WorldWideScience

Sample records for tissue fragments obtained

  1. Improved histopathological evaluation of gliomas using tissue fragments obtained by ultrasonic aspiration

    DEFF Research Database (Denmark)

    Neckelmann, K; Kristensen, B W; Schrøder, H D

    2004-01-01

    included in the biopsy removed for peroperative frozen section investigation. When the slides with Sonocut tissue fragments were analyzed, the probability of making the most malignant diagnosis increased from 81.3% - 99.1%, when slides from 1 - 5 paraffin blocks were analyzed, respectively. When subgroups...... of small, medium and big tumors were analyzed, it was found that only 2 paraffin blocks from small tumors need to be prepared to reach 98.3% probability of making the most malignant diagnosis, whereas 5 paraffin blocks from big tumors need to be prepared to reach a 96.8% probability. In conclusion......, the study shows that a limited amount of Sonocut ultrasonic tissue fragments improve the diagnostic evaluation of gliomas. These tissue fragments therefore must not be discarded. Only few paraffin blocks need to be prepared to reach close to 100% probability of making the most malignant diagnosis, reducing...

  2. Improvement of the method of obtaining human IgA Fc-fragments

    Directory of Open Access Journals (Sweden)

    O. Y. Galkin

    2015-02-01

    Full Text Available To address a number of fundamental and applied problems in immunology, molecular and cellular biology and biotechnology it is necessary to obtain Fc-fragments of immunoglobulins. Fc-fragments may be used for studying of the effector functions of antibodies which are mediated by these areas. They are often used as an immunogen to produce anti-specie (based on so-called secondary antibody conjugate in the development of serological tests for diagnostics (predominantly such conjugate based on monoclonal antibodies. The work is aimed to develop improved methods of obtaining and allocation of Fc-fragments of human IgA. To achieve this objective, optimization of hydrolysis of IgA with subsequent purification of Fс-fragments have been carried out. Improved method of obtaining Fc-fragments of IgA provides: papain hydrolysis of immunoglobulin in the environment of nitrogen for 4 h, allowing to achieve maximum output of Fc-fragments without their further degradation: isolation and purification of Fc-fragments of human IgA by one-stage gel filtration on sephadex G-100; control of purity of the target product by electrophoresis in polyacrylamide gel with sodium dodecyl sulfate and Ouchterlony immunodiffusion. Enzymatic hydrolysis was carried out at the optimal temperature of papain (37 °C. As the oxygen in the air may have inhibitory effect on enzymatic hydrolysis reaction, the reaction mixture was incubated in the nitrogen atmosphere to prevent inactivation of papain. To reduce the incident degradation of immunoglobulin molecules, papain hydrolysis was carried out without using an enzyme activator (cysteine. Usage of the proposed scheme allows obtaining Fc-fragments of human IgA of high purity. Outcome of Fc-fragments after all stages of purification was about 18% of the initial amount of IgA in the preparation. Molecular weight from Fc-fragments of human IgA was equal to approximately 70 kDa.

  3. Profile of sequential determinants in tissue polypeptide antigen BrCN:B fragment.

    Science.gov (United States)

    Chersi, A; Camera, M; Trinca, M L; Castelli, M

    1989-02-15

    A synthetic approach has been applied to determine the profile of sequential determinants of one immunodominant region of Tissue Polypeptide Antigen (TPA). Five overlapping peptides, covering 30 of the 32 amino acid residues of this fragment, were chemically synthesized, and their antibody-binding activities for rabbit anti-TPA antibodies determined by enzyme-linked immunoadsorbant assays. Anti-TPA reacted with two overlapping fragments at the COOH-terminal end of the fragment, but not with peptides that include Arg 15 considered as essential for the antigenicity of the whole fragment. This might suggest that this critical residue is involved in the formation of a complex conformational determinant.

  4. Tissue Microarray Technology for Molecular Applications: Investigation of Cross-Contamination between Tissue Samples Obtained from the Same Punching Device

    Directory of Open Access Journals (Sweden)

    Erik Vassella

    2015-04-01

    Full Text Available Background: Tissue microarray (TMA technology allows rapid visualization of molecular markers by immunohistochemistry and in situ hybridization. In addition, TMA instrumentation has the potential to assist in other applications: punches taken from donor blocks can be placed directly into tubes and used for nucleic acid analysis by PCR approaches. However, the question of possible cross-contamination between samples punched with the same device has frequently been raised but never addressed. Methods: Two experiments were performed. (1 A block from mycobacterium tuberculosis (TB positive tissue and a second from an uninfected patient were aligned side-by-side in an automated tissue microarrayer. Four 0.6 mm punches were cored from each sample and placed inside their corresponding tube. Between coring of each donor block, a mechanical cleaning step was performed by insertion of the puncher into a paraffin block. This sequence of coring and cleaning was repeated three times, alternating between positive and negative blocks. A fragment from the 6110 insertion sequence specific for mycobacterium tuberculosis was analyzed; (2 Four 0.6 mm punches were cored from three KRAS mutated colorectal cancer blocks, alternating with three different wild-type tissues using the same TMA instrument (sequence of coring: G12D, WT, G12V, WT, G13D and WT. Mechanical cleaning of the device between each donor block was made. Mutation analysis by pyrosequencing was carried out. This sequence of coring was repeated manually without any cleaning step between blocks. Results/Discussion: In both analyses, all alternating samples showed the expected result (samples 1, 3 and 5: positive or mutated, samples 2, 4 and 6: negative or wild-type. Similar results were obtained without cleaning step. These findings suggest that no cross-contamination of tissue samples occurs when donor blocks are punched using the same device, however a cleaning step is nonetheless recommended. Our

  5. Adipose tissue-derived microvascular fragments from aged donors exhibit an impaired vascularisation capacity

    Directory of Open Access Journals (Sweden)

    MW Laschke

    2014-10-01

    Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.

  6. Potential hazard to human health from exposure to fragments of lead bullets and shot in the tissues of game animals.

    Directory of Open Access Journals (Sweden)

    Deborah J Pain

    Full Text Available BACKGROUND: Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. METHODOLOGY/PRINCIPAL FINDINGS: Wild-shot gamebirds (6 species obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing > or =5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg(-1 w.w. for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat, some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. CONCLUSIONS/SIGNIFICANCE: The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game.

  7. Tracking mechanical and morphological dynamics of regenerating Hydra tissue fragments using a two fingered micro-robotic hand

    Science.gov (United States)

    Veschgini, M.; Gebert, F.; Khangai, N.; Ito, H.; Suzuki, R.; Holstein, T. W.; Mae, Y.; Arai, T.; Tanaka, M.

    2016-03-01

    Regeneration of a tissue fragment of freshwater polyp Hydra is accompanied by significant morphological fluctuations, suggesting the generation of active forces. In this study, we utilized a two fingered micro-robotic hand to gain insights into the mechanics of regenerating tissues. Taking advantage of a high force sensitivity (˜1 nN) of our micro-hand, we non-invasively acquired the bulk elastic modulus of tissues by keeping the strain levels low (ɛ < 0.15). Moreover, by keeping the strain at a constant level, we monitored the stress relaxation of the Hydra tissue and determined both viscous modulus and elastic modulus simultaneously, following a simple Maxwell model. We further investigated the correlation between the frequency of force fluctuation and that of morphological fluctuation by monitoring one "tweezed" tissue and the other "intact" tissue at the same time. The obtained results clearly indicated that the magnitude and periodicity of the changes in force and shape are directly correlated, confirming that our two fingered micro-hand can precisely quantify the mechanics of soft, dynamic tissue during the regeneration and development in a non-invasive manner.

  8. Refrigeration and freezing of porcine tissue does not affect the retardation of fragment simulating projectiles.

    Science.gov (United States)

    Breeze, J; Carr, D J; Mabbott, A; Beckett, S; Clasper, J C

    2015-05-01

    Explosively propelled fragments are the most common cause of injury to UK service personnel in modern conflicts. Numerical injury models to simulate such injuries utilise algorithms based upon gelatin and animal tissue testing but data is limited on many fragment simulating projectiles and these simulants cannot represent human anatomy. Testing with post mortem specimens may overcome this limitation but no information exists about how post mortem tissue changes and storage conditions in humans or animals may affect projectile penetration. Two chisel nosed cylinders (0.49 g and 1.10 g) and a 0.51 g (5 mm) sphere were fired into three groups of porcine tissue (fresh, refrigerated and frozen then refrigerated) and compared to 20% gelatin. Depth of projectile penetration was ascertained with the assistance of computed tomography and kinetic energy absorption by tissues measured using Doppler radar and high speed photography. No difference in depth of penetration was found between porcine tissue stored in the different manners compared with 20% gelatin by impact velocities less than 100 m/s. Insufficient numbers of projectiles were retained in tissue at higher velocities for statistical analysis to be undertaken. Energy absorbed per millimetre of tissue ranged between 0.42 and 0.98 J/mm for different porcine tissue despite differing storage. This pilot study would suggest that the effect of refrigerating or freezing porcine tissue followed by thawing has no effect on its ability to retard these projectiles. Further research is required to ascertain if these results occur at greater velocities and for other types of projectile. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  9. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  10. Automatic quantification of mitochondrial fragmentation from two-photon microscope images of mouse brain tissue.

    Science.gov (United States)

    Lihavainen, E; Kislin, M; Toptunov, D; Khiroug, L; Ribeiro, A S

    2015-12-01

    The morphology of mitochondria can inform about their functional state and, thus, about cell vitality. For example, fragmentation of the mitochondrial network is associated with many diseases. Recent advances in neuronal imaging have enabled the observation of mitochondria in live brains for long periods of time, enabling the study of their dynamics in animal models of diseases. To aid these studies, we developed an automatic method, based on supervised learning, for quantifying the degree of mitochondrial fragmentation in tissue images acquired via two-photon microscopy from transgenic mice, which exclusively express Enhanced cyan fluorescent protein (ECFP) under Thy1 promoter, targeted to the mitochondrial matrix in subpopulations of neurons. We tested the method on images prior to and after cardiac arrest, and found it to be sensitive to significant changes in mitochondrial morphology because of the arrest. We conclude that the method is useful in detecting morphological abnormalities in mitochondria and, likely, in other subcellular structures as well. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

  11. A method to obtain reference images for evaluation of ultrasonic tissue characterization techniques

    DEFF Research Database (Denmark)

    Jensen, M.S.; Wilhjelm, Jens E.; Sahl, B.

    2002-01-01

    on the corresponding ultrasound images (identified via the fiducial markers) and modified to encompass what appeared to be tissue regions on the ultrasound images and subsequently re-applied to the macroscopic image. This modified macroscopic outline was used as guideline when drawing outlines identifying regions......A general problem when evaluating ultrasonic methods for tissue characterization is that "a golden standard" is seldom known. This paper describes a manual method to obtain a reference image, with the same geometry as the ultrasound image, indicating spatial location of the different tissue types...... present in the biological tissue scanned in vitro. A 30 x 10 x 2 mm(3) piece of formalin fixed porcine tissue was molded into an agar block, which on the top surface, contained a set of fiducial markers, spaced 2.5 mm. The block was submerged into 20 degreesC water and a set of parallel 7.5 MHz spatial...

  12. Evolution of size distribution, optical properties, and structure of Si nanoparticles obtained by laser-assisted fragmentation

    Science.gov (United States)

    Plautz, G. L.; Graff, I. L.; Schreiner, W. H.; Bezerra, A. G.

    2017-05-01

    We investigate the physical properties of Si-based nanoparticles produced by an environment-friendly three-step method relying on: (1) laser ablation of a solid target immersed in water, (2) centrifugation and separation, and (3) laser-assisted fragmentation. The evolution of size distribution is followed after each step by means of dynamic light scattering (DLS) measurements and crosschecked by transmission electron microscopy (TEM). The as-ablated colloidal suspension of Si nanoparticles presents a large size distribution, ranging from a few to hundreds of nanometers. Centrifugation drives the very large particles to the bottom eliminating them from the remaining suspension. Subsequent irradiation of height-separated suspensions with a second high-fluence (40 mJ/pulse) Nd:YAG laser operating at the fourth harmonic (λ =266 nm) leads to size reduction and ultra-small nanoparticles are obtainable depending on the starting size. Si nanoparticles as small as 1.5 nm with low dispersion (± 0.7 nm) are observed for the uppermost part after irradiation. These nanoparticles present a strong blue photoluminescence that remains stable for at least 8 weeks. Optical absorption (UV-Vis) measurements demonstrate an optical gap widening as a consequence of size decrease. Raman spectra present features related to pure silicon and silicon oxides for the irradiated sample. Interestingly, a defect band associated with silicon oxide is also identified, indicating the possible formation of defect states, which, in turn, supports the idea that the blue photoluminescence has its origin in defects.

  13. Fragment-Linking Approach Using (19)F NMR Spectroscopy To Obtain Highly Potent and Selective Inhibitors of β-Secretase.

    Science.gov (United States)

    Jordan, John B; Whittington, Douglas A; Bartberger, Michael D; Sickmier, E Allen; Chen, Kui; Cheng, Yuan; Judd, Ted

    2016-04-28

    Fragment-based drug discovery (FBDD) has become a widely used tool in small-molecule drug discovery efforts. One of the most commonly used biophysical methods in detecting weak binding of fragments is nuclear magnetic resonance (NMR) spectroscopy. In particular, FBDD performed with (19)F NMR-based methods has been shown to provide several advantages over (1)H NMR using traditional magnetization-transfer and/or two-dimensional methods. Here, we demonstrate the utility and power of (19)F-based fragment screening by detailing the identification of a second-site fragment through (19)F NMR screening that binds to a specific pocket of the aspartic acid protease, β-secretase (BACE-1). The identification of this second-site fragment allowed the undertaking of a fragment-linking approach, which ultimately yielded a molecule exhibiting a more than 360-fold increase in potency while maintaining reasonable ligand efficiency and gaining much improved selectivity over cathepsin-D (CatD). X-ray crystallographic studies of the molecules demonstrated that the linked fragments exhibited binding modes consistent with those predicted from the targeted screening approach, through-space NMR data, and molecular modeling.

  14. Complementary analysis of tissue homogenates composition obtained by Vis and NIR laser excitations and Raman spectroscopy.

    Science.gov (United States)

    Staniszewska-Slezak, Emilia; Malek, Kamilla; Baranska, Malgorzata

    2015-08-05

    Raman spectroscopy and four excitation lines in the visible (Vis: 488, 532, 633 nm) and near infrared (NIR: 785 nm) were used for biochemical analysis of rat tissue homogenates, i.e. myocardium, brain, liver, lung, intestine, and kidney. The Vis Raman spectra are very similar for some organs (brain/intestines and kidney/liver) and dominated by heme signals when tissues of lung and myocardium were investigated (especially with 532 nm excitation). On the other hand, the NIR Raman spectra are specific for each tissue and more informative than the corresponding ones collected with the Vis excitations. The spectra analyzed without any special pre-processing clearly illustrate different chemical composition of each tissue and give information about main components e.g. lipids or proteins, but also about the content of some specific compounds such as amino acid residues, nucleotides and nucleobases. However, in order to obtain the whole spectral information about tissues complex composition the spectra of Vis and NIR excitations should be collected and analyzed together. A good agreement of data gathered from Raman spectra of the homogenates and those obtained previously from Raman imaging of the tissue cross-sections indicates that the presented here approach can be a method of choice for an investigation of biochemical variation in animal tissues. Moreover, the Raman spectral profile of tissue homogenates is specific enough to be used for an investigation of potential pathological changes the organism undergoes, in particular when supported by the complementary FTIR spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Profile analysis of hepatic porcine and murine brain tissue slices obtained with a vibratome

    Directory of Open Access Journals (Sweden)

    G Mattei

    2015-04-01

    Full Text Available This study is aimed at characterizing soft tissue slices using a vibratome. In particular, the effect of two sectioning parameters (i.e., step size and sectioning speed on resultant slice thickness was investigated for fresh porcine liver as well as for paraformaldehyde-fixed (PFA-fixed and fresh murine brain. A simple framework for embedding, sectioning and imaging the slices was established to derive their thickness, which was evaluated through a purposely developed graphical user interface. Sectioning speed and step size had little effect on the thickness of fresh liver slices. Conversely, the thickness of PFA-fixed murine brain slices was found to be dependent on the step size, but not on the sectioning speed. In view of these results, fresh brain tissue was sliced varying the step size only, which was found to have a significant effect on resultant slice thickness. Although precision-cut slices (i.e., with regular thickness were obtained for all the tissues, slice accuracy (defined as the match between the nominal step size chosen and the actual slice thickness obtained was found to increase with tissue stiffness from fresh liver to PFA-fixed brain. This quantitative investigation can be very helpful for establishing the most suitable slicing setup for a given tissue.

  16. Metals detected by ICP/MS in wound tissue of war injuries without fragments in Gaza

    OpenAIRE

    Skaik, Sobhi; Abu-Shaban, Nafiz; Abu-Shaban, Nasser; Barbieri, Mario; Barbieri, Maurizio; Giani, Umberto; Manduca, Paola

    2010-01-01

    Abstract Background The amount and identity of metals incorporated into "weapons without fragments" remain undisclosed to health personnel. This poses a long-term risk of assumption and contributes to additional hazards for victims because of increased difficulties with clinical management. We assessed if there was evidence that metals are embedded in "wounds without fragments" of victims of the Israeli military operations in Gaza in 2006 and 2009. Methods Biopsies of "wounds without fragment...

  17. Biological activity of the functional epitope of ciguatoxin fragment AB on the neuroblastoma sodium channel in tissue culture.

    Science.gov (United States)

    Hokama, Y; Chun, K E; Campora, C E; Higa, N; Suma, C; Hamajima, A; Isobe, M

    2006-01-01

    It is well established that the targeted receptor for ciguatoxin (CTX) in mammalian tissues is the sodium channel, affecting the influx of sodium into cells and altering the action potential and function of the cell. Since the syntheses of fragments of CTX has become available, our focus has been on the receptor functions of the west sphere AB and east sphere JKLM fragments using the neuroblastoma cell assay, guinea pig atrium assay, and the membrane immunobead assay (MIA). The data presented here suggest that the west sphere AB of the ciguatoxin molecule is the active portion and is responsible for the activation of the sodium channels. (c) 2006 Wiley-Liss, Inc.

  18. Loss of high-molecular-weight cytokeratin antigenicity in prostate tissue obtained by transurethral resections.

    Science.gov (United States)

    Multhaupt, H A; Fessler, J N; Warhol, M J

    2000-12-01

    Staining of prostatic basal cells for the expression of high-molecular-weight cytokeratin has been suggested as a way of distinguishing benign from malignant prostate glands. We evaluated the utility of high-molecular-weight cytokeratin in the diagnosis of malignancy in prostate specimens obtained in various ways. Prostate tissues obtained from needle biopsies, transurethral resections, and total prostatectomies were immunostained with monoclonal antibody 34betaE12, an antibody directed against high-molecular-weight cytokeratins. Antiserum to high-molecular-weight cytokeratin only stained the basal cells in normal glands in 3 (12%) of 25 specimens obtained by transurethral resection. Other antigens, such as the alternate 10-nm filament protein vimentin, were unaffected and were detected in 100% of these specimens. However, keratin antigenicity in transurethral biopsies could be restored in these specimens by antigen retrieval in a low pH citrate buffer using a microwave heat technique. Keratin staining in needle biopsies and total prostatectomies was unaffected. In summary, our results indicate the technique of transurethral resection results in a specific loss of keratin antigenicity. This limits the utility of anticytokeratin 34betaE12 in interpreting transurethral resections without the application of antigen retrieval.

  19. Evaluation of two endometriosis models by transplantation of human endometrial tissue fragments and human endometrial mesenchymal cells

    Directory of Open Access Journals (Sweden)

    Mina Jafarabadi

    2017-08-01

    Full Text Available Background: The animal models of endometriosis could be a valuable alternative tool for clarifying the etiology of endometriosis. Objective: In this study two endometriosis models at the morphological and molecular levels was evaluated and compared. Materials and Methods: The human endometrial tissues were cut into small fragments then they were randomly considered for transplantation into γ irradiated mice as model A; or they were isolated and cultured up to fourth passages. 2×106 cultured stromal cells were transplanted into γ irradiated mice subcutaneously as model B. twenty days later the ectopic tissues in both models were studied morphologically by Periodic acid-Schiff and hematoxylin and eosin staining. The expression of osteopontin (OPN and matrix metalloproteinase 2 (MMP2 genes were also assessed using real time RT-PCR. 17-β estradiol levels of mice sera were compared before and after transplantation. Results: The endometrial like glands and stromal cells were formed in the implanted subcutaneous tissue of both endometriosis models. The gland sections per cubic millimeter, the expression of OPN and MMP2 genes and the level of 17-β estradiol were higher in model B than model A (p=0.03. Conclusion: Our observation demonstrated that endometrial mesenchymal stromal cells showed more efficiency to establish endometriosis model than human endometrial tissue fragments.

  20. XAS and XRF investigation of an actual HAWC glass fragment obtained from the Karlsruhe vitrification plant (VEK)

    Science.gov (United States)

    Dardenne, K.; González-Robles, E.; Rothe, J.; Müller, N.; Christill, G.; Lemmer, D.; Praetorius, R.; Kienzler, B.; Metz, V.; Roth, G.; Geckeis, H.

    2015-05-01

    Several sections of HAWC glass rods remaining at the end of glass pouring at the Karlsruhe Vitrification Plant (VEK) were retained during vitrification operation in 2009-2010 and transferred to the KIT-INE shielded box line for later glass product characterization. A mm sized fragment with a contact dose rate of ∼590 μSv/h was selected for pilot XAS/XRF investigations at the INE-Beamline for actinide science at the ANKA synchrotron radiation source. The experiment was aimed at elucidating the potential of direct radionuclide speciation with an emphasis on the fission products Se and Tc in highly active nuclear materials and at assessing the possible influence of the γ-radiation field surrounding highly active samples on the beamline instrumentation. While the influence of γ-radiation turned out to be negligible, initial radionuclide speciation studies by XAFS were most promising. In addition to Se and Tc speciation, the focus of these initial investigations was on the possibility for direct actinide speciation by recording corresponding L3-edge XAFS data. The registration of high quality XANES data was possible for the actinide elements U, Np, Pu and Am, as well as for Zr.

  1. Massive Pulmonary Embolism: Treatment with Thrombus Fragmentation and Local Fibrinolysis with Recombinant Human-Tissue Plasminogen Activator

    International Nuclear Information System (INIS)

    Stock, Klaus Wilhelm; Jacob, Augustinus Ludwig; Schnabel, Karl Jakob; Bongartz, Georg; Steinbrich, Wolfgang

    1997-01-01

    Purpose: To report the results of thrombus fragmentation in combination with local fibrinolysis using recombinant human-tissue plasminogen activator (rtPA) in patients with massive pulmonary embolism. Methods: Five patients with massive pulmonary embolism were treated with thrombus fragmentation followed by intrapulmonary injection of rtPA. Clot fragmentation was performed with a guidewire, angiographic catheter, and balloon catheter. Three patients had undergone recent surgery; one of them received a reduced dosage of rtPA. Results: All patients survived and showed clinical improvement with a resultant significant (p < 0.05) decrease in the pulmonary blood pressure (mean systolic pulmonary blood pressure before treatment, 49 mmHg; 4 hr after treatment, 28 mmHg). Angiographic follow-up in three patients revealed a decrease in thrombus material and an increase in pulmonary perfusion. Two patients developed retroperitoneal hematomas requiring transfusion. Conclusion: Clot fragmentation and local fibrinolysis with rtPA was an effective therapy for massive pulmonary embolism. Bleeding at the puncture site was a frequent complication

  2. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  3. GROWTH AND ROOTING SYSTEM OF ACACIA MANGIUM OBTAINED BY TISSUE CULTURE

    Directory of Open Access Journals (Sweden)

    SUPRIYANTO

    1991-01-01

    Full Text Available Since 1980/1981, the government of Indonesia through the Ministry of Forestry has started to reforest logged-over, alang-alang, unproductive areas and to convert them to Forest Industry Plantation. The target is 300 000 ha per year. It means, 750 million seedlings should be provided per year (planting distance 2 m x 2 m. The tree species to be planted in forest industry plantation should have shorter life cycle (8 - 10 years, good stem-form, good rooting system, and should be fast growing. Acacia mangium has been selected as one of the important tree species for forest industry plantation due to its growth, quality of fiber wood (pulp and paper industry and rooting system (produce a lot of secondary root and nitrogen fixater (Soebardjo 1986. The reforestation of logged-over Dipterocarp forests in Malaysia with A. mangium has also been considered (Appanah and Weinland 1989. Generally, reforestation with A. mangium is done with seedlings obtained by seed germination. A. mangium produce a lot of seeds but its production is still limited by the season, while the conventional method of vegetative propagation through cuttings gave very low percentage of rooted-cuttings (1% (Umboh and Syamsul Yani 1989. The micropropagation of A. mangium through tissue culture is a promising method. The production of A. mangium plantlets through that method has been done at the Forest Genetic Laboratory, Tropical Forest Biology, SEAMEO BIOTROP (Situmorang 1988, Umboh 1988, Umboh et al. 1989, 1990. These rooted-plantlets (plantlings were first put in the green house (acclimatization before planting in the field. Field tests of some agricultural plants have been done but information on forest trees species is still lacking because the production of plantlings through tissue culture is still limited as there are still problems of their rooting. In fact, the progress of reproducing woody plants by tissue culture has been much slower than with herbaceous plants. The major

  4. The fractionation of adipose tissue procedure to obtain stromal vascular fractions for regenerative purposes

    NARCIS (Netherlands)

    van Dongen, Joris A.; Stevens, Hieronymus P.; Parvizi, Mojtaba; van der Lei, Berend; Harmsen, Martin C.

    2016-01-01

    Autologous adipose tissue transplantation is clinically used to reduce dermal scarring and to restore volume loss. The therapeutic benefit on tissue damage more likely depends on the stromal vascular fraction of adipose tissue than on the adipocyte fraction. This stromal vascular fraction can be

  5. A Secreted Slit2 Fragment Regulates Adipose Tissue Thermogenesis and Metabolic Function.

    Science.gov (United States)

    Svensson, Katrin J; Long, Jonathan Z; Jedrychowski, Mark P; Cohen, Paul; Lo, James C; Serag, Sara; Kir, Serkan; Shinoda, Kosaku; Tartaglia, Julia A; Rao, Rajesh R; Chédotal, Alain; Kajimura, Shingo; Gygi, Steven P; Spiegelman, Bruce M

    2016-03-08

    Activation of brown and beige fat can reduce obesity and improve glucose homeostasis through nonshivering thermogenesis. Whether brown or beige fat also secretes paracrine or endocrine factors to promote and amplify adaptive thermogenesis is not fully explored. Here we identify Slit2, a 180 kDa member of the Slit extracellular protein family, as a PRDM16-regulated secreted factor from beige fat cells. In isolated cells and in mice, full-length Slit2 is cleaved to generate several smaller fragments, and we identify an active thermogenic moiety as the C-terminal fragment. This Slit2-C fragment of 50 kDa promotes adipose thermogenesis, augments energy expenditure, and improves glucose homeostasis in vivo. Mechanistically, Slit2 induces a robust activation of PKA signaling, which is required for its prothermogenic activity. Our findings establish a previously unknown peripheral role for Slit2 as a beige fat secreted factor that has therapeutic potential for the treatment of obesity and related metabolic disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Obtaining high quality RNA from single cell populations in human postmortem brain tissue.

    Science.gov (United States)

    Pietersen, Charmaine Y; Lim, Maribel P; Woo, Tsung-Ung W

    2009-08-06

    We proposed to investigate the gray matter reduction in the superior temporal gyrus seen in schizophrenia patients, by interrogating gene expression profiles of pyramidal neurons in layer III. It is well known that the cerebral cortex is an exceptionally heterogeneous structure comprising diverse regions, layers and cell types, each of which is characterized by distinct cellular and molecular compositions and therefore differential gene expression profiles. To circumvent the confounding effects of tissue heterogeneity, we used laser-capture microdissection (LCM) in order to isolate our specific cell-type i.e pyramidal neurons. Approximately 500 pyramidal neurons stained with the Histogene staining solution were captured using the Arcturus XT LCM system. RNA was then isolated from captured cells and underwent two rounds of T7-based linear amplification using Arcturus/Molecular Devices kits. The Experion LabChip (Bio-Rad) gel and electropherogram indicated good quality a(m)RNA, with a transcript length extending past 600nt required for microarrays. The amount of mRNA obtained averaged 51 microg, with acceptable mean sample purity as indicated by the A260/280 ratio, of 2.5. Gene expression was profiled using the Human X3P GeneChip probe array from Affymetrix.

  7. Evaluation of several techniques to modify denatured muscle tissue to obtain a scaffold for peripheral nerve regeneration

    NARCIS (Netherlands)

    Meek, MF; den Dunnen, WFA; Schakenraad, JM; Robinson, PH

    The aim of this study was to (1) evaluate the effect of several preparation techniques of denatured muscle tissue to obtain an open three-dimensional structure, and (2) test if this scaffold is suitable for peripheral nerve regeneration. Four samples (A-D) of muscle tissue specimens were evaluated

  8. HistoStitcher© : An Interactive Program for Accurate and Rapid Reconstruction of Digitized Whole Histological Sections from Tissue Fragments

    Science.gov (United States)

    Chappelow, Jonathan; Tomaszewski, John E.; Feldman, Michael; Shih, Natalie; Madabhushi, Anant

    2011-01-01

    We present an interactive program called HistoStitcher© for accurate and rapid reassembly of histology fragments into a pseudo-whole digitized histological section. HistoStitcher© provides both an intuitive graphical interface to assist the operator in performing the stitch of adjacent histology fragments by selecting pairs of anatomical landmarks, and a set of computational routines for determining and applying an optimal linear transformation to generate the stitched image. Reconstruction of whole histological sections from images of slides containing smaller fragments is required in applications where preparation of whole sections of large tissue specimens is not feasible or efficient, and such whole mounts are required to facilitate (a) disease annotation and (b) image registration with radiological images. Unlike manual reassembly of image fragments in a general purpose image editing program (such as Photoshop), HistoStitcher© provides memory efficient operation on high resolution digitized histology images and a highly flexible stitching process capable of producing more accurate results in less time. Further, by parameterizing the series of transformations determined by the stitching process, the stitching parameters can be saved, loaded at a later time, refined, or reapplied to multi-resolution scans, or quickly transmitted to another site. In this paper, we describe in detail the design of HistoStitcher© and the mathematical routines used for calculating the optimal image transformation, and demonstrate its operation for stitching high resolution histology quadrants of a prostate specimen to form a digitally reassembled whole histology section, for 8 different patient studies. To evaluate stitching quality, a 6 point scoring scheme, which assesses the alignment and continuity of anatomical structures important for disease annotation, is employed by three independent expert pathologists. For 6 studies compared with this scheme, reconstructed sections

  9. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  10. Some informations on dental tissues obtained from observations on a complex odontoma.

    Science.gov (United States)

    Marchetti, C

    1993-01-01

    Morphological features of enamel and dentine have been studied in a complex odontoma. The enamel had a prismatic structure with an abundant organic matrix in the inner part and a laminar stratified pattern at the surface. A cell layer above the enamel had the characteristics of maturation ameloblasts. Dentine had morphological characteristics of a normally developed tissue. One of the aggregates forming the odontoma had a structure similar to a normal tooth but the pulp-dentine complex was lacking in the odontoblast cell layer. The loose pulpal tissue of this structure was also devoid of blood vessels and nervous structures.

  11. Fate of transgenic deoxyribonucleic acid fragments in digesta and tissues of rabbits fed genetically modified soybean meal.

    Science.gov (United States)

    Morera, P; Basiricò, L; Ronchi, B; Bernabucci, U

    2016-03-01

    Numerous animal feeding studies have investigated the presence of DNA from transgenic plants in tissues from different animal species, but the data reported are sometimes controversial. The aim of this study was to investigate the presence of transgenic DNA (tDNA) in the digesta and tissues of a meat rabbit breed fed genetically modified (GM) soybean meal. Fifteen male New Zealand White rabbits were used for the experimental trial. Ten rabbits (treated group [TG]) were fed a mixed feed containing 10% GM soybean meal and 5 rabbits (control group [CG]) received a mixed feed containing conventional soybean meal, both from weaning (28 d of age) to slaughter (80 ± 3 d). Samples of blood, liver, kidney, heart, stomach, intestine (jejunum), lateral quadricep muscle, longissimus muscle, and perirenal adipose tissue were collected to assess the possible DNA transfer from GM feed to animal tissues. Samples of stomach contents and feces were also taken to study the degradability of ingested tDNA from feed in the digestive tract of rabbit. Moreover, samples of hair were collected to determine the possible environmental contamination from feed powders present on the farm. The DNA extraction was performed using specific genomic DNA kits. All samples were monitored, by using real-time PCR, for oligonucleotide primers and probes specific for the transgenic Roundup Ready soybean 40-3-2 and for the endogenous () gene. As an internal control of rabbit tissues, the presence of the () gene was used. In this study, no fragments of tDNA were detectable in tissue DNA samples of rabbits except in the extracted DNA from stomach digesta, feces, and hair of rabbits fed with GM soybean. Similar results were found for the reference gene, whereas the presence of the gene was detected in all rabbit tissues. The lack of tDNA of soybean in rabbit tissues represents an important result, which demonstrates that meat from rabbits fed a diet containing GM feed is as that derived from rabbits fed

  12. The Effects of Melatonin on Oxidative Stress Parameters and DNA Fragmentation in Testicular Tissue of Rats Exposed to Microwave Radiation.

    Science.gov (United States)

    Sokolovic, Dusan; Djordjevic, Branka; Kocic, Gordana; Stoimenov, Tatjana J; Stanojkovic, Zoran; Sokolovic, Danka M; Veljkovic, Andrej; Ristic, Goran; Despotovic, Milena; Milisavljevic, Dusan; Jankovic, Radmilo; Binic, Ivana

    2015-01-01

    Microwaves from mobile phones are one of the environmental toxicants that are capable of compromising male fertility by inducing oxidative stress and apoptosis in the testes. Melatonin is a lipophilic tryptophan indole amine and a potent antioxidant. The aim of the study was to evaluate the effect of melatonin treatment on oxidative stress parameters and DNA fragmentation in the testicular tissue of rats exposed to microwave radiation (4 h/day). Adult Wistar rats were divided in 4 groups: I--treated with saline; II--treated with melatonin; III--exposed to microwaves; IV--exposed to microwaves and treated with melatonin. The melatonin (2 mg/kg ip) was administered daily. The animals were sacrificed after 20, 40 and 60 days. Melatonin treatment prevented previously registered increases in malondialdehyde after only 20 days. Furthermore, it reversed the effects of microwave exposure on xanthine oxidase (after 40 days) and acid-DNase activity (after 20 days). However, neither protein carbonyl content nor catalase and alkaline Dnase activity were changed due to melatonin treatment. Melatonin exerts potent antioxidant effects in the testes of rats exposed to microwaves by decreasing the intensity of oxidative stress; it also reduces DNA fragmentation.

  13. Nuclear microprobe analysis of the selective boron uptake obtained with BPA in brain tumour tissue

    International Nuclear Information System (INIS)

    Wegden, M.; Kristiansson, P.; Ceberg, C.; Munck af Rosenschoeld, P.; Auzelyte, V.; Elfman, M.; Malmqvist, K.G.; Nilsson, C.; Pallon, J.; Shariff, A.

    2004-01-01

    The tumour selective ability of the boron compound boronophenylalanine (BPA), today used in Boron Neutron Capture Therapy in Sweden, has been investigated with the Lund Nuclear Microprobe. The tumour to tissue ratio of the boron concentration, as well as the location of boron within the cells, is critical for the efficiency of the therapy. It is desirable that the boron is accumulated as close as possible to the cell nucleus, since the alpha particles produced in the 10 B(n,α) 7 Li reaction only have a range of about 10 microns, i.e. a cell diameter. The nuclear reaction 11 B(p,α)2α, which has an especially high cross-section (300 mb) for 660 keV protons, has been used to analyse brain tissue from BPA-injected rats. Previous studies on other boron compounds have shown significant background problems when the alpha particles are detected in the backward direction. By a specially designed set-up, alpha particles in the forward and backward direction are detected simultaneously, and only the coincidences between the two directions are considered to be true boron events. In this way we could achieve excellent background suppression. The analysis shows that BPA indeed is tumour selective. Quantifications show a boron abundance of 150 ± 20 ng/cm 2 in normal tissue and 567 ± 70 ng/cm 2 in tumour tissue. If the rat is fed with L-dopa before the injection of BPA the uptake increases 3-4 times. The boron is homogeneously distributed in the cellular structure and no specific intracellular accumulation has been shown

  14. ImmunoPET of tissue factor expression in triple-negative breast cancer with a radiolabeled antibody Fab fragment

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Sixiang [University of Wisconsin, Materials Science Program, Madison, WI (United States); Hong, Hao; Orbay, Hakan; Yang, Yunan; Ohman, Jakob D. [University of Wisconsin, Department of Radiology, Madison, WI (United States); Graves, Stephen A.; Nickles, Robert J. [University of Wisconsin, Department of Medical Physics, Madison, WI (United States); Liu, Bai; Wong, Hing C. [Altor BioScience, Miramar, FL (United States); Cai, Weibo [University of Wisconsin, Materials Science Program, Madison, WI (United States); University of Wisconsin, Department of Radiology, Madison, WI (United States); University of Wisconsin, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States); University of Wisconsin, Departments of Radiology and Medical Physics, Madison, WI (United States)

    2015-07-15

    To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and {sup 64}Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of {sup 64}Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of {sup 64}Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. {sup 64}Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management. (orig.)

