clues for searching new approaches to assess prognosis of laryngeal squamous cell carcinoma.
DEFF Research Database (Denmark)
Nielsen, S. D.; Jeppesen, D. L.; Kolte, L.
2001-01-01
and fetal thymic organ cultures (FTOCs). Lower naive CD4 counts (459.3 +/- 68.9 vs 1128.9 +/- 146.8 cells/microL, P mothers were found (frequency of CD4(+) cells with TRECs was 3.6% +/- 0.7% compared with 14.3% +/- 2.2% in controls, P ...). In combination with lower red blood cell counts in infants of HIV-positive mothers, this finding suggested impairment of progenitor cell function. Indeed, progenitors from infants of HIV-positive mothers had decreased cloning efficiency (15.7% +/- 2.6% vs 55.8% +/- 15.9%, P =.009) and seemed to generate fewer T...... cells in FTOCs. In conclusion, lower numbers of naive CD4(+) cells and reduced thymic output in HIV-negative infants of HIV-positive mothers may be due to impaired progenitor cell function....
Identification of CD133-positive radioresistant cells in atypical teratoid/rhabdoid tumor.
Directory of Open Access Journals (Sweden)
Shih-Hwa Chiou
2008-05-01
Full Text Available Atypical teratoid/rhabdoid tumor (AT/RT is an extremely malignant neoplasm in the central nervous system (CNS which occurs in infancy and childhood. Recent studies suggested that CD133 could be considered a marker for brain cancer stem-like cells (CSCs. However, the role of CD133 in AT/RT has never been investigated. Herein we report the isolation of CD133-positive cells (CD133(+, found to have the potential to differentiate into three germ layer tissues, from tissues of nine AT/RT patients. The migration/invasion/malignancy and radioresistant capabilities of CD133(+ were significantly augmented when compared to CD133(-. The clinical data showed that the amount of CD133(+ in AT/RTs correlated positively with the degree of resistance to radiation therapy. Using cDNA microarray analysis, the genotoxic-response profiles of CD133(+ and CD133(- irradiated with 10 Gy ionizing radiation (IR were analyzed 0.5, 2, 6, 12 and 24 h post-IR. We then validated these microarray data and showed increased phosphorylation after IR of p-ATM, p-RAD17, and p-CHX2 as well as increased expression of BCL-2 protein in CD133(+ compared to CD133(-. Furthermore, we found that CD133(+ can effectively resist IR with cisplatin- and/or TRAIL-induced apoptosis. Immunohistochemical analysis confirmed the up-regulated expression of p-ATM and BCL-2 proteins in IR-treated CD133(+ xenotransgrafts in SCID mice but not in IR-treated CD133(-. Importantly, the effect of IR in CD133(+ transplanted mice can be significantly improved by a combination of BCL-2 siRNA with debromohymenialdisine, an inhibitor of checkpoint kinases. In sum, this is the first report indicating that CD133(+ AT/RT cells demonstrate the characteristics of CSCs. The IR-resistant and anti-apoptotic properties in CD133(+ may reflect the clinical refractory malignancy of AT/RTs and thus the activated p-ATM pathway and BCL-2 expression in CD133(+ could be possible targets to improve future treatment of deadly diseases
CD133 expression in osteosarcoma and derivation of CD133⁺ cells.
Li, Ji; Zhong, Xiao-Yan; Li, Zong-Yu; Cai, Jin-Fang; Zou, Lin; Li, Jian-Min; Yang, Tao; Liu, Wei
2013-02-01
Cluster of differentiation 133 (CD133) is recognized as a stem cell marker for normal and cancerous tissues. Using cell culture and real‑time fluorescent polymerase chain reaction, CD133 expression was analyzed in osteosarcoma tissue and Saos‑2 cell lines. In addition, cancer stem cell‑related gene expression in the Saos‑2 cell line was determined to explore the mechanisms underlying tumorigenesis and high drug resistance in osteosarcoma. CD133+ cells were found to be widely distributed in various types of osteosarcoma tissue. Following cell culture, cells entered the G2/M and S cell cycle stages from G0/G1. Levels of CD133+ cells decreased to normal levels rapidly over the course of cell culture. Colony forming efficiency was higher in the CD133+ compared with the CD133‑ subpopulation of Saos‑2 cells. Expression levels of stem cell‑related genes, including multidrug resistance protein 1 (MDR1) and sex determining region Y‑box 2 (Sox2) in the CD133+ subpopulation of cells were found to be significantly higher compared with the CD133‑ subpopulation. These observations indicate that CD133+ Saos‑2 cells exhibit stem cell characteristics, including low abundance, quiescence and a high potential to undergo differentiation, as well as expression of key stem cell regulatory and drug resistance genes, which may cause osteosarcoma and high drug resistance.
Directory of Open Access Journals (Sweden)
Yu-Hua Chao
Full Text Available Sepsis remains an important cause of death worldwide, and vigorous immune responses during sepsis could be beneficial for bacterial clearance but at the price of collateral damage to self tissues. Mesenchymal stem cells (MSCs have been found to modulate the immune system and attenuate sepsis. In the present study, MSCs derived from bone marrow and umbilical cord were used and compared. With a cecal ligation and puncture (CLP model, the mechanisms of MSC-mediated immunoregulation during sepsis were studied by determining the changes of circulating inflammation-associated cytokine profiles and peripheral blood mononuclear cells 18 hours after CLP-induced sepsis. In vitro, bone marrow-derived MSCs (BMMSCs and umbilical cord-derived MSCs (UCMSCs showed a similar morphology and surface marker expression. UCMSCs had stronger potential for osteogenesis but lower for adipogenesis than BMMSCs. Compared with rats receiving PBS only after CLP, the percentage of circulating CD3+CD4+CD25+ regulatory T (Treg cells and the ratio of Treg cells/T cells were elevated significantly in rats receiving MSCs. Further experiment regarding Treg cell function demonstrated that the immunosuppressive capacity of Treg cells from rats with CLP-induced sepsis was decreased, but could be restored by administration of MSCs. Compared with rats receiving PBS only after CLP, serum levels of interleukin-6 and tumor necrosis factor-α were significantly lower in rats receiving MSCs after CLP. There were no differences between BMMSCs and UCMSCs. In summary, this work provides the first in vivo evidence that administering BMMSCs or UCMSCs to rats with CLP-induced sepsis could increase circulating CD3+CD4+CD25+ Treg cells and Treg cells/T cells ratio, enhance Treg cell suppressive function, and decrease serum levels of interleukin-6 and tumor necrosis factor-α, suggesting the immunomodulatory association of Treg cells and MSCs during sepsis.
Brinkman, C Colin; Peske, J David; Engelhard, Victor Henry
2013-01-01
T cell activation induces homing receptors that bind ligands on peripheral tissue vasculature, programing movement to sites of infection and injury. There are three major types of CD8 effector T cells based on homing receptor expression, which arise in distinct lymphoid organs. Recent publications indicate that naïve, effector, and memory T cell migration is more complex than once thought; while many effectors enter peripheral tissues, some re-enter lymph nodes (LN), and contain central memory precursors. LN re-entry can depend on CD62L or peripheral tissue homing receptors. Memory T cells in LN tend to express the same homing receptors as their forebears, but often are CD62Lneg. Homing receptors also control CD8 T cell tumor entry. Tumor vasculature has low levels of many peripheral tissue homing receptor ligands, but portions of it resemble high endothelial venules (HEV), enabling naïve T cell entry, activation, and subsequent effector activity. This vasculature is associated with positive prognoses in humans, suggesting it may sustain ongoing anti-tumor responses. These findings reveal new roles for homing receptors expressed by naïve, effector, and memory CD8 T cells in controlling entry into lymphoid and non-lymphoid tissues.
DEFF Research Database (Denmark)
Overgaard, Nana Haahr; Cruz, Jazmina L.; Bridge, Jennifer A.
2017-01-01
CD4+CD8+ double-positive (DP), mature, peripheral T cells are readily detectable in a variety of species and tissues. Despite a common association with autoimmune and malignant skin disorders, however, little is understood about their role or function. Herein, we show that DP T cells are readily ...
ALK-positive anaplastic large cell lymphoma with soft tissue involvement in a young woman
Directory of Open Access Journals (Sweden)
Gao KH
2016-07-01
Full Text Available Kehai Gao, Hongtao Li, Caihong Huang, Huazhuang Li, Jun Fang, Chen Tian Department of Orthopaedics, Yidu Central Hospital, Shandong, People’s Republic of China Introduction: Anaplastic large cell lymphoma (ALCL is a type of non-Hodgkin lymphoma that has strong expression of CD30. ALCL can sometimes involve the bone marrow, and in advanced stages, it can produce destructive extranodal lesions. But anaplastic large cell lymphoma kinase (ALK+ ALCL with soft tissue involvement is very rare.Case report: A 35-year-old woman presented with waist pain for over 1 month. The biopsy of soft tissue lesions showed that these cells were positive for ALK-1, CD30, TIA-1, GranzymeB, CD4, CD8, and Ki67 (90%+ and negative for CD3, CD5, CD20, CD10, cytokeratin (CK, TdT, HMB-45, epithelial membrane antigen (EMA, and pan-CK, which identified ALCL. After six cycles of Hyper-CVAD/MA regimen, she achieved partial remission. Three months later, she died due to disease progression.Conclusion: This case illustrates the unusual presentation of ALCL in soft tissue with a bad response to chemotherapy. Because of the tendency for rapid progression, ALCL in young adults with extranodal lesions are often treated with high-grade chemotherapy, such as Hyper-CVAD/MA. Keywords: anaplastic large cell lymphoma, ALK+, soft tissue involvement, Hyper-CVAD/MA
Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.
Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan
2016-10-01
This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Caroline Neu
Full Text Available Macrophages are an important line of defence against invading pathogens. Human macrophages derived by different methods were tested for their suitability as models to investigate Listeria monocytogenes (Lm infection and compared to macrophage-like THP-1 cells. Human primary monocytes were isolated by either positive or negative immunomagnetic selection and differentiated in the presence of granulocyte macrophage colony-stimulating factor (GM-CSF or macrophage colony-stimulating factor (M-CSF into pro- or anti-inflammatory macrophages, respectively. Regardless of the isolation method, GM-CSF-derived macrophages (GM-Mφ stained positive for CD206 and M-CSF-derived macrophages (M-Mφ for CD163. THP-1 cells did not express CD206 or CD163 following incubation with PMA, M- or GM-CSF alone or in combination. Upon infection with Lm, all primary macrophages showed good survival at high multiplicities of infection whereas viability of THP-1 was severely reduced even at lower bacterial numbers. M-Mφ generally showed high phagocytosis of Lm. Strikingly, phagocytosis of Lm by GM-Mφ was markedly influenced by the method used for isolation of monocytes. GM-Mφ derived from negatively isolated monocytes showed low phagocytosis of Lm whereas GM-Mφ generated from positively selected monocytes displayed high phagocytosis of Lm. Moreover, incubation with CD14 antibody was sufficient to enhance phagocytosis of Lm by GM-Mφ generated from negatively isolated monocytes. By contrast, non-specific phagocytosis of latex beads by GM-Mφ was not influenced by treatment with CD14 antibody. Furthermore, phagocytosis of Lactococcus lactis, Escherichia coli, human cytomegalovirus and the protozoan parasite Leishmania major by GM-Mφ was not enhanced upon treatment with CD14 antibody indicating that this effect is specific for Lm. Based on these observations, we propose macrophages derived by ex vivo differentiation of negatively selected human primary monocytes as the most
CD52 expression on CD4+ T cells in HIV-positive individuals on cART
DEFF Research Database (Denmark)
Vojdeman, Fie Juhl; Gaardbo, Julie Christine; Hartling, Hans Jakob
2018-01-01
BACKGROUND: Human immune defect virus (HIV) persists in a latent state in quiescent CD4+ T cells preventing eradication of HIV. CD52 is a surface molecule modulated by HIV. We aimed at examining factors related to CD52 expression on CD4+ T cells in HIV-positive individuals and the impact...... of initiation of combination antiretroviral therapy (cART). METHODS: Peripheral blood mononuclear cells (PBMC) from 18 HIV-positive individuals and 10 uninfected age and gender matched controls were examined by flow cytometry for CD38 and CD52 expression on CD4+ T cells. Stimulation assays were performed on 8...... healthy blood donors to determine a cut-off for CD52 expression. RESULTS: All examined CD4+ T cells expressed CD52. However, both CD4+ T cells with higher (CD52++) and with lower CD52 expression (CD52dim) were found in HIV-positive individuals compared to uninfected controls. Two % CD52dim cells defined...
Functional dichotomy between NKG2D and CD28-mediated co-stimulation in human CD8+ T cells.
Directory of Open Access Journals (Sweden)
Kamalakannan Rajasekaran
2010-09-01
Full Text Available Both CD28 and NKG2D can function as co-stimulatory receptors in human CD8+ T cells. However, their independent functional contributions in distinct CD8+ T cell subsets are not well understood. In this study, CD8+ T cells in human peripheral blood- and lung-derived lymphocytes were analyzed for CD28 and NKG2D expression and function. We found a higher level of CD28 expression in PBMC-derived naïve (CD45RA+CD27+ and memory (CD45RA-CD27+ CD8+ T cells (CD28Hi, while its expression was significantly lower in effector (CD45RA+CD27- CD8+ T cells (CD28Lo. Irrespective of the differences in the CD28 levels, NKG2D expression was comparable in all three CD8+ T cell subsets. CD28 and NKG2D expressions followed similar patterns in human lung-resident GILGFVFTL/HLA-A2-pentamer positive CD8+ T cells. Co-stimulation of CD28Lo effector T cells via NKG2D significantly increased IFN-γ and TNF-α levels. On the contrary, irrespective of its comparable levels, NKG2D-mediated co-stimulation failed to augment IFN-γ and TNF-α production in CD28Hi naïve/memory T cells. Additionally, CD28-mediated co-stimulation was obligatory for IL-2 generation and thereby its production was limited only to the CD28Hi naïve/memory subsets. MICA, a ligand for NKG2D was abundantly expressed in the tracheal epithelial cells, validating the use of NKG2D as the major co-stimulatory receptor by tissue-resident CD8+ effector T cells. Based on these findings, we conclude that NKG2D may provide an expanded level of co-stimulation to tissue-residing effector CD8+ T cells. Thus, incorporation of co-stimulation via NKG2D in addition to CD28 is essential to activate tumor or tissue-infiltrating effector CD8+ T cells. However, boosting a recall immune response via memory CD8+ T cells or vaccination to stimulate naïve CD8+ T cells would require CD28-mediated co-stimulation.
Directory of Open Access Journals (Sweden)
Lu Liu
2016-01-01
Full Text Available Introduction. Inflammation in dental pulp cells (DPCs initiated by Lipopolysaccharide (LPS results in dental pulp necrosis. So far, whether there is a common system regulating inflammation response and tissue regeneration remains unknown. miR-146a is closely related to inflammation. Basic fibroblast growth factor (bFGF is an important regulator for differentiation. Methods. To explore the effect of miR-146a/bFGF on inflammation and tissue regeneration, polyethylene glycol-polyethyleneimine (PEG-PEI was synthesized, and physical characteristics were analyzed by dynamic light scattering and gel retardation analysis. Cell absorption, transfection efficiency, and cytotoxicity were assessed. Alginate gel was combined with miR-146a/PEG-PEI nanoparticles and bFGF. Drug release ratio was measured by ultraviolet spectrophotography. Proliferation and odontogenic differentiation of DPCs with 1 μg/mL LPS treatment were determined. Results. PEG-PEI prepared at N/P 2 showed complete gel retardation and smallest particle size and zeta potential. Transfection efficiency of PEG-PEI was higher than lipo2000. Cell viability decreased as N/P ratio increased. Drug release rate amounted to 70% at the first 12 h and then maintained slow release afterwards. Proliferation and differentiation decreased in DPCs with LPS treatment, whereas they increased in miR-146a/bFGF gel group. Conclusions. PEG-PEI is a promising vector for gene therapy. miR-146a and bFGF play critical roles in inflammation response and tissue regeneration of DPCs.
DEFF Research Database (Denmark)
Ohki, Makiko; Ohki, Yuichi; Ishihara, Makoto
2010-01-01
tissue regeneration is not well understood. Bone marrow (BM)-derived myeloid cells facilitate angiogenesis during tissue regeneration. Here, we report that a serpin-resistant form of tPA by activating the extracellular proteases matrix metalloproteinase-9 and plasmin expands the myeloid cell pool......-A. Remarkably, transplantation of BM-derived tPA-mobilized CD11b(+) cells and VEGFR-1(+) cells, but not carrier-mobilized cells or CD11b(-) cells, accelerates neovascularization and ischemic tissue regeneration. Inhibition of VEGF signaling suppresses tPA-induced neovascularization in a model of hind limb...... and mobilizes CD45(+)CD11b(+) proangiogenic, myeloid cells, a process dependent on vascular endothelial growth factor-A (VEGF-A) and Kit ligand signaling. tPA improves the incorporation of CD11b(+) cells into ischemic tissues and increases expression of neoangiogenesis-related genes, including VEGF...
Sp1-CD147 positive feedback loop promotes the invasion ability of ovarian cancer.
Zhao, Jing; Ye, Wei; Wu, Juan; Liu, Lijuan; Yang, Lina; Gao, Lu; Chen, Biliang; Zhang, Fanglin; Yang, Hong; Li, Yu
2015-07-01
CD147 is a novel cancer biomarker that has been confirmed to be overexpressed in ovarian carcinoma, which is significantly associated with poor prognosis. Although the Sp1 protein regulates the expression level of CD147, it remains unclear whether Sp1 phosphorylation plays a role in this regulation. A dual-luciferase assay revealed that T453 and T739 mutations decreased the activity of Sp1 binding to the promoter of CD147, followed by a decrease in CD147 mRNA and protein expression. Western blot analysis showed that CD147 promoted Sp1 phosphorylation at T453 and T739 through the PI3K/AKT and MAPK/ERK pathways. In addition, blocking the Sp1-CD147 positive feedback loop reduced the invasion ability of HO-8910pm cells. Immunohistochemical staining showed that the components of the feedback loop were overexpressed in ovarian cancer tissues. The correlation analysis revealed a significant correlation between phospho-Sp1 (T453), phospho-Sp1 (T739) and CD147 expression levels, with correlation coefficients of r=0.477 and r=0.461, respectively. Collectively, our results suggest that a Sp1-CD147 positive feedback loop plays a critical role in the invasion ability of ovarian cancer cells.
Shen, Jiangli; Yu, Zhaohui; Li, Na
2018-06-20
The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.
Angulski, Addeli B B; Capriglione, Luiz G; Batista, Michel; Marcon, Bruna H; Senegaglia, Alexandra C; Stimamiglio, Marco A; Correa, Alejandro
2017-04-01
Adult stem cells have beneficial effects when exposed to damaged tissue due, at least in part, to their paracrine activity, which includes soluble factors and extracellular vesicles (EVs). Given the multiplicity of signals carried by these vesicles through the horizontal transfer of functional molecules, human mesenchymal stem cell (hMSCs) and CD133 + cell-derived EVs have been tested in various disease models and shown to recover damaged tissues. In this study, we profiled the protein content of EVs derived from expanded human CD133 + cells and bone marrow-derived hMSCs with the intention of better understanding the functions performed by these vesicles/cells and delineating the most appropriate use of each EV in future therapeutic procedures. Using LC-MS/MS analysis, we identified 623 proteins for expanded CD133 + -EVs and 797 proteins for hMSCs-EVs. Although the EVs from both origins were qualitatively similar, when protein abundance was considered, hMSCs-EVs and CD133 + -EVs were different. Gene Ontology (GO) enrichment analysis in CD133 + -EVs revealed proteins involved in a variety of angiogenesis-related functions as well proteins related to the cytoskeleton and highly implicated in cell motility and cellular activation. In contrast, when overrepresented proteins in hMSCs-EVs were analyzed, a GO cluster of immune response-related genes involved with immune response-regulating factors acting on phagocytosis and innate immunity was identified. Together our data demonstrate that from the point of view of protein content, expanded CD133 + -EVs and hMSCs-EVs are in part similar but also sufficiently different to reflect the main beneficial paracrine effects widely reported in pre-clinical studies using expanded CD133 + cells and/or hBM-MSCs.
Yang, Hongna; Sun, Jinhua; Li, Yan; Duan, Wei-Ming; Bi, Jianzhong; Qu, Tingyu
2016-04-01
Bone marrow-derived mesenchymal stem cells (MSCs) are promising candidate cells for therapeutic application in autoimmune diseases due to their immunomodulatory properties. Unused human umbilical cords (UC) offer an abundant and noninvasive source of MSCs without ethical issues and are emerging as a valuable alternative to bone marrow tissue for producing MSCs. We thus investigated the immunomodulation effect of umbilical cord-derived MSCs (UC-MSCs) on human peripheral blood mononuclear cells (PBMCs), T cells in particular, in a co-culture system. We found that UC-MSCs efficiently suppressed the proliferation of phytohaemagglutinin (PHA)-stimulated PBMCs (pMSCs primarily inhibited the division of generation 3 (G3) and 4 (G4) of PBMCs. In addition, UC-MSCs augmented the expression of CD127(+) and CD45RA(+) but reduced the expression of CD25(+) in PBMCs stimulated by PHA (pMSCs inhibited PHA-resulted increase in the frequency of CD4(+)CD25(+)CD127(low/-) Tregs significantly (pMSCs are able to suppress mitogen-induced PBMC activation and proliferation in vitro by altering T lymphocyte phenotypes, increasing the frequency of CD4(+)CD25(high)CD45RA(+) Tregs, and modulating the associated cytokine production. Further studies are warranted to investigate the therapeutic potential of UC-MSCs in immunologically-diseased conditions. Copyright © 2016 Elsevier Inc. All rights reserved.
Bystander CD4+ T lymphocytes survive in HIV-infected human lymphoid tissue
Grivel, Jean-Charles; Biancotto, Angelique; Ito, Yoshinori; Lima, Rosangela G.; Margolis, Leonid B.
2003-01-01
HIV infection is associated with depletion of CD4(+) T cells. The mechanisms of this phenomenon remain to be understood. In particular, it remains controversial whether and to what extent uninfected ("bystander") CD4(+) T cells die in HIV-infected individuals. We address this question using a system of human lymphoid tissue ex vivo. Tissue blocks were inoculated with HIV-1. After productive infection was established, they were treated with the reverse transcriptase inhibitor nevirapine to protect from infection those CD4(+) T cells that had not yet been infected. These CD4(+) T cells residing in HIV-infected tissue are by definition bystanders. Our results demonstrate that after nevirapine application the number of bystander CD4(+) T cells is conserved. Thus, in the context of HIV-infected human lymphoid tissue, productive HIV infection kills infected cells but is not sufficient to cause the death of a significant number of uninfected CD4(+) T cells.
Directory of Open Access Journals (Sweden)
Yongxing Liu
Full Text Available Controlled differentiation of human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs into cells that resemble adult mesenchymal stem cells (MSCs is an attractive approach to obtain a readily available source of progenitor cells for tissue engineering. The present study reports a new method to rapidly derive MSC-like cells from hESCs and hiPSCs, in one step, based on culturing the cells on thin, fibrillar, type I collagen coatings that mimic the structure of physiological collagen. Human H9 ESCs and HDFa-YK26 iPSCs were singly dissociated in the presence of ROCK inhibitor Y-27632, plated onto fibrillar collagen coated plates and cultured in alpha minimum essential medium (alpha-MEM supplemented with 10% fetal bovine serum, 50 uM magnesium L-ascorbic acid phosphate and 100 nM dexamethasone. While fewer cells attached on the collagen surface initially than standard tissue culture plastic, after culturing for 10 days, resilient colonies of homogenous spindle-shaped cells were obtained. Flow cytometric analysis showed that a high percentage of the derived cells expressed typical MSC surface markers including CD73, CD90, CD105, CD146 and CD166 and were negative as expected for hematopoietic markers CD34 and CD45. The MSC-like cells derived from pluripotent cells were successfully differentiated in vitro into three different lineages: osteogenic, chondrogenic, and adipogenic. Both H9 hES and YK26 iPS cells displayed similar morphological changes during the derivation process and yielded MSC-like cells with similar properties. In conclusion, this study demonstrates that bioimimetic, fibrillar, type I collagen coatings applied to cell culture plates can be used to guide a rapid, efficient derivation of MSC-like cells from both human ES and iPS cells.
LOCAL IMMUNITY BY TISSUE-RESIDENT CD8+ MEMORY T CELLS
Directory of Open Access Journals (Sweden)
Thomas eGebhardt
2012-11-01
Full Text Available Microbial infection primes a CD8+ cytotoxic T cell response that gives rise to a long-lived population of circulating memory cells able to provide protection against systemic reinfection. Despite this, effective CD8+ T cell surveillance of barrier tissues such as skin and mucosa typically wanes with time, resulting in limited T cell-mediated protection in these peripheral tissues. However, recent evidence suggests that a specialized subset of CD103+ memory T cells can permanently lodge and persist in peripheral tissues, and that these cells can compensate for the loss of peripheral immune surveillance by circulating memory T cells. Here, we review evolving concepts regarding the generation and long-term persistence of these tissue-resident memory T cells (TRM in epithelial and neuronal tissues. We further discuss the role of TRM cells in local infection control and their contribution to localized immune phenomena, in both mice and humans.
Dickkopf-3, a tissue-derived modulator of local T cell responses
Directory of Open Access Journals (Sweden)
Michael eMeister
2015-02-01
Full Text Available The adaptive immune system protects organisms from harmful environmental insults. In parallel, regulatory mechanisms control immune responses in order to assure preservation of organ integrity. Yet, molecules involved in the control of T cell responses in peripheral tissues are poorly characterized. Here, we investigated the function of Dickkopf-3 in the modulation of local T cell reactivity. Dkk3 is a secreted, mainly tissue derived protein with highest expression in organs considered as immune privileged such as the eye, embryo, placenta and brain. While T cell development and activation status in naïve Dkk3 deficient mice was comparable to littermate controls, we found that Dkk3 contributes to the immunosuppressive microenvironment that protects transplanted, class-I mismatched embryoid bodies from T cell mediated rejection. Moreover, genetic deletion or antibody mediated neutralization of Dkk3 led to an exacerbated experimental autoimmune encephalomyelitis (EAE. This phenotype was accompanied by a change of T cell polarization displayed by an increase of IFNγ producing T cells within in the CNS. In the wild type situation, Dkk3 expression in the brain was up-regulated during the course of EAE in an IFNγ dependent manner. In turn, Dkk3 decreased IFNγ activity and served as part of a negative feedback mechanism. Thus, our findings suggest that Dkk3 functions as a tissue-derived modulator of local CD4+ and CD8+ T cell responses.
Isolation of Mesenchymal Stromal Cells (MSCs from Human Adenoid Tissue
Directory of Open Access Journals (Sweden)
Yoon Se Lee
2013-04-01
Full Text Available Background: Mesenchymal stromal cells (MSCs are multipotent progenitor cells that originally derived from bone marrow. Clinical use of bone marrow-derived MSC is difficult due to morbidity and low MSC abundance and isolation efficiency. Recently, MSCs have been isolated from various adult tissues. Here we report the isolation of adenoid tissue-derived MSCs (A-MSCs and their characteristics. Methods: We compared the surface markers, morphologies, and differentiation and proliferation capacities of previously established tonsil-derived MSCs (T-MSCs and bone marrow-derived MSCs (BM-MSCs with cells isolated from adenoid tissue. The immunophenotype of A-MSCs was investigated upon interferon (IFN-γ stimulation. Results: A-MSCs, T-MSCs, and BM-MSCs showed negative CD45, CD31 HLA-DR, CD34, CD14, CD19 and positive CD 90, CD44, CD73, CD105 expression. A-MSCs were fibroblast-like, spindle-shaped non-adherent cells, similar to T-MSCs and BM-MSCs. Adipogenesis was observed in A-MSCs by the formation of lipid droplets after Oil Red O staining. Osteogenesis was observed by the formation of the matrix mineralization in Alizarin Red staining. Chondrogenesis was observed by the accumulation of sulfated glycosaminoglycan-rich matrix in collagen type II staining. These data were similar to those of T-MSCs and BM-MSCs. Expression of marker genes (i.e., adipogenesis; lipoprotein lipase, proliferator-activator receptor-gamma, osteogenesis; osteocalcin, alkaline phasphatase, chondrogenesis; aggrecan, collagen type II α1 in A-MSCs were not different from those in T-MSCs and BM-MSCs. Conclusions: A-MSCs possess the characteristics of MSCs in terms of morphology, multipotent differentiation capacity, cell surface markers, and immunogeneity. Therefore, A-MSCs fulfill the definition of MSCs and represent an alternate source of MSCs.
Immig, Kerstin; Gericke, Martin; Menzel, Franziska; Merz, Felicitas; Krueger, Martin; Schiefenhövel, Fridtjof; Lösche, Andreas; Jäger, Kathrin; Hanisch, Uwe-Karsten; Biber, Knut; Bechmann, Ingo
2015-04-01
The brain's immune privilege has been also attributed to the lack of dendritic cells (DC) within its parenchyma and the adjacent meninges, an assumption, which implies maintenance of antigens rather than their presentation in lymphoid organs. Using mice transcribing the green fluorescent protein under the promoter of the DC marker CD11c (itgax), we identified a juxtavascular population of cells expressing this DC marker and demonstrated their origin from bone marrow and local microglia. We now phenotypically compared this population with CD11c/CD45 double-positive cells from lung, liver, and spleen in healthy mice using seven-color flow cytometry. We identified unique, site-specific expression patterns of F4/80, CD80, CD86, CX3CR1, CCR2, FLT3, CD103, and MHC-II. Furthermore, we observed the two known CD45-positive populations (CD45(high) and CD45(int) ) in the brain, whereas liver, lung, and spleen exhibited a homogeneous CD45(high) population. CD11c-positive microglia lacked MHC-II expression and CD45(high) /CD11c-positive cells from the brain have a lower percentage of MHC-II-positive cells. To test whether phenotypical differences are fixed by origin or specifically develop due to environmental factors, we transplanted brain and spleen mononuclear cells on organotypic slice cultures from brain (OHSC) and spleen (OSSC). We demonstrate that adaption and ramification of MHC-II-positive splenocytes is paralleled by down-regulation of MHC-II, whereas brain-derived mononuclear cells neither ramified nor up-regulated MHC-II in OSSCs. Thus, brain-derived mononuclear cells maintain their MHC-II-negative phenotype within the environment of an immune organ. Intraparenchymal CD11c-positive cells share immunophenotypical characteristics of DCs from other organs but remain unique for their low MHC-II expression. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
R. N. Bárcia
2015-01-01
Full Text Available MSCs derived from the umbilical cord tissue, termed UCX, were investigated for their immunomodulatory properties and compared to bone marrow-derived MSCs (BM-MSCs, the gold-standard in immunotherapy. Immunogenicity and immunosuppression were assessed by mixed lymphocyte reactions, suppression of lymphocyte proliferation and induction of regulatory T cells. Results showed that UCX were less immunogenic and showed higher immunosuppression activity than BM-MSCs. Further, UCX did not need prior activation or priming to exert their immunomodulatory effects. This was further corroborated in vivo in a model of acute inflammation. To elucidate the potency differences observed between UCX and BM-MSCs, gene expression related to immune modulation was analysed in both cell types. Several gene expression profile differences were found between UCX and BM-MSCs, namely decreased expression of HLA-DRA, HO-1, IGFBP1, 4 and 6, ILR1, IL6R and PTGES and increased expression of CD200, CD273, CD274, IL1B, IL-8, LIF and TGFB2. The latter were confirmed at the protein expression level. Overall, these results show that UCX seem to be naturally more potent immunosuppressors and less immunogenic than BM-MSCs. We propose that these differences may be due to increased levels of immunomodulatory surface proteins such as CD200, CD273, CD274 and cytokines such as IL1β, IL-8, LIF and TGFβ2.
Directory of Open Access Journals (Sweden)
Rahul Ashok Gosavi
2018-01-01
Full Text Available 12–14 days of culturing of bone marrow (BM cells containing various growth factors is widely used method for generating dendritic cells (DCs from suspended cell population. Here we compared flask culture method and commercially available CD11c Positive Selection kit method. Immature BMDCs’ purity of adherent as well as suspended cell population was generated in the decreasing concentration of recombinant-murine granulocyte-macrophage colony-stimulating factor (rmGM-CSF in nontreated tissue culture flasks. The expression of CD11c, MHCII, CD40, and CD86 was measured by flow cytometry. We found significant difference (P<0.05 between the two methods in the adherent cells population but no significant difference was observed between the suspended cell populations with respect to CD11c+ count. However, CD11c+ was significantly higher in both adhered and suspended cell population by culture method but kit method gave more CD11c+ from suspended cells population only. On the other hand, using both methods, immature DC expressed moderate level of MHC class II molecules as well as low levels of CD40 and CD86. Our findings suggest that widely used culture method gives the best results in terms of yield, viability, and purity of BMDCs from both adherent and suspended cell population whereas kit method works well for suspended cell population.
Hagmann, Sebastien; Moradi, Babak; Frank, Sebastian; Dreher, Thomas; Kämmerer, Peer Wolfgang; Richter, Wiltrud; Gotterbarm, Tobias
2013-07-30
Bone marrow-derived mesenchymal stromal cells (BM-MSCs) play an important role in modern tissue engineering, while distinct variations of culture media compositions and supplements have been reported. Because MSCs are heterogeneous regarding their regenerative potential and their surface markers, these parameters were compared in four widely used culture media compositions. MSCs were isolated from bone marrow and expanded in four established cell culture media. MSC yield/1000 MNCs, passage time and growth index were observed. In P4, typical MSC surface markers were analysed by fluorescence cytometry. Additionally, chondrogenic, adipogenic and osteogenic differentiation potential were evaluated. Growth index and P0 cell yield varied importantly between the media. The different expansion media had a significant influence on the expression of CD10, CD90, CD105, CD140b CD146 and STRO-1. While no significant differences were observed regarding osteogenic and adipogenic differentiation, chondrogenic differentiation was superior in medium A as reflected by GAG/DNA content. The choice of expansion medium can have a significant influence on growth, differentiation potential and surface marker expression of mesenchymal stromal cells, which is of fundamental importance for tissue engineering procedures.
Volkova, Elena K.; Yanina, Irina Yu.; Sagaydachnaya, Elena; Konyukhova, Julia G.; Kochubey, Vyacheslav I.; Tuchin, Valery V.
2018-02-01
The spectra of luminescence of ZnCdS nanoparticles (ZnCdS NPs) were measured and analyzed in a wide temperature range: from room to human body and further to a hyperthermic temperature resulting in tissue morphology change. The results show that the signal of luminescence of ZnCdS NPs placed within the tissue is reasonably good sensitive to temperature change and accompanied by phase transitions of lipid structures of adipose tissue. It is shown that the presence of a phase transition in adipose tissue upon its heating (polymorphic transformations of lipids) leads to a nonmonotonic temperature dependence of the intensity of luminescence for the nanoparticles introduced into adipose tissue. This is due to a change in the light scattering by the tissue. The light scattering of adipose tissue greatly distorts the results of temperature measurements. The application of these nanoparticles is possible for temperature measurements in very thin or weakly scattering samples.
Directory of Open Access Journals (Sweden)
Heiner Falkenberg
2013-01-01
Full Text Available Ex vivo expansion of haematopoetic cells by application of specific cytokines is one approach to overcome boundaries in cord blood transplantation due to limited numbers of haematopoetic stem cells. While many protocols describe an effective increase of total cell numbers and the amount of CD34-positive cells, it still remains unclear if and how the procedure actually affects the cells’ properties. In the presented publications, CD34-positive cells were isolated from cord blood and expanded for up to 7 days in media supplemented with stem cell factor (SCF, thrombopoietin (THPO, interleukin 6 (IL-6, and fms-related tyrosine kinase 3 ligand (FLT3lg. At days 3 and 7, expanded cells were harvested and analyzed by flow cytometry and quantitative proteomics. 2970 proteins were identified, whereof proteomic analysis showed 440 proteins significantly changed in abundance during ex vivo expansion. Despite the fact that haematopoetic cells still expressed CD34 on the surface after 3 days, major changes in regard to the protein profile were observed, while further expansion showed less effect on the proteome level. Enrichment analysis of biological processes clearly showed a proteomic change toward a protein biosynthesis phenotype already within the first three days of expression.
Directory of Open Access Journals (Sweden)
Mehdi Mesri
Full Text Available Genomic and proteomic analysis of normal and cancer tissues has yielded abundant molecular information for potential biomarker and therapeutic targets. Considering potential advantages in accessibility to pharmacological intervention, identification of targets resident on the vascular endothelium within tumors is particularly attractive. By employing mass spectrometry (MS as a tool to identify proteins that are over-expressed in tumor-associated endothelium relative to normal cells, we aimed to discover targets that could be utilized in tumor angiogenesis cancer therapy. We developed proteomic methods that allowed us to focus our studies on the discovery of cell surface/secreted proteins, as they represent key antibody therapeutic and biomarker opportunities. First, we isolated endothelial cells (ECs from human normal and kidney cancer tissues by FACS using CD146 as a marker. Additionally, dispersed human colon and lung cancer tissues and their corresponding normal tissues were cultured ex-vivo and their endothelial content were preferentially expanded, isolated and passaged. Cell surface proteins were then preferentially captured, digested with trypsin and subjected to MS-based proteomic analysis. Peptides were first quantified, and then the sequences of differentially expressed peptides were resolved by MS analysis. A total of 127 unique non-overlapped (157 total tumor endothelial cell over-expressed proteins identified from directly isolated kidney-associated ECs and those identified from ex-vivo cultured lung and colon tissues including known EC markers such as CD146, CD31, and VWF. The expression analyses of a panel of the identified targets were confirmed by immunohistochemistry (IHC including CD146, B7H3, Thy-1 and ATP1B3. To determine if the proteins identified mediate any functional role, we performed siRNA studies which led to previously unidentified functional dependency for B7H3 and ATP1B3.
CD163 positive subsets of blood dendritic cells
DEFF Research Database (Denmark)
Maniecki, Maciej Bogdan; Møller, Holger Jon; Moestrup, Søren Kragh
2006-01-01
CD163 and CD91 are scavenging receptors with highly increased expression during the differentiation of monocytes into the anti-inflammatory macrophage phenotype. In addition, CD91 is expressed in monocyte-derived dendritic cells (MoDCs), where the receptor is suggested to be important...... for internalization of CD91-targeted antigens to be presented on the dendritic cell surface for T-cell stimulation. Despite their overlap in functionality, the expression of CD91 and CD163 has never been compared and the expression of CD163 in the monocyte-dendritic cell lineage is not yet characterized. CD163...... expression in dendritic cells (DCs) was investigated using multicolor flow cytometry in peripheral blood from 31 healthy donors and 15 HIV-1 patients in addition to umbilical cord blood from 5 newborn infants. Total RNA was isolated from MACS purified DCs and CD163 mRNA was determined with real-time reverse...
Ecto-ATPase CD39 Inactivates Isoprenoid-Derived Vγ9Vδ2 T Cell Phosphoantigens
Directory of Open Access Journals (Sweden)
Georg Gruenbacher
2016-07-01
Full Text Available In humans, Vγ9Vδ2 T cells respond to self and pathogen-associated, diphosphate-containing isoprenoids, also known as phosphoantigens (pAgs. However, activation and homeostasis of Vγ9Vδ2 T cells remain incompletely understood. Here, we show that pAgs induced expression of the ecto-ATPase CD39, which, however, not only hydrolyzed ATP but also abrogated the γδ T cell receptor (TCR agonistic activity of self and microbial pAgs (C5 to C15. Only mevalonate-derived geranylgeranyl diphosphate (GGPP, C20 resisted CD39-mediated hydrolysis and acted as a regulator of CD39 expression and activity. GGPP enhanced macrophage differentiation in response to the tissue stress cytokine interleukin-15. In addition, GGPP-imprinted macrophage-like cells displayed increased capacity to produce IL-1β as well as the chemokine CCL2 and preferentially activated CD161-expressing CD4+ T cells in an innate-like manner. Our studies reveal a previously unrecognized immunoregulatory function of CD39 and highlight a particular role of GGPP among pAgs.
Bone marrow-derived CD13+ cells sustain tumor progression
Dondossola, Eleonora; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata
2014-01-01
Non-malignant cells found within neoplastic lesions express alanyl (membrane) aminopeptidase (ANPEP, best known as CD13), and CD13-null mice exhibit limited tumor growth and angiogenesis. We have recently demonstrated that a subset of bone marrow-derived CD11b+CD13+ myeloid cells accumulate within neoplastic lesions in several murine models of transplantable cancer to promote angiogenesis. If these findings were confirmed in clinical settings, CD11b+CD13+ myeloid cells could become a non-malignant target for the development of novel anticancer regimens. PMID:25339996
Directory of Open Access Journals (Sweden)
Qian Cheng
2017-01-01
Full Text Available Exosomes derived from cancer cells can affect various functions of mesenchymal stem cells (MSCs via conveying microRNAs (miRs. miR-21 and miR-146a have been demonstrated to regulate MSC proliferation and transformation. Interleukin-6 (IL-6 secreted from transformed MSCs in turn favors the survival of multiple myeloma (MM cells. However, the effects of MM exosomes on MSC functions remain largely unclear. In this study, we investigated the effects of OPM2 (a MM cell line exosomes (OPM2-exo on regulating the proliferation, cancer-associated fibroblast (CAF transformation, and IL-6 secretion of MSCs and determined the role of miR-21 and miR-146a in these effects. We found that OPM2-exo harbored high levels of miR-21 and miR-146a and that OPM2-exo coculture significantly increased MSC proliferation with upregulation of miR-21 and miR-146a. Moreover, OPM2-exo induced CAF transformation of MSCs, which was evidenced by increased fibroblast-activated protein (FAP, α-smooth muscle actin (α-SMA, and stromal-derived factor 1 (SDF-1 expressions and IL-6 secretion. Inhibition of miR-21 or miR-146a reduced these effects of OPM2-exo on MSCs. In conclusion, MM could promote the proliferation, CAF transformation, and IL-6 secretion of MSCs partially through regulating miR21 and miR146a.
Characterization Of Bovine Adipose-Derived Stem Cells
Daniel Cebo
2017-01-01
Bovine adipose-derived stem cells were obtained from the subcutaneous abdominal adipose tissue. The cells were cultured by the modified tissue-explants method developed in our laboratory and then analyzed using optical microscopy and flow cytometry. These cells were able to replicate in our cell culture conditions. cell Flow cytometry showed that bovine adipose-derived stem cells expressed mesenchymal stem cell markers CD73 and CD90. Meanwhile haematopoietic markers CD45 and CD34 are absent f...
Directory of Open Access Journals (Sweden)
MW Laschke
2014-10-01
Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.
van den Berg, T. K.; Hasbold, J.; Renardel de Lavalette, C.; Döpp, E. A.; Dijkstra, C. D.; Klaus, G. G.
1996-01-01
In this study we describe the tissue distribution of mouse CD40 using two monoclonal antibodies (mAb) against different epitopes of the molecule. In lymphoid tissues CD40 was expressed by B lymphocytes. Most B cells in typical B-cell compartments were CD40-positive, including germinal centre B
Effect of curcumin on the cell surface markers CD44 and CD24 in breast cancer.
Calaf, Gloria M; Ponce-Cusi, Richard; Abarca-Quinones, Jorge
2018-04-20
Human breast cell lines are often characterized based on the expression of the cell surface markers CD44 and CD24. CD44 is a type I transmembrane glycoprotein that regulates cell adhesion and cell-cell, as well as cell-extracellular matrix interactions. CD24 is expressed in benign and malignant solid tumors and is also involved in cell adhesion and metastasis. The aim of the present study was to investigate the effects of curcumin on the surface expression of CD44 and CD24 in breast epithelial cell lines. An established breast cancer model derived from the MCF-10F cell line was used. The results revealed that curcumin decreased CD44 and CD24 gene and protein expression levels in MCF-10F (normal), Alpha5 (premalignant) and Tumor2 (malignant) cell lines compared with the levels in their counterpart control cells. Flow cytometry revealed that the CD44+/CD24+ cell subpopulation was greater than the CD44+/CD24- subpopulation in these three cell lines. Curcumin increased CD44+/CD24+ to a greater extent and decreased CD44+/CD24- subpopulations in the normal MCF-10F and the pre-tumorigenic Alpha5 cells, but had no significant effect on Tumor2 cells compared with the corresponding control cells. Conversely, curcumin increased CD44 and decreased CD24 gene expression in MCF-7 breast cancer cells, and decreased CD44 gene expression in MDA-MB-231 cell line, while CD24 was not present in these cells. Curcumin did not alter the CD44+/CD24+ or CD44+/CD24- subpopulations in the MCF-7 cell line. However, it increased CD44+/CD24+ and decreased CD44+/CD24- subpopulations in MDA-MB-231 cells. In breast cancer specimens from patients, normal tissues were negative for CD44 and CD24 expression, while benign lesions were positive for both markers, and malignant tissues were found to be negative for CD44 and positive for CD24 in most cases. In conclusion, these results indicated that curcumin may be used to improve the proportion of CD44+/CD24+ cells and decrease the proportion of CD44
miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.
Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili
2017-10-02
Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.
Directory of Open Access Journals (Sweden)
Xue-Jun Zhu
Full Text Available Dendritic cells (DCs regulate innate and acquired immunity through their roles as antigen-presenting cells. Specific subsets of mature DCs, including monocyte-derived and lymphoid-derived DCs, can be distinguished based on distinct immunophenotypes and functional properties. The leukocyte integrin, CD11c, is considered a specific marker for DCs and it is expressed by all DC subsets. We created a strain of mice in which DCs and their progenitors could be lineage traced based on activity of the CD11c proximal promoter. Surprisingly, we observed levels of CD11c promoter activity that were similar in DCs and in other mature leukocytes, including monocytes, granulocytes, and lymphocytes. We sought to identify DNA elements and transcription factors that regulate DC-associated expression of CD11c. The ets transcription factor, PU.1, is a key regulator of DC development, and expression of PU.1 varies in different DC subsets. GM-CSF increased monocyte-derived DCs in mice and from mouse bone marrow cultured in vitro, but it did not increase CD8(+ lymphoid-derived DCs or B220(+ plasmacytoid DCs. FLT3L increased both monocyte-derived DCs and lymphoid-derived DCs from mouse bone marrow cultured in vitro. GM-CSF increased the 5.3 Kb CD11c proximal promoter activity in monocyte-derived DCs and CD8(+ lymphoid-derived DCs, but not in B220(+ plasmacytoid DCs. In contrast, FLT3L increased the CD11c proximal promoter activity in both monocyte-derived DCs and B220(+ plasmacytoid DCs. We used shRNA gene knockdown and chromatin immunoprecipitation to demonstrate that PU.1 is required for the effects of GM-CSF or FLT3L on monocyte-derived DCs. We conclude that both GM-CSF and FLT3L act through PU.1 to activate the 5.3 Kb CD11c proximal promoter in DCs and to induce differentiation of monocyte-derived DCs. We also confirm that the CD11c proximal promoter is not sufficient to direct lineage specificity of CD11c expression, and that additional DNA elements are required
DEFF Research Database (Denmark)
Ditte Caroline Andersen, Ditte Caroline; Kristiansen, Gitte Qvist; Jensen, Line
2012-01-01
The skeletal muscle-derived side population (mSP) which highly excludes Hoechst 33342 is composed of CD45(+) and CD45(-) subpopulations; yet, rareness of mSP cells in general has complicated extensive quantitative analysis of gene expression profiles in primarily isolated mSP cells. Here, we desc...... a satellite cell subpopulation) remain in the mSPCD45(-) fraction, and we show that these cells express high levels of many of the known myogenic precursor/stem cell related markers, including Pax7 and Myf5.......The skeletal muscle-derived side population (mSP) which highly excludes Hoechst 33342 is composed of CD45(+) and CD45(-) subpopulations; yet, rareness of mSP cells in general has complicated extensive quantitative analysis of gene expression profiles in primarily isolated mSP cells. Here, we...... describe the isolation of adult mouse normal skeletal muscle residing SPCD45(+) and SPCD45(-) cells from a parent mononuclear muscle-derived cell (MDC) population. Relative quantitative real time PCR (RT-PCR) of 64 genes revealed that mSPCD45(-) compared with mSPCD45(+) was enriched for cells expressing...
Liang, Zhi-Jie; Huang, Min-Hong; Peng, Qi-Liu; Zou, Dong-Hua; Gu, Rong-He; Xu, Fang-Tian; Gao, Hui; Chen, Zhen-Dong; Chi, Guang-Yi; Wei, Zhong-Heng; Chen, Li; Li, Hong-Mian
2017-01-01
Fat flap transplantation is frequently performed in patients suffering from soft tissue defects resulting from disease or trauma. This study explored the feasibility of constructing vascularized fat flaps using rabbit adipose-derived stem cells (rASCs) and collagen scaffolds in a rabbit model. We evaluated rASCs proliferation, paracrine function, adipogenesis, vascularization, and CD54 expression, with or without HIF-1α transfection in vitro and in vivo. We observed that adipogenic differentiation potential was greater in rASCs with high CD54 expression (CD54+rASCs) than in those with low expression (CD54–rASCs), both in vitro and in vivo. HIF-1α overexpression not only augmented this effect, but also enhanced cell proliferation and paracrine function in vitro. We also demonstrated that HIF-1α-transfected CD54+rASCs showed enhanced paracrine function and adipogenic capacity, and that paracrine function increases expression of angiogenesis-related markers. Thus, CD54+rASCs overexpressing HIF-1α enhanced large volume vascularized fat flap regeneration in rabbits, suggesting CD54 may be an ideal candidate marker for ASCs adipogenic differentiation. PMID:28423354
Directory of Open Access Journals (Sweden)
Emerence Crompot
Full Text Available Microparticles (MPs, also called microvesicles (MVs are plasma membrane-derived fragments with sizes ranging from 0.1 to 1μm. Characterization of these MPs is often performed by flow cytometry but there is no consensus on the appropriate negative control to use that can lead to false positive results.We analyzed MPs from platelets, B-cells, T-cells, NK-cells, monocytes, and chronic lymphocytic leukemia (CLL B-cells. Cells were purified by positive magnetic-separation and cultured for 48h. Cells and MPs were characterized using the following monoclonal antibodies (CD19,20 for B-cells, CD3,8,5,27 for T-cells, CD16,56 for NK-cells, CD14,11c for monocytes, CD41,61 for platelets. Isolated MPs were stained with annexin-V-FITC and gated between 300nm and 900nm. The latex bead technique was then performed for easy detection of MPs. Samples were analyzed by Transmission (TEM and Scanning Electron microscopy (SEM.Annexin-V positive events within a gate of 300-900nm were detected and defined as MPs. Our results confirmed that the characteristic antigens CD41/CD61 were found on platelet-derived-MPs validating our technique. However, for MPs derived from other cell types, we were unable to detect any antigen, although they were clearly expressed on the MP-producing cells in the contrary of several data published in the literature. Using the latex bead technique, we confirmed detection of CD41,61. However, the apparent expression of other antigens (already deemed positive in several studies was determined to be false positive, indicated by negative controls (same labeling was used on MPs from different origins.We observed that mother cell antigens were not always detected on corresponding MPs by direct flow cytometry or latex bead cytometry. Our data highlighted that false positive results could be generated due to antibody aspecificity and that phenotypic characterization of MPs is a difficult field requiring the use of several negative controls.
Arslan, Yavuz Emre; Sezgin Arslan, Tugba; Derkus, Burak; Emregul, Emel; Emregul, Kaan C
2017-06-01
In the present study, we aimed at fabricating an osteoinductive biocomposite scaffold using keratin obtained from human hair, jellyfish collagen and eggshell-derived nano-sized spherical hydroxyapatite (nHA) for bone tissue engineering applications. Keratin, collagen and nHA were characterized with the modified Lowry method, free-sulfhydryl groups and hydroxyproline content analysis, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), attenuated total reflectance-fourier transform infrared spectroscopy (ATR-FTIR) and thermal gravimetric analysis (TGA) which confirmed the success of the extraction and/or isolation processes. Human adipose mesenchymal stem cells (hAMSCs) were isolated and the cell surface markers were characterized via flow cytometry analysis in addition to multilineage differentiation capacity. The undifferentiated hAMSCs were highly positive for CD29, CD44, CD73, CD90 and CD105, but were not seen to express hematopoietic cell surface markers such as CD14, CD34 and CD45. The cells were successfully directed towards osteogenic, chondrogenic and adipogenic lineages in vitro. The microarchitecture of the scaffolds and cell attachment were evaluated using scanning electron microscopy (SEM). The cell viability on the scaffolds was assessed by the MTT assay which revealed no evidence of cytotoxicity. The osteogenic differentiation of hAMSCs on the scaffolds was determined histologically using alizarin red S, osteopontin and osteonectin stainings. Early osteogenic differentiation markers of hAMSCs were significantly expressed on the collagen-keratin-nHA scaffolds. In conclusion, it is believed that collagen-keratin-nHA osteoinductive biocomposite scaffolds have the potential of being used in bone tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Robert B Lochhead
2014-06-01
Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B
Directory of Open Access Journals (Sweden)
Oh Young Bang
Full Text Available Cancer and stroke, which are known to be associated with one another, are the most common causes of death in the elderly. However, the pathomechanisms that lead to stroke in cancer patients are not well known. Circulating extracellular vesicles (EVs play a role in cancer-associated thrombosis and tumor progression. Therefore, we hypothesized that cancer cell-derived EVs cause cancer-related coagulopathy resulting in ischemic stroke.Serum levels of D-dimer and EVs expressing markers for cancer cells (epithelial cell adhesion molecule [CD326], tissue factor (TF [CD142], endothelial cells (CD31+CD42b-, and platelets (CD62P were measured using flow cytometry in (a 155 patients with ischemic stroke and active cancer (116 - cancer-related, 39 - conventional stroke mechanisms, (b 25 patients with ischemic stroke without cancer, (c 32 cancer patients without stroke, and (d 101 healthy subjects.The levels of cancer cell-derived EVs correlated with the levels of D-dimer and TF+ EVs. The levels of cancer cell-derived EVs (CD326+ and CD326+CD142+ were higher in cancer-related stroke than in other groups (P<0.05 in all the cases. Path analysis showed that cancer cell-derived EVs are related to stroke via coagulopathy as measured by D-dimer levels. Poor correlation was observed between TF+ EV and D-dimer, and path analysis demonstrated that cancer cell-derived EVs may cause cancer-related coagulopathy independent of the levels of TF+ EVs.Our findings suggest that cancer cell-derived EVs mediate coagulopathy resulting in ischemic stroke via TF-independent mechanisms.
Rao, I G; Singh, Amrita; Singh, V K; Singh, D K
2003-01-01
Effect of single and binary treatments of plant-derived molluscicides on different enzymes--acetylcholinesterase (AChE), lactic dehydrogenase (LDH) and acid/alkaline phosphatase (ACP/ALP)--in the nervous tissue of the harmful terrestrial snail Achatina fulica were studied. Sublethal in vivo 24-h exposure to 40% and 80% LC(50) of Azadirachta indica oil, Cedrus deodara oil, Allium sativum bulb powder, Nerium indicum bark powder and binary combinations of A. sativum (AS) + C. deodara (CD) and CD + A. indica (AI) oils significantly altered the activity of these enzymes in the nervous tissue of Achatina fulica. The binary treatment of AS + CD was more effective against AChE, LDH, and ALP than the single ones. However, binary treatment of AI + CD was more effective against ALP. Copyright 2003 John Wiley & Sons, Ltd.
CD34-positive cells as stem cell support after high dose therapy
International Nuclear Information System (INIS)
Kvalheim, G.; Pharo, A.; Holte, H.
1996-01-01
Six patients, five with breast cancer and one with non-Hodgkin's lymphoma, were mobilized by chemotherapy and G-CSF. CD34-positive cells were isolated by means of immunomagnetic beads and Isolex 300 Cell Separator. Mean purity of isolated CD34-positive cells was 97% and mean yield was 54%. Three patients were treated with high dose therapy followed by reinfusion of CD34-positive cells as stem cell support. Recovery of neutrophils occurred at day 8, 11 and 13 and of platelets at day 9, 14 and 32. It is concluded that immunomagnetic isolated CD34-positive cells give high purity and yield. Although use of CD34-positive cells reduces the content of contaminating tumours cells in the graft, breast cancer cells were still detectable in two out of five CD34-positive cell products. 20 refs., 2 figs., 1 tab
Directory of Open Access Journals (Sweden)
Shogo Inoue
2017-01-01
Full Text Available The objective is to develop an easier technique for regenerating corpora cavernosa tissue through transplantation of human bone marrow-derived CD133 + cells into a rat corpora cavernosa defect model. We excised 2 mm × 2 mm squares of the right corpora cavernosa of twenty-three 8-week-old male nude rats. Alginate gel sponge sheets supplemented with 1 × 10 4 CD133 + cells were then placed over the excised area of nine rats. Functional and histological evaluations were carried out 8 weeks later. The mean intracavernous pressure/mean arterial pressure ratio for the nine rats (0.34258 ± 0.0831 was significantly higher than that for eight rats with only the excision (0.0580 ± 0.0831, P = 0.0238 and similar to that for five rats for which the penis was exposed, and there was no excision (0.37228 ± 0.1051, P = 0.8266. Immunohistochemical analysis revealed that the nine fully treated rats had venous sinus-like structures and quantitative reverse transcription polymerase chain reaction analysis of extracts from their alginate gel sponge sheets revealed that the amounts of mRNA encoding the nerve growth factor (NGF, and vascular endothelial growth factor (VEGF were significantly higher than those for rats treated with alginate gel sheets without cell supplementation (NGF: P = 0.0309; VEGF: P < 0.0001. These findings show that transplantation of CD133 + cells accelerates functional and histological recovery in the corpora cavernosa defect model.
Rh antigen expression during erythropoeisis: Comparison of cord and adult derived CD34 + cells
Directory of Open Access Journals (Sweden)
Gupta Namita
2008-01-01
Full Text Available Objectives: Concentrations of O 2 and CO 2 in the fetal circulation differ to that in maternal blood. Previous studies done in algae demonstrate the functional role of Rh antigen as CO 2 transporter. As a preliminary study, it was the aim of this project to compare the expression of Rh polypeptides on cord and adult red blood cell progenitors during ex vivo proliferation and differentiation of CD34 + cells during erythropoeisis. Materials and Methods: CD34 positive hematopoeitic progenitor cells were isolated from umbilical cord blood and adult peripheral blood using an immunomagnetic system and cultured in serum free medium containing erythropoietin in order to compel them along the erythroid lineage. Cultured cells were analyzed for cell surface marker expression by flow cytometry, using monoclonal antibodies to RhAG, Glycophorin A, Rh polypeptides, CD47 and Band 3. Cytospin analysis was also done to study the morphology of cultured cells. Results: The appearance of cell surface markers analyzed on different days of culture varied slightly between samples. There was no evidence to suggest that RhAG, GPA, CD47 and Band 3 expression was any different between adult and cord derived cells. Nevertheless, the results of Rh antigenic expression suggest a reasonable difference between the two groups with adult sample derived cells showing higher and earlier expression than cord blood derived cells. These preliminary findings require further investigation. Conclusion: Comparing the expression of cell surface markers especially Rh polypeptides between adult and cord blood derived erythroid progenitors might assist in discerning their functions and could be valuable in the study of erythropoeisis.
König, Matthias A; Canepa, Daisy D; Cadosch, Dieter; Casanova, Elisa; Heinzelmann, Michael; Rittirsch, Daniel; Plecko, Michael; Hemmi, Sonja; Simmen, Hans-Peter; Cinelli, Paolo; Wanner, Guido A
2016-01-01
Fractures with a critical size bone defect (e.g., open fracture with segmental bone loss) are associated with high rates of delayed union and non-union. The prevention and treatment of these complications remain a serious issue in trauma and orthopaedic surgery. Autologous cancellous bone grafting is a well-established and widely used technique. However, it has drawbacks related to availability, increased morbidity and insufficient efficacy. Mesenchymal stromal cells can potentially be used to improve fracture healing. In particular, human fat tissue has been identified as a good source of multilineage adipose-derived stem cells, which can be differentiated into osteoblasts. The main issue is that mesenchymal stromal cells are a heterogeneous population of progenitors and lineage-committed cells harboring a broad range of regenerative properties. This heterogeneity is also mirrored in the differentiation potential of these cells. In the present study, we sought to test the possibility to enrich defined subpopulations of stem/progenitor cells for direct therapeutic application without requiring an in vitro expansion. We enriched a CD146+NG2+CD45- population of pericytes from freshly isolated stromal vascular fraction from mouse fat tissue and tested their osteogenic differentiation capacity in vitro and in vivo in a mouse model for critical size bone injury. Our results confirm the ability of enriched CD146+NG2+CD45- cells to efficiently generate osteoblasts in vitro, to colonize cancellous bone scaffolds and to successfully contribute to regeneration of large bone defects in vivo. This study represents proof of principle for the direct use of enriched populations of cells with stem/progenitor identity for therapeutic applications. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
21 CFR 146.146 - Frozen concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen concentrated orange juice. 146.146 Section... Fruit Juices and Beverages § 146.146 Frozen concentrated orange juice. (a) Frozen concentrated orange juice is the food prepared by removing water from the juice of mature oranges as provided in § 146.135...
Directory of Open Access Journals (Sweden)
Guojiang Chen
Full Text Available BACKGROUND: CD4(+CD25(+ regulatory T cell (Treg-based immunotherapy is considered a promising regimen for controlling the progression of autoimmune diabetes. In this study, we tested the hypothesis that the therapeutic effects of Tregs in response to the antigenic epitope stimulation depend on the structural properties of the epitopes used. METHODOLOGY/PRINCIPAL FINDINGS: Splenic lymphocytes from nonobese diabetic (NOD mice were stimulated with different glutamic acid decarboxylase (GAD-derived epitopes for 7-10 days and the frequency and function of Tregs was analyzed. We found that, although all expanded Tregs showed suppressive functions in vitro, only p524 (GAD524-538-expanded CD4(+CD25(+ T cells inhibited diabetes development in the co-transfer models, while p509 (GAD509-528- or p530 (GAD530-543-expanded CD4(+CD25(+ T cells had no such effects. Using computer-guided molecular modeling and docking methods, the differences in structural characteristics of these epitopes and the interaction mode (including binding energy and identified domains in the epitopes between the above-mentioned epitopes and MHC class II I-A(g7 were analyzed. The theoretical results showed that the epitope p524, which induced protective Tregs, possessed negative surface-electrostatic potential and bound two chains of MHC class II I-A(g7, while the epitopes p509 and p530 which had no such ability exhibited positive surface-electrostatic potential and bound one chain of I-A(g7. Furthermore, p524 bound to I-A(g7 more stably than p509 and p530. Of importance, we hypothesized and subsequently confirmed experimentally that the epitope (GAD570-585, p570, which displayed similar characteristics to p524, was a protective epitope by showing that p570-expanded CD4(+CD25(+ T cells suppressed the onset of diabetes in NOD mice. CONCLUSIONS/SIGNIFICANCE: These data suggest that molecular modeling-based structural analysis of epitopes may be an instrumental tool for prediction of
Park, Jeong-Ran; Lee, Hanbyeol; Kim, Chung-Hyo; Hong, Seok-Ho; Ha, Kwon-Soo; Yang, Se-Ran
2016-05-01
Mesenchymal stem cells (MSCs) can be isolated from various tissues including bone marrow, adipose tissue, skin dermis, and umbilical Wharton's jelly as well as injured tissues. MSCs possess the capacity for self-renewal and the potential for differentiation into adipogenic, osteogenic, and chondrogenic lineages. However, the characteristics of MSCs in injured tissues, such as achondroplasia (ACH), are not well known. In this study, we isolated MSCs from human subcutaneous adipose (ACH-SAMSCs) tissue and circumjacent human adipose tissue of the cartilage (ACH-CAMSCs) from a patient with ACH. We then analyzed the characterization of ACH-SAMSCs and ACH-CAMSCs, compared with normal human dermis-derived MSCs (hDMSCs). In flow cytometry analysis, the isolated ACH-MSCs expressed low levels of CD73, CD90, and CD105, compared with hDMSCs. Moreover, both ACH- SAMSCs and ACH-CAMSCs had constitutionally overactive fibroblast growth factor receptor 3 (FGFR3) and exhibited significantly reduced osteogenic differentiation, compared to enhanced adipogenic differentiation. The activity of extracellular signal-regulated kinases 1/2 (ERK1/2) and p38 mitogen-activated protein kinases (p38 MAPK) was increased in ACH-MSCs. In addition, the efficacy of osteogenic differentiation was slightly restored in osteogenic differentiation medium with MAPKs inhibitors. These results suggest that they play essential roles in MSC differentiation toward adipogenesis in ACH pathology. In conclusion, the identification of the characteristics of ACH-MSCs and the favoring of adipogenic differentiation via the FGFR3/MAPK axis might help to elucidate the pathogenic mechanisms relevant to other skeletal diseases and could provide targets for therapeutic interventions.
CD34-positive interstitial cells of the human detrusor
DEFF Research Database (Denmark)
Rasmussen, Helle; Hansen, Alastair; Smedts, Frank
2007-01-01
using a panel of antibodies directed against CD117/c-kit, CD34, CD31, S100, tryptase, neurofilament, NSE, Factor-VIII and GFAP. A striking finding was an interstitial type of cell which is CD34 immunoreactive (CD34-ir) but CD117/c-kit negative. The cells have a tentacular morphology, enveloping...... flattened processes, ramifying primarily in a bipolar fashion. Using immunoelectron microscopy (I-TEM) it was possible to view CD34 gold labelling of cells corresponding to interstitial cells. Although similar CD34-positive cells have been demonstrated in the bowel wall, they have never been described...... in the detrusor. The ontogeny and function of CD34-ir, a kit-negative cell, is unknown, but it may be involved in smooth muscle contraction....
Lee, Jae Geun; Bak, Seon Young; Nahm, Ji Hae; Lee, Sang Woo; Min, Seon Ok; Kim, Kyung Sik
2015-05-01
Stem cell therapies for liver disease are being studied by many researchers worldwide, but scientific evidence to demonstrate the endocrinologic effects of implanted cells is insufficient, and it is unknown whether implanted cells can function as liver cells. Achieving angiogenesis, arguably the most important characteristic of the liver, is known to be quite difficult, and no practical attempts have been made to achieve this outcome. We carried out this study to observe the possibility of angiogenesis of implanted bio-artificial liver using scaffolds. This study used adipose tissue-derived stem cells that were collected from adult patients with liver diseases with conditions similar to the liver parenchyma. Specifically, microfilaments were used to create an artificial membrane and maintain the structure of an artificial organ. After scratching the stomach surface of severe combined immunocompromised (SCID) mice (n=4), artificial scaffolds with adipose tissue-derived stem cells and type I collagen were implanted. Expression levels of angiogenesis markers including vascular endothelial growth factor (VEGF), CD34, and CD105 were immunohistochemically assessed after 30 days. Grossly, the artificial scaffolds showed adhesion to the stomach and surrounding organs; however, there was no evidence of angiogenesis within the scaffolds; and VEGF, CD34, and CD105 expressions were not detected after 30 days. Although implantation of cells into artificial scaffolds did not facilitate angiogenesis, the artificial scaffolds made with type I collagen helped maintain implanted cells, and surrounding tissue reactions were rare. Our findings indicate that type I collagen artificial scaffolds can be considered as a possible implantable biomaterial.
Gupta, Sweta K; Dinda, Amit K; Potdar, Pravin D; Mishra, Narayan C
2013-10-01
The present study aims to fabricate scaffold from cadaver goat-lung tissue and evaluate it for skin tissue engineering applications. Decellularized goat-lung scaffold was fabricated by removing cells from cadaver goat-lung tissue enzymatically, to have cell-free 3D-architecture of natural extracellular matrix. DNA quantification assay and Hematoxylin and eosin staining confirmed the absence of cellular material in the decellularized lung-tissue. SEM analysis of decellularized scaffold shows the intrinsic porous structure of lung tissue with well-preserved pore-to-pore interconnectivity. FTIR analysis confirmed non-denaturation and well maintainance of collagenous protein structure of decellularized scaffold. MTT assay, SEM analysis and H&E staining of human skin-derived Mesenchymal Stem cell, seeded over the decellularized scaffold, confirms stem cell attachment, viability, biocompatibility and proliferation over the decellularized scaffold. Expression of Keratin18 gene, along with CD105, CD73 and CD44, by human skin-derived Mesenchymal Stem cells over decellularized scaffold signifies that the cells are viable, proliferating and migrating, and have maintained their critical cellular functions in the presence of scaffold. Thus, overall study proves the applicability of the goat-lung tissue derived decellularized scaffold for skin tissue engineering applications. Copyright © 2013 Elsevier B.V. All rights reserved.