  15. Normal Values of Tissue-Muscle Perfusion Indexes of Lower Limbs Obtained with a Scintigraphic Method.

    Science.gov (United States)

    Manevska, Nevena; Stojanoski, Sinisa; Pop Gjorceva, Daniela; Todorovska, Lidija; Miladinova, Daniela; Zafirova, Beti

    2017-09-01

    Introduction Muscle perfusion is a physiologic process that can undergo quantitative assessment and thus define the range of normal values of perfusion indexes and perfusion reserve. The investigation of the microcirculation has a crucial role in determining the muscle perfusion. Materials and method The study included 30 examinees, 24-74 years of age, without a history of confirmed peripheral artery disease and all had normal findings on Doppler ultrasonography and pedo-brachial index of lower extremity (PBI). 99mTc-MIBI tissue muscle perfusion scintigraphy of lower limbs evaluates tissue perfusion in resting condition "rest study" and after workload "stress study", through quantitative parameters: Inter-extremity index (for both studies), left thigh/right thigh (LT/RT) left calf/right calf (LC/RC) and perfusion reserve (PR) for both thighs and calves. Results In our investigated group we assessed the normal values of quantitative parameters of perfusion indexes. Indexes ranged for LT/RT in rest study 0.91-1.05, in stress study 0.92-1.04. LC/RC in rest 0.93-1.07 and in stress study 0.93-1.09. The examinees older than 50 years had insignificantly lower perfusion reserve of these parameters compared with those younger than 50, LC (p=0.98), and RC (p=0.6). Conclusion This non-invasive scintigraphic method allows in individuals without peripheral artery disease to determine the range of normal values of muscle perfusion at rest and stress condition and to clinically implement them in evaluation of patients with peripheral artery disease for differentiating patients with normal from those with impaired lower limbs circulation.

  16. Isolation and Characterization of Human Dental Pulp Stem Cells from Cryopreserved Pulp Tissues Obtained from Teeth with Irreversible Pulpitis.

    Science.gov (United States)

    Malekfar, Azin; Valli, Kusum S; Kanafi, Mohammad Mahboob; Bhonde, Ramesh R

    2016-01-01

    Human dental pulp stem cells (DPSCs) are becoming an attractive target for therapeutic purposes because of their neural crest origin and propensity. Although DPSCs can be successfully cryopreserved, there are hardly any reports on cryopreservation of dental pulp tissues obtained from teeth diagnosed with symptomatic irreversible pulpitis during endodontic treatment and isolation and characterization of DPSCs from such cryopreserved pulp. The aim of this study was to cryopreserve the said pulp tissues to propagate and characterize isolated DPSCs. A medium consisting of 90% fetal bovine serum and 10% dimethyl sulfoxide was used for cryopreservation of pulp tissues. DPSCs were isolated from fresh and cryopreserved pulp tissues using an enzymatic method. Cell viability and proliferation were determined using the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. DPSC migration and interaction were analyzed with the wound healing assay. Mesenchymal characteristics of DPSCs were verified by flow cytometric analysis of cell surface CD markers. The osteogenic and adipogenic potential of DPSCs was shown by von Kossa and oil red O staining methods, respectively, and the polymerase chain reaction method. We found no significant difference in CD marker expression and osteogenic and adipogenic differentiation potential of DPSCs obtained from fresh and cryopreserved dental pulp tissue. Our study shows that dental pulp can be successfully cryopreserved without losing normal characteristics and differentiation potential of their DPSCs, thus making them suitable for dental banking and future therapeutic purposes. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  17. Investigation of Borrelia burgdorferi genotypes in Australia obtained from erythema migrans tissue

    Directory of Open Access Journals (Sweden)

    Mayne PJ

    2012-07-01

    Full Text Available Peter J Mayne International Lyme and Associated Diseases Society, Bethesda, MD, USA The author is a member of the International Lyme and Associated Diseases Society (ILADSBackground: Lyme disease (LD is an emerging infectious disease in Australia. There has been controversy regarding endemic lyme disease in the country for over 20 years. Borrelia burgdorferi sensu stricto (Bbss and sensu lato (Bbsl are closely related spirochetal species that are the causative agents of LD in humans. Clinical transmission of this tick-borne disease is marked by a characteristic rash known as erythema migrans (EM. This study employed molecular techniques to demonstrate the spirochetal agent of Lyme disease isolated from EM biopsies of patients in Australia and then investigate their genetic diversity.Methods: Four patients who presented to the author's practice over a one-year period from mid 2010 to mid 2011 returned positive results on central tissue biopsy of EM lesions using polymerase chain reaction (PCR analysis. The findings were confirmed by DNA sequencing, and basic local alignment search tool (BLAST analysis was then used to genetically characterize the causative organisms.Results: Three isolates were identified as Bbss that lay genotypically between strains B31 and ZS7 and were then characterized as strain 64b. One of the three isolates though may have similarity to B. bissettii a Bbsl. The fourth isolate was more appropriately placed in the sensu lato group and appeared to be similar, but not identical to, a B. valaisiana-type isolate. In this study, a central biopsy taken within 6 days of infection was used instead of conventional sampling at the leading edge, and the merits of this are discussed.Conclusion: These patients acquired infection in Australia, further proving endemic LD on the continent. Central biopsy site of EM is a useful tool for PCR evaluation. BLAST searches suggest a genetic diversity of B. burgdorferi, which has implications

  18. Normalization of gene expression measurement of tissue samples obtained by transurethral resection of bladder tumors

    Directory of Open Access Journals (Sweden)

    Pop LA

    2016-06-01

    Full Text Available Laura A Pop,1,* Valentina Pileczki,1,2,* Roxana M Cojocneanu-Petric,1 Bogdan Petrut,3,4 Cornelia Braicu,1 Ancuta M Jurj,1 Rares Buiga,5 Patriciu Achimas-Cadariu,6,7 Ioana Berindan-Neagoe1,8 1The Research Center for Functional Genomics, Biomedicine and Translational Medicine, Iuliu Haţieganu University of Medicine and Pharmacy, Cluj-Napoca, Cluj, Romania; 2Department of Analytical Chemistry, Iuliu Haţieganu University of Medicine and Pharmacy, Cluj-Napoca, Cluj, Romania; 3Department of Surgery II – Urology, The Oncology Institute “Prof Dr Ion Chiricuţă”, Cluj-Napoca, Cluj, Romania; 4Department of Urology, Iuliu Haţieganu University of Medicine and Pharmacy, Cluj-Napoca, Cluj, Romania; 5Department of Pathology, The Oncology Institute “Prof. Dr Ion Chiricuţă”, Cluj-Napoca, Cluj, Romania; 6Department of Surgery, The Oncology Institute “Prof Dr Ion Chiricuţă”, Cluj-Napoca, Cluj, Romania; 7Department of Surgical Oncology and Gynecological Oncology, Iuliu Haţieganu University of Medicine and Pharmacy, 8Department of Functional Genomics and Experimental Pathology, The Oncology Institute “Prof Dr Ion Chiricuţă”, Cluj-Napoca, Cluj, Romania *These authors contributed equally to this work Background: Sample processing is a crucial step for all types of genomic studies. A major challenge for researchers is to understand and predict how RNA quality affects the identification of transcriptional differences (by introducing either false-positive or false-negative errors. Nanotechnologies help improve the quality and quantity control for gene expression studies. Patients and methods: The study was performed on 14 tumor and matched normal pairs of tissue from patients with bladder urothelial carcinomas. We assessed the RNA quantity by using the NanoDrop spectrophotometer and the quality by nano-microfluidic capillary electrophoresis technology provided by Agilent 2100 Bioanalyzer. We evaluated the amplification status of three

  19. Investigation of Borrelia burgdorferi genotypes in Australia obtained from erythema migrans tissue

    Science.gov (United States)

    Mayne, Peter J

    2012-01-01

    Background Lyme disease (LD) is an emerging infectious disease in Australia. There has been controversy regarding endemic lyme disease in the country for over 20 years. Borrelia burgdorferi sensu stricto (Bbss) and sensu lato (Bbsl) are closely related spirochetal species that are the causative agents of LD in humans. Clinical transmission of this tick-borne disease is marked by a characteristic rash known as erythema migrans (EM). This study employed molecular techniques to demonstrate the spirochetal agent of Lyme disease isolated from EM biopsies of patients in Australia and then investigate their genetic diversity. Methods Four patients who presented to the author’s practice over a one-year period from mid 2010 to mid 2011 returned positive results on central tissue biopsy of EM lesions using polymerase chain reaction (PCR) analysis. The findings were confirmed by DNA sequencing, and basic local alignment search tool (BLAST) analysis was then used to genetically characterize the causative organisms. Results Three isolates were identified as Bbss that lay genotypically between strains B31 and ZS7 and were then characterized as strain 64b. One of the three isolates though may have similarity to B. bissettii a Bbsl. The fourth isolate was more appropriately placed in the sensu lato group and appeared to be similar, but not identical to, a B. valaisiana-type isolate. In this study, a central biopsy taken within 6 days of infection was used instead of conventional sampling at the leading edge, and the merits of this are discussed. Conclusion These patients acquired infection in Australia, further proving endemic LD on the continent. Central biopsy site of EM is a useful tool for PCR evaluation. BLAST searches suggest a genetic diversity of B. burgdorferi, which has implications concerning the diagnosis, clinical severity, and testing of LD in Australia. PMID:22956879

  20. A study of the b-quark fragmentation function with the DELPHI detector at LEP I and an averaged distribution obtained at the Z Pole

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W.D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J.E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K.H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P.S.L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, N.; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, S.U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M.J.; Crennell, D.; Cuevas, J.; D'Hondt, J.; da Silva, T.; Da Silva, W.; Della Ricca, G.; De Angelis, A.; De Boer, W.; De Clercq, C.; De Lotto, B.; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Drees, J.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Espirito Santo, M.C.; Fanourakis, G.; Fassouliotis, D.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, E.; Gokieli, R.; Golob, B.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Hoffman, J.; Holmgren, S.O.; Holt, P.J.; Houlden, M.A.; Jackson, J.N.; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, E.K.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, F.; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kersevan, B.P.; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J.C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; McNulty, R.; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Moenig, K.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nemecek, S.; Nicolaidou, R.; Nikolenko, M.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, H.; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Podobnik, T.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Radojicic, D.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Roudeau, P.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Savoy-Navarro, A.; Schwickerath, U.; Sekulin, R.; Siebel, M.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Tegenfeldt, F.; Timmermans, J.; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Turluer, M.L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; Van Dam, P.; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimine, N.I.; Zintchenko, A.; Zupan, M.

    2011-01-01

    The nature of b-quark jet hadronisation has been investigated using data taken at the Z peak by the DELPHI detector at LEP. Two complementary methods are used to reconstruct the energy of weakly decaying b-hadrons, E^weak_B. The average value of x^weak_B = E^weak_B/E_beam is measured to be 0.699 +/- 0.011. The resulting x^weak_B distribution is then analysed in the framework of two choices for the perturbative contribution (parton shower and Next to Leading Log QCD calculation) in order to extract measurements of the non-perturbative contribution to be used in studies of b-hadron production in other experimental environments than LEP. In the parton shower framework, data favour the Lund model ansatz and corresponding values of its parameters have been determined within PYTHIA~6.156 from DELPHI data: a= 1.84^{+0.23}_{-0.21} and b=0.642^{+0.073}_{-0.063} GeV^-2, with a correlation factor rho = 92.2%. Combining the data on the b-quark fragmentation distributions with those obtained at the Z peak by ALEPH, OPAL a...

  1. Intersphincteric anal lipofilling with micro-fragmented fat tissue for the treatment of faecal incontinence: preliminary results of three patients.

    Science.gov (United States)

    Cestaro, Giovanni; De Rosa, Michele; Massa, Salvatore; Amato, Bruno; Gentile, Maurizio

    2015-07-01

    Faecal incontinence is a very debilitating problem. Many techniques have been proposed to treat this condition, with controversial results. Autologous transplant of fat tissue is an established procedure used for the repair of tissue damage, and recent studies revealed the potentiality of tissue regeneration by human adipose-derived stem cells. We treated this condition with the injection, in the intersphincteric anal groove, of lipoaspirate processed by an innovative technology (Lipogems). The aim of the study was to evaluate the efficacy of Lipogems injection for the treatment of faecal incontinence. In February 2014 we treated 3 patients with faecal incontinence. The surgical procedure required three phases: lipoaspiration, processing of lipoaspirate with the Lipogems system, and injection of the obtained product in the intersphincteric anal groove. An accurate proctological examination followed at 1 week, 1 month and 6 months after treatment. Each patient reported an improved Wexner incontinence score at 1 month after the procedure. We observed an increase of resting pressure (by at least 10 mm Hg) and thickness of the internal anal sphincter respectively at ano-rectal manometry and by ultrasound (US) evaluation at the sixth month of follow-up. Our preliminary results are encouraging, but multicentric studies with longer follow-up are needed to validate this novel technique for treatment of faecal incontinence.

  2. Magnetic resonance metabolic profiling of breast cancer tissue obtained with core needle biopsy for predicting pathologic response to neoadjuvant chemotherapy.

    Directory of Open Access Journals (Sweden)

    Ji Soo Choi

    Full Text Available The purpose of this study was to determine whether metabolic profiling of core needle biopsy (CNB samples using high-resolution magic angle spinning (HR-MAS magnetic resonance spectroscopy (MRS could be used for predicting pathologic response to neoadjuvant chemotherapy (NAC in patients with locally advanced breast cancer. After institutional review board approval and informed consent were obtained, CNB tissue samples were collected from 37 malignant lesions in 37 patients before NAC treatment. The metabolic profiling of CNB samples were performed by HR-MAS MRS. Metabolic profiles were compared according to pathologic response to NAC using the Mann-Whitney test. Multivariate analysis was performed with orthogonal projections to latent structure-discriminant analysis (OPLS-DA. Various metabolites including choline-containing compounds were identified and quantified by HR-MAS MRS in all 37 breast cancer tissue samples obtained by CNB. In univariate analysis, the metabolite concentrations and metabolic ratios of CNB samples obtained with HR-MAS MRS were not significantly different between different pathologic response groups. However, there was a trend of lower levels of phosphocholine/creatine ratio and choline-containing metabolite concentrations in the pathologic complete response group compared to the non-pathologic complete response group. In multivariate analysis, the OPLS-DA models built with HR-MAS MR metabolic profiles showed visible discrimination between the pathologic response groups. This study showed OPLS-DA multivariate analysis using metabolic profiles of pretreatment CNB samples assessed by HR- MAS MRS may be used to predict pathologic response before NAC, although we did not identify the metabolite showing statistical significance in univariate analysis. Therefore, our preliminary results raise the necessity of further study on HR-MAS MR metabolic profiling of CNB samples for a large number of cancers.

  3. Endogenous proteolytic cleavage of disease-associated prion protein to produce C2 fragments is strongly cell- and tissue-dependent.

    Science.gov (United States)

    Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert

    2010-04-02

    The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.

  4. Endogenous Proteolytic Cleavage of Disease-associated Prion Protein to Produce C2 Fragments Is Strongly Cell- and Tissue-dependent*

    Science.gov (United States)

    Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert

    2010-01-01

    The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089

  5. A study of the b-quark fragmentation function with the DELPHI detector at LEP I and an averaged distribution obtained at the Z Pole

    Czech Academy of Sciences Publication Activity Database

    Abdallah, J.; Abreu, A.; Adam, W.; Mašík, Jiří; Němeček, Stanislav; Řídký, Jan; Todorovová, Šárka; Trávníček, Petr; Vrba, Václav

    2011-01-01

    Roč. 71, č. 2 (2011), 1-50 ISSN 1434-6044 R&D Projects: GA MŠk LA08015 Institutional research plan: CEZ:AV0Z10100502 Keywords : parton: shower s * bottom: fragmentation function * jet: hadronization * CERN * LEP * DELPHI * quantum chromodynamics * PYTHIA * ALEPH * OPAL * SLD Subject RIV: BF - Elementary Particles and High Energy Physics Impact factor: 3.631, year: 2011

  6. Bone marrow dosimetry in rats using direct tissue counting after injection of radio-iodinated intact monoclonal antibodies or F(ab')2 fragments

    International Nuclear Information System (INIS)

    Buchegger, F.; Chalandon, Y.; Pelegrin, A.; Hardman, N.; Mach, J.P.

    1991-01-01

    Normal rats were injected intravenously with 131I- and 125I-labeled intact murine and chimeric mouse-human monoclonal antibodies directed against carcinoembryonic antigen or with the corresponding F(ab')2 fragments. At different times after injection, individual animals were killed and radioactivity of blood and major organs, including bones and bone marrow, was determined. Ratios comparing radioactivity concentration in different tissues with that of bone marrow were calculated and found to remain stable during several effective half-lives of the antibodies. Mean bone marrow radioactivity was 35% (range, 29%-40%) of that of blood and 126% (range, 108%-147%) of that of liver after injection of intact Mabs or F(ab')2 fragments. In nude rats bearing human colon carcinoma xenografts producing carcinoembryonic antigen, relative bone marrow radioactivity was slightly lower than that in normal rats

  7. Structure and properties of slow-resorbing nanofibers obtained by (co-axial electrospinning as tissue scaffolds in regenerative medicine

    Directory of Open Access Journals (Sweden)

    Andrzej Hudecki

    2017-12-01

    Full Text Available With the rapid advancement of regenerative medicine technologies, there is an urgent need for the development of new, cell-friendly techniques for obtaining nanofibers—the raw material for an artificial extracellular matrix production. We investigated the structure and properties of PCL10 nanofibers, PCL5/PCL10 core-shell type nanofibers, as well as PCL5/PCLAg nanofibres prepared by electrospinning. For the production of the fiber variants, a 5–10% solution of polycaprolactone (PCL (Mw = 70,000–90,000, dissolved in a mixture of formic acid and acetic acid at a ratio of 70:30 m/m was used. In order to obtain fibers containing PCLAg 1% of silver nanoparticles was added. The electrospin was conducted using the above-described solutions at the electrostatic field. The subsequent bio-analysis shows that synthesis of core-shell nanofibers PCL5/PCL10, and the silver-doped variant nanofiber core shell PCL5/PCLAg, by using organic acids as solvents, is a robust technique. Furthermore, the incorporation of silver nanoparticles into PCL5/PCLAg makes such nanofibers toxic to model microbes without compromising its biocompatibility. Nanofibers obtained such way may then be used in regenerative medicine, for the preparation of extracellular scaffolds: (i for controlled bone regeneration due to the long decay time of the PCL, (ii as bioscaffolds for generation of other types of artificial tissues, (iii and as carriers of nanocapsules for local drug delivery. Furthermore, the used solvents are significantly less toxic than the solvents for polycaprolactone currently commonly used in electrospin, like for example chloroform (CHCl3, methanol (CH3OH, dimethylformamide (C3H7NO or tetrahydrofuran (C4H8O, hence the presented here electrospin technique may allow for the production of multilayer nanofibres more suitable for the use in medical field.

  8. Structure and properties of slow-resorbing nanofibers obtained by (co-axial) electrospinning as tissue scaffolds in regenerative medicine

    Science.gov (United States)

    Gola, Joanna; Ghavami, Saeid; Skonieczna, Magdalena; Markowski, Jarosław; Likus, Wirginia; Lewandowska, Magdalena; Maziarz, Wojciech

    2017-01-01

    With the rapid advancement of regenerative medicine technologies, there is an urgent need for the development of new, cell-friendly techniques for obtaining nanofibers—the raw material for an artificial extracellular matrix production. We investigated the structure and properties of PCL10 nanofibers, PCL5/PCL10 core-shell type nanofibers, as well as PCL5/PCLAg nanofibres prepared by electrospinning. For the production of the fiber variants, a 5–10% solution of polycaprolactone (PCL) (Mw = 70,000–90,000), dissolved in a mixture of formic acid and acetic acid at a ratio of 70:30 m/m was used. In order to obtain fibers containing PCLAg 1% of silver nanoparticles was added. The electrospin was conducted using the above-described solutions at the electrostatic field. The subsequent bio-analysis shows that synthesis of core-shell nanofibers PCL5/PCL10, and the silver-doped variant nanofiber core shell PCL5/PCLAg, by using organic acids as solvents, is a robust technique. Furthermore, the incorporation of silver nanoparticles into PCL5/PCLAg makes such nanofibers toxic to model microbes without compromising its biocompatibility. Nanofibers obtained such way may then be used in regenerative medicine, for the preparation of extracellular scaffolds: (i) for controlled bone regeneration due to the long decay time of the PCL, (ii) as bioscaffolds for generation of other types of artificial tissues, (iii) and as carriers of nanocapsules for local drug delivery. Furthermore, the used solvents are significantly less toxic than the solvents for polycaprolactone currently commonly used in electrospin, like for example chloroform (CHCl3), methanol (CH3OH), dimethylformamide (C3H7NO) or tetrahydrofuran (C4H8O), hence the presented here electrospin technique may allow for the production of multilayer nanofibres more suitable for the use in medical field. PMID:29302386

  9. Proteomic analysis of tissue from α1,3-galactosyltransferase knockout mice reveals that a wide variety of proteins and protein fragments change expression level.

    Directory of Open Access Journals (Sweden)

    Louise Thorlacius-Ussing

    Full Text Available A barrier in a pig-to-man xenotransplantation is that the Galα1-3Galβ1-4GlcNAc-R carbohydrate (α-Gal epitope expressed on pig endothelial cells reacts with naturally occurring antibodies in the recipient's blood leading to rejection. Deletion of the α1,3-galactosyltransferase gene prevents the synthesis of the α-Gal epitope. Therefore, knockout models of the α1,3-galactosyltransferase gene are widely used to study xenotransplantation. We have performed proteomic studies on liver and pancreas tissues from wild type and α1,3-galactosyltransferase gene knockout mice. The tissues were analyzed by two-dimensional polyacrylamide gel electrophoresis and liquid chromatography-tandem mass spectrometry. The analyses revealed that a wide variety of proteins and protein fragments are differentially expressed suggesting that knockout of the α1,3-galactosyltransferase gene affects the expression of several other genes.

  10. Targeting of prolamins by RNAi in bread wheat: effectiveness of seven silencing-fragment combinations for obtaining lines devoid of coeliac disease epitopes from highly immunogenic gliadins.

    Science.gov (United States)

    Barro, Francisco; Iehisa, Julio C M; Giménez, María J; García-Molina, María D; Ozuna, Carmen V; Comino, Isabel; Sousa, Carolina; Gil-Humanes, Javier

    2016-03-01

    Gluten proteins are responsible for the viscoelastic properties of wheat flour but also for triggering pathologies in susceptible individuals, of which coeliac disease (CD) and noncoeliac gluten sensitivity may affect up to 8% of the population. The only effective treatment for affected persons is a strict gluten-free diet. Here, we report the effectiveness of seven plasmid combinations, encompassing RNAi fragments from α-, γ-, ω-gliadins, and LMW glutenin subunits, for silencing the expression of different prolamin fractions. Silencing patterns of transgenic lines were analysed by gel electrophoresis, RP-HPLC and mass spectrometry (LC-MS/MS), whereas gluten immunogenicity was assayed by an anti-gliadin 33-mer monoclonal antibody (moAb). Plasmid combinations 1 and 2 downregulated only γ- and α-gliadins, respectively. Four plasmid combinations were highly effective in the silencing of ω-gliadins and γ-gliadins, and three of these also silenced α-gliadins. HMW glutenins were upregulated in all but one plasmid combination, while LMW glutenins were downregulated in three plasmid combinations. Total protein and starch contents were unaffected regardless of the plasmid combination used. Six plasmid combinations provided strong reduction in the gluten content as measured by moAb and for two combinations, this reduction was higher than 90% in comparison with the wild type. CD epitope analysis in peptides identified in LC-MS/MS showed that lines from three plasmid combinations were totally devoid of CD epitopes from the highly immunogenic α- and ω-gliadins. Our findings raise the prospect of breeding wheat species with low levels of harmful gluten, and of achieving the important goal of developing nontoxic wheat cultivars. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. A method for obtaining peri-implant soft-tissue contours by using screw-retained provisional restorations as impression copings: a clinical report.

    Science.gov (United States)

    Tsai, Bi-Yuan

    2011-10-01

    In the esthetic zone, remodeling of the peri-implant soft-tissue contours through the use of provisional restorations is one of the imperative key factors for optimizing outcomes. Several methods have been described to produce the desired peri-implant soft-tissue contours using customized impression copings or cement-retained provisional crowns. The aim of this article is to present an alternative method for obtaining the desired peri-implant soft-tissue contours by using screw-retained provisional restorations as impression copings, which facilitates the definitive prosthesis fabrication.

  12. A large-scale study of the ultrawideband microwave dielectric properties of normal, benign and malignant breast tissues obtained from cancer surgeries

    Energy Technology Data Exchange (ETDEWEB)

    Lazebnik, Mariya [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States); Popovic, Dijana [Department of Electrical and Computer Engineering, University of Calgary, Calgary, AB (Canada); McCartney, Leah [Department of Electrical and Computer Engineering, University of Calgary, Calgary, AB (Canada); Watkins, Cynthia B [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States); Lindstrom, Mary J [Department of Biostatistics and Medical Informatics, University of Wisconsin, Madison, WI (United States); Harter, Josephine [Department of Pathology, University of Wisconsin, Madison, WI (United States); Sewall, Sarah [Department of Pathology, University of Wisconsin, Madison, WI (United States); Ogilvie, Travis [Department of Pathology, University of Calgary, Calgary, AB (Canada); Magliocco, Anthony [Department of Pathology, University of Calgary, Calgary, AB (Canada); Breslin, Tara M [Department of Surgery, University of Wisconsin, Madison, WI (United States); Temple, Walley [Department of Surgery and Oncology, University of Calgary, Calgary, AB (Canada); Mew, Daphne [Department of Surgery and Oncology, University of Calgary, Calgary, AB (Canada); Booske, John H [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States); Okoniewski, Michal [Department of Electrical and Computer Engineering, University of Calgary, Calgary, AB (Canada); Hagness, Susan C [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States)

    2007-10-21

    The development of microwave breast cancer detection and treatment techniques has been driven by reports of substantial contrast in the dielectric properties of malignant and normal breast tissues. However, definitive knowledge of the dielectric properties of normal and diseased breast tissues at microwave frequencies has been limited by gaps and discrepancies across previously published studies. To address these issues, we conducted a large-scale study to experimentally determine the ultrawideband microwave dielectric properties of a variety of normal, malignant and benign breast tissues, measured from 0.5 to 20 GHz using a precision open-ended coaxial probe. Previously, we reported the dielectric properties of normal breast tissue samples obtained from reduction surgeries. Here, we report the dielectric properties of normal (adipose, glandular and fibroconnective), malignant (invasive and non-invasive ductal and lobular carcinomas) and benign (fibroadenomas and cysts) breast tissue samples obtained from cancer surgeries. We fit a one-pole Cole-Cole model to the complex permittivity data set of each characterized sample. Our analyses show that the contrast in the microwave-frequency dielectric properties between malignant and normal adipose-dominated tissues in the breast is considerable, as large as 10:1, while the contrast in the microwave-frequency dielectric properties between malignant and normal glandular/fibroconnective tissues in the breast is no more than about 10%.

  13. A large-scale study of the ultrawideband microwave dielectric properties of normal, benign and malignant breast tissues obtained from cancer surgeries

    Science.gov (United States)

    Lazebnik, Mariya; Popovic, Dijana; McCartney, Leah; Watkins, Cynthia B.; Lindstrom, Mary J.; Harter, Josephine; Sewall, Sarah; Ogilvie, Travis; Magliocco, Anthony; Breslin, Tara M.; Temple, Walley; Mew, Daphne; Booske, John H.; Okoniewski, Michal; Hagness, Susan C.

    2007-10-01

    The development of microwave breast cancer detection and treatment techniques has been driven by reports of substantial contrast in the dielectric properties of malignant and normal breast tissues. However, definitive knowledge of the dielectric properties of normal and diseased breast tissues at microwave frequencies has been limited by gaps and discrepancies across previously published studies. To address these issues, we conducted a large-scale study to experimentally determine the ultrawideband microwave dielectric properties of a variety of normal, malignant and benign breast tissues, measured from 0.5 to 20 GHz using a precision open-ended coaxial probe. Previously, we reported the dielectric properties of normal breast tissue samples obtained from reduction surgeries. Here, we report the dielectric properties of normal (adipose, glandular and fibroconnective), malignant (invasive and non-invasive ductal and lobular carcinomas) and benign (fibroadenomas and cysts) breast tissue samples obtained from cancer surgeries. We fit a one-pole Cole-Cole model to the complex permittivity data set of each characterized sample. Our analyses show that the contrast in the microwave-frequency dielectric properties between malignant and normal adipose-dominated tissues in the breast is considerable, as large as 10:1, while the contrast in the microwave-frequency dielectric properties between malignant and normal glandular/fibroconnective tissues in the breast is no more than about 10%.

  14. ACE-Inhibitory and Antioxidant Activities of Peptide Fragments Obtained from Tomato Processing By-Products Fermented Using Bacillus subtilis: Effect of Amino Acid Composition and Peptides Molecular Mass Distribution.

    Science.gov (United States)

    Moayedi, Ali; Mora, Leticia; Aristoy, M-Concepción; Hashemi, Maryam; Safari, Mohammad; Toldrá, Fidel

    2017-01-01

    The effects of amino acid composition and peptide molecular mass on ACE-inhibitory and antioxidant activities of protein fragments obtained from tomato waste fermented using Bacillus subtilis were evaluated. The addition of B. subtilis increased the relative amounts of aromatic and positively-charged amino acids which have been described to influence the biological activities of peptide fragments. IC 50 values of hydrolysates for ACE-inhibitory and 2, 2'-diphenyl-1-picrylhydrazyl (DPPH) scavenging activities were found to be 1.5 and 8.2 mg/mL, respectively. Size-exclusion chromatography (SEC) pattern of the hydrolysate indicated the breakdown of parent proteins to smaller peptides with molecular weights mainly below 1400 Da. MALDI-TOF mass spectrometry analysis revealed that the highest ACE-inhibitory activity was due to peptides showing molecular mass range 500-800 Da, while the most active antioxidant peptides were found to be mainly at the two different peptide weight ranges 500-800 Da and 1200-1500 Da.

  15. Obtaining Normal Tissue Constraints Using Intensity Modulated Radiotherapy (IMRT) in Patients with Oral Cavity, Oropharnygeal, and Laryngeal Carcinoma

    International Nuclear Information System (INIS)

    Skinner, William K.J.; Muse, Evan D.; Yaparpalvi, Ravindra; Guha, Chandan; Garg, Madhur K.; Kalnicki, Shalom

    2009-01-01

    The purpose of this study was to evaluate normal tissue dose constraints while maintaining planning target volume (PTV) prescription without reducing PTV margins. Sixteen patients with oral cavity carcinoma (group I), 27 patients with oropharyngeal carcinoma (group II), and 28 patients with laryngeal carcinoma (group III) were reviewed. Parotid constraints were a mean dose to either parotid < 26 Gy (PP1), 50% of either parotid < 30 Gy (PP2), or 20 cc of total parotid < 20 Gy (PP3). Treatment was intensity modulated radiation therapy (IMRT) with simultaneous integrated boost (SIB). All patients met constraints for cord and brain stem. The mandibular constraints were met in 66%, 29%, and 57% of patients with oral, oropharyngeal, and laryngeal cancers, respectively. Mean dose of 26 Gy (PP1) was achieved in 44%, 41%, and 38% of oral, oropharyngeal, and laryngeal patients. PP2 (parotid constraint of 30 Gy to less than 50% of one parotid) was the easiest to achieve (group I, II, and III: 82%, 76%, and 78%, respectively). PP3 (20 cc of total parotid < 20 Gy) was difficult, and was achieved in 25%, 17%, and 35% of oral, oropharyngeal, and laryngeal patients, respectively. Mean parotid dose of 26 Gy was met 40% of the time. However, a combination of constraints allowed for sparing of the parotid based on different criteria and was met in high numbers. This was accomplished without reducing PTV-parotid overlap. What dose constraint best correlates with subjective and objective functional outcomes remains a focus for future study.

  16. Plant DNA detection from grasshopper guts: A step-by-step protocol, from tissue preparation to obtaining plant DNA sequences.

    Science.gov (United States)

    Avanesyan, Alina

    2014-02-01

    A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. • The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA) gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. • The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant "movement" during food consumption, to detecting plant-insect interactions.

  17. Acute sleep fragmentation does not alter pro-inflammatory cytokine gene expression in brain or peripheral tissues of leptin-deficient mice

    Directory of Open Access Journals (Sweden)

    Jennifer E. Dumaine

    2018-02-01

    Full Text Available Obesity and sleep fragmentation (SF are often co-occurring pro-inflammatory conditions in patients with obstructive sleep apnea. Leptin is a peptide hormone produced by adipocytes that has anorexigenic effects upon appetite while regulating immunity. The role of leptin in mediating inflammatory responses to SF is incompletely understood. Male C57BL/6j (lean and ob/ob mice (leptin-deficient mice exhibiting obese phenotype were subjected to SF or control conditions for 24 h using an automated SF chamber. Trunk blood and tissue samples from the periphery (liver, spleen, fat, and heart and brain (hypothalamus, prefrontal cortex, and hippocampus were collected. Quantitative PCR was used to determine relative cytokine gene expression of pro-inflammatory (IL-1β, TNF-α and anti-inflammatory (TGF-β1 cytokines. Enzyme-linked immunosorbent assay (ELISA was used to determine serum corticosterone concentration. Ob/ob mice exhibited elevated cytokine gene expression in liver (TNF-α, TGF-β1, heart (TGF-β1, fat (TNF-α, and brain (hippocampus, hypothalamus, prefrontal cortex: IL-1β, TNF-α compared with wild-type mice. Conversely, leptin deficiency decreased pro-inflammatory cytokine gene expression in heart (IL-1β, TNF-α. SF significantly increased IL-1β and TNF-α gene expression in fat and TGF-β1 expression in spleen relative to controls, but only in wild-type mice. SF increased basal serum corticosterone regardless of genotype. Taken together, these findings suggest that leptin deficiency affects cytokine gene expression differently in the brain compared to peripheral tissues with minimal interaction from acute SF.

  18. Standardization of a Protocol for Obtaining Platelet Rich Plasma from blood Donors; a Tool for Tissue Regeneration Procedures.

    Science.gov (United States)

    Gómez, Lina Andrea; Escobar, Magally; Peñuela, Oscar

    2015-01-01

    To develop a protocol for obtaining autologous platelet rich plasma in healthy individuals and to determine the concentration of five major growth factors before platelet activation. This protocol could be integrated into the guidelines of good clinical practice and research in regenerative medicine. Platelet rich plasma was isolated by centrifugation from 38 healthy men and 42 women ranging from 18 to 59 years old. The platelet count and quantification of growth factors were analyzed in eighty samples, stratified for age and gender of the donor. Analyses were performed using parametric the t-test or Pearson's analysis for non-parametric distribution. P platelet counts from 1.6 to 4.9 times (mean = 2.8). There was no correlation between platelet concentration and the level of the following growth factors: VEGF-D (r = 0.009, p = 0.4105), VEGF-A (r = 0.0068, p = 0.953), PDGF subunit AA (p = 0.3618; r = 0.1047), PDGF-BB (p = 0.5936; r = 0.6095). In the same way, there was no correlation between donor gender and growth factor concentrations. Only TGF-β concentration was correlated to platelet concentration (r = 0.3163, p = 0.0175). The procedure used allowed us to make preparations rich in platelets, low in leukocytes and red blood cells, and sterile. Our results showed biological variations in content of growth factors in PRP. The factors influencing these results should be further studied.

  19. Plant DNA Detection from Grasshopper Guts: A Step-by-Step Protocol, from Tissue Preparation to Obtaining Plant DNA Sequences

    Directory of Open Access Journals (Sweden)

    Alina Avanesyan

    2014-02-01

    Full Text Available Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions.

  20. Enzyme-Mediated Ring-Opening Polymerization of Pentadecalactone to Obtain Biodegradable Polymer for Fabrication of Scaffolds for Bone Tissue Engineering

    Directory of Open Access Journals (Sweden)

    V. A. Korzhikov

    2013-01-01

    Full Text Available The optimization of enzyme-mediated polymerization of pentadecalactone (PDL was performed to obtain macromolecular products suitable for generation of 3D cell supports (scaffolds for bone tissue engineering. Such parameters as temperature, monomer/enzyme ratio, and monomer concentration were studied. The maximum molecular weight of synthesized polymers was about 90,000. Methods allowing the introduction of reactive double bonds into polypentadecalactone (polyPDL structure were developed. The macroporous matrices were obtained by modification of thermoinduced phase separation method.

  1. Effects of staple size, tissue thickness, and precompression time on staple shape in side-to-side jejunocecal anastomosis in specimens obtained from healthy horses at an abattoir.

    Science.gov (United States)

    Giusto, Gessica; Gandini, Marco; Amedeo, Stefano

    2014-07-01

    To determine effects of staple size, precompression time, and tissue thickness on staple shape and tissue approximation in side-to-side jejunocecal anastomosis in equine specimens. Cecum, ileum, and jejunum specimens obtained from 18 healthy horses at an abattoir. Specimens were allotted into 2 groups. Anastomoses were stapled with 4.8-or 3.8-mm staples. Precompression time was 15 seconds for both groups. Staple lines were cut into proximal, middle, and distal sections. Thickness of intestinal walls was measured with a calibrated tissue micrometer, photographs were obtained, and intestinal tissues were digested. An investigator measured staples and assessed the shape of staples on high-definition digital images. Number of optimally shaped staples and staple height were compared among sections and between groups. Use of 4.8-mm staples resulted in poor approximation of tissues in the distal sections of anastomoses. The percentage of optimally shaped staples was 538 of 551 (97.6%) and 616 of 634 (97.2%) for 4.8- and 3.8-mm staples, respectively. The percentage of optimally shaped staples did not differ significantly between groups for the same sections. There was a lower percentage of optimally shaped staples in the distal sections than in the proximal and middle sections of each group. Mean staple height did not differ significantly among sections of each group. Use of 3.8-mm staples with an adequate precompression time for jejunocecal anastomosis in horses resulted in proper staple shape. These findings could be used to improve the technique and outcome for stapled jejunocecal anastomoses in horses.

  2. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  3. Treatment with TUG891, a free fatty acid receptor 4 agonist, restores adipose tissue metabolic dysfunction following chronic sleep fragmentation in mice.

    Science.gov (United States)

    Gozal, D; Qiao, Z; Almendros, I; Zheng, J; Khalyfa, A; Shimpukade, B; Ulven, T

    2016-07-01

    Sleep fragmentation (SF), a frequent occurrence in multiple sleep and other diseases leads to increased food intake and insulin resistance via increased macrophage activation and inflammation in visceral white adipose tissue (VWAT). Free fatty acid receptor 4 (FFA4) is reduced in pediatric sleep apnea patients and FFA4 agonists have been proposed in the treatment of obesity and metabolic dysfunction. Male mice were subjected to SF exposures for 6 weeks, and treated during the last 2 weeks with either TUG891, a potent and selective FFA4 agonist, or vehicle (Veh). Glucose and insulin tolerance tests and VWAT insulin sensitivity tests were conducted (phosphorylated Akt/total Akt), along with flow cytometric assessments of VWAT macrophage polarity, and T-cell lymphocyte subsets. SF-TUG891 mice showed reduction in food consumption, weight gain and VWAT mass. Furthermore, TUG891 treatment ameliorated glucose tolerance test and insulin tolerance test responses and increased VWAT p-Akt/Akt responses to insulin. Increases in M1/M2 macrophages and decreased Treg counts in VWAT associated with SF were markedly improved by TUG891, and VWAT macrophages from TUG891-treated mice had markedly attenuated insulin resistance effects on naïve cultured adipocytes. Treatment with an FFA4 agonist reverses SF-induced food intake increases and gains in body weight, and significantly attenuates VWAT inflammation and insulin resistance. Thus, interventional dietary or pharmaceutical strategies aimed at increasing FFA4 activity may serve as potentially useful adjunctive therapies for sleep disorders accompanied by metabolic morbidity.

  4. Umbilical Cord Wharton’s Jelly Repeated Culture System: A New Device and Method for Obtaining Abundant Mesenchymal Stem Cells for Bone Tissue Engineering

    Science.gov (United States)

    Xing, Junchao; Wu, Xuehui; Jin, Huiyong; Li, Zhiqiang; Deng, Moyuan; Xie, Zhao; Xu, Jianzhong

    2014-01-01

    To date, various types of cells for seeding regenerative scaffolds have been used for bone tissue engineering. Among seed cells, the mesenchymal stem cells derived from human umbilical cord Wharton’s jelly (hUCMSCs) represent a promising candidate and hold potential for bone tissue engineering due to the the lack of ethical controversies, accessibility, sourced by non-invasive procedures for donors, a reduced risk of contamination, osteogenic differentiation capacities, and higher immunomodulatory capacity. However, the current culture methods are somewhat complicated and inefficient and often fail to make the best use of the umbilical cord (UC) tissues. Moreover, these culture processes cannot be performed on a large scale and under strict quality control. As a result, only a small quantity of cells can be harvested using the current culture methods. To solve these problems, we designed and evaluated an UC Wharton’s jelly repeated culture device. Using this device, hUCMSCs were obtained from the repeated cultures and their quantities and biological characteristics were compared. We found that using our culture device, which retained all tissue blocks on the bottom of the dish, the total number of obtained cells increased 15–20 times, and the time required for the primary passage was reduced. Moreover, cells harvested from the repeated cultures exhibited no significant difference in their immunophenotype, potential for multilineage differentiation, or proliferative, osteoinductive capacities, and final osteogenesis. The application of the repeated culture frame (RCF) not only made full use of the Wharton’s jelly but also simplified and specified the culture process, and thus, the culture efficiency was significantly improved. In summary, abundant hUCMSCs of dependable quality can be acquired using the RCF. PMID:25329501

  5. Discriminating parathyroid adenoma from local mimics by using inherent tissue attenuation and vascular information obtained with four-dimensional CT: formulation of a multinomial logistic regression model.

    Science.gov (United States)

    Hunter, George J; Ginat, Daniel T; Kelly, Hillary R; Halpern, Elkan F; Hamberg, Leena M

    2014-01-01

    To identify a set of parameters, which are based on tissue enhancement and native iodine content obtained from a standardized triple-phase four-dimensional (4D) computed tomographic (CT) scan, that define a multinomial logistic regression model that discriminates between parathyroid adenoma (PTA) and thyroid nodules or lymph nodes. Informed consent was waived by the institutional review board for this retrospective HIPAA-compliant study. Electronic medical records were reviewed for 102 patients with hyperparathyroidism who underwent triple-phase 4D CT and parathyroid surgery resulting in pathologically proved removal of adenoma from July 2010 through December 2011. Hounsfield units were measured in PTA, thyroid, lymph nodes, and aorta and were used to determine seven parameters characterizing tissue contrast enhancement. These were used as covariates in 10 multinomial logistic regression models. Three models with one covariate, four models with two covariates, and three models with three covariates were investigated. Receiver operating characteristic (ROC) analysis was performed to determine how well each model discriminated between adenoma and nonadenomatous tissues. Statistical differences between the areas under the ROC curves (AUCs) for each model pair were calculated, as well as sensitivity, specificity, accuracy, negative predictive value, and positive predictive value. A total of 120 lesions were found; 112 (93.3%) lesions were weighed, and mean and median weights were 589 and 335 mg, respectively. The three-covariate models were significantly identical (P > .65), with largest AUC of 0.9913 ± 0.0037 (standard error), accuracy of 96.9%, and sensitivity, specificity, negative predictive value, and positive predictive value of 94.3%, 98.3%, 97.1%, and 96.7%, respectively. The one- and two-covariate models were significantly less accurate (P logistic model derived from a triple-phase 4D CT scan can accurately provide the probability that tissue is PTA and

  6. Fragment-fragment correlations in near-binary fragmentation of C60

    International Nuclear Information System (INIS)

    Vandenbosch, R.; Henry, B.; Cooper, C.H.; Liang, J.F.; Will, D.I.

    1997-01-01

    The collision dynamics of C 60 with H 2 and He gas has been studied using reverse kinematics. A beam of C 60 - is obtained by electron attachment to neutral molecules exiting an oven and then accelerated to energies between 75 and 150 keV. The collisions take place in a windowless gas cell. We energy analyze the products in a pair of electrostatic analyzers which are oriented so that coincidences between light and heavy fragments can be observed. Our energy, and hence mass, resolution is sufficient to uniquely identify all C n clusters between n=1 and 60. The principal question we are addressing is whether heavy products in the mass range C 34 to C 56 are produced solely by sequential emission of C 2 fragments, or whether longer chains (and possibly rings) compete with C 2 emission. From our coincidence studies we have conclusive evidence that fragments such as C 8 are fragmentation partners to heavy fragments. In general we find that the products of a binary fragmentation are sufficiently excited that sequential decay follows the initial fragmentation. Although only even-n heavy fragments are observed, the coincident light fragments include both odd and even-n fragments due to subsequent fragmentation of the excited lighter partner of the initial binary fragmentation. This scenario has been confirmed by studying coincidences between two light fragments. copyright 1997 American Institute of Physics

  7. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  8. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  9. Comparison of Endometrial Pathology between Tissues Obtained from Manual Vacuum Aspiration and Sharp Metal Curettage in Women with Abnormal Uterine Bleeding.

    Science.gov (United States)

    Sirimai, Korakot; Lertbunnaphong, Tripop; Malakorn, Kitti; Warnnissorn, Malee

    2016-02-01

    To study the correlation of endometrial pathology, which were derived from manual vacuum aspiration (MVA) and sharp metal curettage (SMC). Women aged over 35 years old who presented with abnormal uterine bleeding were enrolled. Endometrial biopsy using MVA and sharp metal curettage under paracervical nerve block were performed, respectively. Correlation of endometrial pathology from both methods and correlation between endometrial pathology from MVA and the most severe pathology were analyzed using Kappa statistics. One hundred and thirty two women were enrolled Nine cases were drop out because of inability to pass the MVA's cannula through the cervical os. Mean age was 49.3 ± 8.5 years old. Mean BMI was 25.1 ± 4 kg/m². Pathological correspondence between tissue obtained from MVA and sharp metal curette was 64.2% and the Kappa agreement was 0.56 (K0 = 0.56, p-value abnormal uterine bleeding.

  10. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    ‘Engaging Through Architecture’ in 2015 by Aarhus School of Architecture as a part of the Ventura Lambrate Milan Design Week, where it was exhibited under the name Concrete. The fundamental pool of techniques and knowledge that set the agenda for the fragment was established before the intentions...

  11. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    to create architectural meaning and give character to an architecture of fragmentation. Layers are both seen as conceptual as well as material frames which define certain strong properties or meanings in the architectural work. Defining layers is a way of separating and organizing; it both defines...

  12. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  13. Kinetics and tissue distribution of the radiolabeled chimeric monoclonal antibody MOv18 IgG and F(ab')2 fragments in ovarian carcinoma patients

    NARCIS (Netherlands)

    Buist, M. R.; Kenemans, P.; den Hollander, W.; Vermorken, J. B.; Molthoff, C. J.; Burger, C. W.; Helmerhorst, T. J.; Baak, J. P.; Roos, J. C.

    1993-01-01

    Twenty-four patients suspected of having ovarian carcinoma received i.v. injection with a combination of radiolabeled intact IgG (1 mg) and F(ab')2 fragments (1 mg) of the chimeric monoclonal antibody MOv18, each form labeled with 1.85 MBq 131I or 125I. Laparotomy was performed either 2 or 6 days

  14. Fragmentation of Chitosan by Acids

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Kasaai

    2013-01-01

    Full Text Available Fragmentation of chitosan in aqueous solution by hydrochloric acid was investigated. The kinetics of fragmentation, the number of chain scissions, and polydispersity of the fragments were followed by viscometry and size exclusion chromatography. The chemical structure and the degree of N-acetylation (DA of the original chitosan and its fragments were examined by 1H NMR spectroscopy and elemental analysis. The kinetic data indicates that the reaction was of first order. The results of polydispersity and the DA suggest that the selected experimental conditions (temperature and concentration of acid were appropriate to obtain the fragments having the polydispersity and the DA similar to or slightly different from those of the original one. A procedure to estimate molecular weight of fragments as well as the number of chain scissions of the fragments under the experimental conditions was also proposed.

  15. Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications

    Directory of Open Access Journals (Sweden)

    José A. Centeno

    2014-01-01

    Full Text Available Background: The majority of modern war wounds are characterized by high-energy blast injuries containing a wide range of retained foreign materials of a metallic or composite nature. Health effects of retained fragments range from local or systemic toxicities to foreign body reactions or malignancies, and dependent on the chemical composition and corrosiveness of the fragments in vivo. Information obtained by chemical analysis of excised fragments can be used to guide clinical decisions regarding the need for fragment removal, to develop therapeutic interventions, and to better anticipate future medical problems from retained fragment related injuries. In response to this need, a new U.S Department of Defense (DoD directive has been issued requiring characterization of all removed fragments to provide a database of fragment types occurring in combat injuries. Objectives: The objective of this study is to determine the chemical composition of retained embedded fragments removed from injured military personnel, and to relate results to histological findings in tissue adjacent to fragment material. Methods: We describe an approach for the chemical analysis and characterization of retained fragments and adjacent tissues, and include case examples describing fragments containing depleted uranium (DU, tungsten (W, lead (Pb, and non-metal foreign bodies composed of natural and composite materials. Fragments obtained from four patients with penetrating blast wounds to the limbs were studied employing a wide range of chemical and microscopy techniques. Available adjacent tissues from three of the cases were histologically, microscopically, and chemically examined. The physical and compositional properties of the removed foreign material surfaces were examined with energy dispersive x-ray fluorescence spectrometry (EDXRF, scanning electron microscopy (SEM, laser ablation inductively-coupled plasma mass-spectrometry (LA-ICP-MS, and confocal laser Raman

  16. Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications

    Science.gov (United States)

    Centeno, José A.; Rogers, Duane A.; van der Voet, Gijsbert B.; Fornero, Elisa; Zhang, Lingsu; Mullick, Florabel G.; Chapman, Gail D.; Olabisi, Ayodele O.; Wagner, Dean J.; Stojadinovic, Alexander; Potter, Benjamin K.

    2014-01-01

    Background: The majority of modern war wounds are characterized by high-energy blast injuries containing a wide range of retained foreign materials of a metallic or composite nature. Health effects of retained fragments range from local or systemic toxicities to foreign body reactions or malignancies, and dependent on the chemical composition and corrosiveness of the fragments in vivo. Information obtained by chemical analysis of excised fragments can be used to guide clinical decisions regarding the need for fragment removal, to develop therapeutic interventions, and to better anticipate future medical problems from retained fragment related injuries. In response to this need, a new U.S Department of Defense (DoD) directive has been issued requiring characterization of all removed fragments to provide a database of fragment types occurring in combat injuries. Objectives: The objective of this study is to determine the chemical composition of retained embedded fragments removed from injured military personnel, and to relate results to histological findings in tissue adjacent to fragment material. Methods: We describe an approach for the chemical analysis and characterization of retained fragments and adjacent tissues, and include case examples describing fragments containing depleted uranium (DU), tungsten (W), lead (Pb), and non-metal foreign bodies composed of natural and composite materials. Fragments obtained from four patients with penetrating blast wounds to the limbs were studied employing a wide range of chemical and microscopy techniques. Available adjacent tissues from three of the cases were histologically, microscopically, and chemically examined. The physical and compositional properties of the removed foreign material surfaces were examined with energy dispersive x-ray fluorescence spectrometry (EDXRF), scanning electron microscopy (SEM), laser ablation inductively-coupled plasma mass-spectrometry (LA-ICP-MS), and confocal laser Raman

  17. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    or from a position as business leader to a position in the state apparatus or in the Party and vice versa. To conceptualize the coexistence of the contradicting forces for further enterprise autonomy and continued central control that characterizes the evolving relationship between business groups...... and the Party-state, I suggest the notion of integrated fragmentation....

  18. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  19. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  20. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    the photographs as a starting point for a series of paintings. This way of creating representations of something that already exists is for me to see a way forward in the "decoding" of my own models into other depictions. The models are analyzed through a series of representations in different types of drawings....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...

  1. A Method to Correlate mRNA Expression Datasets Obtained from Fresh Frozen and Formalin-Fixed, Paraffin-Embedded Tissue Samples: A Matter of Thresholds.

    Directory of Open Access Journals (Sweden)

    Dana A M Mustafa

    Full Text Available Gene expression profiling of tumors is a successful tool for the discovery of new cancer biomarkers and potential targets for the development of new therapeutic strategies. Reliable profiling is preferably performed on fresh frozen (FF tissues in which the quality of nucleic acids is better preserved than in formalin-fixed paraffin-embedded (FFPE material. However, since snap-freezing of biopsy materials is often not part of daily routine in pathology laboratories, one may have to rely on archival FFPE material. Procedures to retrieve the RNAs from FFPE materials have been developed and therefore, datasets obtained from FFPE and FF materials need to be made compatible to ensure reliable comparisons are possible.To develop an efficient method to compare gene expression profiles obtained from FFPE and FF samples using the same platform.Twenty-six FFPE-FF sample pairs of the same tumors representing various cancer types, and two FFPE-FF sample pairs of breast cancer cell lines, were included. Total RNA was extracted and gene expression profiling was carried out using Illumina's Whole-Genome cDNA-mediated Annealing, Selection, extension and Ligation (WG-DASL V3 arrays, enabling the simultaneous detection of 24,526 mRNA transcripts. A sample exclusion criterion was created based on the expression of 11 stably expressed reference genes. Pearson correlation at the probe level was calculated for paired FFPE-FF, and three cut-off values were chosen. Spearman correlation coefficients between the matched FFPE and FF samples were calculated for three probe lists with varying levels of significance and compared to the correlation based on all measured probes. Unsupervised hierarchical cluster analysis was performed to verify performance of the included probe lists to compare matched FPPE-FF samples.Twenty-seven FFPE-FF pairs passed the sample exclusion criterion. From the profiles of 27 FFPE and FF matched samples, the best correlating probes were identified

  2. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  3. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  4. Procedures for the quantification of whole-tissue immunofluorescence images obtained at single-cell resolution during murine tubular organ development.

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Hirashima

    Full Text Available Whole-tissue quantification at single-cell resolution has become an inevitable approach for further quantitative understanding of morphogenesis in organ development. The feasibility of the approach has been dramatically increased by recent technological improvements in optical tissue clearing and microscopy. However, the series of procedures required for this approach to lead to successful whole-tissue quantification is far from developed. To provide the appropriate procedure, we here show tips for each critical step of the entire process, including fixation for immunofluorescence, optical clearing, and digital image processing, using developing murine internal organs such as epididymis, kidney, and lung as an example. Through comparison of fixative solutions and of clearing methods, we found optimal conditions to achieve clearer deep-tissue imaging of specific immunolabeled targets and explain what methods result in vivid volume imaging. In addition, we demonstrated that three-dimensional digital image processing after optical clearing produces objective quantitative data for the whole-tissue analysis, focusing on the spatial distribution of mitotic cells in the epididymal tubule. The procedure for the whole-tissue quantification shown in this article should contribute to systematic measurements of cellular processes in developing organs, accelerating the further understanding of morphogenesis at the single cell level.

  5. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    proved their influence by obstructing the creation of new ministries and regulatory commissions that would limit their powers. The heads of these business groups often outrank their counterparts in state administrative organs and bureaus that are supposed to regulate their activities. The increased role...... of these business leaders prompts the question of whether we are seeing the development of distinct interest groups that could challenge Party and state authority and create a fragmented polity. However, through the nomenklatura system the Party has an important instrument of control to wield over business groups....... Through this system the Party controls the appointment and promotion of the heads of the most important state-owned enterprises. The nomenklatura system also enables the Party to rotate leaders in big business from a position as CEO in one company to a similar position in another state-owned company...

  6. Frequência de mola hidatiforme em tecidos obtidos por curetagem uterina Frequency of hydatidiform mole in tissue obtained by curettage

    Directory of Open Access Journals (Sweden)

    Andressa Biscaro

    2012-06-01

    Full Text Available OBJETIVO: Determinar a frequência de mola hidatiforme em tecidos obtidos por curetagem uterina. MÉTODOS: Estudo transversal, prospectivo e descritivo que incluiu pacientes submetidas à curetagem uterina por diagnóstico de aborto ou mola hidatiforme cujo material obtido foi encaminhado para exame anatomopatológico. Foram excluídas aquelas que não aceitaram participar da pesquisa, recusando-se a assinar o Termo de Consentimento Informado Livre e Esclarecido. Foram analisadas as seguintes variáveis: achados anatomopatológicos, idade, raça/cor, número de gestações e abortos prévios, idade gestacional no momento do diagnóstico, níveis séricos quantitativos da fração beta da gonadotrofina coriônica humana e achados ultrassonográficos. As variáveis foram empregadas para a verificação com o diagnóstico histológico, considerado o padrão-ouro. Os dados foram armazenados e analisados no software Microsoft Excel® e no programa Epi-Info, versão 6.0 (STATCALC e os resultados apresentados como frequência (porcentagem ou média±desvio padrão. Para a associação entre variáveis qualitativas foi usado o teste do χ², e admitiu-se significância estatística quando pPURPOSE: To determine the frequency of hydatiform mole in tissues obtained by curettage. METHODS: A cross-sectional, prospective and descriptive conducted on patients who underwent curretage due to a diagnosis of abortion or hydatiform mole whose material was sent for pathological examination. We excluded women who did not accept to participate and refused to sign the free informed consent form. We studied the following variables: pathological findings, age, race, number of pregnancies and previous abortions, gestational age at diagnosis, quantitative serum beta fraction of human chorionic gonadotropin and ultrasound findings. The data were compared to the to histological diagnosis, considered to be the gold standard. Data were stored and analyzed in Microsoft Excel

  7. Vascular smooth muscle cells for use in vascular tissue engineering obtained by endothelial-to-mesenchymal transdifferentiation (EnMT) on collagen matrices

    NARCIS (Netherlands)

    Krenning, Guido; Moonen, Jan-Renier A. J.; van Luyn, Marja J. A.; Harmsen, Martin C.

    The discovery of the endothelial progenitor cell (EPC) has led to an intensive research effort into progenitor cell-based tissue engineering of (small-diameter) blood vessels. Herein, EPC are differentiated to vascular endothelial cells and serve as the inner lining of bioartificial vessels. As yet,

  8. The design and validation of a magnetic resonance imaging-compatible device for obtaining mechanical properties of plantar soft tissue via gated acquisition.

    Science.gov (United States)

    Williams, Evan D; Stebbins, Michael J; Cavanagh, Peter R; Haynor, David R; Chu, Baocheng; Fassbind, Michael J; Isvilanonda, Vara; Ledoux, William R

    2015-10-01

    Changes in the mechanical properties of the plantar soft tissue in people with diabetes may contribute to the formation of plantar ulcers. Such ulcers have been shown to be in the causal pathway for lower extremity amputation. The hydraulic plantar soft tissue reducer (HyPSTER) was designed to measure in vivo, rate-dependent plantar soft tissue compressive force and three-dimensional deformations to help understand, predict, and prevent ulcer formation. These patient-specific values can then be used in an inverse finite element analysis to determine tissue moduli, and subsequently used in a foot model to show regions of high stress under a wide variety of loading conditions. The HyPSTER uses an actuator to drive a magnetic resonance imaging-compatible hydraulic loading platform. Pressure and actuator position were synchronized with gated magnetic resonance imaging acquisition. Achievable loading rates were slower than those found in normal walking because of a water-hammer effect (pressure wave ringing) in the hydraulic system when the actuator direction was changed rapidly. The subsequent verification tests were, therefore, performed at 0.2 Hz. The unloaded displacement accuracy of the system was within 0.31%. Compliance, presumably in the system's plastic components, caused a displacement loss of 5.7 mm during a 20-mm actuator test at 1354 N. This was accounted for with a target to actual calibration curve. The positional accuracy of the HyPSTER during loaded displacement verification tests from 3 to 9 mm against a silicone backstop was 95.9% with a precision of 98.7%. The HyPSTER generated minimal artifact in the magnetic resonance imaging scanner. Careful analysis of the synchronization of the HyPSTER and the magnetic resonance imaging scanner was performed. With some limitations, the HyPSTER provided key functionality in measuring dynamic, patient-specific plantar soft tissue mechanical properties. © IMechE 2015.

  9. Pathology, Tissue Metalloproteinase Transcription and Haptoglobin Responses in Mice after Experimental Challenge with Different Isolates of Pasteurella multocida Obtained from Cases of Porcine Pneumonia

    DEFF Research Database (Denmark)

    Pors, S. E.; Chadfield, M. S.; Sørensen, D. B.

    2011-01-01

    Pasteurella multocida is a major cause of porcine pneumonia, but the pathogenesis of the disease is poorly defined. The aim of this study was to further understand the host response to infection by use of a mouse model of P. multocida pneumonia. Twenty female mice were divided into four groups (n=5......). Three groups were infected with one of three isolates of P. multocida isolated from clinical cases of chronic porcine pneumonia with necrotizing, suppurative and non-suppurative lesions, respectively. The fourth group served as uninfected controls. Mice were killed 24h postinfection and samples were...... collected for bacteriology, histopathology and in-situ hybridization for detection of P. multocida. Measurements of expression of genes encoding matrix metalloproteinase 9 (MMP9) and tissue inhibitor of metalloproteinase 1 (TIMP1) in lung tissue and quantification of serum haptoglobin concentration were...

  10. Ethical and technical considerations for the creation of cell lines in the head & neck and tissue harvesting for research and drug development (Part II: Ethical aspects of obtaining tissue specimens

    Directory of Open Access Journals (Sweden)

    Upile Tahwinder

    2009-04-01

    Full Text Available Abstract Background Although much has been published for the development of cell lines, these were lab based and developed for scientific technical staff. Objective of review We discuss the ethical implications of tissue retention and present a generic consent form (Part II. We also present a simple and successful protocol for the development of cell lines and tissue harvesting for the clinical scientist (Part I. Conclusion Consent is also more proximate and assurance can be given of appropriate usage. Ethical questions concerning tissue ownership are in many institutions raised during the current consenting procedure. We provide a robust ethical framework, based on the current legislation, which allows clinicians to be directly involved in cell and tissue harvesting.

  11. Biocomposite coatings based on Poly(3-hydroxybutyrate-co-3-hydroxyvalerate)/calcium phosphates obtained by MAPLE for bone tissue engineering

    Science.gov (United States)

    Raşoga, O.; Sima, L.; Chiriţoiu, M.; Popescu-Pelin, G.; Fufǎ, O.; Grumezescu, V.; Socol, M.; Stǎnculescu, A.; Zgurǎ, I.; Socol, G.

    2017-09-01

    The aim of our research was to synthesize and investigate the physico-chemical and biological features of composite coatings based on poly(3-hydroxybutyrate-co-hydroxyvalerate) (PHBV) and commercial calcium phosphates (CaPs), hydroxyapatite and β-tricalcium phosphate, obtained by means of matrix assisted pulsed laser evaporation (MAPLE) technique. In this respect, laser fluence and dropcast studies were performed for pristine polymer and PHBV-CaPs composites. The microstructure of the synthesized coatings was investigated by scanning electron microscopy, while for the chemical structure and functional integrity we performed Fourier transform infrared spectroscopy comparative analysis. By using the X-ray diffraction measurements we experimentally evaluated the crystalline nature of the obtained composite materials, while relevant data regarding the hydrophilic/hydrophobic behavior of the synthesized coatings were obtained by performing static CA measurements. The biocompatibility of PHBV/CaPs coatings was evaluated by performing cellular adhesion and differentiation in vitro assays on mesenchymal stem cells.

  12. Nutrients and contaminants in tissues of five fish species obtained from Shanghai markets: Risk–benefit evaluation from human health perspectives

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Jing-Jing [Key Laboratory of Geographic Information Science, Ministry of Education, School of Geographic Sciences, East China Normal University, 500 Dongchuan Road, Shanghai 200241 (China); Li, Huan; Liu, Jin-Pin [Laboratory of Aquaculture Nutrition and Environmental Health (LANEH), School of Life Sciences, East China Normal University, 200241 Shanghai (China); Yang, Yi, E-mail: yyang@geo.ecnu.edu.cn [Key Laboratory of Geographic Information Science, Ministry of Education, School of Geographic Sciences, East China Normal University, 500 Dongchuan Road, Shanghai 200241 (China); State Key Laboratory of Estuarine and Coastal Research, East China Normal University, 3663 Zhongshan North Road, Shanghai 200062 (China); Jin, Ze-Lin; Zhang, Yun-Ni; Zhang, Mei-Ling; Chen, Li-Qiao [Laboratory of Aquaculture Nutrition and Environmental Health (LANEH), School of Life Sciences, East China Normal University, 200241 Shanghai (China); Du, Zhen-Yu, E-mail: zydu@bio.ecnu.edu.cn [Laboratory of Aquaculture Nutrition and Environmental Health (LANEH), School of Life Sciences, East China Normal University, 200241 Shanghai (China)

    2015-12-01

    Shanghai is a Chinese megacity in the Yangtze River Delta area, one of the most polluted coastal areas in China. The inhabitants of Shanghai have very high aquatic product consumption rates. A risk–benefit assessment of the co-ingestion of fish nutrients and contaminants has not previously been performed for Shanghai residents. Samples of five farmed fish species (marine and freshwater) with different feeding habits were collected from Shanghai markets in winter and summer. Fatty acids, protein, mercury, cadmium, lead, copper, polychlorinated biphenyls, hexachlorocyclohexanes, and dichlorodiphenyltrichloroethanes were measured in liver, abdominal fat, and dorsal, abdominal, and tail muscles from fish. Tolerable daily intakes and benefit–risk quotients were calculated to allow the benefits and risks of co-ingesting n − 3 long-chain polyunsaturated fatty acids and contaminants to be assessed according to the cancer slope factors and reference doses of selected pollutants. All of the contaminant concentrations in the muscle tissues were much lower than the national maximum limits, but the livers generally contained high Hg concentrations, exceeding the regulatory limit. The organic pollutant and n − 3 long-chain polyunsaturated fatty acid concentrations correlated with the lipid contents of the fish tissues, and were higher in carnivorous marine fish than in omnivorous and herbivorous freshwater fish. The tolerable daily intakes, risk–benefit quotients, and current daily aquatic product intakes for residents of large Chinese cities indicated that the muscle tissues of most of the fish analyzed can be consumed regularly without significant contaminant-related risks to health. However, attention should be paid to the potential risks posed by dichlorodiphenyltrichloroethane in large yellow croaker and Hg in tilapia. Based on the results of this study, we encourage people to consume equal portions of marine and freshwater fish. - Highlights: • Shanghai coast

  13. Nutrients and contaminants in tissues of five fish species obtained from Shanghai markets: Risk–benefit evaluation from human health perspectives

    International Nuclear Information System (INIS)

    Geng, Jing-Jing; Li, Huan; Liu, Jin-Pin; Yang, Yi; Jin, Ze-Lin; Zhang, Yun-Ni; Zhang, Mei-Ling; Chen, Li-Qiao; Du, Zhen-Yu

    2015-01-01

    Shanghai is a Chinese megacity in the Yangtze River Delta area, one of the most polluted coastal areas in China. The inhabitants of Shanghai have very high aquatic product consumption rates. A risk–benefit assessment of the co-ingestion of fish nutrients and contaminants has not previously been performed for Shanghai residents. Samples of five farmed fish species (marine and freshwater) with different feeding habits were collected from Shanghai markets in winter and summer. Fatty acids, protein, mercury, cadmium, lead, copper, polychlorinated biphenyls, hexachlorocyclohexanes, and dichlorodiphenyltrichloroethanes were measured in liver, abdominal fat, and dorsal, abdominal, and tail muscles from fish. Tolerable daily intakes and benefit–risk quotients were calculated to allow the benefits and risks of co-ingesting n − 3 long-chain polyunsaturated fatty acids and contaminants to be assessed according to the cancer slope factors and reference doses of selected pollutants. All of the contaminant concentrations in the muscle tissues were much lower than the national maximum limits, but the livers generally contained high Hg concentrations, exceeding the regulatory limit. The organic pollutant and n − 3 long-chain polyunsaturated fatty acid concentrations correlated with the lipid contents of the fish tissues, and were higher in carnivorous marine fish than in omnivorous and herbivorous freshwater fish. The tolerable daily intakes, risk–benefit quotients, and current daily aquatic product intakes for residents of large Chinese cities indicated that the muscle tissues of most of the fish analyzed can be consumed regularly without significant contaminant-related risks to health. However, attention should be paid to the potential risks posed by dichlorodiphenyltrichloroethane in large yellow croaker and Hg in tilapia. Based on the results of this study, we encourage people to consume equal portions of marine and freshwater fish. - Highlights: • Shanghai coast

  14. Influence of the Laser Spot Size, Focal Beam Profile, and Tissue Type on the Lipid Signals Obtained by MALDI-MS Imaging in Oversampling Mode

    Science.gov (United States)

    Wiegelmann, Marcel; Dreisewerd, Klaus; Soltwisch, Jens

    2016-12-01

    To improve the lateral resolution in matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI) beyond the dimensions of the focal laser spot oversampling techniques are employed. However, few data are available on the effect of the laser spot size and its focal beam profile on the ion signals recorded in oversampling mode. To investigate these dependencies, we produced 2 times six spots with dimensions between 30 and 200 μm. By optional use of a fundamental beam shaper, square flat-top and Gaussian beam profiles were compared. MALDI-MSI data were collected using a fixed pixel size of 20 μm and both pixel-by-pixel and continuous raster oversampling modes on a QSTAR mass spectrometer. Coronal mouse brain sections coated with 2,5-dihydroxybenzoic acid matrix were used as primary test systems. Sizably higher phospholipid ion signals were produced with laser spots exceeding a dimension of 100 μm, although the same amount of material was essentially ablated from the 20 μm-wide oversampling pixel at all spot size settings. Only on white matter areas of the brain these effects were less apparent to absent. Scanning electron microscopy images showed that these findings can presumably be attributed to different matrix morphologies depending on tissue type. We propose that a transition in the material ejection mechanisms from a molecular desorption at large to ablation at smaller spot sizes and a concomitant reduction in ion yields may be responsible for the observed spot size effects. The combined results indicate a complex interplay between tissue type, matrix crystallization, and laser-derived desorption/ablation and finally analyte ionization.

  15. Comparação entre fragmentos obtidos com agulhas de calibres 14 e 12 em "core biopsy" estereotáxica de lesões mamárias impalpáveis: diferenças entre o tamanho dos fragmentos e freqüência dos tipos de lesões diagnosticadas Comparison between the fragments obtained by stereotactic core biopsy of nonpalpable breast lesions using 14- and 12-gauge needles: differences on the length of the fragments obtained and on the frequency of the types of diagnosed lesions

    Directory of Open Access Journals (Sweden)

    Maria do Carmo Abreu-e-Lima

    2001-10-01

    Full Text Available Com o objetivo de avaliar o desempenho das agulhas de calibres 14 e 12 na obtenção de "core biopsies" da mama sob controle estereotáxico, os autores compararam biópsias de lesões mamárias impalpáveis obtidas com agulhas desses calibres quanto ao tamanho dos fragmentos e freqüência dos tipos de lesões diagnosticadas. De um total de 1.009 biópsias, os autores analisaram 900 obtidas por agulhas 14 e 109 obtidas por agulhas 12, para análise da freqüência das lesões. Os tamanhos dos fragmentos foram analisados nos 700 primeiros casos para os espécimes obtidos por agulhas 14. A utilização de agulhas 12 resultou em maior tamanho dos fragmentos (p The purpose of this study was to compare the performance of 14- and 12-gauge needles for obtaining biopsy specimens under stereotactic guidance. The authors compared the biopsies of nonpalpable breast lesions using these different size needles, regarding the length of the fragments obtained and the types of diagnosed lesions. A total of 1,009 samples were obtained using 14-gauge (900 samples and 12-gauge (109 samples needles. The size of the samples was evaluated on the first 700 consecutive biopsies using 14-gauge needles. The use of 12-gauge needles consistently provided larger size specimens than 14-gauge needles (p < 0.001; a reduction in the prevalence of benign nonneoplastic lesions (p = 0.03 and a higher frequency of in situ and invasive carcinomas (p < 0.001 were also observed. These findings may suggest a higher diagnostic accuracy of biopsies performed with 12-gauge needles due to the larger samples obtained and/or due to a better radiological selection of those lesions, which were detected by digital mammography and biopsied under digital stereotactic guidance.

  16. Early evaluation and on field conditions of resistance to Mycosphaerella fijiensis Morelet of plants from Grande naine (AAA cultivar, obtained through out tissue culture and mutations induction

    Directory of Open Access Journals (Sweden)

    Lourdes R. García

    2003-04-01

    Full Text Available The present work was carried out in the Plants Biotechnology Institute of the Central University of Las Villas. The plant material from the cv. Grande Naine (AAA was treated with physical mutagenic agents(gamma radiation 60Co source to induce genetic variability. The behaviour of the population to the black Sigatoka was evaluated. A somaclone was selected by its disease resistance and was in vitro multiplied and the plants were acclimatized to evaluate its behaviour facing the disease on greenhouse conditions and in a second cycle of multiplication in the field. The results showed that in the majority of the plants were not found differences respect cv Grande Naine, just one presented similar reaction to cv. ‘FHIA 18’ (AAAB (partially resistant as for the variable evaluated, being obtained a frequency of 0.018% for this character. This plant was named IBP 446. After 60 days of application of the mycelial homogenized of M. fijiensis in micropropagated plants of this somaclone, differences in the respect affectation states were found at susceptible witness in greenhouse conditions. When plants of the IBP 446 were evaluated in a second cycle of multiplication differences were found with the susceptible control only at flowering, while they behaved similar at susceptible control in the crop. Key words: early detection, breeding, mutation, Black Sigatoka

  17. Plant DNA detection from grasshopper guts: A step-by-step protocol, from tissue preparation to obtaining plant DNA sequences1

    Science.gov (United States)

    Avanesyan, Alina

    2014-01-01

    • Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. • Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA) gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. • Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions. PMID:25202604

  18. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  19. Impact failure and fragmentation properties of metals

    Energy Technology Data Exchange (ETDEWEB)

    Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

    1998-03-01

    In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  20. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  1. Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

    Science.gov (United States)

    Lirman

    2000-08-23

    Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

  2. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  3. Obtención y criopreservación de células madre del tejido graso mediante liposucción Collecting and criopreservation of stem cells obtained by liposuction from fat tissue

    Directory of Open Access Journals (Sweden)

    J. Planas Ribo

    2011-12-01

    de una mezcla enriquecida de células madre adultas de tejido graso aspirado. Dicho método permite a todas aquellas personas que no hayan tenido la oportunidad de almacenar su cordón umbilical al nacer, almacenar MSCs obtenidas de la grasa de liposucción. La criopreservación conservará las células durante años que, en el momento de ser requeridas por el paciente, se descongelarán, pudiéndose recuperar alrededor del 80% de las mismas.There are different techniques to obtain embryonic stem cells directly through cryopreserved embryos in liquid nitrogen (-196ºC, individual blastomers, ovocyte activation by nuclear transfer and stem cells from amniotic fluid, among others. It is also possible to obtain hematopoietic adult stem cells and those from the bone marrow, better well-known and used in clinics for a long time; besides, from the blood of umbilical cord in newborns and body fat in adults. The autologous fat extracted from the body using liposuction, is sometimes reused to inject or infiltrate other body and facial areas as a filling material, but in most of the cases, it is thrown away. Sometimes it´s necessary to perform several surgical operations; therefore, it would be very useful to count on a bank of personalized adipose tissue. There are different studies that demonstrate that adipose tissue obtained through conventional liposuction can be preserved and stored successfully at a low temperature (-85 ºC in a tissue bank for a future use. Mesenchymal stem cells (MSCs are those with a high capacity of proliferation and differentiation with a high therapeutic value. Fat tissue is an important reservoir of MSCs, able to be differentiated in osseous, cartilaginous, muscular, etc. tissues. Therefore, if we reserve a small amount of fat tissue obtained through liposuction, we can get the enough amount and preserve the MSCs with the best method of cryopreservation. In 2007 we carried out a study of the fat obtained though liposuction in 36 patients, in

  4. Washout of 82Rb as a marker of impaired tissue integrity, obtained by list-mode cardiac PET/CT: relationship with perfusion/metabolism patterns of myocardial viability

    International Nuclear Information System (INIS)

    Chien, David T.; Bravo, Paco; Higuchi, Takahiro; Merrill, Jennifer; Bengel, Frank M.