Askari, Arman T.; Unzek, Samuel; Popovic, Zoran B.; Goldman, Corey K.; Forudi, Farhad; Kiedrowski, Matthew; Rovner, Aleksandr; Ellis, Stephen G.; Thomas, James D.; DiCorleto, Paul E.;
2003-01-01
BACKGROUND: Myocardial regeneration via stem-cell mobilisation at the time of myocardial infarction is known to occur, although the mechanism for stem-cell homing to infarcted tissue subsequently and whether this approach can be used for treatment of ischaemic cardiomyopathy are unknown. We investigated these issues in a Lewis rat model (ligation of the left anterior descending artery) of ischaemic cardiomyopathy. METHODS: We studied the effects of stem-cell mobilisation by use of granulocyte colony-stimulating factor (filgrastim) with or without transplantation of syngeneic cells. Shortening fraction and myocardial strain by tissue doppler imaging were quantified by echocardiography. FINDINGS: Stem-cell mobilisation with filgrastim alone did not lead to engraftment of bone-marrow-derived cells. Stromal-cell-derived factor 1 (SDF-1), required for stem-cell homing to bone marrow, was upregulated immediately after myocardial infarction and downregulated within 7 days. 8 weeks after myocardial infarction, transplantation into the peri-infarct zone of syngeneic cardiac fibroblasts stably transfected to express SDF-1 induced homing of CD117-positive stem cells to injured myocardium after filgrastim administration (control vs SDF-1-expressing cardiac fibroblasts mean 7.2 [SD 3.4] vs 33.2 [6.0] cells/mm2, n=4 per group, pcell homing to injured myocardium and suggest a strategy for directed stem-cell engraftment into injured tissues. Our findings also indicate that therapeutic strategies focused on stem-cell mobilisation for regeneration of myocardial tissue must be initiated within days of myocardial infarction unless signalling for stem-cell homing is re-established.
Energy Technology Data Exchange (ETDEWEB)
Gupta, Sweta K. [Department of Polymer and Process Engineering, Indian Institute of Technology, Roorkee (India); Dinda, Amit K. [Department of Pathology, All India Institute of Medical Sciences, New Delhi (India); Potdar, Pravin D. [Department of Molecular Medicine, Jaslok Hospital and Research Centre, Mumbai (India); Mishra, Narayan C., E-mail: mishrawise@gmail.com [Department of Polymer and Process Engineering, Indian Institute of Technology, Roorkee (India)
2013-10-15
The present study aims to fabricate scaffold from cadaver goat-lung tissue and evaluate it for skin tissue engineering applications. Decellularized goat-lung scaffold was fabricated by removing cells from cadaver goat-lung tissue enzymatically, to have cell-free 3D-architecture of natural extracellular matrix. DNA quantification assay and Hematoxylin and eosin staining confirmed the absence of cellular material in the decellularized lung-tissue. SEM analysis of decellularized scaffold shows the intrinsic porous structure of lung tissue with well-preserved pore-to-pore interconnectivity. FTIR analysis confirmed non-denaturation and well maintainance of collagenous protein structure of decellularized scaffold. MTT assay, SEM analysis and H and E staining of human skin-derived Mesenchymal Stem cell, seeded over the decellularized scaffold, confirms stem cell attachment, viability, biocompatibility and proliferation over the decellularized scaffold. Expression of Keratin18 gene, along with CD105, CD73 and CD44, by human skin-derived Mesenchymal Stem cells over decellularized scaffold signifies that the cells are viable, proliferating and migrating, and have maintained their critical cellular functions in the presence of scaffold. Thus, overall study proves the applicability of the goat-lung tissue derived decellularized scaffold for skin tissue engineering applications. - Highlights: • We successfully fabricated decellularized scaffold from cadaver goat-lung tissue. • Decellularized goat-lung scaffolds were found to be highly porous. • Skin derived MSC shows high cell viability and proliferation over the scaffold. • Phenotype of MSCs was well maintained over the scaffold. • The scaffold shows potential for applications in skin tissue engineering.
International Nuclear Information System (INIS)
Gupta, Sweta K.; Dinda, Amit K.; Potdar, Pravin D.; Mishra, Narayan C.
2013-01-01
The present study aims to fabricate scaffold from cadaver goat-lung tissue and evaluate it for skin tissue engineering applications. Decellularized goat-lung scaffold was fabricated by removing cells from cadaver goat-lung tissue enzymatically, to have cell-free 3D-architecture of natural extracellular matrix. DNA quantification assay and Hematoxylin and eosin staining confirmed the absence of cellular material in the decellularized lung-tissue. SEM analysis of decellularized scaffold shows the intrinsic porous structure of lung tissue with well-preserved pore-to-pore interconnectivity. FTIR analysis confirmed non-denaturation and well maintainance of collagenous protein structure of decellularized scaffold. MTT assay, SEM analysis and H and E staining of human skin-derived Mesenchymal Stem cell, seeded over the decellularized scaffold, confirms stem cell attachment, viability, biocompatibility and proliferation over the decellularized scaffold. Expression of Keratin18 gene, along with CD105, CD73 and CD44, by human skin-derived Mesenchymal Stem cells over decellularized scaffold signifies that the cells are viable, proliferating and migrating, and have maintained their critical cellular functions in the presence of scaffold. Thus, overall study proves the applicability of the goat-lung tissue derived decellularized scaffold for skin tissue engineering applications. - Highlights: • We successfully fabricated decellularized scaffold from cadaver goat-lung tissue. • Decellularized goat-lung scaffolds were found to be highly porous. • Skin derived MSC shows high cell viability and proliferation over the scaffold. • Phenotype of MSCs was well maintained over the scaffold. • The scaffold shows potential for applications in skin tissue engineering
Potential Effect of CD271 on Human Mesenchymal Stromal Cell Proliferation and Differentiation.
Calabrese, Giovanna; Giuffrida, Raffaella; Lo Furno, Debora; Parrinello, Nunziatina Laura; Forte, Stefano; Gulino, Rosario; Colarossi, Cristina; Schinocca, Luciana Rita; Giuffrida, Rosario; Cardile, Venera; Memeo, Lorenzo
2015-07-09
The Low-Affinity Nerve Growth Factor Receptor (LNGFR), also known as CD271, is a member of the tumor necrosis factor receptor superfamily. The CD271 cell surface marker defines a subset of multipotential mesenchymal stromal cells and may be used to isolate and enrich cells derived from bone marrow aspirate. In this study, we compare the proliferative and differentiation potentials of CD271+ and CD271- mesenchymal stromal cells. Mesenchymal stromal cells were isolated from bone marrow aspirate and adipose tissue by plastic adherence and positive selection. The proliferation and differentiation potentials of CD271+ and CD271- mesenchymal stromal cells were assessed by inducing osteogenic, adipogenic and chondrogenic in vitro differentiation. Compared to CD271+, CD271- mesenchymal stromal cells showed a lower proliferation rate and a decreased ability to give rise to osteocytes, adipocytes and chondrocytes. Furthermore, we observed that CD271+ mesenchymal stromal cells isolated from adipose tissue displayed a higher efficiency of proliferation and trilineage differentiation compared to CD271+ mesenchymal stromal cells isolated from bone marrow samples, although the CD271 expression levels were comparable. In conclusion, these data show that both the presence of CD271 antigen and the source of mesenchymal stromal cells represent important factors in determining the ability of the cells to proliferate and differentiate.
CD4+/CD8+ double-positive T cells
DEFF Research Database (Denmark)
Overgaard, Nana H; Jung, Ji-Won; Steptoe, Raymond J
2015-01-01
CD4(+)/CD8(+) DP thymocytes are a well-described T cell developmental stage within the thymus. However, once differentiated, the CD4(+) lineage or the CD8(+) lineage is generally considered to be fixed. Nevertheless, mature CD4(+)/CD8(+) DP T cells have been described in the blood and peripheral...... cells, CD4(+)/CD8(+) T cell populations, outside of the thymus, have recently been described to express concurrently ThPOK and Runx3. Considerable heterogeneity exists within the CD4(+)/CD8(+) DP T cell pool, and the function of CD4(+)/CD8(+) T cell populations remains controversial, with conflicting...... reports describing cytotoxic or suppressive roles for these cells. In this review, we describe how transcriptional regulation, lineage of origin, heterogeneity of CD4 and CD8 expression, age, species, and specific disease settings influence the functionality of this rarely studied T cell population....
Improvement of CD-SEM mark position measurement accuracy
Kasa, Kentaro; Fukuhara, Kazuya
2014-04-01
CD-SEM is now attracting attention as a tool that can accurately measure positional error of device patterns. However, the measurement accuracy can get worse due to pattern asymmetry as in the case of image based overlay (IBO) and diffraction based overlay (DBO). For IBO and DBO, a way of correcting the inaccuracy arising from measurement patterns was suggested. For CD-SEM, although a way of correcting CD bias was proposed, it has not been argued how to correct the inaccuracy arising from pattern asymmetry using CD-SEM. In this study we will propose how to quantify and correct the measurement inaccuracy affected by pattern asymmetry.
Directory of Open Access Journals (Sweden)
Tessa Bergsbaken
2017-04-01
Full Text Available Many pathogens initiate infection at mucosal surfaces, and tissue-resident memory T (Trm cells play an important role in protective immunity, yet the tissue-specific signals that regulate Trm differentiation are poorly defined. During Yersinia infection, CD8+ T cell recruitment to areas of inflammation within the intestine is required for differentiation of the CD103−CD69+ Trm subset. Intestinal proinflammatory microenvironments have elevated interferon (IFN-β and interleukin-12 (IL-12, which regulated Trm markers, including CD103. Type I interferon-receptor- or IL-12-receptor-deficient T cells functioned similarly to wild-type (WT cells during infection; however, the inability of T cells to respond to inflammation resulted in defective differentiation of CD103−CD69+ Trm cells and reduced Trm persistence. Intestinal macrophages were the main producers of IFN-β and IL-12 during infection, and deletion of CCR2+ IL-12-producing cells reduced the size of the CD103− Trm population. These data indicate that intestinal inflammation drives phenotypic diversity and abundance of Trm cells for optimal tissue-specific immunity.
Directory of Open Access Journals (Sweden)
Peter van Balen
2018-02-01
Full Text Available IntroductionConditioning regimens preceding allogeneic stem cell transplantation (alloSCT can cause tissue damage and acceleration of the development of graft-versus-host disease (GVHD. T-cell-depleted alloSCT with postponed donor lymphocyte infusion (DLI may reduce GVHD, because tissue injury can be restored at the time of DLI. In this study, we investigated the presence of tissue injury and inflammation in skin during the period of hematologic recovery and immune reconstitution after alloSCT.MethodsSkin biopsies were immunohistochemically stained for HLA class II, CD1a, CD11c, CD40, CD54, CD68, CD86, CD206, CD3, and CD8. HLA class II-expressing cells were characterized as activated T-cells, antigen-presenting cells (APCs, or tissue repairing macrophages. In sex-mismatched patient and donor couples, origin of cells was determined by multiplex analysis combining XY-FISH and fluorescent immunohistochemistry.ResultsNo inflammatory environment due to pretransplant conditioning was detected at the time of alloSCT, irrespective of the conditioning regimen. An increase in HLA class II-positive macrophages and CD3 T-cells was observed 12–24 weeks after myeloablative alloSCT, but these macrophages did not show signs of interaction with the co-localized T-cells. In contrast, during GVHD, an increase in HLA class II-expressing cells coinciding with T-cell interaction was observed, resulting in an overt inflammatory reaction with the presence of activated APC, activated donor T-cells, and localized upregulation of HLA class II expression on epidermal cells. In the absence of GVHD, patient derived macrophages were gradually replaced by donor-derived macrophages although patient-derived macrophages were detectable even 24 weeks after alloSCT.ConclusionConditioning regimens cause tissue damage in the skin, but this does not result in a local increase of activated APC. In contrast to the inflamed situation in GVHD, when interaction takes place between
Leepiyasakulchai, Chaniya; Taher, Chato; Chuquimia, Olga D.; Mazurek, Jolanta; Söderberg-Naucler, Cecilia; Fernández, Carmen; Sköld, Markus
2013-01-01
Non-hematopoietic cells, including lung epithelial cells, influence host immune responses. By co-culturing primary alveolar epithelial cells and monocytes from naïve donor mice, we show that alveolar epithelial cells support monocyte survival and differentiation in vitro, suggesting a role for non-hematopoietic cells in monocyte differentiation during the steady state in vivo. CD103+ dendritic cells (αE-DC) are present at mucosal surfaces. Using a murine primary monocyte adoptive transfer model, we demonstrate that αE-DC in the lungs and pulmonary lymph nodes are monocyte-derived during pulmonary tuberculosis. The tissue localization may influence the functional potential of αE-DC that accumulate in Mycobacterium tuberculosis-infected lungs. Here, we confirm the localization of αE-DC in uninfected mice beneath the bronchial epithelial cell layer and near the vascular wall, and show that αE-DC have a similar distribution in the lungs during pulmonary tuberculosis and are detected in the bronchoalveolar lavage fluid from infected mice. Lung DC can be targeted by M. tuberculosis in vivo and play a role in bacterial dissemination to the draining lymph node. In contrast to other DC subsets, only a fraction of lung αE-DC are infected with the bacterium. We also show that virulent M. tuberculosis does not significantly alter cell surface expression levels of MHC class II on infected cells in vivo and that αE-DC contain the highest frequency of IL-12p40+ cells among the myeloid cell subsets in infected lungs. Our results support a model in which inflammatory monocytes are recruited into the M. tuberculosis-infected lung tissue and, depending on which non-hematopoietic cells they interact with, differentiate along different paths to give rise to multiple monocyte-derived cells, including DC with a distinctive αE-DC phenotype. PMID:23861965
Leepiyasakulchai, Chaniya; Taher, Chato; Chuquimia, Olga D; Mazurek, Jolanta; Söderberg-Naucler, Cecilia; Fernández, Carmen; Sköld, Markus
2013-01-01
Non-hematopoietic cells, including lung epithelial cells, influence host immune responses. By co-culturing primary alveolar epithelial cells and monocytes from naïve donor mice, we show that alveolar epithelial cells support monocyte survival and differentiation in vitro, suggesting a role for non-hematopoietic cells in monocyte differentiation during the steady state in vivo. CD103(+) dendritic cells (αE-DC) are present at mucosal surfaces. Using a murine primary monocyte adoptive transfer model, we demonstrate that αE-DC in the lungs and pulmonary lymph nodes are monocyte-derived during pulmonary tuberculosis. The tissue localization may influence the functional potential of αE-DC that accumulate in Mycobacterium tuberculosis-infected lungs. Here, we confirm the localization of αE-DC in uninfected mice beneath the bronchial epithelial cell layer and near the vascular wall, and show that αE-DC have a similar distribution in the lungs during pulmonary tuberculosis and are detected in the bronchoalveolar lavage fluid from infected mice. Lung DC can be targeted by M. tuberculosis in vivo and play a role in bacterial dissemination to the draining lymph node. In contrast to other DC subsets, only a fraction of lung αE-DC are infected with the bacterium. We also show that virulent M. tuberculosis does not significantly alter cell surface expression levels of MHC class II on infected cells in vivo and that αE-DC contain the highest frequency of IL-12p40(+) cells among the myeloid cell subsets in infected lungs. Our results support a model in which inflammatory monocytes are recruited into the M. tuberculosis-infected lung tissue and, depending on which non-hematopoietic cells they interact with, differentiate along different paths to give rise to multiple monocyte-derived cells, including DC with a distinctive αE-DC phenotype.
Incomplete Memories: The Natural Suppression of Tissue-Resident Memory CD8 T Cells in the Lung
Directory of Open Access Journals (Sweden)
Katie L. Reagin
2018-01-01
Full Text Available The yearly, cyclic impact of viruses like influenza on human health and the economy is due to the high rates of mutation of traditional antibody targets, which negate any preexisting humoral immunity. However, the seasonality of influenza infections can equally be attributed to an absent or defective memory CD8 T cell response since the epitopes recognized by these cells are derived from essential virus proteins that mutate infrequently. Experiments in mouse models show that protection from heterologous influenza infection is temporally limited and conferred by a population of tissue-resident memory (TRM cells residing in the lung and lung airways. TRM are elicited by a diverse set of pathogens penetrating mucosal barriers and broadly identified by extravascular staining and expression of the activation and adhesion molecules CD69 and CD103. Interestingly, lung TRM fail to express these molecules, which could limit tissue retention, resulting in airway expulsion or death with concomitant loss of heterologous protection. Here, we make the case that respiratory infections uniquely evoke a form of natural immunosuppression whereby specific cytokines and cell–cell interactions negatively impact memory cell programming and differentiation. Respiratory memory is not only short-lived but most of the memory cells in the lung parenchyma may not be bona fide TRM. Given the quantity of microbes humans inhale over a lifetime, limiting cellular residence could be a mechanism employed by the respiratory tract to preserve organismal vitality. Therefore, successful efforts to improve respiratory immunity must carefully and selectively breach these inherent tissue barriers.
Kabel, M.A.; Heijnis, W.H.; Bakx, E.J.; Kuijpers, I.J.; Voragen, A.G.J.; Schols, H.A.
2006-01-01
Various plant polysaccharide derived mono- and oligosaccharides were derivatized with the fluorescent 9-aminopyrene-1,4,6-trisulfonate (APTS) and subjected to capillary electrophoresis (CE) in combination with laser induced fluorescence (LIF) detection. CE-LIF was suitable for mol-based
Directory of Open Access Journals (Sweden)
Katy Milne
Full Text Available BACKGROUND: Tumor-infiltrating T cells are associated with survival in epithelial ovarian cancer (EOC, but their functional status is poorly understood, especially relative to the different risk categories and histological subtypes of EOC. METHODOLOGY/PRINCIPAL FINDINGS: Tissue microarrays containing high-grade serous, endometrioid, mucinous and clear cell tumors were analyzed immunohistochemically for the presence of lymphocytes, dendritic cells, neutrophils, macrophages, MHC class I and II, and various markers of activation and inflammation. In high-grade serous tumors from optimally debulked patients, positive associations were seen between intraepithelial cells expressing CD3, CD4, CD8, CD45RO, CD25, TIA-1, Granzyme B, FoxP3, CD20, and CD68, as well as expression of MHC class I and II by tumor cells. Disease-specific survival was positively associated with the markers CD8, CD3, FoxP3, TIA-1, CD20, MHC class I and class II. In other histological subtypes, immune infiltrates were less prevalent, and the only markers associated with survival were MHC class II (positive association in endometrioid cases and myeloperoxidase (negative association in clear cell cases. CONCLUSIONS/SIGNIFICANCE: Host immune responses to EOC vary widely according to histological subtype and the extent of residual disease. TIA-1, FoxP3 and CD20 emerge as new positive prognostic factors in high-grade serous EOC from optimally debulked patients.
Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells
Directory of Open Access Journals (Sweden)
Suning Huang
2014-01-01
Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.
Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang
2014-01-01
Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.
Activation of TGF-β1-CD147 positive feedback loop in hepatic stellate cells promotes liver fibrosis.
Li, Hai-Yan; Ju, Di; Zhang, Da-Wei; Li, Hao; Kong, Ling-Min; Guo, Yanhai; Li, Can; Wang, Xi-Long; Chen, Zhi-Nan; Bian, Huijie
2015-11-12
Activation of hepatic stellate cells (HSCs) by transforming growth factor-β1 (TGF-β1) initiates HBV-associated fibrogenesis. The mechanism of TGF-β1 modulating HSC activation is not fully uncovered. We hypothesized a positive feedback signaling loop of TGF-β1-CD147 promoting liver fibrogenesis by activation of HSCs. Human HSC cell line LX-2 and spontaneous liver fibrosis model derived from HBV transgenic mice were used to evaluate the activation of molecules in the signaling loop. Wound healing and cell contraction assay were performed to detect the CD147-overexpressed HSC migration and contraction. The transcriptional regulation of CD147 by TGF-β1/Smad4 was determined using dual-luciferase reporter assay and chromatin immunoprecipitation. We found that a positive reciprocal regulation between TGF-β1 and CD147 mediated HSC activation. CD147 over-expression promoted HSC migration and accelerated TGF-β1-induced cell contraction. Phosphorylation of Smad2 and Smad3 in cooperation with Smad4 mediated the TGF-β1-regulated CD147 expression. Smad4 activated the transcription by direct interaction with CD147 promoter. Meanwhile, CD147 modulated the activated phenotype of HSCs through the ERK1/2 and Sp1 which up-regulated α-SMA, collagen I, and TGF-β1 synthesis. These findings indicate that TGF-β1-CD147 loop plays a key role in regulating the HSC activation and combination of TGF-β receptor inhibitor and anti-CD147 antibody might be promised to reverse fibrogenesis.
Dalley, Andrew J; AbdulMajeed, Ahmad A; Upton, Zee; Farah, Camile S
2013-01-01
Oral squamous cell carcinomas (OSCC) often arise from dysplastic lesions. The role of cancer stem cells in tumour initiation is widely accepted, yet the potential existence of pre-cancerous stem cells in dysplastic tissue has received little attention. Cell lines from oral diseases ranging in severity from dysplasia to malignancy provide opportunity to investigate the involvement of stem cells in malignant progression from dysplasia. Stem cells are functionally defined by their ability to generate hierarchical tissue structures in consortium with spatial regulation. Organotypic cultures readily display tissue hierarchy in vitro; hence, in this study, we compared hierarchical expression of stem cell-associated markers in dermis-based organotypic cultures of oral epithelial cells from normal tissue (OKF6-TERT2), mild dysplasia (DOK), severe dysplasia (POE-9n) and OSCC (PE/CA P J15). Expression of CD44, p75(NTR), CD24 and ALDH was studied in monolayers by flow cytometry and in organotypic cultures by immunohistochemistry. Spatial regulation of CD44 and p75(NTR) was evident for organotypic cultures of normal (OKF6-TERT2) and dysplasia (DOK and POE-9n) but was lacking for OSCC (PE/CA PJ15)-derived cells. Spatial regulation of CD24 was not evident. All monolayer cultures exhibited CD44, p75(NTR), CD24 antigens and ALDH activity (ALDEFLUOR(®) assay), with a trend towards loss of population heterogeneity that mirrored disease severity. In monolayer, increased FOXA1 and decreased FOXA2 expression correlated with disease severity, but OCT3/4, Sox2 and NANOG did not. We conclude that dermis-based organotypic cultures give opportunity to investigate the mechanisms that underlie loss of spatial regulation of stem cell markers seen with OSCC-derived cells. © 2012 John Wiley & Sons A/S.
Directory of Open Access Journals (Sweden)
Ilaria Burba
Full Text Available BACKGROUND: Use of peripheral blood- or bone marrow-derived progenitors for ischemic heart repair is a feasible option to induce neo-vascularization in ischemic tissues. These cells, named Endothelial Progenitors Cells (EPCs, have been extensively characterized phenotypically and functionally. The clinical efficacy of cardiac repair by EPCs cells remains, however, limited, due to cell autonomous defects as a consequence of risk factors. The devise of "enhancement" strategies has been therefore sought to improve repair ability of these cells and increase the clinical benefit. PRINCIPAL FINDINGS: Pharmacologic inhibition of histone deacetylases (HDACs is known to enhance hematopoietic stem cells engraftment by improvement of self renewal and inhibition of differentiation in the presence of mitogenic stimuli in vitro. In the present study cord blood-derived CD34(+ were pre-conditioned with the HDAC inhibitor Valproic Acid. This treatment affected stem cell growth and gene expression, and improved ischemic myocardium protection in an immunodeficient mouse model of myocardial infarction. CONCLUSIONS: Our results show that HDAC blockade leads to phenotype changes in CD34(+ cells with enhanced self renewal and cardioprotection.
Lippross, Sebastian; Loibl, Markus; Hoppe, Sven; Meury, Thomas; Benneker, Lorin; Alini, Mauro; Verrier, Sophie
2011-01-01
Stem cell based autologous grafting has recently gained mayor interest in various surgical fields for the treatment of extensive tissue defects. CD34(+) and CD133(+) cells that can be isolated from the pool of bone marrow mononuclear cells (BMC) are capable of differentiating into mature endothelial cells in vivo. These endothelial progenitor cells (EPC) are believed to represent a major portion of the angiogenic regenerative cells that are released from bone marrow when tissue injury has occurred. In recent years tissue engineers increasingly looked at the process of vessel neoformation because of its major importance for successful cell grafting to replace damaged tissue. Up to now one of the greatest problems preventing a clinical application is the large scale of expansion that is required for such purpose. We established a method to effectively enhance the expansion of CD34(+) and CD133(+) cells by the use of platelet-released growth factors (PRGF) as a media supplement. PRGF were prepared from thrombocyte concentrates and used as a media supplement to iscove's modified dulbecco's media (IMDM). EPC were immunomagnetically separated from human bone morrow monocyte cells and cultured in IMDM + 10% fetal calf serum (FCS), IMDM + 5%, FCS + 5% PRGF and IMDM + 10% PRGF. We clearly demonstrate a statistically significant higher and faster cell proliferation rate at 7, 14, 21, and 28 days of culture when both PRGF and FCS were added to the medium as opposed to 10% FCS or 10% PRGF alone. The addition of 10% PRGF to IMDM in the absence of FCS leads to a growth arrest from day 14 on. In histochemical, immunocytochemical, and gene-expression analysis we showed that angiogenic and precursor markers of CD34(+) and CD133(+) cells are maintained during long-term culture. In summary, we established a protocol to boost the expansion of CD34(+) and CD133(+) cells. Thereby we provide a technical step towards the clinical application of autologous stem cell
Diao, Yinze; Ma, Qingjun; Cui, Fuzhai; Zhong, Yanfeng
2009-10-01
Mesenchymal stem cells (MSCs) are ideal seed cells for bone tissue engineering. However, intrinsic deficiencies exist for the autologous transplantation strategy of constructing artificial bone with MSCs derived from bone marrow of patients. In this study, MSCs-like cells were isolated from human umbilical cords and were expanded in vitro. Flow cytometric analysis revealed that cells from the fourth passage were positive for CD29, CD44, CD71, CD73, CD90, and CD105 whereas they were negative for CD14, CD34, CD45, and CD117. Furthermore, these cells expressed HLA-A, B, C (MHC-I), but not HLA-DP, DQ, DR (MHC-II), or costimulatory molecules such as CD80 and CD86. Following incubation in specific inductive media for 3 weeks, cultured cells were shown to possess potential to differentiate into adipogenic, osteogenic or chondrogenic lineages in vitro. The umbilical cord-derived MSCs (UC-MSCs) were loaded with a biomimetic artificial bone scaffold material before being implanted subcutaneously in the back of Balb/c nude mice for four to twelve weeks. Our results revealed that UC-MSCs loaded with the scaffold displayed capacity of osteogenic differentiation leading to osteogenesis with human origin in vivo. As a readily available source of seed cells for bone tissue engineering, UC-MSCs should have broad application prospects.
Adipose tissue-derived stem cells in oral mucosa tissue engineering ...
African Journals Online (AJOL)
Jane
2011-10-10
Oct 10, 2011 ... stem cells (ADSCs) may play an important role in this field. In this research ..... Adipose tissue is derived from embryonic mesodermal precursors and .... Clonogenic multipotent stem cells in human adipose tissue differentiate ...
Potential Effect of CD271 on Human Mesenchymal Stromal Cell Proliferation and Differentiation
Directory of Open Access Journals (Sweden)
Giovanna Calabrese
2015-07-01
Full Text Available The Low-Affinity Nerve Growth Factor Receptor (LNGFR, also known as CD271, is a member of the tumor necrosis factor receptor superfamily. The CD271 cell surface marker defines a subset of multipotential mesenchymal stromal cells and may be used to isolate and enrich cells derived from bone marrow aspirate. In this study, we compare the proliferative and differentiation potentials of CD271+ and CD271− mesenchymal stromal cells. Mesenchymal stromal cells were isolated from bone marrow aspirate and adipose tissue by plastic adherence and positive selection. The proliferation and differentiation potentials of CD271+ and CD271− mesenchymal stromal cells were assessed by inducing osteogenic, adipogenic and chondrogenic in vitro differentiation. Compared to CD271+, CD271− mesenchymal stromal cells showed a lower proliferation rate and a decreased ability to give rise to osteocytes, adipocytes and chondrocytes. Furthermore, we observed that CD271+ mesenchymal stromal cells isolated from adipose tissue displayed a higher efficiency of proliferation and trilineage differentiation compared to CD271+ mesenchymal stromal cells isolated from bone marrow samples, although the CD271 expression levels were comparable. In conclusion, these data show that both the presence of CD271 antigen and the source of mesenchymal stromal cells represent important factors in determining the ability of the cells to proliferate and differentiate.
Directory of Open Access Journals (Sweden)
Jong-Ho Kim
Full Text Available Adipose-derived stem cells (ADSCs have the potential to differentiate into various cell lineages and they are easily obtainable from patients, which makes them a promising candidate for cell therapy. However, a drawback is their limited life span during in vitro culture. Therefore, hTERT-immortalized CD34+ and CD34- mouse ADSC lines (mADSCshTERT tagged with GFP were established. We evaluated the proliferation capacity, multi-differentiation potential, and secretory profiles of CD34+ and CD34- mADSCshTERT in vitro, as well as their effects on cardiac function and systemic inflammation following transplantation into a rat model of acute myocardial infarction (AMI to assess whether these cells could be used as a novel cell source for regeneration therapy in the cardiovascular field. CD34+ and CD34- mADSCshTERT demonstrated phenotypic characteristics and multi-differentiation potentials similar to those of primary mADSCs. CD34+ mADSCshTERT exhibited a higher proliferation ability compared to CD34- mADSCshTERT, whereas CD34- mADSCshTERT showed a higher osteogenic differentiation potential compared to CD34+ mADSCshTERT. Primary mADSCs, CD34+, and CD34- mADSCshTERT primarily secreted EGF, TGF-β1, IGF-1, IGF-2, MCP-1, and HGFR. CD34+ mADSCshTERT had higher secretion of VEGF and SDF-1 compared to CD34- mADSCshTERT. IL-6 secretion was severely reduced in both CD34+ and CD34- mADSCshTERT compared to primary mADSCs. Transplantation of CD34+ and CD34- mADSCshTERT significantly improved the left ventricular ejection fraction and reduced infarct size compared to AMI-induced rats after 28 days. At 28 days after transplantation, engraftment of CD34+ and CD34- mADSCshTERT was confirmed by positive Y chromosome staining, and differentiation of CD34+ and CD34- mADSCshTERT into endothelial cells was found in the infarcted myocardium. Significant decreases were observed in circulating IL-6 levels in CD34+ and CD34- mADSCshTERT groups compared to the AMI
International Nuclear Information System (INIS)
Martin-Garcia, Julio; Cao, Wei; Varela-Rohena, Angel; Plassmeyer, Matthew L.; Gonzalez-Scarano, Francisco
2006-01-01
We previously described envelope glycoproteins of an HIV-1 isolate adapted in vitro for growth in microglia that acquired a highly fusogenic phenotype and lower CD4 dependence, as well as resistance to inhibition by anti-CD4 antibodies. Here, we investigated whether similar phenotypic changes are present in vivo. Envelope clones from the brain and spleen of an HIV-1-infected individual with neurological disease were amplified, cloned, and sequenced. Phylogenetic analysis demonstrated clustering of sequences according to the tissue of origin, as expected. Functional clones were then used in cell-to-cell fusion assays to test for CD4 and co-receptor utilization and for sensitivity to various antibodies and inhibitors. Both brain- and spleen-derived envelope clones mediated fusion in cells expressing both CD4 and CCR5 and brain envelopes also used CCR3 as co-receptor. We found that the brain envelopes had a lower CD4 dependence, since they efficiently mediated fusion in the presence of low levels of CD4 on the target cell membrane, and they were significantly more resistant to blocking by anti-CD4 antibodies than the spleen-derived envelopes. In contrast, we observed no difference in sensitivity to the CCR5 antagonist TAK-779. However, brain-derived envelopes were significantly more resistant than those from spleen to the fusion inhibitor T-1249 and concurrently showed slightly greater fusogenicity. Our results suggest an increased affinity for CD4 of brain-derived envelopes that may have originated from in vivo adaptation to replication in microglial cells. Interestingly, we note the presence of envelopes more resistant to a fusion inhibitor in the brain of an untreated, HIV-1-infected individual
Destiny of autologous bone marrow-derived stromal cells implanted in the vocal fold.
Kanemaru, Shin-ichi; Nakamura, Tatsuo; Yamashita, Masaru; Magrufov, Akhmar; Kita, Tomoko; Tamaki, Hisanobu; Tamura, Yoshihiro; Iguchi, Fuku-ichiro; Kim, Tae Soo; Kishimoto, Masanao; Omori, Koichi; Ito, Juichi
2005-12-01
The aim of this study was to investigate the destiny of implanted autologous bone marrow-derived stromal cells (BSCs) containing mesenchymal stem cells. We previously reported the successful regeneration of an injured vocal fold through implantation of BSCs in a canine model. However, the fate of the implanted BSCs was not examined. In this study, implanted BSCs were traced in order to determine the type of tissues resulting at the injected site of the vocal fold. After harvest of bone marrow from the femurs of green fluorescent transgenic mice, adherent cells were cultured and selectively amplified. By means of a fluorescence-activated cell sorter, it was confirmed that some cells were strongly positive for mesenchymal stem cell markers, including CD29, CD44, CD49e, and Sca-1. These cells were then injected into the injured vocal fold of a nude rat. Immunohistologic examination of the resected vocal folds was performed 8 weeks after treatment. The implanted cells were alive in the host tissues and showed positive expression for keratin and desmin, markers for epithelial tissue and muscle, respectively. The implanted BSCs differentiated into more than one tissue type in vivo. Cell-based tissue engineering using BSCs may improve the quality of the healing process in vocal fold injuries.
Liu, Ming-Hao; Li, Ya; Han, Lu; Zhang, Yao-Yuan; Wang, Di; Wang, Zhi-Hao; Zhou, Hui-Min; Song, Ming; Li, Yi-Hui; Tang, Meng-Xiong; Zhang, Wei; Zhong, Ming
2017-07-01
Atherosclerosis (AS) is the most common and serious complication of type 2 diabetes mellitus (T2DM) and is accelerated via chronic systemic inflammation rather than hyperglycemia. Adipose tissue is the major source of systemic inflammation in abnormal metabolic state. Pro-inflammatory CD4 + T cells play pivotal role in promoting adipose inflammation. Adipose-derived stem cells (ADSCs) for fat regeneration have potent ability of immunosuppression and restricting CD4 + T cells as well. Whether T2DM ADSCs are impaired in antagonizing CD4 + T cell proliferation and polarization remains unclear. We constructed type 2 diabetic ApoE -/- mouse models and tested infiltration and subgroups of CD4 + T cell in stromal-vascular fraction (SVF) in vivo. Normal/T2DM ADSCs and normal splenocytes with or without CD4 sorting were separated and co-cultured at different scales ex vivo. Immune phenotypes of pro- and anti-inflammation of ADSCs were also investigated. Flow cytometry (FCM) and ELISA were applied in the experiments above. CD4 + T cells performed a more pro-inflammatory phenotype in adipose tissue in T2DM ApoE -/- mice in vivo. Restriction to CD4 + T cell proliferation and polarization was manifested obviously weakened after co-cultured with T2DM ADSCs ex vivo. No obvious distinctions were found in morphology and growth type of both ADSCs. However, T2DM ADSCs acquired a pro-inflammatory immune phenotype, with secreting less PGE2 and expressing higher MHC-II and co-stimulatory molecules (CD40, CD80). Normal ADSCs could also obtain the phenotypic change after cultured with T2DM SVF supernatant. CD4 + T cell infiltration and pro-inflammatory polarization exist in adipose tissue in type 2 diabetic ApoE -/- mice. T2DM ADSCs had impaired function in restricting CD4 + T lymphocyte proliferation and pro-inflammatory polarization due to immune phenotypic changes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Matsuoka, Yoshikazu; Nakatsuka, Ryusuke; Sumide, Keisuke; Kawamura, Hiroshi; Takahashi, Masaya; Fujioka, Tatsuya; Uemura, Yasushi; Asano, Hiroaki; Sasaki, Yutaka; Inoue, Masami; Ogawa, Hiroyasu; Takahashi, Takayuki; Hino, Masayuki; Sonoda, Yoshiaki
2015-05-01
Hematopoietic stem cells (HSCs) are maintained in a specialized bone marrow (BM) niche, which consists of osteoblasts, endothelial cells, and a variety of mesenchymal stem/stromal cells (MSCs). However, precisely what types of MSCs support human HSCs in the BM remain to be elucidated because of their heterogeneity. In this study, we succeeded in prospectively isolating/establishing three types of MSCs from human BM-derived lineage- and CD45-negative cells, according to their cell surface expression of CD271 and stage-specific embryonic antigen (SSEA)-4. Among them, the MSCs established from the Lineage(-) CD45(-) CD271(+) SSEA-4(+) fraction (DP MSC) could differentiate into osteoblasts and chondrocytes, but they lacked adipogenic differentiation potential. The DP MSCs expressed significantly higher levels of well-characterized HSC-supportive genes, including IGF-2, Wnt3a, Jagged1, TGFβ3, nestin, CXCL12, and Foxc1, compared with other MSCs. Interestingly, these osteo-chondrogenic DP MSCs possessed the ability to support cord blood-derived primitive human CD34-negative severe combined immunodeficiency-repopulating cells. The HSC-supportive actions of DP MSCs were partially carried out by soluble factors, including IGF-2, Wnt3a, and Jagged1. Moreover, contact between DP MSCs and CD34-positive (CD34(+) ) as well as CD34-negative (CD34(-) ) HSCs was important for the support/maintenance of the CD34(+/-) HSCs in vitro. These data suggest that DP MSCs might play an important role in the maintenance of human primitive HSCs in the BM niche. Therefore, the establishment of DP MSCs provides a new tool for the elucidation of the human HSC/niche interaction in vitro as well as in vivo. © 2014 AlphaMed Press.
Habitual physical activity levels are positively correlated with CD4 ...
African Journals Online (AJOL)
Habitual physical activity levels are positively correlated with CD4 counts in an ... per month) and functional independence as assessed from the responses to the ... and between CD4 cell counts and total habitual physical activity levels (p ...
International Nuclear Information System (INIS)
Thomas, Elaine R.; Dunfee, Rebecca L.; Stanton, Jennifer; Bogdan, Derek; Taylor, Joann; Kunstman, Kevin; Bell, Jeanne E.; Wolinsky, Steven M.; Gabuzda, Dana
2007-01-01
HIV infects macrophages and microglia in the central nervous system (CNS), which express lower levels of CD4 than CD4+ T cells in peripheral blood. To investigate mechanisms of HIV neurotropism, full-length env genes were cloned from autopsy brain and lymphoid tissues from 4 AIDS patients with HIV-associated dementia (HAD). Characterization of 55 functional Env clones demonstrated that Envs with reduced dependence on CD4 for fusion and viral entry are more frequent in brain compared to lymphoid tissue. Envs that mediated efficient entry into macrophages were frequent in brain but were also present in lymphoid tissue. For most Envs, entry into macrophages correlated with overall fusion activity at all levels of CD4 and CCR5. gp160 nucleotide sequences were compartmentalized in brain versus lymphoid tissue within each patient. Proline at position 308 in the V3 loop of gp120 was associated with brain compartmentalization in 3 patients, but mutagenesis studies suggested that P308 alone does not contribute to reduced CD4 dependence or macrophage-tropism. These results suggest that HIV adaptation to replicate in the CNS selects for Envs with reduced CD4 dependence and increased fusion activity. Macrophage-tropic Envs are frequent in brain but are also present in lymphoid tissues of AIDS patients with HAD, and entry into macrophages in the CNS and other tissues is dependent on the ability to use low receptor levels and overall efficiency of fusion
Okiyama, Naoko; Hasegawa, Hisanori; Oida, Takatoku; Hirata, Shinya; Yokozeki, Hiroo; Fujimoto, Manabu; Miyasaka, Nobuyuki; Kohsaka, Hitoshi
2015-07-01
It is suggested that polymyositis, an autoimmune inflammatory myopathy, is mediated by autoaggressive CD8 T cells. Skeletal muscle C protein is a self-antigen that induces C protein-induced myositis, a murine model of polymyositis. To establish a new murine model of myositis inducible with a single CD8 T-cell epitope peptide that derives from the C protein, three internet-based prediction systems were employed to identify 24 candidate peptides of the immunogenic fragment of the C protein and bind theoretically to major histocompatibility complex class I molecules of C57BL/6 (B6) mice. RMA-S cell assay revealed that a HILIYSDV peptide, amino acid position 399-406 of the C protein, had the highest affinity to the H2-K(b) molecules. Transfer of mature bone marrow-derived dendritic cells pulsed with HILIYSDV induced myositis in naive B6 mice. This myositis was suppressed by anti-CD8-depleting antibodies but not by anti-CD4-depleting antibodies. Because this myositis model is mediated by CD8 T cells independently of CD4 T cells, it should be a useful tool to investigate pathology of polymyositis and develop therapies targeting CD8 T cells. © The Japanese Society for Immunology. 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Kae Won Cho
2014-10-01
Full Text Available An adaptive immune response triggered by obesity is characterized by the activation of adipose tissue CD4+ T cells by unclear mechanisms. We have examined whether interactions between adipose tissue macrophages (ATMs and CD4+ T cells contribute to adipose tissue metainflammation. Intravital microscopy identifies dynamic antigen-dependent interactions between ATMs and T cells in visceral fat. Mice deficient in major histocompatibility complex class II (MHC II showed protection from diet-induced obesity. Deletion of MHC II expression in macrophages led to an adipose tissue-specific decrease in the effector/memory CD4+ T cells, attenuation of CD11c+ ATM accumulation, and improvement in glucose intolerance by increasing adipose tissue insulin sensitivity. Ablation experiments demonstrated that the maintenance of proliferating conventional T cells is dependent on signals from CD11c+ ATMs in obese mice. These studies demonstrate the importance of MHCII-restricted signals from ATMs that regulate adipose tissue T cell maturation and metainflammation.
Analysis of gene expression and chemoresistance of CD133+ cancer stem cells in glioblastoma
Directory of Open Access Journals (Sweden)
Lu Lizhi
2006-12-01
Full Text Available Abstract Background Recently, a small population of cancer stem cells in adult and pediatric brain tumors has been identified. Some evidence has suggested that CD133 is a marker for a subset of leukemia and glioblastoma cancer stem cells. Especially, CD133 positive cells isolated from human glioblastoma may initiate tumors and represent novel targets for therapeutics. The gene expression and the drug resistance property of CD133 positive cancer stem cells, however, are still unknown. Results In this study, by FACS analysis we determined the percentage of CD133 positive cells in three primary cultured cell lines established from glioblastoma patients 10.2%, 69.7% and 27.5%, respectively. We also determined the average mRNA levels of markers associated with neural precursors. For example, CD90, CD44, CXCR4, Nestin, Msi1 and MELK mRNA on CD133 positive cells increased to 15.6, 5.7, 337.8, 21.4, 84 and 1351 times, respectively, compared to autologous CD133 negative cells derived from cell line No. 66. Additionally, CD133 positive cells express higher levels of BCRP1 and MGMT mRNA, as well as higher mRNA levels of genes that inhibit apoptosis. Furthermore, CD133 positive cells were significantly resistant to chemotherapeutic agents including temozolomide, carboplatin, paclitaxel (Taxol and etoposide (VP16 compared to autologous CD133 negative cells. Finally, CD133 expression was significantly higher in recurrent GBM tissue obtained from five patients as compared to their respective newly diagnosed tumors. Conclusion Our study for the first time provided evidence that CD133 positive cancer stem cells display strong capability on tumor's resistance to chemotherapy. This resistance is probably contributed by the CD133 positive cell with higher expression of on BCRP1 and MGMT, as well as the anti-apoptosis protein and inhibitors of apoptosis protein families. Future treatment should target this small population of CD133 positive cancer stem cells in
Identification of rabbit annulus fibrosus-derived stem cells.
Directory of Open Access Journals (Sweden)
Chen Liu
Full Text Available Annulus fibrosus (AF injuries can lead to substantial deterioration of intervertebral disc (IVD which characterizes degenerative disc disease (DDD. However, treatments for AF repair/regeneration remain challenging due to the intrinsic heterogeneity of AF tissue at cellular, biochemical, and biomechanical levels. In this study, we isolated and characterized a sub-population of cells from rabbit AF tissue which formed colonies in vitro and could self-renew. These cells showed gene expression of typical surface antigen molecules characterizing mesenchymal stem cells (MSCs, including CD29, CD44, and CD166. Meanwhile, they did not express negative markers of MSCs such as CD4, CD8, and CD14. They also expressed Oct-4, nucleostemin, and SSEA-4 proteins. Upon induced differentiation they showed typical osteogenesis, chondrogenesis, and adipogenesis potential. Together, these AF-derived colony-forming cells possessed clonogenicity, self-renewal, and multi-potential differentiation capability, the three criteria characterizing MSCs. Such AF-derived stem cells may potentially be an ideal candidate for DDD treatments using cell therapies or tissue engineering approaches.
Impact of CD133 positive stem cell proportion on survival in patients with glioblastoma multiforme
International Nuclear Information System (INIS)
Kase, Marju; Minajeva, Ave; Niinepuu, Kristi; Kase, Sandra; Vardja, Markus; Asser, Toomas; Jaal, Jana
2013-01-01
The aim of the study was to assess the impact of CD133-positive (CD133+) cancer stem cell proportions on treatment results of glioblastoma multiforme (GBM) patients. Patients with GBM (n = 42) received postoperative radiotherapy (± chemotherapy). Surgically excised GBM tissue sections were immunohistochemically examined for CD133 expression. The proportions of CD133+ GBM cells were determined (%). The proportion of CD133+ GBM stem cells was established by 2 independent researchers whose results were in good accordance (R = 0.8, p < 0.01). Additionally, CD133 expression levels were correlated with patients overall survival. The proportion of CD133+ cells varied between patients, being from 0.5% to 82%. Mean and median proportions of CD133+ cells of the entire study group were 33% ± 24% (mean ± SD) and 28%, respectively. Clinical data do not support the association between higher proportion of stem cells and the aggressiveness of GBM. Median survival time of the study group was 10.0 months (95% CI 9.0–11.0). The survival time clearly depended on the proportion of CD133+ cells (log rank test, p = 0.02). Median survival times for patients with low (< median) and high (≥ median) proportion of CD133+ cells were 9.0 months (95% CI 7.6–10.5) and 12.0 months (95% CI 9.3–14.7), respectively. In multivariate analysis, the proportion of CD133+ cells emerged as a significant independent predictor for longer overall survival (HR 2.0, 95% CI 1.0–3.8, p = 0.04). In patients with higher stem cell proportion, significantly longer survival times after postoperative radiotherapy were achieved. Underlying reasons and possible higher sensitivity of GBM stem cells to fractionated radio-therapy should be clarified in further studies
Ferraz, Raquel; Cunha, Clarissa F; Pimentel, Maria Inês F; Lyra, Marcelo R; Pereira-Da-Silva, Tatiana; Schubach, Armando O; Da-Cruz, Alda Maria; Bertho, Alvaro Luiz
2017-05-03
Cutaneous leishmaniasis (CL) is caused by Leishmania (Viannia) braziliensis, which infects dermal macrophages and dendritic cells, causing an intense immune-mediated-tissue inflammation and a skin ulcer with elevated borders that can heal spontaneously or after antimonial therapy. The resolution of lesions depends on an adaptive immune response, and cytotoxic cells seem to have a fundamental role in this process. The aim of this study is to better understand the role of cytotoxicity mediated mechanisms that occur during the immune response in the CL lesion milieu, considering distinct cytotoxic-related CD107a + cells, such as CD8 + , CD4 + , CD4 neg CD8 neg (double-negative, DN) and CD4 + CD8 + (double-positive, DP) T lymphocytes, as well as NK and NKT cells. Lesion derived cells were assessed for T cell subpopulations and NK cells, as well as CD107a expression by flow cytometry. In addition, cytometric bead array (CBA) was used to quantify cytokines and granzyme B concentrations in supernatants from macerated lesions. Flow cytometry analyses revealed that NKT cells are the major CD107a-expressing cell population committed to cytotoxicity in CL lesion, although we also observed high frequencies of CD4 + and DN T cells expressing CD107a. Analysing the pool of CD107a + -cell populations, we found a higher distribution of DN T cells (44%), followed by approximately 25% of NKT cells. Interestingly, NK and CD8 + T cells represented only 3 and 4% of the total-CD107a + -cell pool, respectively. The cytotoxicity activity that occurs in the lesion milieu of CL patients seems to be dominated by DN T and NKT cells. These findings suggest the need for a reevaluation of the role of classical-cytotoxic NK and CD8 + T cells in the pathogenesis of CL, implicating an important role for other T cell subpopulations.
Directory of Open Access Journals (Sweden)
Michael Ngo
2016-08-01
Full Text Available The high rate of metastasis and recurrence among melanoma patients indicates the existence of cells within melanoma that have the ability to both initiate metastatic programs and bypass immune recognition. Here, we identify CD47 as a regulator of melanoma tumor metastasis and immune evasion. Protein and gene expression analysis of clinical melanoma samples reveals that CD47, an anti-phagocytic signal, correlates with melanoma metastasis. Antibody-mediated blockade of CD47 coupled with targeting of CD271+ melanoma cells strongly inhibits tumor metastasis in patient-derived xenografts. This therapeutic effect is mediated by drastic changes in the tumor and metastatic site immune microenvironments, both of whichwhich exhibit greatly increased density of differentiated macrophages and significantly fewer inflammatory monocytes, pro-metastatic macrophages (CCR2+/VEGFR1+, and neutrophils, all of which are associated with disease progression. Thus, antibody therapy that activates the innate immune response in combination with selective targeting of CD271+ melanoma cells represents a powerful therapeutic approach against metastatic melanoma.
Directory of Open Access Journals (Sweden)
Alessandra Consonni
2017-09-01
Full Text Available Reinstating tissue-specific tolerance has attracted much attention as a means to treat autoimmune diseases. However, despite promising results in rodent models of autoimmune diseases, no established tolerogenic therapy is clinically available yet. In the experimental autoimmune myasthenia gravis (EAMG model several protocols have been reported that induce tolerance against the prime disease-associated antigen, the acetylcholine receptor (AChR at the neuromuscular junction. Using the whole AChR, the extracellular part or peptides derived from the receptor, investigators have reported variable success with their treatments, though, usually relatively large amounts of antigen has been required. Hence, there is a need for better formulations and strategies to improve on the efficacy of the tolerance-inducing therapies. Here, we report on a novel targeted fusion protein carrying the immunodominant peptide from AChR, mCTA1–T146, which given intranasally in repeated microgram doses strongly suppressed induction as well as ongoing EAMG disease in mice. The results corroborate our previous findings, using the same fusion protein approach, in the collagen-induced arthritis model showing dramatic suppressive effects on Th1 and Th17 autoaggressive CD4 T cells and upregulated regulatory T cell activities with enhanced IL10 production. A suppressive gene signature with upregulated expression of mRNA for TGFβ, IL10, IL27, and Foxp3 was clearly detectable in lymph node and spleen following intranasal treatment with mCTA1–T146. Amelioration of EAMG disease was accompanied by reduced loss of muscle AChR and lower levels of anti-AChR serum antibodies. We believe this targeted highly effective fusion protein mCTA1–T146 is a promising candidate for clinical evaluation in myasthenia gravis patients.
International Nuclear Information System (INIS)
Moniuszko, Marcin; Edghill-Smith, Yvette; Venzon, David; Stevceva, Liljana; Nacsa, Janos; Tryniszewska, Elzbieta; Tsai, Wen-Po; Franchini, Genoveffa
2006-01-01
Acute HIV/SIV (human/simian immunodeficiency virus) infection results in severe CD4 + T cell depletion in lymphoid compartments. During the chronic phase of infection, CD4 + T cell numbers rebound in blood but remain low in the gut-associated lymphoid tissue (GALT), even when viral replication is suppressed by antiretroviral therapy (ART). Thus, strategies to repopulate lymphoid compartments may ameliorate the clinical outcome of HIV/SIV infection. Interleukin (IL)-7 is a key cytokine for the maintenance of homeostatic proliferation of T cells. In HIV/SIV infection, IL-7 expression is increased, likely to compensate for T cell loss, suggesting that supraphysiological administration of IL-7 could provide additional benefit. However, the ability of T cells to respond to IL-7 is dependent on the level of expression of the IL-7 receptor (IL-7R) in T cells in various body compartments. In here, we investigated the proportion of IL-7R + T cells in blood, spleen, gut, and genitourinary tract of healthy and SIV-infected macaques with various degrees of CD4 + T cell depletion. We found that the percentage of T cells expressing IL-7R was significantly lower in both CD4 + and CD8 + T cell subsets in SIV-infected macaques than in healthy animals and this decrease directly correlated with the CD4 + T cell number. Importantly, the proportion of CD4 + and CD8 + T cells expressing IL-7R in blood paralleled that found in tissues. IL-7R + T cells within the SIV-specific CD8 + T cells varied and were lowest in most tissues of viremic macaques, likely reflecting continuous antigen stimulation of effector cells
Directory of Open Access Journals (Sweden)
Tomasz Maj
2014-01-01
Full Text Available Immune phenomena during the preimplantation period of pregnancy are poorly understood. The aim of our study was to assess the capacity for antigen presentation of splenic antigen-presenting cells (APCs derived from pregnant and pseudopregnant mice in in vitro conditions. Therefore, sorted CD11c+ dendritic cells and macrophages F4/80+ and CD11b+ presenting ovalbumin (OVA were cocultured with CD4+ T cells derived from OT-II mice’s (C57BL6/J-Tg(TcraTcrb1100Mjb/J spleen. After 132 hours of cell culture, proliferation of lymphocytes (ELISA-BrdU, activation of these cells (flow cytometry, cytokine profile (ELISA, and influence of costimulatory molecules blocking on these parameters were measured. We did not detect any differences in regulation of Th1/Th2 cytokine balance. CD86 seems to be the main costimulatory molecule involved in the proliferation response but CD80 is the main costimulatory molecule influencing cytokine secretion in pregnant mice. In conclusion, this study showed that CD80 and CD86 costimulatory molecules regulate OT-II CD4+ T lymphocyte proliferation and cytokine response in cocultures with antigen-presenting cells derived from pregnant and pseudopregnant mice. The implications of these changes still remain unclear.
Directory of Open Access Journals (Sweden)
Rucha Patil
Full Text Available BACKGROUND: 15% of reproducing couples suffer from pregnancy loss(PL and recurs in 2-3%. One of the most frequently hypothesized causes of unexplained PL refers to a defective maternal haemostatic response leading to uteroplacental thrombosis. Hereditary thrombophilia and antiphospholipid antibodies have been extensively described as risk factors for PL in women with unknown aetiology. Recently, a new marker has emerged: the cell-derived procoagulant circulating microparticles(MPs which have been reported to have a major role in many thrombosis complicated diseases. This study aims to analyze the significance of procoagulant MPs in women suffering from unexplained recurrent pregnancy loss(RPL, and characterize their cellular origin. METHOD AND FINDINGS: 115 women with RPL were analyzed for common thrombophilia markers and different cell derived MPs-total annexinV, platelet(CD41a, endothelial(CD146,CD62e, leukocyte(CD45, erythrocyte(CD235a and tissue factor(CD142(TF expressing MPs and were compared with 20 healthy non-pregnant women. Methodology for MP analysis was standardized by participating in the "Vascular Biology Scientific and Standardization Committee workshop". RESULTS: Total annexinV, TF and endothelial MPs were found significantly increased(p<0.05, 95% confidence interval in women with RPL. The procoagulant activity of MPs measured by STA-PPL clotting time assay was found in correspondence with annexinV MP levels, wherein the clot time was shortened in samples with increased MP levels. Differences in platelet, leukocyte and erythrocyte derived MPs were not significant. Thirty seven of 115 women were found to carry any of the acquired or hereditary thrombophilia markers. No significant differences were seen in the MP profile of women with and without thrombophilia marker. CONCLUSION: The presence of elevated endothelial, TF and phosphatidylserine expressing MPs at a distance (at least 3 months from the PL suggests a continued chronic
Penfornis, Patrice; Cai, David Z; Harris, Michael R; Walker, Ryan; Licini, David; Fernandes, Joseph D A; Orr, Griffin; Koganti, Tejaswi; Hicks, Chindo; Induru, Spandana; Meyer, Mark S; Khokha, Rama; Barr, Jennifer; Pochampally, Radhika R
2014-08-01
Overall prognosis for osteosarcoma (OS) is poor despite aggressive treatment options. Limited access to primary tumors, technical challenges in processing OS tissues, and the lack of well-characterized primary cell cultures has hindered our ability to fully understand the properties of OS tumor initiation and progression. In this study, we have isolated and characterized cell cultures derived from four central high-grade human OS samples. Furthermore, we used the cell cultures to study the role of CD49f in OS progression. Recent studies have implicated CD49f in stemness and multipotency of both cancer stem cells and mesenchymal stem cells. Therefore, we investigated the role of CD49f in osteosarcomagenesis. First, single cell suspensions of tumor biopsies were subcultured and characterized for cell surface marker expression. Next, we characterized the growth and differentiation properties, sensitivity to chemotherapy drugs, and anchorage-independent growth. Xenograft assays showed that cell populations expressing CD49f(hi) /CD90(lo) cell phenotype produced an aggressive tumor. Multiple lines of evidence demonstrated that inhibiting CD49f decreased the tumor-forming ability. Furthermore, the CD49f(hi) /CD90(lo) cell population is generating more aggressive OS tumor growth and indicating this cell surface marker could be a potential candidate for the isolation of an aggressive cell type in OSs. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
CD71(high) population represents primitive erythroblasts derived from mouse embryonic stem cells.
Chao, Ruihua; Gong, Xueping; Wang, Libo; Wang, Pengxiang; Wang, Yuan
2015-01-01
The CD71/Ter119 combination has been widely used to reflect dynamic maturation of erythrocytes in vivo. However, because CD71 is expressed on all proliferating cells, it is unclear whether it can be utilized as an erythrocyte-specific marker during differentiation of embryonic stem cells (ESCs). In this study, we revealed that a population expressing high level of CD71 (CD71(high)) during mouse ESC differentiation represented an in vitro counterpart of yolk sac-derived primitive erythroblasts (EryPs) isolated at 8.5days post coitum. In addition, these CD71(high) cells went through "maturational globin switching" and enucleated during terminal differentiation in vitro that were similar to the yolk sac-derived EryPs in vivo. We further demonstrated that the formation of CD71(high) population was regulated differentially by key factors including Scl, HoxB4, Eaf1, and Klf1. Taken together, our study provides a technical advance that allows efficient segregation of EryPs from differentiated ESCs in vitro for further understanding molecular regulation during primitive erythropoiesis. Copyright © 2014. Published by Elsevier B.V.
Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao
2015-02-01
The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.
International Nuclear Information System (INIS)
Chang, C.-J.; Hsu, C.-C.; Yung, M.-C.; Chen, K.-Y.; Tzao Ching; Wu, W.-F.; Chou, H.-Y.; Lee, Y.-Y.; Lu, K.-H.; Chiou, S.-H.; Ma, H.-I
2009-01-01
CD133-expressing glioma cells play a critical role in tumor recovery after treatment and are resistant to radiotherapy. Herein, we demonstrated that glioblastoma-derived CD133-positive cells (GBM-CD133 + ) are capable of self-renewal and express high levels of embryonic stem cell genes and SirT1 compared to GBM-CD133 - cells. To evaluate the role of SirT1 in GBM-CD133 + , we used a lentiviral vector expressing shRNA to knock-down SirT1 expression (sh-SirT1) in GBM-CD133 + . Silencing of SirT1 significantly enhanced the sensitivity of GBM-CD133 + to radiation and increased the level of radiation-mediated apoptosis. Importantly, knock-down of SirT1 increased the effectiveness of radiotherapy in the inhibition of tumor growth in nude mice transplanted with GBM-CD133 + . Kaplan-Meier survival analysis indicated that the mean survival rate of GBM-CD133 + mice treated with radiotherapy was significantly improved by Sh-SirT1 as well. In sum, these results suggest that SirT1 is a potential target for increasing the sensitivity of GBM and glioblastoma-associated cancer stem cells to radiotherapy.
Energy Technology Data Exchange (ETDEWEB)
Luo, Run; Liu, Bo; Yang, Xiaoyan; Bao, Zheng; Li, Bing, E-mail: libing70@126.com; Zhang, Jingquan; Li, Wei; Wu, Lili; Feng, Lianghuan
2016-01-01
Graphical abstract: - Highlights: • The large-area CdTe film has been prepared by PVD under the pressure of 0.9 kPa. • The as-prepared CdTe thin film processes excellent photovoltaic properties. • This technique is suitable for depositing large-area CdTe thin film. • The 14.6% champion efficiency CdS/CdTe cell has been achieved. - Abstract: The Cadmium telluride (CdTe) thin film has been prepared by physical vapor deposition (PVD), the Ar + O{sub 2} pressure is about 0.9 kPa. This method is a newer technique to deposit CdTe thin film in large area, and the size of the film is 30 × 40 cm{sup 2}. This method is much different from the close-spaced sublimation (CSS), as the relevance between the source temperature and the substrate temperature is weak, and the gas phase of CdTe is transferred to the substrate by Ar + O{sub 2} flow. Through this method, the compact and uniform CdTe film (30 × 40 cm{sup 2}) has been achieved, and the performances of the CdTe thin film have been determined by transmission spectrum, SEM and XRD. The film is observed to be compact with a good crystallinity, the CdTe is polycrystalline with a cubic structure and a strongly preferred (1 1 1) orientation. Using the CdTe thin film (3 × 5 cm{sup 2}) which is taken from the deposited large-area film, the 14.6% efficiency CdS/CdTe thin film solar cell has been prepared successfully. The structure of the cell is glass/FTO/CdS/CdTe/graphite slurry/Au, short circuit current density (J{sub sc}) of the cell is 26.9 mA/cm{sup 2}, open circuit voltage (V{sub oc}) is 823 mV, and filling factor (FF) is 66.05%. This technique can be a quite promising method to apply in the industrial production, as it has great prospects in the fabricating of large-area CdTe film.
Dou, Yingying; van Montfoort, Nadine; van den Bosch, Aniek; de Man, Robert A; Zom, Gijs G; Krebber, Willem-Jan; Melief, Cornelis J M; Buschow, Sonja I; Woltman, Andrea M
2018-02-14
Vaccination with synthetic long peptides (SLP) is a promising new treatment strategy for chronic hepatitis B virus (CHB). SLP can induce broad T-cell responses for all HLA types. Here we investigated the ability of a prototype HBV-core (HBc)-sequence-derived SLP to boost HBV-specific T cells in CHB patients ex vivo. HBc-SLP was used to assess cross-presentation by monocyte-derived dendritic cells (moDC) and BDCA1+ blood myeloid DC (mDC) to engineered HBV-specific CD8+ T cells. Autologous SLP-loaded and toll-like receptor (TLR)-stimulated DC were used to activate patient HBc-specific CD8+ and CD4+ T cells. HBV-SLP was cross-presented by moDC, which was further enhanced by adjuvants. Patient-derived SLP-loaded moDC significantly increased autologous HBcAg18-27-specific CD8+ T cells and CD4+ T cells ex vivo. HBV-specific T cells were functional as they synthesized tumor necrosis factor-alpha and interferon-gamma. In 6/7 of patients blockade of PD-L1 further increased SLP effects. Also, importantly, patient-derived BDCA1+ mDC cross-presented and activated autologous T-cell responses ex vivo. As a proof of concept, we showed a prototype HBc-SLP can boost T-cell responses in patients ex vivo. These results pave the way for the development of a therapeutic SLP-based vaccine to induce effective HBV-specific adaptive immune responses in CHB patients. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Distribution of CD163-positive cell and MHC class II-positive cell in the normal equine uveal tract.
Sano, Yuto; Matsuda, Kazuya; Okamoto, Minoru; Takehana, Kazushige; Hirayama, Kazuko; Taniyama, Hiroyuki
2016-02-01
Antigen-presenting cells (APCs) in the uveal tract participate in ocular immunity including immune homeostasis and the pathogenesis of uveitis. In horses, although uveitis is the most common ocular disorder, little is known about ocular immunity, such as the distribution of APCs. In this study, we investigated the distribution of CD163-positive and MHC II-positive cells in the normal equine uveal tract using an immunofluorescence technique. Eleven eyes from 10 Thoroughbred horses aged 1 to 24 years old were used. Indirect immunofluorescence was performed using the primary antibodies CD163, MHC class II (MHC II) and CD20. To demonstrate the site of their greatest distribution, positive cells were manually counted in 3 different parts of the uveal tract (ciliary body, iris and choroid), and their average number was assessed by statistical analysis. The distribution of pleomorphic CD163- and MHC II-expressed cells was detected throughout the equine uveal tract, but no CD20-expressed cells were detected. The statistical analysis demonstrated the distribution of CD163- and MHC II-positive cells focusing on the ciliary body. These results demonstrated that the ciliary body is the largest site of their distribution in the normal equine uveal tract, and the ciliary body is considered to play important roles in uveal and/or ocular immune homeostasis. The data provided in this study will help further understanding of equine ocular immunity in the normal state and might be beneficial for understanding of mechanisms of ocular disorders, such as equine uveitis.
Directory of Open Access Journals (Sweden)
Shuzi Zhang
Full Text Available BACKGROUND: Insulin-producing cell clusters (IPCCs have recently been generated in vitro from adipose tissue-derived stem cells (ASCs to circumvent islet shortage. However, it is unknown how long they can survive upon transplantation, whether they are eventually rejected by recipients, and how their long-term survival can be induced to permanently cure type 1 diabetes. IPCC graft survival is critical for their clinical application and this issue must be systematically addressed prior to their in-depth clinical trials. METHODOLOGY/PRINCIPAL FINDINGS: Here we found that IPCC grafts that differentiated from murine ASCs in vitro, unlike their freshly isolated islet counterparts, did not survive long-term in syngeneic mice, suggesting that ASC-derived IPCCs have intrinsic survival disadvantage over freshly isolated islets. Indeed, β cells retrieved from IPCC syngrafts underwent faster apoptosis than their islet counterparts. However, blocking both Fas and TNF receptor death pathways inhibited their apoptosis and restored their long-term survival in syngeneic recipients. Furthermore, blocking CD40-CD154 costimulation and Fas/TNF signaling induced long-term IPCC allograft survival in overwhelming majority of recipients. Importantly, Fas-deficient IPCC allografts exhibited certain immune privilege and enjoyed long-term survival in diabetic NOD mice in the presence of CD28/CD40 joint blockade while their islet counterparts failed to do so. CONCLUSIONS/SIGNIFICANCE: Long-term survival of ASC-derived IPCC syngeneic grafts requires blocking Fas and TNF death pathways, whereas blocking both death pathways and CD28/CD40 costimulation is needed for long-term IPCC allograft survival in diabetic NOD mice. Our studies have important clinical implications for treating type 1 diabetes via ASC-derived IPCC transplantation.