    2011-01-01

    Myocardial washout of the potassium analogue 82 Rb may indicate tissue impairment. Few studies have evaluated its usefulness for viability assessment, and controversial results were reported. We revisited this topic using list-mode positron emission tomography (PET)/CT. A total of 22 patients with chronic ischemic cardiomyopathy (ICM) and 11 control subjects with normal CT coronary angiogram were studied. Rest 82 Rb PET/CT studies were acquired in list mode and resampled to static, gated, and dynamic images. Using a 17-segment model, 82 Rb washout was determined by monoexponential fitting of myocardial time-activity curves. In ICM patients, 18 F-fluorodeoxyglucose (FDG) studies were obtained in the same session and segments were classified as normally perfused, mismatch, or matched defect. 82 Rb washout was minimal and homogeneous in control subjects. Normally perfused segments of ICM did not differ (p = 0.33). ICM patients had a left ventricular ejection fraction (LVEF) of 25 ± 12%, 25/353 mismatched, and 46/353 matched defect segments. 82 Rb washout was higher in hypoperfused vs normal segments (p 82 Rb washout correlated inversely with 82 Rb uptake (r = -0.70; p 82 Rb washout does not distinguish between perfusion/metabolism patterns of hibernating myocardium and scar. Tissue integrity may be at least partially impaired in hibernation. (orig.)

  5. Glycomics expression analysis of sulfated glycosaminoglycans of human colorectal cancer tissues and non-neoplastic mucosa by electrospray ionization mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Marolla, Ana Paula Cleto [Universidade Federal de São Paulo, São Paulo, SP (Brazil); Waisberg, Jaques [Hospital do Servidor Público Estadual, São Paulo, SP (Brazil); Faculdade de Medicina do ABC, Santo André, SP (Brazil); Saba, Gabriela Tognini [Faculdade de Medicina do ABC, Santo André, SP (Brazil); Waisberg, Daniel Reis [Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva [Faculdade de Medicina do ABC, Santo André, SP (Brazil)

    2015-07-01

    To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student’s t test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues.

  6. Glycomics expression analysis of sulfated glycosaminoglycans of human colorectal cancer tissues and non-neoplastic mucosa by electrospray ionization mass spectrometry.

    Science.gov (United States)

    Marolla, Ana Paula Cleto; Waisberg, Jaques; Saba, Gabriela Tognini; Waisberg, Daniel Reis; Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva

    2015-01-01

    To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student'st test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues.

  7. The VERDI fission fragment spectrometer

    International Nuclear Information System (INIS)

    Fregeau, M. O.; Brys, T.; Gamboni, T.; Geerts, W.; Oberstedt, S.; Oberstedt, A.; Borcea, R.

    2013-01-01

    The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF) technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD) diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD) show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution. (authors)

  8. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  9. Gluon fragmentation into 3 PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1995-01-01

    The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

  10. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  11. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  12. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  13. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    , edited and performed by the storyteller in an ongoing process allowing tensions, discontinuities and editing between failures and achievements, between dreams and work realities and between home and work life. We argue that by including different types of fragmentation, we offer a new type......Following a strand of narrative studies pointing to the living conditions of storytelling and the micro-level implications of working within fragmented narrative perspectives, this article contributes to narrative research on work stories by focusing on how meaning is created from fragmented...... stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  14. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  15. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  16. Quark fragmentation into 3PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1996-01-01

    The functions of parton fragmentation into 3 P J quarkonium at order α 2 s are calculated, where the parton can be a heavy or a light quark. The obtained functions explicitly satisfy the Altarelli-Parisi equation and they are divergent, behaving as z -1 near z = O. However, if one choses the renormalization scale as twice of the heavy quark mass, the fragmentation functions are regular over the whole range of z. 15 refs., 2 figs

  17. Washout of {sup 82}Rb as a marker of impaired tissue integrity, obtained by list-mode cardiac PET/CT: relationship with perfusion/metabolism patterns of myocardial viability

    Energy Technology Data Exchange (ETDEWEB)

    Chien, David T.; Bravo, Paco; Higuchi, Takahiro; Merrill, Jennifer [Johns Hopkins University School of Medicine, Division of Nuclear Medicine, Russell H Morgan Department of Radiology, Baltimore, MD (United States); Bengel, Frank M. [Johns Hopkins University School of Medicine, Division of Nuclear Medicine, Russell H Morgan Department of Radiology, Baltimore, MD (United States); Hannover Medical School, Department of Nuclear Medicine, Hannover (Germany)

    2011-08-15

    Myocardial washout of the potassium analogue {sup 82}Rb may indicate tissue impairment. Few studies have evaluated its usefulness for viability assessment, and controversial results were reported. We revisited this topic using list-mode positron emission tomography (PET)/CT. A total of 22 patients with chronic ischemic cardiomyopathy (ICM) and 11 control subjects with normal CT coronary angiogram were studied. Rest {sup 82}Rb PET/CT studies were acquired in list mode and resampled to static, gated, and dynamic images. Using a 17-segment model, {sup 82}Rb washout was determined by monoexponential fitting of myocardial time-activity curves. In ICM patients, {sup 18}F-fluorodeoxyglucose (FDG) studies were obtained in the same session and segments were classified as normally perfused, mismatch, or matched defect. {sup 82}Rb washout was minimal and homogeneous in control subjects. Normally perfused segments of ICM did not differ (p = 0.33). ICM patients had a left ventricular ejection fraction (LVEF) of 25 {+-} 12%, 25/353 mismatched, and 46/353 matched defect segments. {sup 82}Rb washout was higher in hypoperfused vs normal segments (p < 0.05), but not different between mismatch and matched defect (p = 0.18). Intraindividual analysis in nine patients showing both FDG mismatch and matched defect confirmed absence of differences. Overall, segmental {sup 82}Rb washout correlated inversely with {sup 82}Rb uptake (r = -0.70; p < 0.05) and less well with FDG uptake (r = -0.31; p < 0.05). Using state-of-the-art PET/CT technology for myocardial viability assessment, {sup 82}Rb washout does not distinguish between perfusion/metabolism patterns of hibernating myocardium and scar. Tissue integrity may be at least partially impaired in hibernation. (orig.)

  18. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  19. Dual Fragment Impact of PBX Charges

    Science.gov (United States)

    Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

    2017-06-01

    Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

  20. Fragmentation in Carbon Therapy Beams

    CERN Document Server

    Charara, Y M

    2010-01-01

    The state of the art Monte Carlo code HETC-HEDS was used to simulate spallation products, secondary neutron, and secondary proton production in A-150 Tissue Equivalent Plastic phantoms to investigate fragmentation of carbon therapy beams. For a 356 MeV/Nucleon carbon ion beam, production of charged particles heavier than protons was 0.24 spallation products per incident carbon ion with atomic numbers ranging from 1 through 5 (hydrogen to boron). In addition, there were 4.73 neutrons and 2.95 protons produced per incident carbon ion. Furthermore, as the incident energy increases, the neutron production rate increases at a rate of 20% per 10 MeV/nucleon. Secondary protons were created at a rate between 2.62-2.87 per carbon ion, while spallation products were created at a rate between 0.20-0.24 per carbon ion.

  1. Fragmentation of kidney stones

    International Nuclear Information System (INIS)

    Kovacs, K.; Kun, F.; Vertse, T.

    2005-01-01

    Complete text of publication follows. Fragmentation, i.e. the breaking of particulate materials into smaller pieces is abundant in nature and underlies several industrial processes, which attracted a continuous interest in scientific and engineering research over the past decades. In industrial applications, fragmentation processes are mostly used for the comminution of ores in various types of mills. Kidney stone is a well known human dis- ease which embitters the life of many people (in a country like the USA about 10 6 cases are registered yearly). In order to extract large kidney stones (diameter ≥ 1 cm) from the human body without operation, one of the most efficient treatment is the fragmentation of kidney stones by the so-called extracorporal shock wave lithography method: a shock wave penetrating the human body is generated by an electric pulse. The repeated application of the shock wave gradually fragments the stones into pieces of size ≤ 2 mm which then leave the body through the urine system. Recently, a novel type of lithographic method has been suggested by using widely focused shock waves which fragment the stones by a squeezing mechanism. Laboratory experiments showed that the widely focused squeezing waves achieve a higher fragmentation efficiency than the frequently used shock waves of sharp focus. Based on this method a novel medical treatment can be introduced which is less demanding for the patients. Before the application of the method in the clinical practice a detailed understanding of the fragmentation mechanism of kidney stones due to shock waves is required. Since analytic theoretical methods have serious limitations in this field, we develop a realistic model of the mechanical behavior of kidney stones and a simulation code which makes possible to study the mechanism of breakup under various external conditions. Computer simulations in two dimensions have revealed a peculiar way of crack formation, i.e. the crack which finally breaks

  2. Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

    Science.gov (United States)

    Singh, Pardeep; Kaur, Harjeet

    2016-11-01

    The fission-fragment mass distribution is analysed for the 208Pb(18O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schrödinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process.

  3. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  4. Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

    Science.gov (United States)

    Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

    2017-02-01

    A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  6. Picking Up (On) Fragments

    NARCIS (Netherlands)

    Ellis, Phil

    2015-01-01

    abstractThis article discusses the implications for archival and media archaeological research and reenactment artwork relating to a recent arts practice project: reenacttv: 30 lines / 60 seconds. It proposes that archival material is unstable but has traces and fragments that are full of creative

  7. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...

  8. Wildlife habitat fragmentation.

    Science.gov (United States)

    John. Lehmkuhl

    2005-01-01

    A primary issue in forest wildlife management is habitat fragmentation and its effects on viability, which is the "bottom line" for plant and animal species of conservation concern. Population viability is the likelihood that a population will be able to maintain itself (remain viable) over a long period of time-usually 100 years or more. Though it is true...

  9. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  10. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Some delicate nerves and fibres in the surrounding areas of the stones present in the kidney are also damaged by high ultrasonic intensity used in such systems. In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavitation bubbles are found to implode faster, with more ...

  11. Subcloning of DNA fragments.

    Science.gov (United States)

    Struhl, K

    2001-05-01

    The essence of recombinant DNA technology is the joining of two or more separate segments of DNA to generate a single DNA molecule that is capable of autonomous replication in a given host. The simplest constructions of hybrid DNA molecules involve the cloning of insert sequences into plasmid or bacteriophage cloning vectors. The insert sequences can derive from essentially any organism, and they may be isolated directly from the genome, from mRNA, or from previously cloned DNA segments (in which case, the procedure is termed subcloning). Alternatively, insert DNAs can be created directly by DNA synthesis. This unit provides protocols for the subcloning of DNA fragments and ligation of DNA fragments in gels.

  12. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    , it was the central government’s task to coordinate, steer and control the newly emerged decentralized organizations. This raises questions about the overall design of the public sector at present. Our paper engages with the prevalent public governance phenomenon of fragmentation from a design perspective in order......Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  13. Heavy Flavor Fragmentation and Decay at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, Richard M

    1999-02-24

    Results on heavy quark fragmentation obtained using the SLD detector at the SLAC Linear Collider are presented. This talk will cover the ratio of vector to pseudoscalar charmed meson production, the inclusive B hadron energy distribution, the inclusive particle production in heavy jets compared to their production in light jets, and charged and neutral B meson lifetimes.

  14. Brownian shape motion: Fission fragment mass distributions

    Directory of Open Access Journals (Sweden)

    Sierk Arnold J.

    2012-02-01

    Full Text Available It was recently shown that remarkably accurate fission-fragment mass distributions can be obtained by treating the nuclear shape evolution as a Brownian walk on previously calculated five-dimensional potential-energy surfaces; the current status of this novel method is described here.

  15. Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

    Science.gov (United States)

    Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

    2017-12-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

  16. SCALING AND 4-QUARK FRAGMENTATION

    NARCIS (Netherlands)

    SCHOLTEN, O; BOSVELD, GD

    1991-01-01

    The conditions for a scaling behaviour from the fragmentation process leading to slow protons are discussed- The scaling referred to implies that the fragmentation functions depend on the light-cone momentum fraction only. It is shown that differences in the fragmentation functions for valence- and

  17. Fresh muscle fiber fragments on a scaffold in rats-a new concept in urogynecology?

    DEFF Research Database (Denmark)

    Boennelycke, Marie; Christensen, Lise; Nielsen, Lene F

    2011-01-01

    To investigate if a synthetic, biodegradable scaffold with either autologous in vitro cultured muscle-derived cells or autologous fresh muscle fiber fragments could be used for tissue repair.......To investigate if a synthetic, biodegradable scaffold with either autologous in vitro cultured muscle-derived cells or autologous fresh muscle fiber fragments could be used for tissue repair....

  18. Fission fragment mass distributions via prompt γ-ray spectroscopy

    Indian Academy of Sciences (India)

    fragment mass distributions, generally obtained via conventional methods (i.e., by measuring the energy and/or the velocity of the correlated fission fragments) are limited to a mass resolution of 4–. 5 units. On the other hand, by employing the γ-ray spectroscopy, it is possible to estimate the yield of individual fission ...

  19. Fractal Fragmentation triggered by meteor impact: The Ries Crater (Germany)

    Science.gov (United States)

    Paredes Marino, Joali; Perugini, Diego; Rossi, Stefano; Kueppers, Ulrich

    2015-04-01

    FRACTAL FRAGMENTATION TRIGGERED BY METEOR IMPACT: THE RIES CRATER (GERMANY) Joali Paredes (1), Stefano Rossi (1), Diego Perugini (1), Ulrich Kueppers (2) 1. Department of Physics and Geology, University of Perugia, Italy 2. Department of Earth and Environmental Sciences, University of Munich, Germany The Nördlinger Ries is a large circular depression in western Bavaria, Germany. The depression was caused by a meteor impact, which occurred about 14.3 million-14.5 million years ago. The original crater rim had an estimated diameter of 24 kilometers. Computer modeling of the impact event indicates that the impact or probably had diameters of about 1.5 kilometers and impacted the target area at an angle around 30 to 50 degrees from the surface in a west- southwest to east-northeast direction. The impact velocity is thought to have been about 20 km/s. The meteor impact generated extensive fragmentation of preexisting rocks. In addition, melting of these rocks also occurred. The impact melt was ejected at high speed provoking its extensive fragmentation. Quenched melt fragments are ubiquitous in the outcrops. Here we study melt fragment size distributions with the aim of understanding the style of melt fragmentation during ejection and to constrain the rheological properties of such melts. Digital images of suevite (i.e. the rock generated after deposition and diagenesis of ash and fragments produced by the meteor impact) were obtained using a high-resolution optical scanner. Successively, melt fragments were traced by image analysis and the images segmented in order to obtain binary images on which impact melt fragments are in black color, embedded on a white background. Hence, the size of fragments was determined by image analysis. Fractal fragmentation theory has been applied to fragment size distributions of melt fragments in the Ries crater. Results indicate that melt fragments follow fractal distributions indicating that fragmentation of melt generated by the

  20. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  1. Generic behaviours in impact fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Sator, N.; Mechkov, S.; Sausset, F. [Paris-6 Univ. Pierre et Marie Curie, Lab. de Physique Theorique de la Matiere Condensee, UMR CNRS 7600, 75 - Paris (France); Mechkov, S. [Ecole Normale Superieure, Lab. de Physique Statistique, 75 - Paris (France)

    2008-02-15

    From atomic nuclei to supernovae, including plates and rocks, every cohesive system can be broken into fragments, provided that the deposited energy is sufficiently large compared to its cohesive energy. We present a simple numerical model for investigating the general properties of fragmentation. By use of molecular dynamics simulations, we study the impact fragmentation of a solid disk of interacting particles with a wall. Regardless of the particular form of the interaction potential, the fragment size distribution exhibits a power law behaviour with an exponent that increases logarithmically with the energy deposited in the system, in agreement with experiments. We expect this behaviour to be generic in fragmentation phenomena. (authors)

  2. Glioma spheroids obtained via ultrasonic aspiration are viable and express stem cell markers

    DEFF Research Database (Denmark)

    Jensen, Stine Skov; Aaberg-Jessen, Charlotte; Andersen, Claus

    2013-01-01

    Ultrasonic aspirators allow safe, rapid, and accurate removal of brain tumors. However, the tissue fragments removed are used surprisingly little in research.......Ultrasonic aspirators allow safe, rapid, and accurate removal of brain tumors. However, the tissue fragments removed are used surprisingly little in research....

  3. Intermediate mass fragments emission in binary fragmentation model

    International Nuclear Information System (INIS)

    Bhattacharya, C.; Bhattacharya, S.

    1991-01-01

    Intermediate mass fragments emission in intermediate-energy nucleus-nucleus collisions has been studied in the framework of a generalized model where the fragments are assumed to be emitted from binary fissionlike decay of the fully equilibrated compound nucleus. The present formulation, with a schematic exit channel shape configuration and simple rotating liquid-drop nuclear potential, has been found to explain most of the intermediate mass fragments emission cross sections reasonably well without incorporating any free parameters in the calculation

  4. Postoperative Airway Obstruction by a Bone Fragment

    Directory of Open Access Journals (Sweden)

    Patrick Schober

    2017-01-01

    Full Text Available Postoperative airway obstructions are potentially life-threatening complications. These obstructions may be classified as functional (sagging tongue, laryngospasm, or bronchospasm, pathoanatomical (airway swelling or hematoma within the airways, or foreign body-related. Various cases of airway obstruction by foreign bodies have previously been reported, for example, by broken teeth or damaged airway instruments. Here we present the exceptional case of a postoperative airway obstruction due to a large fragment of the patient’s maxillary bone, left accidentally in situ after transoral surgical tumor resection. Concerning this type of airway obstruction, we discuss possible causes, diagnosis, and treatment options. Although it is an exceptional case after surgery, clinicians should be aware of this potentially life-threatening complication. In summary, this case demonstrates that the differential diagnosis of postoperative airway obstructions should include foreign bodies derived from surgery, including tissue and bone fragments.

  5. Gastric Perforation by Ingested Rabbit Bone Fragment

    Directory of Open Access Journals (Sweden)

    Giulio Gambaracci

    2016-04-01

    Full Text Available The majority of accidentally ingested foreign bodies is excreted from the gastrointestinal (GI tract without any complications. Sometimes sharp foreign bodies – like chicken and fish bones – can lead to intestinal perforation and may present insidiously with a wide range of symptoms and, consequently, different diagnoses. We report the case of a 59-year-old woman presenting with fever and a 1-month history of vague abdominal pain. Computed tomography (CT showed the presence of a hyperdense linear image close to the gastric antrum surrounded by a fluid collection and free peritoneal air. At laparotomy, a 4-cm rabbit bone fragment covered in inflamed tissue was detected next to a gastric wall perforation. Rabbit bone fragment ingestion, even if rarely reported, should not be underestimated as a possible cause of GI tract perforation.

  6. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  7. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    International Nuclear Information System (INIS)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

    2013-01-01

    We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  8. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  9. Study of drip line nuclei through two-step fragmentation

    International Nuclear Information System (INIS)

    Stanoiu, M.; Becker, F.; Lewitowicz, M.; Azaiez, F.; Bourgeois, C.; Ibrahim, F.; Belleguic, M.; Borcea, C.; Mrazek, J.; Brown, B.A.; Dlouhy, Z.; Dombradi, Z.; Fueloep, Z.; Krasznahorkay, A.; Grawe, H.; Mayet, P.; Grevy, S.; Kerek, A.; Marel, H. van der; Lukyanov, S.; Mandal, S.; Guillemaud-Mueller, D.; Negoita, F.; Penionzhkevich, Y.E.; Podolyak, Z.; Roussel-Chomaz, P.; Saint Laurent, M.G.; Savajols, H.; Sorlin, O.; Sletten, G.; Sohler, D.; Timar, J.; Timis, C.; Yamamoto, A.

    2004-01-01

    We have studied the structure of light neutron-rich nuclei around N = 16 by employing the in-beam γ-ray spectroscopy technique using the fragmentation of secondary beams of 25,26 Ne, 27,28 Na and 29,30 Mg isotopes. This secondary-beam ''cocktail'' was obtained by the fragmentation of a 36 S beam at 77.5 MeV.A by the SISSI/GANIL facility. By a second-step fragmentation, we have measured γ-ray-residue coincidences in 17-20 C and 23,24 O and described the obtained levels in the framework of the shell model. (orig.)

  10. 4-Aminobiphenyl (4-ABP) - DNA Damage in Breast Tissue and Relationship to p53 Mutations and Polymorphisms of Metabolizing Genes

    National Research Council Canada - National Science Library

    Niguidula, Nancy

    2000-01-01

    .... The analysis of the CYP1A2 gene is currently in progress. Due to the difficulty in obtaining large fragments of DNA from the tumor tissue sections required for PCR-RFLP, a new method is under development for genotyping NAT2...

  11. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab......Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar...... and by variables having program fragments as values. Basic operations such as valuetransfer, composition and decomposition are defined for program fragments allowing more complicated operations to be implemented. Usual operations such as testing for equality are defined, and in addition more specialized operations...... such as testing that a program fragment is derivable from another and converting program fragments in concrete form to abstract form are defined. By introducing regular expressions in the grammar these may be used in program fragments in concrete form. By defining constructors for regular expressions these may...

  12. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  13. Internal structure and fragmentation kinetics of silica granules

    Science.gov (United States)

    Grosseau, P.; Dumas, T.; Bonnefoy, O.; Barriquand, L.; Guy, L.; Thomas, G.

    2013-06-01

    To improve the mechanical properties of tires, silica granules can be incorporated into the elastomer as well as carbon black. Ideally, the fragmentation of the granules in the elastomer must be obtained with low mechanical stresses and lead to very small fragments distributed homogeneously in the material. On the other hand, granules must present a sufficient cohesion, in order to avoid the generation of fine particles during handling operations. Thus it appears necessary to control the mechanical strength of granules and the mechanism of their fragmentation. In this experimental study, we investigated the fragmentation of silica granules of 250 microns produced by spray drying. For this, we characterized by granulometry the evolution of the Particle Size Distribution of silica powder in water. The granules were suspended in water and submitted to ultrasounds. This treatment is used to create the fragmentation that occurs by viscous shearing in industrial rubber processing. A core-shell structure, characteristic of granules obtained by atomization process, was observed by SEM. Furthermore, by varying the intensity of mechanical stress, the multi-scale structure of granules was evidenced as well as the existence of different regimes of fragmentation. The kinetics of fragmentation was experimentally followed on two grades of silica that showed significant differences in their behavior during the fragmentation process.

  14. Critical Features of Fragment Libraries for Protein Structure Prediction

    Science.gov (United States)

    dos Santos, Karina Baptista

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction. PMID:28085928

  15. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Directory of Open Access Journals (Sweden)

    Raphael Trevizani

    Full Text Available The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  16. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Science.gov (United States)

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  17. DNA from keratinous tissue

    DEFF Research Database (Denmark)

    Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted

    2011-01-01

    Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...

  18. Obtaining of inulin acetate

    OpenAIRE

    Khusenov, Arslonnazar; Rakhmanberdiev, Gappar; Rakhimov, Dilshod; Khalikov, Muzaffar

    2014-01-01

    In the article first obtained inulin ester inulin acetate, by etherification of inulin with acetic anhydride has been exposed. Obtained product has been studied using elementary analysis and IR spectroscopy.

  19. Management of small fragment wounds in war: current research.

    Science.gov (United States)

    Bowyer, G W; Cooper, G J; Rice, P

    1995-03-01

    The majority of war wounds are caused by antipersonnel fragments from munitions such as mortars and bomblets. Modern munitions aim to incapacitate soldiers with multiple wounds from very small fragments of low available kinetic energy. Many of these fragments may be stopped by helmets and body armour and this has led to a predominance of multiple wounds to limbs in those casualties requiring surgery. The development of an appropriate management strategy for these multiple wounds requires knowledge of the contamination and extent of soft tissue injury; conservative management may be appropriate. The extent of skin and muscle damage associated with a small fragment wound, the way in which these wounds may progress without intervention and their colonisation by bacteria has been determined in an experimental animal model. Results from 12 animals are presented. There was a very small (approximately 1 mm) margin of nonviable skin around the entrance wound. The amount of devitalised muscle in the wound tract was a few hundred milligrams. Some muscles peripheral to the wound track also showed signs of damage 1 h after wounding, but this improved over 24 h; the proportion of fragmented muscle fibres in the tissue around the track decreased as time went on. There was no clinical sign or bacteriological evidence of the track becoming infected up to 24 h after wounding. This preliminary work suggests that, in the absence of infection, the amount of muscle damage caused by small fragment wounds begins to resolve in the first 24 h after injury, even without surgical intervention.

  20. Polymer fragmentation in extensional flow

    International Nuclear Information System (INIS)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-01-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments

  1. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  2. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  3. Identification of pro-opiomelanocortin and secretion of its peptide fragments in bovine adrenals

    Energy Technology Data Exchange (ETDEWEB)

    Tennov, A.V.; Dmitriev, A.D.; Kizim, E.A.; Ustinova, E.E.

    1986-01-01

    This paper describes the results of an investigation to show that biosynthesis of POMC, its proteolytic processing, an secretion of the peptide products of that processing take place in the bovine adrenals. Rabbit antisera against endorphins were obtained and used for radioimmunoassay of peptides. I 125-labeled peptides were obtained by the chloramine method and purified from free I 125 on Sephadex G-10 (0.7 x 5 cm, centrifugation for 10 min at 1500 g). To detect secretion of peptide fragments of POMC in the adrenals experiments were undertaken to determine the beta-endorphin content in perfusates obtained during retrograde perfusion of the bovine adrenals. It was found that immunoreactive compounds, indistinguishable in their immunochemical properties from beta-endorphin, are present in the perfusates, just as in the tissue extracts.

  4. Yields of correlated fragment pairs and neutron multiplicity in spontaneous fission of {sup 242}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Veselsky, M.; Kliman, J.; Morhaccaron, M. [Institute of Physics of Slovak Academy of Sciences, Dubravska 9, 84228 Bratislava (Slovakia); Ramayya, A.V.; Kormicki, J.; Daniel, A.V. [Physics Department, Vanderbilt University, Nashville (United States)] Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley (United States)] Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore (United States); Daniel, A.V.; Popeko, G.S.; Oganessian, Yu. Ts. [Joint Institute for Nuclear Research, Dubna (Russia)] Greiner, W. [Institut fur Theoretische Physik, J. W. Goethe Universitaet, Frankfurt a. M. (Germany); Aryaeinejad, R. [Idaho National Engineering Laboratory, Idaho Falls (United States)

    1998-10-01

    Yields of correlated fragment pairs were obtained in spontaneous fission of {sup 242}Pu. Charge, mass and neutron multiplicity distributions of fragment pairs were determined and compared to available data. The yield of cold fission without neutron emission was determined to about 10{percent} for the set of observed correlated fragment pairs. {copyright} {ital 1998 American Institute of Physics.}

  5. Tissue Classification

    DEFF Research Database (Denmark)

    Van Leemput, Koen; Puonti, Oula

    2015-01-01

    Computational methods for automatically segmenting magnetic resonance images of the brain have seen tremendous advances in recent years. So-called tissue classification techniques, aimed at extracting the three main brain tissue classes (white matter, gray matter, and cerebrospinal fluid), are now...... well established. In their simplest form, these methods classify voxels independently based on their intensity alone, although much more sophisticated models are typically used in practice. This article aims to give an overview of often-used computational techniques for brain tissue classification....... Although other methods exist, we concentrate on Bayesian modeling approaches, in which generative image models are constructed and subsequently ‘inverted’ to obtain automated segmentations. This general framework encompasses a large number of segmentation methods, including those implemented in widely used...

  6. Fission fragments transport by gaseous flow with aerosols

    CERN Document Server

    Gangrskij, Y P; Zhemenik, V I; Myshinskij, G V; Penionzhkevich, Yu E; Selesh, O

    2002-01-01

    Paper describes a pilot facility for fission fragment transport by gaseous flow with aerosols. This facility designed for fragment transport consists of a reaction chamber with irradiated target, receipt chamber to collect fragments, aerosol generator, roughing pump to pump put gas and a capillary connecting these units of facility. Paper presents the results of facility testing with fragments of sup 2 sup 3 sup 8 U photofission by microtron Bremsstrahlung. The obtained parameters of facility (up to 70% efficiency of transport, up to 0.1 s time of transport at 1 m distance) enable to use it efficiently in experiments dealing with heavy nuclei fission and with investigation in properties of fission fragments

  7. A sampling approach for protein backbone fragment conformations.

    Science.gov (United States)

    Yu, J Y; Zhang, W

    2013-01-01

    In protein structure prediction, backbone fragment bias information can narrow down the conformational space of the whole polypeptide chain significantly. Unlike existing methods that use fragments as building blocks, the paper presents a probabilistic sampling approach for protein backbone torsion angles by modelling angular correlation of (phi, psi) with a directional statistics distribution. Given a protein sequence and secondary structure information, this method samples backbone fragments conformations by using a backtrack sampling algorithm for the hidden Markov model with multiple inputs and a single output. The proposed approach is applied to a fragment library, and some well-known structural motifs are sampled very well on the optimal path. Computational results show that the method can help to obtain native-like backbone fragments conformations.

  8. Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator

    International Nuclear Information System (INIS)

    Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.

    1993-10-01

    Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)

  9. Fragment emission studies of the 16O+12C reaction

    International Nuclear Information System (INIS)

    Kundu, S.; Dey, A.; Banerjee, K.; Rana, T. K.; Muhkopadhayay, S.; Gupta, D.; Saha, R.; Bhattacharya, S.; Bhattacharya, C.

    2008-01-01

    The inclusive energy distributions of the fragments (3≤Z≤5) emitted in the reaction 16 O+ 12 C have been measured in the angular range 9 deg. to 29 deg., at the energies 117, 125, 145, and 160 MeV, respectively. The centroids of the fragments energy distributions follow Viola systematics, which suggest that the fragments are emitted from a fully energy relaxed composite--as expected for both FF and orbiting processes. The center of mass angular distributions of the fragments B, Be, and Li obtained at all the bombarding energies follow 1/sinθ c.m. like variation--which further corroborates the conjecture of emission from fully equilibrated composite. The average values for the fragments B, Be, and Li are found to be independent of the center of mass emission angles, which further suggest that at all angles, the fragments are emitted from completely equilibrated source at all incident energies considered here. The yields of the fragments Li and Be are in agreement with statistical-model predictions. The enhanced yields of entrance channel fragment B indicate the survival of orbiting-like process in 16 O+ 12 C system at these energies

  10. Gun Testing Ballistics Issues for Insensitive Munitions Fragment Impact Testing

    Science.gov (United States)

    Baker, Ernest; Schultz, Emmanuel; NATO Munitions Safety Information Analysis Centre Team

    2017-06-01

    The STANAG 4496 Ed. 1 Fragment Impact, Munitions Test Procedure is normally conducted by gun launching a projectile for attack against a munition. The purpose of this test is to assess the reaction of a munition impacted by a fragment. The test specifies a standardized projectile (fragment) with a standard test velocity of 2530+/-90 m/s, or an alternate test velocity of 1830+/-60 m/s. The standard test velocity can be challenging to achieve and has several loosely defined and undefined characteristics that can affect the test item response. This publication documents the results of an international review of the STANAG 4496 related to the fragment impact test. To perform the review, MSIAC created a questionnaire in conjunction with the custodian of this STANAG and sent it to test centers. Fragment velocity variation, projectile tilt upon impact and aim point variation were identified as observed gun testing issues. Achieving 2530 m/s consistently and cost effectively can be challenging. The aim point of impact of the fragment is chosen with the objective of obtaining the most violent reaction. No tolerance for aim point is specified, although aim point variation can be a source for IM response variation. Fragment tilt on impact is also unspecified. The standard fragment fabricated from a variety of different steels which have a significant margin for mechanical properties. These, as well as other gun testing issues, have significant implications to resulting IM response.

  11. The role of fragmentation mechanism in large-scale vapor explosions

    International Nuclear Information System (INIS)

    Liu, Jie

    2003-01-01

    A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)

  12. Gluon fragmentation into {sup 3} P{sub J} quarkonium

    Energy Technology Data Exchange (ETDEWEB)

    Ma, J.P.

    1995-10-01

    The functions of the gluon fragmentation into {sup 3}P{sub j} quarkonium are calculated to order {alpha}{sup 2}{sub s}. With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of {alpha} {sup 2}{sub s} the Altarelli-Parisi equation and when z {yields} 0 they behave as z{sup -1} as expected. 19 refs., 7 figs.

  13. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    Klingbeil, Maria Fatima Guarizo

    2006-01-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  14. Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome

    International Nuclear Information System (INIS)

    Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie

    2008-01-01

    Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus

  15. QGP and Modified Jet Fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xin-Nian

    2005-04-18

    Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed.

  16. Robust Object Tracking Using Valid Fragments Selection.

    Science.gov (United States)

    Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

    Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

  17. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  18. The matrikine N-α-PGP couples extracellular matrix fragmentation to endothelial permeability

    NARCIS (Netherlands)

    Hahn, Cornelia S; Scott, David W; Xu, Xin; Roda, Mojtaba Abdul; Payne, Gregory A; Wells, J Michael; Viera, Liliana; Winstead, Colleen J; Bratcher, Preston; Sparidans, Rolf W; Redegeld, Frank A; Jackson, Patricia L; Folkerts, Gert; Blalock, J Edwin; Patel, Rakesh P; Gaggar, Amit

    2015-01-01

    The compartmentalization and transport of proteins and solutes across the endothelium is a critical biologic function altered during inflammation and disease, leading to pathology in multiple disorders. The impact of tissue damage and subsequent extracellular matrix (ECM) fragmentation in regulating

  19. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 10617, Taiwan (China); Teixeira, Paula S. [Institut fuer Astrophysik, Universitaet Wien, Tuerkenschanzstrasse 17, A-1180, Wien (Austria); Zapata, Luis A., E-mail: satoko_t@asiaa.sinica.edu.tw [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, Morelia, Michoacan 58090 (Mexico)

    2013-01-20

    We present a high angular resolution map of the 850 {mu}m continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 Multiplication-Sign 2.'0 (0.88 Multiplication-Sign 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H{sub 2} mass between 0.3-5.7 M {sub Sun} and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n{sub H{sub 2}}{>=}10{sup 6} cm{sup -3}), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of Almost-Equal-To 17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud ( Almost-Equal-To 35 pc), large-scale clumps ( Almost-Equal-To 1.3 pc), and small-scale clumps ( Almost-Equal-To 0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  20. The biokinetics of uranium migrating from embedded DU fragments

    International Nuclear Information System (INIS)

    Leggett, R.W.; Pellmar, T.C.

    2003-01-01

    Military uses of depleted uranium (DU) munitions have resulted in casualties with embedded DU fragments. Assessment of radiological or chemical health risks from these fragments requires a model relating urinary U to the rate of migration of U from the fragments, and its accumulation in systemic tissues. A detailed biokinetic model for U has been published by the International Commission on Radiological Protection (ICRP), but its applicability to U migrating from embedded DU fragments is uncertain. Recently, ) conducted a study at the Armed Forces Radiobiology Research Institute (AFRRI) on the redistribution and toxicology of U in rats with implanted DU pellets, simulating embedded fragments. This paper compares the biokinetic data from that study with the behavior of commonly studied forms of U in rats (e.g., intravenously injected U nitrate). The comparisons indicate that the biokinetics of U migrating from embedded DU is similar to that of commonly studied forms of U with regard to long-term accumulation in kidneys, bone, and liver. The results provide limited support for the application of the ICRP's model to persons with embedded DU fragments. Additional information is needed with regard to the short-term behavior of migrating U and its accumulation in lymph nodes, brain, testicles, and other infrequently studied U repositories

  1. DNA fragmentation in spermatozoa and its relationship with impaired spermatogenesis

    Directory of Open Access Journals (Sweden)

    S. A. Rudneva

    2014-01-01

    Full Text Available Sperm cells DNA fragmentation is one of the factors of male sub-/infertility discovered recently. At present, pathophysiological mechanisms that cause DNA fragmentation have not been studied completely. It is suggested that they may be caused with defects of chromatin remodeling, apoptosis, and oxidative stress. Spermiological examination was performed in 461 infertile men. With 23 % of the patients examined, the frequency of sperm cells DNA fragmentation comprises over 15 %, with that, 18 % of the patients demonstrated its range from 15.1 to 30 %, and with 5 % of patients, it exceeded 30 %. We found that the amount of sperm cells with fragmented DNA with severe forms of pathozoospermia is higher that with less manifested disturbances of spermatogenesis. Negative dynamics was revealed regarding the change in sperm concentration in men that have increased frequency of DNA fragmentation. Obtained results confirm the suggestion of the correlation between some semen parameters (concentration, motility, and morphology and sperm DNA fragmentation. Thus, one can state that the DNA fragmentation parameter of sperm cells has a certain diagnostic and forecasting value for married couples with reproduction disorders.

  2. Histopathological findings in brain tissue obtained during epilepsy surgery

    NARCIS (Netherlands)

    Blü mcke, I.; Spreafico, R.; Haaker, G.; Coras, R.; Kobow, K.; Bien, C.G.; Pfä fflin, M.; Elger, C.; Widman, G.; Schramm, J.; Becker, A.; Braun, K.P.J.; Leijten, F.S.S.; Baayen, J.C.; Aronica, E.; Chassoux, F.; Hamer, H.; Stefan, H.; Rö ssler, K.; Thom, M.; Walker, M.C.; Sisodiya, S.M.; Duncan, J.S.; McEvoy, A.W.; Pieper, T.; Holthausen, H.; Kudernatsch, M.; Meencke, H.J.; Kahane, P.; Schulze-Bonhage, A.; Zentner, J.; Heiland, D.; Urbach, H.; Steinhoff, B.J.; Bast, T.; Tassi, L.; Lo Russo, G.; Ozkara, C.; Oz, B.; Krsek, P.; Vogelgesang, S.; Runge, U.; Lerche, H.; Weber, Y.; Honavar, M.; Pimentel, J.; Arzimanoglou, A.; Ulate-Campos, A.; Noachtar, S.; Hartl, E.; Schijns, O.E.M.G.; Guerrini, R.; Barba, C.; Jacques, T.S.; Cross, J.H.; Feucht, M.; Mü hlebner, A.; Grunwald, T.; Trinka, E.; Winkler, P.A.; Gil-Nagel, A.; Toledano Delgado, R.; Mayer, T.; Lutz, M.; Zountsas, B.; Garganis, K.; Rosenow, F.; Hermsen, A.; Ö rtzen, T.J. von; Diepgen, T.L.; Avanzini, G.; Aparicio, J.; Bento, C.; Beckervordersandforth, J.; Buccoliero, A.M.; Cabral, P.; Chamadoira, C.; Colon, A.; Chabardè s, S.; Carpenter, S.; Czech, T.; Dressler, A.; Deleo, F.; Dí lio, A.; Dings, J.; Devaux, B.; De Tisi, J.; De Bellescize, J.; Ebner, A.; Franke, K.; Groeppel, G.; Giordano, F.; Gozzo, F.; Garbelli, R.; Guenot, M.; Garcí a‐ Morales, I.; Gó mez‐ Angulo, J.C.; Garcia, G.; Hainfellner, J.A.; Hö fler, J.; Hoogland, G.; Hendriks, M.P.H.; Hofman, P.; Harding, B.; Huppertz, H.J.; Herms, J.; Hilkman, D.M.W.; Hamelin, S.; Idema, S.; Jansen, F.E.; Jahodova, A.; Keeley, A.; Kalss, G.; Kudr, M.; Kroell, J.; Kokkinos, V.; Keo Kosal, P.; Kalbhenn, T.; Leitinger, M.; Landré , E.; Melo Pires, M.; Matas, A.; Mann, M.W.; Ostrowsky‐ Coste, K.; Prinz, M.; Puttinger, G.; Peraud, A.; Rangel Pinho, R.; Romero, C.; Rego, R.; Rouhl, R.; Ryvlin, P.; Rumia, J.; Rampp, S.; Scholl, T.; Schulz, R.; Stone, T.J.; Streichenberger, N.; Tisdall, M.; Turak, B.; Taipa, R.; Uzan, M.; Kranen‐ Mastenbroek, V. van; Varlet, P.; Vlooswijk, M.C.G.; Wagner, L.; Weis, S.

    2017-01-01

    Background: Detailed neuropathological information on the structural brain lesions underlying seizures is valuable for understanding drug-resistant focal epilepsy. Methods: We report the diagnoses made on the basis of resected brain specimens from 9523 patients who underwent epilepsy surgery for

  3. Histopathological findings in brain tissue obtained during epilepsy surgery

    NARCIS (Netherlands)

    Blumcke, I.; Spreafico, R.; Haaker, G.; Coras, Roland; Kobow, K.; Bien, Christian G.; Pfäfflin, M.; Elger, C.E.; Widman, G.; Schramm, J.; Becker, A.; Braun, K. P.; Leijten, F.; Baayen, Johannes C; Aronica, E.; Chassoux, F.; Hamer, H.M.; Stefan, H.; Rössler, K.; Thom, M.; Walker, M. C.; Sisodiya, Sanjay M.; Duncan, J.S.; McEvoy, A. W.; Pieper, T.; Holthausen, Hans; Kudernatsch, M.; Meencke, H. J.; Kahane, P.; Schulze-Bonhage, A.; Zentner, J.; Heiland, D. H.; Urbach, H.; Steinhoff, Bernhard J; Bast, Thomas; Tassi, L.; Russo, Maria Giovanna; Özkara, Cigdem; Oz, B.; Krsek, Pavel; Vogelgesang, S.; Runge, U.; Lerche, H.; Weber, Y.G.; Honavar, M.; Pimentel, J.; Arzimanoglou, A.; Ulate-Campos, A.; Noachtar, S.; Hartl, E.; Schijns, Olaf E M G; Guerrini, R.; Barba, C.; Jacques, T.S.; Cross, J. Helen; Feucht, Martha; Mühlebner, Angelika; Grunwald, T.; Trinka, Eugen; Winkler, P. A.; Gil-Nagel, Antonio; Toledano Delgado, R.; Mayer, T. E.; Lutz, M.B.; Zountsas, B.; Garganis, K.; Rosenow, F.; Hermsen, Mario A J A; Von Oertzen, T. J.; Diepgen, T. L.; Avanzini, G.

    2017-01-01

    BACKGROUND: Detailed neuropathological information on the structural brain lesions underlying seizures is valuable for understanding drug-resistant focal epilepsy. METHODS: We report the diagnoses made on the basis of resected brain specimens from 9523 patients who underwent epilepsy surgery for

  4. Histopathological Findings in Brain Tissue Obtained during Epilepsy Surgery

    NARCIS (Netherlands)

    Blumcke, Ingmar; Spreafico, Roberto; Haaker, Gerrit; Coras, Roland; Kobow, Katja; Bien, Christian G.; Pfäfflin, Margarete; Elger, Christian; Widman, Guido; Schramm, Johannes; Becker, Albert; Braun, Kees P.; Leijten, Frans; Baayen, Johannes C.; Aronica, Eleonora; Chassoux, Francine; Hamer, Hajo; Stefan, Hermann; Rössler, Karl; Thom, Maria; Walker, Matthew C.; Sisodiya, Sanjay M.; Duncan, John S.; McEvoy, Andrew W.; Pieper, Tom; Holthausen, Hans; Kudernatsch, Manfred; Meencke, H. Joachim; Kahane, Philippe; Schulze-Bonhage, Andreas; Zentner, Josef; Heiland, Dieter H.; Urbach, Horst; Steinhoff, Bernhard J.; Bast, Thomas; Tassi, Laura; Lo Russo, Giorgio; Özkara, Cigdem; Oz, Buge; Krsek, Pavel; Vogelgesang, Silke; Runge, Uwe; Lerche, Holger; Weber, Yvonne; Honavar, Mrinalini; Pimentel, José; Arzimanoglou, Alexis; Ulate-Campos, Adriana; Noachtar, Soheyl; Hartl, Elisabeth; Schijns, Olaf; Guerrini, Renzo; Barba, Carmen; Jacques, Thomas S.; Cross, J. Helen; Feucht, Martha; Mühlebner, Angelika; Grunwald, Thomas; Trinka, Eugen; Winkler, Peter A.; Gil-Nagel, Antonio; Toledano Delgado, Rafael; Mayer, Thomas; Lutz, Martin; Zountsas, Basilios; Garganis, Kyriakos; Rosenow, Felix; Hermsen, Anke; von Oertzen, Tim J.; Diepgen, Thomas L.; Avanzini, Giuliano; Aparicio, Javier; Bento, Conceição; Beckervordersandforth, Jan; Buccoliero, Annamaria; Cabral, Pedro; Chamadoira, Clara; Colon, Albert; Chabardès, Stéphan; Carpenter, Stirling; Czech, Thomas; Dressler, Anastasia; Deleo, Francesco; Dílio, Alves; Dings, Jim; Devaux, Bertrand; de Tisi, Jane; de Bellescize, Julitta; Ebner, Alois; Franke, Kerstin; Groeppel, Gudrun; Giordano, Flavio; Gozzo, Francesca; Garbelli, Rita; Guenot, Marc; García‐Morales, Irene; Gómez‐Angulo, Juan Carlos; Garcia, Gemma; Hainfellner, Johannes A.; Höfler, Julia; Hoogland, Govert; Hendriks, Marc; Hofman, Paul; Harding, Brian; Huppertz, Hans‐Jürgen; Herms, Jochen; Hilkman, Danny M. W.; Hamelin, Sophie; Idema, Sander; Jansen, Floor E.; Jahodova, Alena; Keeley, Angus; Kalss, Gudrun; Kudr, Martin; Kroell, Judith; Kokkinos, Vasileios; Keo Kosal, Pascale; Kalbhenn, Thilo; Leitinger, Markus; Landré, Elisabeth; Melo Pires, Manuel; Matas, Andreia; Mann, Michael W.; Ostrowsky‐Coste, Karine; Prinz, Marco; Puttinger, Gertraud; Peraud, Aurelia; Rangel Pinho, Rui; Romero, Clara; Rego, Ricardo; Rouhl, Rob; Ryvlin, Philippe; Rumia, Jordi; Rampp, Stefan; Scholl, Theresa; Schulz, Reinhard; Stone, Thomas J.; Streichenberger, Nathalie; Tisdall, Martin; Turak, Baris; Taipa, Ricardo; Uzan, Mustafa; van Kranen‐Mastenbroek, Vivianne; Varlet, Pascale; Vlooswijk, Marielle; Wagner, Louis; Weis, Serge

    2017-01-01

    Detailed neuropathological information on the structural brain lesions underlying seizures is valuable for understanding drug-resistant focal epilepsy. We report the diagnoses made on the basis of resected brain specimens from 9523 patients who underwent epilepsy surgery for drug-resistant seizures

  5. Unusual Fragmentation Pathways in Collagen Glycopeptides

    Science.gov (United States)

    Perdivara, Irina; Perera, Lalith; Sricholpech, Marnisa; Terajima, Masahiko; Pleshko, Nancy; Yamauchi, Mitsuo; Tomer, Kenneth B.

    2013-07-01

    Collagens are the most abundant glycoproteins in the body. One characteristic of this protein family is that the amino acid sequence consists of repeats of three amino acids -(X—Y—Gly)n. Within this motif, the Y residue is often 4-hydroxyproline (HyP) or 5-hydroxylysine (HyK). Glycosylation in collagen occurs at the 5-OH group in HyK in the form of two glycosides, galactosylhydroxylysine (Gal-HyK) and glucosyl galactosylhydroxylysine (GlcGal-HyK). In collision induced dissociation (CID), collagen tryptic glycopeptides exhibit unexpected gas-phase dissociation behavior compared to typical N- and O-linked glycopeptides (i.e., in addition to glycosidic bond cleavages, extensive cleavages of the amide bonds are observed). The Gal- or GlcGal- glycan modifications are largely retained on the fragment ions. These features enable unambiguous determination of the amino acid sequence of collagen glycopeptides and the location of the glycosylation site. This dissociation pattern was consistent for all analyzed collagen glycopeptides, regardless of their length or amino acid composition, collagen type or tissue. The two fragmentation pathways—amide bond and glycosidic bond cleavage—are highly competitive in collagen tryptic glycopeptides. The number of ionizing protons relative to the number of basic sites (i.e., Arg, Lys, HyK, and N-terminus) is a major driving force of the fragmentation. We present here our experimental results and employ quantum mechanics calculations to understand the factors enhancing the labile character of the amide bonds and the stability of hydroxylysine glycosides in gas phase dissociation of collagen glycopeptides.

  6. Inclusive breakup of three-fragment weakly bound nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)

    2017-04-10

    The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.

  7. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  8. Energy distribution of projectile fragment particles in heavy ion therapeutic beam

    Energy Technology Data Exchange (ETDEWEB)

    Matsufuji, Naruhiro; Tomura, Hiromi; Futami, Yasuyuki [National Inst. of Radiological Sciences, Chiba (Japan)] [and others

    1998-03-01

    Production of fragment particles in a patient`s body is one of important problems for heavy charged particle therapy. It is required to know the yield and the energy spectrum for each fragment element - so called `beam quality` to understand the effect of therapeutic beam precisely. In this study, fragment particles produced by practical therapeutic beam of HIMAC were investigated with using tissue-equivalent material and a detector complex. From the results, fragment particles were well identified by difference of their atomic numbers and the beam quality was derived. Responses of the detectors in this energy region were also researched. (author)

  9. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  10. HZEFRG1 - SEMIEMPIRICAL NUCLEAR FRAGMENTATION MODEL

    Science.gov (United States)

    Townsend, L. W.

    1994-01-01

    The high charge and energy (HZE), Semiempirical Nuclear Fragmentation Model, HZEFRG1, was developed to provide a computationally efficient, user-friendly, physics-based program package for generating nuclear fragmentation databases. These databases can then be used in radiation transport applications such as space radiation shielding and dosimetry, cancer therapy with laboratory heavy ion beams, and simulation studies of detector design in nuclear physics experiments. The program provides individual element and isotope production cross sections for the breakup of high energy heavy ions by the combined nuclear and Coulomb fields of the interacting nuclei. The nuclear breakup contributions are estimated using an energy-dependent abrasion-ablation model of heavy ion fragmentation. The abrasion step involves removal of nucleons by direct knockout in the overlap region of the colliding nuclei. The abrasions are treated on a geometric basis and uniform spherical nuclear density distributions are assumed. Actual experimental nuclear radii obtained from tabulations of electron scattering data are incorporated. Nuclear transparency effects are included by using an energy-dependent, impact-parameter-dependent average transmission factor for the projectile and target nuclei, which accounts for the finite mean free path of nucleons in nuclear matter. The ablation step, as implemented by Bowman, Swiatecki, and Tsang (LBL report no. LBL-2908, July 1973), was treated as a single-nucleon emission for every 10 MeV of excitation energy. Fragmentation contributions from electromagnetic dissociation (EMD) processes, arising from the interacting Coulomb fields, are estimated by using the Weiszacker-Williams theory, extended to include electric dipole and electric quadrupole contributions to one-nucleon removal cross sections. HZEFRG1 consists of a main program, seven function subprograms, and thirteen subroutines. Each is fully commented and begins with a brief description of its

  11. Comparative study of intact A7 MoAc and F(ab')2 fragments for radioimmunoimaging of human colon cancer in nude mice

    International Nuclear Information System (INIS)

    Kojima, Shuji; Suzuki, Naomi; Shimura, Noriko; Kubodera, Akiko; Kubota, Kazuhiko; Yamaguchi, Toshiharu; Takahashi, Toshio; Oyamada, Hiyoshimaru

    1993-01-01

    Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab) 2 fragments were studied in human colon cancer (LS-174T)-bearing nude mice. The authors examined the yield and the immunoreactivity of F(ab) 2 fragments after treatment with ficin as a function of time. The yield of F(ab) 2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab) 2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab') 2 was preferentially taken up by the tumor, cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. The tumor image obtained at an early time using 131 I-F(ab') 2 was much superior in quality to that with intact 131 I-A7 MoAb. The use of F(ab') 2 fragments may be effective for tumor diagnosis and therapy. (author)

  12. Fragmented nature: consequences for biodiversity

    NARCIS (Netherlands)

    Olff, H.; Ritchie, M.E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  13. Fragmented nature : consequences for biodiversity

    NARCIS (Netherlands)

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  14. Nuclear energy release from fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

    2016-08-15

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  15. Phthalocyanides sensitized fragmentation of proteins

    Czech Academy of Sciences Publication Activity Database

    Klementová, S.; Tothová, D.; Revaková, R.; Kasková, M.; Wagnerová, Dana Marie

    2001-01-01

    Roč. 5, č. 1 (2001), s. 13-18 ISSN 0972-0626 R&D Projects: GA ČR GA203/96/1322 Institutional research plan: CEZ:AV0Z4032918 Keywords : phthalocyanides * photosensitied fragmentation of proteins Subject RIV: CA - Inorganic Chemistry

  16. Ultrasound assisted arthroscopic approach for removal of basilar sesamoid fragments of the proximal sesamoid bones in horses.

    Science.gov (United States)

    Barrett, Elizabeth J; Rodgerson, Dwayne H

    2014-08-01

    To describe an ultrasound assisted arthroscopic approach for removal of non-articular basilar sesamoid fragments in Thoroughbred yearlings. Thoroughbred yearlings (n = 7). Basilar sesamoid fragments identified during pre-sale radiographic examination were removed using a palmar/plantar arthroscopic approach to the fetlock joint and ultrasonographic guidance. Complete fragment removal was confirmed by ultrasonography and radiography. Basilar sesamoid fracture fragments were localized and removed successfully using rongeurs and a radiofrequency probe for soft tissue dissection of the fragment. Complete fragment removal was confirmed by ultrasonography and radiography. No intra- or postoperative complications occurred. At 6-8 months follow-up, no fragments or bony proliferation at the base of the sesamoid was observed. Ultrasonographic guidance can be used to facilitate localization, dissection, and confirmation of removal of basilar fragments of the proximal sesamoid bone. © Copyright 2014 by The American College of Veterinary Surgeons.

  17. Experimental Volcanology: Fragmentation and Permeability

    Science.gov (United States)

    Spieler, O.

    2005-12-01

    An increasing number of scientists design new experiments to analyse processes that control the dynamics of explosive eruptions. There research is mostly coupled to numerical models and aims toward its controlling parameters. The fragmentation process, its threshold and the speed of the fragmentation wave as well as the energy consumed by the fragmentation are some hot spots of the experimental volcanology. Analysing the fragmentation behaviour of volcaniclastics as close to the natural system as possible, we found a number of physical constrains. Identifying the porosity as determining factor of the threshold, we realised that neither threshold nor the speed of the fragmentation process are solely controlled by the rock density. The later results of the shock tube type apparatus lead to the analysis of the specific surface area and permeability as direct links to textural features. Permeability analysis performed in a modified shock tube type apparatus, show two clear, distinct trends for dome rock and pyroclastic samples. The specific surface determined by Argon sorbtion (BET) as well as textural features of pumices from Campi Flegrei, Montserrat and Krakatoa (1883) give in contrary evidence of a more complex story. Large spherical, or ellipsoidal bubbles around fractured crystals prove that the high permeability of the pumice has partially developed after the fixing of the bubble size distribution. This puts up the question, if permeability measurements on pyroclastic samples reveal relevant numbers! The surface tension controlled 'self sealing' behaviour of surfaces from foaming obsidian hinders in situ measurements. Close textural investigations will have to clarify how the 'post process' samples deviate from the syneruptive conduit filling.

  18. Combinatorial Labeling Method for Improving Peptide Fragmentation in Mass Spectrometry

    Science.gov (United States)

    Kuchibhotla, Bhanuramanand; Kola, Sankara Rao; Medicherla, Jagannadham V.; Cherukuvada, Swamy V.; Dhople, Vishnu M.; Nalam, Madhusudhana Rao

    2017-06-01

    Annotation of peptide sequence from tandem mass spectra constitutes the central step of mass spectrometry-based proteomics. Peptide mass spectra are obtained upon gas-phase fragmentation. Identification of the protein from a set of experimental peptide spectral matches is usually referred as protein inference. Occurrence and intensity of these fragment ions in the MS/MS spectra are dependent on many factors such as amino acid composition, peptide basicity, activation mode, protease, etc. Particularly, chemical derivatizations of peptides were known to alter their fragmentation. In this study, the influence of acetylation, guanidinylation, and their combination on peptide fragmentation was assessed initially on a lipase (LipA) from Bacillus subtilis followed by a bovine six protein mix digest. The dual modification resulted in improved fragment ion occurrence and intensity changes, and this resulted in the equivalent representation of b- and y-type fragment ions in an ion trap MS/MS spectrum. The improved representation has allowed us to accurately annotate the peptide sequences de novo. Dual labeling has significantly reduced the false positive protein identifications in standard bovine six peptide digest. Our study suggests that the combinatorial labeling of peptides is a useful method to validate protein identifications for high confidence protein inference. [Figure not available: see fulltext.

  19. The effects of experimental sleep fragmentation on cognitive processing.

    Science.gov (United States)

    Ferri, Raffaele; Drago, Valeria; Aricò, Debora; Bruni, Oliviero; Remington, Roger W; Stamatakis, Katherine; Punjabi, Naresh M

    2010-04-01

    The primary objective of this study was to characterize the association between cyclic alternating pattern (CAP) and neurocognitive performance in a group of normal subjects before and after two nights of experimentally-induced sleep fragmentation. Fifteen healthy subjects underwent one night of uninterrupted and two sequential nights of experimental sleep fragmentation achieved by auditory and mechanical stimuli. Eight subjects were re-examined using a similar paradigm with three nights of uninterrupted sleep. Sleep was polygraphically recorded and CAP analysis was performed for all recordings. A battery of neurocognitive tests was performed for spatial attention, inhibition of return, mental rotation, and Stroop color word test in the afternoon following the first and third night of sleep under fragmented and non-fragmented conditions. With sleep fragmentation, the percentage of slow-wave sleep was dramatically reduced and there was a twofold increase in total CAP rate across all NREM sleep stages. Moreover, the number of all CAP A subtypes/hour of sleep (index) was significantly increased. Total CAP rate during the non-fragmented night correlated with reaction times. Similarly, the percentages of A1 and A3 subtypes were negatively and positively correlated with reaction times, respectively. Of the neurocognitive test battery, however, only values obtained from some subtests of the mental rotation test showed a significant improvement after sleep fragmentation. The results of this study suggest that CAP A1 subtypes are associated with higher cognitive functioning, whereas CAP A3 subtypes are associated with lower cognitive functioning in young healthy subjects. The lack of cognitive functioning impairment after sleep fragmentation may be due to persistence and even enhancement of transient slow-wave activity contained in CAP A1 subtypes which also caused a significant enhancement of the EEG power spectrum in the lower frequencies. Copyright 2010 Elsevier B.V. All

  20. Fragmentation of suddenly heated liquids

    International Nuclear Information System (INIS)

    Blink, J.A.

    1985-03-01

    Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate. The x-ray ablated materials must cool and recondense to allow driver beam propagation. The increased surface area caused by fragmentation will enhance the cooling and condensation rates. Relaxation from the suddenly heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The lithium equation of state was used to demonstrate that neutron-induced vaporization uses only a minor fraction of the added heat, much less than would be required to drive the expansion. A 77% expansion of the lithium is required before the rapid vaporization process of spinodal decomposition could begin, and nucleation and growth are too slow to contribute to the expansion

  1. Fragmentering og korridorer i landskabet

    DEFF Research Database (Denmark)

    Hammershøj, M.; Madsen, A. B.

    , at fragmentering af habitater resulterer i en reduktion og isolering af mange plante- og dyrepopulationer. Det er desuden vist, at korridorer har en funktion som habitater, hvilket er medvirkende til, at et område med korridorer kan huse flere arter og individer end et tilsvarende område uden korridorer. Der......Rapporten indeholder en litteraturudredning, der er baseret på en bearbejdning af den tilgængelige nationale og internationale litteratur omhandlende fragmentering og korridorer på det botaniske og zoologiske område. I alt 1.063 titler ligger til grund for udredningen. Udredningen har vist...... mangler dog entydige beviser for, at korridorer kan være af afgørende betydning for rekolonisering af habitater, i hvilke en given art er forsvundet. Afslutningsvis gives en liste med forskningsbehov samt en række anbefalinger....

  2. Fragmentation of percolation cluster perimeters

    Science.gov (United States)

    Debierre, Jean-Marc; Bradley, R. Mark

    1996-05-01

    We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

  3. Fragmented nature: consequences for biodiversity

    OpenAIRE

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species with different size and mobility can be regulated by different processes at the same spatial scale, a principle that may contribute to diversity. Differences in species richness between local commu...

  4. Virtual reunification of papyrus fragments

    OpenAIRE

    Vannini, Lucia

    2015-01-01

    Many Greek and Latin papyri, originally belonging to only one book (be it in roll or codex form), are currently scattered among different libraries. While it is not possible to physically rejoin these fragments as they cannot be moved from their institutions, they may be virtually reunited thanks to the techniques of digitisation, image processing and electronic publishing. This paper focuses on some issues – emerged from the work of my MA dissertation – that virtual reunification of Greek an...

  5. Testing independence of fragment lengths within VNTR loci

    Energy Technology Data Exchange (ETDEWEB)

    Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))

    1993-11-01

    Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

  6. Research at the fragment mass analyser at ATLAS

    International Nuclear Information System (INIS)

    Davids, C.N.; Back, B.; Bearden, I.G.

    1993-01-01

    The experimental program at the Fragment Mass Analyzer (FMA) at the ATLAS heavy ion accelerator of the Argonne National Laboratory is described. The brief description and operational properties of the FMA are presented. The highest mass resolution obtained with the FMA is 525/1. Some experimental results are presented. 5 refs., 7 figs

  7. Fragmentation measurement using image processing

    Directory of Open Access Journals (Sweden)

    Farhang Sereshki

    2016-12-01

    Full Text Available In this research, first of all, the existing problems in fragmentation measurement are reviewed for the sake of its fast and reliable evaluation. Then, the available methods used for evaluation of blast results are mentioned. The produced errors especially in recognizing the rock fragments in computer-aided methods, and also, the importance of determination of their sizes in the image analysis methods are described. After reviewing the previous work done, an algorithm is proposed for the automated determination of rock particles’ boundary in the Matlab software. This method can determinate automatically the particles boundary in the minimum time. The results of proposed method are compared with those of Split Desktop and GoldSize software in two automated and manual states. Comparing the curves extracted from different methods reveals that the proposed approach is accurately applicable in measuring the size distribution of laboratory samples, while the manual determination of boundaries in the conventional software is very time-consuming, and the results of automated netting of fragments are very different with the real value due to the error in separation of the objects.

  8. Residual Fragments after Percutaneous Nephrolithotomy

    Directory of Open Access Journals (Sweden)

    Kaan Özdedeli

    2012-09-01

    Full Text Available Clinically insignificant residual fragments (CIRFs are described as asymptomatic, noninfectious and nonobstructive stone fragments (≤4 mm remaining in the urinary system after the last session of any intervention (ESWL, URS or PCNL for urinary stones. Their insignificance is questionable since CIRFs could eventually become significant, as their presence may result in recurrent stone growth and they may cause pain and infection due to urinary obstruction. They may become the source of persistent infections and a significant portion of the patients will have a stone-related event, requiring auxilliary interventions. CT seems to be the ultimate choice of assessment. Although there is no concensus about the timing, recent data suggests that it may be performed one month after the procedure. However, imaging can be done in the immediate postoperative period, if there are no tubes blurring the assessment. There is some evidence indicating that selective medical therapy may have an impact on decreasing stone formation rates. Retrograde intrarenal surgery, with its minimally invasive nature, seems to be the best way to deal with residual fragments.

  9. Functionalized Coumarine Fragment to Obtain Fluorescent and Selective P-Glycoprotein Ligands.

    Science.gov (United States)

    Capparelli, Elena; Contino, Marialessandra; Perrone, Maria G; Berardi, Francesco; Perrone, Roberto; Leopoldo, Marcello; Colabufo, Nicola A

    2016-03-01

    Starting from our lead compound MC70 displaying high P-glycoprotein (P-gp) inhibition activity but low selectivity, a new class of coumarine derivatives was studied to develop selective and fluorescent P-gp ligands. In this series, the biphenyl moiety of MC70 was replaced with the coumarine fluorophore as a bioisostere of the biphenyl nucleus in order to improve the selectivity toward P-gp and the fluorescent properties for in vitro studies. Moreover, the presence and position of substituents on the coumarine nucleus were probed to develop suitable fluorescent probes to study the expression and activity of P-gp in living cells. The best result was found for compound 4c, which exerts a good P-gp activity profile (EC50  = 13 μM) as substrate and a high selectivity toward the pump since it is inactive toward MRP1. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Scale breaking parton fragmentation functions, analytical parametrizations and comparison with charged multiplicities in e+e- annihilation

    International Nuclear Information System (INIS)

    Perlt, H.

    1980-01-01

    Scale breaking quark and gluon fragmentation functions obtained by solving numerically Altarelli-Parisi type equations are presented. Analytical parametrizations are given for the fragmentation of u and d quarks into pions. The calculated Q 2 dependent fragmentation functions are compared with experimental data. With these scale breaking fragmentation functions the average charged multiplicity is calculated in e + e - annihilation, which rises with energy more than logarithmically and is in good agreement with experiment. (author)

  11. Growth of Fullerene Fragments Using the Diels-Alder Cycloaddition Reaction: First Step towards a C60 Synthesis by Dimerization

    Directory of Open Access Journals (Sweden)

    Julio A. Alonso

    2013-02-01

    Full Text Available Density Functional Theory has been used to model the Diels-Alder reactions of the fullerene fragments triindenetriphenilene and pentacyclopentacorannulene with ethylene and 1,3-butadiene. The purpose is to prove the feasibility of using Diels-Alder cycloaddition reactions to grow fullerene fragments step by step, and to dimerize fullerene fragments, as a way to obtain C60. The dienophile character of the fullerene fragments is dominant, and the reaction of butadiene with pentacyclopentacorannulene is favored.

  12. Fragmentation during primordial star formation

    Science.gov (United States)

    Dutta, Jayanta

    Understanding the physics of the very first stars in the universe, the so-called Population III (or Pop III) stars, is crucial in determining how the universe evolved into what we observe today. In the standard model of Pop III star formation, the baryonic matter, mainly atomic hydrogen, collapses gravitationally into small Dark Matter (DM) minihalos. However, so far there is little understanding on how the thermal, dynamical and chemical evolution of the primordial gas depend on the initial configuration of the minihalos (for example, rotation of the unstable clumps inside minihalos, turbulence, formation of molecular hydrogen and cosmic variance of the minihalos). We use the modified version of the Gadget-2 code, a three-dimensional smoothed particle hydrodynamics (SPH) simulations, to follow the evolution of the collapsing gas in both idealized as well as more realistic minihalos. Unlike some earlier cosmological calculations, the implementation of sink particles allows us to follow the evolution of the accretion disk that builds up in the centre of each minihalo and fragments. We find that the fragmentation behavior depends on the adopted choice of three-body H2 formation rate coefficient. The increasing cooling rate during rapid conversion of the atomic to molecular hydrogen is offset by the heating due to gas contraction. We propose that the H2 cooling, the heating due to H2 formation and compressional heating together set a density and temperature structure in the disk that favors fragmentation. We also find that the cloud's initial degree of rotation has a significant effect on the thermal and dynamical evolution of the collapsing gas. Clouds with higher rotation exhibit spiral-arm-like structures that become gravitationally unstable to fragmentation on several scales. These type of clouds tend to fragment more and have lower accretion rates compared to their slowly rotating counterparts. In addition, we find that the distribution of specific angular

  13. Identification of amplified fragment length polymorphism (AFLP ...

    African Journals Online (AJOL)

    Identification of amplified fragment length polymorphism (AFLP) fragments linked to soybean mosaic virus resistance gene in Glycine soja and conversion to a sequence characterized amplified regions (SCAR) marker for rapid selection.

  14. Polarization and alignment of nucleus fission fragments

    International Nuclear Information System (INIS)

    Barabanov, A.L.; Grechukhin, D.P.

    1987-01-01

    Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

  15. Deformation energy of a toroidal nucleus and plane fragmentation barriers

    International Nuclear Information System (INIS)

    Fauchard, C.; Royer, G.

    1996-01-01

    The path leading to pumpkin-like configurations and toroidal shapes is investigated using a one-parameter shape sequence. The deformation energy is determined within the analytical expressions obtained for the various shape-dependent functions and the generalized rotating liquid drop model taking into account the proximity energy and the temperature. With increasing mass and angular momentum, a potential well appears in the toroidal shape path. For the heaviest systems, the pocket is large and locally favourable with respect to the plane fragmentation barriers which might allow the formation of evanescent toroidal systems which would rapidly decay in several fragments to minimize the surface tension. (orig.)

  16. Quark fragmentation into {sup 3}P{sub J} quarkonium

    Energy Technology Data Exchange (ETDEWEB)

    Ma, J.P.

    1996-03-01

    The functions of parton fragmentation into {sup 3}P{sub J} quarkonium at order {alpha}{sup 2}{sub s} are calculated, where the parton can be a heavy or a light quark. The obtained functions explicitly satisfy the Altarelli-Parisi equation and they are divergent, behaving as z{sup -1} near z = O. However, if one choses the renormalization scale as twice of the heavy quark mass, the fragmentation functions are regular over the whole range of z. 15 refs., 2 figs.

  17. Scaling and four-quark fragmentation

    NARCIS (Netherlands)

    Scholten, O.; Bosveld, G. D.

    1991-01-01

    The conditions for a scaling behaviour from the fragmentation process leading to slow protons are discussed. The scaling referred to implies that the fragmentation functions depend on the light-cone momentum fraction only. It is shown that differences in the fragmentation functions for valence- and

  18. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  19. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  20. Scaling and critical behaviour in nuclear fragmentation

    International Nuclear Information System (INIS)

    Campi, X.

    1990-09-01

    These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

  1. Self-organized criticality in fragmenting

    DEFF Research Database (Denmark)

    Oddershede, L.; Dimon, P.; Bohr, J.

    1993-01-01

    The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

  2. Relative fragmentation in ternary systems within the temperature-dependent relativistic mean-field approach

    Science.gov (United States)

    Kannan, M. T. Senthil; Kumar, Bharat; Balasubramaniam, M.; Agrawal, B. K.; Patra, S. K.

    2017-06-01

    For the first time, we apply the temperature-dependent relativistic mean-field (TRMF) model to study the ternary fragmentation of heavy nuclei using the level density approach. The relative fragmentation probability of a particular fragment is obtained by evaluating the convolution integrals that employ the excitation energy and the level density parameter for a given temperature calculated within the TRMF formalism. To illustrate, we have considered the ternary fragmentations in 252Cf, 242Pu, and 236U with a fixed third fragment A3=48Ca , 20O, and 16O, respectively. The relative fragmentation probabilities are studied for the temperatures T =1 , 2, and 3 MeV. For the comparison, the relative fragmentation probabilities are also calculated from the single-particle energies of the finite range droplet model (FRDM). In general, the larger phase space for the ternary fragmentation is observed indicating that such fragmentations are most probable ones. For T =2 and 3 MeV, Sn +Ni +Ca is the most probable combination for the nucleus 252Cf. However, for the nuclei 242Pu and 236U, the maximum fragmentation probabilities at T =2 MeV differ from those at T =3 MeV. For T =3 MeV, the closed shell (Z =8 ) light-mass fragment with its corresponding partners has larger scission point probabilities. But, at T =2 MeV, Si, P, and S are favorable fragments with the corresponding partners. It is noticed that the symmetric binary fragmentation along with the fixed third fragment for 242Pu and 236U is also favored at T =1 MeV.

  3. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  4. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  5. Multiplicity distributions in the binary fragmenting with inhibition at the transition line

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1996-03-01

    Properties of the fragment multiplicity distribution obtained in the sequential binary fragmentation process at the transition line are investigated. It is shown that the multifragment cumulant correlation functions have the hierarchical, linked-pair structure. Several distinct classes of multiplicity domains are clearly identified, and the asymptotic appearance of the Koba - Nielsen - Olesen scaling is discussed. (author)

  6. A fragment-based approach towards ab-initio treatment of polymeric ...

    Indian Academy of Sciences (India)

    Reshma S Pingale

    2017-06-20

    Jun 20, 2017 ... conquer'-type approach for the ab-initio studies of these polymeric systems. The method employs a fragmentation technique with independent fragment optimization for obtaining optimized geometries of the oligomers of various polymeric materials such as polyfuran, polypyrrole, polythiophene and other ...

  7. Jet mass dependence of fragmentation in positron-proton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Urmossy, K. [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan, Shandong (China)

    2017-02-15

    We propose the characterization of fragmentation functions by the energy fraction x a hadron takes away from the energy of the jet measured in the frame co-moving with the jet. Besides, we propose the usage of the jet mass as the fragmentation scale Q. We show that these two Lorentz-invariant variables emerge naturally in a microcanonical ensemble with conserved four-momentum. Then, we construct a statistical hadronisation model, in which, two features of the hadronic final states in various high-energy reactions (power law spectra and negative-binomial multiplicity distributions) can be connected simply. Finally, we analyse the scale dependence of the parameters of the model (power of the spectrum and mean energy per hadron) in the φ{sup 3} theory. Fitting fragmentation functions in diffractive positron-proton collisions, we obtain a prediction for the jet mass dependence of the hadron multiplicity distribution inside jets. (orig.)

  8. Toroidal and rotating bubble nuclei and the nuclear fragmentation

    International Nuclear Information System (INIS)

    Royer, G.; Fauchard, C.; Haddad, F.; Jouault, B.

    1997-01-01

    The energy of rotating bubble and toroidal nuclei predicted to be formed in central heavy ion collisions at intermediate energies is calculated within the generalized rotating liquid drop model. Previously, a one-parameter shape sequence has been defined to describe the path leading to pumpkin-like configurations and toroidal shapes. New analytical expressions for the shape dependent functions have been obtained. The potential barriers standing in these exotic deformation paths are compared with the three-dimensional and plane-fragmentation barriers. Metastable bubble-like minima only appear at very high angular momentum and above the three dimensional fragmentation barriers. In the toroidal deformation path of the heaviest systems exists a large potential pocket localized below the plane-fragmentation barriers. This might allow the temporary survival of heavy nuclear toroids before the final clusterization induced by the surface and proximity tension

  9. Apparatus and method for producing fragment-free openings

    Science.gov (United States)

    Cherry, Christopher R.

    2001-01-01

    An apparatus and method for explosively penetrating hardened containers such as steel drums without producing metal fragmentation is disclosed. The apparatus can be used singularly or in combination with water disrupters and other disablement tools. The apparatus is mounted in close proximity to the target and features a main sheet explosive that is initiated at least three equidistant points along the sheet's periphery. A buffer material is placed between the sheet explosive and the target. As a result, the metallic fragments generated from the detonation of the detonator are attenuated so that no fragments from the detonator are transferred to the target. As a result, an opening can be created in containers such as steel drums through which access to the IED is obtained to defuse it with projectiles or fluids.

  10. Hadronic and electromagnetic fragmentation of ultrarelativistic heavy ions at LHC

    Directory of Open Access Journals (Sweden)

    H. H. Braun

    2014-02-01

    Full Text Available Reliable predictions of yields of nuclear fragments produced in electromagnetic dissociation and hadronic fragmentation of ion beams are of great practical importance in analyzing beam losses and interactions with the beam environment at the Large Hadron Collider (LHC at CERN as well as for estimating radiation effects of galactic cosmic rays on the spacecraft crew and electronic equipment. The model for predicting the fragmentation of relativistic heavy ions is briefly described, and then applied to problems of relevance for LHC. The results are based on the fluka code, which includes electromagnetic dissociation physics and dpmjet-iii as hadronic event generator. We consider the interaction of fully stripped lead ions with nuclei in the energy range from about one hundred MeV to ultrarelativistic energies. The yields of fragments close in the mass and charge to initial ions are calculated. The approach under discussion provides a good overall description of Pb fragmentation data at 30 and 158A  GeV as well as recent LHC data for sqrt[s_{NN}]=2.76  TeV Pb-Pb interactions. Good agreement with the calculations in the framework of different models is found. This justifies application of the developed simulation technique both at the LHC injection energy of 177A  GeV and at its collision energies of 1.38, 1.58, and 2.75A  TeV, and gives confidence in the results obtained.

  11. Binding-site assessment by virtual fragment screening.

    Directory of Open Access Journals (Sweden)

    Niu Huang

    2010-04-01

    Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.

  12. RNA-seq analysis of bovine intramuscular, subcutaneous and perirenal adipose tissues.

    Science.gov (United States)

    Sheng, Xihui; Ni, Hemin; Liu, Yunhai; Li, Junya; Zhang, Lupei; Guo, Yong

    2014-03-01

    The deposition of intramuscular fat is an important factor affecting the beef quality, such as flavour and palatability. In this study, for further identifying the differential molecular mechanisms regulating the deposition of fat between intramuscular and external adipose tissues, particularly subcutaneous and perirenal adipose tissues, it was designed to obtain transcript sequence data and compare the transcriptomes among intramuscular, subcutaneous, and perirenal adipose tissues by RNA-Seq. A total of 66,206,912, 55,114,070 and 67,320,426 fragments were sequenced for the intramuscular (IAT), subcutaneous (SAT), and perirenal adipose tissue (PAT) respectively. Among them, total 953, 1,534, 2,026 genes showing differential expression between IAT and SAT, IAT and PAT, SAT and PAT, were identified respectively (FDR fat deposition, especially intramuscular fat, at a fine scale.