Hocaoglu-Emre, F Sinem; Saribal, Devrim; Yenmis, Guven; Guvenen, Guvenc
2017-03-01
Type 2 diabetes mellitus (T2DM) is a multisystemic, chronic disease accompanied by microvascular complications involving various complicated mechanisms. Intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and cluster of differentiation-146 (CD146) are mainly expressed by endothelial cells, and facilitate the adhesion and transmigration of immune cells, leading to inflammation. In the present study, we evaluated the levels of soluble adhesion molecules in patients with microvascular complications of T2DM. Serum and whole blood samples were collected from 58 T2DM patients with microvascular complications and 20 age-matched healthy subjects. Levels of soluble ICAM-1 (sICAM-1) and soluble VCAM-1 (sVCAM-1) were assessed using enzyme-linked immunosorbent assay, while flow cytometry was used to determine CD146 levels. Serum sICAM-1 levels were lower in T2DM patients with microvascular complications than in healthy controls (Pmolecule levels were not correlated with the complication type. In the study group, most of the patients were on insulin therapy (76%), and 95% of them were receiving angiotensin-converting enzyme (ACE)-inhibitor agents. Insulin and ACE-inhibitors have been shown to decrease soluble adhesion molecule levels via various mechanisms, so we suggest that the decreased or unchanged levels of soluble forms of cellular adhesion molecules in our study group may have resulted from insulin and ACE-inhibitor therapy, as well as tissue-localized inflammation in patients with T2DM. Copyright © 2017 Korean Endocrine Society
Cheng, Christina W.; Solorio, Loran D.; Alsberg, Eben
2014-01-01
The reconstruction of musculoskeletal defects is a constant challenge for orthopaedic surgeons. Musculoskeletal injuries such as fractures, chondral lesions, infections and tumor debulking can often lead to large tissue voids requiring reconstruction with tissue grafts. Autografts are currently the gold standard in orthopaedic tissue reconstruction; however, there is a limit to the amount of tissue that can be harvested before compromising the donor site. Tissue engineering strategies using allogeneic or xenogeneic decellularized bone, cartilage, skeletal muscle, tendon and ligament have emerged as promising potential alternative treatment. The extracellular matrix provides a natural scaffold for cell attachment, proliferation and differentiation. Decellularization of in vitro cell-derived matrices can also enable the generation of autologous constructs from tissue specific cells or progenitor cells. Although decellularized bone tissue is widely used clinically in orthopaedic applications, the exciting potential of decellularized cartilage, skeletal muscle, tendon and ligament cell-derived matrices has only recently begun to be explored for ultimate translation to the orthopaedic clinic. PMID:24417915
Meng, Jinhong; Muntoni, Francesco; Morgan, Jennifer
2018-05-12
Cell-mediated gene therapy is a possible means to treat muscular dystrophies like Duchenne muscular dystrophy. Autologous patient stem cells can be genetically-corrected and transplanted back into the patient, without causing immunorejection problems. Regenerated muscle fibres derived from these cells will express the missing dystrophin protein, thus improving muscle function. CD133+ cells derived from normal human skeletal muscle contribute to regenerated muscle fibres and form muscle stem cells after their intra-muscular transplantation into an immunodeficient mouse model. But it is not known whether CD133+ cells derived from DMD patient muscles have compromised muscle regenerative function. To test this, we compared CD133+ cells derived from DMD and normal human muscles. DMD CD133+ cells had a reduced capacity to undergo myogenic differentiation in vitro compared with CD133+ cells derived from normal muscle. In contrast to CD133+ cells derived from normal human muscle, those derived from DMD muscle formed no satellite cells and gave rise to significantly fewer muscle fibres of donor origin, after their intra-muscular transplantation into an immunodeficient, non-dystrophic, mouse muscle. DMD CD133+ cells gave rise to more clones of smaller size and more clones that were less myogenic than did CD133+ cells derived from normal muscle. The heterogeneity of the progeny of CD133+ cells, combined with the reduced proliferation and myogenicity of DMD compared to normal CD133+ cells, may explain the reduced regenerative capacity of DMD CD133+ cells. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Zhao, K-X; Dai, G-Z; Zhu, J-F
2016-05-01
Diffuse large B-cell lymphoma (DLBCL) is the most common lymphoid malignancy and the most common type of non-Hodgkin's lymphomas, the stomach is the most common extranodal site. Gastric DLBCL is often characterized by epigastric pain and vomiting. We report a case of a 78-year-old female patient with gastric diffuse large B-cell lymphoma (DLBCL) with high CD8 level which was initially manifested with ascites of unknown origin. The patient was admitted with a chief complaint of abdominal distension and scanty urine over the last twenty days, while without anorexia and fatigue until 15 March. She had no history of viral hepatitis, tuberculosis, schistosomiasis. Laboratory data revealed normal aminotransferases and bilirubin levels, but serum lactate dehydrogenase, CA125, ascitic fluid lactate dehydrogenase, ascitic fluid lymphocytes increased. The ascitic fluid was yellow-colored with 98.5% lymphocytes. Stool occult blood test was positive. Upper gastrointestinal endoscopy performed a few days later revealed multiple gastric crateriform ulcers, and Helicobacter pylori was detected in the biopsy specimen. Peripheral blood CD8+ was increased by 51%. Pathology test showed lymphocytes with atypical hyperplasia, and immunohistochemistry test resulted CD20+, CD10-, CD79α+, κ+, bcl-6+, Ki-67+ (approximately 95%), λ-, bcl-2-, CD3-, CD43-. Immunoglobulin gene (Ig) clonal rearrangement showed IgH: FR1 (+), FR2 (+), FR3(-), Igk: VJ(+), Vkde (+) in lymphoma tissue. The features of histopathology and immunohistochemistry of the tissue confirmed diffuse large B-cell lymphoma (DLBL). The patient received an uncompleted CHOP program combined with H. pylori eradication. However, the patient deceased due to disease development sixteen days later after the diagnosis.
Meyer, A; Gruber, A D; Klopfleisch, R
2012-11-01
Canine cutaneous mast cell tumors (MCT) of different histological grades have distinct biological behaviors. However, little is known about underlying molecular mechanisms that lead to tumor development and increasing malignancy with higher tumor grade. Recent studies have identified the interleukin-2 receptor (IL-2R) subunits CD25 and CD2 as markers that distinguish nonneoplastic from neoplastic mast cells in human systemic mastocytosis. In this study, their potential as a marker for canine MCT and their possible impact on MCT carcinogenesis were evaluated. mRNA expression levels of both genes were compared between grade 1 (n = 12) and grade 3 (n = 8) MCT, and protein expression levels of CD25 were compared in 90 MCT of different tumor grades. mRNA expression levels of both CD25 and CD2 were upregulated in grade 3 MCT. In contrast, CD25 protein was expressed by fewer tumor cells and at decreased levels in grade 3 tumors, while most grade 1 MCT had strong CD25 protein expression. Moreover, CD25 was not expressed by nonneoplastic, resting cutaneous mast cells, while few presumably activated mast cells in tissue samples from dogs with allergic dermatitis had weak CD25 expression. Taken together, these findings suggest that CD25 may play a critical role in early MCT development and may be a stimulatory factor in grade 1 MCT, while grade 3 MCT seem to be less dependent on CD25. Because of the low number of CD25-positive tumor cells in high-grade tumors, the usefulness of CD25 as a tumor marker is, however, questionable.
Comparison Of Cd And Zn Accumulation In Tissues Of Different Vascular Plants: A Radiometric Study
Directory of Open Access Journals (Sweden)
Dürešová Zuzana
2015-12-01
Full Text Available The aim of the present work was to compare the accumulation and translocation of Cd and Zn in plants of tobacco (Nicotiana tabacum L., celery (Apium graveolens L., maize (Zea mays L., giant reed (Arundo donax L., and alpine pennycress (Noccaea caerulescens L. under conditions of short-term hydroponic experiments using nutrient solutions spiked with radionuclides 109Cd or 65Zn, and direct gamma-spectrometry. It was found that the time-course of metals accumulation in studied plants was not different in terms of target metal, but it was significantly different on the level of plant species. The highest values of Cd accumulation showed plants of giant reed, whereby the accumulation decreased in the order: giant reed > tobacco > alpine pennycress >> maize and celery. On the basis of concentration ratios (CR [Me]shoot / [Me]root calculation for both metals, it was found that Cd and Zn were in prevailing part accumulated in the root tissues and only partially accumulated in the shoots, where the amount of accumulated Cd and Zn increased from the oldest developed leaves to the youngest developed leaves. The CR values corresponding to these facts were calculated in the range 0.06 – 0.27 for Cd and for Zn 0.06 – 0.48. In terms of plant species, the CR values obtained for Cd decreased in the order: maize > celery > tobacco and giant reed > alpine pennycress. The similarity between studied objects – individual plant species on the basis of the obtained variables defining Cd or Zn accumulation at different conditions of the experiments as well as the relationships between obtained variables and conditions of the experiments were subjected to multivariate analysis method – cluster analysis (CA. According to the findings and this analysis, it can be expected that plants of tobacco and giant reed will dispose with similar characteristics as plants of alpine pennycress, which are classified as Zn/Cd hyperaccumulators, in terms of Cd or Zn accumulation
Kawai, Takamasa; Katagiri, Wataru; Osugi, Masashi; Sugimura, Yukiko; Hibi, Hideharu; Ueda, Minoru
2015-04-01
Periodontal tissue regeneration with the use of mesenchymal stromal cells (MSCs) has been regarded as a future cell-based therapy. However, low survival rates and the potential tumorigenicity of implanted MSCs could undermine the efficacy of cell-based therapy. The use of conditioned media from MSCs (MSC-CM) may be a feasible approach to overcome these limitations. The aim of this study was to confirm the effect of MSC-CM on periodontal regeneration. MSC-CM were collected during their cultivation. The concentrations of the growth factors in MSC-CM were measured with the use of enzyme-linked immunoassay. Rat MSCs (rMSCs) and human umbilical vein endothelial cells cultured in MSC-CM were assessed on wound-healing and angiogenesis. The expressions of osteogenetic- and angiogenic-related genes of rMSCs cultured in MSC-CM were quantified by means of real-time reverse transcriptase-polymerase chain reaction analysis. In vivo, periodontal defects were prepared in the rat models and the collagen sponges with MSC-CM were implanted. MSC-CM includes insulin-like growth factor-1, vascular endothelial growth factor, transforming growth factor-β1 and hepatocyte growth factor. In vitro, wound-healing and angiogenesis increased significantly in MSC-CM. The levels of expression of osteogenetic- and angiogenic-related genes were significantly upregulated in rMSCs cultured with MSC-CM. In vivo, in the MSC-CM group, 2 weeks after implantation, immunohistochemical analysis showed several CD31-, CD105-or FLK-1-positive cells occurring frequently. At 4 weeks after implantation, regenerated periodontal tissue was observed in MSC-CM groups. The use of MSC-CM may be an alternative therapy for periodontal tissue regeneration because several cytokines included in MSC-CM will contribute to many processes of complicated periodontal tissue regeneration. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Green, Damian J.; Pagel, John M.; Nemecek, Eneida R.; Lin, Yukang; Kenoyer, Aimee L.; Pantelias, Anastasia; Hamlin, Donald K.; Wilbur, D. S.; Fisher, Darrell R.; Rajendran, Joseph G.; Gopal, Ajay K.; Park, Steven I.; Press, Oliver W.
2009-01-01
Pretargeted radioimmunotherapy (PRIT) is designed to enhance the directed delivery of radionuclides to malignant cells. Through a series of studies in nineteen nonhuman primates (M. fascicularis) the potential therapeutic advantage of anti-CD45 PRIT was evaluated. Anti-CD45 PRIT demonstrated a significant improvement in target-to-normal organ ratios of absorbed radiation when compared to directly radiolabeled bivalent antibody (conventional radioimmunotherapy (RIT)). Radio-DOTA-biotin administered 48 hours after anti-CD45 streptavidin fusion protein (FP) (BC8 (scFv)4SA) produced markedly lower concentrations of radiation in non-target tissues when compared to conventional RIT. PRIT generated superior target:normal organ ratios in the blood, lung and liver (10.3:1, 18.9:1 and 9.9:1 respectively) when compared to the conventional RIT controls (2.6:1, 6.4:1 and 2.9:1 respectively). The FP demonstrated superior retention in target tissues relative to comparable directly radiolabeled bivalent anti-CD45 RIT. The time-point of administration of the second step radiolabeled ligand (radio-DOTA-biotin) significantly impacted the biodistribution of radioactivity in target tissues. Rapid clearance of the FP from the circulation rendered unnecessary the addition of a synthetic clearing agent in this model. These results support proceeding to anti-CD45 PRIT clinical trials for patients with both leukemia and lymphoma
Directory of Open Access Journals (Sweden)
Santos Jorge M
2013-01-01
Full Text Available Abstract Background ECBio has developed proprietary technology to consistently isolate, expand and cryopreserve a well-characterized population of stromal cells from human umbilical cord tissue (UCX® cells. The technology has recently been optimized in order to become compliant with Advanced Medicine Therapeutic Products. In this work we report the immunosuppressive capacity of UCX® cells for treating induced autoimmune inflammatory arthritis. Methods UCX® cells were isolated using a proprietary method (PCT/IB2008/054067 that yields a well-defined number of cells using a precise proportion between tissue digestion enzyme activity units, tissue mass, digestion solution volume and void volume. The procedure includes three recovery steps to avoid non-conformities related to cell recovery. UCX® surface markers were characterized by flow cytometry and UCX® capacity to expand in vitro and to differentiate into adipocyte, chondrocyte and osteoblast-like cells was evaluated. Mixed Lymphocyte Reaction (MLR assays were performed to evaluate the effect of UCX® cells on T-cell activation and Treg conversion assays were also performed in vitro. Furthermore, UCX® cells were administered in vivo in both a rat acute carrageenan-induced arthritis model and rat chronic adjuvant induced arthritis model for arthritic inflammation. UCX® anti-inflammatory activity was then monitored over time. Results UCX® cells stained positive for CD44, CD73, CD90 and CD105; and negative for CD14, CD19 CD31, CD34, CD45 and HLA-DR; and were capable to differentiate into adipocyte, chondrocyte and osteoblast-like cells. UCX® cells were shown to repress T-cell activation and promote the expansion of Tregs better than bone marrow mesenchymal stem cells (BM-MSCs. Accordingly, xenogeneic UCX® administration in an acute carrageenan-induced arthritis model showed that human UCX® cells can reduce paw edema in vivo more efficiently than BM-MSCs. Finally, in a chronic adjuvant
Zigdon-Giladi, Hadar; Elimelech, Rina; Michaeli-Geller, Gal; Rudich, Utai; Machtei, Eli E
2017-07-01
Endothelial progenitor cells (EPCs) participate in angiogenesis and induce favorable micro-environments for tissue regeneration. The efficacy of EPCs in regenerative medicine is extensively studied; however, their safety profile remains unknown. Therefore, our aims were to evaluate the safety profile of human peripheral blood-derived EPCs (hEPCs) and to assess the long-term efficacy of hEPCs in bone tissue engineering. hEPCs were isolated from peripheral blood, cultured and characterized. β tricalcium phosphate scaffold (βTCP, control) or 10 6 hEPCs loaded onto βTCP were transplanted in a nude rat calvaria model. New bone formation and blood vessel density were analyzed using histomorphometry and micro-computed tomography (CT). Safety of hEPCs using karyotype analysis, tumorigenecity and biodistribution to target organs was evaluated. On the cellular level, hEPCs retained their karyotype during cell expansion (seven passages). Five months following local hEPC transplantation, on the tissue and organ level, no inflammatory reaction or dysplastic change was evident at the transplanted site or in distant organs. Direct engraftment was evident as CD31 human antigens were detected lining vessel walls in the transplanted site. In distant organs human antigens were absent, negating biodistribution. Bone area fraction and bone height were doubled by hEPC transplantation without affecting mineral density and bone architecture. Additionally, local transplantation of hEPCs increased blood vessel density by nine-fold. Local transplantation of hEPCs showed a positive safety profile. Furthermore, enhanced angiogenesis and osteogenesis without mineral density change was found. These results bring us one step closer to first-in-human trials using hEPCs for bone regeneration. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Shimizu, Yuji; Sato, Shimpei; Koyamatsu, Jun; Yamanashi, Hirotomo; Nagayoshi, Mako; Kadota, Koichiro; Maeda, Takahiro
2015-11-01
Serum triglycerides have been reported to be independently associated with the development of chronic kidney disease (CKD), which is known to play a role in vascular disturbance. On the other hand, circulating CD34-positve cells, including endothelial progenitor cells, are reported to contribute to vascular repair. However, no studies have reported on the correlation between triglycerides and the number of CD34-positive cells. Since hypertension is well known factor for vascular impairment, the degree of correlation between serum triglycerides and circulating CD34-positve cells should account for hypertension status. We conducted a cross-sectional study of 274 elderly Japanese men aged ≥ 60 years (range 60-79 years) undergoing general health checkups. Multiple linear regression analysis of non-hypertensive subjects adjusting for classical cardiovascular risk factors showed that although triglyceride levels (1SD increments; 64 mg/dL) did not significantly correlate with glomerular filtration rate (GFR) (β = -2.06, p = 0.163), a significant positive correlation was seen between triglycerides and the number of circulating CD34-positive cells (β = 0.50, p = 0.004). In hypertensive subjects, a significant inverse correlation between triglycerides and GFR was observed (β = -2.66, p = 0.035), whereas no significant correlation between triglycerides and the number of circulating CD34-positive cells was noted (β = -0.004, p = 0.974). Since endothelial progenitor cells (CD34-positive cells) have been reported to contribute to vascular repair, our results indicate that in non-hypertensive subjects, triglycerides may stimulate an increase in circulating CD34-positive cells (vascular repair) by inducing vascular disturbance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Induction of CD69 expression by cagPAI-positive Helicobacter pylori infection
Institute of Scientific and Technical Information of China (English)
Naoki Mori; Chie Ishikawa; Masachika Senba
2011-01-01
AIM: To investigate and elucidate the molecular mech-anism that regulates inducible expression of CD69 by Helicobacter pylori (H. pylori ) infection.METHODS: The expression levels of CD69 in a T-cell line, Jurkat, primary human peripheral blood mononu-clear cells (PBMCs), and CD4+T cells, were assessed by immunohistochemistry, reverse transcription polymerase chain reaction, and flow cytometry. Activation of CD69 promoter was detected by reporter gene. Nuclear factor (NF)-κB activation in Jurkat cells infected with H. pylori was evaluated by electrophoretic mobility shift assay. The role of NF-κB signaling in H. pylori -induced CD69 expression was analyzed using inhibitors of NF-κB and dominant-negative mutants. The isogenic mutants with disrupted cag pathogenicity island ( cagPAI) and virD4 were used to elucidate the role of cagPAI-encoding type Ⅳ secretion system and CagA in CD69 expression.RESULTS: CD69 staining was detected in mucosal lymphocytes and macrophages in specimens of pa-tients with H. pylori -positive gastritis. Although cagPAI-positive H. pylori and an isogenic mutant of virD4 induced CD69 expression, an isogenic mutant of cag-PAI failed to induce this in Jurkat cells. H. pylori also induced CD69 expression in PBMCs and CD4+T cells. The activation of the CD69 promoter by H. pylori was mediated through NF-κB. Transfection of dominant-negative mutants of IκBs, IκB kinases, and NF-κB-inducing kinase inhibited H. pylori -induced CD69 activation. Inhibitors of NF-κB suppressed H. pylori -induced CD69 mRNA expression.CONCLUSION: The results suggest that H. pylori in-duces CD69 expression through the activation of NF-κB. cagPAI might be relevant in the induction of CD69 expression in T cells. CD69 in T cells may play a role in H. pylori -induced gastritis.
The relationship between skin manifestations and CD4 counts among hiv positive patients
International Nuclear Information System (INIS)
Rad, F.; Ghaderi, E.; Moradi, G.; Mafakheri, L.
2008-01-01
Skin manifestations are common clinical features among HIV positive patients. The aim of this study was to document skin manifestations and their relationships with CD4 cell counts among HIV positive patients in Sanandaj. This was a descriptive study. The patients were examined for skin disorders by a dermatologist and CD4 counts were obtained from the patient's medical records. Independent samples T test were used for data analysis. In this study 66 (94.3%) patients had at least one skin problem. Fungal infections were the most common cause. The eight most common types of mucocutaneous problems were gingivitis, pallor, itching, photosensitivity, seborrheic dermatitis, candidiasis, folliculitis and tinea versicolor. The most common manifestation was gingivitis. Mean CD4 cell counts were lower in individuals with viral and bacterial skin diseases (P <0.05). The results of this study indicated that skin problems were common among HIV positive patients. Patients with advanced stages of skin disorders had relatively lower CD4 counts. Therefore examination of skin is recommended for all HIV positive patients for early detection of skin disorders, as early diagnosis and management of dermatologic problems will improve the quality of life in HIV positive patients. (author)
Luo, Wei; Hu, Qiang; Wang, Dan; Deeb, Kristin K.; Ma, Yingyu; Morrison, Carl D.; Liu, Song; Johnson, Candace S.; Trump, Donald L.
2013-01-01
Endothelial cells (ECs) are an important component involved in the angiogenesis. Little is known about the global gene expression and epigenetic regulation in tumor endothelial cells. The identification of gene expression and epigenetic difference between human prostate tumor-derived endothelial cells (TdECs) and those in normal tissues may uncover unique biological features of TdEC and facilitate the discovery of new anti-angiogenic targets. We established a method for isolation of CD31+ endothelial cells from malignant and normal prostate tissues obtained at prostatectomy. TdECs and normal-derived ECs (NdECs) showed >90% enrichment in primary culture and demonstrated microvascular endothelial cell characteristics such as cobblestone morphology in monolayer culture, diI-acetyl-LDL uptake and capillary-tube like formation in Matrigel®. In vitro primary cultures of ECs maintained expression of endothelial markers such as CD31, von Willebrand factor, intercellular adhesion molecule, vascular endothelial growth factor receptor 1, and vascular endothelial growth factor receptor 2. We then conducted a pilot study of transcriptome and methylome analysis of TdECs and matched NdECs from patients with prostate cancer. We observed a wide spectrum of differences in gene expression and methylation patterns in endothelial cells, between malignant and normal prostate tissues. Array-based expression and methylation data were validated by qRT-PCR and bisulfite DNA pyrosequencing. Further analysis of transcriptome and methylome data revealed a number of differentially expressed genes with loci whose methylation change is accompanied by an inverse change in gene expression. Our study demonstrates the feasibility of isolation of ECs from histologically normal prostate and prostate cancer via CD31+ selection. The data, although preliminary, indicates that there exist widespread differences in methylation and transcription between TdECs and NdECs. Interestingly, only a small
Lukenda, Adrian; Dotlic, Snjezana; Vukojevic, Nenad; Saric, Borna; Vranic, Semir; Zarkovic, Kamelija
2016-03-01
The aim of the present study was to immunohistochemically investigate the expression and prognostic significance of putative cancer stem cell markers CD117 (c-kit), CD34, CD20 and CD15 in a cohort of patients with primary choroidal and ciliary body melanoma. The immunohistochemical expression of these markers was evaluated using 3,3'-diaminobenzidine tetrahydrochloride (DAB) and 3-amino-9-ethylcarbazole (AEC) chromogens on paraffin-embedded tissue samples from 40 patients who underwent enucleation in the period from 1985 through 2000. Thirty-one patients had adequate tissue specimens for the analysis. CD117 overexpression was observed in 12 of the 31 samples (39%) when AEC chromogen was used and in 14 of 26 (54%) samples when DAB was used. CD15 positivity was seen in three out of 30 (10%) samples with AEC and in six out of 26 (23%) samples with DAB. CD20 and CD34 exhibited no positivity in the tested samples. During the average follow-up time of 8.7 years (range 0.5-22 years), 17 patients (55%) died due to metastatic disease. The Kaplan-Meier plots showed a significantly shorter overall and disease-free survival in CD117-positive patients when the AEC chromogen was used. CD15 expression was not associated with patients' survival. In multivariate analysis, patients expressing the CD117 AEC had 4.13 times higher risk of lethal outcome in comparison with CD117 AEC negative patients. Our retrospective cohort study has for the first time demonstrated a small proportion of CD15-positive uveal melanomas. CD117 AEC overexpression was associated with a worse outcome in patients with choroidal and ciliary body melanoma. Further studies should confirm the validity of these observations and their potential for targeted treatment modalities. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
[Expression and clinical significance of CD147 in parathyroid carcinoma].
Du, X M; Wang, L L; Chang, H; Meng, W; Zhang, J Y; Shen, B
2016-06-08
To study the expression and clinical significance of CD147 in the patients of parathyroid carcinoma. Fourteen cases of parathyroid carcinoma encountered during the period from 2012 to 2015 were enrolled. Thirty three cases of parathyroid adenoma encountered during the same period were enrolled. The expression of CD147 in parathyroid carcinoma and parathyroid adenoma was studied by means of immunohistochemistry (EnVision method). CD147 positive color was brown and yellow, and positive position was located mainly in the cytomembrane, and a small amount of cytoplasm was appeared. Among 14 cases of parathyroid carcinoma, 11 cases of CD147 positive score was 3+ , 3 cases of CD147 positive score was 2+ ; Among 33 cases of parathyroid adenoma , 8 cases of CD147 positive score was 2+ , 15 cases of it was 1+ , 10 cases of it was negative. CD147 was highly expressed in parathyroid carcinoma tissues, and the expression of CD147 was significantly different from the expression of parathyroid adenoma(PCD147 immunohistochemical staining can help to diagnose parathyroid carcinoma.
Damouche, Abderaouf; Pourcher, Guillaume; Pourcher, Valérie; Benoist, Stéphane; Busson, Elodie; Lataillade, Jean-Jacques; Le Van, Mélanie; Lazure, Thierry; Adam, Julien; Favier, Benoit; Vaslin, Bruno; Müller-Trutwin, Michaela; Lambotte, Olivier; Bourgeois, Christine
2017-12-01
We and others have demonstrated that adipose tissue is a reservoir for HIV. Evaluation of the mechanisms responsible for viral persistence may lead to ways of reducing these reservoirs. Here, we evaluated the immune characteristics of adipose tissue in HIV-infected patients receiving antiretroviral therapy (ART) and in non-HIV-infected patients. We notably sought to determine whether adipose tissue's intrinsic properties and/or HIV induced alteration of the tissue environment may favour viral persistence. ART-controlled HIV infection was associated with a difference in the CD4/CD8 T-cell ratio and an elevated proportion of Treg cells in subcutaneous adipose tissue. No changes in Th1, Th2 and Th17 cell proportions or activation markers expression on T cell (Ki-67, HLA-DR) could be detected, and the percentage of CD69-expressing resident memory CD4 + T cells was not affected. Overall, our results indicate that adipose-tissue-resident CD4 + T cells are not extensively activated during HIV infection. PD-1 was expressed by a high proportion of tissue-resident memory CD4 + T cells in both HIV-infected patients and non-HIV-infected patients. Our findings suggest that adipose tissue's intrinsic immunomodulatory properties may limit immune activation and thus may strongly contribute to viral persistence. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Directory of Open Access Journals (Sweden)
O. I. Stepanova
2011-01-01
Full Text Available Abstract. Leukocyte recruitment to placental tissue is an important factor of its development. In this respect, adhesion molecules at the endothelial cell surface represent a key determining factor of leukocyte adhesion and their trans-endothelial migration. The goal of investigation was to evaluate changed expression of adhesion molecules on the endothelial cells induced by supernates of placental tissue cultures. Placental tissue supernatants produced by the first- and third-trimester placental tissue from normal pregnancy, as well as from women with gestosis, induced higher expression of CD31, CD9, CD62E, CD62P, CD34, CD54, CD51/61, CD49d and integrin β7 expression by endothelial cells, as compared with their baseline levels. However, the supernates from pre-eclamptic placental tissue (3rd trimester caused an increased CD9 expression by endothelial cells, as compared with effects of placental supernates from eclampsia-free cases. Our data contribute to understanding a possible role of endothelial cell adhesion molecules in recruitment of leukocytes to placental tissue and possible participation of adhesion molecules in pathogenesis of pre-eclampsia. The work was supported by a grant from Russian Ministry of Education and Science ГК №02.740.11.0711 and Presidential grant № НШ-3594.2010.7 and МД-150.2011.7. (Med. Immunol., 2011, vol. 13, N 6, pp 589-596
International Nuclear Information System (INIS)
Notten, M.J.M.; Oosthoek, A.J.P.; Rozema, J.; Aerts, R.
2006-01-01
We studied Cd accumulation in Cepaea nemoralis snails at low, but field-relevant Cd concentrations in the diet (Urtica dioica leaves). Six treatments of U. dioica plants were grown, resulting in leaf Cd concentrations between 0 and 2.6 μg g -1 dw. Seven snails per treatment were fed for 38 days. Leaf Cd concentrations did not affect food consumption rates, and consequently Cd intake rates increased with increasing leaf concentrations. No differences were detected among treatments in the final soft tissue Cd concentrations and body burdens in the snails. Regression analyses showed no positive relationship between either snail Cd concentrations or body burdens and total Cd intake. This suggests a regulation of internal Cd concentrations at low food Cd concentrations. Our data suggest that Cd excretion via the mucus plays a substantial role in this regulation, in addition to Cd excretion via the faeces. Snail shells were no sinks for Cd. - Cd excretion via the mucus plays a substantial role in the regulation of C. nemoralis soft tissue Cd concentrations at low, but field-relevant Cd concentrations in the food
Energy Technology Data Exchange (ETDEWEB)
Notten, M.J.M. [Institute of Ecological Science, Department of Systems Ecology, Vrije Universiteit Amsterdam, De Boelelaan 1085, 1081 HV, Amsterdam (Netherlands)]. E-mail: martje.notten@ecology.falw.vu.nl; Oosthoek, A.J.P. [Institute of Ecological Science, Department of Systems Ecology, Vrije Universiteit Amsterdam, De Boelelaan 1085, 1081 HV, Amsterdam (Netherlands); Rozema, J. [Institute of Ecological Science, Department of Systems Ecology, Vrije Universiteit Amsterdam, De Boelelaan 1085, 1081 HV, Amsterdam (Netherlands); Aerts, R. [Institute of Ecological Science, Department of Systems Ecology, Vrije Universiteit Amsterdam, De Boelelaan 1085, 1081 HV, Amsterdam (Netherlands)
2006-01-15
We studied Cd accumulation in Cepaea nemoralis snails at low, but field-relevant Cd concentrations in the diet (Urtica dioica leaves). Six treatments of U. dioica plants were grown, resulting in leaf Cd concentrations between 0 and 2.6 {mu}g g{sup -1} dw. Seven snails per treatment were fed for 38 days. Leaf Cd concentrations did not affect food consumption rates, and consequently Cd intake rates increased with increasing leaf concentrations. No differences were detected among treatments in the final soft tissue Cd concentrations and body burdens in the snails. Regression analyses showed no positive relationship between either snail Cd concentrations or body burdens and total Cd intake. This suggests a regulation of internal Cd concentrations at low food Cd concentrations. Our data suggest that Cd excretion via the mucus plays a substantial role in this regulation, in addition to Cd excretion via the faeces. Snail shells were no sinks for Cd. - Cd excretion via the mucus plays a substantial role in the regulation of C. nemoralis soft tissue Cd concentrations at low, but field-relevant Cd concentrations in the food.
Directory of Open Access Journals (Sweden)
Daniela Belotti
2015-01-01
Full Text Available According to the European Medicine Agency (EMA regulatory frameworks, Advanced Therapy Medicinal Products (ATMP represent a new category of drugs in which the active ingredient consists of cells, genes, or tissues. ATMP-CD133 has been widely investigated in controlled clinical trials for cardiovascular diseases, making CD133+ cells one of the most well characterized cell-derived drugs in this field. To ensure high quality and safety standards for clinical use, the manufacturing process must be accomplished in certified facilities following standard operative procedures (SOPs. In the present work, we report the fully compliant GMP-grade production of ATMP-CD133 which aims to address the treatment of chronic refractory ischemic heart failure. Starting from bone marrow (BM, ATMP-CD133 manufacturing output yielded a median of 6.66 × 106 of CD133+ cells (range 2.85 × 106–30.84 × 106, with a viability ranged between 96,03% and 99,97% (median 99,87% and a median purity of CD133+ cells of 90,60% (range 81,40%–96,20%. Based on these results we defined our final release criteria for ATMP-CD133: purity ≥ 70%, viability ≥ 80%, cellularity between 1 and 12 × 106 cells, sterile, and endotoxin-free. The abovementioned criteria are currently applied in our Phase I clinical trial (RECARDIO Trial.
Belotti, Daniela; Gaipa, Giuseppe; Bassetti, Beatrice; Cabiati, Benedetta; Spaltro, Gabriella; Biagi, Ettore; Parma, Matteo; Biondi, Andrea; Cavallotti, Laura; Gambini, Elisa; Pompilio, Giulio
2015-01-01
According to the European Medicine Agency (EMA) regulatory frameworks, Advanced Therapy Medicinal Products (ATMP) represent a new category of drugs in which the active ingredient consists of cells, genes, or tissues. ATMP-CD133 has been widely investigated in controlled clinical trials for cardiovascular diseases, making CD133(+) cells one of the most well characterized cell-derived drugs in this field. To ensure high quality and safety standards for clinical use, the manufacturing process must be accomplished in certified facilities following standard operative procedures (SOPs). In the present work, we report the fully compliant GMP-grade production of ATMP-CD133 which aims to address the treatment of chronic refractory ischemic heart failure. Starting from bone marrow (BM), ATMP-CD133 manufacturing output yielded a median of 6.66 × 10(6) of CD133(+) cells (range 2.85 × 10(6)-30.84 × 10(6)), with a viability ranged between 96,03% and 99,97% (median 99,87%) and a median purity of CD133(+) cells of 90,60% (range 81,40%-96,20%). Based on these results we defined our final release criteria for ATMP-CD133: purity ≥ 70%, viability ≥ 80%, cellularity between 1 and 12 × 10(6) cells, sterile, and endotoxin-free. The abovementioned criteria are currently applied in our Phase I clinical trial (RECARDIO Trial).
Belotti, Daniela; Gaipa, Giuseppe; Bassetti, Beatrice; Cabiati, Benedetta; Spaltro, Gabriella; Biagi, Ettore; Parma, Matteo; Biondi, Andrea; Cavallotti, Laura; Gambini, Elisa; Pompilio, Giulio
2015-01-01
According to the European Medicine Agency (EMA) regulatory frameworks, Advanced Therapy Medicinal Products (ATMP) represent a new category of drugs in which the active ingredient consists of cells, genes, or tissues. ATMP-CD133 has been widely investigated in controlled clinical trials for cardiovascular diseases, making CD133+ cells one of the most well characterized cell-derived drugs in this field. To ensure high quality and safety standards for clinical use, the manufacturing process must be accomplished in certified facilities following standard operative procedures (SOPs). In the present work, we report the fully compliant GMP-grade production of ATMP-CD133 which aims to address the treatment of chronic refractory ischemic heart failure. Starting from bone marrow (BM), ATMP-CD133 manufacturing output yielded a median of 6.66 × 106 of CD133+ cells (range 2.85 × 106–30.84 × 106), with a viability ranged between 96,03% and 99,97% (median 99,87%) and a median purity of CD133+ cells of 90,60% (range 81,40%–96,20%). Based on these results we defined our final release criteria for ATMP-CD133: purity ≥ 70%, viability ≥ 80%, cellularity between 1 and 12 × 106 cells, sterile, and endotoxin-free. The abovementioned criteria are currently applied in our Phase I clinical trial (RECARDIO Trial). PMID:26495296
Tissue-specific regulation of mouse MicroRNA genes in endoderm-derived tissues
Gao, Yan; Schug, Jonathan; McKenna, Lindsay B.; Le Lay, John; Kaestner, Klaus H.; Greenbaum, Linda E.
2010-01-01
MicroRNAs fine-tune the activity of hundreds of protein-coding genes. The identification of tissue-specific microRNAs and their promoters has been constrained by the limited sensitivity of prior microRNA quantification methods. Here, we determine the entire microRNAome of three endoderm-derived tissues, liver, jejunum and pancreas, using ultra-high throughput sequencing. Although many microRNA genes are expressed at comparable levels, 162 microRNAs exhibited striking tissue-specificity. After...
Directory of Open Access Journals (Sweden)
Jesse J R Masson
Full Text Available Metabolism plays a fundamental role in supporting the growth, proliferation and effector functions of T cells. We investigated the impact of HIV infection on key processes that regulate glucose uptake and mitochondrial biogenesis in subpopulations of CD4+ and CD8+ T cells from 18 virologically-suppressed HIV-positive individuals on combination antiretroviral therapy (cART; median CD4+ cell count: 728 cells/μl and 13 HIV seronegative controls. Mitochondrial membrane potential (MMP and reactive oxygen species (ROS production were also analysed in total CD4+ and CD8+ T cells. Among HIV+/cART individuals, expression of glucose transporter (Glut1 and mitochondrial density were highest within central memory and naïve CD4+ T cells, and lowest among effector memory and transitional memory T cells, with similar trends in HIV-negative controls. Compared to HIV-negative controls, there was a trend towards higher percentage of circulating CD4+Glut1+ T cells in HIV+/cART participants. There were no significant differences in mitochondrial dynamics between subject groups. Glut1 expression was positively correlated with mitochondrial density and MMP in total CD4+ T cells, while MMP was also positively correlated with ROS production in both CD4+ and CD8+ T cells. Our study characterizes specific metabolic features of CD4+ and CD8+ T cells in HIV-negative and HIV+/cART individuals and will invite future studies to explore the immunometabolic consequences of HIV infection.
The Tissue Analysis Core (TAC) within the AIDS and Cancer Virus Program will process, embed, and perform microtomy on fixed tissue samples presented in ethanol. CD4 (DAB) and CD68/CD163 (FastRed) double immunohistochemistry will be performed, in whic
Directory of Open Access Journals (Sweden)
Umang G Thakkar
2014-08-01
Full Text Available Stem cell therapy is emerging as a viable approach in regenerative medicine. A 31-year-old male with brachial plexus injury had complete sensory-motor loss since 16 years with right pseudo-meningocele at C5-D1 levels and extra-spinal extension up to C7-D1, with avulsion on magnetic resonance imaging and irreversible damage. We generated adipose tissue derived neuronal differentiated mesenchymal stem cells (N-AD-MSC and bone marrow derived hematopoietic stem cells (HSC-BM. Neuronal stem cells expressed β-3 tubulin and glial fibrillary acid protein which was confirmed on immunofluorescence. On day 14, 2.8 ml stem cell inoculum was infused under local anesthesia in right brachial plexus sheath by brachial block technique under ultrasonography guidance with a 1.5-inch-long 23 gauge needle. Nucleated cell count was 2 × 10 4 /μl, CD34+ was 0.06%, and CD45-/90+ and CD45-/73+ were 41.63% and 20.36%, respectively. No untoward effects were noted. He has sustained recovery with re-innervation over a follow-up of 4 years documented on electromyography-nerve conduction velocity study.
CD3 Positive Gastric Plasmablastic Lymphoma in A HIV Negative Patient: A Case Report
Directory of Open Access Journals (Sweden)
Betül Bolat Küçükzeybek,
2017-03-01
Full Text Available Plasmablastic lymphoma is a rare and aggressive lymphoma characterized by the diffuse proliferation of large neoplastic cells resembling immunoblasts with an immunophenotype of plasma cells. A 47-year-old male was referred to our hospital with gastrointestinal bleeding, and a mass 10 cm in diameter, was detected. An endoscopic biopsy was performed subsequently. Histopathological examination of the biopsy material revealed ulcer, alterations associated with ulcer, and further presented a diffuse infiltration of atypical cells with abundant cytoplasm and pleomorphic nuclei, some with crush artifacts in lamina propria. Immunohistochemically, the tumor cells were negative for cytokeratin, CD2, CD20, and PAX5; but they were positive for CD3, MUM1, CD38 and CD138. Ki67 proliferation index was as high as 95%. The case was signed out as CD3-positive plasmablastic lymphoma with clinical, histopathological and immunohisto-chemical findings. The plasmablastic lymphoma case with an aberrant CD3 expression has been presented here, which is rarely observed in stomach.
CD44-positive cells are candidates for astrocyte precursor cells in developing mouse cerebellum.
Cai, Na; Kurachi, Masashi; Shibasaki, Koji; Okano-Uchida, Takayuki; Ishizaki, Yasuki
2012-03-01
Neural stem cells are generally considered to be committed to becoming precursor cells before terminally differentiating into either neurons or glial cells during neural development. Neuronal and oligodendrocyte precursor cells have been identified in several areas in the murine central nervous system. The presence of astrocyte precursor cells (APCs) is not so well understood. The present study provides several lines of evidence that CD44-positive cells are APCs in the early postnatal mouse cerebellum. In developing mouse cerebellum, CD44-positive cells, mostly located in the white matter, were positive for the markers of the astrocyte lineage, but negative for the markers of mature astrocytes. CD44-positive cells were purified from postnatal cerebellum by fluorescence-activated cell sorting and characterized in vitro. In the absence of any signaling molecule, many cells died by apoptosis. The surviving cells gradually expressed glial fibrillary acidic protein, a marker for mature astrocytes, indicating that differentiation into mature astrocytes is the default program for these cells. The cells produced no neurospheres nor neurons nor oligodendrocytes under any condition examined, indicating these cells are not neural stem cells. Leukemia inhibitory factor greatly promoted astrocytic differentiation of CD44-positive cells, whereas bone morphogenetic protein 4 (BMP4) did not. Fibroblast growth factor-2 was a potent mitogen for these cells, but was insufficient for survival. BMP4 inhibited activation of caspase-3 and greatly promoted survival, suggesting a novel role for BMP4 in the control of development of astrocytes in cerebellum. We isolated and characterized only CD44 strongly positive large cells and discarded small and/or CD44 weakly positive cells in this study. Further studies are necessary to characterize these cells to help determine whether CD44 is a selective and specific marker for APCs in the developing mouse cerebellum. In conclusion, we succeeded in
Foetal stem cell derivation & characterization for osteogenic lineage
Directory of Open Access Journals (Sweden)
A Mangala Gowri
2013-01-01
Full Text Available Background & objectives: Mesencymal stem cells (MSCs derived from foetal tissues present a multipotent progenitor cell source for application in tissue engineering and regenerative medicine. The present study was carried out to derive foetal mesenchymal stem cells from ovine source and analyze their differentiation to osteogenic linage to serve as an animal model to predict human applications. Methods: Isolation and culture of sheep foetal bone marrow cells were done and uniform clonally derived MSC population was collected. The cells were characterized using cytochemical, immunophenotyping, biochemical and molecular analyses. The cells with defined characteristics were differentiated into osteogenic lineages and analysis for differentiated cell types was done. The cells were analyzed for cell surface marker expression and the gene expression in undifferentiated and differentiated osteoblast was checked by reverse transcriptase PCR (RT PCR analysis and confirmed by sequencing using genetic analyzer. Results: Ovine foetal samples were processed to obtain mononuclear (MNC cells which on culture showed spindle morphology, a characteristic oval body with the flattened ends. MSC population CD45 - /CD14 - was cultured by limiting dilution to arrive at uniform spindle morphology cells and colony forming units. The cells were shown to be positive for surface markers such as CD44, CD54, integrinβ1, and intracellular collagen type I/III and fibronectin. The osteogenically induced MSCs were analyzed for alkaline phosphatase (ALP activity and mineral deposition. The undifferentiated MSCs expressed RAB3B, candidate marker for stemness in MSCs. The osteogenically induced and uninduced MSCs expressed collagen type I and MMP13 gene in osteogenic induced cells. Interpretation & conclusions: The protocol for isolation of ovine foetal bone marrow derived MSCs was simple to perform, and the cultural method of obtaining pure spindle morphology cells was established
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...
Energy Technology Data Exchange (ETDEWEB)
Doerr, W. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Medical University / AKH Vienna (Austria). Dept. of Radiation Oncology; Kallfels, S. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Kinder- und Jugendmedizin, Chemnitz [Germany; Herrmann, T. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology
2013-07-15
Purpose: The present retrospective study was initiated to characterize the effect of oncological treatments in children and adolescents on bone and soft tissues, and to assess their dependence on radiation dose and age at exposure. Patients and methods: The study included 146 patients treated between 1970 and 1997. All patients received external beam radiotherapy to the trunk or extremities, but no cranial irradiation. Median age at treatment was 8.8 years. Patients were screened at 18 years (median time interval since treatment 9.2 years, range 0.9-17.7 years) for pathological changes in the skeletal system and soft tissues (scoliosis, kyphosis, bony hypoplasia, soft tissue defects, asymmetries), which were classified as minor/moderate (grade 1) or substantial (grade 2). Results: Pathological findings were recorded in 75/146 patients (51 %). These were scored as minor in 44 (59 %) and substantial in 31 patients (41 %). Most pathological changes occurred in children treated under the age of 6 years. At 6 years and older, only doses > 35 Gy caused an effect, and no substantial changes were seen for treatment ages exceeding 12 years. Significant effects of radiation dose and age at exposure were observed for kyphoscoliosis (with vertebral body dose gradients < 35 Gy), hypoplasia and soft tissue defects and asymmetrical growth. Conclusion: Tolerance doses of 20 Gy need to be respected for growing bone, particularly in children treated under the age of 6 years. The late treatment sequelae analysed in the present study are largely avoided with the use of current therapeutic protocols. However, the systematic evaluation, documentation and continuous analysis of adverse events in paediatric oncology remains essential, as does the evaluation of novel radio(chemo)therapeutic approaches. (orig.)
Vermeire, Kurt; Lisco, Andrea; Grivel, Jean-Charles; Scarbrough, Emily; Dey, Kaka; Duffy, Noah; Margolis, Leonid; Bell, Thomas W; Schols, Dominique
2007-08-15
A new class of anti-retrovirals, cyclotriazadisulfonamide (CADA) and its derivatives, specifically down-regulate CD4, the main receptor of HIV, and prevent HIV infection in vitro. In this work, several CADA derivatives, chemically labeled with a fluorescent dansyl group, were evaluated for their biological features and cellular uptake kinetics. We identified a derivative KKD-016 with antiviral and CD4 down-modulating capabilities similar to those of the parental compound CADA. By using flow cytometry, we demonstrated that the dose-dependent cellular uptake of this derivative correlated with CD4 down-modulation. The uptake and activity of the dansyl-labeled compounds were not dependent on the level of expression of CD4 at the cell surface. Removal of the CADA compounds from the cell culture medium resulted in their release from the cells followed by a complete restoration of CD4 expression. The inability of several fluorescent CADA derivatives to down-modulate CD4 was not associated with their lower cellular uptake and was not reversed by facilitating their cell penetration by a surfactant. These results prove the successful integration of the dansyl fluorophore into the chemical structure of a CD4 down-modulating anti-HIV compound, and show the feasibility of tracking a receptor and its down-modulator simultaneously. These fluorescent CADA analogs with reversible CD4 down-regulating potency can now be applied in further studies on receptor modulation, and in the exploration of their potentials as preventive and therapeutic anti-HIV drugs.
Directory of Open Access Journals (Sweden)
Kun Taek Park
Full Text Available Phylogenic comparisons of the mononuclear phagocyte system (MPS of humans and mice demonstrate phenotypic divergence of dendritic cell (DC subsets that play similar roles in innate and adaptive immunity. Although differing in phenotype, DC can be classified into four groups according to ontogeny and function: conventional DC (cDC1 and cDC2, plasmacytoid DC (pDC, and monocyte derived DC (MoDC. DC of Artiodactyla (pigs and ruminants can also be sub-classified using this system, allowing direct functional and phenotypic comparison of MoDC and other DC subsets trafficking in blood (bDC. Because of the high volume of blood collections required to study DC, cattle offer the best opportunity to further our understanding of bDC and MoDC function in an outbred large animal species. As reported here, phenotyping DC using a monoclonal antibody (mAb to CD209 revealed CD209 is expressed on the major myeloid population of DC present in blood and MoDC, providing a phenotypic link between these two subsets. Additionally, the present study demonstrates that CD209 is also expressed on monocyte derived macrophages (MoΦ. Functional analysis revealed each of these populations can take up and process antigens (Ags, present them to CD4 and CD8 T cells, and elicit a T-cell recall response. Thus, bDC, MoDC, and MoΦ pulsed with pathogens or candidate vaccine antigens can be used to study factors that modulate DC-driven T-cell priming and differentiation ex vivo.
cd4 changes in haart-naïve hiv positive pregnant women on haart
African Journals Online (AJOL)
boaz
This study thus attempt an assessment of the pattern of immunologic (CD4) changes in naïve. HIV positive pregnant women, in the first two months of commencing HAART, with a view to possibly postulate CD4 response rate and recommend the ideal time to initiate HAARTin HIV positive pregnant patients. METHODOLOGY.
International Nuclear Information System (INIS)
Xu, Zhong-Xuan; Ao, Ke-Hou; Zhang, Jian
2016-01-01
A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd 2.5 ((R)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-D), [Cd 2.5 ((S)-CIA) 6 (1,4-DIB)(H 2 O) 2 ]·((CH 3 ) 2 NH 2 )·H 2 O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H 3 CIA and (S)-H 3 CIA) and 1,4-DIB to assemble with Cd 2+ ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers
Henrich, D; Seebach, C; Verboket, R; Schaible, A; Marzi, I; Bonig, H
2018-03-06
Bone marrow mononuclear cells (BMC) seeded on a scaffold of β-tricalcium phosphate (β-TCP) promote bone healing in a critical-size femur defect model. Being BMC a mixed population of predominantly mature haematopoietic cells, which cell type(s) is(are) instrumental for healing remains elusive. Although clinical therapies using BMC are often dubbed as stem cell therapies, whether stem cells are relevant for the therapeutic effects is unclear and, at least in the context of bone repair, seems dubious. Instead, in light of the critical contribution of monocytes and macrophages to tissue development, homeostasis and injury repair, in the current study it was hypothesised that BMC-mediated bone healing derived from the stem cell population. To test this hypothesis, bone remodelling studies were performed in an established athymic rats critical-size femoral defect model, with β-TCP scaffolds augmented with complete BMC or BMC immunomagnetically depleted of stem cells (CD34+) or monocytes/macrophages (CD14+). Bone healing was assessed 8 weeks after transplantation. Compared to BMC-augmented controls, when CD14- BMC, but not CD34- BMC were transplanted into the bone defect, femora possessed dramatically decreased biomechanical stability and new bone formation was markedly reduced, as measured by histology. The degree of vascularisation did not differ between the two groups. It was concluded that the monocyte fraction within the BMC provided critical osteo-inductive cues during fracture healing. Which factors were responsible at the molecular levels remained elusive. However, this study marked a significant progress towards elucidating the mechanisms by which BMC elicit their therapeutic effects, at least in bone regeneration.
Primary Cutaneous CD4-Positive Small/Medium Pleomorphic T-cell Lymphoma – A Case Report
Directory of Open Access Journals (Sweden)
Micković Milena
2016-12-01
Full Text Available Primary cutaneous CD4-positive small- to medium-sized pleomorphic T-cell lymphoma is a provisional entity in the 2005 WHO-EORTC classification for cutaneous lymphomas. It is a rare condition and, in most cases, it has a favorable clinical course and prognosis. Primary cutaneous CD4-positive small/medium pleomorphic T-cell lymphoma (PCSM-TCL is defined as a cutaneous T-cell lymphoma with predominantly small- to medium-sized CD4-positive pleomorphic T-cells without a history of patches and plaques typical of mycosis fungoides. PCSM-TCL usually presents as a solitary plaque or tumor on the head, neck, trunk or upper extremities and it is considered to have indolent clinical behavior. Histologically, it is characterized by a dense infiltration of small/medium-sized pleomorphic T-cells that involves the entire dermal thickness, often with nodular extension into the hypodermis. Using immunohistochemical staining, the majority of the reported cases proved to be CD3, CD4 positive and CD8, CD30 negative. However, due to the rarity and heterogeneity of the PCSM-TCL, precise clinicopathologic characteristics of PCSM-TCL have not been well characterized and the optimal treatment for this group of lymphomas is yet to be defined. Dermatologists and pathologists should be aware of this entity in order to avoid unnecessary aggressive treatments.
Directory of Open Access Journals (Sweden)
Catherine To
Full Text Available Eph and ephrin proteins are essential cell guidance cues that orchestrate cell navigation and control cell-cell interactions during developmental tissue patterning, organogenesis and vasculogenesis. They have been extensively studied in animal models of embryogenesis and adult tissue regeneration, but less is known about their expression and function during human tissue and organ regeneration. We discovered the hypoxia inducible factor (HIF-1α-controlled expression of EphA3, an Eph family member with critical functions during human tumour progression, in the vascularised tissue of regenerating human endometrium and on isolated human endometrial multipotent mesenchymal stromal cells (eMSCs, but not in other highly vascularised human organs. EphA3 affinity-isolation from human biopsy tissue yielded multipotent CD29+/CD73+/CD90+/CD146+ eMSCs that can be clonally propagated and respond to EphA3 agonists with EphA3 phosphorylation, cell contraction, cell-cell segregation and directed cell migration. EphA3 silencing significantly inhibited the ability of transplanted eMSCs to support neovascularisation in immunocompromised mice. In accord with established roles of Eph receptors in mediating interactions between endothelial and perivascular stromal cells during mouse development, our findings suggest that HIF-1α-controlled expression of EphA3 on human MSCs functions during the hypoxia-initiated early stages of adult blood vessel formation.
Local induction of immunosuppressive CD8+ T cells in the gut-associated lymphoid tissues.
Directory of Open Access Journals (Sweden)
Diana Fleissner
Full Text Available BACKGROUND: In contrast to intestinal CD4(+ regulatory T cells (T(regs, the generation and function of immunomodulatory intestinal CD8(+ T cells is less well defined. To dissect the immunologic mechanisms of CD8(+ T cell function in the mucosa, reactivity against hemagglutinin (HA expressed in intestinal epithelial cells of mice bearing a MHC class-I-restricted T-cell-receptor specific for HA was studied. METHODOLOGY AND PRINCIPAL FINDINGS: HA-specific CD8(+ T cells were isolated from gut-associated tissues and phenotypically and functionally characterized for the expression of Foxp3(+ and their suppressive capacity. We demonstrate that intestinal HA expression led to peripheral induction of HA-specific CD8(+Foxp3(+ T cells. Antigen-experienced CD8(+ T cells in this transgenic mouse model suppressed the proliferation of CD8(+ and CD4(+ T cells in vitro. Gene expression analysis of suppressive HA-specific CD8(+ T cells revealed a specific up-regulation of CD103, Nrp1, Tnfrsf9 and Pdcd1, molecules also expressed on CD4(+ T(reg subsets. Finally, gut-associated dendritic cells were able to induce HA-specific CD8(+Foxp3(+ T cells. CONCLUSION AND SIGNIFICANCE: We demonstrate that gut specific antigen presentation is sufficient to induce CD8(+ T(regsin vivo which may maintain intestinal homeostasis by down-modulating effector functions of T cells.
Local induction of immunosuppressive CD8+ T cells in the gut-associated lymphoid tissues.
Fleissner, Diana; Hansen, Wiebke; Geffers, Robert; Buer, Jan; Westendorf, Astrid M
2010-10-20
In contrast to intestinal CD4(+) regulatory T cells (T(regs)), the generation and function of immunomodulatory intestinal CD8(+) T cells is less well defined. To dissect the immunologic mechanisms of CD8(+) T cell function in the mucosa, reactivity against hemagglutinin (HA) expressed in intestinal epithelial cells of mice bearing a MHC class-I-restricted T-cell-receptor specific for HA was studied. HA-specific CD8(+) T cells were isolated from gut-associated tissues and phenotypically and functionally characterized for the expression of Foxp3(+) and their suppressive capacity. We demonstrate that intestinal HA expression led to peripheral induction of HA-specific CD8(+)Foxp3(+) T cells. Antigen-experienced CD8(+) T cells in this transgenic mouse model suppressed the proliferation of CD8(+) and CD4(+) T cells in vitro. Gene expression analysis of suppressive HA-specific CD8(+) T cells revealed a specific up-regulation of CD103, Nrp1, Tnfrsf9 and Pdcd1, molecules also expressed on CD4(+) T(reg) subsets. Finally, gut-associated dendritic cells were able to induce HA-specific CD8(+)Foxp3(+) T cells. We demonstrate that gut specific antigen presentation is sufficient to induce CD8(+) T(regs)in vivo which may maintain intestinal homeostasis by down-modulating effector functions of T cells.
Reynolds, G; Gibbon, J R; Pratt, A G; Wood, M J; Coady, D; Raftery, G; Lorenzi, A R; Gray, A; Filer, A; Buckley, C D; Haniffa, M A; Isaacs, J D; Hilkens, C M U
2016-01-01
Objective A population of synovial inflammatory dendritic cells (infDCs) has recently been identified in rheumatoid arthritis (RA) and is thought to be monocyte-derived. Here, we investigated the role and source of granulocyte macrophage-colony-stimulating factor (GM-CSF) in the differentiation of synovial infDC in RA. Methods Production of GM-CSF by peripheral blood (PB) and synovial fluid (SF) CD4+ T cells was assessed by ELISA and flow cytometry. In vitro CD4+ T-cell polarisation experiments were performed with T-cell activating CD2/CD3/CD28-coated beads in the absence or presence of pro-Th1 or pro-Th17 cytokines. CD1c+ DC and CD16+ macrophage subsets were flow-sorted and analysed morphologically and functionally (T-cell stimulatory/polarising capacity). Results RA-SF CD4+ T cells produced abundant GM-CSF upon stimulation and significantly more than RA-SF mononuclear cells depleted of CD4+ T cells. GM-CSF-producing T cells were significantly increased in RA-SF compared with non-RA inflammatory arthritis SF, active RA PB and healthy donor PB. GM-CSF-producing CD4+ T cells were expanded by Th1-promoting but not Th17-promoting conditions. Following coculture with RA-SF CD4+ T cells, but not healthy donor PB CD4+ T cells, a subpopulation of monocytes differentiated into CD1c+ infDC; a process dependent on GM-CSF. These infDC displayed potent alloproliferative capacity and enhanced GM-CSF, interleukin-17 and interferon-γ production by CD4+ T cells. InfDC with an identical phenotype to in vitro generated cells were significantly enriched in RA-SF compared with non-RA-SF/tissue/PB. Conclusions We demonstrate a therapeutically tractable feedback loop of GM-CSF secreted by RA synovial CD4+ T cells promoting the differentiation of infDC with potent capacity to induce GM-CSF-producing CD4+ T cells. PMID:25923217
Effectiveness of Vascular Markers (Immunohistochemical Stains) in Soft Tissue Sarcomas.
Naeem, Namra; Mushtaq, Sajid; Akhter, Noreen; Hussain, Mudassar; Hassan, Usman
2018-05-01
To ascertain the effectiveness of IHC markers of vascular origin like CD31, CD34, FLI1 and ERG in vascular soft tissue sarcomas including angiosarcomas, Kaposi sarcomas, epithelioid hemangioendothelioma and a non-vascular soft tissue sarcoma (Epithelioid sarcoma). Descriptive study. Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, from 2011 to 2017. Diagnosed cases of angiosarcomas (n=48), epithelioid hemangioendothelioma (n=9), Kaposi sarcoma (n=9) and epithelioid sarcoma (n=20) were selected. Immunohistochemical staining as performed on formalin fixed paraffin embedded sections. The sections were stained for the following markers: CD34 (VENTANA clone Q Bend 10), CD31 (Leica clone 1 A 10), FLI1 (CELL MARQUE clone MRQ-1) and ERG (CELL MARQUE clone EP111). A complete panel of CD34, CD31 and ERG was applied on 8/48 cases of angiosarcomas with triple positivity in 6 cases. Eight cases showed positivity for only CD31 and ERG and 2 cases showed positivity for only ERG. A complete panel of CD34, CD31 and ERG was applied on 3/9 cases of epithelioid hemangioendothelioma with positivity for all markers in 2 cases. Combined positivity for ERG and CD34 was seen in 2 cases and on 4 cases only CD31 immunohistochemical was solely applied with 100% positivity. FLI1 was not applied on any case. Among 9 cases of Kaposi sarcoma, ERG, CD34 and CD31 in combination were applied on only 1 case with triple positivity. Remaining cases show positivity for either CD34, CD31 or FLI1. Majority of cases of epithelioid sarcomas were diagnosed on the basis of cytokeratin and CD34 positivity with loss of INI1. The other vascular markers showed negativity in all cases. Among these four markers, ERG immunohistochemical stain is highly effective for endothelial differentiation due to its specific nuclear staining pattern in normal blood vessel endothelial cells (internal control) as well as neoplastic cells of vascular tumors and lack of background staining.
CD20-based Immunotherapy of B-cell Derived Hematologic Malignancies.
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili
2017-01-01
CD20 is a surface antigen, which is expressed at certain stages of B-cell differentiation. Targeting the CD20-positive B-cells with therapeutic monoclonal antibodies (MAbs) has been an effectual strategy in the treatment of hematologic malignancies such as non-Hodgkin's lymphoma (NHL) and chronic lymphocytic leukemia (CLL). Initial success with Rituximab (RTX) has encouraged the creation and development of more effective CD20 based therapeutics. However, treatment with conventional MAbs has not been adequate to overcome the problems such as refractory/ relapsed disease. In this regard, new generations of MAbs with enhanced affinity or improved anti-tumor properties have been developed. CD20 directed therapeutics have heterogeneous features and mechanisms of action. Hence, having sufficient knowledge on the immunological and molecular aspects of CD20 based cancer therapy is necessary for predicting the clinical outcomes and taking the necessary measures. An extensive search was performed in PubMed and similar databases for peer-reviewed articles concerning the biology, function and characteristics of CD20 molecule as well as the mechanisms of action and evolutionary process of CD20 targeting agents. This review provides information about the current situation of CD20 targeting immunotherapeutics including MAbs, bispecific antibodies (which exert multiple functions or involve Tcells in tumor elimination) and CAR T-cells (engineered T-cells armed with chimeric antigen receptors). Moreover, limitations, challenges and available solutions regarding the application of CD20 targeting treatments are addressed. Utilization of CD20-targeted therapeutics, due to their diverse properties, requires special considerations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Zeng, Ming; Paiardini, Mirko; Engram, Jessica C; Beilman, Greg J; Chipman, Jeffrey G; Schacker, Timothy W; Silvestri, Guido; Haase, Ashley T
2012-08-30
Loss of the fibroblastic reticular cell (FRC) network in lymphoid tissues during HIV-1 infection has been shown to impair the survival of naive T cells and limit immune reconstitution after antiretroviral therapy. What causes this FRC loss is unknown. Because FRC loss correlates with loss of both naive CD4 and CD8 T-cell subsets and decreased lymphotoxin-β, a key factor for maintenance of FRC network, we hypothesized that loss of naive T cells is responsible for loss of the FRC network. To test this hypothesis, we assessed the consequences of antibody-mediated depletion of CD4 and CD8 T cells in rhesus macaques and sooty mangabeys. We found that only CD4 T-cell depletion resulted in FRC loss in both species and that this loss was caused by decreased lymphotoxin-β mainly produced by the CD4 T cells. We further found the same dependence of the FRC network on CD4 T cells in HIV-1-infected patients before and after antiretroviral therapy and in other immunodeficiency conditions, such as CD4 depletion in cancer patients induced by chemotherapy and irradiation. CD4 T cells thus play a central role in the maintenance of lymphoid tissue structure necessary for their own homeostasis and reconstitution.
Hu, Xiao Liang; Ciaglia, Riccardo; Pietrucci, Fabio; Gallet, Grégoire A; Andreoni, Wanda
2014-06-19
We introduce a new ab initio derived reactive potential for the simulation of CdTe within density functional theory (DFT) and apply it to calculate both static and dynamical properties of a number of systems (bulk solid, defective structures, liquid, surfaces) at finite temperature. In particular, we also consider cases with low sulfur concentration (CdTe:S). The analysis of DFT and classical molecular dynamics (MD) simulations performed with the same protocol leads to stringent performance tests and to a detailed comparison of the two schemes. Metadynamics techniques are used to empower both Car-Parrinello and classical molecular dynamics for the simulation of activated processes. For the latter, we consider surface reconstruction and sulfur diffusion in the bulk. The same procedures are applied using previously proposed force fields for CdTe and CdTeS materials, thus allowing for a detailed comparison of the various schemes.
Teshima, Kazuaki; Ohyagi, Hideaki; Kume, Masaaki; Takahashi, Satsuki; Saito, Masahiro; Takahashi, Naoto
A 79-year-old male patient presented with systemic lymphadenopathy. A lymph node biopsy revealed effacement of the normal nodal architecture with diffuse proliferation of medium-sized atypical lymphoid cells. Southern blot analyses demonstrated rearrangement of the T-cell receptor gene but not the immunoglobulin heavy chain gene. He was diagnosed with CD20-positive peripheral T-cell lymphoma (PTCL), NOS. Although he achieved partial remission after six cycles of R-CHOP, he relapse occurred after 2 months. CD20-negative conversion was confirmed in the lymph node, which was positive for CCR4, and the skin at the time of relapse. The patient received the GDP regimen as salvage therapy with the addition of vorinostat for skin involvement; however, he failed to respond, and the disease systemically progressed. Furthermore, he also exhibited progression in the skin after stopping vorinostat due to hematologic toxicity. A lymph node biopsy at progression revealed CD20 re-expression by immunohistochemistry. At progression, the patient received mogamulizumab but failed to respond, and he died owing to disease progression 8 months after relapse. In this case, we demonstrated CD20-negative conversion following rituximab and CD20-positive reversion after using vorinostat and gemcitabine.
Directory of Open Access Journals (Sweden)
Mirhane Hassan
2018-02-01
Full Text Available INTRODUCTION: Type 1 Diabetes Mellitus (T1D is an autoimmune disease that results from the destruction of insulin-producing beta cells of the pancreas by autoreactive T cells. Myeloid-derived suppressor cells (MDSCs are a heterogeneous population of cells that can potently suppress T cell responses. AIM: To detect the presence of MDSCs in T1D and compare their percentage in T1D versus healthy individuals. METHOD: Thirty T1D patients were included in the study. Diabetic patients with nephropathy (n = 18 and diabetic patients without nephropathy (n = 12. A control group of healthy individuals (n = 30 were also included. CD33+ and HLA-DR– markers were used to identify MDSCs by flow cytometry. CD14 positive and negative MDSCs subsets were also identified. RESULTS: MDSCs was significantly increased in T1D than the control group and diabetic patient with nephropathy compared to diabetic patients without nephropathy. M-MDSCs (CD14+ CD33+ HLA–DR− were the most abundant MDSCs subpopulation in all groups, however their percentage decrease in T1D than the control group. CONCLUSION: MDSCs are increased in the peripheral blood of T1D with a predominance of the CD14+ MDSCs subset. Future studies are needed to test the immune suppression function of MDSCs in T1D.
Directory of Open Access Journals (Sweden)
Maxime DUCRET
2016-11-01
Full Text Available Mesenchymal stromal/stem cells (MSCs from human dental pulp (DP can be expanded in vitro for cell-based and regenerative dentistry therapeutic purposes. However, their heterogeneity may be a hurdle to the achievement of reproducible and predictable therapeutic outcomes. To get a better knowledge about this heterogeneity, we designed a flow cytometric strategy to analyze the phenotype of DP cells in vivo and upon in vitro expansion with stem cell markers. We focused on the CD31- cell population to exclude endothelial and leukocytic cells. Results showed that the in vivo CD31- DP cell population contained 1.4% of CD56+, 1.5% of CD146+, 2.4% of CD271+ and 6.3% of MSCA-1+ cells but very few Stro-1+ cells (≤1%. CD56+, CD146+, CD271+ and MSCA-1+ cell subpopulations expressed various levels of these markers. CD146+MSCA-1+, CD271+MSCA-1+ and CD146+CD271+ cells were the most abundant DP-MSC populations. Analysis of DP-MSCs expanded in vitro with a medicinal manufacturing approach showed that CD146 was expressed by about 50% of CD56+, CD271+, MSCA-1+ and Stro-1+ cells, and MSCA-1 by 15-30% of CD56+, CD146+, CD271+ and Stro-1+ cells. These ratios remained stable with passages. CD271 and Stro-1 were expressed by less than 1% of the expanded cell populations. Interestingly, the percentage of CD56+ cells strongly increased from P1 (25% to P4 (80% both in all sub-populations studied. CD146+CD56+, MSCA-1+CD56+ and CD146+MSCA-1+ cells were the most abundant DP-MSCs at the end of P4. These results established that DP-MSCs constitute a heterogeneous mixture of cells in pulp tissue in vivo and in culture, and that their phenotype is modified upon in vitro expansion. Further studies are needed to determine whether co-expression of specific MSC markers confers DP cells specific properties that could be used for the regeneration of human tissues, including the dental pulp, with standardized cell-based medicinal products.
MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.
Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun
2016-03-01
Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.
Shen, S Q; Wang, R; Huang, S G
2017-03-08
Stem cell factor (SCF), an important stem cell cytokine, has multiple functions. Fibroblasts (FBs), mature mast cells, endothelial cells (ECs), and eosinophil granulocytes can produce SCF in the inflammatory process. Therefore, we aimed to observe SCF expression in FBs, ECs, and macrophages (MPs) in periapical tissues in human chronic periapical disease and investigate the effects of cells expressing SCF in pathogenesis of the disease. Healthy (N = 20), periapical cyst (N = 15), and periapical granuloma (N = 15) tissues were fixed in 10% formalin for 48 h, embedded in paraffin, and stained with hematoxylin and eosin to observe histological changes. SCF expression was observed in FBs, ECs, and MPs in periapical tissues by double immunofluorescence. CD334, CD31, and CD14 are specific markers of FBs, ECs, and MPs, respectively. Results showed that densities of CD334-SCF double-positive FBs, CD31-SCF double-positive ECs, and CD14-SCF double-positive MPs were significantly increased in periapical tissue groups (P periapical tissue groups (P > 0.05). CD14-SCF double-positive MP density was considerably higher in periapical granulomas than in cysts (P periapical tissues, suggesting that the cells might be related to occurrence, development, and pathogenesis of chronic periapical disease.
Directory of Open Access Journals (Sweden)
Hernandez Osvaldo
2005-01-01
Full Text Available Abstract Background An elevated CD4/CD8 T-cell ratio on flow cytometry (FCM analysis has been reported in the literature to be associated with Hodgkin lymphoma (HL. The purpose of our study was to determine the diagnostic significance of an elevated CD4/CD8 ratio in lymph node fine needle aspiration (FNA specimens. Design Between 1996 and 2002, out of 837 lymph node FNAs submitted for flow cytometry analysis, 85 cases showed an elevated CD4/CD8 ratio, defined as greater than or equal to 4, without definitive evidence of a lymphoproliferative disorder. The cytologic diagnoses of these 85 cases were grouped into four categories: reactive, atypical, Hodgkin lymphoma (HL, and non-Hodgkin lymphoma (NHL. Histologic follow-up was available in 17/85 (20% of the cases. Results 5 of the 64 cases in which FCM and cytology did not reveal evidence of a lymphoproliferative disease had tissue follow-up because of persistent lymphadenopathy and high clinical suspicion. 3/5 (60% confirmed the diagnosis of reactive lymphadenopathy. The two remaining cases (40% were positive for lymphoma (1HL, 1NHL. 8/15 cases called atypical on cytology had histologic follow-up. 7/8 (87.5% cases were positive for lymphoma (3HL, 4NHL. 3/4 cases called HL on cytology had tissue follow-up and all 3 (100% confirmed the diagnosis of HL. One case diagnosed as NHL on cytology was found to be a diffuse large B-cell lymphoma. In summary, out of 17 cases with histologic follow-up 4/17 (24% were reactive with CD4/CD8 T-cell ratio of 4.1–29, 7/17 (41% were HLs with CD4/CD8 T-cell ratio of 5.3 – 11, and 6/17 (35% were NHLs with CD4/CD8 T-cell ratio of 4.2 – 14. Conclusion An elevated CD4/CD8 ratio on FCM is a nonspecific finding which may be seen in both reactive and lymphoproliferative disorders. The cytomorphologic features of the smear are more relevant than the sole flow cytometric finding of an elevated CD4/CD8 ratio.