  13. Reframing landscape fragmentation's effects on ecosystem services.

    Science.gov (United States)

    Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

    2015-04-01

    Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. The formation of planets by disc fragmentation

    Directory of Open Access Journals (Sweden)

    Stamatellos Dimitris

    2013-04-01

    Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

  15. Effects of forest fragmentation on brood parasitism and nest predation in eastern and western landscapes

    Science.gov (United States)

    Cavitt, J.F.; Martin, T.E.

    2002-01-01

    The fragmentation of North American forests by agriculture and other human activities may negatively impact the demographic processes of birds through increases in nest predation and brood parasitism. In fact, the effects of fragmentation on demographic processes are thought to be a major underlying cause of long-term population declines of many bird species. However, much of our understanding of the demographic consequences of fragmentation has come from research conducted in North America east of the Rocky Mountains. Thus, results obtained from these studies may not be applicable to western landscapes, where habitats are often naturally heterogeneous due to topographic variation and periodic fire. We utilized data from a large database of nest records (>10,000) collected at sites both east and west of the Rocky Mountains to determine if the effects of fragmentation are consistent across broad geographic regions. We found that forest fragmentation tended to increase the frequency of brood parasitism by Brown-headed Cowbirds (Molothrus ater) east of the Rockies but we were unable to detect a significant difference in the West. Within the eastern United States, nest predation rates were consistently higher within fragmented sites relative to unfragmented sites. Yet, in the West, fragmentation resulted in a decrease in nest predation relative to unfragmented sites. This is perhaps accounted for by differential responses of the local predator community to fragmentation. Our results suggest that the effects of fragmentation may not be consistent across broad geographic regions and that the effects of fragmentation may depend on dynamics within local landscapes.

  16. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  17. Processing of hydroxyapatite obtained by combustion synthesis

    International Nuclear Information System (INIS)

    Canillas, M.; Rivero, R.; García-Carrodeguas, R.; Barba, F.; Rodríguez, M.A.

    2017-01-01

    One of the reasons of implants failure are the stress forces appearing in the material–tissue interface due to the differences between their mechanical properties. For this reason, similar mechanical properties to the surrounding tissue are desirable. The synthesis of hydroxyapatite by solution combustion method and its processing have been studied in order to obtain fully dense ceramic bodies with improved mechanical strength. Combustion synthesis provides nanostructured powders characterized by a high surface area to facilitate the following sintering. Moreover, synthesis was conducted in aqueous and oxidizing media. Oxidizing media improve homogenization and increase the energy released during combustion. It gives rise to particles whose morphology and size suggest lower surface energies compared with aqueous media. The obtained powders were sintered by using a controlled sintering rate schedule. Lower surfaces energies minimize the shrinkage during sintering and relative densities measurements and diametral compression test confirm improved densification and consequently mechanical properties. [es

  18. Processing of hydroxyapatite obtained by combustion synthesis

    Directory of Open Access Journals (Sweden)

    M. Canillas

    2017-09-01

    Full Text Available One of the reasons of implants failure are the stress forces appearing in the material–tissue interface due to the differences between their mechanical properties. For this reason, similar mechanical properties to the surrounding tissue are desirable. The synthesis of hydroxyapatite by solution combustion method and its processing have been studied in order to obtain fully dense ceramic bodies with improved mechanical strength. Combustion synthesis provides nanostructured powders characterized by a high surface area to facilitate the following sintering. Moreover, synthesis was conducted in aqueous and oxidizing media. Oxidizing media improve homogenization and increase the energy released during combustion. It gives rise to particles whose morphology and size suggest lower surface energies compared with aqueous media. The obtained powders were sintered by using a controlled sintering rate schedule. Lower surfaces energies minimize the shrinkage during sintering and relative densities measurements and diametral compression test confirm improved densification and consequently mechanical properties.

  19. Fragmentation of Ceramics in Rapid Expansion Mode

    Science.gov (United States)

    Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

    The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

  20. Dynamic effects in fragmentation reactions

    International Nuclear Information System (INIS)

    Bertsch, G. F.; Esbensen, H.

    2002-01-01

    Fragmentation reactions offer a useful tool to study the spectroscopy of halo nuclei, but the large extent of the halo wave function makes the reaction theory more difficult. The simple reaction models based on the eikonal approximation for the nuclear interaction or first-order perturbation theory for the Coulomb interaction have systematic errors that they investigate here, comparing to the predictions of complete dynamical calculations. They find that stripping probabilities are underpredicted by the eikonal model, leading to extracted spectroscopy strengths that are two large. In contrast, the Coulomb excitation is overpredicted by the simple theory. They attribute this to a screening effect, as is well known in the Barkas effect on stopping powers. The errors decrease with beam energy as E(sub beam)(sup -1), and are not significant at beam energies above 50 MeV/u. At lower beam energies, the effects should be taken into account when extracting quantitative spectroscopic strengths

  1. Therapeutic angiogenesis in ischemic muscles after local injection of fragmented fibers with loaded traditional Chinese medicine

    Science.gov (United States)

    Li, Huiyan; Wan, Huiying; Xia, Tian; Chen, Maohua; Zhang, Yun; Luo, Xiaoming; Li, Xiaohong

    2015-07-01

    Therapeutic angiogenesis remains the most effective method to re-establish a proper blood flow in ischemic tissues. There is a great clinical need to identify an injectable format to achieve a well accumulation following local administration and a sustained delivery of biological factors at the ischemic sites. In the current study, fragmented nanofibers with loaded traditional Chinese medicines, astragaloside IV (AT), the main active ingredient of astragalus, and ferulic acid (FA), the main ingredient of angelica, were proposed to promote the microvessel formation after intramuscular injection into ischemic hindlimbs. Fragmented fibers with average lengths of 5 (FF-5), 20 (FF-20) and 80 μm (FF-80) were constructed by the cryocutting of aligned electrospun fibers. Their dispersion in sodium alginate solution (0.2%) indicated good injectability. After injection into the quadriceps muscles of the hindlimbs, FF-20 and FF-80 fiber fragments showed higher tissue retentions than FF-5, and around 90% of the injected doses were determined after 7 days. On a hindlimb ischemia model established by ligating the femoral arteries, intramuscular injection of the mixtures of FA-loaded and AT-loaded FF-20 fiber fragments substantially reduced the muscle degeneration with minimal fibrosis formation, significantly enhanced the neovessel formation and hindlimb perfusion in the ischemic tissues, and efficiently promoted the limb salvage with few limb losses. Along with the easy manipulation and lower invasiveness for in vivo administration, fragmented fibers should become potential drug carriers for disease treatment, wound recovery and tissue repair after local injection.

  2. Radioimmunolocalization and selective delivery of radiation in a rat model system: comparison of intact and fragmented antibody

    International Nuclear Information System (INIS)

    Walker, K.Z.; Seymour-Munn, K.; Axiak, S.M.; Raison, R.L.; Basten, A.; Towson, J.E.; Bautovitch, G.J.; Morris, J.

    1988-01-01

    Monoclonal antibody (MoAb) fragments are known to have advantages over intact immunoglobulins for radioimmunoscintigraphy. It is less clear whether they are as effective in the delivery of radioimmunotherapy. The imaging and dosimetric properties of an intact MoAb, K-1-21, reactive against human kappa light chains (LC) were compared with that of its F(ab') 2 and Fab fragments using a normal rat model system. Two days after injection of 131 I-K-1-21 into rats bearing antigen-sepharose implants, gamma camera images showed specific localization of the MoAb to the target (kappa LC) but not to the control (lambda LC) implant. Better images were obtained with K-1-21 F(ab') 2 than with Fab or intact antibody. Mean kappa implant: blood ratios were 8.6 ± 3.9 for Fab, 7.9 ± 1.8 for F(ab') 2 and 2.0 ± 0.3 for intact K-1-21. The improvement associated with the use of 131 I-K-1-21 fragments was, however, achieved at the expense of lower absolute values of activity at the target site. Thus the absorbed dose delivered to the implant by the intact K-1-21 was double that delivered with F(ab') 2 and six times that delivered with Fab. As intact K-1-21 also delivered a greater radiation dose to normal tissues, F(ab') 2 fragments may have the greatest overall advantages for therapy with radionuclide MoAb conjugates. (author)

  3. Tissue engineering

    CERN Document Server

    Fisher, John P; Bronzino, Joseph D

    2007-01-01

    Increasingly viewed as the future of medicine, the field of tissue engineering is still in its infancy. As evidenced in both the scientific and popular press, there exists considerable excitement surrounding the strategy of regenerative medicine. To achieve its highest potential, a series of technological advances must be made. Putting the numerous breakthroughs made in this field into a broad context, Tissue Engineering disseminates current thinking on the development of engineered tissues. Divided into three sections, the book covers the fundamentals of tissue engineering, enabling technologies, and tissue engineering applications. It examines the properties of stem cells, primary cells, growth factors, and extracellular matrix as well as their impact on the development of tissue engineered devices. Contributions focus on those strategies typically incorporated into tissue engineered devices or utilized in their development, including scaffolds, nanocomposites, bioreactors, drug delivery systems, and gene t...

  4. Lead bullet fragments in venison from rifle-killed deer: potential for human dietary exposure.

    Directory of Open Access Journals (Sweden)

    W Grainger Hunt

    Full Text Available Human consumers of wildlife killed with lead ammunition may be exposed to health risks associated with lead ingestion. This hypothesis is based on published studies showing elevated blood lead concentrations in subsistence hunter populations, retention of ammunition residues in the tissues of hunter-killed animals, and systemic, cognitive, and behavioral disorders associated with human lead body burdens once considered safe. Our objective was to determine the incidence and bioavailability of lead bullet fragments in hunter-killed venison, a widely-eaten food among hunters and their families. We radiographed 30 eviscerated carcasses of White-tailed Deer (Odocoileus virginianus shot by hunters with standard lead-core, copper-jacketed bullets under normal hunting conditions. All carcasses showed metal fragments (geometric mean = 136 fragments, range = 15-409 and widespread fragment dispersion. We took each carcass to a separate meat processor and fluoroscopically scanned the resulting meat packages; fluoroscopy revealed metal fragments in the ground meat packages of 24 (80% of the 30 deer; 32% of 234 ground meat packages contained at least one fragment. Fragments were identified as lead by ICP in 93% of 27 samples. Isotope ratios of lead in meat matched the ratios of bullets, and differed from background lead in bone. We fed fragment-containing venison to four pigs to test bioavailability; four controls received venison without fragments from the same deer. Mean blood lead concentrations in pigs peaked at 2.29 microg/dL (maximum 3.8 microg/dL 2 days following ingestion of fragment-containing venison, significantly higher than the 0.63 microg/dL averaged by controls. We conclude that people risk exposure to bioavailable lead from bullet fragments when they eat venison from deer killed with standard lead-based rifle bullets and processed under normal procedures. At risk in the U.S. are some ten million hunters, their families, and low

  5. The content of manganese and iron in hip joint tissue.

    Science.gov (United States)

    Brodziak-Dopierała, Barbara; Kwapuliński, Jerzy; Sobczyk, Krzysztof; Wiechuła, Danuta

    2013-07-01

    Manganese and iron are elements that constitute components of bone tissue. The aim of this study was to determine presence of manganese and iron in hip joint tissue and interdependencies between these elements. The objects of the research were hip joint elements from people residing in cities on the territory of the Upper Silesian Industrial District. The number of people in the study group was 91 samples, including 66 samples from women and 25 from a man. The examined tissues were obtained intraoperatively during hip replacement procedures. The content of manganese and iron was determined using the atomic absorption spectrophotometry (AAS) method. The lowest content of manganese and iron was found in the cortical bone, and the largest, in the case of manganese, in the articular cartilage, whereas in the case of iron in a fragment of the cancellous bone from the intertrochanteric area. The content of iron in selected elements of the hip joint decreased with age. Higher content of manganese in hip joint tissue of women compared to men was confirmed. What is more, higher content of iron in hip joint tissue of men was confirmed as well. Copyright © 2012 Elsevier GmbH. All rights reserved.

  6. Relativistic heavy ion fragmentation at HISS [Heavy Ion Spectrometer System

    International Nuclear Information System (INIS)

    Tull, C.E.

    1990-10-01

    An experiment was conducted at the Lawrence Berkeley Laboratory to measure projectile fragmentation of relativistic heavy ions. Charge identification was obtained by the use of a Cerenkov Hodoscope operating above the threshold for total internal reflection, while velocity measurement was performed by use of a second set of Cerenkov radiators operating at the threshold for total internal reflection. Charge and mass resolution for the system was σ Z = 0.2 e and σ A = 0.2 u. Measurements of the elemental and isotopic production cross sections for the fragmentation of 40 Ar at 1.65·A GeV have been compared with an Abrasion-Ablation Model based on the evaporation computer code GEMINI. The model proves to be an accurate predictor of the cross sections for fragments between Chlorine and Boron. The measured cross section were reproduced using simple geometry with charge dispersions induced by zero-point vibrations of the giant dipole resonance for the prompt abrasion stage, and injecting an excitation energy spectrum based on a final state interaction with scaling factor E fsi = 38.8 MeV/c. Measurement of the longitudinal momentum distribution widths for projectile fragments are consistent with previous experiment and can be interpreted as reflecting the Fermi momentum distribution in the initial projectile nucleus. Measurement of the transverse momentum indicate an additional, unexplained dependence of the reduced momentum widths on fragment mass. This dependence has the same sign and similar slope to previously measured fragments of 139 La, and to predictions based on phase-space constraints on the final state of the system

  7. Fragment Size Distribution of Blasted Rock Mass

    Science.gov (United States)

    Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

    2017-12-01

    Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

  8. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium fredii RT19].

    Science.gov (United States)

    Bian, X L; Ge, S C; Yang, S S

    2000-01-01

    A 23 kb DNA fragment related to salt tolerance was obtained from the gene library of S. fredii strain RT19. In this study, BamH I was selected to digest 23 kb DNA fragment into different length of DNA fragments. The resulting fragments were ligated with plasmid pML122, then the recombinant plasmids were transformed to competent cells of E. coli S17-1 on selective medium and three transformants TR were obtained. Two-parental mating experiments were carried out with these transformants as donor and salt sensitive S. fredii strain RC3-3 as recipient, and the transconjugant BR2 was selected on FY plates containing gentamycin and 0.4 mol/L NaCl. Thus, a 4.4 kb DNA fragment related to salt tolerance was obtained. Based on its physical map, six restriction fragments were subcloned into plasmid pUC18 for DNA sequencing. Subsequently, sequencing and analysis of 4.4 kb DNA fragment showed that fixO, fixN genes and three ORFs were obtained.

  9. Gluon fragmentation in T(1S) decays

    International Nuclear Information System (INIS)

    Bienlein, J.K.

    1983-05-01

    In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

  10. Measuring the temperature of hot nuclear fragments

    International Nuclear Information System (INIS)

    Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.

    2010-01-01

    A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.

  11. In Vitro and In Vivo Differentiation of Progenitor Stem Cells Obtained After Mechanical Digestion of Human Dental Pulp.

    Science.gov (United States)

    Monti, Manuela; Graziano, Antonio; Rizzo, Silvana; Perotti, Cesare; Del Fante, Claudia; d'Aquino, Riccardo; Redi, Carlo Alberto; Rodriguez Y Baena, Ruggero

    2017-03-01

    Human population is facing a revolutionary change in the demographic structure with an increasing number of elderly people requiring an unmet need to ensure a smooth aging process and dental care is certainly an important aspect that has to be considered. To date, dentistry has been conservative and the need of transferring the scientific models of regenerative dentistry into clinical practice is becoming a necessity. The aim of this study was to characterize the differentiation commitment (in vitro) and the clinical grafting ability (in vivo) of a population of progenitor stem cells obtained after mechanical digestion of dental pulp with an innovative system recently developed. This approach was successfully used in previous studies to obtain a clinical-grade ready to use dental pulp fragments that could be grafted in autologous tissues to obtain bone. We are thus showing that micro grafts resulting from mechanical digestion contain stem cells with a mesenchymal phenotype, able to differentiate toward different cell types and to generate new bone in patients. We are providing data for the establishment of standardized and routinely oral surgery approaches, having outlined the cellular properties of human stem cells obtained from the dental pulp. This method can represent a valid tool for both regenerative medicine and tissue engineering purposes not only applicable to the cranio-maxillofacial region but, likely, to different bone pathologies for a fastening and healing recovering of patients. J. Cell. Physiol. 232: 548-555, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. DNA fragmentation and sperm head morphometry in cat epididymal spermatozoa.

    Science.gov (United States)

    Vernocchi, Valentina; Morselli, Maria Giorgia; Lange Consiglio, Anna; Faustini, Massimo; Luvoni, Gaia Cecilia

    2014-10-15

    Sperm DNA fragmentation is an important parameter to assess sperm quality and can be a putative fertility predictor. Because the sperm head consists almost entirely of DNA, subtle differences in sperm head morphometry might be related to DNA status. Several techniques are available to analyze sperm DNA fragmentation, but they are labor-intensive and require expensive instrumentations. Recently, a kit (Sperm-Halomax) based on the sperm chromatin dispersion test and developed for spermatozoa of different species, but not for cat spermatozoa, became commercially available. The first aim of the present study was to verify the suitability of Sperm-Halomax assay, specifically developed for canine semen, for the evaluation of DNA fragmentation of epididymal cat spermatozoa. For this purpose, DNA fragmentation indexes (DFIs) obtained with Sperm-Halomax and terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) were compared. The second aim was to investigate whether a correlation between DNA status, sperm head morphology, and morphometry assessed by computer-assisted semen analysis exists in cat epididymal spermatozoa. No differences were observed in DFIs obtained with Sperm-Halomax and TUNEL. This result indicates that Sperm-Halomax assay provides a reliable evaluation of DNA fragmentation of epididymal feline spermatozoa. The DFI seems to be independent from all the measured variables of sperm head morphology and morphometry. Thus, the evaluation of the DNA status of spermatozoa could effectively contribute to the completion of the standard analysis of fresh or frozen semen used in assisted reproductive technologies. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Changes in tree reproductive traits reduce functional diversity in a fragmented Atlantic forest landscape.

    Science.gov (United States)

    Girão, Luciana Coe; Lopes, Ariadna Valentina; Tabarelli, Marcelo; Bruna, Emilio M

    2007-09-19

    Functional diversity has been postulated to be critical for the maintenance of ecosystem functioning, but the way it can be disrupted by human-related disturbances remains poorly investigated. Here we test the hypothesis that habitat fragmentation changes the relative contribution of tree species within categories of reproductive traits (frequency of traits) and reduces the functional diversity of tree assemblages. The study was carried out in an old and severely fragmented landscape of the Brazilian Atlantic forest. We used published information and field observations to obtain the frequency of tree species and individuals within 50 categories of reproductive traits (distributed in four major classes: pollination systems, floral biology, sexual systems, and reproductive systems) in 10 fragments and 10 tracts of forest interior (control plots). As hypothesized, populations in fragments and control plots differed substantially in the representation of the four major classes of reproductive traits (more than 50% of the categories investigated). The most conspicuous differences were the lack of three pollination systems in fragments--pollination by birds, flies and non-flying mammals--and that fragments had a higher frequency of both species and individuals pollinated by generalist vectors. Hermaphroditic species predominate in both habitats, although their relative abundances were higher in fragments. On the contrary, self-incompatible species were underrepresented in fragments. Moreover, fragments showed lower functional diversity (H' scores) for pollination systems (-30.3%), floral types (-23.6%), and floral sizes (-20.8%) in comparison to control plots. In contrast to the overwhelming effect of fragmentation, patch and landscape metrics such as patch size and forest cover played a minor role on the frequency of traits. Our results suggest that habitat fragmentation promotes a marked shift in the relative abundance of tree reproductive traits and greatly reduces

  14. Changes in tree reproductive traits reduce functional diversity in a fragmented Atlantic forest landscape.

    Directory of Open Access Journals (Sweden)

    Luciana Coe Girão

    Full Text Available Functional diversity has been postulated to be critical for the maintenance of ecosystem functioning, but the way it can be disrupted by human-related disturbances remains poorly investigated. Here we test the hypothesis that habitat fragmentation changes the relative contribution of tree species within categories of reproductive traits (frequency of traits and reduces the functional diversity of tree assemblages. The study was carried out in an old and severely fragmented landscape of the Brazilian Atlantic forest. We used published information and field observations to obtain the frequency of tree species and individuals within 50 categories of reproductive traits (distributed in four major classes: pollination systems, floral biology, sexual systems, and reproductive systems in 10 fragments and 10 tracts of forest interior (control plots. As hypothesized, populations in fragments and control plots differed substantially in the representation of the four major classes of reproductive traits (more than 50% of the categories investigated. The most conspicuous differences were the lack of three pollination systems in fragments--pollination by birds, flies and non-flying mammals--and that fragments had a higher frequency of both species and individuals pollinated by generalist vectors. Hermaphroditic species predominate in both habitats, although their relative abundances were higher in fragments. On the contrary, self-incompatible species were underrepresented in fragments. Moreover, fragments showed lower functional diversity (H' scores for pollination systems (-30.3%, floral types (-23.6%, and floral sizes (-20.8% in comparison to control plots. In contrast to the overwhelming effect of fragmentation, patch and landscape metrics such as patch size and forest cover played a minor role on the frequency of traits. Our results suggest that habitat fragmentation promotes a marked shift in the relative abundance of tree reproductive traits and

  15. Equine preantral follicles obtained via the Biopsy Pick-Up method: histological evaluation and validation of a mechanical isolation technique.

    Science.gov (United States)

    Haag, K T; Magalhães-Padilha, D M; Fonseca, G R; Wischral, A; Gastal, M O; King, S S; Jones, K L; Figueiredo, J R; Gastal, E L

    2013-03-15

    The aims of this study in mares were to: (1) compare preantral follicle parameters between in vitro Biopsy Pick-Up (BPU) and scalpel blade collection methods and between histological and mechanical isolation processing (experiment 1); (2) histologically evaluate preantral follicles (experiment 2); and (3) compare histological analysis with a previously established mechanical isolation technique using a tissue chopper (experiment 3) for ovarian cortical fragments obtained in vivo using a BPU instrument. In experiment 1, preantral follicles were analyzed (N = 220; 90% primordial and 10% primary). Proportions of primordial and primary follicles did not differ (P > 0.05) between tissue collection (BPU vs. scalpel blade dissection) or processing (mechanical isolation vs. histology) methods. Follicle viability and morphology rates were similar (P > 0.05) between tissue collection methods, but mechanical isolation produced more (P histology. For experiment 2, preantral follicles (N = 332) were analyzed and primordial and transitional (combined) follicles and oocytes were 36.3 ± 0.3 and 26.1 ± 0.3 μm in diameter, respectively, and primary follicles and oocytes averaged 42.9 ± 1.8 and 31.8 ± 2.1 μm. For experiment 3 (188 preantral follicles), within the same animals, the proportion of primordial versus primary follicles was higher (P histological analysis (98%) compared to tissue chopper analysis (94%), and number of follicles per mg of tissue was not affected (P > 0.05) by processing methods. In conclusion, most parameters evaluated for preantral follicles were similar between histological and tissue chopper processing techniques; hence, mechanical isolation efficiently dissociated equine preantral follicles from the ovarian cortex. Therefore, the tissue chopper could be used to isolate large numbers of morphologically normal equine preantral follicles for cryopreservation and/or in vitro culture. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Delayed β ray spectrum of 235U fission fragments

    International Nuclear Information System (INIS)

    Pascholati, P.R.

    1973-01-01

    The time-dependent electron spectra of fission fragments from the thermal-neutron-induced fission of 235 U are calculated. The Gross theory of nuclear beta decay is used to obtain the decay constant and individual electron spectra. The mean energy per fission carried by the electrons and the number of electrons per fission are also calculated. Comparison of these calculated spectra to experimental ones shows good agreements. (Author) [pt

  17. Mechanisms Affecting Population Density in Fragmented Habitat

    Directory of Open Access Journals (Sweden)

    Lutz Tischendorf

    2005-06-01

    Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

  18. The fragmentation of prestellar clouds

    International Nuclear Information System (INIS)

    Ibanez S, M.H.

    1979-10-01

    The radiative heating problem has been solved analytically, in first approximation, for a semi-infinite cloud model with transverse fluctuations in extinction. The radiative heating problem has been solved with the help of a numerical (approximated) method for the following models: a) semi-infinite cloud with transverse fluctuations in extinction; b) finite cloud with mean optical thickness tau 0 and transverse fluctuations in extinction. Assuming isobaricity as a first approximation, the chemical equation for H 2 formation (in non-equilibrium condition) and the energy equation were solved numerically like a two boundary-value problem. The conditions under which H 2 formation can induce fragmentation in a contracting cloud are examined. A study (in orders of magnitude) of the turbulence as a mechanism generator of density fluctuations has been done. If the Kolmogorov spectral law is assumed, subsonic turbulence is enough to provide any prestellar cloud with the elemental fluctuations which are effectively amplified by molecule formation in a time shorter than one free-fall. (author)

  19. Decoupling habitat fragmentation from habitat loss: butterfly species mobility obscures fragmentation effects in a naturally fragmented landscape of lake islands.

    Science.gov (United States)

    MacDonald, Zachary G; Anderson, Iraleigh D; Acorn, John H; Nielsen, Scott E

    2018-01-01

    Since the publication of the theory of island biogeography, ecologists have postulated that fragmentation of continuous habitat presents a prominent threat to species diversity. However, negative fragmentation effects may be artifacts; the result of species diversity declining with habitat loss, and habitat loss correlating positively with degree of fragmentation. In this study, we used butterfly assemblages on islands of Lake of the Woods, Ontario, Canada to decouple habitat fragmentation from habitat loss and test two competing hypotheses: (1) the island effect hypothesis, which predicts that decreasing fragment size and increasing fragment isolation reduces species diversity beyond the effects of habitat loss, and (2) the habitat amount hypothesis, which negates fragmentation effects and predicts that only total habitat area determines the diversity of species persisting on fragmented landscapes. Using eight independent size classes of islands (ranging from 0.1 to 8.0 ha) that varied in number of islands while holding total area constant, species diversity comparisons, species accumulation curves, and species-area relationship extrapolations demonstrated that smaller insular habitats contained at least as many butterfly species as continuous habitat. However, when highly mobile species occurring on islands without their larval food plants were excluded from analyses, island effects on potentially reproducing species became apparent. Similarily, generalized linear models suggested that effects of island isolation and vascular plant richness on insular butterfly richness were confounded by species of high mobility. We conclude that inter-fragment movements of highly mobile species may obscure important fragmentation effects on potentially reproducing populations, questioning support for the habitat amount hypothesis.

  20. Tissue types (image)

    Science.gov (United States)

    There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue. Connective tissue ... and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of ...

  1. Tissue Photolithography

    Science.gov (United States)

    Wade, Lawrence A.; Kartalov, Emil; Shibata, Darryl; Taylor, Clive

    2011-01-01

    Tissue lithography will enable physicians and researchers to obtain macromolecules with high purity (greater than 90 percent) from desired cells in conventionally processed, clinical tissues by simply annotating the desired cells on a computer screen. After identifying the desired cells, a suitable lithography mask will be generated to protect the contents of the desired cells while allowing destruction of all undesired cells by irradiation with ultraviolet light. The DNA from the protected cells can be used in a number of downstream applications including DNA sequencing. The purity (i.e., macromolecules isolated form specific cell types) of such specimens will greatly enhance the value and information of downstream applications. In this method, the specific cells are isolated on a microscope slide using photolithography, which will be faster, more specific, and less expensive than current methods. It relies on the fact that many biological molecules such as DNA are photosensitive and can be destroyed by ultraviolet irradiation. Therefore, it is possible to protect the contents of desired cells, yet destroy undesired cells. This approach leverages the technologies of the microelectronics industry, which can make features smaller than 1 micrometer with photolithography. A variety of ways has been created to achieve identification of the desired cell, and also to designate the other cells for destruction. This can be accomplished through chrome masks, direct laser writing, and also active masking using dynamic arrays. Image recognition is envisioned as one method for identifying cell nuclei and cell membranes. The pathologist can identify the cells of interest using a microscopic computerized image of the slide, and appropriate custom software. In one of the approaches described in this work, the software converts the selection into a digital mask that can be fed into a direct laser writer, e.g. the Heidelberg DWL66. Such a machine uses a metalized glass plate (with

  2. A note on convex renorming and fragmentability

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Using the game approach to fragmentability, we give new and simpler proofs of the following known results: (a) If the Banach space admits an equivalent. Kadec norm, then its weak topology is fragmented by a metric which is stronger than the norm topology. (b) If the Banach space admits an equivalent rotund ...

  3. Fragmentation of eastern United States forest types

    Science.gov (United States)

    Kurt H. Riitters; John W. Coulston

    2013-01-01

    Fragmentation is a continuing threat to the sustainability of forests in the Eastern United States, where land use changes supporting a growing human population are the primary driver of forest fragmentation (Stein and others 2009). While once mostly forested, approximately 40 percent of the original forest area has been converted to other land uses, and most of the...

  4. Thermodynamics of the fuel fragmentation gas

    International Nuclear Information System (INIS)

    Perez, R.B.; Alsmiller, R.G. Jr.

    1977-01-01

    In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

  5. Evaluation of thyroid tissue by Raman spectroscopy

    Science.gov (United States)

    Teixeira, C. S. B.; Bitar, R. A.; Santos, A. B. O.; Kulcsar, M. A. V.; Friguglietti, C. U. M.; Martinho, H. S.; da Costa, R. B.; Martin, A. A.

    2010-02-01

    Thyroid gland is a small gland in the neck consisting of two lobes connected by an isthmus. Thyroid's main function is to produce the hormones thyroxine (T4), triiodothyronine (T3) and calcitonin. Thyroid disorders can disturb the production of these hormones, which will affect numerous processes within the body such as: regulating metabolism and increasing utilization of cholesterol, fats, proteins, and carbohydrates. The gland itself can also be injured; for example, neoplasias, which have been considered the most important, causing damage of to the gland and are difficult to diagnose. There are several types of thyroid cancer: Papillary, Follicular, Medullary, and Anaplastic. The occurrence rate, in general is between 4 and 7%; which is on the increase (30%), probably due to new technology that is able to find small thyroid cancers that may not have been found previously. The most common method used for thyroid diagnoses are: anamnesis, ultrasonography, and laboratory exams (Fine Needle Aspiration Biopsy- FNAB). However, the sensitivity of those test are rather poor, with a high rate of false-negative results, therefore there is an urgent need to develop new diagnostic techniques. Raman spectroscopy has been presented as a valuable tool for cancer diagnosis in many different tissues. In this work, 27 fragments of the thyroid were collected from 18 patients, comprising the following histologic groups: goitre adjacent tissue, goitre nodular tissue, follicular adenoma, follicular carcinoma, and papillary carcinoma. Spectral collection was done with a commercial FTRaman Spectrometer (Bruker RFS100/S) using a 1064 nm laser excitation and Ge detector. Principal Component Analysis, Cluster Analysis, and Linear Discriminant Analysis with cross-validation were applied as spectral classification algorithm. Comparing the goitre adjacent tissue with the goitre nodular region, an index of 58.3% of correct classification was obtained. Between goitre (nodular region and

  6. Fragmentation versus stability in bimodal coalitions

    Science.gov (United States)

    Galam, Serge

    1996-02-01

    Competing bimodal coalitions among a group of actors are discussed. First, a model from political sciences is revisited. Most of the model statements are found not to be contained in the model. Second, a new coalition model is built. It accounts for local versus global alignment with respect to the joining of a coalition. The existence of two competing world coalitions is found to yield one unique stable distribution of actors. On the opposite a unique world leadership allows the emergence of unstable relationships. In parallel to regular actors which have a clear coalition choice, “neutral”, “frustrated” and “risky” actors are produced. The cold war organisation after world war II is shown to be rather stable. The emergence of a fragmentation process from eastern group disappearance is explained as well as continuing western group stability. Some hints are obtained about possible policies to stabilize world nation relationships. European construction is analyzed with respect to European stability. Chinese stability is also discussed.

  7. Evaluation of thermobarometry for spinel lherzolite fragments in alkali basalts

    Science.gov (United States)

    Ozawa, Kazuhito; Youbi, Nasrrddine; Boumehdi, Moulay Ahmed; McKenzie, Dan; Nagahara, Hiroko

    2017-04-01

    Geothermobarometry of solid fragments in kimberlite and alkali basalts, generally called "xenoliths", provides information on thermal and chemical structure of lithospheric and asthenospheric mantle, based on which various chemical, thermal, and rheological models of lithosphere have been constructed (e.g., Griffin et al., 2003; McKenzie et al., 2005; Ave Lallemant et al., 1980). Geothermobarometry for spinel-bearing peridotite fragments, which are frequently sampled from Phanerozoic provinces in various tectonic environments (Nixon and Davies, 1987), has essential difficulties, and it is usually believed that appropriated barometers do not exist for them (O'Reilly et al., 1997; Medaris et al., 1999). Ozawa et al. (2016; EGU) proposed a method of geothermobarometry for spinel lherzolite fragments. They applied the method to mantle fragments in alkali basalts from Bou Ibalhatene maars in the Middle Atlas in Morocco (Raffone et al. 2009; El Azzouzi et al., 2010; Witting et al., 2010; El Messbahi et al., 2015). Ozawa et al. (2016) obtained 0.5GPa pressure difference (1.5-2.0GPa) for 100°C variation in temperatures (950-1050°C). However, it is imperative to verify the results on the basis of completely independent data. There are three types of independent information: (1) time scale of solid fragment extraction, which may be provided by kinetics of reactions induced by heating and/or decompression during their entrapment in the host magma and transportation to the Earth's surface (Smith, 1999), (2) depth of the host basalt formation, which may be provided by the petrological and geochemical studies of the host basalts, and (3) lithosphere-asthenosphere boundary depths, which may be estimated by geophysical observations. Among which, (3) is shown to be consistent with the result in Ozawa et al. (2016). We here present that the estimated thermal structure just before the fragment extraction is fully supported by the information of (1) and (2). Spera (1984) reviewed

  8. Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

    Directory of Open Access Journals (Sweden)

    S. C. Oukouomi Noutchie

    2014-01-01

    Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

  9. Comparison of SEC and CE-SDS methods for monitoring hinge fragmentation in IgG1 monoclonal antibodies.

    Science.gov (United States)

    Dada, Oluwatosin O; Rao, Romesh; Jones, Natalie; Jaya, Nomalie; Salas-Solano, Oscar

    2017-10-25

    Fragmentation of monoclonal antibodies is a critical quality attribute routinely monitored to assess the purity and integrity of the product from development to commercialization. Cleavage in the upper hinge region of IgG1 monoclonal antibodies is a common fragmentation pattern widely studied by size exclusion chromatography (SEC). Capillary electrophoresis with sodium dodecylsulfate (CE-SDS) is a well-established technique commonly used for monitoring antibody fragments as well, but its comparability to SEC in monitoring hinge fragments has not been established until now. We report a characterization strategy that establishes the correlation between hinge region fragments analyzed by SEC and CE-SDS. Monoclonal antibodies with elevated hinge fragments were generated under low pH stress conditions and analyzed by SEC and CE-SDS. The masses of the fragments generated were determined by LC-MS. Electrophoretic migration of the hinge fragmentation products in CE-SDS were determined based on their mass values. Comparative assessment of fragments by SEC, and CE-SDS showed similar correlation with incubation time. This study demonstrates that CE-SDS can be employed as a surrogate technique to SEC for monitoring hinge region fragments. Most importantly, combination of these techniques can be used to obtain comprehensive understanding of fragment related characteristics of therapeutic protein products. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Cultures of skin fragments of Salamandra salamandra salamandra (L.) larvae.

    Science.gov (United States)

    Pederzoli, A; Restani, C

    1998-04-01

    As part of a study on the pigmentary system of Salamandra salamandra salamandra (L.), we cultured skin fragments of 7-10-day-old larvae in order to examine the expression of molecules implicated in cellular adhesion and migration and in regulating cell-cell relationships. Keratinocytes, fibroblasts, Leydig cells, xanthophores, and melanophores migrated from the fragments and were observed in the outgrowth. Keratinocytes and fibroblasts organized into an epidermal layer and an underlying "dermal portion." The chromatophores were always located below the epithelial cells, often with fibroblasts. We examined by immunocytochemistry the expression of fibronectin, beta1-integrin, L-CAM, and A-CAM in the cultures. Many keratinocytes, fibroblasts, and Leydig cells expressed all the signal molecules tested. Xanthophores and melanophores were only immunoreactive to the anti-adhesion molecules antisera. Since the molecules tested are known to play a role in cell adhesion, growth, and spreading, as well as in regulating tissue differentiation and in maintaining normal tissue morphology, we may hypothesize that in Salamandra salamandra salamandra fibronectin, beta1-integrin, L-, and A-CAMs concertedly act to stabilize the architecture of the outgrowth and regulate the relationships between chromatophores and those between chromatophores and the other elements of the skin culture.

  11. Filamentary fragmentation in a turbulent medium

    Science.gov (United States)

    Clarke, S. D.; Whitworth, A. P.; Duarte-Cabral, A.; Hubber, D. A.

    2017-06-01

    We present the results of smoothed particle hydrodynamic simulations investigating the evolution and fragmentation of filaments that are accreting from a turbulent medium. We show that the presence of turbulence and the resulting inhomogeneities in the accretion flow play a significant role in the fragmentation process. Filaments that experience a weakly turbulent accretion flow fragment in a two-tier hierarchical fashion, similar to the fragmentation pattern seen in the Orion Integral Shaped Filament. Increasing the energy in the turbulent velocity field results in more sub-structure within the filaments, and one sees a shift from gravity-dominated fragmentation to turbulence-dominated fragmentation. The sub-structure formed in the filaments is elongated and roughly parallel to the longitudinal axis of the filament, similar to the fibres seen in observations of Taurus, and suggests that the fray and fragment scenario is a possible mechanism for the production of fibres. We show that the formation of these fibre-like structures is linked to the vorticity of the velocity field inside the filament and the filament's accretion from an inhomogeneous medium. Moreover, we find that accretion is able to drive and sustain roughly sonic levels of turbulence inside the filaments, but is not able to prevent radial collapse once the filaments become supercritical. However, the supercritical filaments that contain fibre-like structures do not collapse radially, suggesting that fibrous filaments may not necessarily become radially unstable once they reach the critical line-density.