Nikitina, Irina Yu; Kondratuk, Natalya A; Kosmiadi, George A; Amansahedov, Rasul B; Vasilyeva, Irina A; Ganusov, Vitaly V; Lyadova, Irina V
2012-01-01
Effector CD4 T cells represent a key component of the host's anti-tuberculosis immune defense. Successful differentiation and functioning of effector lymphocytes protects the host against severe M. tuberculosis (Mtb) infection. On the other hand, effector T cell differentiation depends on disease severity/activity, as T cell responses are driven by antigenic and inflammatory stimuli released during infection. Thus, tuberculosis (TB) progression and the degree of effector CD4 T cell differentiation are interrelated, but the relationships are complex and not well understood. We have analyzed an association between the degree of Mtb-specific CD4 T cell differentiation and severity/activity of pulmonary TB infection. The degree of CD4 T cell differentiation was assessed by measuring the percentages of highly differentiated CD27(low) cells within a population of Mtb- specific CD4 T lymphocytes ("CD27(low)IFN-γ(+)" cells). The percentages of CD27(low)IFN-γ+ cells were low in healthy donors (median, 33.1%) and TB contacts (21.8%) but increased in TB patients (47.3%, p76%), but varied in blood (12-92%). The major correlate for the accumulation of CD27(low)IFN-γ(+) cells in blood was lung destruction (r = 0.65, p = 2.7 × 10(-7)). A cutoff of 47% of CD27(low)IFN-γ(+) cells discriminated patients with high and low degree of lung destruction (sensitivity 89%, specificity 74%); a decline in CD27(low)IFN-γ(+)cells following TB therapy correlated with repair and/or reduction of lung destruction (ppulmonary TB. Accumulation of CD27(low)IFN-γ(+) cells in the blood is associated with lung destruction. The findings indicate that there is no deficiency in CD4 T cell differentiation during TB; evaluation of CD27(low)IFN-γ(+) cells provides a valuable means to assess TB activity, lung destruction, and tissue repair following TB therapy.
Energy Technology Data Exchange (ETDEWEB)
Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China); Ao, Ke-Hou [Department of Chemistry, Zunyi Normal College, Zunyi, Guizhou 563002 (China); Zhang, Jian [State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002 (China)
2016-09-15
A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.
Directory of Open Access Journals (Sweden)
Blessing Didia
2008-12-01
Full Text Available OBJECTIVE: The present study attempts to determine normal values of CD4, CD8, CD4/CD8 ratio, total WBC and differential counts, hematocrit and total lymphocyte count (TLC in healthy HIV sero-negative and sero-positive subjects, and to assess the prognostic significance of these parameters in these subjects as compared to AIDS subjects.METHODS: A total of 300 subjects (147 M, 153 F aged between 17 and 71 years were recruited into the study. Subjects were separated according to sex and divided into three groups: Group A: healthy HIV sero-negative subjects; Group B: healthy HIV sero-positive newly diagnosed ART-naïve subjects; and Group C: AIDS subjects. CD4 and CD8 counts were determined by flow cytometry; hematocrit was determined using Hawksley micro-capillary tubes; total WBC and differential counts were determined manually with the improved Neubauer counting chamber; and TLC was obtained by multiplying the percentage of lymphocytes by the total WBC count.RESULTS: For male subjects, significant differences were found in CD4 count, CD4/CD8 count ratio, hematocrit, total WBC and TLC, whereas for female subjects, significant differences were found only in CD4 and CD4/CD8 count ratio in the three groups of subjects. In both sexes, however, these parameters were found to be highest in healthy HIV sero-negative subjects and lowest in AIDS subjects, with HIV sero-positive subjects having intermediate values. CONCLUSION: The results confirm previous reports that the CD4 count and CD4/CD8 count ratio are fairly reliable indicators of the progression of HIV infection. In addition, the results also apparently suggest that the prognostic value of CD8 count is limited and that of TLC possibly sex-dependent. The results could be of importance in our environment since previous reports have been relatively scarce.
Directory of Open Access Journals (Sweden)
Gregory A. Watson
2011-03-01
Full Text Available Introduction: The CD95/CD95L pathway plays a critical role in tissue homeostasis and immune system regulation; however, the function of this pathway in malignancy remains poorly understood. We hypothesized that CD95L expression in esophageal adenocarcinoma confers advantages to the neoplasm other than immune privilege. Methods: CD95L expression was characterized in immortalized squamous esophagus (HET-1A and Barrett esophagus (BAR-T cells; adenocarcinoma cell lines FLO-1, SEG-1, and BIC-1, and MDA468 (- control; and KFL cells (+ control. Analyses included reverse transcription-polymerase chain reaction, immunoblots of whole cell and secretory vesicle lysates, FACScan analysis, laser scanning confocal microscopy of native proteins and fluorescent constructs, and assessment of apoptosis and ERK1/2 pathways. Results: Cleaved, soluble CD95L is expressed at both the RNA and protein levels in these cell lines derived from esophageal adenocarcinoma and other human tissues. CD95L was neither trafficked to the cell membrane nor secreted into the media or within vesicles, rather the protein seems to be sequestered in the cytoplasm. CD95 and CD95L colocalize by immunofluorescence, but an interaction was not proven by immunoprecipitation. Overexpression of CD95L in the adenocarcinoma cell lines induced robust apoptosis and, under conditions of pan-caspase inhibition, resulted in activation of ERK signaling. Conclusions: CD95L localization in EA cells is inconsistent with the conference of immune privilege and is more consistent with a function that promotes tumor growth through alternative CD95 signaling. Reduced cell surface expression of CD95 affects cell sensitivity to extracellular apoptotic signals more significantly than alterations in downstream modulators of apoptosis.
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Serum soluble CD163 predicts risk of type 2 diabetes in the general population
DEFF Research Database (Denmark)
Møller, Holger Jon; Frikke-Schmidt, Ruth; Moestrup, Søren
2011-01-01
Activation of adipose tissue macrophages with concomitant low-grade inflammation is believed to play a central role in the development of type 2 diabetes. We tested whether a new macrophage-derived biomarker, soluble CD163 (sCD163), identifies at-risk individuals before overt disease has developed....
Marei, Hany El Sayed; El-Gamal, Aya; Althani, Asma; Afifi, Nahla; Abd-Elmaksoud, Ahmed; Farag, Amany; Cenciarelli, Carlo; Thomas, Caceci; Anwarul, Hasan
2018-02-01
Mesenchymal stem cells (MSCs) are multipotent cells that can differentiate into various cell types such as cartilage, bone, and fat cells. Recent studies have shown that induction of MSCs in vitro by growth factors including epidermal growth factor (EGF) and fibroblast growth factor (FGF2) causes them to differentiate into neural like cells. These cultures also express ChAT, a cholinergic marker; and TH, a dopaminergic marker for neural cells. To establish a protocol with maximum differentiation potential, we examined MSCs under three experimental culture conditions using neural induction media containing FGF2, EGF, BMP-9, retinoic acid, and heparin. Adipose-derived MSCs were extracted and expanded in vitro for 3 passages after reaching >80% confluency, for a total duration of 9 days. Cells were then characterized by flow cytometry for CD markers as CD44 positive and CD45 negative. MSCs were then treated with neural induction media and were characterized by morphological changes and Q-PCR. Differentiated MSCs expressed markers for immature and mature neurons; β Tubulin III (TUBB3) and MAP2, respectively, showing the neural potential of these cells to differentiate into functional neurons. Improved protocols for MSCs induction will facilitate and ensure the reproducibility and standard production of MSCs for therapeutic applications in neurodegenerative diseases. © 2017 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Liu, Ruiping [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Liu, Feng [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Hu, Chengzhi, E-mail: czhu@rcees.ac.cn [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); He, Zan [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Liu, Huijuan; Qu, Jiuhui [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China)
2015-12-30
Highlights: • Fe–Mn binary oxide achieves the simultaneous removal of Cd(II) and Sb(V). • Cd(II) at above 0.25 mmol/L improves Sb(V) adsorption onto FMBO. • Cd(II) improves more significant Sb(V) adsorption than Ca{sup 2+} and Mn{sup 2+}. • Sb(V) adsorption decreases whereas Cd(II) adsorption increases with elevated pH. • The increased ζ-potential and Cd(II)–Sb(V) precipitation favors Sb(V) adsorption. - Abstract: The coexistence of cadmium ion (Cd(II)) and antimonate (Sb(V)) creates the need for their simultaneous removal. This study aims to investigate the effects of positively-charged Cd(II) on the removal of negative Sb(V) ions by Fe–Mn binary oxide (FMBO) and associated mechanisms. The maximum Sb(V) adsorption density (Q{sub max,Sb(V)}) increased from 1.02 to 1.32 and 2.01 mmol/g in the presence of Cd(II) at 0.25 and 0.50 mmol/L. Cd{sup 2+} exhibited a more significant positive effect than both calcium ion (Ca{sup 2+}) and manganese ion (Mn{sup 2+}). Cd{sup 2+} showed higher affinity towards FMBO and increased its ζ-potential more significantly compared to Ca{sup 2+} and Mn{sup 2+}. The simultaneous adsorption of Sb(V) and Cd(II) onto FMBO can be achieved over a wide initial pH (pH{sub i}) range from 2 to 9, and Q{sub Sb(V)} decreases whereas Q{sub Cd(II)} increases with elevated pH{sub i}. Their combined values, as expressed by Q{sub Sb(V)+Cd(II)}, amount to about 2 mmol/g and vary slightly in the pH{sub i} range 4–9. FTIR and XPS spectra indicate the significant synergistic effect of Cd(II) on Sb(V) adsorption onto FMBO, and that little chemical valence transformation occurs. These results may be valuable for the treatment of wastewater with coexisting heavy metals such as Cd(II) and Sb(V).
2010-10-01
... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...
Directory of Open Access Journals (Sweden)
Christopher M Weber
Full Text Available The ability to regenerate tissues is shared across many metazoan taxa, yet the type and extent to which multiple cellular mechanisms come into play can differ across species. For example, urodele amphibians can completely regenerate all lost tissues, including skeletal muscles after limb amputation. This remarkable ability of urodeles to restore entire limbs has been largely linked to a dedifferentiation-dependent mechanism of regeneration. However, whether cell dedifferentiation is the fundamental factor that triggers a robust regeneration capacity, and whether the loss or inhibition of this process explains the limited regeneration potential in other vertebrates is not known. Here, we studied the cellular mechanisms underlying the repetitive regeneration of myogenic tissues in the electric fish S. macrurus. Our in vivo microinjection studies of high molecular weight cell lineage tracers into single identified adult myogenic cells (muscle or noncontractile muscle-derived electrocytes revealed no fragmentation or cellularization proximal to the amputation plane. In contrast, ultrastructural and immunolabeling studies verified the presence of myogenic stem cells that express the satellite cell marker Pax7 in mature muscle fibers and electrocytes of S. macrurus. These data provide the first example of Pax-7 positive muscle stem cells localized within a non-contractile electrogenic tissue. Moreover, upon amputation, Pax-7 positive cells underwent a robust replication and were detected exclusively in regions that give rise to myogenic cells and dorsal spinal cord components revealing a regeneration process in S. macrurus that is dependent on the activation of myogenic stem cells for the renewal of both skeletal muscle and the muscle-derived electric organ. These data are consistent with the emergent concept in vertebrate regeneration that different tissues provide a distinct progenitor cell population to the regeneration blastema, and these
Chen, Wei; Xie, Minkai; Yang, Bin; Bharadwaj, Shantaram; Song, Lujie; Liu, Guihua; Yi, Shanhong; Ye, Gang; Atala, Anthony; Zhang, Yuanyuan
2017-02-01
Stem cells are regarded as possible cell therapy candidates for skeletal muscle regeneration. However, invasive harvesting of those cells can cause potential harvest-site morbidity. The goal of this study was to assess whether human urine-derived stem cells (USCs), obtained through non-invasive procedures, can differentiate into skeletal muscle linage cells (Sk-MCs) and potentially be used for skeletal muscle regeneration. In this study, USCs were harvested from six healthy individuals aged 25-55. Expression profiles of cell-surface markers were assessed by flow cytometry. To optimize the myogenic differentiation medium, we selected two from four different types of myogenic differentiation media to induce the USCs. Differentiated USCs were identified with myogenic markers by gene and protein expression. USCs were implanted into the tibialis anterior muscles of nude mice for 1 month. The results showed that USCs displayed surface markers with positive staining for CD24, CD29, CD44, CD73, CD90, CD105, CD117, CD133, CD146, SSEA-4 and STRO-1, and negative staining for CD14, CD31, CD34 and CD45. After myogenic differentiation, a change in morphology was observed from 'rice-grain'-like cells to spindle-shaped cells. The USCs expressed specific Sk-MC transcripts and protein markers (myf5, myoD, myosin, and desmin) after being induced with different myogenic culture media. Implanted cells expressed Sk-MC markers stably in vivo. Our findings suggest that USCs are able to differentiate into the Sk-MC lineage in vitro and after being implanted in vivo. Thus, they might be a potential source for cell injection therapy in the use of skeletal muscle regeneration. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.
miR-375 induces human decidua basalis-derived stromal cells to become insulin-producing cells.
Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad
2014-09-01
This paper focuses on the development of renewable sources of isletreplacement tissue for the treatment of type I diabetes mellitus. Placental tissue-derived mesenchymal stem cells (MSCs) are a promising source for regenerative medicine due to their plasticity and easy availability. They have the potential to differentiate into insulin-producing cells. miR-375 is a micro RNA that is expressed in the pancreas and involved in islet development. Human placental decidua basalis MSCs (PDB-MSCs) were cultured from full-term human placenta. The immunophenotype of the isolated cells was checked for CD90, CD105, CD44, CD133 and CD34 markers. The MSCs (P3) were chemically transfected with hsa-miR-375. Total RNA was extracted 4 and 6 days after transfection. The expressions of insulin, NGN3, GLUT2, PAX4, PAX6, KIR6.2, NKX6.1, PDX1, and glucagon genes were evaluated using real-time qPCR. On day 6, we tested the potency of the clusters in response to the high glucose challenge and assessed the presence of insulin and NGN3 proteins via immunocytochemistry. Flow cytometry analysis confirmed that more than 90% of the cells were positive for CD90, CD105 and CD44 and negative for CD133 and CD34. Morphological changes were followed from day 2. Cell clusters formed during day 6. Insulin-producing clusters showed a deep red color with DTZ. The expression of pancreatic-specific transcription factors increased remarkably during the four days after transfection and significantly increased on day 7. The clusters were positive for insulin and NGN3 proteins, and C-peptide and insulin secretion increased in response to changes in the glucose concentration (2.8 mM and 16.7 mM). In conclusion, the MSCs could be programmed into functional insulin-producing cells by transfection of miR-375.
2017-11-20
B Acute Lymphoblastic Leukemia; CD19 Positive; Minimal Residual Disease; Philadelphia Chromosome Positive; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Childhood Acute Lymphoblastic Leukemia; Refractory Acute Lymphoblastic Leukemia
Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.
Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E
2016-09-01
Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Dependence of Brown Adipose Tissue Function on CD36-Mediated Coenzyme Q Uptake
Directory of Open Access Journals (Sweden)
Courtney M. Anderson
2015-02-01
Full Text Available Brown adipose tissue (BAT possesses the inherent ability to dissipate metabolic energy as heat through uncoupled mitochondrial respiration. An essential component of the mitochondrial electron transport chain is coenzyme Q (CoQ. While cells synthesize CoQ mostly endogenously, exogenous supplementation with CoQ has been successful as a therapy for patients with CoQ deficiency. However, which tissues depend on exogenous CoQ uptake as well as the mechanism by which CoQ is taken up by cells and the role of this process in BAT function are not well understood. Here, we report that the scavenger receptor CD36 drives the uptake of CoQ by BAT and is required for normal BAT function. BAT from mice lacking CD36 displays CoQ deficiency, impaired CoQ uptake, hypertrophy, altered lipid metabolism, mitochondrial dysfunction, and defective nonshivering thermogenesis. Together, these data reveal an important new role for the systemic transport of CoQ to BAT and its function in thermogenesis.
Dondossola, Eleonora; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata
2014-01-01
Non-malignant cells found within neoplastic lesions express alanyl (membrane) aminopeptidase (ANPEP, best known as CD13), and CD13-null mice exhibit limited tumor growth and angiogenesis. We have recently demonstrated that a subset of bone marrow-derived CD11b + CD13 + myeloid cells accumulate within neoplastic lesions in several murine models of transplantable cancer to promote angiogenesis. If these findings were confirmed in clinical settings, CD11b + CD13 + myeloid cells could become a non-malignant target for the development of novel anticancer regimens.
Palapattu, Ganesh S; Meeker, Alan; Harris, Timothy; Collector, Michael I; Sharkis, Saul J; DeMarzo, Angelo M; Warlick, Christopher; Drake, Charles G; Nelson, William G
2006-08-01
Using various nonphysiological tissue injury/repair models numerous studies have demonstrated the capacity of bone marrow derived cells to contribute to the repopulation of epithelial tissues following damage. To investigate whether this phenomenon might also occur during periods of physiological tissue degeneration/regeneration we compared the ability of bone marrow derived cells to rejuvenate the prostate gland in mice that were castrated and then later treated with dihydrotestosterone vs mice with prostate epithelium that had been damaged by lytic virus infection. Using allogenic bone marrow grafts from female donor transgenic mice expressing green fluorescent protein transplanted into lethally irradiated males we were able to assess the contributions of bone marrow derived cells to recovery of the prostatic epithelium in 2 distinct systems, including 1) surgical castration followed 1 week later by dihydrotestosterone replacement and 2) intraprostatic viral injection. Eight to 10-week-old male C57/Bl6 mice were distributed among bone marrow donor-->recipient/prostate injury groups, including 5 with C57/Bl6-->C57/Bl6/no injury, 3 with green fluorescent protein-->C57/Bl6/no injury, 3 with green fluorescent protein-->C57/Bl6/vehicle injection, 4 with green fluorescent protein-->C57/Bl6/virus injection and 3 each with green fluorescent protein-->C57/Bl6/castration without and with dihydrotestosterone, respectively. Prostate tissues were harvested 3 weeks after dihydrotestosterone replacement or 14 days following intraprostatic viral injection. Prostate tissue immunofluorescence was performed with antibodies against the epithelial marker cytokeratin 5/8, the hematopoietic marker CD45 and green fluorescent protein. Mice that sustained prostate injury from vaccinia virus infection with concomitant severe inflammation and glandular disruption showed evidence of bone marrow derived cell reconstitution of prostate epithelium, that is approximately 4% of all green
Directory of Open Access Journals (Sweden)
Martín-García Julio
2008-10-01
Full Text Available Abstract Background HIV-1 infects macrophages and microglia in the brain and can cause neurological disorders in infected patients. We and others have shown that brain-derived envelope glycoproteins (Env have lower CD4 dependence and higher avidity for CD4 than those from peripheral isolates, and we have also observed increased fusogenicity and reduced sensitivity to the fusion inhibitor T-1249. Due to the genetic differences between brain and spleen env from one individual throughout gp120 and in gp41's heptad repeat 2 (HR2, we investigated the viral determinants for the phenotypic differences by performing functional studies with chimeric and mutant Env. Results Chimeric Env showed that the V1/V2-C2-V3 region in brain's gp120 determines the low CD4 dependence and high avidity for CD4, as well as macrophage tropism and reduced sensitivity to the small molecule BMS-378806. Changes in brain gp41's HR2 region did not contribute to the increased fusogenicity or to the reduced sensitivity to T-1249, since a T-1249-based peptide containing residues found in brain's but not in spleen's HR2 had similar potency than T-1249 and interacted similarly with an immobilized heptad repeat 1-derived peptide in surface plasmon resonance analysis. However, the increased fusogenicity and reduced T-1249 sensitivity of brain and certain chimeric Env mostly correlated with the low CD4 dependence and high avidity for CD4 determined by brain's V1-V3 region. Remarkably, most but not all of these low CD4-dependent, macrophage tropic envelopes glycoproteins also had increased sensitivity to the novel allosteric entry inhibitor HNG-105. The gp120's C2 region asparagine 283 (N283 has been previously associated with macrophage tropism, brain infection, lower CD4 dependence and higher CD4 affinity. Therefore, we introduced the N283T mutation into an env clone from a brain-derived isolate and into a brain tissue-derived env clone, and the T283N change into a spleen-derived env
Directory of Open Access Journals (Sweden)
Stephanie C Burke Schinkel
Full Text Available Generalized CD8+ T-cell impairment in chronic hepatitis C virus (HCV infection and the contribution of liver-infiltrating CD8+ T-cells to the immunopathogenesis of this infection remain poorly understood. It is hypothesized that this impairment is partially due to reduced CD8+ T-cell activity in response to cytokines such as IL-7, particularly within the liver. To investigate this, the phenotype and cytokine responsiveness of blood- and liver-derived CD8+ T-cells from healthy controls and individuals with HCV infection were compared. In blood, IL-7 receptor α (CD127 expression on bulk CD8+ T-cells in HCV infection was no different than controls yet was lower on central memory T-cells, and there were fewer naïve cells. IL-7-induced signalling through phosphorylated STAT5 was lower in HCV infection than in controls, and differed between CD8+ T-cell subsets. Production of Bcl-2 following IL-7 stimulation was also lower in HCV infection and inversely related to the degree of liver fibrosis. In liver-derived CD8+ T-cells, STAT5 activation could not be increased with cytokine stimulation and basal Bcl-2 levels of liver-derived CD8+ T-cells were lower than blood-derived counterparts in HCV infection. Therefore, generalized CD8+ T-cell impairment in HCV infection is characterized, in part, by impaired IL-7-mediated signalling and survival, independent of CD127 expression. This impairment is more pronounced in the liver and may be associated with an increased potential for apoptosis. This generalized CD8+ T-cell impairment represents an important immune dysfunction in chronic HCV infection that may alter patient health.
Tsuda, Masato; Arakawa, Haruka; Ishii, Narumi; Ubukata, Chihiro; Michimori, Mana; Noda, Masanari; Takahashi, Kyoko; Kaminogawa, Shuichi; Hosono, Akira
2017-01-01
Fructo-oligosaccharides (FOS) are prebiotic agents with immunomodulatory effects involving improvement of the intestinal microbiota and metabolome. In this study, we investigated the cellular mechanisms through which FOS modulate intestinal antigen-specific CD4+ T cell responses in food allergy, using OVA23-3 mice. OVA23-3 mice were fed an experimental diet containing either ovalbumin (OVA) or OVA and FOS for 1 week. Body weight and mucosal mast cell protease 1 in the serum were measured as the indicator of intestinal inflammation. Single-cell suspensions were prepared from intestinal and systemic lymphoid tissues for cellular analysis. Cytokine production was measured by ELISA. Activation markers and intracellular cytokines in CD4+ T cells were analyzed by flow cytometry. Activated CD4+ T cells were purified to examine cytokine production. Dietary intake of FOS provided moderate protection from the intestinal inflammation induced by the OVA-containing diet. FOS significantly reduced food allergy-induced Th2 cytokine responses in intestinal tissues but not in systemic tissues. FOS decreased OVA diet-induced IFN-γ+IL-4+ double-positive CD4+ T cells and early-activated CD45RBhighCD69+CD4+ T cells in the mesenteric lymph nodes. Furthermore, we confirmed that these CD45RBhighCD69+CD4+ T cells are able to produce high levels of IFN-γ and moderate level of IL-4, IL-10, and IL-13. Dietary intake of FOS during the development of food allergy attenuates the induction of intestinal Th2 cytokine responses by regulating early activation of naïve CD4+ T cells, which produce both Th1 and Th2 cytokines. Our results suggest FOS might be a potential food agent for the prevention of food allergy by modulating oral sensitization to food antigens. © 2017 S. Karger AG, Basel.
The role of sialomucin CD164 (MGC-24v or endolyn) in prostate cancer metastasis
International Nuclear Information System (INIS)
Havens, AM; Jung, Y; Sun, YX; Wang, J; Shah, RB; Bühring, HJ; Pienta, KJ; Taichman, RS
2006-01-01
The chemokine stromal derived factor-1 (SDF-1 or CXCL12) and its receptor CXCR4 have been demonstrated to be crucial for the homing of stem cells and prostate cancers to the marrow. While screening prostate cancers for CXCL12-responsive adhesion molecules, we identified CD164 (MGC-24) as a potential regulator of homing. CD164 is known to function as a receptor that regulates stem cell localization to the bone marrow. Using prostate cancer cell lines, it was demonstrated that CXCL12 induced both the expression of CD164 mRNA and protein. Functional studies demonstrated that blocking CD164 on prostate cancer cell lines reduced the ability of these cells to adhere to human bone marrow endothelial cells, and invade into extracellular matrices. Human tissue microarrays stained for CD164 demonstrated a positive correlation with prostate-specific antigen levels, while its expression was negatively correlated with the expression of androgen receptor. Our findings suggest that CD164 may participate in the localization of prostate cancer cells to the marrow and is further evidence that tumor metastasis and hematopoietic stem cell trafficking may involve similar processes
Marriott, Clare L; Dutton, Emma E; Tomura, Michio; Withers, David R
2017-05-01
Several different memory T-cell populations have now been described based upon surface receptor expression and migratory capabilities. Here we have assessed murine endogenous memory CD4 + T cells generated within a draining lymph node and their subsequent migration to other secondary lymphoid tissues. Having established a model response targeting a specific peripheral lymph node, we temporally labelled all the cells within draining lymph node using photoconversion. Tracking of photoconverted and non-photoconverted Ag-specific CD4 + T cells revealed the rapid establishment of a circulating memory population in all lymph nodes within days of immunisation. Strikingly, a resident memory CD4 + T cell population became established in the draining lymph node and persisted for several months in the absence of detectable migration to other lymphoid tissue. These cells most closely resembled effector memory T cells, usually associated with circulation through non-lymphoid tissue, but here, these cells were retained in the draining lymph node. These data indicate that lymphoid tissue resident memory CD4 + T-cell populations are generated in peripheral lymph nodes following immunisation. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Díez, José M; Bauman, Ewa; Gajardo, Rodrigo; Jorquera, Juan I
2015-03-13
Fetal bovine serum (FBS) is an animal product used as a medium supplement. The animal origin of FBS is a concern if cultured stem cells are to be utilized for human cell therapy. Therefore, a substitute for FBS is desirable. In this study, an industrial, xeno-free, pharmaceutical-grade supplement for cell culture (SCC) under development at Grifols was tested for growth of human mesenchymal stem cells (hMSCs), cell characterization, and differentiation capacity. SCC is a freeze-dried product obtained through cold-ethanol fractionation of industrial human plasma pools from healthy donors. Bone marrow-derived hMSC cell lines were obtained from two commercial suppliers. Cell growth was evaluated by culturing hMSCs with commercial media or media supplemented with SCC or FBS. Cell viability and cell yield were assessed with an automated cell counter. Cell surface markers were studied by indirect immunofluorescence assay. Cells were cultured then differentiated into adipocytes, chondrocytes, osteoblasts, and neurons, as assessed by specific staining and microscopy observation. SCC supported the growth of commercial hMSCs. Starting from the same number of seeded cells in two consecutive passages of culture with medium supplemented with SCC, hMSC yield and cell population doubling time were equivalent to the values obtained with the commercial medium and was consistent among lots. The viability of hMSCs was higher than 90%, while maintaining the characteristic phenotype of undifferentiated hMSCs (positive for CD29, CD44, CD90, CD105, CD146, CD166 and Stro-1; negative for CD14 and CD19). Cultured hMSCs maintained the potential for differentiation into adipocytes, chondrocytes, osteoblasts, and neurons. The tested human plasma-derived SCC sustains the adequate growth of hMSCs, while preserving their differentiation capacity. SCC can be a potential candidate for cell culture supplement in advanced cell therapies.
International Nuclear Information System (INIS)
Liu, Ruiping; Liu, Feng; Hu, Chengzhi; He, Zan; Liu, Huijuan; Qu, Jiuhui
2015-01-01
Highlights: • Fe–Mn binary oxide achieves the simultaneous removal of Cd(II) and Sb(V). • Cd(II) at above 0.25 mmol/L improves Sb(V) adsorption onto FMBO. • Cd(II) improves more significant Sb(V) adsorption than Ca"2"+ and Mn"2"+. • Sb(V) adsorption decreases whereas Cd(II) adsorption increases with elevated pH. • The increased ζ-potential and Cd(II)–Sb(V) precipitation favors Sb(V) adsorption. - Abstract: The coexistence of cadmium ion (Cd(II)) and antimonate (Sb(V)) creates the need for their simultaneous removal. This study aims to investigate the effects of positively-charged Cd(II) on the removal of negative Sb(V) ions by Fe–Mn binary oxide (FMBO) and associated mechanisms. The maximum Sb(V) adsorption density (Q_m_a_x_,_S_b_(_V_)) increased from 1.02 to 1.32 and 2.01 mmol/g in the presence of Cd(II) at 0.25 and 0.50 mmol/L. Cd"2"+ exhibited a more significant positive effect than both calcium ion (Ca"2"+) and manganese ion (Mn"2"+). Cd"2"+ showed higher affinity towards FMBO and increased its ζ-potential more significantly compared to Ca"2"+ and Mn"2"+. The simultaneous adsorption of Sb(V) and Cd(II) onto FMBO can be achieved over a wide initial pH (pH_i) range from 2 to 9, and Q_S_b_(_V_) decreases whereas Q_C_d_(_I_I_) increases with elevated pH_i. Their combined values, as expressed by Q_S_b_(_V_)_+_C_d_(_I_I_), amount to about 2 mmol/g and vary slightly in the pH_i range 4–9. FTIR and XPS spectra indicate the significant synergistic effect of Cd(II) on Sb(V) adsorption onto FMBO, and that little chemical valence transformation occurs. These results may be valuable for the treatment of wastewater with coexisting heavy metals such as Cd(II) and Sb(V).
Prototype of high resolution PET using resistive electrode position sensitive CdTe detectors
International Nuclear Information System (INIS)
Kikuchi, Yohei; Ishii, Keizo; Matsuyama, Shigeo; Yamazaki, Hiromichi
2008-01-01
Downsizing detector elements makes it possible that spatial resolutions of positron emission tomography (PET) cameras are improved very much. From this point of view, semiconductor detectors are preferable. To obtain high resolution, the pixel type or the multi strip type of semiconductor detectors can be used. However, in this case, there is a low packing ratio problem, because a dead area between detector arrays cannot be neglected. Here, we propose the use of position sensitive semiconductor detectors with resistive electrode. The CdTe detector is promising as a detector for PET camera because of its high sensitivity. In this paper, we report development of prototype of high resolution PET using resistive electrode position sensitive CdTe detectors. We made 1-dimensional position sensitive CdTe detectors experimentally by changing the electrode thickness. We obtained 750 A as an appropriate thickness of position sensitive detectors, and evaluated the performance of the detector using a collimated 241 Am source. A good position resolution of 1.2 mm full width half maximum (FWHM) was obtained. On the basis of the fundamental development of resistive electrode position sensitive detectors, we constructed a prototype of high resolution PET which was a dual head type and was consisted of thirty-two 1-dimensional position sensitive detectors. In conclusion, we obtained high resolutions which are 0.75 mm (FWHM) in transaxial, and 1.5 mm (FWHM) in axial. (author)
CD147 knockdown improves the antitumor efficacy of trastuzumab in HER2-positive breast cancer cells.
Xiong, Lijuan; Ding, Li; Ning, Haoyong; Wu, Chenglin; Fu, Kaifei; Wang, Yuxiao; Zhang, Yan; Liu, Yan; Zhou, Lijun
2016-09-06
Trastuzumab is widely used in the clinical treatment of human epidermal growth factor receptor-2 (HER2)-positive breast cancer, but the patient response rate is low. CD147 stimulates cancer cell proliferation, migration, metastasis and differentiation and is involved in chemoresistance in many types of cancer cells. Whether CD147 alters the effect of trastuzumab on HER2-positive breast cancer cells has not been previously reported. Our study confirmed that CD147 suppression enhances the effects of trastuzumab both in vitro and in vivo. CD147 suppression increased the inhibitory rate of trastuzumab and cell apoptosis in SKBR3, BT474, HCC1954 and MDA-MB453 cells compared with the controls. Furthermore, CD147 knockdown increased expression of cleaved Caspase-3/9 and poly (ADP-ribose) polymerase (PARP) and decreased both mitogen-activated protein kinase (MAPK) and Akt phosphorylation in the four cell lines. In an HCC1954 xenograft model, trastuzumab achieved greater suppression of tumor growth in the CD147-knockdown group than in the shRNA negative control (NC) group. These data indicated that enhancement of the effect of trastuzumab on HER2-positive cells following CD147 knockdown might be attributed to increased apoptosis and decreased phosphorylation of signaling proteins. CD147 may be a key protein for enhancing the clinical efficacy of trastuzumab.
CD117 expression in operable oesophageal squamous cell carcinomas predicts worse clinical outcome
Fan, Huijie; Yuan, Yuan; Wang, Junsheng; Zhou, Fuyou; Zhang, Mingzhi; Giercksky, Karl-Erik; Nesland, Jahn M; Suo, Zhenhe
2013-01-01
Aims To investigate the aberrant expression of CD117 in oesophageal squamous cell carcinoma (SCC) and its prognostic significance. Methods and results Immunohistochemical staining for CD117 was performed on tissue microarray and routine tissue sections from 157 oesophageal SCC patients and 10 normal oesophageal epithelia adjacent to tumour. The positive rate of CD117 expression was 29.9% in oesophageal SCC tissues, whereas no CD117 expression was detected in the 10 normal oesophageal epithelia. CD117 expression was significantly associated with T stage (P < 0.001), distant metastasis (P = 0.015), lymph node metastasis (P = 0.019), and clinical stage (P = 0.021). Progression-free survival in the patients with CD117-positive tumours was shorter than that in the patients with CD117-negative tumours (P = 0.010). In univariate analyses, CD117 expression was the most significant factor for overall survival of oesophageal SCC patients (P < 0.001), followed by lymph node metastasis (P = 0.001), T stage (P = 0.002), clinical stage (P = 0.006), distant metastasis (P = 0.020), and histological grade (P = 0.027). Multivariate analyses verified that CD117 expression was an independent prognostic marker for oesophageal SCC patients (P = 0.002). In addition, CD117 expression predicted poorer survival in patients without distant metastases. Conclusions CD117 expression in operable oesophageal SCC may be a valuable prognostic marker, and detection of its expression in clinical samples may be useful in defining a subclass of oesophageal SCCs with extremely poor clinical outcome, which may require a specially targeted treatment modality. PMID:23570416
Risk factors associated with low CD4+ lymphocyte count among HIV-positive pregnant women in Nigeria.
Abimiku, Alash'le; Villalba-Diebold, Pacha; Dadik, Jelpe; Okolo, Felicia; Mang, Edwina; Charurat, Man
2009-09-01
To determine the risk factors for CD4+ lymphocyte counts of 200 cells/mm(3) or lower in HIV-positive pregnant women in Nigeria. A cross-sectional data analysis from a prospective cohort of 515 HIV-positive women attending a prenatal clinic. Risk of a low CD4+ count was estimated using logistic regression analysis. CD4+ lymphocyte counts of 200 cells/mm(3) or lower (280+/-182 cells/mm(3)) were recorded in 187 (36.3%) out of 515 HIV-positive pregnant women included in the study. Low CD4+ count was associated with older age (adjusted odds ratio [aOR] 10.71; 95% confidence interval [CI], 1.20-95.53), lack of condom use (aOR, 5.16; 95% CI, 1.12-23.8), history of genital ulcers (aOR, 1.78; 95% CI, 1.12-2.82), and history of vaginal discharge (aOR; 1.62; 1.06-2.48). Over 35% of the HIV-positive pregnant women had low CD4+ counts, indicating the need for treatment. The findings underscore the need to integrate prevention of mother-to-child transmission with HIV treatment and care, particularly services for sexually transmitted infections.
Isolation and expansion of adipose-derived stem cells for tissue engineering
DEFF Research Database (Denmark)
Fink, Trine; Rasmussen, Jeppe Grøndahl; Lund, Pia
2011-01-01
For treatment of cardiac failure with bone marrow-derived mesenchymal stem cells, several clinical trials are ongoing. However, more attention is gathering on the use of adipose tissue-derived stem cells (ASCs). This paper describes the optimization of isolation and propagation of ASCs for subseq......For treatment of cardiac failure with bone marrow-derived mesenchymal stem cells, several clinical trials are ongoing. However, more attention is gathering on the use of adipose tissue-derived stem cells (ASCs). This paper describes the optimization of isolation and propagation of ASCs...
Leu-9 (CD 7) positivity in acute leukemias: a marker of T-cell lineage?
Ben-Ezra, J; Winberg, C D; Wu, A; Rappaport, H
1987-01-01
Monoclonal antibody Leu-9 (CD 7) has been reported to be a sensitive and specific marker for T-cell lineage in leukemic processes, since it is positive in patients whose leukemic cells fail to express other T-cell antigens. To test whether Leu-9 is indeed specific for T-cell leukemias, we examined in detail 10 cases of acute leukemia in which reactions were positive for Leu-9 and negative for other T-cell-associated markers including T-11, Leu-1, T-3, and E-rosettes. Morphologically and cytochemically, 2 of these 10 leukemias were classified as lymphoblastic, 4 as myeloblastic, 2 as monoblastic, 1 as megakaryoblastic, and 1 as undifferentiated. The case of acute megakaryoblastic leukemia is the first reported case to be Leu-9 positive. None of the 10 were TdT positive. Of six cases (two monoblastic, one lymphoblastic, one myeloblastic, one megakaryoblastic, and one undifferentiated) in which we evaluated for DNA gene rearrangements, only one, a peroxidase-positive leukemia, showed a novel band on study of the T-cell-receptor beta-chain gene. We therefore conclude that Leu-9 is not a specific marker to T-cell lineage and that, in the absence of other supporting data, Leu-9 positivity should not be used as the sole basis of classifying an acute leukemia as being T-cell derived.
Immuno-biosensor for Detection of CD20-Positive Cells Using Surface Plasmon Resonance
Shanehbandi, Dariush; Majidi, Jafar; Kazemi, Tohid; Baradaran, Behzad; Aghebati-Maleki, Leili; Fathi, Farzaneh; Ezzati Nazhad Dolatabadi, Jafar
2017-01-01
Purpose: Surface plasmon resonance (SPR) sensing confers a real-time assessment of molecular interactions between biomolecules and their ligands. This approach is highly sensitive and reproducible and could be employed to confirm the successful binding of drugs to cell surface targets. The specific affinity of monoclonal antibodies (MAb) for their target antigens is being utilized for development of immuno-sensors and therapeutic agents. CD20 is a surface protein of B lymphocytes which has been widely employed for immuno-targeting of B-cell related disorders. In the present study, binding ability of an anti-CD20 MAb to surface antigens of intact target cells was investigated by SPR technique. Methods: Two distinct strategies were used for immobilization of the anti-CD20 MAb onto gold (Au) chips. MUA (11-mercaptoundecanoic acid) and Staphylococcus aureus protein A (SpA) were the two systems used for this purpose. A suspension of CD20-positive Raji cells was injected in the analyte phase and the resulting interactions were analyzed and compared to those of MOLT-4 cell line as CD20-negative control. Results: Efficient binding of anti-CD20 MAb to the surface antigens of Raji cell line was confirmed by both immobilizing methods, whereas this MAb had not a noticeable affinity to the MOLT-4 cells. Conclusion: According to the outcomes, the investigated MAb had acceptable affinity and specificity to the target antigens on the cell surface and could be utilized for immuno-detection of CD20-positive intact cells by SPR method. PMID:28761820
DEFF Research Database (Denmark)
Joeris, Thorsten
Along the process of epithelial self-renewal, antigens derived from apoptotic intestinal epithelial cells (IECs) are taken up by antigen presenting cells (APCs), transported to gut-draining lymph nodes and crosspresented to CD8 T cells. In steady state, rapid tolerization of CD8 T cells reactive...... towards epithelialderived antigens is crucial to maintain tissue homeostasis. Since IRF8-dependent dendritic dells (IRF8-DCs) have superior cross-presenting capabilities, we aimed to investigate their role in this process. IFABP-tOva mice, expressing the model-antigen Ovalbumin (Ova) in IECs, were used...... as recipients to set up chimeras using either CD11c-cre.Irf8fl/fl bone marrow, which cannot generate IRF8-DCs, or cre-negative Irf8fl/fl control bone marrow. Whereas transfer of Ova-specific CD8 T cells (OT-I cells) to control chimeras resulted in their rapid tolerization, OT-I cells transferred to CD11c...
Ansari, Sahar; Sarrion, Patricia; Hasani-Sadrabadi, Mohammad Mahdi; Aghaloo, Tara; Wu, Benjamin M; Moshaverinia, Alireza
2017-11-01
Mesenchymal stem cells (MSCs) derived from dental and orofacial tissues provide an alternative therapeutic option for craniofacial bone tissue regeneration. However, there is still a need to improve stem cell delivery vehicles to regulate the fate of the encapsulated MSCs for high quality tissue regeneration. Matrix elasticity plays a vital role in MSC fate determination. Here, we have prepared various hydrogel formulations based on alginate and gelatin methacryloyl (GelMA) and have encapsulated gingival mesenchymal stem cells (GMSCs) and human bone marrow MSCs (hBMMSCs) within these fabricated hydrogels. We demonstrate that addition of the GelMA to alginate hydrogel reduces the elasticity of the hydrogel mixture. While presence of GelMA in an alginate-based scaffold significantly increased the viability of encapsulated MSCs, increasing the concentration of GelMA downregulated the osteogenic differentiation of encapsulated MSCs in vitro due to decrease in the stiffness of the hydrogel matrix. The osteogenic suppression was rescued by addition of a potent osteogenic growth factor such as rh-BMP-2. In contrast, MSCs encapsulated in alginate hydrogel without GelMA were successfully osteo-differentiated without the aid of additional growth factors, as confirmed by expression of osteogenic markers (Runx2 and OCN), as well as positive staining using Xylenol orange. Interestingly, after two weeks of osteo-differentiation, hBMMSCs and GMSCs encapsulated in alginate/GelMA hydrogels still expressed CD146, an MSC surface marker, while MSCs encapsulated in alginate hydrogel failed to express any positive staining. Altogether, our findings suggest that it is possible to control the fate of encapsulated MSCs within hydrogels by tuning the mechanical properties of the matrix. We also reconfirmed the important role of the presence of inductive signals in guiding MSC differentiation. These findings may enable the design of new multifunctional scaffolds for spatial and temporal
Rushworth, Stuart A; Pillinger, Genevra; Abdul-Aziz, Amina; Piddock, Rachel; Shafat, Manar S; Murray, Megan Y; Zaitseva, Lyubov; Lawes, Matthew J; MacEwan, David J; Bowles, Kristian M
2015-05-01
Roughly 80% of patients with acute myeloid leukaemia have high activity of Bruton's tyrosine-kinase (BTK) in their blast cells compared with normal haemopoietic cells, rendering the cells sensitive to the oral BTK inhibitor ibrutinib in vitro. We aimed to develop the biological understanding of the BTK pathway in acute myeloid leukaemia to identify clinically relevant diagnostic information that might define a subset of patients that should respond to ibrutinib treatment. We obtained acute myeloid leukaemia blast cells from unselected patients attending our UK hospital between Feb 19, 2010, and Jan 20, 2014. We isolated primary acute myeloid leukaemia blast cells from heparinised blood and human peripheral blood mononuclear cells to establish the activity of BTK in response to CD117 activation. Furthermore, we investigated the effects of ibrutinib on CD117-induced BTK activation, downstream signalling, adhesion to primary bone-marrow mesenchymal stromal cells, and proliferation of primary acute myeloid leukaemia blast cells. We used the Mann-Whitney U test to compare results between groups. We obtained acute myeloid leukaemia blast cells from 29 patients. Ibrutinib significantly inhibited CD117-mediated proliferation of primary acute myeloid leukaemia blast cells (p=0·028). CD117 activation increased BTK activity by inducing phosphorylated BTK in patients with CD117-positive acute myeloid leukaemia. Furthermore, ibrutinib inhibited CD117-induced activity of BTK and downstream kinases at a concentration of 100 nM or more. CD117-mediated adhesion of CD117-expressing blast cells to bone-marrow stromal cells was significantly inhibited by Ibrutinib at 500 nM (p=0·028) INTERPRETATION: As first-in-man clinical trials of ibrutinib in patients with acute myeloid leukaemia commence, the data suggest not all patients will respond. Our findings show that BTK has specific pro-tumoural biological actions downstream of surface CD117 activation, which are inhibited by ibrutinib
He, Huaidong; Tam, Nora F Y; Yao, Aijun; Qiu, Rongliang; Li, Wai Chin; Ye, Zhihong
2017-12-01
Contamination of rice (Oryza sativa) by Cd is of great concern. Steel slag could be used to amend Cd-contaminated soils and make them safe for cereal production. This work was conducted to study the effects of steel slag on Cd uptake and growth of rice plants in acidic and Cd-contaminated paddy soils and to determine the possible mechanisms behind these effects. Pot (rhizobag) experiments were conducted using rice plants grown on two acidic and Cd-contaminated paddy soils with or without steel slag amendment. Steel slag amendment significantly increased grain yield by 36-45% and root catalase activity, and decreased Cd concentrations in brown rice by 66-77% compared with the control, in both soils. Steel slag amendment also markedly decreased extractable soil Cd, Cd concentrations in pore-water and Cd translocation from roots to above-ground parts. It also significantly increased soil pH, extractable Si and Ca in soils and Ca concentrations in roots. Significant positive correlations were found between extractable soil Cd and Cd concentrations in rice tissues, but it was negatively correlated with soil pH and extractable Si. Calcium in root tissues significantly and negatively correlated with Cd translocation factors from roots to straw. Overall, steel slag amendment not only significantly promoted rice growth but decreased Cd accumulation in brown rice. These benefits appear to be related to improvements in soil conditions (e.g. increasing pH, extractable Si and Ca), a reduction in extractable soil Cd, and suppression of Cd translocation from roots to above-ground parts. Copyright © 2017 Elsevier Ltd. All rights reserved.
2010-01-01
... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...
DEFF Research Database (Denmark)
Møller, Holger Jon; de Fost, Maaike; Aerts, Hans
2004-01-01
Recently, soluble CD163 (sCD163) has been identified as a macrophage/monocyte-specific plasma protein and increased concentrations have been measured in patients with infection and myeloid leukaemia. In the present study we investigated the levels of sCD163 in patients with Gaucher's disease...
Garba, Abubakar; Desmarets, Lowiese M B; Acar, Delphine D; Devriendt, Bert; Nauwynck, Hans J
2017-01-01
Mesenchymal stromal cells have been isolated from different sources. They are multipotent cells capable of differentiating into many different cell types, including osteocytes, chondrocytes and adipocytes. They possess a therapeutic potential in the management of immune disorders and the repair of damaged tissues. Previous work in our laboratory showed an increase of the percentages of CD172a+, CD14+, CD163+, Siglec-1+, CD4+ and CD8+ hematopoietic cells, when co-cultured with immortalized mesenchymal cells derived from bone marrow. The present work aimed to demonstrate the stemness properties of SV40-immortalized mesenchymal cells derived from nasal mucosa, lungs, spleen, lymph nodes and red bone marrow and their immunomodulatory effect on blood monocytes. Mesenchymal cells from nasal mucosa, lungs, spleen, lymph nodes and red bone marrow were isolated and successfully immortalized using simian virus 40 large T antigen (SV40LT) and later, co-cultured with blood monocytes, in order to examine their differentiation stage (expression of Siglec-1). Flow cytometric analysis revealed that the five mesenchymal cell lines were positive for mesenchymal cell markers CD105, CD44, CD90 and CD29, but lacked the expression of myeloid cell markers CD16 and CD11b. Growth analysis of the cells demonstrated that bone marrow derived-mesenchymal cells proliferated faster compared with those derived from the other tissues. All five mesenchymal cell lines co-cultured with blood monocytes for 1, 2 and 7 days triggered the expression of siglec-1 in the monocytes. In contrast, no siglec-1+ cells were observed in monocyte cultures without mesenchymal cell lines. Mesenchymal cells isolated from nasal mucosa, lungs, spleen, lymph nodes and bone marrow were successfully immortalized and these cell lines retained their stemness properties and displayed immunomodulatory effects on blood monocytes.
Monibi, Farrah A; Cook, James L
2017-08-01
Musculoskeletal injuries are a common problem in orthopedic practice. Given the long-term consequences of unaddressed cartilage and meniscal pathology, a number of treatments have been attempted to stimulate repair or to replace the injured tissue. Despite advances in orthopedic surgery, effective treatments for cartilage and meniscus injuries remain a significant clinical challenge. Tissue engineering is a developing field that aims to regenerate injured tissues with a combination of cells, scaffolds, and signals. Many natural and synthetic scaffold materials have been developed and tested for the repair and restoration of a number of musculoskeletal tissues. Among these, biological scaffolds derived from cell and tissue-derived extracellular matrix (ECM) have shown great promise in tissue engineering given the critical role of the ECM for maintaining the biological and biomechanical properties, structure, and function of native tissues. This review article presents emerging applications for tissue-derived ECM scaffolds in cartilage and meniscus repair. We examine normal ECM composition and the current and future methods for potential treatment of articular cartilage and meniscal defects with decellularized scaffolds.
Directory of Open Access Journals (Sweden)
Yoshihiro Sowa
Full Text Available Recent studies have shown that adipose-derived stromal/stem cells (ASCs contain phenotypically and functionally heterogeneous subpopulations of cells, but their developmental origin and their relative differentiation potential remain elusive. In the present study, we aimed at investigating how and to what extent the neural crest contributes to ASCs using Cre-loxP-mediated fate mapping. ASCs harvested from subcutaneous fat depots of either adult P0-Cre/or Wnt1-Cre/Floxed-reporter mice contained a few neural crest-derived ASCs (NCDASCs. This subpopulation of cells was successfully expanded in vitro under standard culture conditions and their growth rate was comparable to non-neural crest derivatives. Although NCDASCs were positive for several mesenchymal stem cell markers as non-neural crest derivatives, they exhibited a unique bipolar or multipolar morphology with higher expression of markers for both neural crest progenitors (p75NTR, Nestin, and Sox2 and preadipocytes (CD24, CD34, S100, Pref-1, GATA2, and C/EBP-delta. NCDASCs were able to differentiate into adipocytes with high efficiency but their osteogenic and chondrogenic potential was markedly attenuated, indicating their commitment to adipogenesis. In vivo, a very small proportion of adipocytes were originated from the neural crest. In addition, p75NTR-positive neural crest-derived cells were identified along the vessels within the subcutaneous adipose tissue, but they were negative for mural and endothelial markers. These results demonstrate that ASCs contain neural crest-derived adipocyte-restricted progenitors whose phenotype is distinct from that of non-neural crest derivatives.
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...
Satellite Cells CD44 Positive Drive Muscle Regeneration in Osteoarthritis Patients
Scimeca, Manuel; Bonanno, Elena; Piccirilli, Eleonora; Baldi, Jacopo; Mauriello, Alessandro; Orlandi, Augusto; Tancredi, Virginia; Gasbarra, Elena; Tarantino, Umberto
2015-01-01
Age-related bone diseases, such as osteoarthritis and osteoporosis, are strongly associated with sarcopenia and muscle fiber atrophy. In this study, we analyzed muscle biopsies in order to demonstrate that, in osteoarthritis patients, both osteophytes formation and regenerative properties of muscle stem cells are related to the same factors. In particular, thanks to immunohistochemistry, transmission electron microscopy, and immunogold labeling we investigated the role of BMP-2 in muscle stem cells activity. In patients with osteoarthritis both immunohistochemistry and transmission electron microscopy allowed us to note a higher number of CD44 positive satellite muscle cells forming syncytium. Moreover, the perinuclear and cytoplasmic expression of BMP-2 assessed by in situ molecular characterization of satellite cells syncytia suggest a very strict correlation between BMP-2 expression and muscle regeneration capability. Summing up, the higher BMP-2 expression in osteoarthritic patients could explain the increased bone mineral density as well as decreased muscle atrophy in osteoarthrosic patients. In conclusion, our results suggest that the control of physiological BMP-2 balance between bone and muscle tissues may be considered as a potential pharmacological target in bone-muscle related pathology. PMID:26101529
Satellite Cells CD44 Positive Drive Muscle Regeneration in Osteoarthritis Patients
Directory of Open Access Journals (Sweden)
Manuel Scimeca
2015-01-01
Full Text Available Age-related bone diseases, such as osteoarthritis and osteoporosis, are strongly associated with sarcopenia and muscle fiber atrophy. In this study, we analyzed muscle biopsies in order to demonstrate that, in osteoarthritis patients, both osteophytes formation and regenerative properties of muscle stem cells are related to the same factors. In particular, thanks to immunohistochemistry, transmission electron microscopy, and immunogold labeling we investigated the role of BMP-2 in muscle stem cells activity. In patients with osteoarthritis both immunohistochemistry and transmission electron microscopy allowed us to note a higher number of CD44 positive satellite muscle cells forming syncytium. Moreover, the perinuclear and cytoplasmic expression of BMP-2 assessed by in situ molecular characterization of satellite cells syncytia suggest a very strict correlation between BMP-2 expression and muscle regeneration capability. Summing up, the higher BMP-2 expression in osteoarthritic patients could explain the increased bone mineral density as well as decreased muscle atrophy in osteoarthrosic patients. In conclusion, our results suggest that the control of physiological BMP-2 balance between bone and muscle tissues may be considered as a potential pharmacological target in bone-muscle related pathology.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...
DiPiazza, Anthony; Laniewski, Nathan; Rattan, Ajitanuj; Topham, David J; Miller, Jim; Sant, Andrea J
2018-07-01
Pulmonary CD4 T cells are critical in respiratory virus control, both by delivering direct effector function and through coordinating responses of other immune cells. Recent studies have shown that following influenza virus infection, virus-specific CD4 T cells are partitioned between pulmonary vasculature and lung tissue. However, very little is known about the peptide specificity or functional differences of CD4 T cells within these two compartments. Using a mouse model of influenza virus infection in conjunction with intravascular labeling in vivo , the cell surface phenotype, epitope specificity, and functional potential of the endogenous polyclonal CD4 T cell response was examined by tracking nine independent CD4 T cell epitope specificities. These studies revealed that tissue-localized CD4 cells were globally distinct from vascular cells in expression of markers associated with transendothelial migration, residency, and micropositioning. Despite these differences, there was little evidence for remodeling of the viral epitope specificity or cytokine potential as cells transition from vasculature to the highly inflamed lung tissue. Our studies also distinguished cells in the pulmonary vasculature from peripheral circulating CD4 T cells, providing support for the concept that the pulmonary vasculature does not simply reflect circulating cells that are trapped within the narrow confines of capillary vessels but rather is enriched in transitional cells primed in the draining lymph node that have specialized potential to enter the lung tissue. IMPORTANCE CD4 T cells convey a multitude of functions in immunity to influenza, including those delivered in the lymph node and others conveyed by CD4 T cells that leave the lymph node, enter the blood, and extravasate into the lung tissue. Here, we show that the transition of recently primed CD4 cells detected in the lung vasculature undergo profound changes in expression of markers associated with tissue localization as
Luo, Xi; Hong, Haiyu; Tang, Jun; Wu, Xingmei; Lin, Zhibin; Ma, Renqiang; Fan, Yunping; Xu, Geng; Liu, Dabo; Li, Huabin
2016-03-01
MicroRNAs (miRs) were recently recognized to be important for immune cell differentiation and immune regulation. However, whether miRs were involved in allergen-specific immunotherapy (SIT) remains largely unknown. This study sought to examine changes in miR-146a and T regulatory cells in children with persistent allergic rhinitis (AR) after 3 months of subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT). Twenty-four HDM-sensitized children with persistent AR were enrolled and treated with SCIT (n=13) or SLIT (n=11) for 3 months. Relative miR-146a and Foxp3 mRNA expression, the TRAF6 protein level, and the ratio of post-treatment to baseline IL-10+CD4+ T cells between the SCIT and SLIT groups were examined in the peripheral blood mononuclear cells (PBMCs) of AR patients using quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry, and Western blot analysis, respectively. Serum levels of IL-5 and IL-10 were determined using ELISA. After 3 months of SIT, both the TNSS and INSS scores were significantly decreased compared to the baseline value (P<0.01). The relative expression of miR-146a and Foxp3 mRNA was significantly increased after both SCIT and SLIT (P<0.01). The ratio of post-treatment to baseline IL-10⁺CD4⁺ T cells and the serum IL-10 level were significantly increased in both the SCIT and SLIT groups (P<0.01), whereas the TRAF6 protein level and serum IL-5 level were significantly decreased (P<0.01). No significant differences in these biomarkers were observed between the SCIT and SLIT groups. Our findings suggest that miR-146a and its related biomarkers may be comparably modulated after both SCIT and SLIT, highlighting miR-146a as a potential therapeutic target for the improved management of AR.
Yang, Maobin; Zhang, Hongming; Gangolli, Riddhi
2014-05-01
Bone and dental tissues in craniofacial region work as an important aesthetic and functional unit. Reconstruction of craniofacial tissue defects is highly expected to ensure patients to maintain good quality of life. Tissue engineering and regenerative medicine have been developed in the last two decades, and been advanced with the stem cell technology. Bone marrow derived mesenchymal stem cells are one of the most extensively studied post-natal stem cell population, and are widely utilized in cell-based therapy. Dental tissue derived mesenchymal stem cells are a relatively new stem cell population that isolated from various dental tissues. These cells can undergo multilineage differentiation including osteogenic and odontogenic differentiation, thus provide an alternative source of mesenchymal stem cells for tissue engineering. In this review, we discuss the important issues in mesenchymal stem cell biology including the origin and functions of mesenchymal stem cells, compare the properties of these two types of mesenchymal cells, update recent basic research and clinic applications in this field, and address important future challenges.
Directory of Open Access Journals (Sweden)
Zhou Quan
2012-09-01
Full Text Available Abstract Objectives This study consisted of two parts. One part was to analyze the survival rates of adenoid cystic carcinoma (ACC in Chinese and explain the difference between our data and the literature. The other was to analyze the relationship between the expression of CD117 and the histological grade and the prognosis. Methods A retrospective study of 80 ACC patients was performed. Clinical data were collected, and p63, CD117 were detected by immunohistochemical staining. Results Eighty patients received follow-ups 3 to 216 months after initial diagnosis. ACC occurred in the lacrimal gland (26.3%, n = 21, nasal cavity and parasinus (33.8%, n = 27 and other sites (40.0%, n = 33. The 5-year and 10-year survival rates were 66.41% and 10.16%, respectively. Over expression of CD117 was detected in p63-negative cells in 94.3% of cases and in p63-positive cells in 45.8%. The expression of CD117 in p63-positive cells was significantly associated with the histological grade (P Conclusions ACC had a good 5-year survival but poor 10-year survival in Chinese, which differed from the occidental data. More p63+/CD117+ cells were associated with a higher histological grade and poorer outcome. Virtual slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1701457278762097
Concentrations of /sup 113m/Cd in the marine environment
Energy Technology Data Exchange (ETDEWEB)
Noshkin, V.E.; Wong, K.M.; Eagle, R.J.; Anglin, D.L.
1980-09-18
Reports on the detection of /sup 113m/Cd in any type of environmental sample have been rare. The 113 mass chain yield is small relative to other longer-lived fission products, such as /sup 90/Sr and /sup 137/Cs, produced from uranium, plutonium and thorium fissions. Also, only a small fraction of the 113 chain yield decays to /sup 113m/Cd. Salter estimated that the /sup 113m/Cd//sup 90/Sr activity quotient in thermonuclear fission should be 0.003. He stated that this ratio is in good agreement with data from a few samples measured in the northern hemisphere prior to 1962 which have no /sup 109/Cd. This, to our knowledge, was the first report of the detection of fission-produced /sup 113m/Cd in the environment. Salter also calculated that 0.062 MCi of /sup 113m/Cd and 0.25 MCi of /sup 109/Cd were produced by activation during the atmospheric detonation of the 1.4-megaton Starfish device on 9 July 1962 over Johnston Atoll. As both /sup 109/Cd and /sup 113m/Cd are produced during neutron activation of stable cadmium, and /sup 109/Cd is not a fission product, the last part of Salter's statement is significant. The absence of /sup 109/Cd in samples collected before 1962 indicates that all nuclear testing before this time, which included all tests conducted at Enewetak and Bikini Atolls in the Marshall Islands, could have generated /sup 113m/Cd only as a fission product. It is therefore important to recognize that /sup 113m/Cd could be present in other environments contaminated with fission product wastes discharged to the aquatic environment from other nuclear facilities. /sup 113m/Cd has a half life of 14.6 +- 0.1 y and decays predominantly by beta-particle emission. We present here a preliminary report of /sup 113m/Cd concentrations measured in sediment and tissue samples of marine organisms collected around different atolls in the Marshall Islands.
McLane, Laura M.; Steblyanko, Maria; Anikeeva, Nadia; Ablanedo-Terrazas, Yuria; Demers, Korey; Eller, Michael A.; Streeck, Hendrik; Jansson, Marianne; Sönnerborg, Anders; Canaday, David H.; Naji, Ali; Wherry, E. John; Robb, Merlin L.; Reyes-Teran, Gustavo; Sykulev, Yuri; Betts, Michael R.
2018-01-01
CD4+ T cells subsets have a wide range of important helper and regulatory functions in the immune system. Several studies have specifically suggested that circulating effector CD4+ T cells may play a direct role in control of HIV replication through cytolytic activity or autocrine β-chemokine production. However, it remains unclear whether effector CD4+ T cells expressing cytolytic molecules and β-chemokines are present within lymph nodes (LNs), a major site of HIV replication. Here, we report that expression of β-chemokines and cytolytic molecules are enriched within a CD4+ T cell population with high levels of the T-box transcription factors T-bet and eomesodermin (Eomes). This effector population is predominately found in peripheral blood and is limited in LNs regardless of HIV infection or treatment status. As a result, CD4+ T cells generally lack effector functions in LNs, including cytolytic capacity and IFNγ and β-chemokine expression, even in HIV elite controllers and during acute/early HIV infection. While we do find the presence of degranulating CD4+ T cells in LNs, these cells do not bear functional or transcriptional effector T cell properties and are inherently poor to form stable immunological synapses compared to their peripheral blood counterparts. We demonstrate that CD4+ T cell cytolytic function, phenotype, and programming in the peripheral blood is dissociated from those characteristics found in lymphoid tissues. Together, these data challenge our current models based on blood and suggest spatially and temporally dissociated mechanisms of viral control in lymphoid tissues. PMID:29652923
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...
Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells
International Nuclear Information System (INIS)
Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun
2014-01-01
Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma
The role of CD133 in normal human prostate stem cells and malignant cancer-initiating cells.
Vander Griend, Donald J; Karthaus, Wouter L; Dalrymple, Susan; Meeker, Alan; DeMarzo, Angelo M; Isaacs, John T
2008-12-01
Resolving the specific cell of origin for prostate cancer is critical to define rational targets for therapeutic intervention and requires the isolation and characterization of both normal human prostate stem cells and prostate cancer-initiating cells (CIC). Single epithelial cells from fresh normal human prostate tissue and prostate epithelial cell (PrEC) cultures derived from them were evaluated for the presence of subpopulations expressing stem cell markers and exhibiting stem-like growth characteristics. When epithelial cell suspensions containing cells expressing the stem cell marker CD133+ are inoculated in vivo, regeneration of stratified human prostate glands requires inductive prostate stromal cells. PrEC cultures contain a small subpopulation of CD133+ cells, and fluorescence-activated cell sorting-purified CD133+ PrECs self-renew and regenerate cell populations expressing markers of transit-amplifying cells (DeltaNp63), intermediate cells (prostate stem cell antigen), and neuroendocrine cells (CD56). Using a series of CD133 monoclonal antibodies, attachment and growth of CD133+ PrECs requires surface expression of full-length glycosylated CD133 protein. Within a series of androgen receptor-positive (AR+) human prostate cancer cell lines, CD133+ cells are present at a low frequency, self-renew, express AR, generate phenotypically heterogeneous progeny negative for CD133, and possess an unlimited proliferative capacity, consistent with CD133+ cells being CICs. Unlike normal adult prostate stem cells, prostate CICs are AR+ and do not require functional CD133. This suggests that (a) AR-expressing prostate CICs are derived from a malignantly transformed intermediate cell that acquires "stem-like activity" and not from a malignantly transformed normal stem cell and (b) AR signaling pathways are a therapeutic target for prostate CICs.
Si, Chengshuai; Yu, Qiao; Yao, Yufeng
2018-05-01
MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.
Directory of Open Access Journals (Sweden)
Silvio Däster
2014-01-01
Full Text Available Aims. A trend towards local excision of early rectal cancers has prompted us to investigate if immunoprofiling might help in predicting lymph node involvement in this subgroup. Methods. A tissue microarray of 126 biopsies of early rectal cancer (T1 and T2 was stained for several immunomarkers of the innate and the adaptive immune response. Patients’ survival and nodal status were analyzed and correlated with infiltration of the different immune cells. Results. Of all tested markers, only CD8 (P=0.005 and TIA-1 (P=0.05 were significantly more frequently detectable in early rectal cancer biopsies of node negative as compared to node positive patients. Although these two immunomarkers did not display prognostic effect “per se,” CD8+ and, marginally, TIA-1 T cell infiltration could predict nodal involvement in univariate logistic regression analysis (OR 0.994; 95% CI 0.992–0.996; P=0.009 and OR 0.988; 95% CI 0.984–0.994; P=0.05, resp.. An algorithm significantly predicting the nodal status in early rectal cancer based on CD8 together with vascular invasion and tumor border configuration could be calculated (P<0.00001. Conclusion. Our data indicate that in early rectal cancers absence of CD8+ T-cell infiltration helps in predicting patients’ nodal involvement.
Shakir, Mohammad; Jolly, Reshma; Khan, Mohd Shoeb; Rauf, Ahmar; Kazmi, Shadab
2016-12-01
Herein, we report the synthesis of a novel tri-component nanocomposite system incorporating β-cyclodextrin (β-CD) with nano-hydroxyapatite (n-HA) and chitosan (CS), (n-HA/β-CD/CS) at three different temperatures via co-precipitation method. The chemical interactions and surface morphology have been evaluated by TEM, SEM and AFM techniques revealing the agglomerated nanoparticles in CS/n-HA-HA binary system whereas the ternary systems produced needle shaped nanoparticles dispersed homogeneously at low temperature with more porous and rougher surface. The addition of β-CD in CS/n-HA at low temperature decreased the particle size and raised the thermal stability as compared to CS/n-HA. The comparative hemolytic, protein adsorption and platelet adhesion studies confirmed the better hemocompatibility of n-HA/β-CD/CS-(RT,HT,LT) nanocomposites relative to CS/n-HA. The cell viability has been evaluated in vitro using MG-63 cell line which revealed superior non toxicity of n-HA/β-CD/CS-LT nanocomposite in comparison to n-HA/β-CD/CS-(RT,HT) and CS/n-HA nanocomposites. Thus it may be concluded that the orchestrated organic/inorganic n-HA/β-CD/CS-(RT,HT,LT) nanocomposites exhibited relatively higher cell viability of human osteoblast cells, stimulated greater osteogenesis, controlled biodegradation, enhanced antibacterial activity with excellent in-vitro biomineralization and remarkable mechanical parameters as compared to CS/n-HA nanocomposite and thus may provide opportunities for potential use as an alternative biomaterial for Bone tissue engineering applications. Copyright © 2016 Elsevier B.V. All rights reserved.
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...
The effects of CD147 on the cell proliferation, apoptosis, invasion, and angiogenesis in glioma.
Yin, Haoyuan; Shao, Ying; Chen, Xuan
2017-01-01
To analyze the effects of extracellular matrix metalloproteinase inducer (CD147) on glioma proliferation, apoptosis, invasion, and angiogenesis. Tissue samples were obtained from 101 glioma cases while normal brain tissues were obtained from 30 brain injury cases. Immunohistochemical assay was performed to detect the expressions of CD147, CD34, and VEGF in tissue samples. QRT-PCR was performed to detect the relative expression of CD147 mRNA in human glioma cell lines. CD147 siRNA was transfected into glioma cell line U251. Cell proliferation, apoptosis, invasion, and angiogenesis were tested by MTT, flow cytometry, Transwell assay, and vasculogenic mimicry assay, respectively. Expressions of relative proteins were analyzed with western blot. CD147 was positively expressed with the percentage of 0, 37.5, 44.8, 67.9, and 85.7 % in normal tissues and glioma tissues with WHO grades I-IV, respectively, and the scores of MVDand VEGF were associated with the expression of CD147. CD147 was significantly upregulated in the human glioma cell lines (P CD147 suppressed cell proliferation, blocked cell cycle, induced apoptosis, inhibited cell invasion and angiogenesis in glioma cells in vitro. The expression of CD147 was significantly associated with WHO tumor grade and angiogenesis; silencing of CD147 contributed to inhibition of glioma proliferation, invasion, and angiogenesis. Our study provided firm evidence that CD 147 is a potential glioma target for anti-angiogenic therapies.