  12. On disciplinary fragmentation and scientific progress.

    Directory of Open Access Journals (Sweden)

    Stefano Balietti

    Full Text Available Why are some scientific disciplines, such as sociology and psychology, more fragmented into conflicting schools of thought than other fields, such as physics and biology? Furthermore, why does high fragmentation tend to coincide with limited scientific progress? We analyzed a formal model where scientists seek to identify the correct answer to a research question. Each scientist is influenced by three forces: (i signals received from the correct answer to the question; (ii peer influence; and (iii noise. We observed the emergence of different macroscopic patterns of collective exploration, and studied how the three forces affect the degree to which disciplines fall apart into divergent fragments, or so-called "schools of thought". We conducted two simulation experiments where we tested (A whether the three forces foster or hamper progress, and (B whether disciplinary fragmentation causally affects scientific progress and vice versa. We found that fragmentation critically limits scientific progress. Strikingly, there is no effect in the opposite causal direction. What is more, our results shows that at the heart of the mechanisms driving scientific progress we find (i social interactions, and (ii peer disagreement. In fact, fragmentation is increased and progress limited if the simulated scientists are open to influence only by peers with very similar views, or when within-school diversity is lost. Finally, disciplines where the scientists received strong signals from the correct answer were less fragmented and experienced faster progress. We discuss model's implications for the design of social institutions fostering interdisciplinarity and participation in science.

  13. A study of τ , the critical exponent of nuclear fragmentation

    International Nuclear Information System (INIS)

    Cardenas, R.; Lopez, J.A.; Barranon, A.; Dorso, C.O.

    2001-01-01

    Full text: When nuclei break into pieces, fragments with different sizes mass and charge numbers, are generated. Using the Fisher droplet model this fragmentation process can be characterized as a second order phase transitions of the excited nuclear matter. For breakups occurring near the critical point, the mass distribution should obeys a power law of the form ∼ A - τ , with τ being a critical exponent, apparently universal to processes at different scales with values within 2 ≤ τ ≤3. In this work we study the behavior of this exponent considering four different models. In summary the findings are as follows. Using percolation theory for a cubic system with 216 sites, a value of τ = 2.3 was obtained. A spherical system, also yielded a value of τ = 2.3. The third model, consisting of two 74-particle colliding nuclei interacting via a Lennard-Jones potential, also produced fragments with a power law distribution of τ = 2.3. Finally, studying a series of collisions of 147-particle nuclei using a more realistic potential (Pandharipande), a τ = 1.92 was obtained. This last result, however, can be expected for breakups not occurring near the critical point. Further refinements of this last study are in progress. JAL acknowledges support from the National Science Foundation, through grant PHY-96-00038. (Author)

  14. Mass measurements of exotic fragments

    International Nuclear Information System (INIS)

    Schutz, Y.

    1990-01-01

    Some of the experiments on exotic nuclei performed at Ganil are discussed. Data on the reaction cross section induced by exotic beams is summarized. A new technique developed to perform mass measurements at Ganil is described. Measurements in the N=20 region are presented. A mass resolution of about 3 x 10 -4 is obtained

  15. Monte Carlo simulation as a tool to predict blasting fragmentation based on the Kuz Ram model

    Science.gov (United States)

    Morin, Mario A.; Ficarazzo, Francesco

    2006-04-01

    Rock fragmentation is considered the most important aspect of production blasting because of its direct effects on the costs of drilling and blasting and on the economics of the subsequent operations of loading, hauling and crushing. Over the past three decades, significant progress has been made in the development of new technologies for blasting applications. These technologies include increasingly sophisticated computer models for blast design and blast performance prediction. Rock fragmentation depends on many variables such as rock mass properties, site geology, in situ fracturing and blasting parameters and as such has no complete theoretical solution for its prediction. However, empirical models for the estimation of size distribution of rock fragments have been developed. In this study, a blast fragmentation Monte Carlo-based simulator, based on the Kuz-Ram fragmentation model, has been developed to predict the entire fragmentation size distribution, taking into account intact and joints rock properties, the type and properties of explosives and the drilling pattern. Results produced by this simulator were quite favorable when compared with real fragmentation data obtained from a blast quarry. It is anticipated that the use of Monte Carlo simulation will increase our understanding of the effects of rock mass and explosive properties on the rock fragmentation by blasting, as well as increase our confidence in these empirical models. This understanding will translate into improvements in blasting operations, its corresponding costs and the overall economics of open pit mines and rock quarries.

  16. Heart Rate Fragmentation: A Symbolic Dynamical Approach

    Directory of Open Access Journals (Sweden)

    Madalena D. Costa

    2017-11-01

    Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

  17. WHAT IS CONTROLLING THE FRAGMENTATION IN THE INFRARED DARK CLOUD G14.225–0.506?: DIFFERENT LEVELS OF FRAGMENTATION IN TWIN HUBS

    Energy Technology Data Exchange (ETDEWEB)

    Busquet, Gemma; Girart, Josep Miquel [Institut de Ciències de l’Espai (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193, Cerdanyola del Vallès, Catalunya (Spain); Estalella, Robert [Departament d’Astronomia i Meteorologia, Institut de Ciències del Cosmos (ICC), Universitat de Barcelona (IEEC-UB), Martí i Franquès, 1, E-08028 Barcelona, Catalunya (Spain); Palau, Aina [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán, México (Mexico); Liu, Hauyu Baobab; Ho, Paul T. P. [Academia Sinica Institute of Astronomy and Astrophysics, Taipei, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); De Gregorio-Monsalvo, Itziar [European Southern Observatory (ESO), Karl-Schwarzschild-Str. 2, D-85748 Garching (Germany); Pillai, Thushara [Max Planck Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Anglada, Guillem, E-mail: busquet@ice.cat [Instituto de Astrofísica de Andalucía, CSIC, Glorieta de la Astronomía, s/n, E-18008, Granada (Spain)

    2016-03-20

    We present observations of the 1.3 mm continuum emission toward hub-N and hub-S of the infrared dark cloud G14.225–0.506 carried out with the Submillimeter Array, together with observations of the dust emission at 870 and 350 μm obtained with APEX and CSO telescopes. The large-scale dust emission of both hubs consists of a single peaked clump elongated in the direction of the associated filament. At small scales, the SMA images reveal that both hubs fragment into several dust condensations. The fragmentation level was assessed under the same conditions and we found that hub-N presents 4 fragments while hub-S is more fragmented, with 13 fragments identified. We studied the density structure by means of a simultaneous fit of the radial intensity profile at 870 and 350 μm and the spectral energy distribution adopting a Plummer-like function to describe the density structure. The parameters inferred from the model are remarkably similar in both hubs, suggesting that density structure could not be responsible for determining the fragmentation level. We estimated several physical parameters, such as the level of turbulence and the magnetic field strength, and we found no significant differences between these hubs. The Jeans analysis indicates that the observed fragmentation is more consistent with thermal Jeans fragmentation compared with a scenario in which turbulent support is included. The lower fragmentation level observed in hub-N could be explained in terms of stronger UV radiation effects from a nearby H ii region, evolutionary effects, and/or stronger magnetic fields at small scales, a scenario that should be further investigated.

  18. Low fragment polyatomic molecular ion source by using permanent magnets.

    Science.gov (United States)

    Takeuchi, Mitsuaki; Hayashi, Kyouhei; Imanaka, Kousuke; Ryuto, Hiromichi; Takaoka, Gikan H

    2014-02-01

    Electron-ionization-type polyatomic molecular ion source with low fragment was developed by using a pair of ring-shaped Sm-Co magnets. The magnets were placed forward and backward side of ionization part to confine electrons extracted from a thermionic cathode. Calculated electron trajectory of the developed ion source was 20 times longer than that of an ordinary outer filament configuration that has no magnetic confinement. Mass spectra of the molecular ions generated from n-tetradecane (C14H30) gas exhibited 4 times larger intensity than that of the ordinary configuration in a range of mass/charge from 93 to 210 u. This indicates that suppression of fragment ion was obtained by increase of low energy electrons resulted from the electron confinement.

  19. Effectiveness in detecting fission fragments with ionization chambers

    International Nuclear Information System (INIS)

    Manrique Garcia, J.; Monne, G.

    1991-01-01

    Detection of fission fragments is important in nuclear measurements. When a high detection accuracy is required it is necessary to take in account the detection losses due to the absorption of fragments in the fissionable material. The losses corrections might change the final results in 2-3%. The traditional expression used in the calculation of the detection efficiency does not consider neither the density variation of the fissionable substance with its width, because it depends on the target material. That's why actually in many labs it is being searched new methods that allow to find the efficiency for each target. In this work a new method for determination of absorption efficiency is presented. The obtained results are analyzed

  20. Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.

    2005-06-01

    For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)

  1. Comparison of methods for detection of Toxoplasma gondii in tissues of naturally exposed pigs.

    Science.gov (United States)

    Bezerra, Rodrigo A; Carvalho, Fábio S; Guimarães, Luciana A; Rocha, Daniele S; Silva, Fabiana L; Wenceslau, Amauri A; Albuquerque, George R

    2012-02-01

    This study aimed to compare the sensitivity of five diagnostic methods commonly used for the detection of Toxoplasma gondii in tissues of naturally infected pigs. We purchased 20 heads of pigs in butcher shops in the city of Ilhéus, Bahia. Brain and tongue fragments were taken from each animal for the performance of PCR against T. gondii. The rest of these two tissues were processed and inoculated into three mice. These rodents were observed for 42 days and euthanized. We prepared slides with brain and lungs of each mouse for the visualization of T. gondii. From the tissues of mice, we carried out polymerase chain reaction (PCR), histopathology, and immunohistochemistry in an attempt to identify the parasite. The PCR direct from the tissue of pigs showed 10% (2/20) of positive samples, all from the brain. PCR in tissue from mice found that 55% (11/20) of pigs were positive: 55% (11/20) and 45% (9/20) for brains and tongues, respectively. Mice were inoculated with material obtained from the samples and examined by various methods for resulting Toxoplasma infection (bioassay). Cyst detection in bioassay mice identified 25% (5/20) and immunohistochemistry 30% (6/20) of the samples pigs as positive for T. gondii. Histopathology of mice tissue could not detect parasite; only suggestive pathological changes such as inflammation with foci of necrosis were seen. The results indicated PCR of mice tissue as the most sensitive among those tested.

  2. Antimicrobial resistance profile of Staphylococcus aureus isolates obtained from skin and soft tissue infections of outpatients from a university hospital in Recife -PE, Brazil Perfil de resistência antimicrobiana de isolados de Staphylococcus aureus provenientes de infecções de pele e tecidos moles de pacientes ambulatoriais de um hospital universitário em Recife - PE, Brasil

    Directory of Open Access Journals (Sweden)

    Fabiana Beserra Caraciolo

    2012-12-01

    Full Text Available BACKGROUND: Staphylococcus aureus has a notable ability to acquire resistance to antibiotics, and methicillin resistance represents a growing public health problem. Methicillin-resistant S. aureus (MRSA has also become important outside the hospital environment, particularly in the United States. In Brazil, since 2005, cases of community skin infections caused by MRSA have been reported, but resistance studies involving outpatients are scarce. OBJECTIVE: To know the resistance profile of S. aureus involved in skin and soft tissue infections of patients seen at the Dermatology outpatient clinic of a university hospital in Recife, Pernambuco State, northeastern Brazil. METHODS: Prospective study involving 30 patients with skin and soft tissue infections, seen at the Dermatology outpatient clinic from May until November 2011. To evaluate the susceptibility of S. aureus to antibiotics, the disk diffusion method and oxacillin screening agar were used. RESULTS: From a total of 30 samples of skin lesions, 19 (63% had positive culture for S. aureus. The following resistance patterns of S. aureus were observed: penicillin, 95%; tetracycline, 32%; erythromycin, 21%; gentamicin, 16%; cefoxitin, 11%; oxacillin, 11%; trimethoprim-sulfamethoxazole, 11%; chloramphenicol, 11%; clindamycin, 5% ; and ciprofloxacin, 0%. One of the identified MRSA was obtained from a patient without risk factors for its acquisition, and was resistant, beyond to the beta-lactams, only to tetracycline. CONCLUSIONS: With regard to the resistance patterns of S. aureus, resistances to tetracycline, erythromycin and gentamicin were the highest. It was documented, for the first time in Pernambuco, a case of skin infection caused by community-associated MRSA.FUNDAMENTOS: O Staphylococcus aureus possui uma notável habilidade de adquirir resistência antimicrobiana, sendo a resistência à meticilina um problema de saúde pública crescente. O S. aureus resistente à meticilina (MRSA vem se

  3. Crescimento, produção e absorção de nitrogênio do alho proveniente de cultura de tecidos, cultivado com doses elevadas de nitrogênio Growth, yield and nitrogen uptake in garlic obtained by tissue culture, cultivated under high nitrogen levels

    Directory of Open Access Journals (Sweden)

    Francisco V Resende

    2000-03-01

    accumulation showed a quadratic response, reaching maximum values at N levels of 180 and 164 kg/ha, respectively. The N-accumulation on leaves and bulbs also followed the quadratic behaviour, although only the bulb showed a maximum value of N-accumulation under the level of 182 kg/ha. For total yield, a quadratic effect was observed, increasing up to 234 kg/ha of N. The commercial yield was negatively affected by the high N levels, showing a quadratic effect. The maximum estimated commercial yield (18.74 t/ha was obtained under 194.4 kg/ha of N. Garlic plants originated from tissue culture had better response to higher N levels than those whose bulbs were multiplied in the field. Highly significant correlations were observed between N-accumulation and the plant production components.

  4. Fragmentation of water on swift {sup 3}He{sup 2+} ion impact

    Energy Technology Data Exchange (ETDEWEB)

    Sabin, John R. [Quantum Theory Project, Departments of Chemistry and Physics, P.O. Box 118435, University of Florida, Gainesville, FL 32611-8435 (United States); Institut for Fysik og Kemi, Suddansk Universitet, 5230 Odense M (Denmark)], E-mail: sabin@qtp.ufl.edu; Cabrerra-Trujillo, Remigio [Instituto de Ciencias Fisicas, Universidad Nacional Autonoma de Mexico, Apartado Postal 48-3, Cuernavaca, Morelos 62251 (Mexico); Stolterfoht, Nikolaus [Hahn-Meitner Institut, Glienickerstrasse 100, D-14109 Berlin (Germany); Deumens, Erik; Ohrn, Yngve [Quantum Theory Project, Departments of Chemistry and Physics, P.O. Box 118435, University of Florida, Gainesville, FL 32611-8435 (United States)

    2009-01-15

    Charge exchange and fragmentation are the usual results in ion-molecule collision systems, and the specifics of the fragmentation process determine the chemical destiny of the target system. In this paper, we report recent progress on calculations of the fragmentation patterns for the model system He{sup 2+} + H{sub 2}O for projectile energies of a few keV. The calculations are obtained using the electron-nuclear dynamics (END) method for solution of the time-dependent Schroedinger equation.

  5. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  6. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  7. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  8. Relationship between morphological and amplified fragment length ...

    African Journals Online (AJOL)

    Relationship between morphological and amplified fragment length polymorphism (AFLP) marker based genetic distance with heterosis in hot pepper (Capsicum annuum L.) SL Krishnamurthy, A Mohan Rao, K Madhavi Reddy, S Ramesh, Shailaja Hittalmani, Rao M. Gopinath ...

  9. Extraction of 16th Century Calender Fragments

    DEFF Research Database (Denmark)

    Holck, Jakob Povl; Etheridge, Christian

    The extraction of the calendar fragments requires a careful dissolvement of the old bookbinder’s glue and a meticulous detachment of each calendar leaf. For documentation, each leaf is being photographed by the conservator of Odense City Museums. The 1580 book has an outer cover of parchment made...... at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

  10. An improved algorithm for MFR fragment assembly

    International Nuclear Information System (INIS)

    Kontaxis, Georg

    2012-01-01

    A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.

  11. The NJL Model for Quark Fragmentation Functions

    Energy Technology Data Exchange (ETDEWEB)

    T. Ito, W. Bentz, I. Cloet, A W Thomas, K. Yazaki

    2009-10-01

    A description of fragmentation functions which satisfy the momentum and isospin sum rules is presented in an effective quark theory. Concentrating on the pion fragmentation function, we first explain the reason why the elementary (lowest order) fragmentation process q → qπ is completely inadequate to describe the empirical data, although the “crossed” process π → qq describes the quark distribution functions in the pion reasonably well. Then, taking into account cascade-like processes in a modified jet-model approach, we show that the momentum and isospin sum rules can be satisfied naturally without introducing any ad-hoc parameters. We present numerical results for the Nambu-Jona-Lasinio model in the invariant mass regularization scheme, and compare the results with the empirical parametrizations. We argue that this NJL-jet model provides a very useful framework to calculate the fragmentation functions in an effective chiral quark theory.

  12. An improved algorithm for MFR fragment assembly.

    Science.gov (United States)

    Kontaxis, Georg

    2012-06-01

    A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.

  13. The SOFIA experiment: Measurement of 236U fission fragment yields in inverse kinematics

    Directory of Open Access Journals (Sweden)

    Grente L.

    2016-01-01

    Full Text Available The SOFIA (Studies On FIssion with Aladin experiment aims at measuring fission-fragments isotopic yields with high accuracy using inverse kinematics at relativistic energies. This experimental technique allows to fully identify the fission fragments in nuclear charge and mass number, thus providing very accurate isotopic yields for low energy fission of a large variety of fissioning systems. This report focuses on the latest results obtained with this set-up concerning electromagnetic-induced fission of 236U.

  14. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium meliloti 042B].

    Science.gov (United States)

    Ge, S; Fan, Z; Chen, X; Yang, S

    2001-02-01

    A 4 kb ClaI DNA fragment related to salt tolerance from S. meliloti 042B was digested by HindIII down 2.4 kb fragment, and a 1.6 kb ClaII-HindIII fragment was retained on plasmid pML122. Then, the 2.4 kb DNA fragment was ligated with plasmid pBBR1-MCS2, and the recombinant plasmid was transformed to E. coli DH5 alpha, and transformant GS2 was obtained. Three-parental mating experiments were carried out with transformant GS2 as donor, salt sensitive strains GZ17 as recipient and pRK2013 as helper plasmid, then the transconjugant GG2 was selected on FY plates containing kanamycin and 0.4 mol/L NaCl. The remaining DNA fragment was self ligated with pML122 and then transformed into E. coli S17-1 and transformat GS0 was obtained. Two-parental mating experiment was carried out with transformant GS0 as donor and salt sensitive strain GZ17 as recipient, but no transconjugant was obtained on the FY plates. Then, the 2.4 kb HindIII DNA fragment was ligated into sequencing vector pGEM-7Zf(+) for sequencing. The result of sequencing and analysis showed that the 2.4 kb DNA fragment contained three ORFs. According to the result of sequencing, further subcloning was conducted and 1.9 kb HindIII-Sac II DNA fragment related to salt tolerance was obtained.

  15. Fragon: rapid high-resolution structure determination from ideal protein fragments

    OpenAIRE

    Jenkins, Huw Thomas

    2018-01-01

    Correctly positioning ideal protein fragments by molecular replacement presents an attractive method for obtaining preliminary phases when no template structure for molecular replacement is available. This has been exploited in several existing pipelines. This paper presents a new pipeline, named Fragon, in which fragments (ideal α-helices or β-strands) are placed using Phaser and the phases calculated from these coordinates are then improved by the density-modification methods provided by AC...

  16. In vitro and in vivo tumor models for studies of distribution of radiolabelled monoclonal antibodies and fragments

    International Nuclear Information System (INIS)

    Buchegger, F.; Halpern, S.E.; Sutherland, R.M.; Schreyer, M.; Mach, J.P.; Rochester Univ., NY

    1986-01-01

    Colon carcinoma multicellular spheroids were incubated in vitro with radiolabelled MAbs. The more rapid penetration of fragments as compared to intact MAbs was clearly demonstrated. For the study of antibody localization in tumors in vivo, the model of nude mice with ligated kidneys was used. Although very artificial, this model allowed to demonstrate that, without urinary excretion, Fab fragments accumulated more rapidly into the tumor than intact MAbs and disappeared faster from the blood. This difference was less striking for F(ab') 2 fragments. In the liver a decreased accumulation of both types of fragments as compared to intact MAbs was observed. Concerning radio-immunotherapy we think that Fab fragments are not useful because of their too short half-life the circulation and in tumor and because they will probably be too toxic for the kidneys. Intact MAbs and F(ab') 2 fragments have each their advantages. Intact MAbs show highest tumor accumulation in mice without ligated kidney, however, they remain mostly on the periphery of tumor nodules, as shown by autoradiography. F(ab') 2 fragments have been found to penetrate deeper into the tumor and to accumulate less in the liver. It might be therefore an advantage to combine intact MAbs with F(ab') 2 fragments, so that in the tumor two different regions could be attacked whereas in normal tissues toxicity could be distributed to different organs such as to the liver with intact MAbs and to the kidney with F(ab') 2 fragments. (orig.) [de

  17. Vibrational infrared and Raman spectra of polypeptides: Fragments-in-fragments within molecular tailoring approach

    Energy Technology Data Exchange (ETDEWEB)

    Sahu, Nityananda; Gadre, Shridhar R., E-mail: gadre@iitk.ac.in [Department of Chemistry, Indian Institute of Technology Kanpur, Kanpur 208 016 (India)

    2016-03-21

    The present work reports the calculation of vibrational infrared (IR) and Raman spectra of large molecular systems employing molecular tailoring approach (MTA). Further, it extends the grafting procedure for the accurate evaluation of IR and Raman spectra of large molecular systems, employing a new methodology termed as Fragments-in-Fragments (FIF), within MTA. Unlike the previous MTA-based studies, the accurate estimation of the requisite molecular properties is achieved without performing any full calculations (FC). The basic idea of the grafting procedure is implemented by invoking the nearly basis-set-independent nature of the MTA-based error vis-à-vis the respective FCs. FIF has been tested out for the estimation of the above molecular properties for three isomers, viz., β-strand, 3{sub 10}- and α-helix of acetyl(alanine){sub n}NH{sub 2} (n = 10, 15) polypeptides, three conformers of doubly protonated gramicidin S decapeptide and trpzip2 protein (PDB id: 1LE1), respectively, employing BP86/TZVP, M06/6-311G**, and M05-2X/6-31G** levels of theory. For most of the cases, a maximum difference of 3 cm{sup −1} is achieved between the grafted-MTA frequencies and the corresponding FC values. Further, a comparison of the BP86/TZVP level IR and Raman spectra of α-helical (alanine){sub 20} and its N-deuterated derivative shows an excellent agreement with the existing experimental spectra. In view of the requirement of only MTA-based calculations and the ability of FIF to work at any level of theory, the current methodology provides a cost-effective solution for obtaining accurate spectra of large molecular systems.

  18. Vibrational infrared and Raman spectra of polypeptides: Fragments-in-fragments within molecular tailoring approach

    Science.gov (United States)

    Sahu, Nityananda; Gadre, Shridhar R.

    2016-03-01

    The present work reports the calculation of vibrational infrared (IR) and Raman spectra of large molecular systems employing molecular tailoring approach (MTA). Further, it extends the grafting procedure for the accurate evaluation of IR and Raman spectra of large molecular systems, employing a new methodology termed as Fragments-in-Fragments (FIF), within MTA. Unlike the previous MTA-based studies, the accurate estimation of the requisite molecular properties is achieved without performing any full calculations (FC). The basic idea of the grafting procedure is implemented by invoking the nearly basis-set-independent nature of the MTA-based error vis-à-vis the respective FCs. FIF has been tested out for the estimation of the above molecular properties for three isomers, viz., β-strand, 310- and α-helix of acetyl(alanine)nNH2 (n = 10, 15) polypeptides, three conformers of doubly protonated gramicidin S decapeptide and trpzip2 protein (PDB id: 1LE1), respectively, employing BP86/TZVP, M06/6-311G**, and M05-2X/6-31G** levels of theory. For most of the cases, a maximum difference of 3 cm-1 is achieved between the grafted-MTA frequencies and the corresponding FC values. Further, a comparison of the BP86/TZVP level IR and Raman spectra of α-helical (alanine)20 and its N-deuterated derivative shows an excellent agreement with the existing experimental spectra. In view of the requirement of only MTA-based calculations and the ability of FIF to work at any level of theory, the current methodology provides a cost-effective solution for obtaining accurate spectra of large molecular systems.

  19. Fragmentation of Care in Ectopic Pregnancy.

    Science.gov (United States)

    Stulberg, Debra B; Dahlquist, Irma; Jarosch, Christina; Lindau, Stacy T

    2016-05-01

    Ectopic pregnancy is an important cause of maternal morbidity and mortality. Women who experience fragmented care may undergo unnecessary delays to diagnosis and treatment. Based on ectopic pregnancy cases observed in clinical practice that raised our concern about fragmentation of care, we designed an exploratory study to describe the number, characteristics, and outcomes of fragmented care among patients with ectopic pregnancy at one urban academic hospital. Chart review with descriptive statistics. Fragmented care was defined as a patient being evaluated at an outside facility for possible ectopic pregnancy and transferred, referred, or discharged before receiving care at the study institution. Of 191 women seen for possible or definite ectopic pregnancy during the study period, 42 (22 %) met the study definition of fragmented care. The study was under-powered to observe statistically significant differences across groups, but we found concerning, non-significant trends: patients with fragmented care were more likely to be Medicaid recipients (65.9 vs. 58.8 %) and to experience a complication (23.8 vs. 18.1 %) compared to those with non-fragmented care. Most patients (n = 37) received no identifiable treatment prior to transfer and arrived to the study hospital with no communication to the receiving hospital from the outside provider (n = 34). Nine patients (21 %) presented with ruptured ectopic pregnancies. The fragmentation we observed in our study may contribute to previously identified socio-economic disparities in ectopic pregnancy outcomes. If future research confirms these findings, health information exchanges and regional coordination of care may be important strategies for reducing maternal mortality.

  20. The lund Monte Carlo for jet fragmentation

    International Nuclear Information System (INIS)

    Sjoestrand, T.

    1982-03-01

    We present a Monte Carlo program based on the Lund model for jet fragmentation. Quark, gluon, diquark and hadron jets are considered. Special emphasis is put on the fragmentation of colour singlet jet systems, for which energy, momentum and flavour are conserved explicitly. The model for decays of unstable particles, in particular the weak decay of heavy hadrons, is described. The central part of the paper is a detailed description on how to use the FORTRAN 77 program. (Author)

  1. Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.

    Science.gov (United States)

    Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

    2014-11-01

    Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 μg/μL and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Fragmentation of molten core material by sodium

    International Nuclear Information System (INIS)

    Chu, T.Y.

    1982-01-01

    A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed

  3. Microstructural characterization of pipe bomb fragments

    International Nuclear Information System (INIS)

    Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher

    2010-01-01

    Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.

  4. Distribution of rock fragments and their effects on hillslope soil erosion in purple soil, China

    Science.gov (United States)

    Wang, Xiaoyan

    2017-04-01

    influence of rock fragment cover on purple soil slope erosion process were carried on, under different conditions with two kind of rock fragment positions (resting on soil surface and embedded into top soil layer), varied rock fragment coverage (Rc, 0% 40%), two kind of soils with textural porosity or structural porosity, and three kind of rainfall intensities (I, 1 mm/min, 1.5 mm/min and 2 mm/min). Simulated rainfall experiments in situ plots in the field, combined with simulated rainfall experiments in soil pans indoor, were used. The main conclusions of this dissertation are as following: 1. The spatial distribution characteristics of rock fragments in purple soil slope and its effects on the soil physical properties were clarified basically. 2. The mechanism of influence of rock fragments within top soil layer on soil erosion processes was understood and a threshold of rock fragment content on the infiltration was figured out. 3. The relationships between surface rock fragment cover and hillslope soil erosion in purple soil under different conditions with varied rock fragment positions, soil structures and rainfall intensities were obtained and the soil and water conservation function of surface rock fragment cover on reducing soil loss was affirmed.

  5. Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

    Science.gov (United States)

    Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

    2015-01-01

    Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

  6. Thermodynamic signatures of fragment binding: Validation of direct versus displacement ITC titrations.

    Science.gov (United States)

    Rühmann, Eggert; Betz, Michael; Fricke, Marie; Heine, Andreas; Schäfer, Martina; Klebe, Gerhard

    2015-04-01

    Detailed characterization of the thermodynamic signature of weak binding fragments to proteins is essential to support the decision making process which fragments to take further for the hit-to-lead optimization. Isothermal titration calorimetry (ITC) is the method of choice to record thermodynamic data, however, weak binding ligands such as fragments require the development of meaningful and reliable measuring protocols as usually sigmoidal titration curves are hardly possible to record due to limited solubility. Fragments can be titrated either directly under low c-value conditions (no sigmoidal curve) or indirectly by use of a strong binding ligand displacing the pre-incubated weak fragment from the protein. The determination of Gibbs free energy is reliable and rather independent of the applied titration protocol. Even though the displacement method achieves higher accuracy, the obtained enthalpy-entropy profile depends on the properties of the used displacement ligand. The relative enthalpy differences across different displacement experiments reveal a constant signature and can serve as a thermodynamic fingerprint for fragments. Low c-value titrations are only reliable if the final concentration of the fragment in the sample cell exceeds 2-10 fold its K(D) value. Limited solubility often prevents this strategy. The present study suggests an applicable protocol to characterize the thermodynamic signature of protein-fragment binding. It shows however, that such measurements are limited by protein and fragment solubility. Deviating profiles obtained by use of different displacement ligands indicate that changes in the solvation pattern and protein dynamics most likely take influence on the resulting overall binding signature. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Tissue Classification

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, David Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-01-01

    The project began as a e ort to support InLight and Lumidigm. With the sale of the companies to a non-New Mexico entity, the project then focused on supporting a new company Medici Technologies. The Small Business (SB) is attempting to quantify glucose in tissue using a series of short interferometer scans of the nger. Each scan is produced from a novel presentation of the nger to the device. The intent of the project is to identify and, if possible, implement improved methods for classi cation, feature selection, and training to improve the performance of predictive algorithms used for tissue classi cation.

  8. Prompt particle emission in correlation with fission fragments

    Directory of Open Access Journals (Sweden)

    Litaize Olivier

    2017-01-01

    Full Text Available The de-excitation process of primary fission fragments can be simulated with the FIFRELIN Monte Carlo code leading to an estimation of prompt fission observables such as neutron/gamma multiplicities and spectra in correlation with fission fragments. De-excitation cascades are simulated using the notion of nuclear realization following Becvar terminology generalized to neutron/gamma coupled emission. A nuclear realization is a random set of nuclear levels (energy, spin, parity in association with partial widths for neutron, gamma or electron emission. Experimental data related to electromagnetic transitions in the discrete level region are taken from RIPL-3 database. When nuclear level structure is completely unknown (in the continuum region, level density and strength function models are used. In between these regions, our partial knowledge of nuclear structure is completed by models up to a fixed maximum level density. In this way the whole available experimental information is accounted for. FIFRELIN is ruled by five free input parameters driving the excitation energy sharing, the rotational energy and the spin distribution of primary fission fragments. These five free parameters are determined to match a target observable such as the average total prompt neutron multiplicity (ν. Once this procedure is completed, the whole set of fission observables can be compared with experimental results. Obviously the number of observables obtained within this code is higher than what is available from measurements. This code can therefore provide useful insights into the compatibility between models and a whole set of fission observables. In the present work the influence of shell corrections is reported on level densities and prompt fission neutron spectra (PFNS. The impact of the input data such as primary fission fragment total kinetic energy (TKE is also addressed. Average prompt neutron multiplicity as a function of TKE is also estimated for each

  9. On the fragmentation of biomolecules: Fragmentation of alanine dipeptide along the polypeptide chain

    International Nuclear Information System (INIS)

    Solov'yov, I. A.; Yakubovich, A. V.; Solov'yov, A. V.; Greiner, W.

    2006-01-01

    The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragmentation of dipeptide along the polypeptide chain, as well as the interaction between alanines, has been considered. The energy of the system has been analyzed as a function of the distance between fragments for all possible dipeptide fragmentation channels. Analysis of the energy barriers makes it possible to estimate the characteristic fragmentation times and to determine the degree of applicability of classical electrodynamics for describing the system energy

  10. Methods of obtaining thermodynamic data

    International Nuclear Information System (INIS)

    Brewer, L.

    1987-10-01

    The types of thermodynamic data needed to predict behavior of high temperature systems such as an overheated nuclear reactor in which the fuel has been exposed to water and oxygen are discussed. Procedures for obtaining the needed data are reviewed. 14 refs

  11. SHORT COMMUNICATION INTERMEDIATE OBTAINED FROM ...

    African Journals Online (AJOL)

    Preferred Customer

    selectivity is the ratio of the rate constant of the reaction of carbocation with an externally added nucleophile, (nu, aniline) to that of the rate constant of the water. Our intention was to obtain a carbocation with high selectivity, so that one can pave a path for the synthesis of Schiff's base by the reaction of the carbocation ...

  12. Microfluidic chip for stacking, separation and extraction of multiple DNA fragments.

    Science.gov (United States)

    Wu, Ruige; Seah, Y P; Wang, Zhiping

    2016-03-11

    A disposable integrated microfluidic device was developed for rapid sample stacking, separation and extraction of multiple DNA fragments from a relatively large amount of sample. Isotachophoresis hyphenated gel electrophoresis (ITP-GE) was used to pre-concentrate and separate DNA fragments, followed by extraction of pure DNA fragments with electroelution on-chip. DNA fragments of 200bp, 500bp and 1kbp were successfully separated and collected in the extraction chamber within 25min. The extraction efficiency obtained from the chip was 49.9%, 52.1% and 53.7% for 200bp, 500bp and 1kbp DNA fragments, respectively. The extracted DNA fragments exhibited compatibility with downstream enzymatic reactions, for example PCR. The chip was also used to extract DNA fragments with specific size range from sheared genomic DNA and demonstrated similar performance to that using traditional gel cutting method. The whole assay can finish in 32min, 6 times faster than traditional method. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Geopolymer obtained from coal ash

    International Nuclear Information System (INIS)

    Conte, V.; Bissari, E.S.; Uggioni, E.; Bernardin, A.M.

    2011-01-01

    Geopolymers are three-dimensional alumino silicates that can be rapidly formed at low temperature from naturally occurring aluminosilicates with a structure similar to zeolites. In this work coal ash (Tractebel Energy) was used as source of aluminosilicate according a full factorial design in eight formulations with three factors (hydroxide type and concentration and temperature) and two-levels. The ash was dried and hydroxide was added according type and concentration. The geopolymer was poured into cylindrical molds, cured (14 days) and subjected to compression test. The coal ash from power plants belongs to the Si-Al system and thus can easily form geopolymers. The compression tests showed that it is possible to obtain samples with strength comparable to conventional Portland cement. As a result, temperature and molarity are the main factors affecting the compressive strength of the obtained geopolymer. (author)

  14. Investigation on laser induced salivary stone fragmentation

    Science.gov (United States)

    Sroka, Ronald; Pongratz, Thomas; Eder, Matthias; Domes, Mona; Vogeser, Michael; Johnson, Thorsten; Siedeck, Vanessa; Schroetzlmair, Florian; Zengel, Pamela

    2014-03-01

    Objective: It was the objective of this in-vitro study to investigate photon-based techniques for identifying the composition and fragmentation of salivary stones using a Ho:YAG laser. Materials and Method: Salivary stones (n=47) extracted from patients with clinical symptoms of sialolithiasis were examined in-vitro. After extraction, the stones were kept in Ringers solution until size and volume measurements could be performed. Thereafter, dual-energy CT scans (DECT) were performed to classify the composition of the stones. Subsequently, fluorescence measurements were performed by taking images under blue light excitation as well as by fluorescence spectroscopy, measuring excitation-emission-matrixes (EEM). Further investigation to identify the exact composition of the stone was performed by Raman spectroscopy and FTIR spectroscopy of stone fragments and debris. Fragmentation was performed in an aquarium set-up equipped with a mesh (hole: 1.5mm) using a Ho:YAG-laser to deliver laser pulses of 0.5, 1.0 and 1.5J/pulse at a frequency of 3Hz through a 200μm-fibre to the stone surface. The collected data were analyzed and fragmentation rates were calculated. Finally, correlation between stone composition and fragmentation was performed. Results: Blue light fluorescence excitation resulted in either fluorescence in the green spectral region or in a combination of green and red fluorescence emission. EEM-measurement showed the corresponding spectra. Raman spectroscopy showed a mixture of carbonate apatite and keratin. DECT results in evidence of calcium containing components. FTIR-spectroscopy results showed that carbonate apatite is the main component. Fragmentation experiment showed a dependency on the energy per pulse applied if the evaluation implies the ratio of fragmented weight to pulse, while the ratio fragmented weight to energy remains about constant for the three laser parameter used. Conclusion: The composition of salivary stones could be determined using

  15. Truncated States Obtained by Iteration

    International Nuclear Information System (INIS)

    Cardoso, W. B.; Almeida, N. G. de

    2008-01-01

    We introduce the concept of truncated states obtained via iterative processes (TSI) and study its statistical features, making an analogy with dynamical systems theory (DST). As a specific example, we have studied TSI for the doubling and the logistic functions, which are standard functions in studying chaos. TSI for both the doubling and logistic functions exhibit certain similar patterns when their statistical features are compared from the point of view of DST

  16. A complete ridge-line potential for complex fragment emission

    Energy Technology Data Exchange (ETDEWEB)

    Delis, D.N.; Blumenfeld, Y.; Bowman, D.R.; Colonna, N.; Hanold, K.; Jing, K.; Justice, M.; Meng, J.C.; Peaslee, G.F.; Wozniak, G.J.; Moretto, L.G. (California Univ., Berkeley (USA). Div. of Nuclear Science)

    1991-06-01

    Cross sections were measured for fragments (4obtained for {sup 75}Br. There is excellent agreement between the experimentally determined barriers and the finite-range model calculations, while there is strong disagreement with the liquid-drop model calculations. (orig.).

  17. A complete ridge-line potential for complex fragment emission

    Science.gov (United States)

    Delis, D. N.; Blumenfeld, Y.; Bowman, D. R.; Colonna, N.; Hanold, K.; Jing, K.; Justice, M.; Meng, J. C.; Peaslee, G. F.; Wozniak, G. J.; Moretto, L. G.