Directory of Open Access Journals (Sweden)
Makoto Emori
Full Text Available Epithelioid sarcoma (ES is a relatively rare, highly malignant soft tissue sarcoma. The mainstay of treatment is resection or amputation. Currently other therapeutic options available for this disease are limited. Therefore, a novel therapeutic option needs to be developed. In the present study, we established a new human ES cell line (ESX and analyzed the characteristics of its cancer stem-like cells/cancer-initiating cells (CSCs/CICs based on ALDH1 activity. We demonstrated that a subpopulation of ESX cells with high ALDH1 activity (ALDH(high cells correlated with enhanced clonogenic ability, sphere-formation ability, and invasiveness in vitro and showed higher tumorigenicity in vivo. Next, using gene expression profiling, we identified CD109, a GPI-anchored protein upregulated in the ALDH(high cells. CD109 mRNA was highly expressed in various sarcoma cell lines, but weakly expressed in normal adult tissues. CD109-positive cells in ESX predominantly formed spheres in culture, whereas siCD109 reduced ALDH1 expression and inhibited the cell proliferation in vitro. Subsequently, we evaluated the expression of CD109 protein in 80 clinical specimens of soft tissue sarcoma. We found a strong correlation between CD109 protein expression and the prognosis (P = 0.009. In conclusion, CD109 might be a CSC/CIC marker in epithelioid sarcoma. Moreover, CD109 is a promising prognostic biomarker and a molecular target of cancer therapy for sarcomas including ES.
Zaric, Marija; Becker, Pablo Daniel; Hervouet, Catherine; Kalcheva, Petya; Ibarzo Yus, Barbara; Cocita, Clement; O'Neill, Lauren Alexandra; Kwon, Sung-Yun; Klavinskis, Linda Sylvia
2017-12-28
The generation of tissue resident memory (T RM ) cells at the body surfaces to provide a front line defence against invading pathogens represents an important goal in vaccine development for a wide variety of pathogens. It has been widely assumed that local vaccine delivery to the mucosae is necessary to achieve that aim. Here we characterise a novel micro-needle array (MA) delivery system fabricated to deliver a live recombinant human adenovirus type 5 vaccine vector (AdHu5) encoding HIV-1 gag. We demonstrate rapid dissolution kinetics of the microneedles in skin. Moreover, a consequence of MA vaccine cargo release was the generation of long-lived antigen-specific CD8 + T cells that accumulate in mucosal tissues, including the female genital and respiratory tract. The memory CD8 + T cell population maintained in the peripheral mucosal tissues was attributable to a MA delivered AdHu5 vaccine instructing CD8 + T cell expression of CXCR3 + , CD103 +, CD49a + , CD69 + , CD127 + homing, retention and survival markers. Furthermore, memory CD8 + T cells generated by MA immunization significantly expanded upon locally administered antigenic challenge and showed a predominant poly-functional profile producing high levels of IFNγ and Granzyme B. These data demonstrate that skin vaccine delivery using microneedle technology induces mobilization of long lived, poly-functional CD8 + T cells to peripheral tissues, phenotypically displaying hallmarks of residency and yields new insights into how to design and deliver effective vaccine candidates with properties to exert local immunosurveillance at the mucosal surfaces. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Oedayrajsingh-Varma, M. J.; van Ham, S. M.; Knippenberg, M.; Helder, M. N.; Klein-Nulend, J.; Schouten, T. E.; Ritt, M. J. P. F.; van Milligen, F. J.
2006-01-01
Adipose tissue contains a stromal vascular fraction that can be easily isolated and provides a rich source of adipose tissue-derived mesenchymal stem cells (ASC). These ASC are a potential source of cells for tissue engineering. We studied whether the yield and growth characteristics of ASC were
Memory CD8 T cell inflation vs tissue-resident memory T cells: Same patrollers, same controllers?
Welten, Suzanne P M; Sandu, Ioana; Baumann, Nicolas S; Oxenius, Annette
2018-05-01
The induction of long-lived populations of memory T cells residing in peripheral tissues is of considerable interest for T cell-based vaccines, as they can execute immediate effector functions and thus provide protection in case of pathogen encounter at mucosal and barrier sites. Cytomegalovirus (CMV)-based vaccines support the induction and accumulation of a large population of effector memory CD8 T cells in peripheral tissues, in a process called memory inflation. Tissue-resident memory (T RM ) T cells, induced by various infections and vaccination regimens, constitute another subset of memory cells that take long-term residence in peripheral tissues. Both memory T cell subsets have evoked substantial interest in exploitation for vaccine purposes. However, a direct comparison between these two peripheral tissue-localizing memory T cell subsets with respect to their short- and long-term ability to provide protection against heterologous challenge is pending. Here, we discuss communalities and differences between T RM and inflationary CD8 T cells with respect to their development, maintenance, function, and protective capacity. In addition, we discuss differences and similarities between the transcriptional profiles of T RM and inflationary T cells, supporting the notion that they are distinct memory T cell populations. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Declining Physical Performance Associates with Serum FasL, miR-21, and miR-146a in Aging Sprinters
Directory of Open Access Journals (Sweden)
Reeta Kangas
2017-01-01
Full Text Available Aging is associated with systemic inflammation and cellular apoptosis accelerating physiological dysfunctions. Whether physically active way of life affects these associations is unclear. This study measured the levels of serum inflammatory and apoptotic molecules, their change over 10 years, and their associations with physical performance in sprint-trained male athletes. HsCRP, cell counts, HGB, FasL, miR-21, and miR-146a were measured cross-sectionally (n=67, 18–90 yrs and serum FasL, miR-21, and miR-146a and their aging-related associations with physical performance were assessed over a 10-year follow-up (n=49, 50–90 yrs. The cross-sectional study showed positive age correlations for neutrophils and negative for lymphocytes, red blood cells, HGB, FasL, and miR-146a. During the 10-year follow-up, FasL decreased (P=0.017 and miR-21 (P<0.001 and miR-146a (P=0.005 levels increased. When combining the molecule levels, aging, and physical performance, FasL associated with countermovement jump and bench press (P<0.001, miR-21 and miR-146a with knee flexion (P=0.023; P<0.001, and bench press (P=0.004; P<0.001 and miR-146a with sprint performance (P<0.001. The studied serum molecules changed in an age-dependent manner and were associated with declining physical performance. They have potential as biomarkers of aging-related processes influencing the development of physiological dysfunctions. Further research is needed focusing on the origins and targets of circulating microRNAs to clarify their function in various tissues with aging.
Equine Mesenchymal Stromal Cells Retain a Pericyte-Like Phenotype.
Esteves, Cristina L; Sheldrake, Tara A; Dawson, Lucy; Menghini, Timothy; Rink, Burgunde Elisabeth; Amilon, Karin; Khan, Nusrat; Péault, Bruno; Donadeu, Francesc Xavier
2017-07-01
Mesenchymal stem/stromal cells (MSCs) have been used in human and equine regenerative medicine, and interest in exploiting their potential has increased dramatically over the years. Despite significant effort to characterize equine MSCs, the actual origin of these cells and how much of their native phenotype is maintained in culture have not been determined. In this study, we investigated the relationship between MSCs, derived from adipose tissue (AT) and bone marrow (BM), and pericytes in the horse. Both pericyte (CD146, NG2, and αSMA) and MSC (CD29, CD90, and CD73) markers were detected in equine AT and colocalized around blood vessels. Importantly, as assessed by flow cytometry, both pericyte (CD146, NG2, and αSMA) and MSC (CD29, CD44, CD90, and CD105) markers were present in a majority (≥90%) of cells in cultures of AT-MSCs and BM-MSCs; however, levels of pericyte markers were variable within each of those populations. Moreover, the expression of pericyte markers was maintained for at least eight passages in both AT-MSCs and BM-MSCs. Hematopoietic (CD45) and endothelial (CD144) markers were also detected at low levels in MSCs by quantitative polymerase chain reaction (qPCR). Finally, in coculture experiments, AT-MSCs closely associated with networks produced by endothelial cells, resembling the natural perivascular location of pericytes in vivo. Our results indicate that equine MSCs originate from perivascular cells and moreover maintain a pericyte-like phenotype in culture. Therefore, we suggest that, in addition to classical MSC markers, pericyte markers such as CD146 could be used when assessing and characterizing equine MSCs.
Kapanadze, Tamar; Medina-Echeverz, José; Gamrekelashvili, Jaba; Weiss, Jonathan M.; Wiltrout, Robert H.; Kapoor, Veena; Hawk, Nga; Terabe, Masaki; Berzofsky, Jay A.; Manns, Michael P.; Wang, Ena; Marincola, Francesco M.; Korangy, Firouzeh; Greten, Tim F.
2015-01-01
Immunosuppressive CD11b+Gr-1+ myeloid-derived suppressor cells (MDSC) accumulate in the livers of tumor-bearing mice. We studied hepatic MDSC in two murine models of immune mediated hepatitis. Unexpectedly, treatment of tumor bearing mice with Concanavalin A or α-Galactosylceramide resulted in increased ALT and AST serum levels in comparison to tumor free mice. Adoptive transfer of hepatic MDSC into naïve mice exacerbated Concanavalin A induced liver damage. Hepatic CD11b+Gr-1+ cells revealed a polarized pro-inflammatory gene signature after Concanavalin A treatment. An interferon gamma- dependent up-regulation of CD40 on hepatic CD11b+Gr-1+ cells along with an up-regulation of CD80, CD86, and CD1d after Concanavalin A treatment was observed. Concanavalin A treatment resulted in a loss of suppressor function by tumor-induced CD11b+Gr-1+ MDSC as well as enhanced reactive oxygen species-mediated hepatotoxicity. CD40 knockdown in hepatic MDSC led to increased arginase activity upon Concanavalin A treatment and lower ALT/AST serum levels. Finally, blockade of arginase activity in Cd40−/− tumor-induced myeloid cells resulted in exacerbation of hepatitis and increased reactive oxygen species production in vivo. Our findings indicate that in a setting of acute hepatitis, tumor-induced hepatic MDSC act as pro-inflammatory immune effector cells capable of killing hepatocytes in a CD40-dependent manner. PMID:25616156
A Positive Control for Detection of Functional CD4 T Cells in PBMC: The CPI Pool.
Schiller, Annemarie; Zhang, Ting; Li, Ruliang; Duechting, Andrea; Sundararaman, Srividya; Przybyla, Anna; Kuerten, Stefanie; Lehmann, Paul V
2017-12-07
Testing of peripheral blood mononuclear cells (PBMC) for immune monitoring purposes requires verification of their functionality. This is of particular concern when the PBMC have been shipped or stored for prolonged periods of time. While the CEF (Cytomegalo-, Epstein-Barr and Flu-virus) peptide pool has become the gold standard for testing CD8 cell functionality, a positive control for CD4 cells is so far lacking. The latter ideally consists of proteins so as to control for the functionality of the antigen processing and presentation compartments, as well. Aiming to generate a positive control for CD4 cells, we first selected 12 protein antigens from infectious/environmental organisms that are ubiquitous: Varicella, Influenza, Parainfluenza, Mumps, Cytomegalovirus, Streptococcus , Mycoplasma , Lactobacillus , Neisseria , Candida , Rubella, and Measles. Of these antigens, three were found to elicited interferon (IFN)-γ-producing CD4 cells in the majority of human test subjects: inactivated cytomegalo-, parainfluenza-, and influenza virions (CPI). While individually none of these three antigens triggered a recall response in all donors, the pool of the three (the 'CPI pool'), did. One hundred percent of 245 human donors tested were found to be CPI positive, including Caucasians, Asians, and African-Americans. Therefore, the CPI pool appears to be suitable to serve as universal positive control for verifying the functionality of CD4 and of antigen presenting cells.
Noto, Zenko; Yoshida, Toshiko; Okabe, Motonori; Koike, Chika; Fathy, Moustafa; Tsuno, Hiroaki; Tomihara, Kei; Arai, Naoya; Noguchi, Makoto; Nikaido, Toshio
2013-08-01
Cancer may be derived from cancer stem-like cells (CSCs), which are tumor-initiating cells that have properties similar to those of stem cells. Identification and isolation of CSCs needs to be improved further. CSCs markers were examined in human oral cancer cell lines by flow cytometry. The stem cell properties of subpopulations expressing different markers were assessed further by in vitro sphere formation assays, expression of stemness genes, drug resistance assays, and the ability to form tumors in nude mice. We demonstrated that CSCs could be isolated by the cell surface markers CD44 and stage-specific embryonic antigen-4 (SSEA-4). CD44+SSEA-4+ cells exhibited cancer stem-like properties, including extensive self-renewal into the bulk of cancer cells. In vivo xenograft experiments indicated that CD44+SSEA-4+ cells exhibit the highest tumorigenic capacity compared with the remaining subpopulations and parental cells. Double-positive cells for CD44 and SSEA-4 exhibited preferential expression of some stemness genes and were more resistant to the anticancer drugs, cisplatin and 5-fluorouracil (5-FU). In addition, cells expressing CD44 and SSEA-4 were detected in all tumor specimens analyzed, while coexpression of CD44 and SSEA-4 was not detectable in normal oral mucosa. Our findings suggest that CD44+SSEA-4+ cells exhibit the characteristics of CSCs in oral squamous cell carcinoma and provide a target for the development of more effective therapies. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Qing Yang
Full Text Available To assess the expression of COX-2,CD44v6 and CD147 in hypopharyngeal squamous cell carcinomas and the three biomarkers correlation with tumor invasion and lymph node metastasis of Chinese people. 101 cases of surgically excised primary tumor were included in this study, and 40 tissues of epithelium adjacent to carcinoma were used as controls. We characterized the immunohistochemical expression of COX-2, CD44v6, and CD147 in 141 formalin-fixed, paraffin-embedded tissues, and measured the mean optical density (OD of the positive area to identify the expression of the three bio-markers and relationship with tumor invasion and lymph node metastasis. Our study demonstrates that the expression of the COX-2 and CD147 were significantly increased in carcinoma tissues compared to the epithelium adjacent to carcinoma. We also observed that the expression of COX-2, CD44v6, and CD147 were significantly associated with T classification, lymph node metastasis and clinical stage. There was strong significant correlation among the three biomarkers as well. Additionally, we indicated that recurrence and ≥ P50 level of COX-2 expression had an independent prognostic effect on prognosis. In conclusion, the three biomarkers play important roles in tumor invasion and lymph node metastases and might be valuable indicators of tumor metastasis in hypopharyngeal squamous cell carcinoma.
Pericytes for the treatment of orthopedic conditions.
James, Aaron W; Hindle, Paul; Murray, Iain R; West, Christopher C; Tawonsawatruk, Tulyapruek; Shen, Jia; Asatrian, Greg; Zhang, Xinli; Nguyen, Vi; Simpson, A Hamish; Ting, Kang; Péault, Bruno; Soo, Chia
2017-03-01
Pericytes and other perivascular stem cells are of growing interest in orthopedics and tissue engineering. Long regarded as simple regulators of angiogenesis and blood pressure, pericytes are now recognized to have MSC (mesenchymal stem cell) characteristics, including multipotentiality, self-renewal, immunoregulatory functions, and diverse roles in tissue repair. Pericytes are typified by characteristic cell surface marker expression (including αSMA, CD146, PDGFRβ, NG2, RGS5, among others). Although alone no marker is absolutely specific for pericytes, collectively these markers appear to selectively identify an MSC-like pericyte. The purification of pericytes is most well described as a CD146 + CD34 - CD45 - cell population. Pericytes and other perivascular stem cell populations have been applied in diverse orthopedic applications, including both ectopic and orthotopic models. Application of purified cells has sped calvarial repair, induced spine fusion, and prevented fibrous non-union in rodent models. Pericytes induce these effects via both direct and indirect mechanisms. In terms of their paracrine effects, pericytes are known to produce and secrete high levels of a number of growth and differentiation factors both in vitro and after transplantation. The following review will cover existing studies to date regarding pericyte application for bone and cartilage engineering. In addition, further questions in the field will be pondered, including the phenotypic and functional overlap between pericytes and culture-derived MSC, and the concept of pericytes as efficient producers of differentiation factors to speed tissue repair. Copyright © 2016. Published by Elsevier Inc.
Lymphoid tissue inducer cells: pivotal cells in the evolution of CD4 immunity and tolerance?
Directory of Open Access Journals (Sweden)
Peter John Lane
2012-02-01
Full Text Available Phylogeny suggests that the evolution of placentation in mammals was accompanied by substantial changes in the mammalian immune system: in particular lymph nodes and CD4 high affinity memory antibody responses co-evolved during the same period. Lymphoid tissue inducer cells (LTi are members of an emerging family of innate lymphoid cells (ILCs that are crucial for lymph node development, but our studies have indicated that they also play a pivotal role in the long-term maintenance of memory CD4 T cells in adult mammals through their expression of the tumor necrosis family members, OX40- and CD30-ligands. Additionally, our studies have shown that these two molecules are also key operators in CD4 effector function, as their absence obviates the need for the FoxP3-dependent regulatory T cells (Tregs that prevent CD4 driven autoimmune responses. In this perspective article, we summarize findings from our group over the last 10 years, and focus specifically on the role of LTi in thymus. We suggest that like memory CD4 T cells, LTi also play a role in the selection and maintenance of the Tregs that under normal circumstances are absolutely required to regulate CD4 effector cells.
Directory of Open Access Journals (Sweden)
M. Demestre
2015-09-01
Full Text Available Striated skeletal muscle cells from humans represent a valuable source for in vitro studies of the motoric system as well as for pathophysiological investigations in the clinical settings. Myoblasts can readily be grown from human muscle tissue. However, if muscle tissue is unavailable, myogenic cells can be generated from human induced pluripotent stem cells (hiPSCs preferably without genetic engineering. Our study aimed to optimize the generation of hiPSCs derived myogenic cells by employing selection of CD34 positive cells and followed by distinct, stepwise culture conditions. Following the expansion of CD34 positive single cells under myogenic cell culture conditions, serum deprived myoblast-like cells finally fused and formed multinucleated striated myotubes that expressed a set of key markers for muscle differentiation. In addition, these myotubes contracted upon electrical stimulation, responded to acetylcholine (Ach and were able to generate action potentials. Finally, we co-cultured motoneurons and myotubes generated from identical hiPSCs cell lines. We could observe the early aggregation of acetylcholine receptors in muscle cells of immature co-cultures. At later stages, we identified and characterised mature neuromuscular junctions (NMJs. In summary, we describe here the successful generation of an iPS cell derived functional cellular system consisting of two distinct communicating cells types. This in vitro co-culture system could therefore contribute to research on diseases in which the motoneurons and the NMJ are predominantly affected, such as in amyotrophic lateral sclerosis or spinal muscular atrophy.
Dahlin, Joakim S; Malinovschi, Andrei; Öhrvik, Helena; Sandelin, Martin; Janson, Christer; Alving, Kjell; Hallgren, Jenny
2016-01-28
Mast cells are rare tissue-resident immune cells that are involved in allergic reactions, and their numbers are increased in the lungs of asthmatics. Murine lung mast cells arise from committed bone marrow-derived progenitors that enter the blood circulation, migrate through the pulmonary endothelium, and mature in the tissue. In humans, mast cells can be cultured from multipotent CD34(+) progenitor cells. However, a population of distinct precursor cells that give rise to mast cells has remained undiscovered. To our knowledge, this is the first report of human lineage-negative (Lin(-)) CD34(hi) CD117(int/hi) FcεRI(+) progenitor cells, which represented only 0.0053% of the isolated blood cells in healthy individuals. These cells expressed integrin β7 and developed a mast cell-like phenotype, although with a slow cell division capacity in vitro. Isolated Lin(-) CD34(hi) CD117(int/hi) FcεRI(+) blood cells had an immature mast cell-like appearance and expressed high levels of many mast cell-related genes as compared with human blood basophils in whole-transcriptome microarray analyses. Furthermore, serglycin, tryptase, and carboxypeptidase A messenger RNA transcripts were detected by quantitative reverse transcription-polymerase chain reaction. Altogether, we propose that the Lin(-) CD34(hi) CD117(int/hi) FcεRI(+) blood cells are closely related to human tissue mast cells and likely constitute an immediate precursor population, which can give rise to predominantly mast cells. Furthermore, asthmatics with reduced lung function had a higher frequency of Lin(-) CD34(hi) CD117(int/hi) FcεRI(+) blood mast cell progenitors than asthmatics with normal lung function. © 2016 by The American Society of Hematology.
Directory of Open Access Journals (Sweden)
Vince N Montes
Full Text Available Adipose tissue inflammation and specifically, pro-inflammatory macrophages are believed to contribute to insulin resistance (IR in obesity in humans and animal models. Recent studies have invoked T cells in the recruitment of pro-inflammatory macrophages and the development of IR. To test the role of the T cell response in adipose tissue of mice fed an obesogenic diet, we used two agents (CTLA-4 Ig and anti-CD40L antibody that block co-stimulation, which is essential for full T cell activation. C57BL/6 mice were fed an obesogenic diet for 16 weeks, and concomitantly either treated with CTLA-4 Ig, anti-CD40L antibody or an IgG control (300 µg/week. The treatments altered the immune cell composition of adipose tissue in obese mice. Treated mice demonstrated a marked reduction in pro-inflammatory adipose tissue macrophages and activated CD8+ T cells. Mice treated with anti-CD40L exhibited reduced weight gain, which was accompanied by a trend toward improved IR. CTLA-4 Ig treatment, however, was not associated with improved IR. These data suggest that the presence of pro-inflammatory T cells and macrophages can be altered with co-stimulatory inhibitors, but may not be a significant contributor to the whole body IR phenotype.
Kraft, Jeffrey J.; Jeong, Changhoon; Novotny, John E.; Seacrist, Thomas; Chan, Gilbert; Domzalski, Marcin; Turka, Christina M.; Richardson, Dean W.; Dodge, George R.
2011-01-01
Objective: Many approaches are being taken to generate cartilage replacement materials. The goal of this study was to use a self-aggregating suspension culture model of chondrocytes with mechanical preconditioning. Design: Our model differs from others in that it is based on a scaffold-less, self-aggregating culture model that produces a cartilage tissue analog that has been shown to share many similarities with the natural cartilage phenotype. Owing to the known loaded environment under which chondrocytes function in vivo, we hypothesized that applying force to the suspension culture–derived chondrocyte biomass would improve its cartilage-like characteristics and provide a new model for engineering cartilage tissue analogs. Results: In this study, we used a specialized hydrostatic pressure bioreactor system to apply mechanical forces during the growth phase to improve biochemical and biophysical properties of the biomaterial formed. We demonstrated that using this high-density suspension culture, a biomaterial more consistent with the hyaline cartilage phenotype was produced without any foreign material added. Unpassaged chondrocytes responded to a physiologically relevant hydrostatic load by significantly increasing gene expression of critical cartilage molecule collagen and aggrecan along with other cartilage relevant genes, CD44, perlecan, decorin, COMP, and iNOS. Conclusions: This study describes a self-aggregating bioreactor model without foreign material or scaffold in which chondrocytes form a cartilage tissue analog with many features similar to native cartilage. This study represents a promising scaffold-less, methodological advancement in cartilage tissue engineering with potential translational applications to cartilage repair. PMID:26069584
21 CFR 146.141 - Canned orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...
Development of frequency step tunable 1 MW gyrotron at 131 to 146.5 GHz
Energy Technology Data Exchange (ETDEWEB)
Samartsev, A.; Gantenbein, G.; Dammertz, G.; Illy, S.; Kern, S.; Leonhardt, W.; Schlaich, A.; Schmid, M.; Thumm, M., E-mail: andrey.samartsev@kit.edu [Karlsruhe Institute of Technology, Association EURATOM-KIT, Karlsruhe (Germany)
2011-07-01
Effective control of power absorption in tokamaks and stellarators could be achieved by the frequency tuning of ECH and CD power delivered by high-power gyrotrons. In this report some results of the development of a frequency tunable gyrotron with fused-silica Brewster window are presented. Excitation of several modes at 1 MW power level in the range of frequencies from 131 to 146.5 GHz is achieved. (author)
Liu, X; Liu, H; Guo, Z; Luan, W
2006-01-01
To compare the prevalence of asymptomatic oral candidal carriage in healthy volunteers with human immunodeficiency virus (HIV)-positive patients in China, as well as to investigate the relationship between CD4+ lymphocyte count and oral candidal colonization or oral candidiasis. Oral candidal carriage and oral candidiasis were investigated in 101 patients with HIV-infection seen at Youan Hospital, Beijing, China. Two hundred and seventeen healthy volunteers were involved as a control. Culture from saliva was used to test for the presence of oral Candida. CD4+ lymphocyte count was measured by flow cytometry. All data were analyzed statistically by SAS. Asymptomatic oral candidal carriage rate (28.6%) in HIV-positive group was similar to that in the healthy group (18.0%; P = 0.07). No significant difference in CD4+ lymphocyte count was found between oral Candida carriers and non-carriers among HIV-positive subjects (P = 0.89). However, the frequency of oral candidiasis increased with the decrease in CD4+ lymphocyte count (P < 0.0001), and pseudomembranous candidiasis was predominant in HIV-positive patients with CD4+ <200 cells microl(-1) (66.7%). In HIV-positive subjects, asymptomatic oral candidal colonization is not related to CD4+ lymphocyte count of blood, and the carriage rate is similar to that in the healthy population. Oral candidiasis is more likely to be observed in HIV-positive patients who have a low CD4+ lymphocyte count.
Content Heavy Metal Pb, Cd In Perna viridis And Sediments In Semarang Bay
Suprapto, D.; Suryanti, S.; Latifah, N.
2018-02-01
Waste disposal from human activities, generally contain heavy metals such as Pb and Cd which derived from industrial activities. The aims of the study were to know the concentration of Pb and Cd heavy metals contained in Perna viridis tissue, sediment and water at Semarang Bay. This study was conducted in May 2017 at Semarang Bay. - Samples were collected using purposive sampling method. The heavy metal content in the water and clam was observed using- APHA method and was analyzed using AAS (Atomic Absorption Spectrophotometer). The results showed that concentration of heavy metal of Pb in the water was 0.00-50.5mg/L and the Cd content was of 26.9-51.7 mg/L, whereas the concentration of Pb in the sediment is 445.5-2.053.0mg/L and Cd 963.3-2,150.0 mg/L. Pb content in soft tissue of Perna viridis - is 67.1-1.933.9 mg/L and the concentration of Cd was 203.5-5.787.3 mg/L. The analysis of Pb and Cd in seawater, sediment and soft tissue of Perna viridis according to Enviroment Ministerial decree (KepMenLH ) number 51 of 2004 and applied by NOAA 1999 does not exceed the quality standard, that meant that the Perna viridis has been contaminated by metal Pb it is controversial with the above sentence and Cd. It concluded that the metal content of Pb and Cd in Perna viridis tissue exceeds the quality standard, so it is not suitable to be consumed, especially in high quantity
Directory of Open Access Journals (Sweden)
Chandra M Ohri
Full Text Available BACKGROUND: We have previously investigated the microlocalisation of M1 and M2 macrophages in NSCLC. This study investigated the non-macrophage (NM expression of proteins associated with M1 and M2 macrophages in NSCLC. METHODS: Using immunohistochemistry, CD68(+ macrophages and proteins associated with either a cytotoxic M1 phenotype (HLA-DR, iNOS, and MRP 8/14, or a non-cytotoxic M2 phenotype (CD163 and VEGF were identified. NM expression of the markers was analysed in the islets and stroma of surgically resected tumours from 20 patients with extended survival (ES (median 92.7 months and 20 patients with poor survival (PS (median 7.7 months. RESULTS: The NM expression of NM-HLA-DR (p<0.001, NM-iNOS (p = 0.02 and NM-MRP 8/14 (p = 0.02 was increased in ES compared to PS patients in the tumour islets. The tumour islet expression of NM-VEGF, was decreased in ES compared to PS patients (p<0.001. There was more NM-CD163 expression (p = 0.04 but less NM-iNOS (p = 0.002 and MRP 8/14 (p = 0.01 expression in the stroma of ES patients compared with PS patients. The 5-year survival for patients with above and below median NM expression of the markers in the islets was 74.9% versus 4.7% (NM-HLA-DR p<0.001, 65.0% versus 14.6% (NM-iNOS p = 0.003, and 54.3% versus 22.2% (NM-MRP 8/14 p = 0.04, as opposed to 34.1% versus 44.4% (NM-CD163 p = 0.41 and 19.4% versus 59.0% (NM-VEGF p = 0.001. CONCLUSIONS: Cell proteins associated with M1 and M2 macrophages are also expressed by other cell types in the tumour islets and stroma of patients with NSCLC. Their tissue and cellular microlocalisation is associated with important differences in clinical outcome.
Nakashima, Misako; Iohara, Koichiro; Sugiyama, Masahiko
2009-01-01
Dental caries is a common public health problem, causing early loss of dental pulp and resultant tooth loss. Dental pulp has important functions to sustain teeth providing nutrient and oxygen supply, innervation, reactionary/reparative dentin formation and immune response. Regeneration of pulp is an unmet need in endodontic therapy, and angiogenesis/vasculogenesis and neurogenesis are critical for pulp regeneration. Permanent and deciduous pulp tissue is easily available from teeth after extraction without ethical issues and has potential for clinical use. In this review, we introduce some stem cell subfractions, CD31(-)/CD146(-) SP cells and CD105(+) cells with high angiogenic and neurogenic potential, derived from human adult dental pulp tissue. Potential utility of these cells is addressed as a source of cells for treatment of cerebral and limb ischemia and pulp inflammation complete with angiogenesis and vasculogenesis.
Directory of Open Access Journals (Sweden)
Yadegary Z
2011-04-01
Full Text Available "nBackground and Aims: In the last decade, several studies have reported the isolation of stem cell population from different dental sources, while their mesenchymal nature is still controversial. The aim of this study was to isolate stem cells from mature human dental pulp and follicle and to determine their mesenchymal nature before differentiation based on the ISCT (International Society for Cellular Therapy criteria."nMaterials and Methods: In this experimental study, intact human third molars extracted due to prophylactic or orthodontic reasons were collected from patients aged 18-25. After tooth extraction, dental pulp and follicle were stored at 4°C in RPMI 1640 medium containing antibiotics. Dental pulp and follicle were prepared in a sterile condition and digested using an enzyme solution containing 4mg/ml collagenase I and dispase (ratio: 1:1. The cells were then cultivated in α-MEM medium. Passage-3 cells were analyzed by flow cytometry for the expression of CD34, CD45, CD 73, CD90 and CD105 surface markers."nResults: Dental pulp and follicle were observed to grow in colony forming units, mainly composed of a fibroblast-like cell population. Flow cytometry results showed that dental pulp and follicle are highly positive for CD73, CD90 and CD105 (mesenchymal stem cell markers and are negative for hematopoietic markers such as CD34 and CD 45."nConclusion: In this study we were able to successfully confirm that dental pulp and follicle stem cells isolated from permanent third molars have a mesenchymal nature before differentiation. Therefore, these two sources can be considered as an easy accessible source of mesenchymal stem cells for stem cell research and tissue engineering.
Pulmonary candidiasis and CD4 count in HIV positive patients seen ...
African Journals Online (AJOL)
Pulmonary candidiasis and CD4 count in HIV positive patients seen in Jos, north central Nigeria. YJ Peter, AH Isa, AS Anzaku, MI Builders. Abstract. Background: Accurate and reliable diagnosis of HIV opportunistic infections plays a central role in effective HIV intervention programmes. Pulmonary infections are the leading ...
Directory of Open Access Journals (Sweden)
Matthew A Fischer
2011-11-01
Full Text Available The goal of the innate immune system is containment of a pathogen at the site of infection prior to the initiation of an effective adaptive immune response. However, effector mechanisms must be kept in check to combat the pathogen while simultaneously limiting undesirable destruction of tissue resulting from these actions. Here we demonstrate that innate immune effector cells contain a peripheral poxvirus infection, preventing systemic spread of the virus. These innate immune effector cells are comprised primarily of CD11b⁺Ly6C⁺Ly6G⁻ monocytes that accumulate initially at the site of infection, and are then supplemented and eventually replaced by CD11b⁺Ly6C⁺Ly6G⁺ cells. The phenotype of the CD11b⁺Ly6C⁺Ly6G⁺ cells resembles neutrophils, but the infiltration of neutrophils typically occurs prior to, rather than following, accumulation of monocytes. Indeed, it appears that the CD11b⁺Ly6C⁺Ly6G⁺ cells that infiltrated the site of VACV infection in the ear are phenotypically distinct from the classical description of both neutrophils and monocyte/macrophages. We found that CD11b⁺Ly6C⁺Ly6G⁺ cells produce Type I interferons and large quantities of reactive oxygen species. We also observed that depletion of Ly6G⁺ cells results in a dramatic increase in tissue damage at the site of infection. Tissue damage is also increased in the absence of reactive oxygen species, although reactive oxygen species are typically thought to be damaging to tissue rather than protective. These data indicate the existence of a specialized population of CD11b⁺Ly6C⁺Ly6G⁺ cells that infiltrates a site of virus infection late and protects the infected tissue from immune-mediated damage via production of reactive oxygen species. Regulation of the action of this population of cells may provide an intervention to prevent innate immune-mediated tissue destruction.
Kadin, Marshall E.; Pavlov, Igor; Delgado, Julio C.; Vonderheid, Eric C.
2011-01-01
Histopathology alone cannot predict outcome of patients with CD30+ primary cutaneous lymphoproliferative disorders (CD30CLPD) and early mycosis fungoides (MF). To test the hypothesis that serum cytokines/cytokine receptors provide prognostic information in these disorders, we measured soluble CD30 (sCD30), sCD25, and selected cytokines in cell cultures and sera of 116 patients with CD30CLPD and 96 patients with early MF followed up to 20 years. Significant positive correlation was found between sCD30 levels and sCD25, CD40L, IL-6, and IL-8, suggesting CD30+ neoplastic cells secrete these cytokines, but not Th2 cytokines. In vitro studies confirmed sCD30, sCD25, IL-6 and IL-8 are secreted by CD30CLPD-derived cell lines. CD30CLPD patients with above normal sCD30 and sCD25 had worse overall and disease-related survivals, but only sCD30 retained significance in Cox models that included advanced age. High sCD30 also identified patients with worse survival in early MF. Increased IL-6 and IL-8 correlated with poor disease-related survival in CD30CLPD patients, We conclude that: (1) neoplastic cells of some CD30CLPD patients do not resemble Th2 cells, (2) high serum sCD30, sCD25, IL-6, and perhaps IL-8 levels may provide prognostic information useful for patient management. PMID:22071475
Arai, Ayako; Yamaguchi, Takeshi; Komatsu, Honami; Imadome, Ken-Ichi; Kurata, Morito; Nagata, Kaoru; Miura, Osamu
2014-01-01
A 22-year-old male was admitted for a sustained fever of 2 months, lymphadenopathy, and liver dysfunction. Anti-VCA-IgM antibody was positive, with elevated Epstein-Barr virus (EBV)-DNA load in the peripheral blood. Liver biopsy revealed infiltration of CD8-positive and EBV-positive cells. Most peripheral blood mononuclear cells (PBMCs) were also positive for CD8, and showed detectable levels of EBV-DNA. Monoclonal proliferation of EBV-infected cells was detected in the PBMCs by Southern blotting for EBV-terminal repeat (EBV-TR). Although EBV-positive T-cell lymphoproliferative disease (EBV-T-LPD) was suspected, the symptoms spontaneously resolved within 12 months. Anti-VCA-IgM antibody and the clonal band of EBV-TR were negative 1 year after the onset, while anti-EBNA antibody was positive. The final diagnosis was thus confirmed as infectious mononucleosis (IM). Our results indicate that EBV-infected CD8-positive cells and clonal proliferation of EBV-infected cells may be temporally detected in IM. EBV-T-LPDs should be carefully excluded in such cases.
DEFF Research Database (Denmark)
Gad, Monika; Pedersen, Anders Elm; Kristensen, Nanna N
2004-01-01
Unfractionated CD4+ T cells from the gut-associated lymphoid tissue (GALT) and peripheral lymph nodes are unresponsive when exposed to enterobacterial antigens in vitro. Under similar conditions, CD4+ T cells depleted in vivo or in vitro of CD4+CD25+ T cells proliferate extensively. The CD4+CD25- T...
Energy Technology Data Exchange (ETDEWEB)
Khlifi, Rim, E-mail: rimkhlifi@yahoo.fr [Marine Ecotoxicology, UR 09-03, Sfax University, IPEIS, BP 805, 3018 Sfax (Tunisia); Bioinformatics Unit, Centre of Biotechnology of Sfax, BP 1177, 3018 Sfax (Tunisia); Olmedo, Pablo; Gil, Fernando [Department of Legal Medicine and Toxicology, University of Granada (Spain); Hammami, Bouthaina; Chakroun, Amine [Department of Otorhinolaryngology, HUC Habib Borguiba Hospital, Sfax (Tunisia); Rebai, Ahmed [Bioinformatics Unit, Centre of Biotechnology of Sfax, BP 1177, 3018 Sfax (Tunisia); Hamza-Chaffai, Amel [Marine Ecotoxicology, UR 09-03, Sfax University, IPEIS, BP 805, 3018 Sfax (Tunisia)
2013-05-01
Chronic exposure to heavy metals has long been recognized as being capable to increase head and neck cancer incidence among exposed human populations. Head and neck cancer is a significant public health issue in Tunisia. The aim of the present study was to evaluate the concentrations of As, Cd, Cr and Ni in healthy and tumor tissues of head and neck cancer patients. Metal concentrations were determined in tumor and healthy tissues of 101 head and neck cancer patients, using Atomic Absorption Spectrometry. The As, Cd, Cr, and Ni levels in tumor tissues were 3.4, 2.5, 1.3 and 1.5 times higher than those of healthy tissues (p < 0.05), respectively. Tumor tissue metal levels were higher in men than in women. As and Cd levels in tumor and healthy tissue samples of patients smokers are significantly higher than those of non-smokers (p < 0.05). A strong effect of cumulative smoking as expressed in the number of pack per year, and tumor tissue Cd levels were positively associated with three groups of age (< 40, 51–60 and > 60 years) in both never-smokers and ever-smokers (< 20 and ≥ 20 pack per year). Healthy tissue Cd levels were negatively associated with age in those three groups of smokers. The highest Cd and Cr concentrations among both workers and non-workers were observed in tumor tissues. The Cd and Cr in tissues of farmers, bricklayers and painters were all significantly higher among the workers as compared with the non-workers group. Tissue metal levels have increased due to smoking and occupational exposure. Heavy metal exposure via tobacco smoking and occupational exposures may increase the risk of head and neck in the Tunisian population. - Highlights: ► Heavy metal levels in tumor tissues were higher than those in healthy tissues. ► Tumor tissue Cd levels were positively associated with age in smokers. ► Tumor tissue metal levels were higher in men than in women. ► The highest Cd and Cr concentrations among workers were observed in tumor tissues
Iqbal, Asif J; McNeill, Eileen; Kapellos, Theodore S; Regan-Komito, Daniel; Norman, Sophie; Burd, Sarah; Smart, Nicola; Machemer, Daniel E W; Stylianou, Elena; McShane, Helen; Channon, Keith M; Chawla, Ajay; Greaves, David R
2014-10-09
The recruitment of monocytes and their differentiation into macrophages at sites of inflammation are key events in determining the outcome of the inflammatory response and initiating the return to tissue homeostasis. To study monocyte trafficking and macrophage differentiation in vivo, we have generated a novel transgenic reporter mouse expressing a green fluorescent protein (GFP) under the control of the human CD68 promoter. CD68-GFP mice express high levels of GFP in both monocyte and embryo-derived tissue resident macrophages in adult animals. The human CD68 promoter drives GFP expression in all CD115(+) monocytes of adult blood, spleen, and bone marrow; we took advantage of this to directly compare the trafficking of bone marrow-derived CD68-GFP monocytes to that of CX3CR1(GFP) monocytes in vivo using a sterile zymosan peritonitis model. Unlike CX3CR1(GFP) monocytes, which downregulate GFP expression on differentiation into macrophages in this model, CD68-GFP monocytes retain high-level GFP expression for 72 hours after differentiation into macrophages, allowing continued cell tracking during resolution of inflammation. In summary, this novel CD68-GFP transgenic reporter mouse line represents a powerful resource for analyzing monocyte mobilization and monocyte trafficking as well as studying the fate of recruited monocytes in models of acute and chronic inflammation. © 2014 by The American Society of Hematology.
19 CFR 146.26 - System review.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...
22 CFR 146.525 - Fringe benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...
Directory of Open Access Journals (Sweden)
Keith A Russell
Full Text Available Mesenchymal stromal cells (MSC hold promise for both cell replacement and immune modulation strategies owing to their progenitor and non-progenitor functions, respectively. Characterization of MSC from different sources is an important and necessary step before clinical use of these cells is widely adopted. Little is known about the biology and function of canine MSC compared to their mouse or human counterparts. This knowledge-gap impedes development of canine evidence-based MSC technologies.We hypothesized that canine adipose tissue (AT and bone marrow (BM MSC (derived from the same dogs will have similar differentiation and immune modulatory profiles. Our objectives were to evaluate progenitor and non-progenitor functions as well as other characteristics of AT- and BM-MSC including 1 proliferation rate, 2 cell surface marker expression, 3 DNA methylation levels, 4 potential for trilineage differentiation towards osteogenic, adipogenic, and chondrogenic cell fates, and 5 immunomodulatory potency in vitro.1 AT-MSC proliferated at more than double the rate of BM-MSC (population doubling times in days for passage (P 2, AT: 1.69, BM: 3.81; P3, AT: 1.80, BM: 4.06; P4, AT: 2.37, BM: 5.34; P5, AT: 3.20, BM: 7.21. 2 Canine MSC, regardless of source, strongly expressed cell surface markers MHC I, CD29, CD44, and CD90, and were negative for MHC II and CD45. They also showed moderate expression of CD8 and CD73 and mild expression of CD14. Minor differences were found in expression of CD4 and CD34. 3 Global DNA methylation levels were significantly lower in BM-MSC compared to AT-MSC. 4 Little difference was found between AT- and BM-MSC in their potential for adipogenesis and osteogenesis. Chondrogenesis was poor to absent for both sources in spite of adding varying levels of bone-morphogenic protein to our standard transforming growth factor (TGF-β3-based induction medium. 5 Immunomodulatory capacity was equal regardless of cell source when tested in
International Nuclear Information System (INIS)
Sawada, Keigo; Takedachi, Masahide; Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki; Lee, Chun Man; Okura, Hanayuki; Matsuyama, Akifumi; Kitamura, Masahiro; Murakami, Shinya
2015-01-01
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation
Energy Technology Data Exchange (ETDEWEB)
Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)
2015-08-14
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.
Characterization of osteoclasts derived from CD14+ monocytes isolated from peripheral blood
DEFF Research Database (Denmark)
Sørensen, Mette Grøndahl; Henriksen, Kim; Schaller, Sophie
2007-01-01
Bone resorption is solely mediated by osteoclasts. Therefore, a pure osteoclast population is of high interest for the investigation of biological aspects of the osteoclasts, such as the direct effect of growth factors and hormones, as well as for testing and characterizing inhibitors of bone...... resorption. We have established a pure, stable, and reproducible system for purification of human osteoclasts from peripheral blood. We isolated CD14-positive (CD14+) monocytes using anti-CD14-coated beads. After isolation, the monocytes are differentiated into mature osteoclasts by stimulation...... of osteoclast precursors. No expression of osteoclast markers was observed in the absence of RANKL, whereas RANKL dose-dependently induced the expression of cathepsin K, tartrate-resistant acid phosphatase (TRACP), and matrix metallo proteinase (MMP)-9. Furthermore, morphological characterization of the cells...
21 CFR 146.140 - Pasteurized orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...
Myocardial regeneration potential of adipose tissue-derived stem cells
Energy Technology Data Exchange (ETDEWEB)
Bai, Xiaowen, E-mail: baixw01@yahoo.com [Department of Molecular Pathology, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe, Houston, TX 77030 (United States); Alt, Eckhard, E-mail: ealt@mdanderson.org [Department of Molecular Pathology, The University of Texas M.D. Anderson Cancer Center, 1515 Holcombe, Houston, TX 77030 (United States)
2010-10-22
Research highlights: {yields} Various tissue resident stem cells are receiving tremendous attention from basic scientists and clinicians and hold great promise for myocardial regeneration. {yields} For practical reasons, human adipose tissue-derived stem cells are attractive stem cells for future clinical application in repairing damaged myocardium. {yields} This review summarizes the characteristics of cultured and freshly isolated stem cells obtained from adipose tissue, their myocardial regeneration potential and the, underlying mechanisms, and safety issues. -- Abstract: Various tissue resident stem cells are receiving attention from basic scientists and clinicians as they hold promise for myocardial regeneration. For practical reasons, adipose tissue-derived stem cells (ASCs) are attractive cells for clinical application in repairing damaged myocardium based on the following advantages: abundant adipose tissue in most patients and easy accessibility with minimally invasive lipoaspiration procedure. Several recent studies have demonstrated that both cultured and freshly isolated ASCs could improve cardiac function in animal model of myocardial infarction. The mechanisms underlying the beneficial effect of ASCs on myocardial regeneration are not fully understood. Growing evidence indicates that transplantation of ASCs improve cardiac function via the differentiation into cardiomyocytes and vascular cells, and through paracrine pathways. Paracrine factors secreted by injected ASCs enhance angiogenesis, reduce cell apoptosis rates, and promote neuron sprouts in damaged myocardium. In addition, Injection of ASCs increases electrical stability of the injured heart. Furthermore, there are no reported cases of arrhythmia or tumorigenesis in any studies regarding myocardial regeneration with ASCs. This review summarizes the characteristics of both cultured and freshly isolated stem cells obtained from adipose tissue, their myocardial regeneration potential, and the
Myocardial regeneration potential of adipose tissue-derived stem cells
International Nuclear Information System (INIS)
Bai, Xiaowen; Alt, Eckhard
2010-01-01
Research highlights: → Various tissue resident stem cells are receiving tremendous attention from basic scientists and clinicians and hold great promise for myocardial regeneration. → For practical reasons, human adipose tissue-derived stem cells are attractive stem cells for future clinical application in repairing damaged myocardium. → This review summarizes the characteristics of cultured and freshly isolated stem cells obtained from adipose tissue, their myocardial regeneration potential and the, underlying mechanisms, and safety issues. -- Abstract: Various tissue resident stem cells are receiving attention from basic scientists and clinicians as they hold promise for myocardial regeneration. For practical reasons, adipose tissue-derived stem cells (ASCs) are attractive cells for clinical application in repairing damaged myocardium based on the following advantages: abundant adipose tissue in most patients and easy accessibility with minimally invasive lipoaspiration procedure. Several recent studies have demonstrated that both cultured and freshly isolated ASCs could improve cardiac function in animal model of myocardial infarction. The mechanisms underlying the beneficial effect of ASCs on myocardial regeneration are not fully understood. Growing evidence indicates that transplantation of ASCs improve cardiac function via the differentiation into cardiomyocytes and vascular cells, and through paracrine pathways. Paracrine factors secreted by injected ASCs enhance angiogenesis, reduce cell apoptosis rates, and promote neuron sprouts in damaged myocardium. In addition, Injection of ASCs increases electrical stability of the injured heart. Furthermore, there are no reported cases of arrhythmia or tumorigenesis in any studies regarding myocardial regeneration with ASCs. This review summarizes the characteristics of both cultured and freshly isolated stem cells obtained from adipose tissue, their myocardial regeneration potential, and the underlying
Hori, Yuichi; Fukumoto, Miki; Kuroda, Yoshikazu
2008-11-01
Success in islet transplantation-based therapies for type 1 diabetes mellitus and an extreme shortage of pancreatic islets have motivated recent efforts to develop renewable sources of islet-replacement tissue. Although pancreatic progenitor cells hold a promising potential, only a few attempts have been made at the prospective isolation of pancreatic stem/progenitor cells, because of the lack of specific markers and the development of effective cell culture methods. We found that prominin1 (also known as CD133) recognized the undifferentiated epithelial cells, whereas platelet-derived growth factor receptor beta (PDGFRbeta) was expressed on the mesenchymal cells in the mouse embryonic pancreas. We then developed an isolation method for putative stem/progenitor cells by flow cytometric cell sorting and characterized their potential for differentiation to pancreatic tissue using both in vitro and in vivo protocols. Flow cytometry and the subsequent reverse transcription-polymerase chain reaction and microarray analysis revealed pancreatic epithelial progenitor cells to be highly enriched in the prominin1(high)PDGFRbeta(-) cell population. During in vivo differentiation, these cell populations were able to differentiate into endocrine, exocrine, and ductal tissues, including the formation of an insulin-producing cell cluster. We established the prospective isolation of putative pancreatic epithelial progenitor cells by sorting for prominin1 and PDGFRbeta. Since this strategy is based on the cell surface markers common to human and rodents, these findings may lead to the development of new strategies to derive transplantable islet-replacement tissues from human pancreatic stem/progenitor cells. Disclosure of potential conflicts of interest is found at the end of this article.
Trophic transfer of Cd from duckweed (Lemna minor L.) to tilapia (Oreochromis mossambicus).
Xue, Yan; Peijnenburg, Willie J G M; Huang, Jin; Wang, Dengjun; Jin, Yan
2018-05-01
The transfer of the toxic heavy metal Cd from duckweed (Lemna minor L.) to the freshwater fish tilapia (Oreochromis mossambicus) was investigated. Concentrations of Cd in different chemical forms in duckweed and in different tissues (gut, edible muscle, and remnants or residual) of tilapia (i.e., ethanol-extractable fraction [F E ], HCl-extractable fraction [F HCl ], and residual fraction [F R ]) were quantified, and the bioaccumulation factors (BAFs) of Cd in the tilapia body were calculated. Simple linear regression analysis was used to unravel the correlation and accumulation mechanisms of Cd along the short food chain. Our results showed that with increasing exposure concentrations of Cd (0-50 μM for duckweed and 0-10 μM for tilapia), the total, F E (F e,d )-, F HCl (F h,d )-, and F R (F r,d )-Cd concentrations in duckweed and different tissues of tilapia increased progressively. The Cd sources (aqueous or dietary) influenced the BAF for Cd accumulation in the whole body of tilapia. Furthermore, regression analyses yielded significant positive correlations (R 2 > 0.96) between the Cd concentration in duckweed and in both the 3 parts and the whole body of tilapia. This finding suggests that Cd transfer from duckweed to tilapia can be quantitatively evaluated when tilapia is exposed only to duckweed. In addition, the linear regression between Cd accumulation in whole tilapia and F e,d -, F h,d -, and F r,d -Cd showed that particularly the correlation with F e,d -Cd is statistically significant (p < 0.001). The accumulated Cd concentrations and chemical forms in tilapia tissues also positively correlated with Cd sources (solution or duckweed). Compared with waterborne exposure only, duckweed especially increased the accumulation of Cd in the gut of tilapia. Taken together, our findings support a strong dependence of Cd accumulation and transfer from duckweed to tilapia on its chemical forms, especially on F e,d -Cd. This knowledge may expedite more
Shi, Yunfei; Deng, Lijuan; Song, Yuqin; Lin, Dongmei; Lai, Yumei; Zhou, LiXin; Yang, Lei; Li, Xianghong
2018-05-10
To investigate the prognostic value of tumor-infiltrating T-cell density and programmed cell death ligand-1 (PD-L1) expression in diffuse large B cell lymphoma (DLBCL). One-hundred-twenty-five Chinese DLBCL patients were enrolled in our study and provided samples; 76 of all cases were treated with rituximab (R). Tumor tissues were immunostained and analyzed for CD3+ and CD8+ tumor-infiltrating T-cell density, tumoral PD-L1, and microenvironmental PD-L1 (mPD-L1). The density of CD3 was rated as high in 33.6% cases, while 64.0% of DLBCLs were classified as high CD8 density. Of all cases, 16.8% were PD-L1+. Of the remaining PD-L1-DLBCLs, 29.8% positively expressed mPD-L1. Both CD3 high density and CD8 high density were associated with mPD-L1 positivity (P = 0.001 and P = 0.0001). In multivariate analysis, independently, high CD3 density predicted better OS (P = 0.023), while CD8 high density and PD-L1 positivity were both associated with prolonged PFS (P = 0.013 and P = 0.036, respectively). Even in the subgroup treated with R, univariate analyses indicated that high CD3 density and PD-L1 positivity were associated with better OS (P = 0.041) and PFS (P = 0.033), respectively. The infiltrating densities of CD3+ T-cells, CD8+ T-cells, and PD-L1 expression are predictive of survival in DLBCLs, irrespective of R usage.
Directory of Open Access Journals (Sweden)
Yongkang Wu
2014-01-01
Full Text Available Background & objectives: The presence of CD4+CD8+ (double positive T cells (DPT in the target organs of several autoimmune diseases has been reported. The aim of this study was to investigate the pathogenic role of DPT in systemic lupus erythematosus (SLE. Methods: A total of 175 SLE cases and 125 matched healthy controls were investigated for CD3+, CD4+, CD8+ lymphocytes and DPT by flow cytometry. Serum samples from SLE patients and controls were tested for antinuclear antibody (ANA, anti-double strain deoxyribonucleic acid (anti-dsDNA, anti-U1 ribonucleoprotein (anti-U1 RNP, anti-sjogren syndrome A (anti-SSA, anti-ribosomal P protein (anti-rib-P, anti-Smith (anti-Sm, anti-Sjogren syndrome B (anti-SSB, complement 3 (C3 and complement 4 (C4. Results: The DPT median and 5-95 per cent range of SLE cases and healthy controls were 0.50 [0.10-2.60] and 0.80 [0.20-2.74] respectively (P<0.001. SLE patients were divided into a ≥1:1000 subgroup and a <1:1000 subgroup according to the ANA titre. The DPT of the former subgroup was significantly lower than that of the latter (P=0.032. The DPT medians of positive subgroups with anti-dsDNA (P<0.001, anti-U1RNP (P=0.018, anti-SSA (P=0.021 or anti-rib-P (P=0.039 were also significantly lower than the negative subgroups. Likewise, DPT was significantly lower in SLE subgroups with low concentration of C3 or C4 than those with high concentration (P<0.006. Interpretation & conclusions: Our findings show that the DPT cells may play a key suppressive role in the production of autoantibodies in SLE. Direct evidence that DPT regulates the pathogenesis of SLE needs to be investigated in future work.
Matsuoka, Yoshikazu; Takahashi, Masaya; Sumide, Keisuke; Kawamura, Hiroshi; Nakatsuka, Ryusuke; Fujioka, Tatsuya; Sonoda, Yoshiaki
2017-06-09
In the murine hematopoietic stem cell (HSC) compartment, thrombopoietin (THPO)/MPL (THPO receptor) signaling plays an important role in the maintenance of adult quiescent HSCs. However, the role of THPO/MPL signaling in the human primitive HSC compartment has not yet been elucidated. We have identified very primitive human cord blood (CB)-derived CD34- severe combined immunodeficiency (SCID)-repopulating cells (SRCs) using the intra-bone marrow injection method. In this study, we investigated the roles of the MPL expression in the human primitive HSC compartment. The SRC activities of the highly purified CB-derived 18Lin-CD34+/-MPL+/- cells were analyzed using NOG mice. In the primary recipient mice, nearly all mice that received CD34+/-MPL+/- cells were repopulated with human CD45+ cells. Nearly all of these mice that received CD34+MPL+/- and CD34-MPL- cells showed a secondary repopulation. Interestingly, the secondary recipient mice that received CD34+/-MPL- cells showed a distinct tertiary repopulation. These results clearly indicate that the CD34+/- SRCs not expressing MPL sustain a long-term (LT) (>1 year) human cell repopulation in NOG mice. Moreover, CD34- SRCs generate CD34+CD38-CD90+ SRCs in vitro and in vivo. These findings provide a new concept that CD34-MPL- SRCs reside at the apex of the human HSC hierarchy.
Peng, Liu-Sheng; Mao, Fang-Yuan; Zhao, Yong-Liang; Wang, Ting-Ting; Chen, Na; Zhang, Jin-Yu; Cheng, Ping; Li, Wen-Hua; Lv, Yi-Pin; Teng, Yong-Sheng; Guo, Gang; Luo, Ping; Chen, Weisan; Zou, Quan-Ming; Zhuang, Yuan
2016-08-23
CD3+CD56+ natural killer T (NKT)-like cells are a group of CD3+ T cells sharing characteristics of NK and T cells and constitute a major component of host anti-tumor immune response in human cancer. However, the nature, function and clinical relevance of CD3+CD56+ NKT-like cells in human gastric cancer (GC) remain unclear. In this study, we showed that the frequencies of CD3+CD56+NKT-like cells in GC tumors were significantly decreased and low levels of tumor-infiltrating CD3+CD56+ NKT-like cells were positively correlated with poor survival and disease progression. Most CD3+CD56+NKT-like cells in GC tumors were CD45RA-CD27+/- central/effector-memory cells with decreased activity and lower expression levels of CD69, NKG2D and DNAM-1 than those in non-tumor tissues. We further observed that tumor-infiltrating CD3+CD56+ NKT-like cells had impaired effector function as shown by decreased IFN-γ, TNF-α, granzyme B and Ki-67 expression. Moreover, in vitro studies showed that soluble factors released from GC tumors could induce the functional impairment of CD3+CD56+ NKT-like cells. Collectively, our data indicate that decreased tumor-infiltrating CD3+CD56+ NKT-like cells with impaired effector function are associated with tumor progression and poor survival of GC patients, which may contribute to immune escape of GC.
19 CFR 146.3 - Customs supervision.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...
International Nuclear Information System (INIS)
Waegeneers, Nadia; Ruttens, Ann; De Temmerman, Ludwig
2011-01-01
A chain model was developed to calculate the flow of cadmium from soil, drinking water and feed towards bovine tissues. The data used for model development were tissue Cd concentrations of 57 bovines and Cd concentrations in soil, feed and drinking water, sampled at the farms were the bovines were reared. Validation of the model occurred with a second set of measured tissue Cd concentrations of 93 bovines of which age and farm location were known. The exposure part of the chain model consists of two parts: (1) a soil-plant transfer model, deriving cadmium concentrations in feed from basic soil characteristics (pH and organic matter content) and soil Cd concentrations, and (2) bovine intake calculations, based on typical feed and water consumption patterns for cattle and Cd concentrations in feed and drinking water. The output of the exposure model is an animal-specific average daily Cd intake, which is then taken forward to a kinetic uptake model in which time-dependent Cd concentrations in bovine tissues are calculated. The chain model was able to account for 65%, 42% and 32% of the variation in observed kidney, liver and meat Cd concentrations in the validation study. - Research highlights: → Cadmium transfer from soil, drinking water and feed to bovine tissues was modeled. → The model was based on 57 bovines and corresponding feed and soil Cd concentrations. → The model was validated with an independent data set of 93 bovines. → The model explained 65% of variation in kidney Cd in the validation study.
21 CFR 146.137 - Frozen orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...
21 CFR 146.145 - Orange juice from concentrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...
Posttransplantation primary cutaneous CD30 (Ki-1)-positive large-cell lymphoma.
Seçkin, D; Demirhan, B; Oğuz Güleç, T; Arikan, U; Haberal, M
2001-12-01
We describe the case of a 51-year-old female renal transplant recipient with primary cutaneous CD30-positive large-cell lymphoma of T-cell origin. Cutaneous T-cell lymphomas are rarely reported in organ transplant recipients, and we believe they should be considered in the differential diagnosis of cutaneous neoplastic and infectious diseases affecting this patient group.
Expressions of ABCG2, CD133, and Podoplanin in Salivary Adenoid Cystic Carcinoma
Directory of Open Access Journals (Sweden)
Wuwei Li
2014-01-01
Full Text Available Adenoid cystic carcinoma (ACC is one of the most common salivary gland malignant tumors with a high risk of recurrence and metastasis. Current studies on cancer stem cells (CSCs have verified that CSCs are the driving force behind tumor initiation and progression, suggesting that new cancer therapies may be established by effectively targeting and killing the CSCs. The primary goal of this study is to investigate the expression patterns of ABCG2, CD133, and podoplanin in ACC of minor salivary glands by immunohistochemistry analysis. We found that ABCG2 was weakly expressed in normal looking salivary gland tissues. A significant upregulation of ABCG2 expression in ACC was observed with a similar expression pattern of Ki-67. CD133 was detected in apical membrane of epithelial cells and podoplanin was expressed positively in myoepithelial cells of both normal looking tissue and ACC. However, no significant difference was found of the expression pattern of CD133 and podoplanin between normal looking tissues and ACC. Our observations suggest that CSCs may exist in quiescent cells with ABCG2 positive staining, which are surrounded by cells with positive expression of ABCG2 and Ki-67 in ACC, and costaining with ABCG2 and Ki-67 may help predict the location of CSCs.
DEFF Research Database (Denmark)
Bauer, Matthias; Meyer, Morten; Brevig, Thomas
2002-01-01
Transplantation of dopaminergic ventral mesencephalic (VM) tissue into the basal ganglia of patients with Parkinson's disease (PD) shows at best moderate symptomatic relief in some of the treated cases. Experimental animal studies and clinical trials with allogenic and xenogenic pig-derived VM...... tissue grafts to PD patients indicate that one reason for the poor outcome of neural transplantation is the low survival and differentiation of grafted dopaminergic neurons. To improve dopaminergic cell survival through a gene-therapeutic approach we have established and report here results of lipid-mediated...... numbers of tyrosine hydroxylase-positive neurons in the cultured VM tissue. We conclude that lipid-mediated gene transfer employed on embryonic pig VM explant cultures is a safe and effective method to improve survival of dopaminergic neurons and may become a valuable tool to improve allo...
Directory of Open Access Journals (Sweden)
Noemí Eiró
Full Text Available Tumors are infiltrated by macrophages, T and B-lymphocytes, which may favor tumor development by promoting angiogenesis, growth and invasion. The aim of this study was to investigate the clinical relevance of the relative amount of macrophages (CD68⁺, T-cells (CD3⁺ and B-cells (CD20⁺ at the invasive front of breast carcinomas, and the expression of matrix metalloproteases (MMPs and their inhibitors (TIMPs either at the invasive front or at the tumor center. We performed an immunohistochemical study counting CD3, CD20 and CD68 positive cells at the invasive front, in 102 breast carcinomas. Also, tissue sections were stained with MMP-2, -9, -11, -14 and TIMP-2 antibodies, and immunoreactivity location, percentage of reactive area and intensity were determined at the invasive front and at the tumor center. The results showed that an increased CD68 count and CD68/(CD3+CD20 ratio were directly associated with both MMP-11 and TIMP-2 expression by mononuclear inflammatory cells at the tumor center (p = 0.041 and p = 0.025 for CD68 count and p = 0.001 and p = 0.045 for ratio, respectively for MMP-11 and TIMP-2. In addition, a high CD68/(CD3+CD20 ratio (>0.05 was directly associated with a higher probability of shortened relapse-free survival. Multivariate analysis revealed that CD68/(CD3+CD20 ratio was an independent factor associated with distant relapse-free survival (RR: 2.54, CI: (1.23-5.24, p<0.01. Therefore, CD68/(CD3+CD20 ratio at the invasive front could be used as an important prognostic marker.
Marine-derived collagen biomaterials from echinoderm connective tissues
Ferrario, Cinzia; Leggio, Livio; Leone, Roberta; Di Benedetto, Cristiano; Guidetti, Luca; Coccè , Valentina; Ascagni, Miriam; Bonasoro, Francesco; La Porta, Caterina A.M.; Candia Carnevali, M. Daniela; Sugni, Michela
2016-01-01
The use of marine collagens is a hot topic in the field of tissue engineering. Echinoderms possess unique connective tissues (Mutable Collagenous Tissues, MCTs) which can represent an innovative source of collagen to develop collagen barrier-membranes for Guided Tissue Regeneration (GTR). In the present work we used MCTs from different echinoderm models (sea urchin, starfish and sea cucumber) to produce echinoderm-derived collagen membranes (EDCMs). Commercial membranes for GTR or soluble/reassembled (fibrillar) bovine collagen substrates were used as controls. The three EDCMs were similar among each other in terms of structure and mechanical performances and were much thinner and mechanically more resistant than the commercial membranes. Number of fibroblasts seeded on sea-urchin membranes were comparable to the bovine collagen substrates. Cell morphology on all EDCMs was similar to that of structurally comparable (reassembled) bovine collagen substrates. Overall, echinoderms, and sea urchins particularly, are alternative collagen sources to produce efficient GTR membranes. Sea urchins display a further advantage in terms of eco-sustainability by recycling tissues from food wastes.
Marine-derived collagen biomaterials from echinoderm connective tissues
Ferrario, Cinzia
2016-03-31
The use of marine collagens is a hot topic in the field of tissue engineering. Echinoderms possess unique connective tissues (Mutable Collagenous Tissues, MCTs) which can represent an innovative source of collagen to develop collagen barrier-membranes for Guided Tissue Regeneration (GTR). In the present work we used MCTs from different echinoderm models (sea urchin, starfish and sea cucumber) to produce echinoderm-derived collagen membranes (EDCMs). Commercial membranes for GTR or soluble/reassembled (fibrillar) bovine collagen substrates were used as controls. The three EDCMs were similar among each other in terms of structure and mechanical performances and were much thinner and mechanically more resistant than the commercial membranes. Number of fibroblasts seeded on sea-urchin membranes were comparable to the bovine collagen substrates. Cell morphology on all EDCMs was similar to that of structurally comparable (reassembled) bovine collagen substrates. Overall, echinoderms, and sea urchins particularly, are alternative collagen sources to produce efficient GTR membranes. Sea urchins display a further advantage in terms of eco-sustainability by recycling tissues from food wastes.
Abdel-Mohsen, Mohamed; Kuri-Cervantes, Leticia; Grau-Exposito, Judith; Spivak, Adam M; Nell, Racheal A; Tomescu, Costin; Vadrevu, Surya Kumari; Giron, Leila B; Serra-Peinado, Carla; Genescà, Meritxell; Castellví, Josep; Wu, Guoxin; Del Rio Estrada, Perla M; González-Navarro, Mauricio; Lynn, Kenneth; King, Colin T; Vemula, Sai; Cox, Kara; Wan, Yanmin; Li, Qingsheng; Mounzer, Karam; Kostman, Jay; Frank, Ian; Paiardini, Mirko; Hazuda, Daria; Reyes-Terán, Gustavo; Richman, Douglas; Howell, Bonnie; Tebas, Pablo; Martinez-Picado, Javier; Planelles, Vicente; Buzon, Maria J; Betts, Michael R; Montaner, Luis J
2018-04-18
The persistence of HIV reservoirs, including latently infected, resting CD4 + T cells, is the major obstacle to cure HIV infection. CD32a expression was recently reported to mark CD4 + T cells harboring a replication-competent HIV reservoir during antiretroviral therapy (ART) suppression. We aimed to determine whether CD32 expression marks HIV latently or transcriptionally active infected CD4 + T cells. Using peripheral blood and lymphoid tissue of ART-treated HIV + or SIV + subjects, we found that most of the circulating memory CD32 + CD4 + T cells expressed markers of activation, including CD69, HLA-DR, CD25, CD38, and Ki67, and bore a T H 2 phenotype as defined by CXCR3, CCR4, and CCR6. CD32 expression did not selectively enrich for HIV- or SIV-infected CD4 + T cells in peripheral blood or lymphoid tissue; isolated CD32 + resting CD4 + T cells accounted for less than 3% of the total HIV DNA in CD4 + T cells. Cell-associated HIV DNA and RNA loads in CD4 + T cells positively correlated with the frequency of CD32 + CD69 + CD4 + T cells but not with CD32 expression on resting CD4 + T cells. Using RNA fluorescence in situ hybridization, CD32 coexpression with HIV RNA or p24 was detected after in vitro HIV infection (peripheral blood mononuclear cell and tissue) and in vivo within lymph node tissue from HIV-infected individuals. Together, these results indicate that CD32 is not a marker of resting CD4 + T cells or of enriched HIV DNA-positive cells after ART; rather, CD32 is predominately expressed on a subset of activated CD4 + T cells enriched for transcriptionally active HIV after long-term ART. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Coplanar-grid CdZnTe detector with three-dimensional position sensitivity
International Nuclear Information System (INIS)
Luke, P.N.; Amman, M.; Lee, J.S.; Yaver, H.
1998-06-01
A 3-dimensional position-sensitive coplanar-grid detector design for use with compound semiconductors is described. This detector design maintains the advantage of a coplanar-grid detector in which good energy resolution can be obtained from materials with poor charge transport. Position readout in two dimensions is accomplished using proximity-sensing electrodes adjacent to the electron-collecting grid electrode of the detector. Additionally, depth information is obtained by taking the ratio of the amplitudes of the collecting grid signal and the cathode signal. Experimental results from a prototype CdZnTe detector are presented
Tissue-resident memory T cells in tissue homeostasis, persistent infection, and cancer surveillance.
Gebhardt, Thomas; Palendira, Umaimainthan; Tscharke, David C; Bedoui, Sammy
2018-05-01
A large proportion of memory T cells disseminated throughout the body are non-recirculating cells whose maintenance and function is regulated by tissue-specific environmental cues. These sessile cells are referred to as tissue-resident memory T (T RM ) cells and similar populations of non-recirculating cells also exist among unconventional T cells and innate lymphocyte cells. The pool of T RM cells is highly diverse with respect to anatomical positioning, phenotype, molecular regulation and effector function. Nevertheless, certain transcriptional programs are shared and appear as important unifying features for the overall population of T RM cells and tissue-resident lymphocytes. It is now widely appreciated that T RM cells are a critical component of our immune defense by acting as peripheral sentinels capable of rapidly mobilizing protective tissue immunity upon pathogen recognition. This function is of particular importance in anatomical sites that are not effectively surveilled by blood-borne memory T cells in absence of inflammation, such as neuronal tissues or epithelial compartments in skin and mucosae. Focusing on the well-characterized subtype of CD8 + CD69 + CD103 + T RM cells, we will review current concepts on the generation, persistence and function of T RM cells and will summarize commonly used tools to study these cells. Furthermore, we will discuss accumulating data that emphasize localized T RM responses as an important determinant of tissue homeostasis and immune defense in the context of microbiota-immune interactions, persistent infections and cancer surveillance. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Tansriratanawong, Kallapat; Ishikawa, Hiroshi; Toyomura, Junko; Sato, Soh
2017-10-01
In this study, novel human-derived epithelial-like cells (hEPLCs) lines were established from periodontal ligament (PDL) tissues, which were composed of a variety of cell types and exhibited complex cellular activities. To elucidate the putative features distinguishing these from epithelial rest of Malassez (ERM), we characterized hEPLCs based on cell lineage markers and tight junction protein expression. The aim of this study was, therefore, to establish and characterize hEPLCs lines from PDL tissues. The hEPLCs were isolated from PDL of third molar teeth. Cellular morphology and cell organelles were observed thoroughly. The characteristics of epithelial-endothelial-mesenchymal-like cells were compared in several markers by gene expression and immunofluorescence, to ERM and human umbilical-vein endothelial cells (HUVECs). The resistance between cellular junctions was assessed by transepithelial electron resistance, and inflammatory cytokines were detected by ELISA after infecting hEPLCs with periodontopathic bacteria. The hEPLCs developed into small epithelial-like cells in pavement appearance similar to ERM. However, gene expression patterns and immunofluorescence results were different from ERM and HUVECs, especially in tight junction markers (Claudin, ZO-1, and Occludins), and endothelial markers (vWF, CD34). The transepithelial electron resistance indicated higher resistance in hEPLCs, as compared to ERM. Periodontopathic bacteria were phagocytosed with upregulation of inflammatory cytokine secretion within 24 h. In conclusion, hEPLCs that were derived using the single cell isolation method formed tight multilayers colonies, as well as strongly expressed tight junction markers in gene expression and immunofluorescence. Novel hEPLCs lines exhibited differently from ERM, which might provide some specific functions such as metabolic exchange and defense mechanism against bacterial invasion in periodontal tissue.
Sequential use of human-derived medium supplements favours cardiovascular tissue engineering
Riem Vis, P.W.; Sluijter, J.P.G.; Soekhradj - Soechit, R.S.; Herwerden, van L.A.; Kluin, J.; Bouten, C.V.C.
2012-01-01
For clinical application of tissue engineering strategies, the use of animal-derived serum in culture medium is not recommended, because it can evoke immune responses in patients. We previously observed that human platelet-lysate (PL) is favourable for cell expansion, but generates weaker tissue as
Fan, Yu; Hu, Shuai; Liu, Jie; Xiao, Fei; Li, Xin; Yu, Wei; Cui, Yun; Sun, Mengkui; Lv, Tianjing; He, Qun; Jin, Jie
2014-01-01
Clinical studies suggested thatandrogen might be associated with infiltrating T cells in prostate of benign prostatic hyperplasia (BPH) patients, but detail of T-cell subset and mechanism still remained unclear. The present study tested the hypothesis that intraprostatic 5 α -dihydrotestosterone (DHT) exerts effects on T cells recruitment by BPH epithelial cells. Prostate tissues from 64 cases of BPH patients after transurethral resection of prostate (TURP) were divided into 2 groups: (1) no medication history; (2) administration of 5 α -reductase type II inhibitor-finasteride 5 mg daily for at least 6 months before surgery. Group 2 presented significantly higher CD8+ T cells infiltration than group 1, but no changes in CD4+ T cells (immunohistochemistry and flow cytometry). In vitro study more CD8+ T cell migrated to the prostate tissue lysates from group 2 and BPH-1 cells in low DHT condition. Transcription of chemokine (C-C motif) Ligand 5 (CCL5) mRNA in BPH-1 cells and chemokine (C-C motif) receptor 5 (CCR5) mRNA in CD8+ T cells were upregulated in low DHT condition (q-PCR). CCL5 expression was also identified to be higher in group 2 prostate tissues by IHC. This study suggested that intraprostatic DHT may participate in regulating inflammatory response which was induced by human prostatic epithelial cell, via modulating CCL5 secretion.
Directory of Open Access Journals (Sweden)
Yu Fan
2014-01-01
Full Text Available Clinical studies suggested thatandrogen might be associated with infiltrating T cells in prostate of benign prostatic hyperplasia (BPH patients, but detail of T-cell subset and mechanism still remained unclear. The present study tested the hypothesis that intraprostatic 5α-dihydrotestosterone (DHT exerts effects on T cells recruitment by BPH epithelial cells. Prostate tissues from 64 cases of BPH patients after transurethral resection of prostate (TURP were divided into 2 groups: (1 no medication history; (2 administration of 5α-reductase type II inhibitor-finasteride 5 mg daily for at least 6 months before surgery. Group 2 presented significantly higher CD8+ T cells infiltration than group 1, but no changes in CD4+ T cells (immunohistochemistry and flow cytometry. In vitro study more CD8+ T cell migrated to the prostate tissue lysates from group 2 and BPH-1 cells in low DHT condition. Transcription of chemokine (C-C motif Ligand 5 (CCL5 mRNA in BPH-1 cells and chemokine (C-C motif receptor 5 (CCR5 mRNA in CD8+ T cells were upregulated in low DHT condition (q-PCR. CCL5 expression was also identified to be higher in group 2 prostate tissues by IHC. This study suggested that intraprostatic DHT may participate in regulating inflammatory response which was induced by human prostatic epithelial cell, via modulating CCL5 secretion.
DEFF Research Database (Denmark)
Gjerdrum, Lise Mette; Woetmann, Anders; Ødum, Niels
2008-01-01
for FOXP3 expression in tumour cells and tumour infiltrating Tregs. Labelling of a majority of the neoplastic cells was seen in one case of C-ALCL. Another three cases (one LyP and two C-ALCL) displayed weak labelling of very occasional atypical T-cells. In the remaining 38 cases the atypical lymphoid...... infiltrate was FOXP3 negative. By contrast, all biopsies contained tumour infiltrating FOXP3-positive Tregs. Significant higher numbers were recorded in ALK negative S-ALCL and LyP than in C-ALCL and S-ALCL positive for ALK. In conclusion, it is shown that FOXP3 expression in cutaneous and systemic CD30...
Chaturvedi, Shruti; Cockrell, Erin; Espinola, Ricardo; Hsi, Linda; Fulton, Stacey; Khan, Mohammad; Li, Liang; Fonseca, Fabio; Kundu, Suman; McCrae, Keith R.
2014-01-01
The antiphospholipid syndrome is characterized by venous or arterial thrombosis and/or recurrent fetal loss in the presence of circulating antiphospholipid antibodies. These antibodies cause activation of endothelial and other cell types leading to the release of microparticles with procoagulant and pro-inflammatory properties. The aims of this study were to characterize the levels of endothelial cell, monocyte, platelet derived, and tissue factor-bearing microparticles in patients with antiphospholipid antibodies, to determine the association of circulating microparticles with anticardiolipin and anti-β2-glycoprotein antibodies, and to define the cellular origin of microparticles that express tissue factor. Microparticle content within citrated blood from 47 patients with antiphospholipid antibodies and 144 healthy controls was analyzed within 2 hours of venipuncture. Levels of Annexin-V, CD105 and CD144 (endothelial derived), CD41 (platelet derived) and tissue factor positive microparticles were significantly higher in patients than controls. Though levels of CD14 (monocyte-derived) microparticles in patient plasma were not significantly increased, increased levels of CD14 and tissue factor positive microparticles were observed in patients. Levels of microparticles that stained for CD105 and CD144 showed a positive correlation with IgG (R = 0.60, p=0.006) and IgM anti-beta2-glycoprotein I antibodies (R=0.58, p=0.006). The elevation of endothelial and platelet derived microparticles in patients with APS and their correlation with anti-β2-glycoprotein I antibodies suggests a chronic state of vascular cell activation in these individuals and an important role for β2-glycoprotein I in development of the pro-thrombotic state associated with antiphospholipid antibodies. PMID:25467081
Revision washout decreases implant capsule tissue culture positivity: a multicenter study.
Henry, Gerard D; Carson, Culley C; Wilson, Steven K; Wiygul, Jeremy; Tornehl, Chris; Cleves, Mario A; Simmons, Caroline J; Donatucci, Craig F
2008-01-01
Positive cultures, visible biofilm and confocal micrography confirm bacterial presence on clinically uninfected inflatable penile prostheses at revision surgery. Salvage irrigation has been proved to rescue patients with clinically infected inflatable penile prostheses. Similar washout at revision for noninfectious reasons significantly lowers subsequent infection rates. We investigated a larger series of patients for positive culture rates and evaluated implant capsule tissue culture rates before and after revision washout. At 4 institutions a total of 148 patients with inflatable penile prostheses underwent revision surgery for noninfectious reasons between June 2001 and September 2005. Swab cultures of the fluid around the pump and visible biofilm were obtained. Also, in 65 patients a wedge of tissue from the capsule that forms around the pump was cultured. After implant removal revision washout of the implant spaces was performed and a second wedge of tissue was cultured. Of the 148 patients 97 (66%) had positive bacterial swab cultures of the fluid around the pump or biofilm. A total of 124 isolates were cultured. Of the 65 implant capsule tissue cultures obtained before washout 28 (43%) were positive for bacteria, while 16 (25%) obtained after revision washout were positive. Positive cultures and visible bacterial biofilm are present on clinically uninfected inflatable penile prostheses at revision surgery in most patients. Revision washout appears to decrease the bacterial load on implant capsule tissue at revision surgery of inflatable penile prostheses for noninfectious reasons.
Automatic approach to deriving fuzzy slope positions
Zhu, Liang-Jun; Zhu, A.-Xing; Qin, Cheng-Zhi; Liu, Jun-Zhi
2018-03-01
Fuzzy characterization of slope positions is important for geographic modeling. Most of the existing fuzzy classification-based methods for fuzzy characterization require extensive user intervention in data preparation and parameter setting, which is tedious and time-consuming. This paper presents an automatic approach to overcoming these limitations in the prototype-based inference method for deriving fuzzy membership value (or similarity) to slope positions. The key contribution is a procedure for finding the typical locations and setting the fuzzy inference parameters for each slope position type. Instead of being determined totally by users in the prototype-based inference method, in the proposed approach the typical locations and fuzzy inference parameters for each slope position type are automatically determined by a rule set based on prior domain knowledge and the frequency distributions of topographic attributes. Furthermore, the preparation of topographic attributes (e.g., slope gradient, curvature, and relative position index) is automated, so the proposed automatic approach has only one necessary input, i.e., the gridded digital elevation model of the study area. All compute-intensive algorithms in the proposed approach were speeded up by parallel computing. Two study cases were provided to demonstrate that this approach can properly, conveniently and quickly derive the fuzzy slope positions.
Nishikawa, Satoshi; Arai, Shunya; Masamoto, Yosuke; Kagoya, Yuki; Toya, Takashi; Watanabe-Okochi, Naoko; Kurokawa, Mineo
2014-12-04
Ecotropic viral integration site 1 (Evi1) is a transcription factor that is highly expressed in hematopoietic stem cells and is crucial for their self-renewal capacity. Aberrant expression of Evi1 is observed in 5% to 10% of de novo acute myeloid leukemia (AML) patients and predicts poor prognosis, reflecting multiple leukemogenic properties of Evi1. Here, we show that thrombopoietin (THPO) signaling is implicated in growth and survival of Evi1-expressing cells using a mouse model of Evi1 leukemia. We first identified that the expression of megakaryocytic surface molecules such as ITGA2B (CD41) and the THPO receptor, MPL, positively correlates with EVI1 expression in AML patients. In agreement with this finding, a subpopulation of bone marrow and spleen cells derived from Evi1 leukemia mice expressed both CD41 and Mpl. CD41(+) Evi1 leukemia cells induced secondary leukemia more efficiently than CD41(-) cells in a serial bone marrow transplantation assay. Importantly, the CD41(+) cells predominantly expressing Mpl effectively proliferated and survived on OP9 stromal cells in the presence of THPO via upregulating BCL-xL expression, suggesting an essential role of the THPO/MPL/BCL-xL cascade in enhancing the progression of Evi1 leukemia. These observations provide a novel aspect of the diverse functions of Evi1 in leukemogenesis. © 2014 by The American Society of Hematology.
Directory of Open Access Journals (Sweden)
Alireza Abdollahi
2014-12-01
Full Text Available Opportunistic infections are the leading cause of hospitalization and morbidity in human immunodeficiency virus (HIV positive patients and are the most common cause of death between them. We aimed to measure IgG antibody against EBV viral capsid antigen (EBV-VCA IgG to determine the seroprevalence of this infection in HIV-positive population. A case-control study between September 2011 and October 2012 was conducted in a teaching hospital enrolling 114 HIV-positive patients as case group and 114 healthy individuals as control with similar age and sex. Enzyme-linked immunosurbant assay (ELISA technique was used for determination of EBV-VAC IgG in obtained samples. Of 114 serum samples obtained from HIV-positive patients, 103 (90.4% samples were found positive for EBV-VCA IgG antibody. There was no significant difference in seroprevalence of EBV VCA IgG antibody between patients received antiretroviral therapy and naive patients (91.5% vs. 87.5%, P>0.05. There was no statistically significant difference in EBV-VCA IgG seroprevalence between three groups of CD4+ in HIV positive group. In conclusion current study showed that seroprevalence of EBV in HIV-positive patients is higher than HIV-negative healthy participants; however, administration of HAART and CD4+ lymphocyte count did not reveal a significant effect in seroprevalence of EBV. Due to the significance of this virus in mortality and morbidity and causing certain malignancies in patients with AIDS, these patients are strongly recommended to be tested for this virus.
Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan
2015-02-01
Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.
Xu, Rongman; Zhao, Xiangdong; Zhao, Yuanyuan; Chen, Bin; Sun, Li; Xu, Changgen; Shen, Bo; Wang, Mei; Xu, Wenrong; Zhu, Wei
2018-04-01
Gastric cancer mesenchymal stem cells (GC-MSCs) can promote the development of tumour growth. The tumour-promoting role of tumour-associated MSCs and T cells has been demonstrated. T cells as the major immune cells may influence and induce a pro-tumour phenotype in MSCs. This study focused on whether CD4 + T cells can affect GC-MSCs to promote gastric cancer growth. CD4 + T cells upregulation of programmed death ligand 1 (PD-L1) expression in GC-MSCs through the phosphorylated signal transducer and activator of transcription (p-STAT3) signalling pathway was confirmed by immunofluorescence, western blotting and RT-PCR. Migration of GC cells was detected by Transwell migration assay, and apoptosis of GC cells was measured by flow cytometry using annexin V/propidium iodide double staining. CD4 + T cell-primed GC-MSCs promoted GC growth in a subcutaneously transplanted tumour model in BALB/c nu/nu mice. Gastric cancer mesenchymal stem cells stimulated by activated CD4 + T cells promoted migration of GC cells and enhanced GC growth potential in BALB/c nu/nu xenografts. PD-L1 upregulation of GC-MSCs stimulated by CD4 + T cells was mediated through the p-STAT3 signalling pathway. CD4 + T cells-primed GC-MSCs have greater GC volume and growth rate-promoting role than GC-MSCs, with cancer cell-intrinsic PD-1/mammalian target of rapamycin (mTOR) signalling activation. This study showed that GC-MSCs are plastic. The immunophenotype of GC-MSCs stimulated by CD4 + T cells has major changes that may influence tumour cell growth. This research was based on the interaction between tumour cells, MSCs and immune cells, providing a new understanding of the development and immunotherapy of GC. © 2017 John Wiley & Sons Ltd.
2011-06-01
... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...
Directory of Open Access Journals (Sweden)
Markus Loibl
2014-01-01
Full Text Available Tissue engineering techniques for the regeneration of large bone defects require sufficient vascularisation of the applied constructs to ensure a sufficient supply of oxygen and nutrients. In our previous work, prevascularised 3D scaffolds have been successfully established by coculture of bone marrow derived stem cells (MSCs and endothelial progenitor cells (EPCs. We identified stabilising pericytes (PCs as part of newly formed capillary-like structures. In the present study, we report preliminary data on the interactions between MSCs and EPCs, leading to the differentiation of pericyte-like cells. MSCs and EPCs were seeded in transwell cultures, direct cocultures, and single cultures. Cells were cultured for 10 days in IMDM 10% FCS or IMDM 5% FCS 5% platelet lysate medium. Gene expression of PC markers, CD146, NG2, αSMA, and PDGFR-β, was analysed using RT-PCR at days 0, 3, 7, and 10. The upregulation of CD146, NG2, and αSMA in MSCs in direct coculture with EPCs advocates the MSCs’ differentiation towards a pericyte-like phenotype in vitro. These results suggest that pericyte-like cells derive from MSCs and that cell-cell contact with EPCs is an important factor for this differentiation process. These findings emphasise the concept of coculture strategies to promote angiogenesis for cell-based tissue engineered bone grafts.
High resolution crystal structure of the Grb2 SH2 domain with a phosphopeptide derived from CD28.
Directory of Open Access Journals (Sweden)
Kunitake Higo
Full Text Available Src homology 2 (SH2 domains play a critical role in cellular signal transduction. They bind to peptides containing phosphotyrosine (pY with various specificities that depend on the flanking amino-acid residues. The SH2 domain of growth-factor receptor-bound protein 2 (Grb2 specifically recognizes pY-X-N-X, whereas the SH2 domains in phosphatidylinositol 3-kinase (PI3K recognize pY-X-X-M. Binding of the pY site in CD28 (pY-M-N-M by PI3K and Grb2 through their SH2 domains is a key step that triggers the CD28 signal transduction for T cell activation and differentiation. In this study, we determined the crystal structure of the Grb2 SH2 domain in complex with a pY-containing peptide derived from CD28 at 1.35 Å resolution. The peptide was found to adopt a twisted U-type conformation, similar to, but distinct from type-I β-turn. In all previously reported crystal structures, the peptide bound to the Grb2 SH2 domains adopts a type-I β-turn conformation, except those with a proline residue at the pY+3 position. Molecular modeling also suggests that the same peptide bound to PI3K might adopt a very different conformation.
High resolution crystal structure of the Grb2 SH2 domain with a phosphopeptide derived from CD28.
Higo, Kunitake; Ikura, Teikichi; Oda, Masayuki; Morii, Hisayuki; Takahashi, Jun; Abe, Ryo; Ito, Nobutoshi
2013-01-01
Src homology 2 (SH2) domains play a critical role in cellular signal transduction. They bind to peptides containing phosphotyrosine (pY) with various specificities that depend on the flanking amino-acid residues. The SH2 domain of growth-factor receptor-bound protein 2 (Grb2) specifically recognizes pY-X-N-X, whereas the SH2 domains in phosphatidylinositol 3-kinase (PI3K) recognize pY-X-X-M. Binding of the pY site in CD28 (pY-M-N-M) by PI3K and Grb2 through their SH2 domains is a key step that triggers the CD28 signal transduction for T cell activation and differentiation. In this study, we determined the crystal structure of the Grb2 SH2 domain in complex with a pY-containing peptide derived from CD28 at 1.35 Å resolution. The peptide was found to adopt a twisted U-type conformation, similar to, but distinct from type-I β-turn. In all previously reported crystal structures, the peptide bound to the Grb2 SH2 domains adopts a type-I β-turn conformation, except those with a proline residue at the pY+3 position. Molecular modeling also suggests that the same peptide bound to PI3K might adopt a very different conformation.
Directory of Open Access Journals (Sweden)
Johnnie J Orozco
Full Text Available Radioimmunotherapy (RIT for treatment of hematologic malignancies has primarily employed monoclonal antibodies (Ab labeled with 131I or 90Y which have limitations, and alternative radionuclides are needed to facilitate wider adoption of RIT. We therefore compared the relative therapeutic efficacy and toxicity of anti-CD45 RIT employing 90Y and 177Lu in a syngeneic, disseminated murine myeloid leukemia (B6SJLF1/J model. Biodistribution studies showed that both 90Y- and 177Lu-anti-murine CD45 Ab conjugates (DOTA-30F11 targeted hematologic tissues, as at 24 hours 48.8 ± 21.2 and 156 ± 14.6% injected dose per gram of tissue (% ID/g of 90Y-DOTA-30F11 and 54.2 ± 9.5 and 199 ± 11.7% ID/g of 177Lu-DOTA-30F11 accumulated in bone marrow (BM and spleen, respectively. However, 90Y-DOTA-30F11 RIT demonstrated a dose-dependent survival benefit: 60% of mice treated with 300 µCi 90Y-DOTA-30F11 lived over 180 days after therapy, and mice treated with 100 µCi 90Y-DOTA-30F11 had a median survival 66 days. 90Y-anti-CD45 RIT was associated with transient, mild myelotoxicity without hepatic or renal toxicity. Conversely, 177Lu- anti-CD45 RIT yielded no long-term survivors. Thus, 90Y was more effective than 177Lu for anti-CD45 RIT of AML in this murine leukemia model.
Immunoexpression of CD95 in chronic gastritis and gastric mucosa-associated lymphomas
Directory of Open Access Journals (Sweden)
Vassallo J.
2004-01-01
Full Text Available CD95 (Fas/APO-1-mediated apoptosis plays an important role in immunological regulation and is related to the pathogenesis of autoimmune diseases. Immunoexpression of CD95 has been reported to frequently occur in low grade non-Hodgkin lymphomas, especially of post-germinal center histogenesis, among which those originating in mucosa-associated lymphoid tissue (MALT lymphomas. However, there is no report comparing in situ immunoexpression of this marker in lymphomas and the hyperplastic lymphoid reaction (chronic gastritis related to Helicobacter pylori infection. The purpose of the present research was to compare the intensity of lymphoid CD95 immunoexpression in 15 cases of H. pylori-related chronic gastritis and 15 gastric MALT lymphomas. CD95 (anti-CD95 was detected by an immunoperoxidase technique in paraffin sections using the catalyzed amplification system. Graduation of reaction intensity (percentage of CD95-positive cells was semiquantitative, from 1+ to 4+. Nine cases of chronic gastritis were 4+, five 2+ and one 1+. Three lymphomas were 4+, three 3+, four 2+, four 1+, and one was negative. Although 14 of 15 lymphomas were positive for CD95, the intensity of the reaction was significantly weaker compared to that obtained with gastric tissue for patients with gastritis (P = 0.03. The difference in CD95 immunoexpression does not seem to be useful as an isolated criterion in the differential diagnosis between chronic gastritis and MALT lymphomas since there was overlapping of immunostaining patterns. However, it suggests the possibility of a pathogenetic role of this apoptosis-regulating protein in MALT lymphomas.
42 CFR 410.146 - Diabetes outcome measurements.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...
de Oliveira Titz, T; Orfali, R L; de Lollo, C; Dos Santos, V G; da Silva Duarte, A J; Sato, M N; Aoki, V
2016-12-01
Eosinophils are multifunctional, polymorphonuclear leucocytes that secrete proteins within cytoplasmic granules, such as cytokines, chemokines, metalloproteinases (MMPs) and metalloproteinases tissue inhibitors (TIMPs). Although eosinophilia is a hallmark of atopic dermatitis (AD), several functional aspects of eosinophils remain unknown. We aimed to evaluate the phenotype and functional response of eosinophils under staphylococcal enterotoxin B (SEB) and Toll-like receptor (TLR)-2/6 (FSL-1) stimulation in the secretion of CCL5, MMPs and TIMPs in adults with AD. Forty-one adult patients with AD and 45 healthy controls enrolled for the study. Phenotype of eosinophils from granulocytes of peripheral blood was analysed by flow cytometry. We performed evaluation of CCL5 (cytometric bead array), MMP and TIMP (ELISA) secretion, in culture supernatants of purified eosinophils stimulated with SEB or TLR2/6 agonist (FSL-1). We found a higher frequency of LIN1 - CCR3 + eosinophils, and decreased expression of CD23 and CD62L receptors in eosinophils of AD patients. There was no difference in MMP and TIMP serum levels between the evaluated groups. However, we detected decreased basal levels of TIMP-1, TIMP-2 and CCL5 in culture supernatants from purified, unstimulated eosinophils from AD patients. In adults with AD, phenotypical features of eosinophils reveal decreased expression of early activation and L-selectin receptors. Regarding the functional profile of purified eosinophils related to tissue remodelling in atopic dermatitis, innate immune stimulation (TLR2/6 agonist and SEB) did not affect the ratio of MMP/TIMPs secretion in AD. Our findings reinforce the potential breakdown in tissue remodelling process mediated by eosinophils in AD. © 2016 European Academy of Dermatology and Venereology.
Systematics of (n,t) reactions in medium and heavy mass nuclei at 14.6 MeV
International Nuclear Information System (INIS)
Woo, T.T.
1979-01-01
The production cross sections for (n,t) reactions of 14.6-MeV neutrons with isotopes of the natural elements Ca, Ti, Cr, Fe, Ni, Y, Mo, Pd, Cd, Sn, Pb, La, and with the enriched isotopes 86 Sr, 114 Cd, 130 Te, 205 Tl were measured by the activation technique using high-energy resolution gamma-ray spectrometry. The systematics for the (n,t) reactions were investigated as a function of the relative neutron excess. The experimentally determined values of the cross sections are in good agreement with values calculated by an empirical equation. The cross section ratios (n,t) and (n,p) reactions were calculated on the basis of the statistical model
Directory of Open Access Journals (Sweden)
Zou Qiong
2012-05-01
Full Text Available Abstract Background The objective of this study was to investigate CD9 and HMGA2 expression and its clinicopathological significance in benign and malignant lesion tissues of the gallbladder. Methods The resected specimens of 108 cases of gallbladder adenocarcinoma, 46 cases of adjacent tissue, 15 cases of polyps and 35 cases of chronic cholecystitis were made into conventional paraffin-embedded sections, using the method of EnVision immunohistochemistry to stain HMGA2 and CD9. Results HMGA2 expression of gallbladder adenocarcinoma was significantly higher than that of adenocarcinoma adjacent tissues (= 16.13, P P P P P P P P P P = 0.020, but the survival period of CD9 expression-positive cases was significantly higher than that of cases with CD9 expression-negative (P = 0.019. Cox multivariate regression analysis showed that the HMGA2 positive expression and/or CD9 negative expression was an important indicator reflecting the poor prognosis of gallbladder cancer. Conclusion The expression of HMGA2 and/or CD9 might be closely related to the carcinogenesis, clinical biological behaviors and prognosis of gallbladder adenocarcinoma.
Directory of Open Access Journals (Sweden)
Cynthia Van der Hauwaert
Full Text Available Renal proximal tubular epithelial cells play a central role in renal physiology and are among the cell types most sensitive to ischemia and xenobiotic nephrotoxicity. In order to investigate the molecular and cellular mechanisms underlying the pathophysiology of kidney injuries, a stable and well-characterized primary culture model of proximal tubular cells is required. An existing model of proximal tubular cells is hampered by the cellular heterogeneity of kidney; a method based on cell sorting for specific markers must therefore be developed. In this study, we present a primary culture model based on the mechanical and enzymatic dissociation of healthy tissue obtained from nephrectomy specimens. Renal epithelial cells were sorted using co-labeling for CD10 and CD13, two renal proximal tubular epithelial markers, by flow cytometry. Their purity, phenotypic stability and functional properties were evaluated over several passages. Our results demonstrate that CD10/CD13 double-positive cells constitute a pure, functional and stable proximal tubular epithelial cell population that displays proximal tubule markers and epithelial characteristics over the long term, whereas cells positive for either CD10 or CD13 alone appear to be heterogeneous. In conclusion, this study describes a method for establishing a robust renal proximal tubular epithelial cell model suitable for further experimentation.
Tracking of adipose tissue-derived progenitor cells using two magnetic nanoparticle types
Energy Technology Data Exchange (ETDEWEB)
Kasten, Annika; Siegmund, Birte J. [Department of Oral and Maxillofacial Surgery, Facial Plastic Surgery, Rostock University Medical Center, Schillingallee 35 D-18057 Rostock (Germany); Grüttner, Cordula [Micromod Partikeltechnologie GmbH, Warnemünde, D-18115 Rostock (Germany); Kühn, Jens-Peter [Department of Radiology and Neuroradiology, Greifswald University Medical Center, D-17475 Greifswald (Germany); Frerich, Bernhard, E-mail: bernhard.frerich@med.uni-rostock.de [Department of Oral and Maxillofacial Surgery, Facial Plastic Surgery, Rostock University Medical Center, Schillingallee 35 D-18057 Rostock (Germany)
2015-04-15
Magnetic resonance imaging (MRI) is to be considered as an emerging detection technique for cell tracking experiments to evaluate the fate of transplanted progenitor cells and develop successful cell therapies for tissue engineering. Adipose tissue engineering using adipose tissue-derived progenitor cells has been advocated for the cure of soft tissue defects or for persistent soft tissue augmentation. Adipose tissue-derived progenitor cells were differentiated into the adipogenic lineage and labeled with two different types of magnetic iron oxide nanoparticles in varying concentrations which resulted in a concentration-dependent reduction of gene expression of adipogenic differentiation markers, adiponectin and fatty acid-binding protein 4 (FABP4), whereas the metabolic activity was not altered. As a result, only low nanoparticle concentrations for labeling were used for in vivo experiments. Cells were seeded onto collagen scaffolds and subcutaneously implanted into severe combined immunodeficient (SCID) mice. At 24 h as well as 28 days after implantation, MRI analyses were performed visualizing nanoparticle-labeled cells using T2-weighted sequences. The quantification of absolute volume of the scaffolds revealed a decrease of volume over time in all experimental groups. The distribution of nanoparticle-labeled cells within the scaffolds varied likewise over time. - Highlights: • Adipose tissue-derived stem cells (ASC) were labeled with magnetic iron oxide nanoparticles. • Nanoparticles influenced the adipogenic differentiation of ASC. • Labeled cells were seeded onto collagen scaffolds and implanted in SCID mice. • Nanoparticle-labeled cells were visualized in vivo using T2-weighted sequences. • Volume of collagen scaffolds was decreased over time after implantation.
Tracking of adipose tissue-derived progenitor cells using two magnetic nanoparticle types
International Nuclear Information System (INIS)
Kasten, Annika; Siegmund, Birte J.; Grüttner, Cordula; Kühn, Jens-Peter; Frerich, Bernhard
2015-01-01
Magnetic resonance imaging (MRI) is to be considered as an emerging detection technique for cell tracking experiments to evaluate the fate of transplanted progenitor cells and develop successful cell therapies for tissue engineering. Adipose tissue engineering using adipose tissue-derived progenitor cells has been advocated for the cure of soft tissue defects or for persistent soft tissue augmentation. Adipose tissue-derived progenitor cells were differentiated into the adipogenic lineage and labeled with two different types of magnetic iron oxide nanoparticles in varying concentrations which resulted in a concentration-dependent reduction of gene expression of adipogenic differentiation markers, adiponectin and fatty acid-binding protein 4 (FABP4), whereas the metabolic activity was not altered. As a result, only low nanoparticle concentrations for labeling were used for in vivo experiments. Cells were seeded onto collagen scaffolds and subcutaneously implanted into severe combined immunodeficient (SCID) mice. At 24 h as well as 28 days after implantation, MRI analyses were performed visualizing nanoparticle-labeled cells using T2-weighted sequences. The quantification of absolute volume of the scaffolds revealed a decrease of volume over time in all experimental groups. The distribution of nanoparticle-labeled cells within the scaffolds varied likewise over time. - Highlights: • Adipose tissue-derived stem cells (ASC) were labeled with magnetic iron oxide nanoparticles. • Nanoparticles influenced the adipogenic differentiation of ASC. • Labeled cells were seeded onto collagen scaffolds and implanted in SCID mice. • Nanoparticle-labeled cells were visualized in vivo using T2-weighted sequences. • Volume of collagen scaffolds was decreased over time after implantation
2017-10-01
AWARD NUMBER: W81XWH-16-2-0042 TITLE: Adult Tissue-Derived Stem Cells and Tolerance Induction in Nonhuman Primates for Vascularized Composite...2017 2. REPORT TYPE Annual 3. DATES COVERED 30 Sep 2016 - 29 Sep 2017 4. TITLE AND SUBTITLE Adult Tissue-Derived Stem Cells and Tolerance Induction...Distribution Unlimited 13. SUPPLEMENTARY NOTES The utilization of adult derived adipose stem cells administration in composite tissue transplantation
Genetic Comparison of Stemness of Human Umbilical Cord and Dental Pulp
Directory of Open Access Journals (Sweden)
Chung-Min Kang
2016-01-01
Full Text Available This study focuses on gene expression patterns and functions in human umbilical cord (UC and dental pulp (DP containing mesenchymal stem cells (MSCs. DP tissues were collected from 25 permanent premolars. UC tissue samples were obtained from three newborns. Comparative gene profiles were obtained using cDNA microarray analysis and the expression of tooth development-associated and MSC-related genes was assessed by the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR. Genes related to cell proliferation, angiogenesis, and immune responses were expressed at higher levels in UC, whereas genes related to growth factor and receptor activity and signal transduction were more highly expressed in DP. Although UC and DP tissues exhibited similar expression of surface markers for MSCs, UC showed higher expression of CD29, CD34, CD44, CD73, CD105, CD146, and CD166. qRT-PCR analysis showed that CD146, CD166, and MYC were expressed 18.3, 8.24, and 1.63 times more highly in UC, whereas the expression of CD34 was 2.15 times higher in DP. Immunohistochemical staining revealed significant differences in the expression of genes (DSPP, DMP1, and CALB1 related to odontogenesis and angiogenesis in DP. DP and UC tissue showed similar gene expression, with the usual MSC markers, while they clearly diverged in their differentiation capacity.
Genetic Comparison of Stemness of Human Umbilical Cord and Dental Pulp.
Kang, Chung-Min; Kim, Hyunok; Song, Je Seon; Choi, Byung-Jai; Kim, Seong-Oh; Jung, Han-Sung; Moon, Seok-Jun; Choi, Hyung-Jun
2016-01-01
This study focuses on gene expression patterns and functions in human umbilical cord (UC) and dental pulp (DP) containing mesenchymal stem cells (MSCs). DP tissues were collected from 25 permanent premolars. UC tissue samples were obtained from three newborns. Comparative gene profiles were obtained using cDNA microarray analysis and the expression of tooth development-associated and MSC-related genes was assessed by the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Genes related to cell proliferation, angiogenesis, and immune responses were expressed at higher levels in UC, whereas genes related to growth factor and receptor activity and signal transduction were more highly expressed in DP. Although UC and DP tissues exhibited similar expression of surface markers for MSCs, UC showed higher expression of CD29, CD34, CD44, CD73, CD105, CD146, and CD166. qRT-PCR analysis showed that CD146, CD166, and MYC were expressed 18.3, 8.24, and 1.63 times more highly in UC, whereas the expression of CD34 was 2.15 times higher in DP. Immunohistochemical staining revealed significant differences in the expression of genes (DSPP, DMP1, and CALB1) related to odontogenesis and angiogenesis in DP. DP and UC tissue showed similar gene expression, with the usual MSC markers, while they clearly diverged in their differentiation capacity.
21 CFR 146.150 - Canned concentrated orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...
Ivanovska, Ana; Grolli, Stefano; Borghetti, Paolo; Ravanetti, Francesca; Conti, Virna; De Angelis, Elena; Macchi, Francesca; Ramoni, Roberto; Martelli, Paolo; Gazza, Ferdinando; Cacchioli, Antonio
2017-10-01
Immunophenotypical characterization of mesenchymal stem cells is fundamental for the design and execution of sound experimental and clinical studies. The scarce availability of species-specific antibodies for canine antigens has hampered the immunophenotypical characterization of canine mesenchymal stem cells (MSC). The aim of this study was to select a panel of species-specific direct antibodies readily useful for canine mesenchymal stem cells characterization. They were isolated from perivisceral and subcutaneous adipose tissue samples collected during regular surgeries from 8 dogs. Single color flow cytometric analysis of mesenchymal stem cells (P3) deriving from subcutaneous and perivisceral adipose tissue with a panel of 7 direct anti-canine antibodies revealed two largely homogenous cell populations with a similar pattern: CD29 + , CD44 + , CD73 + , CD90 + , CD34 - , CD45 - and MHC-II - with no statistically significant differences among them. Antibody reactivity was demonstrated on canine peripheral blood mononuclear cells. The similarities are reinforced by their in vitro cell morphology, trilineage differentiation ability and RT-PCR analysis (CD90 + , CD73 + , CD105 + , CD44 + , CD13 + , CD29 + , Oct-4 + gene and CD31 - and CD45 - expression). Our results report for the first time a comparison between the immunophenotypic profile of canine MSC deriving from perivisceral and subcutaneous adipose tissue. The substantial equivalence between the two populations has practical implication on clinical applications, giving the opportunity to choose the source depending on the patient needs. The results contribute to routine characterization of MSC populations grown in vitro, a mandatory process for the definition of solid and reproducible laboratory and therapeutic procedures. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ting-Yu Chang
-regulation compared to healthy control. Knockdown of miR-146a-5p or miR-146b-5p in CAD ECFCs enhanced migration and tube formation activity in diseased ECFCs. Contrarily, overexpression of miR-146a-5p or miR-146b-5p in healthy ECFC repressed migration and tube formation in ECFCs. TargetScan analysis showed that miR-146a-5p and miR-146b-5p target many of the angiogenesis-related genes that were down-regulated in CAD ECFCs. Knockdown of miR-146a-5p or miR-146b-5p restores CAV1 and RHOJ levels in CAD ECFCs. Reporter assays confirmed the direct binding and repression of miR-146a-5p and miR-146b-5p to the 3'-UTR of mRNA of RHOJ, a positive regulator of angiogenic potential in endothelial cells. Consistently, RHOJ knockdown inhibited the migration and tube formation ability in ECFCs. Collectively, we discovered the dysregulation of miR-146a-5p/RHOJ and miR-146b-5p/RHOJ axis in the plasma and ECFCs of CAD patients that could be used as biomarkers or therapeutic targets for CAD and other angiogenesis-related diseases.
Directory of Open Access Journals (Sweden)
Muhaimin Rifa’i
2014-05-01
Full Text Available CD4+ CD25+ regulatory T cells involved in the regulation of self- tolerance and normality of homeostasis. CD122 deficient mice are model animals that have an abnormal immune system characteristically have a high number of activated T cells and TER-119 cell decreased. Here we showed evidence that the transfer of CD4+ CD25+ regulatory T cells derived from normal mice to CD122- defficient neonates prevent the development of activated memory T cells and elicit TER-119 differentiation. Bone marrow reconstitution derived from CD122-/- mice to normal mice resulting tolerance to individual that genetically different. Importantly, CD4+ CD25+ regulatory T cells derived from normal mice can replace CD4+ CD25+ cells derived from CD122-/- mice. The results of this experiment suggest that regulatory T cells from normal mice exert a critical role in maintaining peripheral tolerance and controlling hematopoietic disorder.
Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.
Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin
2018-01-01
Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.
Circulating sCD36 levels in patients with non-alcoholic fatty liver disease and controls
DEFF Research Database (Denmark)
Heebøll, Sara; Poulsen, Marianne Kjær; Ørnstrup, Marie Juul
2017-01-01
with the level of intrahepatic lipid, insulin resistance and dyslipidemia. The weak association with markers of obesity and the association with hepatic CD36 mRNA expression suggest that excess sCD36 in NAFLD patients is derived from the hepatocytes, which may support that CD36 is involved in NAFLD development...... with intrahepatic lipid (rs=0.30), ALT (r=0.31), HOMA-insulin resistance (r=0.24), HDL (r=-0.32) and triglyceride (r=0.44, all P....04); yet, we found no correlations between sCD36 and other measures of fat distribution except an inverse relation to visceral adipose tissue (rs=-0.21, Phepatic CD36 mRNA expression (r=0.37, P=0.07). CONCLUSIONS: sCD36 levels increased...
Functional and phenotypical analysis of IL-6-secreting CD4+ T cells in human adipose tissue.
de Jong, Anja J; Pollastro, Sabrina; Kwekkeboom, Joanneke C; Andersen, Stefan N; Dorjée, Annemarie L; Bakker, Aleida M; Alzaid, Fawaz; Soprani, Antoine; Nelissen, Rob G H H; Mullers, Jan B; Venteclef, Nicolas; de Vries, Niek; Kloppenburg, Margreet; Toes, René E M; Ioan-Facsinay, Andreea
2018-03-01
Emerging evidence indicates that a dynamic interplay between the immune system and adipocytes contributes to the disturbed homeostasis in adipose tissue of obese subjects. Recently, we observed IL-6-secretion by CD4 + T cells from the stromal vascular fraction (SVF) of the infrapatellar fat pad (IFP) of knee osteoarthritis patients directly ex vivo. Here we show that human IL-6 + CD4 + T cells from SVF display a more activated phenotype than the IL-6 - T cells, as evidenced by the expression of the activation marker CD69. Analysis of cytokines secretion, as well as expression of chemokine receptors and transcription factors associated with different Th subsets (Treg, Th1, Th2, Th17 and Tfh) revealed that IL-6-secreting CD4 + T cells cannot be assigned to a conventional Th subset. TCRβ gene analysis revealed that IL-6 + and IL-6 - CD4 + T cells appear clonally unrelated to each other, suggesting a different specificity of these cells. In line with these observations, adipocytes are capable of enhancing IL-6 production by CD4 + T cells. Thus, IL-6 + CD4 + T cells are TCRαβ T cells expressing an activated phenotype potentially resulting from an interplay with adipocytes that could be involved in the inflammatory processes in the OA joint. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...
Farace, F; Gross-Goupil, M; Tournay, E; Taylor, M; Vimond, N; Jacques, N; Billiot, F; Mauguen, A; Hill, C; Escudier, B
2011-01-01
Background: Predicting the efficacy of antiangiogenic therapy would be of clinical value in patients (pts) with metastatic renal cell carcinoma (mRCC). We tested the hypothesis that circulating endothelial cell (CEC), bone marrow-derived CD45dimCD34+VEGFR2+ progenitor cell or plasma angiogenic factor levels are associated with clinical outcome in mRCC pts undergoing treatment with tyrosine kinase inhibitors (TKI). Methods: Fifty-five mRCC pts were prospectively monitored at baseline (day 1) and day 14 during treatment (46 pts received sunitinib and 9 pts received sorafenib). Circulating endothelial cells (CD45−CD31+CD146+7-amino-actinomycin (7AAD)− cells) were measured in 1 ml whole blood using four-color flow cytometry (FCM). Circulating CD45dimCD34+VEGFR2+7AAD− progenitor cells were measured in progenitor-enriched fractions by four-color FCM. Plasma VEGF, sVEGFR2, SDF-1α and sVCAM-1 levels were determined by ELISA. Correlations between baseline CEC, CD45dimCD34+VEGFR2+7AAD− progenitor cells, plasma factors, as well as day 1–day 14 changes in CEC, CD45dimCD34+VEGFR2+7AAD− progenitor, plasma factor levels, and response to TKI, progression-free survival (PFS) and overall survival (OS) were examined. Results: No significant correlation between markers and response to TKI was observed. No association between baseline CEC, plasma VEGF, sVEGFR-2, SDF-1α, sVCAM-1 levels with PFS and OS was observed. However, baseline CD45dimCD34+VEGFR2+7AAD− progenitor cell levels were associated with PFS (P=0.01) and OS (P=0.006). Changes in this population and in SDF-1α levels between day 1 and day 14 were associated with PFS (P=0.03, P=0.002). Changes in VEGF and SDF-1α levels were associated with OS (P=0.02, P=0.007). Conclusion: Monitoring CD45dimCD34+VEGFR2+ progenitor cells, plasma VEGF and SDF-1α levels could be of clinical interest in TKI-treated mRCC pts to predict outcome. PMID:21386843
19 CFR 146.63 - Entry for consumption.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...
Han, Sun Ae; Lee, Sahnghoon; Seong, Sang Cheol; Lee, Myung Chul
2014-10-01
We investigated the effects of CD14 macrophages and proinflammatory cytokines on chondrogenic differentiation of osteoarthritic synovium-derived stem cells (SDSCs). Osteoarthritic synovial fluid was analyzed for interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and IL-6. Levels of stem cell surface markers in osteoarthritic SDSCs were evaluated using flow cytometry. CD14-negative cells were obtained using magnetically activated cell sorting. We compared chondrogenic potentials between whole cells and CD14-negative cells in CD14(low) cells and CD14(high) cells, respectively. To assess whether nuclear factor-κB (NF-κB) and CCAAT/enhancer-binding protein β (C/EBPβ) modulate IL-1β-induced alterations in chondrogenic potential, we performed small interfering RNA transfection. We observed a significant correlation between the CD14 ratio in osteoarthritic SDSCs and IL-1β and TNF-α in osteoarthritic synovial fluid. Phenotypic characterization of whole cells and CD14-negative cells showed no significant differences in levels of stem cell markers. mRNA expression of type II collagen was higher in CD14-negative cell pellets than in whole cell pellets. Immunohistochemical staining indicated higher levels of type II collagen in the CD14-negative cell pellets of CD14(high) cells than in whole cell pellets of CD14(high) cells. As expected, IL-1β and TNF-α significantly inhibited the expression of chondrogenic-related genes in SDSCs, an effect which was antagonized by knockdown of NF-κB and C/EBPβ. Our results suggest that depletion of CD14(+) synovial macrophages leads to improved chondrogenic potential in CD14(high) cell populations in osteoarthritic SDSCs, and that NF-κB (RelA) and C/EBPβ are critical factors mediating IL-1β-induced suppression of the chondrogenic potential of human SDSCs.
Association between red blood cell indices and CD4 count in HIV-positive reproductive women
Lumbanraja, S. N.; Siregar, D. I. S.
2018-03-01
Red blood cell indices, hemoglobin, and hematocrit reflect rapidity of HIV disease progression. This study aims to determine red blood cell indices and CD4 count in HIV-positive reproductive women. This study was a cross sectional study conducted at AIDS outpatient clinic at Haji Adam Malik General Hospital, Medan Indonesia. All seropositive reproductive women within antiretroviral therapy consented for blood count and CD4 examination. Data were collected and analyzed with SPSS 19. In subjects with CD4≤350 mm3, mean hemoglobin was 10.95 ± 2.01, hematocrit was 31.83 ± 5.04%, MCV was 84.17 ± 11.41, MCH was 25.98 ± 2.65, and MCHC was 32.18 ± 2.17. Mean hemoglobin, hematocrit, and MCH value was significantly lower in subjects with CD4 ≤350 mm3 (p=0.014; p=0.001; p=0.01; respectively). Lower Hb, Ht, and MCH associated with thelower CD4 count.
Derivation of Stromal (Skeletal and Mesenchymal) Stem-Like Cells from Human Embryonic Stem Cells
Harkness, Linda; Abdallah, Basem M.; Elsafadi, Mona; Al-Nbaheen, May S.; Aldahmash, Abdullah; Kassem, Moustapha
2012-01-01
Derivation of bone forming cells (osteoblasts) from human embryonic stem cells (hESCs) is a prerequisite for their use in clinical applications. However, there is no standard protocol for differentiating hESCs into osteoblastic cells. The aim of this study was to identify the emergence of a human stromal (mesenchymal and skeletal) stem cell (hMSC)-like population, known to be osteoblastic cell precursors and to test their osteoblastic differentiation capacity in ex vivo cultures and in vivo. We cultured hESCs in a feeder-free environment using serum replacement and as suspension aggregates (embryoid bodies; hEBs). Over a 20 day developmental period, the hEBs demonstrated increasing enrichment for cells expressing hMSC markers: CD29, CD44, CD63, CD56, CD71, CD73, CD105, CD106, and CD166 as revealed by immunohistochemical staining and flow cytometry (fluorescence-activated cell sorting) analysis. Ex vivo differentiation of hEBs using bone morphogenic protein 2 (BMP2) combined with standard osteoblast induction medium led to weak osteoblastic induction. Conversely, subcutaneous in vivo implantation of day 20 hEBs in immune deficient mice, mixed with hydroxyapatite/tricalcium phosphate (HA/TCP) as an osteoconductive scaffold, revealed bone and cartilage, and fibrous tissue elements after 8 weeks. These tissues were of human origin and there was no evidence of differentiation to nonmesodermal tissues. hEBs implanted in the absence of HA/TCP formed vacuolated tissue containing glandular, fibrous and muscle-like tissue elements. Conversely, implantation of undifferentiated hESCs resulted in the formation of a teratoma containing a mixture of endodermal, mesodermal, and ectodermal tissues. Our study demonstrates that hMSC-like cells can be obtained from hESCs and they can be induced to form skeletal tissues in vivo when combined with HA/TCP. These findings are relevant for tissue engineering and suggest that differentiated hEBs can provide an unlimited source for
21 CFR 146.187 - Canned prune juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...
Martinet, Kim Zita; Bloquet, Stéphane; Bourgeois, Christine
2014-01-01
CD4 T cell lymphopenia is an important T cell defect associated to ageing. Higher susceptibility to infections, cancer, or autoimmune pathologies described in aged individuals is thought to partly rely on T cell lymphopenia. We hypothesize that such diverse effects may reflect anatomical heterogeneity of age related T cell lymphopenia. Indeed, no data are currently available on the impact of ageing on T cell pool recovered from gut associated lymphoid tissue (GALT), a crucial site of CD4 T cell accumulation. Primary, secondary and tertiary lymphoid organs of C57BL/6 animals were analysed at three intervals of ages: 2 to 6 months (young), 10 to 14 months (middle-aged) and 22 to 26 months (old). We confirmed that ageing preferentially impacted CD4 T cell compartment in secondary lymphoid organs. Importantly, a different picture emerged from gut associated mucosal sites: during ageing, CD4 T cell accumulation was progressively developing in colon and small intestine lamina propria and Peyer's patches. Similar trend was also observed in middle-aged SJL/B6 F1 mice. Interestingly, an inverse correlation was detected between CD4 T cell numbers in secondary lymphoid organs and colonic lamina propria of C57BL/6 mice whereas no increase in proliferation rate of GALT CD4 T cells was detected. In contrast to GALT, no CD4 T cell accumulation was detected in lungs and liver in middle-aged animals. Finally, the concomitant accumulation of CD4 T cell in GALT and depletion in secondary lymphoid organs during ageing was detected both in male and female animals. Our data thus demonstrate that T cell lymphopenia in secondary lymphoid organs currently associated to ageing is not sustained in gut or lung mucosa associated lymphoid tissues or non-lymphoid sites such as the liver. The inverse correlation between CD4 T cell numbers in secondary lymphoid organs and colonic lamina propria and the absence of overt proliferation in GALT suggest that marked CD4 T cell decay in secondary
Platelet-Rich Blood Derivatives for Stem Cell-Based Tissue Engineering and Regeneration
Masoudi, E.A.; Ribas, J.; Kaushik, G.; Leijten, Jeroen Christianus Hermanus; Khademhosseini, A.
2016-01-01
Platelet-rich blood derivatives have been widely used in different fields of medicine and stem cell-based tissue engineering. They represent natural cocktails of autologous growth factors, which could provide an alternative for recombinant protein-based approaches. Platelet-rich blood derivatives,
Jurgens, W.J.F.M.; Oedayrajsingh-Varma, M.J.; Helder, M.N.; Zandieh Doulabi, B.; Schouten, T.E.; Kuik, D.J.; Ritt, M.J.P.F.; van Milligen-Kummer, F.J.
2008-01-01
The stromal vascular fraction (SVF) of adipose tissue contains an abundant population of multipotent adipose-tissue-derived stem cells (ASCs) that possess the capacity to differentiate into cells of the mesodermal lineage in vitro. For cell-based therapies, an advantageous approach would be to
Restoring Cytokine Balance in HIV-Positive Individuals with Low CD4 T Cell Counts
Valdivia, Anddre; Ly, Judy; Gonzalez, Leslie; Hussain, Parveen; Saing, Tommy; Islamoglu, Hicret; Pearce, Daniel; Ochoa, Cesar
2017-01-01
Abstract HIV infects and destroys CD4+ T cells leading to a compromised immune system. In a double-blinded study, a group of HIV-infected individuals with CD4+ T cell counts below 350 cells/mm3 were given either an empty liposomal supplement or a liposomal glutathione (L-GSH) supplement to take over a 3-month period. Baseline measurements in HIV-positive subjects show a significant decrease in levels of interleukin (IL)-12, IL-2, and interferon (IFN)-γ, along with a substantial increase in the levels of IL-6, IL-10, transforming growth factor (TGF)-β, and free radicals, compared to healthy individuals. Supplementation of HIV-positive subjects with L-GSH for 3 months resulted in a notable increase in the levels of IL-12, IL-2, and IFN-γ, with a concomitant decrease in the levels of IL-6, IL-10, and free radicals, and stabilization in the levels of TGF-β, IL-1, and IL-17, compared to their placebo counterparts. Levels of free radicals in CD4+ T cells stabilized, while GSH levels increased in the treatment group. Those in the placebo group showed no significant difference throughout the study. In summary, supplementation with L-GSH in HIV-infected individuals with CD4+ T cell counts below 350 cells/mm3 can help restore redox homeostasis and cytokine balance, therefore aiding the immune system to control opportunistic infections. PMID:28398068
Nagura, Issei; Kokubu, Takeshi; Mifune, Yutaka; Inui, Atsuyuki; Takase, Fumiaki; Ueda, Yasuhiro; Kataoka, Takeshi; Kurosaka, Masahiro
2016-03-31
It is important to regenerate the tendon-to-bone interface after rotator cuff repair to prevent re-tears. The cells from torn human rotator cuff were targeted, and their capacity for multilineage differentiation was investigated. The edges of the rotator cuff were harvested during arthroscopic rotator cuff repair from nine patients, minced into pieces, and cultured on dishes. Adherent cells were cultured, phenotypically characterized. Then expandability, differentiation potential and gene expression were analyzed. Flow cytometry revealed that the mesenchymal stem cells (MSC)-related markers CD29, CD44, CD105, and CD166 were positive. However, CD14, CD34, and CD45 were negative. On RT-PCR analyses, the cells showed osteogenic, adipogenic, and chondrogenic potential after 3 weeks of culture under the respective differentiation conditions. In addition, SOX9, type II collagen, and type X collagen expression patterns during chondrogenesis were similar to those of endochondral ossification at the enthesis. The cells derived from torn human rotator cuff are multipotent mesenchymal stem cells with the ability to undergo multilineage differentiation, suggesting that MSCs form this tissue could be regenerative capacity for potential self-repair.
Critical illness induces alternative activation of M2 macrophages in adipose tissue.
Langouche, Lies; Marques, Mirna B; Ingels, Catherine; Gunst, Jan; Derde, Sarah; Vander Perre, Sarah; D'Hoore, André; Van den Berghe, Greet
2011-01-01
We recently reported macrophage accumulation in adipose tissue of critically ill patients. Classically activated macrophage accumulation in adipose tissue is a known feature of obesity, where it is linked with increasing insulin resistance. However, the characteristics of adipose tissue macrophage accumulation in critical illness remain unknown. We studied macrophage markers with immunostaining and gene expression in visceral and subcutaneous adipose tissue from healthy control subjects (n = 20) and non-surviving prolonged critically ill patients (n = 61). For comparison, also subcutaneous in vivo adipose tissue biopsies were studied from 15 prolonged critically ill patients. Subcutaneous and visceral adipose tissue biopsies from non-surviving prolonged critically ill patients displayed a large increase in macrophage staining. This staining corresponded with elevated gene expression of "alternatively activated" M2 macrophage markers arginase-1, IL-10 and CD163 and low levels of the "classically activated" M1 macrophage markers tumor necrosis factor (TNF)-α and inducible nitric-oxide synthase (iNOS). Immunostaining for CD163 confirmed positive M2 macrophage staining in both visceral and subcutaneous adipose tissue biopsies from critically ill patients. Surprisingly, circulating levels and tissue gene expression of the alternative M2 activators IL-4 and IL-13 were low and not different from controls. In contrast, adipose tissue protein levels of peroxisome proliferator-activated receptor-γ (PPARγ), a nuclear receptor required for M2 differentiation and acting downstream of IL-4, was markedly elevated in illness. In subcutaneous abdominal adipose tissue biopsies from surviving critically ill patients, we could confirm positive macrophage staining with CD68 and CD163. We also could confirm elevated arginase-1 gene expression and elevated PPARγ protein levels. Unlike obesity, critical illness evokes adipose tissue accumulation of alternatively activated M2
Directory of Open Access Journals (Sweden)
Hernán Trimarchi
2017-05-01
Full Text Available Background: Podocyturia may determine the evolution to podocytopenia, glomerulosclerosis, and renal failure. According to the Oxford classification of IgA nephropathy (IgAN, the S1 lesion describes glomerulosclerosis. Urokinase-type plasminogen activator receptor (uPAR participates in podocyte attachment, while CD80 increases in glomerulosclerosis. We measured uPAR-positive urinary podocytes and urinary CD80 (uCD80 in controls and in IgAN subjects with M1E0S0T0 and M1E0S1T0 Oxford scores to assess a potential association between podocyturia, inflammation, and glomerulosclerosis. Methods: The groups were as follows: controls (G1, n = 20 and IgAN group (G2, n = 39, subdivided into M1E0S0T0 (G2A, n = 21 and M1E0S1T0 (G2B, n = 18. Among the included variables, we determined uPAR-positive podocytes/gram of urinary creatinine (gUrCr and uCD80 ng/gUrCr. Biopsies with interstitial fibrosis and tubular atrophy <10% were included. Results: Groups were not different in age and gender; urinary protein-creatinine (uP/C ratio, Chronic Kidney Disease-Epidemiology Collaboration (CKD-EPI equation, uPAR-positive podocytes/gUrCr, and uCD80 were significantly increased in G2 versus G1. G2A and G2B were not different in age, gender, hypertension, and follow-up. G2B displayed significantly higher uP/C, uPAR-positive podocytes, uCD80, and lower CKD-EPI versus G2A. Strong significant correlations were encountered between uCD80 and podocyturia in G2A and G2B. However, when G1 was compared to G2A and G2B separately, the differences with respect to uP/C, uPAR-positive podocytes, and podocyturia were significantly stronger versus G2B than versus G2A. Conclusions: IgAN presents elevated uCD80 excretion and uPAR-positive podocyturia, while CD80 correlates with podocyturia. Glomerulosclerosis (S1 at the time of biopsy is associated with higher uP/C, lower renal function, increased uPAR-positive podocyturia, and CD80 excretion, and is independent of M1. In IgAN, uPAR may
The Tissue Analysis Core (TAC) within the AIDS and Cancer Virus Program will process, embed, and perform microtomy on fixed tissue samples presented in ethanol. CD4 (DAB) and CD68/CD163 (FastRed) double immunohistochemistry will be performed, allowin
Directory of Open Access Journals (Sweden)
Gerhard Wenz
2012-11-01
Full Text Available Various heptasubstituted derivatives of β-cyclodextrin (β-CD bearing 1, 2 and 3 methyl substituents per glucose unit were synthesized by regioselective methods. Binding free energies and binding enthalpies of these hosts towards 4-tert-butylbenzoate and adamantane-1-carboxylate were determined by isothermal titration microcalorimetry (ITC. It was found that methyl substituents at the secondary positions of β-CD lead to a tremendous reduction of the binding potential, while methylation at the primary positions significantly improved binding. Stabilizing intramolecular hydrogen bonds between the glucose units were made responsible for the high binding potentials of those β-CD derivatives that possess secondary hydroxy groups.
Directory of Open Access Journals (Sweden)
Sean M. Devitt
2015-01-01
Full Text Available We examined cell isolation, viability, and growth in adipose-derived stem cells harvested from whole adipose tissue subject to different cryopreservation lengths (2–1159 days from patients of varying ages (26–62 years. Subcutaneous abdominal adipose tissue was excised during abdominoplasties and was cryopreserved. The viability and number of adipose-derived stem cells isolated were measured after initial isolation and after 9, 18, and 28 days of growth. Data were analyzed with respect to cryopreservation duration and patient age. Significantly more viable cells were initially isolated from tissue cryopreserved 2 years, irrespective of patient age. However, this difference did not persist with continued growth and there were no significant differences in cell viability or growth at subsequent time points with respect to cryopreservation duration or patient age. Mesenchymal stem cell markers were maintained in all cohorts tested throughout the duration of the study. Consequently, longer cryopreservation negatively impacts initial live adipose-derived stem cell isolation; however, this effect is neutralized with continued cell growth. Patient age does not significantly impact stem cell isolation, viability, or growth. Cryopreservation of adipose tissue is an effective long-term banking method for isolation of adipose-derived stem cells in patients of varying ages.
Wu, J; Lu, M; Li, Y; Shang, Y-K; Wang, S-J; Meng, Y; Wang, Z; Li, Z-S; Chen, H; Chen, Z-N; Bian, H
2016-10-20
Cellular plasticity has an important role in the progression of hepatocellular carcinoma (HCC). In this study, the involvement of a TGF-β1-CD147 self-sustaining network in the regulation of the dedifferentiation progress was fully explored in HCC cell lines, hepatocyte-specific basigin/CD147-knockout mice and human HCC tissues. We demonstrated that TGF-β1 stimulation upregulated CD147 expression and mediated the dedifferentiation of HCC cells, whereas all-trans-retinoic acid induced the downregulation of CD147 and promoted differentiation in HCC cells. Overexpression of CD147 induced the dedifferentiation and enhanced the malignancy of HCC cells, and increased the transcriptional expression of TGF-β1 by activating β-catenin. CD147-induced matrix metalloproteinase (MMP) production activated pro-TGF-β1. The activated TGF-β1 signaling subsequently repressed the HNF4α expression via Smad-Snail1 signaling and enhanced the dedifferentiation progress. Hepatocyte-specific basigin/CD147-knockout mice decreased the susceptibility to N-nitrosodiethylamine-induced tumorigenesis by suppressing TGF-β1-CD147 signaling and inhibiting dedifferentiation in hepatocytes during tumor progression. CD147 was positively correlated with TGF-β1 and negatively correlated with HNF4α in human HCC tissues. Positive CD147 staining and lower HNF4α levels in tumor tissues were significantly associated with poor survival of patients with HCC. The overexpression of HNF4α and Smad7 and the deletion of CD147 by lentiviral vectors jointly reprogrammed the expression profile of hepatocyte markers and attenuated malignant properties including proliferation, cell survival and tumor growth of HCC cells. Our results highlight the important role of the TGF-β1-CD147 self-sustaining network in driving HCC development by regulating differentiation plasticity, which provides a strong basis for further investigations of the differentiation therapy of HCC targeting TGF-β1 and CD147.
Rho, Ho Sik; Hong, Soo Hyun; Park, Jongho; Jung, Hyo-Il; Park, Young-Ho; Lee, John Hwan; Shin, Song Seok; Noh, Minsoo
2014-05-01
The subcutaneous fat tissue mass gradually decreases with age, and its regulation is a strategy to develop anti-aging compounds to ameliorate the photo-aging of human skin. The adipogenesis of human adipose tissue-mesenchymal stem cells (hAT-MSCs) can be used as a model to discover novel anti-aging compounds. Cinnamomum cassia methanol extracts were identified as adipogenesis-promoting agents by natural product library screening. Cinnamates, the major chemical components of Cinnamomum cassia extracts, promoted adipogenesis in hAT-MSCs. We synthesized kojyl cinnamate ester derivatives to improve the pharmacological activity of cinnamates. Structure-activity studies of kojyl cinnamate derivatives showed that both the α,β-unsaturated carbonyl ester group and the kojic acid moiety play core roles in promoting adiponectin production during adipogenesis in hAT-MSCs. We conclude that kojyl cinnamate ester derivatives provide novel pharmacophores that can regulate adipogenesis in hAT-MSCs. Copyright © 2014 Elsevier Ltd. All rights reserved.
Katsiani, E; Garas, A; Skentou, C; Tsezou, A; Messini, C I; Dafopoulos, K; Daponte, A; Messinis, I E
2016-09-01
Mesenchymal stem cells (MSCs) can be obtained from a variety of human tissues. MSCs derived from placental chorionic villi of the first trimester are likely to resemble, biologically, embryonic stem cells (ESC), due to the earlier development stage of placenta. In the present study long-term cultures of MSC-like cells were assessed in order to evaluate MSCs multipotent characteristics and molecular features during the period of culture. CV-cells obtained from 10 samples of chorionic villus displayed typical fibroblastoid morphology, undergone 20 passages during a period of 120 days, maintaining a stable karyotype throughout long term expansion. The cells were positive, for CD90, CD73, CD105, CD29, CD44, HLA ABC antigens and negative for CD14, CD34, AC133, and HLA DR antigens as resulted from the flow cytometry analysis. CV-cells were differentiated in adipocytes, osteoblasts, chondrocytes and neuronal cells under specific culture conditions. The expression of the ESC-gene markers POU5F1 (Oct-4) and NANOG was observed at earliest stages (4-12 passages) and not at the late stages (14-20 passages) by RT-PCR analysis. ZFP42 and SOX2 expression were not detected. Moreover, CV-cells were found to express GATA4 but not NES (Nestin). Chorionic villi-derived cells possess multipotent properties, display high proliferation rate and self-renew capacity, share common surface antigens with adult MSCs and express certain embryonics stem cells gene markers. These characteristics highlight chorionic villi as an attractive source of MSCs for the needs of regenerative medicine.
Rentenaar, R. J.; Wever, P. C.; van Diepen, F. N.; Schellekens, P. T.; Wertheim, P. M.; ten Berge, I. J.
1999-01-01
BACKGROUND: T-lymphocytes that co-express CD4 and CD8 antigens may be found in small percentages in the peripheral blood of healthy individuals, and have a CD4brightCD8dull phenotype. CD4dullCD8bright T-lymphocytes have been found only in temporal association with some viral infections. METHODS:
Rudraraju, Rajeev; Surman, Sherri; Jones, Bart; Sealy, Robert; Woodland, David L; Hurwitz, Julia L
2011-02-20
Lymphocytes of the diffuse nasal-associated lymphoid tissue (d-NALT) are uniquely positioned to tackle respiratory pathogens at their point-of-entry, yet are rarely examined after intranasal (i.n.) vaccinations or infections. Here we evaluate an i.n. inoculation with Sendai virus (SeV) for elicitation of virus-specific antibody forming cells (AFCs) and CD8(+) T cells in the d-NALT. Virus-specific AFCs and CD8(+) T cells each appeared by day 7 after SeV inoculation and persisted for 8 months, explaining the long-sustained protection against respiratory virus challenge conferred by this vaccine. AFCs produced IgM, IgG1, IgG2a, IgG2b and IgA, while CD8+ T cells were cytolytic and produced low levels of cytokines. Phenotypic analyses of virus-specific T cells revealed striking similarities with pathogen-specific immune responses in the intestine, highlighting some key features of adaptive immunity at a mucosal site. Copyright © 2010 Elsevier Inc. All rights reserved.
Tumor Vesicle—Associated CD147 Modulates the Angiogenic Capability of Endothelial Cells
Directory of Open Access Journals (Sweden)
Danilo Millimaggi
2007-04-01
Full Text Available Matrix metalloproteinase (MMP degradation of extracellular matrix is thought to play an important role in invasion, angiogenesis, tumor growth, and metastasis. Several studies have demonstrated that CD147/ extracellular MMP inducer, a membrane-spanning molecule highly expressed in tumor cells, may be involved in the progression of malignancies by regulating expression of MMP in peritumoral stromal cells. In the present study we show that CD147 is expressed in microvesicles derived from epithelial ovarian cancer cells and that CD147-positive vesicles may promote an angiogenic phenotype in endothelial cells in vitro. Vesicles shed by human ovarian carcinoma cell lines OVCAR3, SKOV3, and A2780 expressed different levels of CD147 and stimulated proangiogenic activities of human umbilical vein endothelial cells (HUVECs in a CD147-dependent fashion (OVCAR3 > SKOV3 > A2780. Moreover, vesicles shed by ovarian carcinoma cell line CABA I with low CD147 expression had no significant effect on the development of angiogenic phenotype in HUVECs. The treatment of OVCAR3 cells with small interfering RNA against CD147 suppressed the angiogenic potential of OVCAR3-derived microvesicles. However, transfection of CD147 cDNA into the CABA I cell line enabled CABA I-derived vesicles to induce angiogenesis and to promote MMP genes expression in HUVECs. We therefore conclude that vesicles shed by ovarian cancer cells may induce proangiogenic activities of HUVECs by a CD147-mediated mechanism.
Sais, Giovanni; Wyler, Stephen; Hudolin, Tvrtko; Banzola, Irina; Mengus, Chantal; Bubendorf, Lukas; Wild, Peter J.; Hirsch, Hans H.; Sulser, Tullio; Spagnoli, Giulio C.
2012-01-01
The role of the polyomavirus BK (BKV) large tumor antigen (L-Tag) as a target of immune response in patients with prostate cancer (PCa) has not been investigated thus far. In this study, we comparatively analyzed humoral and cellular L-Tag-specific responsiveness in age-matched patients bearing PCa or benign prostatic hyperplasia, expressing or not expressing BKV L-Tag-specific sequences in their tissue specimens, and in non-age-matched healthy individuals. Furthermore, results from patients with PCa were correlated to 5-year follow-up clinical data focusing on evidence of biochemical recurrence (BR) after surgery (prostate specific antigen level of ≥0.2 ng/ml). In peripheral blood mononuclear cells (PBMC) from patients with PCa with evidence of BR and BKV L-Tag-positive tumors, stimulation with peptides derived from the BKV L-Tag but not those derived from Epstein-Barr virus, influenza virus, or cytomegalovirus induced a peculiar cytokine gene expression profile, characterized by high expression of interleukin-10 (IL-10) and transforming growth factor β1 and low expression of gamma interferon genes. This pattern was confirmed by protein secretion data and correlated with high levels of anti-BKV L-Tag IgG. Furthermore, in PBMC from these PCa-bearing patients, L-Tag-derived peptides significantly expanded an IL-10-secreting CD4+ CD25+(high) CD127− FoxP3+ T cell population with an effector memory phenotype (CD103+) capable of inhibiting proliferation of autologous anti-CD3/CD28-triggered CD4+ CD25− T cells. Collectively, our findings indicate that potentially tolerogenic features of L-Tag-specific immune response are significantly associated with tumor progression in patients with BKV+ PCa. PMID:22647697
Chen, Lujun; Lu, Yahua; Chu, Yang; Xie, Jun; Ding, Wen'ge; Wang, Fengming
2013-09-01
Angiogenesis, as well as pannus formation within the joint, plays an important role in the erosion of articular cartilage and bone in the pathological process of rheumatoid arthritis (RA). Tissue factor (TF), an essential initiator of the extrinsic pathway of blood coagulation, is also involved in the angiogenesis and the pannus formation of RA progression. In the present study, we used immunofluorescence and confocal scanning methods to characterize TF immunolocalization in RA synovium. We showed that positive staining of TF could be immunolocalized in synoviocytes, CD19(+) B cells and CD68(+) macrophages, whereas weak or negative staining of tissue factor could be found in CD34(+) endothelial cells of neo-vessels, CD3(+) T cells and CD14(+) monocytes in RA synovium tissues. Our study demonstrates a detailed local expression of TF in the rheumatoid synovium, and supports the notion that TF, expressed not only by the synoviocytes themselves, but also the infiltrating CD19(+) B cells and CD68(+) macrophages, is involved in the pannus invasion in the progression of rheumatoid arthritis. Copyright © 2013 Elsevier GmbH. All rights reserved.
Bose, Bipasha; Shenoy, P Sudheer
2016-01-01
Aging is accompanied by the functional decline of cells, tissues, and organs, as well as, a striking increase in susceptibility to a wide range of diseases. Within a tissue, both differentiated cells and adult stem cells are susceptible to intrinsic and extrinsic changes while aging. Muscle derived stem cells (MDSCs) are tissue specific stem cells which have been studied well for their multipotential nature. Although there are reports relating to diminished function and regenerative capacity of aged MDSCs as compared to their young counterparts, not much has been reported relating to the concomitant gain in unipotent nature of aged MDSCs. In this study, we report an inverse correlation between aging and expression of adult/mesenchymal stem cell markers and a direct correlation between aging and myogenecity in MDSCs. Aged MDSCs were able to generate a greater number of dystrophin positive myofibres, as compared to, the young MDSCs when transplanted in muscle of dystrophic mice. Our data, therefore, suggests that aging stress adds to the decline in stem cell characteristics with a concomitant increase in unipotency, in terms of, myogenecity of MDSCs. This study, hence, also opens the possibilities of using unipotent aged MDSCs as potential candidates for transplantation in patients with muscular dystrophies. Copyright © 2015. Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.
2009-01-01
MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.
CD133 (Prominin negative human neural stem cells are clonogenic and tripotent.
Directory of Open Access Journals (Sweden)
Yirui Sun
Full Text Available CD133 (Prominin is widely used as a marker for the identification and isolation of neural precursor cells from normal brain or tumor tissue. However, the assumption that CD133 is expressed constitutively in neural precursor cells has not been examined.In this study, we demonstrate that CD133 and a second marker CD15 are expressed heterogeneously in uniformly undifferentiated human neural stem (NS cell cultures. After fractionation by flow cytometry, clonogenic tripotent cells are found in populations negative or positive for either marker. We further show that CD133 is down-regulated at the mRNA level in cells lacking CD133 immunoreactivity. Cell cycle profiling reveals that CD133 negative cells largely reside in G1/G0, while CD133 positive cells are predominantly in S, G2, or M phase. A similar pattern is apparent in mouse NS cell lines. Compared to mouse NS cells, however, human NS cell cultures harbour an increased proportion of CD133 negative cells and display a longer doubling time. This may in part reflect a sub-population of slow- or non-cycling cells amongst human NS cells because we find that around 5% of cells do not take up BrdU over a 14-day labelling period. Non-proliferating NS cells remain undifferentiated and at least some of them are capable of re-entry into the cell cycle and subsequent continuous expansion.The finding that a significant fraction of clonogenic neural stem cells lack the established markers CD133 and CD15, and that some of these cells may be dormant or slow-cycling, has implications for approaches to identify and isolate neural stem cells and brain cancer stem cells. Our data also suggest the possibility that CD133 may be specifically down-regulated during G0/G1, and this should be considered when this marker is used to identify and isolate other tissue and cancer stem cells.
Newey, Sarah E; Tsaknakis, Grigorios; Khoo, Cheen P; Athanassopoulos, Thanassi; Camicia, Rosalba; Zhang, Youyi; Grabowska, Rita; Harris, Adrian L; Roubelakis, Maria G; Watt, Suzanne M
2014-11-15
Proangiogenic factors, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 (FGF-2) prime endothelial cells to respond to "hematopoietic" chemokines and cytokines by inducing/upregulating expression of the respective chemokine/cytokine receptors. Coculture of human endothelial colony forming cell (ECFC)-derived cells with human stromal cells in the presence of VEGF and FGF-2 for 14 days resulted in upregulation of the "hematopoietic" chemokine CXCL12 and its CXCR4 receptor by day 3 of coculture. Chronic exposure to the CXCR4 antagonist AMD3100 in this vasculo/angiogenesis assay significantly reduced vascular tubule formation, an observation recapitulated by delayed AMD3100 addition. While AMD3100 did not affect ECFC-derived cell proliferation, it did demonstrate a dual action. First, over the later stages of the 14-day cocultures, AMD3100 delayed tubule organization into maturing vessel networks, resulting in enhanced endothelial cell retraction and loss of complexity as defined by live cell imaging. Second, at earlier stages of cocultures, we observed that AMD3100 significantly inhibited the integration of exogenous ECFC-derived cells into established, but immature, vascular networks. Comparative proteome profiler array analyses of ECFC-derived cells treated with AMD3100 identified changes in expression of potential candidate molecules involved in adhesion and/or migration. Blocking antibodies to CD31, but not CD146 or CD166, reduced the ECFC-derived cell integration into these extant vascular networks. Thus, CXCL12 plays a key role not only in endothelial cell sensing and guidance, but also in promoting the integration of ECFC-derived cells into developing vascular networks.
Improvement of adipose tissue-derived cells by low-energy extracorporeal shock wave therapy.
Priglinger, Eleni; Schuh, Christina M A P; Steffenhagen, Carolin; Wurzer, Christoph; Maier, Julia; Nuernberger, Sylvia; Holnthoner, Wolfgang; Fuchs, Christiane; Suessner, Susanne; Rünzler, Dominik; Redl, Heinz; Wolbank, Susanne
2017-09-01
Cell-based therapies with autologous adipose tissue-derived cells have shown great potential in several clinical studies in the last decades. The majority of these studies have been using the stromal vascular fraction (SVF), a heterogeneous mixture of fibroblasts, lymphocytes, monocytes/macrophages, endothelial cells, endothelial progenitor cells, pericytes and adipose-derived stromal/stem cells (ASC) among others. Although possible clinical applications of autologous adipose tissue-derived cells are manifold, they are limited by insufficient uniformity in cell identity and regenerative potency. In our experimental set-up, low-energy extracorporeal shock wave therapy (ESWT) was performed on freshly obtained human adipose tissue and isolated adipose tissue SVF cells aiming to equalize and enhance stem cell properties and functionality. After ESWT on adipose tissue we could achieve higher cellular adenosine triphosphate (ATP) levels compared with ESWT on the isolated SVF as well as the control. ESWT on adipose tissue resulted in a significantly higher expression of single mesenchymal and vascular marker compared with untreated control. Analysis of SVF protein secretome revealed a significant enhancement in insulin-like growth factor (IGF)-1 and placental growth factor (PLGF) after ESWT on adipose tissue. Summarizing we could show that ESWT on adipose tissue enhanced the cellular ATP content and modified the expression of single mesenchymal and vascular marker, and thus potentially provides a more regenerative cell population. Because the effectiveness of autologous cell therapy is dependent on the therapeutic potency of the patient's cells, this technology might raise the number of patients eligible for autologous cell transplantation. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Espersen, C; Pakkenberg, B; Harder, Eva
2001-01-01
-seropositive patients and seven HIV-negative patients. Eleven of the HIV-positive patients died within 78 months of biopsy time and 10 patients were alive on July 1, 1998. Double immunohistochemical staining procedures were developed to identify CD8(+) cells expressing CD45R0, granzyme B, and Ki-67. A stereological...... method was used to count the different cell types in the lymph nodes. There were no significant differences in the total cell (nucleated) and CD3(+) cell concentrations between the three groups. However, there were significantly higher concentrations of CD3(+)CD8(+), CD8(+)CD45R0(+), and CD8(+)Ki-67...... of biopsy time, were among the patients with the lowest concentrations of CD8(+)granzyme B(+) and CD8(+)Ki-67(+) lymphocytes. This finding allowed us to conclude that CD8(+) lymphocytes expressing high levels of CD45R0, granzyme B, and Ki-67 in lymph nodes of HIV patients are not related to increased...
Circulating cell-derived microparticles in women with pregnancy loss.
Alijotas-Reig, Jaume; Palacio-Garcia, Carles; Farran-Codina, Immaculada; Zarzoso, Cristina; Cabero-Roura, Luis; Vilardell-Tarres, Miquel
2011-09-01
To analyze cell-derived microparticles (cMP) in pregnancy loss (PL), both recurrent miscarriages (RM) and unexplained fetal loss (UFL). Non-matched case-control study was performed at Vall d'Hebron Hospital. Cell-derived microparticles of 53 PL cases, 30 with RM, 16 with UFL, and 7 (RM + UFL), were compared to 38 healthy pregnant women. Twenty healthy non-pregnant women act as controls. Cell-derived microparticles were analyzed through flow cytometry. Results are given as total annexin (A5+), endothelial-(CD144+/CD31+ CD41-), platelet-(CD41+), leukocyte-(CD45+) and CD41- c-MP/μL of plasma. Antiphospholipid antibodies (aPLA) were analyzed according to established methods. Comparing PL versus healthy pregnant, we observed a significant endothelial cMP decrease in PL. When comparing RM subgroup with controls, we observed significant decreases in endothelial cMP. When comparing the PL positive for aPLA versus PL-aPLA-negative, no cMP numbering differences were seen. Pregnancy loss seems to be related to endothelial cell activation and/or consumption. A relationship between aPLA and cMP could not be demonstrated. © 2011 John Wiley & Sons A/S.
40 CFR 146.2 - Law authorizing these regulations.
2010-07-01
... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...
Park, In-Su; Chung, Phil-Sang; Ahn, Jin Chul; Leproux, Anais
2017-11-01
Skin flap grafting is a form of transplantation widely used in plastic surgery. However, ischemia/reperfusion injury is the main factor which reduces the survival rate of flaps following grafting. We investigated whether photobiomodulation (PBM) precondition prior to human adipose-derived stromal cell (hASC) spheroid (PBM-spheroid) transplantation improved skin tissue functional recovery by the stimulation of angiogenesis and tissue regeneration in skin flap of mice. The LED had an emission wavelength peaked at 660 ± 20 nm (6 J/cm 2 , 10 mW/cm 2 ). The expression of angiogenic growth factors in PBM-spheroid hASCs was much greater than that of not-PBM-treated spheroid or monolayer-cultured hASCs. From immunochemical staining analysis, the hASCs of PBM-spheroid were CD31 + , KDR + , and CD34 + , whereas monolayer-cultured hASCs were negative for these markers. To evaluate the therapeutic effect of hASC PBM-spheroid in vivo, PBS, monolayer-cultured hASCs, and not-PBM-spheroid were transplanted into a skin flap model. The animals were observed for 14 days. The PBM-spheroid hASCs transplanted into the skin flap ischemia differentiated into endothelial cells and remained differentiated. Transplantation of PBM-spheroid hASCs into the skin flap ischemia significantly elevated the density of vascular formations through angiogenic factors released by the skin flap ischemia and enhanced tissue regeneration at the lesion site. Consistent with these results, the transplantation of PBM-spheroid hASCs significantly improved functional recovery compared with PBS, monolayer-cultured hASCs, and not-PBM-spheroid treatment. These findings suggest that transplantation of PBM-spheroid hASCs may be an effective stem cell therapy for the treatment of skin flap ischemia.
Kim, Eunjeong; Ma, Eunsook
2007-04-01
The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.
Directory of Open Access Journals (Sweden)
Sabine eKuhn
2015-11-01
Full Text Available Tumors harbor several populations of dendritic cells with the ability to prime tumor-specific T cells. However, these T cells mostly fail to differentiate into armed effectors and are unable to control tumor growth. We have previously shown that treatment with immunostimulatory agents at the tumor site can activate anti-tumor immune responses, and is associated with the appearance of a population of monocyte-derived dendritic cells in the tumor and tumor-draining lymph node. Here we use dendritic cell or monocyte depletion and monocyte transfer to show that these monocyte-derived dendritic cells are critical to the activation of anti-tumor immune responses. Treatment with the immunostimulatory agents Monosodium Urate crystals and Mycobacterium smegmatis induced the accumulation of monocytes in the draining lymph node, their upregulation of CD11c and MHCII, and expression of iNOS, TNFα and IL12p40. Blocking monocyte entry into the lymph node and tumor through neutralization of the chemokine CCL2 or inhibition of Colony Stimulating Factor-1 receptor signaling prevented the generation of monocyte-derived dendritic cells, the infiltration of tumor-specific T cells into the tumor, and anti-tumor responses. In a reciprocal fashion, monocytes transferred into mice depleted of CD11c+ cells were sufficient to rescue CD8+ T cell priming in lymph node and delay tumor growth. Thus monocytes exposed to the appropriate conditions become powerful activators of tumor-specific CD8+ T cells and anti-tumor immunity.
DDX4 (DEAD box polypeptide 4) colocalizes with cancer stem cell marker CD133 in ovarian cancers
International Nuclear Information System (INIS)
Kim, Ki Hyung; Kang, Yun-Jeong; Jo, Jin-Ok; Ock, Mee Sun; Moon, Soo Hyun; Suh, Dong Soo; Yoon, Man Soo; Park, Eun-Sil; Jeong, Namkung; Eo, Wan-Kyu; Kim, Heung Yeol; Cha, Hee-Jae
2014-01-01
Highlights: • Germ cell marker DDX4 was significantly increased in ovarian cancer. • Ovarian cancer stem cell marker CD133 was significantly increased in ovarian cancer. • DDX4 and CD133 were mostly colocalized in various types of ovarian cancer tissues. • CD133 positive ovarian cancer cells also express DDX4 whereas CD133-negative cells did not possess DDX4. • Germ cell marker DDX4 has the potential of ovarian cancer stem cell marker. - Abstract: DDX4 (DEAD box polypeptide 4), characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), is an RNA helicase which is implicated in various cellular processes involving the alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. DDX4 is known to be a germ cell-specific protein and is used as a sorting marker of germline stem cells for the production of oocytes. A recent report about DDX4 in ovarian cancer showed that DDX4 is overexpressed in epithelial ovarian cancer and disrupts a DNA damage-induced G2 checkpoint. We investigated the relationship between DDX4 and ovarian cancer stem cells by analyzing the expression patterns of DDX4 and the cancer stem cell marker CD133 in ovarian cancers via tissue microarray. Both DDX4 and CD133 were significantly increased in ovarian cancer compared to benign tumors, and showed similar patterns of expression. In addition, DDX4 and CD133 were mostly colocalized in various types of ovarian cancer tissues. Furthermore, almost all CD133 positive ovarian cancer cells also express DDX4 whereas CD133-negative cells did not possess DDX4, suggesting a strong possibility that DDX4 plays an important role in cancer stem cells, and/or can be used as an ovarian cancer stem cell marker
CD38 Structure-Based Inhibitor Design Using the N1-Cyclic Inosine 5'-Diphosphate Ribose Template.
Directory of Open Access Journals (Sweden)
Christelle Moreau
Full Text Available Few inhibitors exist for CD38, a multifunctional enzyme catalyzing the formation and metabolism of the Ca(2+-mobilizing second messenger cyclic adenosine 5'-diphosphoribose (cADPR. Synthetic, non-hydrolyzable ligands can facilitate structure-based inhibitor design. Molecular docking was used to reproduce the crystallographic binding mode of cyclic inosine 5'-diphosphoribose (N1-cIDPR with CD38, revealing an exploitable pocket and predicting the potential to introduce an extra hydrogen bond interaction with Asp-155. The purine C-8 position of N1-cIDPR (IC50 276 µM was extended with an amino or diaminobutane group and the 8-modified compounds were evaluated against CD38-catalyzed cADPR hydrolysis. Crystallography of an 8-amino N1-cIDPR:CD38 complex confirmed the predicted interaction with Asp-155, together with a second H-bond from a realigned Glu-146, rationalizing the improved inhibition (IC50 56 µM. Crystallography of a complex of cyclic ADP-carbocyclic ribose (cADPcR, IC50 129 µM with CD38 illustrated that Glu-146 hydrogen bonds with the ligand N6-amino group. Both 8-amino N1-cIDPR and cADPcR bind deep in the active site reaching the catalytic residue Glu-226, and mimicking the likely location of cADPR during catalysis. Substantial overlap of the N1-cIDPR "northern" ribose monophosphate and the cADPcR carbocyclic ribose monophosphate regions suggests that this area is crucial for inhibitor design, leading to a new compound series of N1-inosine 5'-monophosphates (N1-IMPs. These small fragments inhibit hydrolysis of cADPR more efficiently than the parent cyclic compounds, with the best in the series demonstrating potent inhibition (IC50 = 7.6 µM. The lower molecular weight and relative simplicity of these compounds compared to cADPR make them attractive as a starting point for further inhibitor design.
Ultrasound-assisted liposuction provides a source for functional adipose-derived stromal cells.
Duscher, Dominik; Maan, Zeshaan N; Luan, Anna; Aitzetmüller, Matthias M; Brett, Elizabeth A; Atashroo, David; Whittam, Alexander J; Hu, Michael S; Walmsley, Graham G; Houschyar, Khosrow S; Schilling, Arndt F; Machens, Hans-Guenther; Gurtner, Geoffrey C; Longaker, Michael T; Wan, Derrick C
2017-12-01
Regenerative medicine employs human mesenchymal stromal cells (MSCs) for their multi-lineage plasticity and their pro-regenerative cytokine secretome. Adipose-derived mesenchymal stromal cells (ASCs) are concentrated in fat tissue, and the ease of harvest via liposuction makes them a particularly interesting cell source. However, there are various liposuction methods, and few have been assessed regarding their impact on ASC functionality. Here we study the impact of the two most popular ultrasound-assisted liposuction (UAL) devices currently in clinical use, VASER (Solta Medical) and Lysonix 3000 (Mentor) on ASCs. After lipoaspirate harvest and processing, we sorted for ASCs using fluorescent-assisted cell sorting based on an established surface marker profile (CD34 + CD31 - CD45 - ). ASC yield, viability, osteogenic and adipogenic differentiation capacity and in vivo regenerative performance were assessed. Both UAL samples demonstrated equivalent ASC yield and viability. VASER UAL ASCs showed higher osteogenic and adipogenic marker expression, but a comparable differentiation capacity was observed. Soft tissue healing and neovascularization were significantly enhanced via both UAL-derived ASCs in vivo, and there was no significant difference between the cell therapy groups. Taken together, our data suggest that UAL allows safe and efficient harvesting of the mesenchymal stromal cellular fraction of adipose tissue and that cells harvested via this approach are suitable for cell therapy and tissue engineering applications. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Fang Wang
2018-02-01
Full Text Available Smooth muscle differentiated adipose tissue-derived stem cells are a valuable resource for regeneration of gastrointestinal tissues, such as the gut and sphincters. Hypoxia has been shown to promote adipose tissue-derived stem cells proliferation and maintenance of pluripotency, but the influence of hypoxia on their smooth myogenic differentiation remains unexplored. This study investigated the phenotype and contractility of adipose-derived stem cells differentiated toward the smooth myogenic lineage under hypoxic conditions. Oxygen concentrations of 2%, 5%, 10%, and 20% were used during differentiation of adipose tissue-derived stem cells. Real time reverse transcription polymerase chain reaction and immunofluorescence staining were used to detect the expression of smooth muscle cells-specific markers, including early marker smooth muscle alpha actin, middle markers calponin, caldesmon, and late marker smooth muscle myosin heavy chain. The specific contractile properties of cells were verified with both a single cell contraction assay and a gel contraction assay. Five percent oxygen concentration significantly increased the expression levels of α-smooth muscle actin, calponin, and myosin heavy chain in adipose-derived stem cell cultures after 2 weeks of induction (p < 0.01. Cells differentiated in 5% oxygen conditions showed greater contraction effect (p < 0.01. Hypoxia influences differentiation of smooth muscle cells from adipose stem cells and 5% oxygen was the optimal condition to generate smooth muscle cells that contract from adipose stem cells.
Energy Technology Data Exchange (ETDEWEB)
Lecourt, Severine, E-mail: severine.lecourt@sls.aphp.fr [UPMC/AIM UMR S 974, Groupe Hospitalier Pitie-Salpetriere, Paris (France); INSERM U974, Groupe Hospitalier Pitie-Salpetriere, Paris (France); CNRS UMR 7215, Groupe Hospitalier Pitie-Salpetriere, Paris (France); Laboratoire de Therapie Cellulaire, Hopital Saint Louis, Paris (France); Marolleau, Jean-Pierre, E-mail: Marolleau.Jean-Pierre@chu-amiens.fr [Laboratoire de Therapie Cellulaire, Hopital Saint Louis, Paris (France); CHU Amiens Hopital Sud, Service d' Hematologie Clinique, UPJV, Amiens (France); Fromigue, Olivia, E-mail: olivia.fromigue@larib.inserm.fr [INSERM U606, Universite Paris 07, Hopital Lariboisiere, Paris (France); Vauchez, Karine, E-mail: k.vauchez@institut-myologie.org [UPMC/AIM UMR S 974, Groupe Hospitalier Pitie-Salpetriere, Paris (France); INSERM U974, Groupe Hospitalier Pitie-Salpetriere, Paris (France); CNRS UMR 7215, Groupe Hospitalier Pitie-Salpetriere, Paris (France); Genzyme S.A.S., Saint-Germain en Laye (France); Andriamanalijaona, Rina, E-mail: rinandria@yahoo.fr [Laboratoire de Biochimie des Tissus Conjonctifs, Faculte de Medecine, Caen (France); Ternaux, Brigitte, E-mail: brigitte.ternaux@orange.fr [Laboratoire de Therapie Cellulaire, Hopital Saint Louis, Paris (France); Lacassagne, Marie-Noelle, E-mail: mnlacassagne@free.fr [Laboratoire de Therapie Cellulaire, Hopital Saint Louis, Paris (France); Robert, Isabelle, E-mail: isa-robert@hotmail.fr [Laboratoire de Therapie Cellulaire, Hopital Saint Louis, Paris (France); Boumediene, Karim, E-mail: karim.boumediene@unicaen.fr [Laboratoire de Biochimie des Tissus Conjonctifs, Faculte de Medecine, Caen (France); Chereau, Frederic, E-mail: fchereau@pervasistx.com [Myosix S.A., Saint-Germain en Laye (France); Marie, Pierre, E-mail: pierre.marie@larib.inserm.fr [INSERM U606, Universite Paris 07, Hopital Lariboisiere, Paris (France); and others
2010-09-10
Human skeletal muscle is an essential source of various cellular progenitors with potential therapeutic perspectives. We first used extracellular markers to identify in situ the main cell types located in a satellite position or in the endomysium of the skeletal muscle. Immunohistology revealed labeling of cells by markers of mesenchymal (CD13, CD29, CD44, CD47, CD49, CD62, CD73, CD90, CD105, CD146, and CD15 in this study), myogenic (CD56), angiogenic (CD31, CD34, CD106, CD146), hematopoietic (CD10, CD15, CD34) lineages. We then analysed cell phenotypes and fates in short- and long-term cultures of dissociated muscle biopsies in a proliferation medium favouring the expansion of myogenic cells. While CD56{sup +} cells grew rapidly, a population of CD15{sup +} cells emerged, partly from CD56{sup +} cells, and became individualized. Both populations expressed mesenchymal markers similar to that harboured by human bone marrow-derived mesenchymal stem cells. In differentiation media, both CD56{sup +} and CD15{sup +} cells shared osteogenic and chondrogenic abilities, while CD56{sup +} cells presented a myogenic capacity and CD15{sup +} cells presented an adipogenic capacity. An important proportion of cells expressed the CD34 antigen in situ and immediately after muscle dissociation. However, CD34 antigen did not persist in culture and this initial population gave rise to adipogenic cells. These results underline the diversity of human muscle cells, and the shared or restricted commitment abilities of the main lineages under defined conditions.
Wang, F; Zhu, W; Liu, T; Sun, Z; Ju, S; Ju, S; Yu, G; Xie, W; Deng, Z; Lu, B; Zhang, X
2007-01-01
ICOS-L, a newly identified member of B7 superfamily, plays an important role in immune responses. In this article, we report on two novel mouse anti-human ICOS-L monoclonal antibodies (mAbs) named as 11C4 and 12B11, whose specificities were verified by methods of flow cytometry, western blotting, and epitope competition assay. The two mAbs bound to distinct ICOS-L epitopes on B cells. Interestingly, mAb 11C4 could well recognize ICOS-L molecule on activated T cells and Jurkat cell lines, which is different from commercial anti-ICOS-L mAb (clone number MIH12) and the other mAb 12B11. In addition, we found that the expression of ICOS-L molecule was only detected on the surface of immature monocyte-derived dendritic cells (Mo-DCs) and was sharply decreased after induction of mature Mo-DCs activated by tumor necrosis factor-alpha or CD40. Furthermore, we showed that 11C4 could effectively suppress the maturation of Mo-DCs in vitro as evidenced by the low expression of CD80, CD86, CD83, and human leukocyte antigen-DR, which suggested that ICOS-L may be involved in the maturation of Mo-DCs. Using immunohistochemistry staining with mAb 11C4, the expression of ICOS-L was found in B lymphoma tissues and thyroid tissues from the Grave's disease but not in thyroid adenoma and normal thyroid tissues.
22 CFR 146.400 - Education programs or activities.
2010-04-01
... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...
19 CFR 146.13 - Customs forms and procedures.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...
19 CFR 146.10 - Authority to examine merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...
Reddy, Jay P; Atkinson, Rachel L; Larson, Richard; Burks, Jared K; Smith, Daniel; Debeb, Bisrat G; Ruffell, Brian; Creighton, Chad J; Bambhroliya, Arvind; Reuben, James M; Van Laere, Steven J; Krishnamurthy, Savitri; Symmans, William F; Brewster, Abenaa M; Woodward, Wendy A
2018-06-01
We hypothesized that breast tissue not involved by tumor in inflammatory breast cancer (IBC) patients contains intrinsic differences, including increased mammary stem cells and macrophage infiltration, which may promote the IBC phenotype. Normal breast parenchyma ≥ 5 cm away from primary tumors was obtained from mastectomy specimens. This included an initial cohort of 8 IBC patients and 60 non-IBC patients followed by a validation cohort of 19 IBC patients and 25 non-IBC patients. Samples were immunostained for either CD44 + CD49f + CD133/2 + mammary stem cell markers or the CD68 macrophage marker and correlated with IBC status. Quantitation of positive cells was determined using inForm software from PerkinElmer. We also examined the association between IBC status and previously published tumorigenic stem cell and IBC tumor signatures in the validation cohort samples. 8 of 8 IBC samples expressed isolated CD44 + CD49f + CD133/2 + stem cell marked cells in the initial cohort as opposed to 0/60 non-IBC samples (p = 0.001). Similarly, the median number of CD44 + CD49f + CD133/2 + cells was significantly higher in the IBC validation cohort as opposed to the non-IBC validation cohort (25.7 vs. 14.2, p = 0.007). 7 of 8 IBC samples expressed CD68 + histologically confirmed macrophages in initial cohort as opposed to 12/48 non-IBC samples (p = 0.001). In the validation cohort, the median number of CD68 + cells in IBC was 3.7 versus 1.0 in the non-IBC cohort (p = 0.06). IBC normal tissue was positively associated with a tumorigenic stem cell signature (p = 0.02) and with a 79-gene IBC signature (p stem cell signature and IBC-specific tumor signature. Collectively, these data suggest that IBC normal tissue differs from non-IBC tissue. Whether these changes occur before the tumor develops or is induced by tumor warrants further investigation.
Cohen, Shahar; Leshansky, Lucy; Zussman, Eyal; Burman, Michael; Srouji, Samer; Livne, Erella; Abramov, Natalie; Itskovitz-Eldor, Joseph
2010-10-01
The use of stem cells for tissue engineering (TE) encourages scientists to design new platforms in the field of regenerative and reconstructive medicine. Human embryonic stem cells (hESC) have been proposed to be an important cell source for cell-based TE applications as well as an exciting tool for investigating the fundamentals of human development. Here, we describe the efficient derivation of connective tissue progenitors (CTPs) from hESC lines and fetal tissues. The CTPs were significantly expanded and induced to generate tendon tissues in vitro, with ultrastructural characteristics and biomechanical properties typical of mature tendons. We describe a simple method for engineering tendon grafts that can successfully repair injured Achilles tendons and restore the ankle joint extension movement in mice. We also show the CTP's ability to differentiate into bone, cartilage, and fat both in vitro and in vivo. This study offers evidence for the possibility of using stem cell-derived engineered grafts to replace missing tissues, and sets a basic platform for future cell-based TE applications in the fields of orthopedics and reconstructive surgery.
International Nuclear Information System (INIS)
Santos, Beate S.; Farias, Patricia M.A. de; Menezes, Frederico D. de; Ferreira, Ricardo C. de; Junior, Severino A.; Figueiredo, Regina C.B.Q.; de Carvalho, Luiz B. Jr.; Beltrao, Eduardo I.C.
2006-01-01
We report the use of CdS/Cd(OH) 2 quantum dots functionalized with glutaraldehyde and conjugated to concanavalin-A (Con-A) lectin to investigate cell alterations regarding carbohydrate profile in human mammary tissues diagnosed as fibroadenoma (benigne tumor). The Con-A lectin is a biomolecule which binds specifically to glucose/mannose residues present in the cellular membrane. These bioconjugated-particles were incubated with tissue sections of normal and to Fibroadenoma, a benign type of mammary tumor. The tissue sections were deparafinized, hydrated in graded alcohol and treated with a solution of Evans Blue in order to avoid autofluorescence. The fluorescence intensity of QD-Con-A stained tissues showed different patterns which reflect the carbohydrate expression of glucose/mannose in fibroadenoma when compared to the detection of the normal carbohydrate expression. The pattern of inespecific labeling of the tissues with glutharaldehyde functionalized CdS/Cd(OH) 2 quantum dots is compared to the targeting driven by the Con-A lectin. The preliminary findings reported here support the use of CdS/Cd(OH) 2 quantum dots as specific probes of cellular alterations possibiliting their use in diagnostics. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
19 CFR 146.51 - Customs control of merchandise.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...
Law, Becker M P; Wilkinson, Ray; Wang, Xiangju; Kildey, Katrina; Lindner, Mae; Rist, Melissa J; Beagley, Kenneth; Healy, Helen; Kassianos, Andrew J
2017-07-01
Natural killer (NK) cells are a population of lymphoid cells that play a significant role in mediating innate immune responses. Studies in mice suggest a pathological role for NK cells in models of kidney disease. In this study, we characterized the NK cell subsets present in native kidneys of patients with tubulointerstitial fibrosis, the pathological hallmark of chronic kidney disease. Significantly higher numbers of total NK cells (CD3 - CD56 + ) were detected in renal biopsies with tubulointerstitial fibrosis compared with diseased biopsies without fibrosis and healthy kidney tissue using multi-color flow cytometry. At a subset level, both the CD56 dim NK cell subset and particularly the CD56 bright NK cell subset were elevated in fibrotic kidney tissue. However, only CD56 bright NK cells significantly correlated with the loss of kidney function. Expression of the tissue-retention and -activation molecule CD69 on CD56 bright NK cells was significantly increased in fibrotic biopsy specimens compared with non-fibrotic kidney tissue, indicative of a pathogenic phenotype. Further flow cytometric phenotyping revealed selective co-expression of activating receptor CD335 (NKp46) and differentiation marker CD117 (c-kit) on CD56 bright NK cells. Multi-color immunofluorescent staining of fibrotic kidney tissue localized the accumulation of NK cells within the tubulointerstitium, with CD56 bright NK cells (NKp46 + CD117 + ) identified as the source of pro-inflammatory cytokine interferon-γ within the NK cell compartment. Thus, activated interferon-γ-producing CD56 bright NK cells are positioned to play a key role in the fibrotic process and progression to chronic kidney disease. Crown Copyright © 2017. Published by Elsevier Inc. All rights reserved.
LENUS (Irish Health Repository)
Lan, W
2012-02-03
BACKGROUND: Lidocaine has actions potentially of benefit during ischaemia-reperfusion. Neutrophils and endothelial cells have an important role in ischaemia-reperfusion injury. METHODS: Isolated human neutrophil CD11b and CD18, and human umbilical vein endothelial cell (HUVEC) ICAM-1 expression and supernatant IL-1beta concentrations in response to hypoxia-reoxygenation were studied in the presence or absence of different concentrations of lidocaine (0.005, 0.05 and 0.5 mg mL(-1)). Adhesion molecule expression was quantified by flow cytometry and IL- 1beta concentrations by ELISA. Differences were assessed with analysis of variance and Student-Newman-Keuls as appropriate. Data are presented as mean+\\/-SD. RESULTS: Exposure to hypoxia-reoxygenation increased neutrophil CD11b (94.33+\\/-40.65 vs. 34.32+\\/-6.83 mean channel fluorescence (MCF), P = 0.02), CD18 (109.84+\\/-35.44 vs. 59.05+\\/-6.71 MCF, P = 0.03) and endothelial ICAM-1 (146.62+\\/-16.78 vs. 47.29+\\/-9.85 MCF, P < 0.001) expression compared to normoxia. Neutrophil CD18 expression on exposure to hypoxia-reoxygenation was less in lidocaine (0.005 mg mL(-1)) treated cells compared to control (71.07+\\/-10.14 vs. 109.84+\\/-35.44 MCF, P = 0.03). Endothelial ICAM-1 expression on exposure to hypoxia-reoxygenation was less in lidocaine (0.005 mg mL(-1)) treated cells compared to control (133.25+\\/-16.05 vs. 146.62+\\/-16.78 MCF, P = 0.03). Hypoxia-reoxygenation increased HUVEC supernatant IL-1beta concentrations compared to normoxia (3.41+\\/-0.36 vs. 2.65+\\/-0.21 pg mL(-1), P = 0.02). Endothelial supernatant IL-1beta concentrations in lidocaine-treated HUVECs were similar to controls. CONCLUSIONS: Lidocaine at clinically relevant concentrations decreased neutrophil CD18 and endothelial ICAM-1 expression but not endothelial IL-1beta concentrations.
Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters
Directory of Open Access Journals (Sweden)
Farré Domènec
2007-12-01
Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.
International Nuclear Information System (INIS)
Khlifi, Rim; Olmedo, Pablo; Gil, Fernando; Hammami, Bouthaina; Chakroun, Amine; Rebai, Ahmed; Hamza-Chaffai, Amel
2013-01-01
Chronic exposure to heavy metals has long been recognized as being capable to increase head and neck cancer incidence among exposed human populations. Head and neck cancer is a significant public health issue in Tunisia. The aim of the present study was to evaluate the concentrations of As, Cd, Cr and Ni in healthy and tumor tissues of head and neck cancer patients. Metal concentrations were determined in tumor and healthy tissues of 101 head and neck cancer patients, using Atomic Absorption Spectrometry. The As, Cd, Cr, and Ni levels in tumor tissues were 3.4, 2.5, 1.3 and 1.5 times higher than those of healthy tissues (p 60 years) in both never-smokers and ever-smokers (< 20 and ≥ 20 pack per year). Healthy tissue Cd levels were negatively associated with age in those three groups of smokers. The highest Cd and Cr concentrations among both workers and non-workers were observed in tumor tissues. The Cd and Cr in tissues of farmers, bricklayers and painters were all significantly higher among the workers as compared with the non-workers group. Tissue metal levels have increased due to smoking and occupational exposure. Heavy metal exposure via tobacco smoking and occupational exposures may increase the risk of head and neck in the Tunisian population. - Highlights: ► Heavy metal levels in tumor tissues were higher than those in healthy tissues. ► Tumor tissue Cd levels were positively associated with age in smokers. ► Tumor tissue metal levels were higher in men than in women. ► The highest Cd and Cr concentrations among workers were observed in tumor tissues. ► Heavy metal exposure via occupational exposures may increase the risk of HNC
2018-01-25
B Acute Lymphoblastic Leukemia; CD19 Positive; Diffuse Large B-Cell Lymphoma Associated With Chronic Inflammation; Diffuse Large B-Cell Lymphoma, Not Otherwise Specified; Epstein-Barr Virus Positive Diffuse Large B-Cell Lymphoma of the Elderly; Minimal Residual Disease; Philadelphia Chromosome Positive; Recurrent Diffuse Large B-Cell Lymphoma; Recurrent Mediastinal (Thymic) Large B-Cell Cell Lymphoma; Refractory Diffuse Large B-Cell Lymphoma; Refractory Mediastinal (Thymic) Large B-Cell Cell Lymphoma; T-Cell/Histiocyte-Rich Large B-Cell Lymphoma
10 CFR 72.146 - Design control.
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...
21 CFR 146.151 - Orange juice for manufacturing.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...
21 CFR 146.152 - Orange juice with preservative.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...
Directory of Open Access Journals (Sweden)
Siwen WANG
2011-09-01
Full Text Available Background and objective It has been proven that CD147 was an extracellular matrix metalloproteinase inducer reportedly involved in the invasion and metastasis of malignancies. The aim of this study is to investigate CD147 and MMP-2 expression in squamous cell carcinoma and adenocarcinoma of the lungs and to analyze their clinical significance. Methods Tissue samples from 55 patients with squamous cell carcinoma and adenocarcinoma of the lungs and their corresponding non-cancerous tissues were examined for CD147 and MMP-2 expression using immunohistochemistry. Results The positive expression rates of CD147 and MMP-2 in the squamous cell carcinoma and adenocarcinoma among the lung tissues were significantly higher than those in the corresponding normal lung tissues. Moreover, the CD147 and MMP-2 expression in squamous cell carcinoma and adenocarcinoma of the lungs were related to lymph node metastasis and TNM stages (P<0.05, but not to age, gender and histologic type (P>0.05. MMP-2 expression was highly correlated with CD147 expression. Conclusion CD147 and MMP-2 expression is correlated with the invasion and metastasis of squamous cell carcinoma and adenocarcinoma of the lungs and may be used as objective markers for predicting the behavior of squamous cell carcinoma and adenocarcinoma of the lungs.
Energy Technology Data Exchange (ETDEWEB)
Yamazaki, Hiroto; Naito, Motohiko; Ghani, Farhana Ishrat [Division of Clinical Immunology, Institute of Medical Science, University of Tokyo, Tokyo (Japan); Dang, Nam H. [Division of Hematology/Oncology, University of Florida Shands Cancer Center, Gainesville, FL 32610 (United States); Iwata, Satoshi [Division of Clinical Immunology, Institute of Medical Science, University of Tokyo, Tokyo (Japan); Morimoto, Chikao, E-mail: morimoto@ims.u-tokyo.ac.jp [Division of Clinical Immunology, Institute of Medical Science, University of Tokyo, Tokyo (Japan)
2012-03-16
Highlights: Black-Right-Pointing-Pointer We focused on CD24 and CD26 for further analysis of CSC properties in MM. Black-Right-Pointing-Pointer Their expressions were correlated with chemoresistance, cell growth, and invasion. Black-Right-Pointing-Pointer Their expressions were also correlated with several cancer related genes. Black-Right-Pointing-Pointer The expression of each marker was correlated with different CSC property in Meso1. Black-Right-Pointing-Pointer Phosphorylation of ERK by EGF was regulated by expression of CD26, but not CD24. -- Abstract: Malignant mesothelioma (MM) is an asbestos-related malignancy characterized by rapid growth and poor prognosis. In our previous study, we have demonstrated that several cancer stem cell (CSC) markers correlated with CSC properties in MM cells. Among these markers, we focused on two: CD24, the common CSC marker, and CD26, the additional CSC marker. We further analyzed the CSC properties of CD24 and CD26-positve MM cells. We established RNAi-knockdown cells and found that these markers were significantly correlated with chemoresistance, proliferation, and invasion potentials in vitro. Interestingly, while Meso-1 cells expressed both CD24 and CD26, the presence of each of these two markers was correlated with different CSC property. In addition, downstream signaling of these markers was explored by microarray analysis, which revealed that their expressions were correlated with several cancer-related genes. Furthermore, phosphorylation of ERK by EGF stimulation was significantly affected by the expression of CD26, but not CD24. These results suggest that CD24 and CD26 differentially regulate the CSC potentials of MM and could be promising targets for CSC-oriented therapy.
Directory of Open Access Journals (Sweden)
Céline Pinheiro
2010-01-01
Full Text Available Monocarboxylate transporters (MCTs are important cellular pH regulators in cancer cells; however, the value of MCT expression in cancer is still poorly understood. In the present study, we analysed MCT1, MCT2, and MCT4 protein expression in breast, colon, lung, and ovary neoplasms, as well as CD147 and CD44. MCT expression frequency was high and heterogeneous among the different tumours. Comparing with normal tissues, there was an increase in MCT1 and MCT4 expressions in breast carcinoma and a decrease in MCT4 plasma membrane expression in lung cancer. There were associations between CD147 and MCT1 expressions in ovarian cancer as well as between CD147 and MCT4 in both breast and lung cancers. CD44 was only associated with MCT1 plasma membrane expression in lung cancer. An important number of MCT1 positive cases are negative for both chaperones, suggesting that MCT plasma membrane expression in tumours may depend on a yet nonidentified regulatory protein.
Chen, Zhifan; Zhao, Ye; Fan, Lidong; Xing, Liteng; Yang, Yujie
2015-12-01
Phytoremediation using economically valuable, large biomass, non-edible plants is a promising method for metal-contaminated soils. This study investigated cotton's tolerance for Cd and remediation potential through analyzing Cd bioaccumulation and localization in plant organs under different soil Cd levels. Results showed cotton presents good tolerance when soil Cd concentration ≤20.26 mg kg(-1). Cotton had good Cd accumulation ability under low soil Cd levels (soil Cd, while roots and stems were the main compartments of Cd storage. Cd complexation to other organic constituents in root and stem cell sap could be a primary detoxifying strategy. Therefore, cotton is a potential candidate for phytoremediation of Cd-contaminated soils.
DEFF Research Database (Denmark)
Berg, Lise Charlotte; Mata, Xavier; Thomsen, Preben Dybdahl
2008-01-01
Cartilage-derived retinoic acid sensitive protein (CD-RAP) also known as melanoma inhibitory activity (MIA) has already been established as a marker for chondrocyte differentiation and a number of cancerous condition sin humans. Studies have also shown that CD-RAP/MIA is a potential marker of joint......RNA in articular cartilage and chondrocytes from horses with no signs of joint disease. The expression decreased as the cells dedifferentiated in monolayer culture. We also identified an equine CD-RAP/MIA splioce variant similar to that reported in humans. The CD_RAP/MIA protein was detected in equine synovial...... fluid, serum and culture medium from chondrocyte cultures. In conclusion, CD-RAP/MIA is expressed in equine cartilage and chondrocytes, and the protein can be detected in equine serum, synovial fluid and in culture medium from chondrocyte cultures. The equine gene and resulting protein share great...
Directory of Open Access Journals (Sweden)
Danka Đevenica
2016-08-01
Full Text Available Objective(s: The aim of this study was to estimate effects of hyperbaric (HB treatment by determination of CD15s and CD11b leukocyte proinflammatory markers expression. In addition, this study describes changes in CD77 and CD34 expression on rat endothelial cells in renal, pulmonary and cardiac tissue following exposure to hyperbaric pressure. Materials and Methods:Expression of CD11b and CD15s on leukocytes, as well as CD77 and CD34 expression on endothelial cells in cell suspensions of renal, pulmonary and cardiac tissue in rats after hyperbaric treatment and in control rats were determined by flow cytometry. Results: Hyperbaric treatment significantly increased percentage of leukocytes expressing CD15s+CD11b- (from 1.71±1.11 to 23.42±2.85, P
Energy Technology Data Exchange (ETDEWEB)
Lou, Chuangneng [Institute of Polar Environment, School of Earth and Space Sciences, University of Science and Technology of China, Hefei 230026 (China); Liu, Xiaodong, E-mail: ycx@ustc.edu.cn [Institute of Polar Environment, School of Earth and Space Sciences, University of Science and Technology of China, Hefei 230026 (China); Nie, Yaguang [Institute of Polar Environment, School of Earth and Space Sciences, University of Science and Technology of China, Hefei 230026 (China); Emslie, Steven D. [Department of Biology and Marine Biology, University of North Carolina Wilmington, 601S. College Road, Wilmington, NC 28403 (United States)
2015-12-15
To evaluate mobility of toxic elements and their potential ecological risk caused by seabird biovectors, the fractionation distributions of arsenic (As), mercury (Hg) and cadmium (Cd) were investigated in three ornithogenic sediment profiles from the Ross Sea region, East Antarctica. The results show residual As holds a dominant position, and Hg mainly derives from residual, organic matter-bound and humic acid-bound fractions, indicating weak mobility of As and Hg. However, exchangeable Cd occupies a considerable proportion in studied samples, suggesting Cd has strong mobility. The preliminary evaluation of Sediment Quality Guidelines (SGQs) shows adverse biological effects may occur occasionally for As and Cd, and rarely for Hg. Using Risk Assessment Code (RAC), the ecological risk is assessed at moderate, low and very high for As, Hg and Cd pollution, respectively. Organic matter derived from guano is the main factor controlling the mobility of Hg and Cd through adsorption and complexation. - Highlights: • Residual As holds a dominant position in ornithogenic sediments. • Hg mainly derives from residual, organic matter-bound and humic acid-bound fractions. • Exchangeable Cd occupies a considerable proportion in ornithogenic sediments. • TOC is the main factor controlling the mobility of Hg and Cd in studied sediments.
Directory of Open Access Journals (Sweden)
Ali Kazemi
2016-07-01
Full Text Available Background: Marine pollution is a global environmental problem that its monitoring by ideal biomonitors is of great importance. Marine organisms, especially mussels, have the ability to accumulate metals from the environment; they can be considered as a biomonitoring agent. Methods: In this study, concentrations of heavy metals were measured in Saccostrea cucullata collected from seven sites on Qeshm Island's Coast. To achieve a digesting sample, each soft tissue was obtained and each of the shell homogeneous powders, 0.8 g and 1 g, respectively, were mixed with 10 mL HNO3 (69% and poured into a PTFE digestion vessel. The prepared samples were evaluated for Cd, Cu, and Zn by using a flame AAS Model 67OG and for Pb by using a graphite furnace AAS. Results: The distributions of metals between soft tissues and shells were compared in each sampling site. For seven sites, Cd, Zn, and Cu levels in soft tissues were higher than in the shells, but Pb level was higher in the shells than in the soft tissues. In addition, the results indicated the coefficient of variation (CV in the soft tissues was lower than the shells for Cd, and in the shells lower than the soft tissues for Pb, whereas the CV values were different in both the soft tissues and shells for Zn and Cu. Conclusion: The results of this study support using these materials in S. cucullata for biomonitoring. Shells are appropriate for monitoring Pb contamination, and the soft tissues are more apt for monitoring Cd, Zn, and Cu contamination.
International Nuclear Information System (INIS)
Pongrac, Paula; Vogel-Mikus, Katarina; Vavpetic, Primoz; Tratnik, Janja; Regvar, Marjana; Simcic, Jurij; Grlj, Natasa; Pelicon, Primoz
2010-01-01
A detailed localisation of elements within leaf tissues of hydroponically grown Cd/Zn hyperaccumulator Thlaspi praecox (Brassicaceae) was determined by micro-PIXE at Jozef Stefan Institute (Ljubljana, Slovenia) in order to study accumulation patterns of Cd and other elements in the case of a single metal (Cd) pollution. Plants were treated with increasing concentrations of Cd in the solution (0 (control), 1, 10 and 100 μM). As expected, concentration of Cd in the leaves gradually increased with Cd concentration in the solution. In order to reveal the main Cd storage compartment space within the leaves a relative element distribution (pool) was calculated based on concentrations of elements in specific leaf tissues and their weight portions. Where present at detectable levels, Cd accumulated in the epidermal tissues (at 10 μM), but the contribution of epidermal pool decreased with increasing Cd concentration in solution (at 100 μM). The opposite was observed for the mesophyll pool. In addition, in Cd treated plants, a significant decrease in mesophyll Fe pool and an increase in the epidermal Fe pool were observed. Similar effect was seen for Mn pool at 100 μM Cd treatment accompanied by increasing Zn epidermal pool with increasing Cd in nutrient solution. Altogether these results indicate repartitioning of essential mesophyll cation pools (e.g., Fe, Mn and possibly Zn) when increasing Cd contents, that are instead more intensively stored in the epidermal cells. These results confirmed micro-PIXE as effective and powerful technique providing essential information on metal localisation, repartitioning and major elemental stores in plants on the tissue levels that were not accessible using classical analytical techniques and thus complementing our current understanding of plant metal tolerance mechanisms as a whole.
2010-07-07
... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...
Effect of hypoxia on equine mesenchymal stem cells derived from bone marrow and adipose tissue
Directory of Open Access Journals (Sweden)
Ranera Beatriz
2012-08-01
Full Text Available Abstract Background Mesenchymal stem cells (MSCs derived from bone marrow (BM-MSCs and adipose tissue (AT-MSCs are being applied to equine cell therapy. The physiological environment in which MSCs reside is hypoxic and does not resemble the oxygen level typically used in in vitro culture (20% O2. This work compares the growth kinetics, viability, cell cycle, phenotype and expression of pluripotency markers in both equine BM-MSCs and AT-MSCs at 5% and 20% O2. Results At the conclusion of culture, fewer BM-MSCs were obtained in hypoxia than in normoxia as a result of significantly reduced cell division. Hypoxic AT-MSCs proliferated less than normoxic AT-MSCs because of a significantly higher presence of non-viable cells during culture. Flow cytometry analysis revealed that the immunophenotype of both MSCs was maintained in both oxygen conditions. Gene expression analysis using RT-qPCR showed that statistically significant differences were only found for CD49d in BM-MSCs and CD44 in AT-MSCs. Similar gene expression patterns were observed at both 5% and 20% O2 for the remaining surface markers. Equine MSCs expressed the embryonic markers NANOG, OCT4 and SOX2 in both oxygen conditions. Additionally, hypoxic cells tended to display higher expression, which might indicate that hypoxia retains equine MSCs in an undifferentiated state. Conclusions Hypoxia attenuates the proliferative capacity of equine MSCs, but does not affect the phenotype and seems to keep them more undifferentiated than normoxic MSCs.
Prasetyo, R Heru; Hestianah, Eka Pramyrtha
2017-06-01
This study was to evaluate effect of honey in repairing damage of liver tissue due to energy protein malnutrition and in mobilization of endogenous stem cells. Male mice model of degenerative liver was obtained through food fasting but still have drinking water for 5 days. It caused energy protein malnutrition and damage of liver tissue. The administration of 50% (v/v) honey was performed for 10 consecutive days, while the positive control group was fasted and not given honey and the negative control not fasted and without honey. Observations of regeneration the liver tissue based on histologically examination, observation of Hsp70 expression, and homing signal based on vascular endothelial growth factor-1 (VEGF-1) expression using immunohistochemistry technique. Observation on expression of CD34 and CD45 as the marker of auto mobilization of hematopoietic stem cells using flow cytometry technique. There is regeneration of the liver tissue due to protein energy malnutrition, decrease of Hsp70 expression, increase of VEGF-1 expression, and high expression of CD34 and CD45. Honey can improve the liver tissue based on: (1) Mobilization of endogenous stem cells (CD34 and CD45); (2) Hsp70 and VEGF-1 expressions as regeneration marker of improvement, and (3) regeneration histologically of liver tissue.
Degnim, Amy C; Hoskin, Tanya L; Arshad, Muhammad; Frost, Marlene H; Winham, Stacey J; Brahmbhatt, Rushin A; Pena, Alvaro; Carter, Jodi M; Stallings-Mann, Melody L; Murphy, Linda M; Miller, Erin E; Denison, Lori A; Vachon, Celine M; Knutson, Keith L; Radisky, Derek C; Visscher, Daniel W
2017-07-15
Purpose: Little is known about the role of the immune system in the earliest stages of breast carcinogenesis. We studied quantitative differences in immune cell types between breast tissues from normal donors and those from women with benign breast disease (BBD). Experimental Design: A breast tissue matched case-control study was created from donors to the Susan G. Komen for the Cure Tissue Bank (KTB) and from women diagnosed with BBD at Mayo Clinic (Rochester, MN) who either subsequently developed cancer (BBD cases) or remained cancer-free (BBD controls). Serial tissue sections underwent immunostaining and digital quantification of cell number per mm 2 for CD4 + T cells, CD8 + T cells, CD20 + B cells, and CD68 + macrophages and quantification of positive pixel measure for CD11c (dendritic cells). Results: In 94 age-matched triplets, BBD lobules showed greater densities of CD8 + T cells, CD11c + dendritic cells, CD20 + B cells, and CD68 + macrophages compared with KTB normals. Relative to BBD controls, BBD cases had lower CD20 + cell density ( P = 0.04). Nearly 42% of BBD cases had no CD20 + B cells in evaluated lobules compared with 28% of BBD controls ( P = 0.02). The absence of CD20 + cells versus the presence in all lobules showed an adjusted OR of 5.7 (95% confidence interval, 1.4-23.1) for subsequent breast cancer risk. Conclusions: Elevated infiltration of both innate and adaptive immune effectors in BBD tissues suggests an immunogenic microenvironment. The reduced B-cell infiltration in women with later breast cancer suggests a role for B cells in preventing disease progression and as a possible biomarker for breast cancer risk. Clin Cancer Res; 23(14); 3945-52. ©2017 AACR . ©2017 American Association for Cancer Research.
Yu, Yuan; Li, Jialu; Zhu, Xuejun; Tang, Xiaowen; Bao, Yangyi; Sun, Xiang; Huang, Yuhui; Tian, Fang; Liu, Xiaomei; Yang, Lin
2017-01-01
Nanobodies, named as VHHs (variable domain of heavy chain of HCAb [heavy-chain antibodies]), are derived from heavy-chain-only antibodies that circulate in sera of camelids. Their exceptional physicochemical properties, possibility of humanization, and unique antigen recognition properties make them excellent candidates for targeted delivery of biologically active components, including immunotoxins. In our previous efforts, we have successfully generated the monovalent and bivalent CD7 nanobody-based immunotoxins, which can effectively trigger the apoptosis of CD7-positive malignant cells. To pursue the possibility of translating those immunotoxins into clinics, we humanized the nanobody sequences (designated as dhuVHH6) as well as further truncated the Pseudomonas exotoxin A (PE)-derived PE38 toxin to produce a more protease-resistant form, which is named as PE-LR, by deleting majority of PE domain II. Three new types of immunotoxins, dhuVHH6-PE38, dVHH6-PE-LR, and dhuVHH6-PE-LR, were successfully constructed. These recombinant immunotoxins were expressed in Escherichia coli and showed that nanobody immunotoxins have the benefits of easy soluble expression in a prokaryotic expression system. Flow cytometry results revealed that all immunotoxins still maintained the ability to bind specifically to CD7-positive T lymphocyte strains without binding to CD7-negative control cells. Laser scanning confocal microscopy revealed that these proteins can be endocytosed into the cytoplasm after binding with CD7-positive cells and that this phenomenon was not observed in CD7-negative cells. WST-8 experiments showed that all immunotoxins retained the highly effective and specific growth inhibition activity in CD7-positive cell lines and primary T-cell acute lymphoblastic leukemia (T-ALL) cells. Further in vivo animal model experiments showed that humanized dhuVHH6-PE38 immunotoxin can tolerate higher doses and extend the survival of NOD-Prkdc em26 Il2rg em26 Nju (NCG) mice
Wang, Jing-Jing; Sun, Xi-Cai; Hu, Li; Liu, Zhuo-Fu; Yu, Hua-Peng; Li, Han; Wang, Shu-Yi; Wang, De-Hui
2013-12-01
The purpose of this study was to examine endoglin (CD105) expression on microvessel endothelial cells (ECs) in juvenile nasopharyngeal angiofibroma (JNA) and its relationship with recurrence. Immunohistochemistry was performed to detect CD105 expression in a tissue microarray from 70 patients with JNA. Correlation between CD105 expression on microvessel ECs and clinicopathological features, as well as tumor recurrence, were analyzed. Immunohistochemistry revealed CD105 expression on ECs but not in stroma of patients with JNA. Chi-square analysis indicated CD105-based microvessel density (MVD) was correlated with JNA recurrence (p = .013). Univariate and multivariate analyses determined that MVD was a significant predictor of time to recurrence (p = .009). The CD105-based MVD was better for predicting disease recurrence (AUROC: 0.673; p = .036) than other clinicopathological features. MVD is a useful predictor for poor prognosis of patients with JNA after curative resection. Angiogenesis, which may play an important role in the occurrence and development of JNA, is therefore a potential therapeutic target for JNA. Copyright © 2013 Wiley Periodicals, Inc., A Wiley Company.
Energy Technology Data Exchange (ETDEWEB)
Santos, Beate S. [Dept. Ciencias Farmaceuticas, UFPE, Recife, PE, 50740-521 (Brazil); Dept. Quimica Fundamental, UFPE, Recife, PE, 50670-901 (Brazil); Farias, Patricia M.A. de [Dept. Biofisica e Radiobiologia, UFPE, Recife, PE, 50740-521 (Brazil); Menezes, Frederico D. de [Dept. Quimica Fundamental, UFPE, Recife, PE, 50670-901 (Brazil); Dept. Ciencias Farmaceuticas, UFPE, Recife, PE, 50740-521 (Brazil); Ferreira, Ricardo C. de; Junior, Severino A. [Dept. Quimica Fundamental, UFPE, Recife, PE, 50670-901 (Brazil); Figueiredo, Regina C.B.Q. [Centro de Pesquisas Ageu Magalhaes Fiocruz, Recife, PE, 50670-901 (Brazil); de Carvalho, Luiz B. Jr.; Beltrao, Eduardo I.C. [Laboratorio de Imunopatologia Keizo Asami, UFPE, Recife, PE, 50670-910 (Brazil); Dept. Bioquimica, UFPE, Recife, PE, 50670-910 (Brazil)
2006-07-01
We report the use of CdS/Cd(OH){sub 2} quantum dots functionalized with glutaraldehyde and conjugated to concanavalin-A (Con-A) lectin to investigate cell alterations regarding carbohydrate profile in human mammary tissues diagnosed as fibroadenoma (benigne tumor). The Con-A lectin is a biomolecule which binds specifically to glucose/mannose residues present in the cellular membrane. These bioconjugated-particles were incubated with tissue sections of normal and to Fibroadenoma, a benign type of mammary tumor. The tissue sections were deparafinized, hydrated in graded alcohol and treated with a solution of Evans Blue in order to avoid autofluorescence. The fluorescence intensity of QD-Con-A stained tissues showed different patterns which reflect the carbohydrate expression of glucose/mannose in fibroadenoma when compared to the detection of the normal carbohydrate expression. The pattern of inespecific labeling of the tissues with glutharaldehyde functionalized CdS/Cd(OH){sub 2} quantum dots is compared to the targeting driven by the Con-A lectin. The preliminary findings reported here support the use of CdS/Cd(OH){sub 2} quantum dots as specific probes of cellular alterations possibiliting their use in diagnostics. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Directory of Open Access Journals (Sweden)
Mina Soufizomorrod
2016-05-01
Full Text Available Background: Hematopoietic stem cell transplantation (HSCT is a therapeutic approach for treatment of hematological malignancies and incompatibility of Bone marrow. Umbilical cord blood (UCB has known as an alternative for hematopoietic stem/progenitor cells (HPSC in allogeneic transplantation. The low volume of collected samples is the main hindrance in application of HPSC derived from umbilical cord blood. So, ex vivo expansion of HPSCs is the useful approach to overcome this restriction. The goal of using this system is to produce appropriate amount of hematopoietic stem cells, which have the ability of transplantation and long term haematopoiesis. Material & Methods: In current study CD133+ cells were isolated from cord blood (CB. Isolated cells were seeded on microwells. Then expanded cells proliferation rate and ability in colony formation were assessed and finally were compared with 2 Dimensional (2D culture systems. Results: Our findings demonstrated that CD133+ cells derived from UCB which were cultivated on microwells had significantly higher rate of proliferation in compared with routine cell culture systems. Conclusion: In Current study, it was shown that CD133+ cells’ proliferations which were seeded on PDMS microwells coated with collagen significantly increased. We hope that 3 dimensional (3D microenvironment which mimics the 3D structure of bone marrow can solve the problem of using UCB as an alternative source of bone marrow.
Directory of Open Access Journals (Sweden)
S Sobhanardakani
2012-11-01
Full Text Available Importance of heavy metals in food safety and detrimental effects of their high concentrations in food stuff is well documented. In this study, concentrations of Fe, Zn, Cu, Cd and Pb in kidney, liver and muscle tissues of cow and sheep at Hamedan retails were evaluated. A total number of 180 samples was assessed for the amount of heavy metals as ppb in wet weight. For this, wet-digestion method was used to determine the concentration of given elements by ICP (Varian ES-710. Results showed that the highest concentration of heavy metals was determined in the liver and kidney samples, while the lowest concentration was found in muscle tissue. Among the heavy metals, Fe in cow’s liver had the highest concentration (25507±879 ppb and Cd in muscle tissue of sheep has the lowest concentration (192±54 ppb. In overall, accumulation of heavy metals in tissues of cows was higher than sheep. Statistical comparison of accumulated metals concentration in various tissues of these two animal groups showed significant difference (P
21 CFR 146.135 - Orange juice.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...
HIV Persistence in Adipose Tissue Reservoirs.
Couturier, Jacob; Lewis, Dorothy E
2018-02-01
The purpose of this review is to examine the evidence describing adipose tissue as a reservoir for HIV-1 and how this often expansive anatomic compartment contributes to HIV persistence. Memory CD4 T cells and macrophages, the major host cells for HIV, accumulate in adipose tissue during HIV/SIV infection of humans and rhesus macaques. Whereas HIV and SIV proviral DNA is detectable in CD4 T cells of multiple fat depots in virtually all infected humans and monkeys examined, viral RNA is less frequently detected, and infected macrophages may be less prevalent in adipose tissue. However, based on viral outgrowth assays, adipose-resident CD4 T cells are latently infected with virus that is replication-competent and infectious. Additionally, adipocytes interact with CD4 T cells and macrophages to promote immune cell activation and inflammation which may be supportive for HIV persistence. Antiviral effector cells, such as CD8 T cells and NK/NKT cells, are abundant in adipose tissue during HIV/SIV infection and typically exceed CD4 T cells, whereas B cells are largely absent from adipose tissue of humans and monkeys. Additionally, CD8 T cells in adipose tissue of HIV patients are activated and have a late differentiated phenotype, with unique TCR clonotypes of less diversity relative to blood CD8 T cells. With respect to the distribution of antiretroviral drugs in adipose tissue, data is limited, but there may be class-specific penetration of fat depots. The trafficking of infected immune cells within adipose tissues is a common event during HIV/SIV infection of humans and monkeys, but the virus may be mostly transcriptionally dormant. Viral replication may occur less in adipose tissue compared to other major reservoirs, such as lymphoid tissue, but replication competence and infectiousness of adipose latent virus are comparable to other tissues. Due to the ubiquitous nature of adipose tissue, inflammatory interactions among adipocytes and CD4 T cells and macrophages, and
Lewis, D E; Yang, L; Luo, W; Wang, X; Rodgers, J R
1999-06-18
To determine whether the CD28-CD8+ T cells that develop during HIV infection contain HIV-specific cytotoxic precursor cells. CD8 subpopulations from six asymptomatic HIV-positive adults, with varying degrees of CD4 T cell loss, were sorted by flow cytometry and HIV-specific precursor cytotoxic T lymphocyte frequencies were measured. Three populations of CD8 T cells were tested: CD28+CD5-- T cells, CD28-CD57+ T cells (thought to be memory cells) and CD28-CD57- T cells (function unknown). Sorted CD8 subsets were stimulated with antigen presenting cells expressing HIV-1 Gag/Pol molecules. Cytotoxic T cell assays on Gag/Pol expressing 51Cr-labeled Epstein-Barr virus transformed autologous B cells lines or control targets were performed after 2 weeks. Specific lysis and precursor frequencies were calculated. Both CD28 positive and CD28-CD57+ populations contained appreciable numbers of precursors (9-1720 per 10(6) CD8+ T cells). However, the CD28-CD57- population had fewer precursors in five out of six people studied. More CD28 positive HIV-specific cytotoxic T lymphocyte precursors were found in patients with CD4:CD8 ratios > 1, whereas more CD28-CD57+ precursors were found in patients whose CD4:CD8 ratios were < 1 (r2, 0.68). Memory HIV-specific precursor cytotoxic T lymphocytes are found in both CD28 positive and CD28-CD8+ cells, however, a CD28-CD57- subpopulation had fewer. Because CD28-CD57+ cells are antigen-driven with limited diversity, the loss of CD28 on CD8 T cells during disease progression may reduce the response to new HIV mutations; this requires further testing.
Characterization of primary cutaneous CD8+/CD30+ lymphoproliferative disorders.
Martires, Kathryn J; Ra, Seong; Abdulla, Farah; Cassarino, David S
2015-11-01
CD30 primary cutaneous lymphoproliferative diseases include both lymphomatoid papulosis (LyP) and primary cutaneous anaplastic large cell lymphoma (PCALCL). The neoplastic cell of most primary CD30 lymphoproliferative disorders is CD4 positive. The terminology LyP "type D" has been used to describe a growing number of cases of LyP with a predominantly CD8 infiltrate. PCALCL with a CD8 phenotype has also been described, which presents a particularly difficult diagnostic and management challenge, given the difficulty in distinguishing it histologically from other cytotoxic lymphomas such as primary cutaneous aggressive epidermotropic CD8 cytotoxic T-cell lymphoma and CD8 gamma/delta and natural killer/T-cell lymphoma. We report 7 additional cases of these rare cutaneous CD8/CD30 lymphoproliferative disorders. We also present a unique case of CD8/CD30 LyP with histologic similarities to LyP type B. In all 7 of our cases of CD8 LyP and CD8 anaplastic large cell lymphoma, we found focal to diffuse MUM-1 positivity. We propose that MUM-1 may represent an adjunctive marker for CD8 lymphoproliferative disease. Finally, we review the current literature on cases of CD8 LyP and PCALCL. For the 106 cases examined, we found similar clinical and histologic features to those reported for traditional CD4CD30 LyP and PCALCL.
Directory of Open Access Journals (Sweden)
Vaibhav Mundra
Full Text Available The objective of this study was to determine the potential of human bone marrow derived mesenchymal stem cells (hBMSCs as gene carriers for improving the outcome of human islet transplantation. hBMSCs were characterized for the expression of phenotypic markers and transduced with Adv-hVEGF-hIL-1Ra to overexpress human vascular endothelial growth factor (hVEGF and human interleukin-1 receptor antagonist (hIL-1Ra. Human islets were co-cultured with hBMSCs overexpressing hVEGF and hIL-1Ra. Islet viability was determined by membrane fluorescent method and glucose stimulation test. Transduced hBMSCs and human islets were co-transplanted under the kidney capsule of NOD.Cg-Prkdc(scid Il2rg(tm1Wjl /SzJ (NSG diabetic mice and blood glucose levels were measured over time to demonstrate the efficacy of genetically modified hBMSCs. At the end of study, immunofluorescent staining of kidney section bearing islets was performed for insulin and von Willebrand Factor (vWF. hBMSCs were positive for the expression of CD73, CD90, CD105, CD146 and Stro-1 surface markers as determined by flow cytometry. Transduction of hBMSCs with adenovirus did not affect their stemness and differentiation potential as confirmed by mRNA levels of stem cell markers and adipogenic differentiation of transduced hBMSCs. hBMSCs were efficiently transduced with Adv-hVEGF-hIL-1Ra to overexpress hVEGF and hIL-1Ra. Live dead cell staining and glucose stimulation test have shown that transduced hBMSCs improved the viability of islets against cytokine cocktail. Co-transplantation of human islets with genetically modified hBMSCs improved the glycemic control of diabetic NSG mice as determined by mean blood glucose levels and intraperitoneal glucose tolerance test. Immunofluorescent staining of kidney sections was positive for human insulin and vWF. In conclusion, our results have demonstrated that hBMSCs may be used as gene carriers and nursing cells to improve the outcome of islet
Reactivity of naive CD4+CD25- T cells against gut microflora in healthy mice
DEFF Research Database (Denmark)
Gad, Monika; Lundsgaard, Dorthe; Kjellev, Stine
2006-01-01
We have previously shown that conventional as well as germ-free CD4+ T cells depleted of CD25+ cells from the gut-associated lymphoid tissue and the periphery proliferate specifically in response to enterobacterial antigen exposure whereas unfractionated CD4+ T cells are not reactive under...
BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles
Directory of Open Access Journals (Sweden)
Cong Li
2018-01-01
Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66
International Nuclear Information System (INIS)
Privezentsev, K.V.; Sirota, N.P.; Gaziev, A.I.
1996-01-01
The effect of combined treatment of Cd and γ-irradiation on DNA damage and repair was studied in lymphoid tissues of mice using single-cell gel assay. Single i.p. injection of CdCl 2 (1 mg Cd/kg body wt), 2 h prior to irradiation resulted in increasing of DNA lesions in peripheral blood lymphocytes (PBL) when compared to non-injected animals. However, the same treatment, 48 h prior to irradiation is shown to decrease DNA damage in PBL and splenocytes in comparison with untreated mice. In thymocytes maximal protective effect of Cd was determined when mice were irradiated in 24 h after injection. The protective effect observed is due to decreasing of initial level of DNA damage in thymocytes as well as acceleration of DNA repair in PBL and splenocytes. 28 refs.; 2 figs
International Nuclear Information System (INIS)
Lee, Eun Ji; Ju, Hui Yeong; Park, Ki Min; Moon, ASuk Hee; Kang, Young Jin
2015-01-01
Polynuclear coordination polymers can exhibit more intriguing network topologies and better functionalities than those of common complexes because they have metal-cluster nodes for the construction of multidimensional frameworks and the potential applications induced by collaborative activities between metal ions. New tetranuclear Cd(II) coordination polymer 1 based on 1,3-alternate calix arene derivative (H_4 CTA) with four carboxyl pendant arms has been synthesized by the solvo thermal reaction at 110 .deg. C for 2 days. Compound 1 shows a 3-D framework consisting of tetranuclear Cd(II) cluster core as a metal-cluster node and 1,3-alternate H_4CTA as a multidentate linker. The coordination polymer 1 displays intense blue emission, implying that this tetranuclear Cd(II) coordination polymer could be a suitable material in the area of luminescence research
Cupedo, Tom; Crellin, Natasha K.; Papazian, Natalie; Rombouts, Elwin J.; Weijer, Kees; Grogan, Jane L.; Fibbe, Willem E.; Cornelissen, Jan J.; Spits, Hergen
2009-01-01
The human body contains over 500 individual lymph nodes, yet the biology of their formation is poorly understood. Here we identify human lymphoid tissue-inducer cells (LTi cells) as lineage-negative RORC(+) CD127(+) cells with the functional ability to interact with mesenchymal cells through
Serum soluble CD163 predicts risk of type 2 diabetes in the general population
DEFF Research Database (Denmark)
Møller, Holger J; Frikke-Schmidt, Ruth; Moestrup, Søren K
2011-01-01
has developed. METHODS: A prospective cohort study of 8849 study participants from the general population, the Copenhagen City Heart Study, was followed for 18 years for incidence of type 2 diabetes. Risk of disease was calculated according to age- and sex-adjusted percentile categories of serum s......BACKGROUND: Activation of adipose tissue macrophages with concomitant low-grade inflammation is believed to play a central role in the development of type 2 diabetes. We tested whether a new macrophage-derived biomarker, soluble CD163 (sCD163), identifies at-risk individuals before overt disease......CD163 concentrations: 0%-33%, 34%-66%, 67%-90%, 91%-95%, and 96%-100%. RESULTS: A total of 568 participants developed type 2 diabetes. The cumulative incidence increased with increasing baseline sCD163 (trend P
Zong, JiaXin; Li, YunTian; Du, DaYong; Liu, Yang; Yin, YongJun
2016-11-01
Intraplaque angiogenesis has been recognized as an important risk factor for the rupture of advanced atherosclerotic plaques in recent years. CD147, also called Extracellular Matrix Metalloproteinase Inducer, has been found the ability to promote angiogenesis in many pathological conditions such as cancer diseases and rheumatoid arthritis via the up-regulation of vascular endothelial growth factor (VEGF), a critical mediator of angiogenesis. We investigated whether CD147 would also induce the up-regulation of VEGF in the foam cells formation process and explored the probable signaling pathway. The results showed the expression of CD147 and VEGF was significantly higher in U937-derived foam cells. After CD147 stealth siRNA transfection treatment, the production of VEGF was reduced depended on the inhibition efficiency of CD147 siRNAs.The special signaling pathway inhibitors LY294002, SP600125, SB203580 and U0126 were added to cultures respectively and the results showed LY294002 dose-dependently inhibited the expression of VEGF. The reduction of phospho-Akt was observed in both LY294002 and siRNA groups, suggested that the phosphatidylinositol 3-kinase/Akt pathway may be the probable signaling pathway underlying CD147 induced up-regulation of VEGF in U937-derived foam cells. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Salamon, Achim; Jonitz-Heincke, Anika; Adam, Stefanie; Rychly, Joachim; Müller-Hilke, Brigitte; Bader, Rainer; Lochner, Katrin; Peters, Kirsten
2013-01-01
Cartilaginous matrix-degenerative diseases like osteoarthritis (OA) are characterized by gradual cartilage erosion, and also by increased presence of cells with mesenchymal stem cell (MSC) character within the affected tissues. Moreover, primary chondrocytes long since are known to de-differentiate in vitro and to be chondrogenically re-differentiable. Since both findings appear to conflict with each other, we quantitatively assessed the mesenchymal differentiation potential of OA patient cartilage-derived cells (CDC) towards the osteogenic and adipogenic lineage in vitro and compared it to that of MSC isolated from adipose tissue (adMSC) of healthy donors. We analyzed expression of MSC markers CD29, CD44, CD105, and CD166, and, following osteogenic and adipogenic induction in vitro, quantified their expression of osteogenic and adipogenic differentiation markers. Furthermore, CDC phenotype and proliferation were monitored. We found that CDC exhibit an MSC CD marker expression pattern similar to adMSC and a similar increase in proliferation rate during osteogenic differentiation. In contrast, the marked reduction of proliferation observed during adipogenic differentiation of adMSC was absent in CDC. Quantification of differentiation markers revealed a strong osteogenic differentiation potential for CDC, however almost no capacity for adipogenic differentiation. Since in the pathogenesis of OA, cartilage degeneration coincides with high bone turnover rates, the high osteogenic differentiation potential of OA patient-derived CDC may affect clinical therapeutic regimens aiming at autologous cartilage regeneration in these patients. - Highlights: • We analyze the mesenchymal differentiation capacity of cartilage-derived cells (CDC). • CDC express mesenchymal stem cell (MSC) markers CD29, CD44, CD105, and CD166. • CDC and MSC proliferation is reduced in adipogenesis and increased in osteogenesis. • Adipogenic differentiation is virtually absent in CDC, but
Energy Technology Data Exchange (ETDEWEB)
Salamon, Achim, E-mail: achim.salamon@med.uni-rostock.de [Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany); Jonitz-Heincke, Anika, E-mail: anika.jonitz@med.uni-rostock.de [Biomechanics and Implant Technology Research Laboratory, Department of Orthopedics, Rostock University Medical Center, Doberaner Straße 142, D-18057 Rostock (Germany); Adam, Stefanie, E-mail: stefanie.adam@med.uni-rostock.de [Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany); Rychly, Joachim, E-mail: joachim.rychly@med.uni-rostock.de [Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany); Müller-Hilke, Brigitte, E-mail: brigitte.mueller-hilke@med.uni-rostock.de [Institute of Immunology, Rostock University Medical Center, Schillingallee 68, D-18057 Rostock (Germany); Bader, Rainer, E-mail: rainer.bader@med.uni-rostock.de [Biomechanics and Implant Technology Research Laboratory, Department of Orthopedics, Rostock University Medical Center, Doberaner Straße 142, D-18057 Rostock (Germany); Lochner, Katrin, E-mail: katrin.lochner@med.uni-rostock.de [Biomechanics and Implant Technology Research Laboratory, Department of Orthopedics, Rostock University Medical Center, Doberaner Straße 142, D-18057 Rostock (Germany); Peters, Kirsten, E-mail: kirsten.peters@med.uni-rostock.de [Department of Cell Biology, Rostock University Medical Center, Schillingallee 69, D-18057 Rostock (Germany)
2013-11-01
Cartilaginous matrix-degenerative diseases like osteoarthritis (OA) are characterized by gradual cartilage erosion, and also by increased presence of cells with mesenchymal stem cell (MSC) character within the affected tissues. Moreover, primary chondrocytes long since are known to de-differentiate in vitro and to be chondrogenically re-differentiable. Since both findings appear to conflict with each other, we quantitatively assessed the mesenchymal differentiation potential of OA patient cartilage-derived cells (CDC) towards the osteogenic and adipogenic lineage in vitro and compared it to that of MSC isolated from adipose tissue (adMSC) of healthy donors. We analyzed expression of MSC markers CD29, CD44, CD105, and CD166, and, following osteogenic and adipogenic induction in vitro, quantified their expression of osteogenic and adipogenic differentiation markers. Furthermore, CDC phenotype and proliferation were monitored. We found that CDC exhibit an MSC CD marker expression pattern similar to adMSC and a similar increase in proliferation rate during osteogenic differentiation. In contrast, the marked reduction of proliferation observed during adipogenic differentiation of adMSC was absent in CDC. Quantification of differentiation markers revealed a strong osteogenic differentiation potential for CDC, however almost no capacity for adipogenic differentiation. Since in the pathogenesis of OA, cartilage degeneration coincides with high bone turnover rates, the high osteogenic differentiation potential of OA patient-derived CDC may affect clinical therapeutic regimens aiming at autologous cartilage regeneration in these patients. - Highlights: • We analyze the mesenchymal differentiation capacity of cartilage-derived cells (CDC). • CDC express mesenchymal stem cell (MSC) markers CD29, CD44, CD105, and CD166. • CDC and MSC proliferation is reduced in adipogenesis and increased in osteogenesis. • Adipogenic differentiation is virtually absent in CDC, but
International Nuclear Information System (INIS)
Hoffman, Rex; Welton, Mark L.; Klencke, Barbara; Weinberg, Vivian; Krieg, Richard
1999-01-01
Purpose: To assess the outcome and tolerance of HIV-positive patients with anal cancer to standard therapy based on their pretreatment CD4 count. Methods and Materials: Between 1991 and 1997, 17 HIV-positive patients with anal cancer and documented pretreatment CD4 counts were treated at the University of California, San Francisco or its affiliated hospitals with either concurrent chemotherapy and radiation or radiation alone. The outcome and complications of treatment were correlated with the patients' pretreatment CD4 count. Results: Disease for all 9 patients with pretreatment CD4 counts ≥ 200 was controlled with chemoradiation. Although four required a treatment break of 2 weeks because of toxicity, none required hospitalization. Of the 8 patients with pretreatment CD4 counts < 200, 4 experienced decreased counts, intractable diarrhea, or moist desquamation requiring hospitalization. Additionally, 4 of these 8 ultimately required a colostomy either for a therapy-related complication or for salvage. Nevertheless, 6/7 in this group who received concurrent chemotherapy and radiation had their disease controlled, whereas the patient treated with radiation alone failed and required a colostomy for salvage. Conclusion: Patients with CD4 ≥ 200 had excellent disease control with acceptable morbidity. Patients with CD4 < 200 had markedly increased morbidity; however, disease was ultimately controlled in 7/8 patients
Wang, Gongping; Zeng, Guangwei; Wang, Caie; Wang, Huasheng; Yang, Bo; Guan, Fangxia; Li, Dongpeng; Feng, Xiaoshan
2015-06-01
Amniotic membrane-derived mesenchymal stem cells (hAM-dMSCs) are a potential source of mesenchymal stem cells which could be used to repair skin damage. The use of mesenchymal stem cells to repair skin damage requires safe, effective and biocompatible agents to evaluate the effectiveness of the result. Quantum dots (QDs) composed of CdSe/ZnS are semiconductor nanocrystals with broad excitation and narrow emission spectra, which have been considered as a new chemical and fluorescent substance for non-invasively labeling different cells in vitro and in vivo. This study investigated the cytotoxic effects of QDs on hAM-dMSCs at different times following labeling. Using 0.75, 1.5 and 3.0 μL between quantum dots, labeled human amniotic mesenchymal stem cells were collected on days 1, 2 and 4 and observed morphological changes, performed an MTT cell growth assay and flow cytometry for mesenchymal stem cells molecular markers. Quantum dot concentration 0.75 μg/mL labeled under a fluorescence microscope, cell morphology was observed, The MTT assay showed cells in the proliferative phase. Flow cytometry expression CD29, CD31, CD34, CD44, CD90, CD105 and CD106. Within a certain range of concentrations between quantum dots labeled human amniotic mesenchymal stem cells has good biocompatibility.
Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.
Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M
2015-01-01
Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.
Khan, Arif A; Srivastava, Ruchi; Vahed, Hawa; Roy, Soumyabrata; Walia, Sager S; Kim, Grace J; Fouladi, Mona A; Yamada, Taikun; Ly, Vincent T; Lam, Cynthia; Lou, Anthony; Nguyen, Vivianna; Boldbaatar, Undariya; Geertsema, Roger; Fraser, Nigel W; BenMohamed, Lbachir
2018-06-13
Herpes simplex virus 1 (HSV-1) is a prevalent human pathogen that infects the cornea causing potentially blinding herpetic disease. A clinical herpes vaccine is still lacking. In the present study, a novel prime/pull vaccine was tested in Human Leukocyte Antigen- (HLA-) transgenic rabbit model of ocular herpes (HLA Tg rabbit). Three asymptomatic (ASYMP) peptide epitopes were selected from the HSV-1 membrane glycoprotein C (UL44 400-408 ), the DNA replication binding helicase (UL9 196-204 ), and the tegument protein (UL25 572-580 ), all preferentially recognized by CD8 + T cells from "naturally protected" HSV-1-seropositive healthy ASYMP individuals (who never had recurrent corneal herpetic disease). HLA Tg rabbits were immunized with a mixture of these three ASYMP CD8 + T cell peptide epitopes (UL44 400-408 , UL9 196-204 and UL25 572-580 ), delivered subcutaneously with CpG 2007 adjuvant (prime). Fifteen days later, half of the rabbits received a topical ocular treatment with a recombinant neurotropic AAV8 vector, expressing the T cell-attracting CXCL10 chemokine (pull). The frequency, function of HSV-specific CD8 + T cells induced by the prime/pull vaccine were assessed in peripheral blood, cornea, and trigeminal ganglia (TG). Compared to peptides alone, the peptides/CXCL10 prime/pull vaccine generated frequent polyfunctional gamma interferon-positive (IFN-γ + ) CD107 + CD8 + T cells that infiltrated both the cornea and TG. CD8 + T cells mobilization into cornea and TG of prime/pull- vaccinated rabbits was associated with a significant reduction in corneal herpes infection and disease following an ocular HSV-1 challenge (McKrae). These findings draw attention to the novel prime/pull vaccine strategy to mobilize anti-viral CD8 + T cells into tissues protecting them against herpes infection and disease. IMPORTANCE There is an urgent need for a vaccine against widespread herpes simplex virus infections. The present study demonstrates that immunization of HLA
Chen, Chun-Yuan; Rao, Shan-Shan; Ren, Lu; Hu, Xiong-Ke; Tan, Yi-Juan; Hu, Yin; Luo, Juan; Liu, Yi-Wei; Yin, Hao; Huang, Jie; Cao, Jia; Wang, Zhen-Xing; Liu, Zheng-Zhao; Liu, Hao-Ming; Tang, Si-Yuan; Xu, Ran; Xie, Hui
2018-01-01
Chronic non-healing wounds represent one of the most common complications of diabetes and need advanced treatment strategies. Exosomes are key mediators of cell paracrine action and can be directly utilized as therapeutic agents for tissue repair and regeneration. Here, we explored the effects of exosomes from human urine-derived stem cells (USC-Exos) on diabetic wound healing and the underlying mechanism. Methods: USCs were characterized by flow cytometry and multipotent differentiation potential analyses. USC-Exos were isolated from the conditioned media of USCs and identified by transmission electron microscopy and flow cytometry. A series of functional assays in vitro were performed to assess the effects of USC-Exos on the activities of wound healing-related cells. Protein profiles in USC-Exos and USCs were examined to screen the candidate molecules that mediate USC-Exos function. The effects of USC-Exos on wound healing in streptozotocin-induced diabetic mice were tested by measuring wound closure rates, histological and immunofluorescence analyses. Meanwhile, the role of the candidate protein in USC-Exos-induced regulation of angiogenic activities of endothelial cells and diabetic wound healing was assessed. Results: USCs were positive for CD29, CD44, CD73 and CD90, but negative for CD34 and CD45. USCs were able to differentiate into osteoblasts, adipocytes and chondrocytes. USC-Exos exhibited a cup- or sphere-shaped morphology with a mean diameter of 51.57 ± 2.93 nm and positive for CD63 and TSG101. USC-Exos could augment the functional properties of wound healing-related cells including the angiogenic activities of endothelial cells. USC-Exos were enriched in the proteins that are involved in regulation of wound healing-related biological processes. Particularly, a pro-angiogenic protein called deleted in malignant brain tumors 1 (DMBT1) was highly expressed in USC-Exos. Further functional assays showed that DMBT1 protein was required for USC
Carrion, Ricardo; Brasky, Kathleen; Mansfield, Keith; Johnson, Curtis; Gonzales, Monica; Ticer, Anysha; Lukashevich, Igor; Tardif, Suzette; Patterson, Jean
2007-06-01
Lassa virus causes thousands of deaths annually in western Africa and is considered a potential biological weapon. In an attempt to develop a small nonhuman primate model of Lassa fever, common marmosets were subcutaneously inoculated with Lassa virus strain Josiah. This inoculation resulted in a systemic disease with clinical and morphological features mirroring those in fatal human Lassa infection: fever, weight loss, high viremia and viral RNA load in tissues, elevated liver enzymes, and severe morbidity between days 15 and 20. The most prominent histopathology findings included multifocal hepatic necrosis with mild inflammation and hepatocyte proliferation, lymphoid depletion, and interstitial nephritis. Cellular aggregates in regions of hepatocellular necrosis were largely composed of HAM56-positive macrophages, devoid of CD3-positive and CD20-positive cells, and characterized by marked reductions in the intensity of HLA-DP, DQ, DR staining. A marked reduction in the major histocompatibility complex class II expression was also observed in the lymph nodes. Immunophenotypic alterations in spleen included reductions in overall numbers of CD20-positive and CD3-positive cells and the disruption of lymphoid follicular architecture. These findings identify the common marmoset as an appropriate model of human Lassa fever and present the first experimental evidence that replication of Lassa virus in tissues is associated with alterations that would be expected to impair adaptive immunity.
Directory of Open Access Journals (Sweden)
Alexandra Lind
Full Text Available BACKGROUND AND OBJECTIVE: Barrett's esophagus (BE is characterized by the transition of squamous epithelium into columnar epithelium with intestinal metaplasia. The increased number and types of immune cells in BE have been indicated to be due to a Th2-type inflammatory process. We tested the alternative hypothesis that the abundance of T-cells in BE is caused by a homing mechanism that is found in the duodenum. PATIENTS AND METHODS: Biopsies from BE and duodenal tissue from 30 BE patients and duodenal tissue from 18 controls were characterized by immmunohistochemistry for the presence of T-cells and eosinophils(eos. Ex vivo expanded T-cells were further phenotyped by multicolor analysis using flowcytometry. RESULTS: The high percentage of CD4(+-T cells (69±3% (mean±SEM/n = 17, by flowcytometry, measured by flowcytometry and immunohistochemistry, and the presence of non-activated eosinophils found in BE by immunohistochemical staining, were not different from that found in duodenal tissue. Expanded lymphocytes from these tissues had a similar phenotype, characterized by a comparable but low percentage of αE(CD103 positive CD4(+cells (44±5% in BE, 43±4% in duodenum of BE and 34±7% in duodenum of controls and a similar percentage of granzyme-B(+CD8(+ cells(44±5% in BE, 33±6% in duodenum of BE and 36±7% in duodenum of controls. In addition, a similar percentage of α4β7(+ T-lymphocytes (63±5% in BE, 58±5% in duodenum of BE and 62±8% in duodenum of controls was found. Finally, mRNA expression of the ligand for α4β7, MAdCAM-1, was also similar in BE and duodenal tissue. No evidence for a Th2-response was found as almost no IL-4(+-T-cells were seen. CONCLUSION: The immune cell composition (lymphocytes and eosinophils and expression of intestinal adhesion molecule MAdCAM-1 is similar in BE and duodenum. This supports the hypothesis that homing of lymphocytes to BE tissue is mainly caused by intestinal homing signals rather than to an
Stzepourginski, Igor; Nigro, Giulia; Jacob, Jean-Marie; Dulauroy, Sophie; Sansonetti, Philippe J; Eberl, Gérard; Peduto, Lucie
2017-01-24
The intestinal epithelium is continuously renewed by intestinal epithelial stem cells (IESCs) positioned at the base of each crypt. Mesenchymal-derived factors are essential to maintain IESCs; however, the cellular composition and development of such mesenchymal niche remains unclear. Here, we identify pericryptal CD34 + Gp38 + αSMA - mesenchymal cells closely associated with Lgr5 + IESCs. We demonstrate that CD34 + Gp38 + cells are the major intestinal producers of the niche factors Wnt2b, Gremlin1, and R-spondin1, and are sufficient to promote maintenance of Lgr5 + IESCs in intestinal organoids, an effect mainly mediated by Gremlin1. CD34 + Gp38 + cells develop after birth in the intestinal submucosa and expand around the crypts during the third week of life in mice, independently of the microbiota. We further show that pericryptal CD34 + gp38 + cells are rapidly activated by intestinal injury, up-regulating niche factors Gremlin1 and R-spondin1 as well as chemokines, proinflammatory cytokines, and growth factors with key roles in gut immunity and tissue repair, including IL-7, Ccl2, Ptgs2, and Amphiregulin. Our results indicate that CD34 + Gp38 + mesenchymal cells are programmed to develop in the intestine after birth to constitute a specialized microenvironment that maintains IESCs at homeostasis and contribute to intestinal inflammation and repair after injury.
Hegazy, Ahmed N; West, Nathaniel R; Stubbington, Michael J T; Wendt, Emily; Suijker, Kim I M; Datsi, Angeliki; This, Sebastien; Danne, Camille; Campion, Suzanne; Duncan, Sylvia H; Owens, Benjamin M J; Uhlig, Holm H; McMichael, Andrew; Bergthaler, Andreas; Teichmann, Sarah A; Keshav, Satish; Powrie, Fiona
2017-11-01
Interactions between commensal microbes and the immune system are tightly regulated and maintain intestinal homeostasis, but little is known about these interactions in humans. We investigated responses of human CD4 + T cells to the intestinal microbiota. We measured the abundance of T cells in circulation and intestinal tissues that respond to intestinal microbes and determined their clonal diversity. We also assessed their functional phenotypes and effects on intestinal resident cell populations, and studied alterations in microbe-reactive T cells in patients with chronic intestinal inflammation. We collected samples of peripheral blood mononuclear cells and intestinal tissues from healthy individuals (controls, n = 13-30) and patients with inflammatory bowel diseases (n = 119; 59 with ulcerative colitis and 60 with Crohn's disease). We used 2 independent assays (CD154 detection and carboxy-fluorescein succinimidyl ester dilution assays) and 9 intestinal bacterial species (Escherichia coli, Lactobacillus acidophilus, Bifidobacterium animalis subsp lactis, Faecalibacterium prausnitzii, Bacteroides vulgatus, Roseburia intestinalis, Ruminococcus obeum, Salmonella typhimurium, and Clostridium difficile) to quantify, expand, and characterize microbe-reactive CD4 + T cells. We sequenced T-cell receptor Vβ genes in expanded microbe-reactive T-cell lines to determine their clonal diversity. We examined the effects of microbe-reactive CD4 + T cells on intestinal stromal and epithelial cell lines. Cytokines, chemokines, and gene expression patterns were measured by flow cytometry and quantitative polymerase chain reaction. Circulating and gut-resident CD4 + T cells from controls responded to bacteria at frequencies of 40-4000 per million for each bacterial species tested. Microbiota-reactive CD4 + T cells were mainly of a memory phenotype, present in peripheral blood mononuclear cells and intestinal tissue, and had a diverse T-cell receptor Vβ repertoire. These
The Phenotypic Fate of Bone Marrow-Derived Stem Cells in Acute Kidney Injury
Directory of Open Access Journals (Sweden)
Guowei Feng
2013-11-01
Full Text Available Background: Despite increasing attention on the role of bone marrow derived stem cells in repair or rejuvenation of tissues and organs, cellular mechanisms of such cell-based therapy remain poorly understood. Methods: We reconstituted hematopoiesis in recipient C57BL/6J mice by transplanting syngeneic GFP+ bone marrow (BM cells. Subsequently, the recipients received subcutaneous injection of granulocyte-colony stimulating factor (G-CSF and were subjected to acute renal ischemic injury. Flow cytometry and immunostaining were performed at various time points to assess engraftment and phenotype of BM derived stem cells. Results: Administration of G-CSF increased the release of BM derived stem cells into circulation and enhanced the ensuing recruitment of BM derived stem cells into injured kidney. During the second month post injury, migrated BM derived stem cells lost hematopoietic phenotype (CD45 but maintained the expression of other markers (Sca-1, CD133 and CD44, suggesting their potential of transdifferentiation into renal stem cells. Moreover, G-CSF treatment enhanced the phenotypic conversion. Conclusion: Our work depicted a time-course dependent transition of phenotypic characteristics of BM derived stem cells, demonstrated the existence of BM derived stem cells in damaged kidney and revealed the effects of G-CSF on cell transdifferentiation.
Assessment of Energy Metabolic Changes in Adipose Tissue-Derived Stem Cells
Hajmousa, Ghazaleh; Harmsen, Martin C; Di Nardo, Paolo; Dhingra, Sanjiv; Singla, Dinender K.
2017-01-01
Adipose tissue-derived stem cells (ADSC) are promising candidates for therapeutic applications in cardiovascular regenerative medicine. By definition, the phenotype ADSCs, e.g., the ubiquitous secretion of growth factors, cytokines, and extracellular matrix components is not met in vivo, which
Hosoi, Hiroki; Sonoki, Takashi; Murata, Shogo; Mushino, Toshiki; Kuriyama, Kodai; Nishikawa, Akinori; Hanaoka, Nobuyoshi; Ohshima, Koichi; Imadome, Ken-Ichi; Nakakuma, Hideki
2015-01-01
A 30-year-old woman was diagnosed with severe infectious mononucleosis (IM). The Epstein-Barr virus (EBV) had infected both CD19- and CD8-positive cells, and clonal proliferation of EBV-infected cells and T-cells was detected. Although we suspected malignant lymphoma, her condition improved following immunosuppressive therapy. A similar case was recently reported; therefore, this case is the second case of IM with EBV-infected CD8-positive cells and clonal proliferation of EBV-infected cells. Our results demonstrate that the clonal proliferation of EBV-infected cells is not always an indication for chemotherapy in the primary infection phase and that monitoring the EBV viral load is useful for therapeutic decision-making.
Directory of Open Access Journals (Sweden)
Kefang Tan
Full Text Available The application of autologous endothelial progenitor cell (EPC transplantation is a promising approach in therapeutic cardiovascular diseases and ischemic diseases. In this study, we compared the immunogenicity of EPCs, adipose tissue (AD-derived mesenchymal stem cells (MSCs and umbilical cord (UC-derived MSCs by flow cytometry and the mixed lymphocyte reaction. The impact of AD-MSCs and UC-MSCs on the immunogenicity of EPCs was analyzed by the mixed lymphocyte reaction and cytokine secretion in vitro and was further tested by allogenic peripheral blood mononuclear cell (PBMC induced immuno-rejection on a cell/matrigel graft in an SCID mouse model. EPCs and AD-MSCs express higher levels of MHC class I than UC-MSCs. All three kinds of cells are negative for MHC class II. UC-MSCs also express lower levels of IFN-γ receptor mRNA when compared with EPCs and AD-MSCs. EPCs can stimulate higher rates of proliferation of lymphocytes than AD-MSCs and UC-MSCs. Furthermore, AD-MSCs and UC-MSCs can modulate immune response and inhibit lymphocyte proliferation induced by EPCs, mainly through inhibition of the proliferation of CD8+ T cells. Compared with UC-MSCs, AD-MSCs can significantly improve vessel formation and maintain the integrity of neovascular structure in an EPC+MSC/matrigel graft in SCID mice, especially under allo-PBMC induced immuno-rejection. In conclusion, our study shows that AD-MSC is a powerful candidate to minimize immunological rejection and improve vessel formation in EPC transplantation treatment.
Directory of Open Access Journals (Sweden)
R. Heru Prasetyo
2017-06-01
Full Text Available Aim: This study was to evaluate effect of honey in repairing damage of liver tissue due to energy protein malnutrition and in mobilization of endogenous stem cells. Materials and Methods: Male mice model of degenerative liver was obtained through food fasting but still have drinking water for 5 days. It caused energy protein malnutrition and damage of liver tissue. The administration of 50% (v/v honey was performed for 10 consecutive days, while the positive control group was fasted and not given honey and the negative control not fasted and without honey. Observations of regeneration the liver tissue based on histologically examination, observation of Hsp70 expression, and homing signal based on vascular endothelial growth factor-1 (VEGF-1 expression using immunohistochemistry technique. Observation on expression of CD34 and CD45 as the marker of auto mobilization of hematopoietic stem cells using flow cytometry technique. Results: There is regeneration of the liver tissue due to protein energy malnutrition, decrease of Hsp70 expression, increase of VEGF-1 expression, and high expression of CD34 and CD45. Conclusion: Honey can improve the liver tissue based on: (1 Mobilization of endogenous stem cells (CD34 and CD45; (2 Hsp70 and VEGF-1 expressions as regeneration marker of improvement, and (3 regeneration histologically of liver tissue.
Energy Technology Data Exchange (ETDEWEB)
Lee, Eun Ji; Ju, Hui Yeong; Park, Ki Min [Dept. of Chemistry and Research Institute of Natural Science, Gyeongsang National University, Jinju (Korea, Republic of); Moon, ASuk Hee [Dept. of Food and Nutrition, Kyungnam College of Inform ation and Technology, Busan (Korea, Republic of); Kang, Young Jin [Div. of cience Education, Kangwon National University, Chuncheon (Korea, Republic of)
2015-08-15
Polynuclear coordination polymers can exhibit more intriguing network topologies and better functionalities than those of common complexes because they have metal-cluster nodes for the construction of multidimensional frameworks and the potential applications induced by collaborative activities between metal ions. New tetranuclear Cd(II) coordination polymer 1 based on 1,3-alternate calix arene derivative (H{sub 4} CTA) with four carboxyl pendant arms has been synthesized by the solvo thermal reaction at 110 .deg. C for 2 days. Compound 1 shows a 3-D framework consisting of tetranuclear Cd(II) cluster core as a metal-cluster node and 1,3-alternate H{sub 4}CTA as a multidentate linker. The coordination polymer 1 displays intense blue emission, implying that this tetranuclear Cd(II) coordination polymer could be a suitable material in the area of luminescence research.
Rudolf-Oliveira, Renata Cristina Messores; Auat, Mariangeles; Cardoso, Chandra Chiappin; Santos-Pirath, Iris Mattos; Lange, Barbara Gil; Pires-Silva, Jéssica; Moraes, Ana Carolina Rabello de; Dametto, Gisele Cristina; Pirolli, Mayara Marin; Colombo, Maria Daniela Holthausen Périco; Santos-Silva, Maria Claudia
2018-02-01
In 2010, new monoclonal antibodies were submitted to the 9th International Workshop on Human Leukocyte Differentiation Antigens, and there are few studies demonstrating normal expression patterns of these markers. Thus, the objective of this study was to determine the normal patterns of cell expression of CD86, CD210a, CD261, CD262, CD264, CD358, and CD361 in peripheral blood (PB) and bone marrow (BM) samples by flow cytometry. In the present study, CD86 was expressed only in monocytes and B lymphocytes in PB and in monocytes and plasma cells in BM. Regarding CD210a expression, in PB samples, monocytes and NK cells showed weak expression, while neutrophils, B and T lymphocytes, and basophils showed weak and partial expression. In BM samples, expression of CD210a was observed in eosinophils, monocytes, and B and T/NK lymphocytes. Weak expression of CD210a was also observed in neutrophilic cells and plasma cells. All B cell maturation stages had weak expression of CD210a except for immature B cells, which did not express this marker. In the present study, no cell type in PB samples showed positivity for CD261 and, in BM samples, there was very weak expression in neutrophilic series, monocytes, and B lymphocytes. Conversely, plasma cells showed positivity for CD261 with a homogeneous expression. For CD262, there was weak expression in monocytes, neutrophils, and B lymphocytes in PB samples and weak expression in monocytes, B lymphocytes, and plasma cells in BM samples. The evaluation of CD264 showed very weak expression in B cells in PB samples and no expression in BM cells. Very weak expression of CD358 was observed in neutrophils, monocytes, and B lymphocytes in PB and BM samples. In addition, in BM samples, plasma cells and T lymphocytes showed weak expression of CD358. In relation to the maturation stages of B cells, there was weak expression in pro-B cel, pre-B cell, and mature B cell. In the present study, it was possible to observe expression of CD361 in all
Generation of Dopamine-Secreting Cells from Human Adipose Tissue-Derived Stem Cells In Vitro.
Soheilifar, Mohammad Hasan; Javeri, Arash; Amini, Hossein; Taha, Masoumeh Fakhr
2018-03-12
Several studies have demonstrated the differentiation of human adipose tissue-derived stem cells (hADSCs) to neuronal and glial phenotypes, but directing the fate of these cells toward dopaminergic neurons has not been frequently reported. The aim of this study was to investigate dopaminergic specification of hADSCs in vitro. ADSCs were isolated from subcutaneous abdominal adipose tissue and were characterized. For dopaminergic differentiation, a cocktail of sonic hedgehog, fibroblast growth factor 8, basic fibroblast growth factor, and brain-derived neurotrophic factor were used under a low serum condition. As the control group, the ADSCs were cultured under the same low serum condition without the dopaminergic cocktail. At the end of differentiation period, the cells expressed neuron-specific markers, NES, NSE, and NEFL, and dopaminergic markers, EN1, NURR1, PITX3, VMAT2, TH, and GIRK2 genes. TH, NURR1, and EN1 mRNAs were upregulated in the dopaminergic group compared with the control group. NEFL and TH proteins were also expressed in the differentiated cells. A total of 27.9% of the cells differentiated in dopaminergic induction medium showed positive staining for TH protein. Based on reversed-phase high-performance liquid chromatography analysis, the differentiated cells released a significant amount of dopamine in response to KCl-induced depolarization. In conclusion, results of this study indicate that hADSCs can be induced by a growth factor cocktail to produce dopamine secreting cells with possible applications for future cell replacement therapy of Parkinson's disease.
13 CFR 146.500 - Secretary of Defense.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...
13 CFR 146.600 - Semi-annual compilation.
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...
Chinnery, Holly R; Ruitenberg, Marc J; McMenamin, Paul G
2010-09-01
The mouse dura mater, pia mater, and choroid plexus contain resident macrophages and dendritic cells (DCs). These cells participate in immune surveillance, phagocytosis of cellular debris, uptake of antigens from the surrounding cerebrospinal fluid and immune regulation in many pathologic processes. We used Cx3cr1 knock-in, CD11c-eYFP transgenic and bone marrow chimeric mice to characterize the phenotype, density and replenishment rate of monocyte-derived cells in the meninges and choroid plexus and to assess the role of the chemokine receptor CX3CR1 on their number and tissue distribution. Iba-1 major histocompatibility complex (MHC) Class II CD169 CD68 macrophages and CD11c putative DCs were identified in meningeal and choroid plexus whole mounts. Comparison of homozygous and heterozygous Cx3cr1 mice did not reveal CX3CR1-dependancy on density, distribution or phenotype of monocyte-derived cells. In turnover studies, wild type lethally irradiated mice were reconstituted with Cx3cr1/-positive bone marrow and were analyzed at 3 days, 1, 2, 4 and 8 weeks after transplantation. There was a rapid replenishment of CX3CR1-positive cells in the dura mater (at 4 weeks) and the choroid plexus was fully reconstituted by 8 weeks. These data provide the foundation for future studies on the role of resident macrophages and DCs in conditions such as meningitis, autoimmune inflammatory disease and in therapies involving irradiation and hematopoietic or stem cell transplantation.
Energy Technology Data Exchange (ETDEWEB)
Gajdosechova, Zuzana [Trace Element Speciation Laboratory, Department of Chemistry, Meston Walk, University of Aberdeen, Aberdeen AB24 3UE (United Kingdom); Brownlow, Andrew [SAC Wildlife Unit, Inverness (United Kingdom); Cottin, Nicolas T.; Fernandes, Mariana [Trace Element Speciation Laboratory, Department of Chemistry, Meston Walk, University of Aberdeen, Aberdeen AB24 3UE (United Kingdom); Read, Fiona L. [Oceanlab, University of Aberdeen, Main Street, Newburgh AB41 6AA (United Kingdom); Urgast, Dagmar S.; Raab, Andrea; Feldmann, Jörg; Krupp, Eva M. [Trace Element Speciation Laboratory, Department of Chemistry, Meston Walk, University of Aberdeen, Aberdeen AB24 3UE (United Kingdom)
2016-03-01
The bioaccumulation of metals was investigated by analysis of liver, kidney, muscle and brain tissue of a pod of 21 long-finned pilot whales (Globicephala melas) of all ages stranded in Scotland, UK. The results are the first to report cadmium (Cd) passage through the blood–brain barrier of pilot whales and provide a comprehensive study of the long-term (up to 35 years) mammalian exposure to the environmental pollutants. Additionally, linear accumulation of mercury (Hg) was observed in all studied tissues, whereas for Cd this was only observed in the liver. Total Hg concentration above the upper neurochemical threshold was found in the sub-adult and adult brains and methylmercury (MeHg) of 2.2 mg/kg was found in the brain of one individual. Inter-elemental analysis showed significant positive correlations of Hg with selenium (Se) and Cd with Se in all studied tissues. Furthermore, differences in the elemental concentrations in the liver and brain tissues were found between juvenile, sub-adult and adult groups. The highest concentrations of manganese, iron, zinc, Se, Hg and MeHg were noted in the livers, whereas Cd predominantly accumulated in the kidneys. High concentrations of Hg and Cd in the tissues of pilot whales presented in this study reflect ever increasing toxic stress on marine mammals. - Highlights: • Trace elements were measured in a pod of 21 pilot whales stranded in Scotland. • Bioaccumulation of mercury and methyl mercury was found in all studied tissues. • Cadmium age related accumulation was observed in the liver and brain tissues. • Cadmium-selenium correlations suggest formation of cadmium-selenium complexes.
International Nuclear Information System (INIS)
Gajdosechova, Zuzana; Brownlow, Andrew; Cottin, Nicolas T.; Fernandes, Mariana; Read, Fiona L.; Urgast, Dagmar S.; Raab, Andrea; Feldmann, Jörg; Krupp, Eva M.
2016-01-01
The bioaccumulation of metals was investigated by analysis of liver, kidney, muscle and brain tissue of a pod of 21 long-finned pilot whales (Globicephala melas) of all ages stranded in Scotland, UK. The results are the first to report cadmium (Cd) passage through the blood–brain barrier of pilot whales and provide a comprehensive study of the long-term (up to 35 years) mammalian exposure to the environmental pollutants. Additionally, linear accumulation of mercury (Hg) was observed in all studied tissues, whereas for Cd this was only observed in the liver. Total Hg concentration above the upper neurochemical threshold was found in the sub-adult and adult brains and methylmercury (MeHg) of 2.2 mg/kg was found in the brain of one individual. Inter-elemental analysis showed significant positive correlations of Hg with selenium (Se) and Cd with Se in all studied tissues. Furthermore, differences in the elemental concentrations in the liver and brain tissues were found between juvenile, sub-adult and adult groups. The highest concentrations of manganese, iron, zinc, Se, Hg and MeHg were noted in the livers, whereas Cd predominantly accumulated in the kidneys. High concentrations of Hg and Cd in the tissues of pilot whales presented in this study reflect ever increasing toxic stress on marine mammals. - Highlights: • Trace elements were measured in a pod of 21 pilot whales stranded in Scotland. • Bioaccumulation of mercury and methyl mercury was found in all studied tissues. • Cadmium age related accumulation was observed in the liver and brain tissues. • Cadmium-selenium correlations suggest formation of cadmium-selenium complexes.
Arthroscopic Harvest of Adipose-Derived Mesenchymal Stem Cells From the Infrapatellar Fat Pad.
Dragoo, Jason L; Chang, Wenteh
2017-11-01
The successful isolation of adipose-derived mesenchymal stem cells (ADSCs) from the arthroscopically harvested infrapatellar fat pad (IFP) would provide orthopaedic surgeons with an autologous solution for regenerative procedures. To demonstrate the quantity and viability of the mesenchymal stem cell population arthroscopically harvested from the IFP as well as the surrounding synovium. Descriptive laboratory study. The posterior border of the IFP, including the surrounding synovial tissue, was harvested arthroscopically from patients undergoing anterior cruciate ligament reconstruction. Tissue was then collected in an AquaVage adipose canister, followed by fat fractionization using syringe emulsification and concentration with an AdiPrep device. In the laboratory, the layers of tissue were separated and then digested with 0.3% type I collagenase. The pelleted stromal vascular fraction (SVF) cells were then immediately analyzed for viability, mesenchymal cell surface markers by fluorescence-activated cell sorting, and clonogenic capacity. After culture expansion, the metabolic activity of the ADSCs was assessed by an AlamarBlue assay, and the multilineage differentiation capability was tested. The transition of surface antigens from the SVF toward expanded ADSCs at passage 2 was further evaluated. SVF cells were successfully harvested with a mean yield of 4.86 ± 2.64 × 10 5 cells/g of tissue and a mean viability of 69.03% ± 10.75%, with ages ranging from 17 to 52 years (mean, 35.14 ± 13.70 years; n = 7). The cultured ADSCs composed a mean 5.85% ± 5.89% of SVF cells with a mean yield of 0.33 ± 0.42 × 10 5 cells/g of tissue. The nonhematopoietic cells (CD45 - ) displayed the following surface antigens as a percentage of the viable population: CD44 + (52.21% ± 4.50%), CD73 + CD90 + CD105 + (19.20% ± 17.04%), and CD44 + CD73 + CD90 + CD105 + (15.32% ± 15.23%). There was also a significant increase in the expression of ADSC markers CD73 (96.97% ± 1.72%; P
M. Roemeling-Van Rhijn (Marieke); F.K.F. Mensah (Fane ); S.S. Korevaar (Sander); M.J.C. Leijs (Maarten J.C.); G.J.V.M. van Osch (Gerjo); J.N.M. IJzermans (Jan); M.G.H. Betjes (Michiel); C.C. Baan (Carla); W. Weimar (Willem); M.J. Hoogduijn (Martin)
2013-01-01
textabstractAdipose tissue-derived mesenchymal stem cells (ASC) are of great interest as a cellular therapeutic agent for regenerative and immunomodulatory purposes. The function of ASC adapts to environmental conditions, such as oxygen tension. Oxygen levels within tissues are typically much lower
Potential of iPSC-Derived Mesenchymal Stromal Cells for Treating Periodontal Disease
Directory of Open Access Journals (Sweden)
K. Hynes
2018-01-01
Full Text Available Mesenchymal stromal cell-like populations have been derived from mouse-induced pluripotent stem cells (miPSC-MSC with the capability for tissue regeneration. In this study, murine iPSC underwent differentiation towards an MSC-like immunophenotype. Stable miPSC-MSC cultures expressed the MSC-associated markers, CD73, CD105, and Sca-1, but lacked expression of the pluripotency marker, SSEA1, and hematopoietic markers, CD34 and CD45. Functionally, miPSC-MSC exhibited the potential for trilineage differentiation into osteoblasts, adipocytes, and chondrocytes and the capacity to suppress the proliferation of mitogen-activated splenocytes. The efficacy of miPSC-MSC was assessed in an acute inflammation model following systemic or local delivery into mice with subcutaneous implants containing heat-inactivated P. gingivalis. Histological analysis revealed less inflammatory cellular infiltrate within the sponges in mice treated with miPSC-MSC cells delivered locally rather than systemically. Assessment of proinflammatory cytokines in mouse spleens found that CXCL1 transcripts and protein were reduced in mice treated with miPSC-MSC. In a periodontitis model, mice subjected to oral inoculation with P. gingivalis revealed less bone tissue destruction and inflammation within the jaws when treated with miPSC-MSC compared to PBS alone. Our results demonstrated that miPSC-MSC derived from iPSC have the capacity to control acute and chronic inflammatory responses associated with the destruction of periodontal tissue. Therefore, miPSC-MSC present a promising novel source of stromal cells which could be used in the treatment of periodontal disease and other inflammatory systemic diseases such as rheumatoid arthritis.
Time-resolved photoluminescence study of CdSe/CdMnS/CdS core/multi-shell nanoplatelets
International Nuclear Information System (INIS)
Murphy, J. R.; Delikanli, S.; Demir, H. V.; Scrace, T.; Zhang, P.; Norden, T.; Petrou, A.; Thomay, T.; Cartwright, A. N.
2016-01-01
We used photoluminescence spectroscopy to resolve two emission features in CdSe/CdMnS/CdS and CdSe/CdS core/multi-shell nanoplatelet heterostructures. The photoluminescence from the magnetic sample has a positive circular polarization with a maximum centered at the position of the lower energy feature. The higher energy feature has a corresponding signature in the absorption spectrum; this is not the case for the low-energy feature. We have also studied the temporal evolution of these features using a pulsed-excitation/time-resolved photoluminescence technique to investigate their corresponding recombination channels. A model was used to analyze the temporal dynamics of the photoluminescence which yielded two distinct timescales associated with these recombination channels. The above results indicate that the low-energy feature is associated with recombination of electrons with holes localized at the core/shell interfaces; the high-energy feature, on the other hand, is excitonic in nature with the holes confined within the CdSe cores.
Time-resolved photoluminescence study of CdSe/CdMnS/CdS core/multi-shell nanoplatelets
Energy Technology Data Exchange (ETDEWEB)
Murphy, J. R. [Department of Electrical Engineering, State University of New York, University at Buffalo, Buffalo, New York 14260 (United States); Department of Physics, State University of New York, University at Buffalo, Buffalo, New York 14260 (United States); Delikanli, S.; Demir, H. V., E-mail: volkan@bilkent.edu.tr [LUMINOUS Center of Excellence for Semiconductor Lighting and Displays, School of Electrical and Electronic Engineering, School of Physical and Materials Sciences, Nanyang Technological University, Singapore 639798 (Singapore); Department of Electrical and Electronics Engineering, Department of Physics, UNAM−Institute of Materials Science and Nanotechnology, Bilkent University, Ankara 06800 (Turkey); Scrace, T.; Zhang, P.; Norden, T.; Petrou, A., E-mail: petrou@buffalo.edu [Department of Physics, State University of New York, University at Buffalo, Buffalo, New York 14260 (United States); Thomay, T.; Cartwright, A. N. [Department of Electrical Engineering, State University of New York, University at Buffalo, Buffalo, New York 14260 (United States)
2016-06-13
We used photoluminescence spectroscopy to resolve two emission features in CdSe/CdMnS/CdS and CdSe/CdS core/multi-shell nanoplatelet heterostructures. The photoluminescence from the magnetic sample has a positive circular polarization with a maximum centered at the position of the lower energy feature. The higher energy feature has a corresponding signature in the absorption spectrum; this is not the case for the low-energy feature. We have also studied the temporal evolution of these features using a pulsed-excitation/time-resolved photoluminescence technique to investigate their corresponding recombination channels. A model was used to analyze the temporal dynamics of the photoluminescence which yielded two distinct timescales associated with these recombination channels. The above results indicate that the low-energy feature is associated with recombination of electrons with holes localized at the core/shell interfaces; the high-energy feature, on the other hand, is excitonic in nature with the holes confined within the CdSe cores.
Directory of Open Access Journals (Sweden)
Cathleen eSpath
2013-04-01
Full Text Available Background: Recently, we demonstrated the beneficial effects of engineered heart tissues for the treatment of dilated cardiomyopathy in rats. For further development of this technique we started to produce engineered tissue (ET from mesenchymal stem cells. Interestingly, we observed a malignant tumour invading the heart with an inverse relationship between proliferation markers and connexin-expression.Methods: Commercial CD54+/CD90+/CD34-/CD45- bone marrow derived mesenchymal rat stem cells (cBM-MSC, characterized were used for production of mesenchymal stem-cell-ET (MSC-ET by suspending them in a collagen-I, matrigel-mixture and cultivating for 14 days with electrical stimulation. 3 MSC-ET were implanted around the beating heart of adult rats for days. Another 3 MSC-ET were produced from freshly isolated rat bone marrow derived stem cells (sBM-MSC.Results: 3 weeks after implantation of the MSC-ETs the hearts were surgically excised. While in 5/6 cases the ET was clearly distinguishable and was found as a ring containing mostly connective tissue around the heart, in 1/6 the heart was completely surrounded by a huge, undifferentiated, pleomorphic tumour originating from the cMSC-ET (cBM-MSC, classified as a high grade malignant sarcoma. Quantitatively we found a clear inverse relationship between cardiac connexin-expression (Cx43, Cx40 or Cx45 and increased Ki-67 expression (Cx43: p<0.0001, Cx45: p<0.03, Cx40: p<0.014. At the tumour-heart border there were significantly more Ki-67 positive cells (p=0.001, and only 2% Cx45 and Ki-67-expressing cells, while the other connexins were nearly completely absent (p<0.0001.Conclusions and hypothesis: These observations strongly suggest the hypothesis, that invasive tumour growth is accompanied by reduction in connexins. This implicates that gap junction communication between tumour and normal tissue is reduced or absent, which could mean that growth and differentiation signals can not be exchanged.
Mast-Cell-Derived TNF Amplifies CD8+ Dendritic Cell Functionality and CD8+ T Cell Priming
Directory of Open Access Journals (Sweden)
Jan Dudeck
2015-10-01
Full Text Available Mast cells are critical promoters of adaptive immunity in the contact hypersensitivity model, but the mechanism of allergen sensitization is poorly understood. Using Mcpt5-CreTNFFL/FL mice, we show here that the absence of TNF exclusively in mast cells impaired the expansion of CD8+ T cells upon sensitization and the T-cell-driven adaptive immune response to elicitation. T cells primed in the absence of mast cell TNF exhibited a diminished efficiency to transfer sensitization to naive recipients. Specifically, mast cell TNF promotes CD8+ dendritic cell (DC maturation and migration to draining lymph nodes. The peripherally released mast cell TNF further critically boosts the CD8+ T-cell-priming efficiency of CD8+ DCs, thereby linking mast cell effects on T cells to DC modulation. Collectively, our findings identify the distinct potential of mast cell TNF to amplify CD8+ DC functionality and CD8+ T-cell-dominated adaptive immunity, which may be of great importance for immunotherapy and vaccination approaches.
Lifescience Database Archive (English)
Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA
29 CFR 4.146 - Contract obligations after award, generally.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...
34 CFR 300.146 - Responsibility of SEA.
2010-07-01
... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...
Skeletal Muscle Derived IL-6 in Liver and Adipose Tissue Metabolism
DEFF Research Database (Denmark)
Knudsen, Jakob Grunnet
Summary Physical activity can lead to metabolic disease and treatment of several metabolic diseases include exercise training. Skeletal muscle has, due to its central role in glucose and fat metabolism at rest and during exercise been studied in detail with regard to exercise training. The role...... of both liver and adipose tissue regulation in whole body metabolism has come in to focus and it has been shown that both tissues are subject to exercise training-induced adaptations. However, the contribution of endocrine factors to the regulation of exercise training-induced adaptations in liver...... and adipose tissue metabolism is unknown. It has been suggested that myokines, such as IL-6, released from skeletal muscle affects liver and adipose tissue and are involved in the regulation of exercise training adaptations. Thus, the aim of this thesis was to investigate the role of skeletal muscle derived...
Directory of Open Access Journals (Sweden)
Götz Pilarczyk
2016-01-01
Full Text Available The present work addresses the question of to what extent a geometrical support acts as a physiological determining template in the setup of artificial cardiac tissue. Surface patterns with alternating concave to convex transitions of cell size dimensions were used to organize and orientate human-induced pluripotent stem cell (hIPSC-derived cardiac myocytes and mouse neonatal cardiac myocytes. The shape of the cells, as well as the organization of the contractile apparatus recapitulates the anisotropic line pattern geometry being derived from tissue geometry motives. The intracellular organization of the contractile apparatus and the cell coupling via gap junctions of cell assemblies growing in a random or organized pattern were examined. Cell spatial and temporal coordinated excitation and contraction has been compared on plain and patterned substrates. While the α-actinin cytoskeletal organization is comparable to terminally-developed native ventricular tissue, connexin-43 expression does not recapitulate gap junction distribution of heart muscle tissue. However, coordinated contractions could be observed. The results of tissue-like cell ensemble organization open new insights into geometry-dependent cell organization, the cultivation of artificial heart tissue from stem cells and the anisotropy-dependent activity of therapeutic compounds.
19 CFR 146.93 - Inventory control and recordkeeping system.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...
Ezzelarab, Mohamed B; Lu, Lien; Shufesky, William F; Morelli, Adrian E; Thomson, Angus W
2018-01-01
Donor-derived regulatory dendritic cell (DCreg) infusion before transplantation, significantly prolongs renal allograft survival in non-human primates. This is associated with enhanced expression of the immunoregulatory molecules cytotoxic T-lymphocyte-associated antigen (Ag) 4 (CTLA4) and programmed cell death protein 1 (PD1) by host donor-reactive T cells. In rodents and humans, CD28 co-stimulatory pathway blockade with the fusion protein CTLA4:Ig (CTLA4Ig) is associated with reduced differentiation and development of regulatory T cells (Treg). We hypothesized that upregulation of CTLA4 by donor-reactive CD4 + T cells in DCreg-infused recipients treated with CTLA4Ig, might be associated with higher incidences of donor-reactive CD4 + T cells with a Treg phenotype. In normal rhesus monkeys, allo-stimulated CD4 + CTLA4 hi , but not CD4 + CTLA4 med/lo T cells exhibited a regulatory phenotype, irrespective of PD1 expression. CTLA4Ig significantly reduced the incidence of CD4 + CTLA4 hi , but not CD4 + CTLA4 med/lo T cells following allo-stimulation, associated with a significant reduction in the CD4 + CTLA4 hi /CD4 + CTLA4 med/lo T cell ratio. In CTLA4Ig-treated renal allograft recipient monkeys, there was a marked reduction in circulating donor-reactive CD4 + CTLA4 hi T cells. In contrast, in CTLA4Ig-treated monkeys with DCreg infusion, no such reduction was observed. In parallel, the donor-reactive CD4 + CTLA4 hi /CD4 + CTLA4 med/lo T cell ratio was reduced significantly in graft recipients without DCreg infusion, but increased in those given DCreg. These observations suggest that pre-transplant DCreg infusion promotes and maintains donor-reactive CD4 + CTLA4 hi T cells with a regulatory phenotype after transplantation, even in the presence of CD28 co-stimulation blockade.
Energy Technology Data Exchange (ETDEWEB)
Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others
2013-01-15
The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.
Srivastava, Ruchi; Khan, Arif A; Chilukuri, Sravya; Syed, Sabrina A; Tran, Tien T; Furness, Julie; Bahraoui, Elmostafa; BenMohamed, Lbachir
2017-07-15
Herpes simplex virus 1 (HSV-1) establishes latency within the sensory neurons of the trigeminal ganglia (TG). HSV-specific memory CD8 + T cells play a critical role in preventing HSV-1 reactivation from TG and subsequent virus shedding in tears that trigger recurrent corneal herpetic disease. The CXC chemokine ligand 10 (CXCL10)/CXC chemokine receptor 3 (CXCR3) chemokine pathway promotes T cell immunity to many viral pathogens, but its importance in CD8 + T cell immunity to recurrent herpes has been poorly elucidated. In this study, we determined how the CXCL10/CXCR3 pathway affects TG- and cornea-resident CD8 + T cell responses to recurrent ocular herpesvirus infection and disease using a well-established murine model in which HSV-1 reactivation was induced from latently infected TG by UV-B light. Following UV-B-induced HSV-1 reactivation, a significant increase in both the number and function of HSV-specific CXCR3 + CD8 + T cells was detected in TG and corneas of protected C57BL/6 (B6) mice, but not in TG and corneas of nonprotected CXCL10 -/- or CXCR3 -/- deficient mice. This increase was associated with a significant reduction in both virus shedding and recurrent corneal herpetic disease. Furthermore, delivery of exogenous CXCL10 chemokine in TG of CXCL10 -/- mice, using the neurotropic adeno-associated virus type 8 (AAV8) vector, boosted the number and function of effector memory CD8 + T cells (T EM ) and tissue-resident memory CD8 + T cells (T RM ), but not of central memory CD8 + T cells (T CM ), locally within TG, and improved protection against recurrent herpesvirus infection and disease in CXCL10 -/- deficient mice. These findings demonstrate that the CXCL10/CXCR3 chemokine pathway is critical in shaping CD8 + T cell immunity, locally within latently infected tissues, which protects against recurrent herpesvirus infection and disease. IMPORTANCE We determined how the CXCL10/CXCR3 pathway affects CD8 + T cell responses to recurrent ocular herpesvirus
Radiosensitivity of CD4 and CD8 positive human T lymphocytes by an in vitro colony formation assay
International Nuclear Information System (INIS)
Nakamura, Nori; Kusunoki, Yoichiro; Akiyama, Mitoshi.
1989-12-01
The recent development of an in vitro lymphocyte colony assay provides a new opportunity to examine possible variations in human radiosensitivity using peripheral blood lymphocytes (PBL) in place of the hitherto used skin fibroblast assay. Our recent study showed that most of the colonies consisted of lymphocytes bearing CD4 or CD8 antigens. Since the fraction of CD4 + and CD8 + cells in PBL differs among individuals, it was suspected that individual radiosensitivity might be biased by the different subset frequencies if the dose-survival curves of the CD4 + and CD8 + cells differed. In the present study, CD4 + lymphocytes (helper/inducer T cells) and CD8 + lymphocytes (suppressor/cytotoxic T cells) were isolated from PBL and their dose-survival curves were determined. The results showed that the D 10 (the dose required to reduce the surviving fraction to 10 %) was quite similar for these two types of cells (3.13 ± 0.10 Gy [mean ±SD] for CD4 + , 3.34 ± 0.50 Gy for CD8 + and 3.07 ± 0.05 Gy for the unsorted cells), supporting the use of a whole PBL population for screening of individuals with altered radiosensitivity. (author)
DEFF Research Database (Denmark)
Rudolphi, A; Boll, G; Poulsen, S S
1994-01-01
reconstituted a CD3+ T cell receptor alpha beta+ CD4+ T cell subset. CD4+ cells of this subset expressed the surface phenotype of mucosa-seeking, memory T cells. In the immunodeficient scid host, this gut-derived CD4+ T cell subset was found in spleen, peritoneal cavity, mesenteric lymph nodes (LN), epithelial...... compartments with CD4+ T cells from normal GALT plays an essential role in the pathogenesis of IBD in an immunodeficient host.......We studied which T cell subsets from the gut-associated lymphoid tissue (GALT) can migrate out of the gut mucosa and repopulate GALT compartments of an immunodeficient (semi)syngeneic host. Many distinct lymphocyte subsets were found in GALT of immunocompetent H-2d (BALB/c, BALB/cdm2, C.B-17...
Differentiation of human umbilical cord mesenchymal stem cells into dermal fibroblasts in vitro
Energy Technology Data Exchange (ETDEWEB)
Han, Yanfu [Department of Burn and Plastic Surgery, Burns Institute, First Hospital Affiliated to General Hospital of PLA, Beijing (China); Chai, Jiake, E-mail: cjk304@126.com [Department of Burn and Plastic Surgery, Burns Institute, First Hospital Affiliated to General Hospital of PLA, Beijing (China); Sun, Tianjun; Li, Dongjie; Tao, Ran [Department of Burn and Plastic Surgery, Burns Institute, First Hospital Affiliated to General Hospital of PLA, Beijing (China)
2011-10-07
Highlights: {yields} Mesenchymal stem cells (MSCs) are potential seed cells for tissue-engineered skin. {yields} Tissue-derived umbilical cord MSCs (UCMSCs) can readily be isolated in vitro. {yields} We induce UCMSCs to differentiate into dermal fibroblasts via conditioned medium. {yields} Collagen type I and collagen type III mRNA level was higher in differentiated cells. {yields} UCMSCs-derived fibroblast-like cells strongly express fibroblast-specific protein. -- Abstract: Tissue-derived umbilical cord mesenchymal stem cells (UCMSCs) can be readily obtained, avoid ethical or moral constraints, and show excellent pluripotency and proliferation potential. UCMSCs are considered to be a promising source of stem cells in regenerative medicine. In this study, we collected newborn umbilical cord tissue under sterile conditions and isolated UCMSCs through a tissue attachment method. UCMSC cell surface markers were examined using flow cytometry. On the third passage, UCMSCs were induced to differentiate into dermal fibroblasts in conditioned induction media. The induction results were detected using immunofluorescence with a fibroblast-specific monoclonal antibody and real time PCR for type I and type III collagen. UCMSCs exhibited a fibroblast-like morphology and reached 90% confluency 14 to 18 days after primary culture. Cultured UCMSCs showed strong positive staining for CD73, CD29, CD44, CD105, and HLA-I, but not CD34, CD45, CD31, or HLA-DR. After differentiation, immunostaining for collagen type I, type III, fibroblast-specific protein, vimentin, and desmin were all strongly positive in induced cells, and staining was weak or negative in non-induced cells; total transcript production of collagen type I and collagen type III mRNA was higher in induced cells than in non-induced cells. These results demonstrate that UCMSCs can be induced to differentiate into fibroblasts with conditioned induction media and, in turn, could be used as seed cells for tissue
Differentiation of human umbilical cord mesenchymal stem cells into dermal fibroblasts in vitro
International Nuclear Information System (INIS)
Han, Yanfu; Chai, Jiake; Sun, Tianjun; Li, Dongjie; Tao, Ran
2011-01-01
Highlights: → Mesenchymal stem cells (MSCs) are potential seed cells for tissue-engineered skin. → Tissue-derived umbilical cord MSCs (UCMSCs) can readily be isolated in vitro. → We induce UCMSCs to differentiate into dermal fibroblasts via conditioned medium. → Collagen type I and collagen type III mRNA level was higher in differentiated cells. → UCMSCs-derived fibroblast-like cells strongly express fibroblast-specific protein. -- Abstract: Tissue-derived umbilical cord mesenchymal stem cells (UCMSCs) can be readily obtained, avoid ethical or moral constraints, and show excellent pluripotency and proliferation potential. UCMSCs are considered to be a promising source of stem cells in regenerative medicine. In this study, we collected newborn umbilical cord tissue under sterile conditions and isolated UCMSCs through a tissue attachment method. UCMSC cell surface markers were examined using flow cytometry. On the third passage, UCMSCs were induced to differentiate into dermal fibroblasts in conditioned induction media. The induction results were detected using immunofluorescence with a fibroblast-specific monoclonal antibody and real time PCR for type I and type III collagen. UCMSCs exhibited a fibroblast-like morphology and reached 90% confluency 14 to 18 days after primary culture. Cultured UCMSCs showed strong positive staining for CD73, CD29, CD44, CD105, and HLA-I, but not CD34, CD45, CD31, or HLA-DR. After differentiation, immunostaining for collagen type I, type III, fibroblast-specific protein, vimentin, and desmin were all strongly positive in induced cells, and staining was weak or negative in non-induced cells; total transcript production of collagen type I and collagen type III mRNA was higher in induced cells than in non-induced cells. These results demonstrate that UCMSCs can be induced to differentiate into fibroblasts with conditioned induction media and, in turn, could be used as seed cells for tissue-engineered dermis.
CD49a Expression Defines Tissue-Resident CD8+ T Cells Poised for Cytotoxic Function in Human Skin
DEFF Research Database (Denmark)
Cheuk, Stanley; Schlums, Heinrich; Sérézal, Irène Gallais
2017-01-01
with vitiligo, where melanocytes are eradicated locally, CD8+CD49a+ Trm cells that constitutively expressed perforin and granzyme B accumulated both in the epidermis and dermis. Conversely, CD8+CD49a– Trm cells from psoriasis lesions predominantly generated IL-17 responses that promote local inflammation...
Liu, Yawei; Teige, Anna; Mondoc, Emma; Ibrahim, Saleh; Holmdahl, Rikard; Issazadeh-Navikas, Shohreh
2011-01-01
NKT cells in the mouse recognize antigen in the context of the MHC class I-like molecule CD1d and play an important role in peripheral tolerance and protection against autoimmune and other diseases. NKT cells are usually activated by CD1d-presented lipid antigens. However, peptide recognition in the context of CD1 has also been documented, although no self-peptide ligands have been reported to date. Here, we have identified an endogenous peptide that is presented by CD1d to activate mouse NKT cells. This peptide, the immunodominant epitope from mouse collagen type II (mCII707-721), was not associated with either MHC class I or II. Activation of CD1d-restricted mCII707-721-specific NKT cells was induced via TCR signaling and classical costimulation. In addition, mCII707-721-specific NKT cells induced T cell death through Fas/FasL, in an IL-17A-independent fashion. Moreover, mCII707-721-specific NKT cells suppressed a range of in vivo inflammatory conditions, including delayed-type hypersensitivity, antigen-induced airway inflammation, collagen-induced arthritis, and EAE, which were all ameliorated by mCII707-721 vaccination. The findings presented here offer new insight into the intrinsic roles of NKT cells in health and disease. Given the results, endogenous collagen peptide activators of NKT cells may offer promise as novel therapeutics in tissue-specific autoimmune and inflammatory diseases.
Directory of Open Access Journals (Sweden)
Wang Wei
2006-05-01
Full Text Available Abstract Background Angiogenesis is one of the mechanisms most critical to the postoperative recurrence and metastasis of hepatocellular carcinoma (HCC. Thus, finding the molecular markers associated with angiogenesis may help identify patients at increased risk for recurrence and metastasis of HCC. This study was designed to investigate whether CD105 or CD34 could serve as a valid prognostic marker in patients with HCC by determining if there is a correlation between CD105 or CD34 expression and postoperative recurrence or metastasis. Methods Immunohistochemical staining for the CD105, CD34 and vascular endothelial growth factor (VEGF antibodies was performed in 113 HCC tissue specimens containing paracarcinomatous tissue and in 14 normal liver tissue specimens. The quantitation of microvessels identified by anti-CD105 and anti-CD34 monoclonal antibodies and the semiquantitation of VEGF expression identified by anti-VEGF monoclonal antibody were analyzed in conjunction with the clinicopathological characteristics of the HCC and any available follow-up information about the patients from whom the specimens were obtained. Results CD105 was not expressed in the vascular endothelial cells of any normal liver tissue or paracarcinomatous liver tissue but was expressed in the vascular endothelial cells of all HCC tissue. In contrast, CD34 was expressed in the vascular endothelial cells of normal liver tissue, paracarcinomatous tissue, and HCC tissue in the following proportions of specimens: 86.7%, 93.8%, and 100%, respectively. The microvascular densities (MVDs of HCC determined by using an anti-CD105 mAb (CD105-MVD and an anti-CD34 mAb (CD34-MVD, were 71.7 ± 8.3 (SD and 106.3 ± 10.4 (SD, respectively. There was a significant correlation between CD105-MVD and CD34-MVD (r = 0.248, P = 0.021. Although CD34-MVD was significantly correlated with VEGF expression (r = 0.243, P = 0.024, CD105-MVD was more closely correlated (r = 0.300, P= 0.005. The