    1991-06-01

    Cross sections were measured for fragments (4obtained for75Br. There is excellent agreement between the experimentally determined barriers and the finite-range model calculations, while there is strong disagreement with the liquid-drop model calculations.

  18. PIXE-PIGE analysis of late roman glass fragments

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Tubio, B. [Departamento de Fisica Aplicada III, Escuela de Ingenieros, Universidad de Sevilla, Camino de los Descubrimientos s/n, 41092 Sevilla (Spain)]. E-mail: tubio@us.es; Ontalba Salamanca, M.A. [Departamento de Fisica, Escuela Politecnica, Universidad de Extremadura, Avda. de la Universidad s/n, 10071 Caceres (Spain); Ortega-Feliu, I. [Centro Nacional de Aceleradores, Universidad de Sevilla, Avda. Thomas A. Edison s/n, 41092 Sevilla (Spain); Respaldiza, M.A. [Centro Nacional de Aceleradores, Universidad de Sevilla, Avda. Thomas A. Edison s/n, 41092 Sevilla (Spain); Amores Carredano, F. [Departamento de Prehistoria y Arqueologia, Universidad de Sevilla, C/Dona Maria de Padilla s/n, 41010 Sevilla (Spain); Gonzalez-Acuna, D. [Departamento de Geografia, Historia y Filosofia, Universidad Pablo de Olavide, Ctra. de Utrera Km 1, 41013 Sevilla (Spain)

    2006-08-15

    A set of Roman glass fragments, excavated at Sevilla and dated in the 5th century A.D., has been analysed by PIXE and PIGE techniques using the external beam set-up of the 3 MV tandem Pelletron accelerator of the CNA at the University of Sevilla. Using a simple quantification method, based on the indirect charge calculation on the sample by monitoring the X-ray induced by the proton beam on the exit window, the composition of the glasses has been determined. From the obtained results, the use of soda as flux has been inferred and colouring manufacture procedures have been identified.

  19. Light fragment formation at intermediate energies

    International Nuclear Information System (INIS)

    Boal, D.H.

    1982-03-01

    This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

  20. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Global-Scale Patterns of Forest Fragmentation

    Directory of Open Access Journals (Sweden)

    Kurt Riitters

    2000-12-01

    Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.

  2. Simulations of High Speed Fragment Trajectories

    Science.gov (United States)

    Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

    2017-11-01

    Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

  3. Molten aluminum alloy fuel fragmentation experiments

    International Nuclear Information System (INIS)

    Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

    1992-01-01

    Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

  4. Stream hydrological fragmentation drives bacterioplankton community composition.

    Directory of Open Access Journals (Sweden)

    Stefano Fazi

    Full Text Available In Mediterranean intermittent streams, the hydrological fragmentation in summer and the successive water flow re-convergence in autumn allow exploring how local processes shape the microbial community within the same habitat. The objectives of this study were to determine how bacterial community composition responded to hydrological fragmentation in summer, and to evaluate whether the seasonal shifts in community composition predominate over the effects of episodic habitat fragmentation. The bacterial community was assessed along the intermittent stream Fuirosos (Spain, at different levels of phylogenetic resolution by in situ hybridization, fingerprinting, and 16S rRNA gene sequencing. The hydrological fragmentation of the stream network strongly altered the biogeochemical conditions with the depletion of oxidized solutes and caused changes in dissolved organic carbon characteristics. In the isolated ponds, beta-Proteobacteria and Actinobacteria increased their abundance with a gradual reduction of the alpha-diversity as pond isolation time increased. Moreover, fingerprinting analysis clearly showed a shift in community composition between summer and autumn. In the context of a seasonal shift, the temporary stream fragmentation simultaneously reduced the microbial dispersion and affected local environmental conditions (shift in redox regime and quality of the dissolved organic matter tightly shaping the bacterioplankton community composition.

  5. Meta-analysis of susceptibility of woody plants to loss of genetic diversity through habitat fragmentation.

    Science.gov (United States)

    Vranckx, Guy; Jacquemyn, Hans; Muys, Bart; Honnay, Olivier

    2012-04-01

    Shrubs and trees are assumed less likely to lose genetic variation in response to habitat fragmentation because they have certain life-history characteristics such as long lifespans and extensive pollen flow. To test this assumption, we conducted a meta-analysis with data on 97 woody plant species derived from 98 studies of habitat fragmentation. We measured the weighted response of four different measures of population-level genetic diversity to habitat fragmentation with Hedge's d and Spearman rank correlation. We tested whether the genetic response to habitat fragmentation was mediated by life-history traits (longevity, pollination mode, and seed dispersal vector) and study characteristics (genetic marker and plant material used). For both tests of effect size habitat fragmentation was associated with a substantial decrease in expected heterozygosity, number of alleles, and percentage of polymorphic loci, whereas the population inbreeding coefficient was not associated with these measures. The largest proportion of variation among effect sizes was explained by pollination mechanism and by the age of the tissue (progeny or adult) that was genotyped. Our primary finding was that wind-pollinated trees and shrubs appeared to be as likely to lose genetic variation as insect-pollinated species, indicating that severe habitat fragmentation may lead to pollen limitation and limited gene flow. In comparison with results of previous meta-analyses on mainly herbaceous species, we found trees and shrubs were as likely to have negative genetic responses to habitat fragmentation as herbaceous species. We also found that the genetic variation in offspring was generally less than that of adult trees, which is evidence of a genetic extinction debt and probably reflects the genetic diversity of the historical, less-fragmented landscape. ©2011 Society for Conservation Biology.

  6. Neutrophil elastase cleaves VEGF to generate a VEGF fragment with altered activity.

    Science.gov (United States)

    Kurtagic, Elma; Jedrychowski, Mark P; Nugent, Matthew A

    2009-03-01

    Excessive neutrophil elastase (NE) activity and altered vascular endothelial growth factor (VEGF) signaling have independently been implicated in the development and progression of pulmonary emphysema. In the present study, we investigated the potential link between NE and VEGF. We noted that VEGF(165) is a substrate for NE. Digestion of purified VEGF(165) with NE generated a partially degraded disulfide-linked fragment of VEGF. Mass spectrometric analysis revealed that NE likely cleaves VEGF(165) at both the NH(2) and COOH termini to produce VEGF fragment chains approximately 5 kDa reduced in size. NE treatment of VEGF-laden endothelial cell cultures and smooth muscle cells endogenously expressing VEGF generated VEGF fragments similar to those observed with purified VEGF(165). NE-generated VEGF fragment showed significantly reduced binding to VEGF receptor 2 and heparin yet retained the ability to bind to VEGF receptor 1. Interestingly, VEGF fragment showed altered signaling in pulmonary artery endothelial cells compared with intact VEGF(165). Specifically, treatment with VEGF fragment did not activate extracellular-regulated kinases 1 and 2 (ERK1/2), yet resulted in enhanced activation of protein kinase B (Akt). Treatment of monocyte/macrophage RAW 264.7 cells with VEGF fragment, on the other hand, led to both Akt and ERK1/2 activation, increased VEGFR1 expression, and stimulated chemotaxis. These findings suggest that the tissue response to NE-mediated injury might involve the generation of diffusible VEGF fragments that stimulate inflammatory cell recruitment and activation via VEGF receptor 1.

  7. Muscle fragments on a scaffold in rats

    DEFF Research Database (Denmark)

    Jangö, Hanna; Gräs, Søren; Christensen, Lise

    2015-01-01

    labeled with PKH26-fluorescence dye. After 8 weeks labeled cells were identified in tissue samples and histopathological and immunohistochemical analyses of connective tissue organization and desmin reactivity of muscle cells were performed. Fresh tissue samples were subjected to uniaxial biomechanical......-PLGA scaffolds seeded with autologous MFF affected some histological and biomechanical properties of native tissue repair in an abdominal wall defect model in rats. The method thus appears to be a simple tissue engineering concept with potential relevance for native tissue repair of POP....

  8. Different proliferative capacity of lung fibroblasts obtained from control subjects and patients with emphysema

    NARCIS (Netherlands)

    Noordhoek, JA; Postma, DS; Chong, LL; Vos, JTWM; Kauffman, HF; Timens, W; van Straaten, JFM

    2003-01-01

    To characterize the possible role of a dysregulated proliferative capacity of pulmonary fibroblasts in insufficient tissue repair in lungs from patients with pulmonary emphysema, the authors undertook in vitro proliferative studies with pulmonary fibroblasts obtained from lung tissue of patients

  9. A new statistical scission-point model fed with microscopic ingredients to predict fission fragments distributions

    International Nuclear Information System (INIS)

    Heinrich, S.

    2006-01-01

    Nucleus fission process is a very complex phenomenon and, even nowadays, no realistic models describing the overall process are available. The work presented here deals with a theoretical description of fission fragments distributions in mass, charge, energy and deformation. We have reconsidered and updated the B.D. Wilking Scission Point model. Our purpose was to test if this statistic model applied at the scission point and by introducing new results of modern microscopic calculations allows to describe quantitatively the fission fragments distributions. We calculate the surface energy available at the scission point as a function of the fragments deformations. This surface is obtained from a Hartree Fock Bogoliubov microscopic calculation which guarantee a realistic description of the potential dependence on the deformation for each fragment. The statistic balance is described by the level densities of the fragment. We have tried to avoid as much as possible the input of empirical parameters in the model. Our only parameter, the distance between each fragment at the scission point, is discussed by comparison with scission configuration obtained from full dynamical microscopic calculations. Also, the comparison between our results and experimental data is very satisfying and allow us to discuss the success and limitations of our approach. We finally proposed ideas to improve the model, in particular by applying dynamical corrections. (author)

  10. Mass distribution of fission fragments within the Born-Oppenheimer approximation

    Science.gov (United States)

    Pomorski, K.; Ivanyuk, F. A.; Nerlo-Pomorska, B.

    2017-03-01

    The fission fragments mass-yield of 236 U is obtained by an approximate solution of the eigenvalue problem of the collective Hamiltonian that describes the dynamics of the fission process whose degrees of freedom are: the fission (elongation), the neck and mass-asymmetry modes. The macroscopic-microscopic method is used to evaluate the potential energy surface. The macroscopic energy part is calculated using the liquid drop model and the microscopic corrections are obtained using a Woods-Saxon single-particle levels. The four-dimensional modified Cassini ovals shape parametrization is used to describe the shape of the fissioning nucleus. The mass tensor is taken within a cranking-type approximation. The final fragment mass distribution is obtained by weighting the adiabatic density distribution in the collective space with the neck-dependent fission probability. The neck degree of freedom is found to play a significant role in determining the final fragment mass distribution.

  11. Assessment of Fragmentation Performance of Blast-enhanced Explosive Fragmentation Munitions

    Science.gov (United States)

    2010-10-01

    weighing the individual fragments with precision electronic scales and measuring their average projected areas using the icosahedron gage technique...The icosahedron gage is an electro-optical devise that throws a shadow of a fragment on an electronic sensing surface resulting in an automated

  12. Anti-Staphylococcus aureus single-chain variable region fragments provide protection against mastitis in mice.

    Science.gov (United States)

    Wang, Man; Zhang, Yan; Zhu, Jianguo

    2016-03-01

    Staphylococcus aureus is a leading causative agent of bovine mastitis, which can result in significant economic losses to the dairy industry. However, available vaccines against bovine mastitis do not confer adequate protection, although passive immunization with antibodies may be useful to prevent disease. Hence, we constructed a bovine single-chain variable region fragment (scFv) phage display library using cDNAs from peripheral blood lymphocytes of cows with S. aureus-induced mastitis. After four rounds of selection, eight scFvs that bound S. aureus antigens with high affinity were obtained. The framework regions of the variable domains (VH and VL) of the eight scFvs were highly conserved, and the complementarity-determining regions (CDRs) displayed significant diversity, especially CDR3 of the VH domain. All eight scFvs inhibited S. aureus growth in culture medium. Lactating mice were challenged by injecting S. aureus into the fourth mammary gland. Histopathological analysis showed that treatment with these scFvs prior to bacterial challenge maintained the structure of the mammary acini, decreased infiltration of polymorphonuclear neutrophils, increased levels of interferon-gamma and interleukin-4, and reduced tumor necrosis factor-alpha levels in mammary tissues, as compared with mice treatment with physiological saline (P < 0.05). These novel bovine scFvs may be suitable candidates for therapeutic agents for the prevention of S. aureus-induced bovine mastitis.

  13. Structural Changes are More Important than Compositional Changes in Driving Biomass Loss in Ugandan Forest Fragments

    Directory of Open Access Journals (Sweden)

    C. Bulafu

    2014-01-01

    Full Text Available Aboveground biomass (AGB contained in privately-owned forests is less frequently measured than in forest reserves despite their greater likelihood of degradation. We demonstrate how density changes in contrast to species compositional changes have driven AGB changes in privately-owned fragments in Uganda over two decades. Data on tree assemblages in fragments were obtained by re-sampling a 1990 dataset in 2010 and AGB estimated using generalised allometric equation that incorporates diameter at breast height (DBH and species-specific wood density. AGB were highly variable between fragments and over time. Structural changes contributed a higher proportion of change in AGB than species compositional changes in all forests. Non-pioneer species constituted over 50% of AGB in reserve forest, in contrast to private forests where pioneer species dominated. Our study demonstrates the potential of private forests to hold comparable AGB to plantation. Reduction in exploitation pressure is required if fragments are to mitigate carbon emissions.

  14. Carbon ion fragmentation effects on the nanometric level behind the Bragg peak depth

    Science.gov (United States)

    Francis, Z.; Seif, E.; Incerti, S.; Champion, C.; Karamitros, M.; Bernal, M. A.; Ivanchenko, V. N.; Mantero, A.; Tran, H. N.; El Bitar, Z.

    2014-12-01

    In this study, fragmentation yields of carbon therapy beams are estimated using the Geant4 simulation toolkit version 9.5. Simulations are carried out in a step-by-step mode using the Geant4-DNA processes for each of the major contributing fragments. The energy of the initial beam is taken 400 MeV amu-1 as this is the highest energy, which is used for medical accelerators and this would show the integral role of secondary contributions in radiotherapy irradiations. The obtained results showed that 64% of the global dose deposition is initiated by carbon ions, while up to 36% is initiated by the produced fragments including all their isotopes. The energy deposition clustering yields of each of the simulated fragments are then estimated using the DBSCAN clustering algorithm and they are compared to the yields of the incident primary beam.

  15. Study of fission fragments produced by 14N + 235U reaction

    International Nuclear Information System (INIS)

    Yalcinkaya, M.; Erduran, M.N.; Ganioglu, E.; Akkus, B.; Bostan, M.; Gurdal, G.; Erturk, S.; Balabanski, D.; Minkova, A.; Danchev, M.

    2005-01-01

    This work was performed to understand the structure of neutron rich fission fragments around ∼ 130 region. A thin metallic 235 U target was bombarded by 14 N beam with 10 MeV/A from the Separated Sector Cyclotron at the National Accelerator Centre, Cape Town, South Africa. The main goal to detect and identify fission fragments and to obtain their mass distribution was achieved by using Solar Cell detectors in the AFRODITE (African Omnipurpose Detector for Innovative Techniques and Experiments) spectrometer. The X-rays emitted from fission fragments were detected by LEP detectors and γ rays emitted from excited states of the fission fragments were detected by CLOVER detectors in the spectrometer. (author)

  16. The Injured Body: Humiliation and Fragmentation

    Directory of Open Access Journals (Sweden)

    Graciela Mayet

    2017-03-01

    Full Text Available Simone de Beauvoir’s nouvelles and Titus Andronicus by Shakespeare present us opposite and complementary corporeal nature. In the first case, two women about their sixties are in front of the personal drama of their lost which happen through the years of ageing. It is a kind of fragmentation of existence. Ageing is the most authentic state of the human condition because the human being can only hang on to himself. In Titus Andronicus, are shown mutilations, murderers as fragmentation of biological body and social body. Individualism of modernity doesn’t forgive the bodies deteriorated by the years. In the early modernity, in the times of Elizabeth the First, like in the Ancient Rome, it wasn’t spared humiliations and violence towards the enemy body in order to impose power and authority. In this Shakespeare’s play, the fragmentation of the other’s body and murder are the emergence of social and individual violence.

  17. Dynamical Model of Fission Fragment Angular Distribution

    Science.gov (United States)

    Drozdov, V. A.; Eremenko, D. O.; Fotina, O. V.; Platonov, S. Yu.; Yuminov, O. A.; Giardina, G.; Taccone, A.

    2002-01-01

    A dynamical model of fission fragment angular distributions is suggested. The model allows one to calculate fission fragment angular distributions, prescission light particle multyplicities, evaporation residue cross sections etc. for the cases of decay of hot and rotating heavy nuclei. The experimental data on angular anisotropies of fission fragments and prescission neutron multiplicities are analyzed for the 16O + 208Pb, 232Th, 248Cm and 238U reactions at the energies of the incident 16O ions ranging from 90 to 160 MeV. This analysis allows us to extract both the nuclear friction coefficient value and the relaxation time for the tilting mode. It is also demonstrated that the angular distributions are sensitive to the deformation dependence of the nuclear friction.

  18. Antiproton Induced Fission and Fragmentation of Nuclei

    CERN Multimedia

    2002-01-01

    The annihilation of slow antiprotons with nuclei results in a large highly localized energy deposition primarily on the nuclear surface. \\\\ \\\\ The study of antiproton induced fission and fragmentation processes is expected to yield new information on special nuclear matter states, unexplored fission modes, multifragmentation of nuclei, and intranuclear cascades.\\\\ \\\\ In order to investigate the antiproton-nucleus interaction and the processes following the antiproton annihilation at the nucleus, we propose the following experiments: \\item A)~Measurement of several fragments from fission and from multifragmentation in coincidence with particle spectra, especially neutrons and kaons. \\item B)~Precise spectra of $\\pi$, K, n, p, d and t with time-of-flight techniques. \\item C)~Installation of the Berlin 4$\\pi$ neutron detector with a 4$\\pi$ Si detector placed inside for fragments and charged particles. This yields neutron multiplicity distributions and consequently distributions of thermal excitation energies and...

  19. Fragmented-condensate solid of dipolar excitons

    Science.gov (United States)

    Andreev, S. V.

    2017-05-01

    We discuss a possible link between the recently observed macroscopic ordering of ultracold dipolar excitons (MOES) and the phenomenon of supersolidity. In the dilute limit we predict a stable supersolid state for a quasi-one-dimensional system of bosonic dipoles characterized by two- and three-body contact repulsion. We phenomenologically extend our theory to the strongly-correlated regime and find a critical value of the contact interaction parameter at which the supersolid exhibits a quantum phase transition to a fragmented state. The wavelength of the fragmented-condensate solid is defined by the balance between the quantum pressure and the entropy due to fluctuations of the relative phases between the fragments. Our model appears to be in good agreement with the relevant experimental data, including the very recent results on commensurability effect and wavelength of the MOES.

  20. Evaluation of nuclear reaction cross-sections and fragment yields in carbon beams using the SHIELD-HIT Monte Carlo code. Comparison with experiments

    International Nuclear Information System (INIS)

    Hultqvist, Martha; Gudowska, Irena; Lazzeroni, Marta; Brahme, Anders; Botvina, Alexander; Sobolevsky, Nikolai

    2012-01-01

    In light ion therapy, the knowledge of the spectra of both primary and secondary particles in the target volume is needed in order to accurately describe the treatment. The transport of ions in matter is complex and comprises both atomic and nuclear processes involving primary and secondary ions produced in the cascade of events. One of the critical issues in the simulation of ion transport is the modeling of inelastic nuclear reaction processes, in which projectile nuclei interact with target nuclei and give rise to nuclear fragments. In the Monte Carlo code SHIELD-HIT, inelastic nuclear reactions are described by the Many Stage Dynamical Model (MSDM), which includes models for the different stages of the interaction process. In this work, the capability of SHIELD-HIT to simulate the nuclear fragmentation of carbon ions in tissue-like materials was studied. The value of the parameter κ, which determines the so-called freeze-out volume in the Fermi break-up stage of the nuclear interaction process, was adjusted in order to achieve better agreement with experimental data. In this paper, results are shown both with the default value κ = 1 and the modified value κ = 10 which resulted in the best overall agreement. Comparisons with published experimental data were made in terms of total and partial charge-changing cross-sections generated by the MSDM, as well as integral and differential fragment yields simulated by SHIELD-HIT in intermediate and thick water targets irradiated with a beam of 400 MeV u −1 12 C ions. Better agreement with the experimental data was in general obtained with the modified parameter value (κ = 10), both on the level of partial charge-changing cross-sections and fragment yields. (paper)

  1. Obtaining zircaloy powder through hydriding

    International Nuclear Information System (INIS)

    Dupim, Ivaldete da Silva; Moreira, Joao M.L.

    2009-01-01

    Zirconium alloys are good options for the metal matrix in dispersion fuels for power reactors due to their low thermal neutron absorption cross-section, good corrosion resistance, good mechanical strength and high thermal conductivity. A necessary step for obtaining such fuels is producing Zr alloy powder for the metal matrix composite material. This article presents results from the Zircaloy-4 hydrogenation tests with the purpose to embrittle the alloy as a first step for comminuting. Several hydrogenation tests were performed and studied through thermogravimetric analysis. They included H 2 pressures of 25 and 50 kPa and temperatures ranging between from 20 to 670 deg C. X-ray diffraction analysis showed in the hydrogenated samples the predominant presence of ZrH 2 and some ZrO 2 . Some kinetics parameters for the Zircaloy-4 hydrogenation reaction were obtained: the time required to reach the equilibrium state at the dwell temperature was about 100 minutes; the hydrogenation rate during the heating process from 20 to 670 deg C was about 21 mg/h, and at constant temperature of 670 deg C, the hydride rate was about 1.15 mg/h. The hydrogenation rate is largest during the heating process and most of it occurs during this period. After hydrogenated, the samples could easily be comminuted indicating that this is a possible technology to obtain Zircaloy powder. The results show that only few minutes of hydrogenation are necessary to reach the hydride levels required for comminuting the Zircaloy. The final hydride stoichiometry was between 2.7 and 2.8 H for each Zr atom in the sample (author)

  2. DNA damage in preserved specimens and tissue samples: a molecular assessment

    Directory of Open Access Journals (Sweden)

    Cantin Elizabeth

    2008-10-01

    Full Text Available Abstract The extraction of genetic information from preserved tissue samples or museum specimens is a fundamental component of many fields of research, including the Barcode of Life initiative, forensic investigations, biological studies using scat sample analysis, and cancer research utilizing formaldehyde-fixed, paraffin-embedded tissue. Efforts to obtain genetic information from these sources are often hampered by an inability to amplify the desired DNA as a consequence of DNA damage. Previous studies have described techniques for improved DNA extraction from such samples or focused on the effect of damaging agents – such as light, oxygen or formaldehyde – on free nucleotides. We present ongoing work to characterize lesions in DNA samples extracted from preserved specimens. The extracted DNA is digested to single nucleosides with a combination of DNase I, Snake Venom Phosphodiesterase, and Antarctic Phosphatase and then analyzed by HPLC-ESI-TOF-MS. We present data for moth specimens that were preserved dried and pinned with no additional preservative and for frog tissue samples that were preserved in either ethanol, or formaldehyde, or fixed in formaldehyde and then preserved in ethanol. These preservation methods represent the most common methods of preserving animal specimens in museum collections. We observe changes in the nucleoside content of these samples over time, especially a loss of deoxyguanosine. We characterize the fragmentation state of the DNA and aim to identify abundant nucleoside lesions. Finally, simple models are introduced to describe the DNA fragmentation based on nicks and double-strand breaks.

  3. Targeted cancer therapy through antibody fragments-decorated nanomedicines.

    Science.gov (United States)

    Alibakhshi, Abbas; Abarghooi Kahaki, Fatemeh; Ahangarzadeh, Shahrzad; Yaghoobi, Hajar; Yarian, Fatemeh; Arezumand, Roghaye; Ranjbari, Javad; Mokhtarzadeh, Ahad; de la Guardia, Miguel

    2017-12-28

    Active targeting in cancer nanomedicine, for improved delivery of agents and diagnose, has been reviewed as a successful way for facilitating active uptake of theranostic agents by the tumor cells. The application of a targeting moiety in the targeted carrier complexes can play an important role in differentiating between tumor and healthy tissues. The pharmaceutical carriers, as main part of complexes, can be polymeric nanoparticles, micelles, liposomes, nanogels and carbon nanotubes. The antibodies are among the natural ligands with highest affinity and specificity to target pharmaceutical nanoparticle conjugates. However, the limitations, such as size and long circulating half-lives, hinder reproducible manufacture in clinical studies. Therefore, novel approaches have moved towards minimizing and engineering conventional antibodies as fragments like scFv, Fab, nanobody, bispecific antibody, bifunctional antibody, diabody and minibody preserving their functional potential. Different formats of antibody fragments have been reviewed in this literature update, in terms of structure and function, as smart ligands in cancer diagnosis and therapy of tumor cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Fragmented sleep accelerates tumor growth and progression through recruitment of tumor-associated macrophages and TLR4 signaling.

    Science.gov (United States)

    Hakim, Fahed; Wang, Yang; Zhang, Shelley X L; Zheng, Jiamao; Yolcu, Esma S; Carreras, Alba; Khalyfa, Abdelnaby; Shirwan, Haval; Almendros, Isaac; Gozal, David

    2014-03-01

    Sleep fragmentation (SF) is a highly prevalent condition and a hallmark of sleep apnea, a condition that has been associated with increased cancer incidence and mortality. In this study, we examined the hypothesis that sleep fragmentation promotes tumor growth and progression through proinflammatory TLR4 signaling. In the design, we compared mice that were exposed to sleep fragmentation one week before engraftment of syngeneic TC1 or LL3 tumor cells and tumor analysis four weeks later. We also compared host contributions through the use of mice genetically deficient in TLR4 or its effector molecules MYD88 or TRIF. We found that sleep fragmentation enhanced tumor size and weight compared with control mice. Increased invasiveness was apparent in sleep fragmentation tumors, which penetrated the tumor capsule into surrounding tissues, including adjacent muscle. Tumor-associated macrophages (TAM) were more numerous in sleep fragmentation tumors, where they were distributed in a relatively closer proximity to the tumor capsule compared with control mice. Although tumors were generally smaller in both MYD88(-/-) and TRIF(-/-) hosts, the more aggressive features produced by sleep fragmentation persisted. In contrast, these more aggressive features produced by sleep fragmentation were abolished completely in TLR4(-/-) mice. Our findings offer mechanistic insights into how sleep perturbations can accelerate tumor growth and invasiveness through TAM recruitment and TLR4 signaling pathways. ©2014 AACR

  5. Forming spectroscopic massive protobinaries by disc fragmentation

    Science.gov (United States)

    Meyer, D. M.-A.; Kuiper, R.; Kley, W.; Johnston, K. G.; Vorobyov, E.

    2018-01-01

    The surroundings of massive protostars constitute an accretion disc which has numerically been shown to be subject to fragmentation and responsible for luminous accretion-driven outbursts. Moreover, it is suspected to produce close binary companions which will later strongly influence the star's future evolution in the Hertzsprung-Russel diagram. We present three-dimensional gravitation-radiation-hydrodynamic numerical simulations of 100 M⊙ pre-stellar cores. We find that accretion discs of young massive stars violently fragment without preventing the (highly variable) accretion of gaseous clumps on to the protostars. While acquiring the characteristics of a nascent low-mass companion, some disc fragments migrate on to the central massive protostar with dynamical properties showing that its final Keplerian orbit is close enough to constitute a close massive protobinary system, having a young high- and a low-mass components. We conclude on the viability of the disc fragmentation channel for the formation of such short-period binaries, and that both processes - close massive binary formation and accretion bursts - may happen at the same time. FU-Orionis-type bursts, such as observed in the young high-mass star S255IR-NIRS3, may not only indicate ongoing disc fragmentation, but also be considered as a tracer for the formation of close massive binaries - progenitors of the subsequent massive spectroscopic binaries - once the high-mass component of the system will enter the main-sequence phase of its evolution. Finally, we investigate the Atacama Large (sub-)Millimeter Array observability of the disc fragments.

  6. New approach to assess sperm DNA fragmentation dynamics: Fine-tuning mathematical models.

    Science.gov (United States)

    Ortiz, Isabel; Dorado, Jesús; Morrell, Jane; Gosálvez, Jaime; Crespo, Francisco; Jiménez, Juan M; Hidalgo, Manuel

    2017-01-01

    Sperm DNA fragmentation (sDF) has been proved to be an important parameter in order to predict in vitro the potential fertility of a semen sample. Colloid centrifugation could be a suitable technique to select those donkey sperm more resistant to DNA fragmentation after thawing. Previous studies have shown that to elucidate the latent damage of the DNA molecule, sDF should be assessed dynamically, where the rate of fragmentation between treatments indicates how resistant the DNA is to iatrogenic damage. The rate of fragmentation is calculated using the slope of a linear regression equation. However, it has not been studied if sDF dynamics fit this model. The objectives of this study were to evaluate the effect of different after-thawing centrifugation protocols on sperm DNA fragmentation and elucidate the most accurate mathematical model (linear regression, exponential or polynomial) for DNA fragmentation over time in frozen-thawed donkey semen. After submitting post-thaw semen samples to no centrifugation (UDC), sperm washing (SW) or single layer centrifugation (SLC) protocols, sDF values after 6 h of incubation were significantly lower in SLC samples than in SW or UDC. Coefficient of determination (R 2 ) values were significantly higher for a second order polynomial model than for linear or exponential. The highest values for acceleration of fragmentation (aSDF) were obtained for SW, followed by SLC and UDC. SLC after thawing seems to preserve longer DNA longevity in comparison to UDC and SW. Moreover, the fine-tuning of models has shown that sDF dynamics in frozen-thawed donkey semen fit a second order polynomial model, which implies that fragmentation rate is not constant and fragmentation acceleration must be taken into account to elucidate hidden damage in the DNA molecule.

  7. Biomechanics of brain tissue.

    Science.gov (United States)

    Prevost, Thibault P; Balakrishnan, Asha; Suresh, Subra; Socrate, Simona

    2011-01-01

    The dynamic behavior of porcine brain tissue, obtained from a series of in vitro observations and experiments, is analyzed and described here with the aid of a large strain, nonlinear, viscoelastic constitutive model. Mixed gray and white matter samples excised from the superior cortex were tested in unconfined uniaxial compression within 15h post mortem. The test sequence consisted of three successive load-unload segments at strain rates of 1, 0.1 and 0.01 s⁻¹, followed by stress relaxation (n=25). The volumetric compliance of the tissue was assessed for a subset of specimens (n=7) using video extensometry techniques. The tissue response exhibited moderate compressibility, substantial nonlinearity, hysteresis, conditioning and rate dependence. A large strain kinematics nonlinear viscoelastic model was developed to account for the essential features of the tissue response over the entire deformation history. The corresponding material parameters were obtained by fitting the model to the measured conditioned response (axial and volumetric) via a numerical optimization scheme. The model successfully captures the observed complexities of the material response in loading, unloading and relaxation over the entire range of strain rates. The accuracy of the model was further verified by comparing model predictions with the tissue response in unconfined compression at higher strain rate (10 s⁻¹) and with literature data in uniaxial tension. The proposed constitutive framework was also found to be adequate to model the loading response of brain tissue in uniaxial compression over a wider range of strain rates (0.01-3000 s⁻¹), thereby providing a valuable tool for simulations of dynamic transients (impact, blast/shock wave propagation) leading to traumatic brain injury. Copyright © 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  8. Inflammation-Generated Extracellular Matrix Fragments Drive Lung Metastasis

    Directory of Open Access Journals (Sweden)

    Sandrine Bekaert

    2017-12-01

    Full Text Available Mechanisms explaining the propensity of a primary tumor to metastasize to a specific site still need to be unveiled, and clinical studies support a link between chronic inflammation and cancer dissemination to specific tissues. Using different mouse models, we demonstrate the role of inflammation-generated extracellular matrix fragments ac-PGP ( N -acetyl-proline-glycine-proline on tumor cells dissemination to lung parenchyma. In mice exposed to cigarette smoke or lipopolysaccharide, lung neutrophilic inflammation produces increased levels of MMP-9 (matrix metalloproteinase 9 that contributes to collagen breakdown and allows the release of ac-PGP tripeptides. By silencing CXCR2 gene expression in tumor cells, we show that these generated ac-PGP tripeptides exert a chemotactic activity on tumor cells in vivo by binding CXCR2.

  9. Parton Propagation and Fragmentation in QCD Matter

    Energy Technology Data Exchange (ETDEWEB)

    Alberto Accardi, Francois Arleo, William Brooks, David D' Enterria, Valeria Muccifora

    2009-12-01

    We review recent progress in the study of parton propagation, interaction and fragmentation in both cold and hot strongly interacting matter. Experimental highlights on high-energy hadron production in deep inelastic lepton-nucleus scattering, proton-nucleus and heavy-ion collisions, as well as Drell-Yan processes in hadron-nucleus collisions are presented. The existing theoretical frameworks for describing the in-medium interaction of energetic partons and the space-time evolution of their fragmentation into hadrons are discussed and confronted to experimental data. We conclude with a list of theoretical and experimental open issues, and a brief description of future relevant experiments and facilities.

  10. Quantum fluctuations within the fragmentation theory

    International Nuclear Information System (INIS)

    Maruhn, J.A.; Hahn, J.; Lustig, H.J.; Zeigenhain, K.H.; Greiner, W.

    1980-01-01

    The measured spread of the fragment mass distributions in heavy ion collisions may be due to two quite different physical mechanisms: the quantum-mechanical uncertainty associated with collective motion in the mass asymmetry degree of freedom, and the spread caused by thermal excitation of the nuclear system. The fluctuations in physical observables induced in these ways are referred to as quantum fluctuations and statistical fluctuations. In this lecture quantum fluctuations are studied within the fragmentation theory. Mass distributions for spontaneous fission and low energy heavy ion collisions are investigated. (author)

  11. Rotating bubble and toroidal nuclei and fragmentation

    International Nuclear Information System (INIS)

    Royer, G.; Haddad, F.; Jouault, B.

    1995-01-01

    The energy of rotating bubble and toroidal nuclei predicted to be formed in central heavy-ion collisions at intermediate energies is calculated within the generalized rotating liquid drop model. The potential barriers standing in these exotic deformation paths are compared with the three dimensional and plane fragmentation barriers. In the toroidal deformation path of the heaviest systems exists a large potential pocket localised below the plane fragmentation barriers. This might allow the temporary survival of heavy nuclear toroids before the final clusterization induced by the surface and proximity tension. (author)

  12. Computer Model Of Fragmentation Of Atomic Nuclei

    Science.gov (United States)

    Wilson, John W.; Townsend, Lawrence W.; Tripathi, Ram K.; Norbury, John W.; KHAN FERDOUS; Badavi, Francis F.

    1995-01-01

    High Charge and Energy Semiempirical Nuclear Fragmentation Model (HZEFRG1) computer program developed to be computationally efficient, user-friendly, physics-based program for generating data bases on fragmentation of atomic nuclei. Data bases generated used in calculations pertaining to such radiation-transport applications as shielding against radiation in outer space, radiation dosimetry in outer space, cancer therapy in laboratories with beams of heavy ions, and simulation studies for designing detectors for experiments in nuclear physics. Provides cross sections for production of individual elements and isotopes in breakups of high-energy heavy ions by combined nuclear and Coulomb fields of interacting nuclei. Written in ANSI FORTRAN 77.

  13. Strain-energy effects on dynamic fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Chudnovsky, A.

    1986-01-01

    Grady's model of the dynamic fragmentation process, in which the average fragment size is determined by balancing the local kinetic energy and the surface energy, is modified to include the stored elastic (strain) energy. The revised model predicts that the strain energy should dominate for brittle materials, with low fracture toughness and high fracture-initiation stress. This conclusion is not borne out, however, by limited experimental data on brittle steels, even when the kinetic-energy density is small compared with the strain-energy density

  14. Numerical solution of Q evolution equations for fragmentation functions

    Science.gov (United States)

    Hirai, M.; Kumano, S.

    2012-04-01

    Semi-inclusive hadron-production processes are becoming important in high-energy hadron reactions. They are used for investigating properties of quark-hadron matters in heavy-ion collisions, for finding the origin of nucleon spin in polarized lepton-nucleon and nucleon-nucleon reactions, and possibly for finding exotic hadrons. In describing the hadron-production cross sections in high-energy reactions, fragmentation functions are essential quantities. A fragmentation function indicates the probability of producing a hadron from a parton in the leading order of the running coupling constant αs. Its Q dependence is described by the standard DGLAP (Dokshitzer-Gribov-Lipatov-Altarelli-Parisi) evolution equations, which are often used in theoretical and experimental analyses of the fragmentation functions and in calculating semi-inclusive cross sections. The DGLAP equations are complicated integro-differential equations, which cannot be solved in an analytical method. In this work, a simple method is employed for solving the evolution equations by using Gauss-Legendre quadrature for evaluating integrals, and a useful code is provided for calculating the Q evolution of the fragmentation functions in the leading order (LO) and next-to-leading order (NLO) of αs. The renormalization scheme is MSbar in the NLO evolution. Our evolution code is explained for using it in one's studies on the fragmentation functions. Catalogue identifier: AELJ_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AELJ_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 1535 No. of bytes in distributed program, including test data, etc.: 10 191 Distribution format: tar.gz Programming language: Fortran77 Computer: Tested on an HP DL360G5-DC-X5160 Operating system: Linux 2.6.9-42.ELsmp RAM: 130 M

  15. Avian guild assemblages in forest fragments around Budongo ...

    African Journals Online (AJOL)

    Remnant forest fragments provide an opportunity for conservation in fragmented landscapes but some patches are more useful than others. Forest fragments around Budongo Forest Reserve, an Important Bird Area in western Uganda, were surveyed to explore the effects of different aspects of habitat fragmentation on bird ...

  16. Study of fragmentation cross-sections for 12C+12C reaction at 95 MeV/u and 400 MeV/u for hadron-therapy

    International Nuclear Information System (INIS)

    Juliani, Didier

    2013-01-01

    The hadron-therapy is a radiotherapy method using ions (carbon ions here) instead of the more conventional X-rays for cancer treatment. Deep radioresistant tumour areas, as brain carcinoma for example, can be treated thanks to the specific dose deposition at the end of the ion path. This is an additional method to older classic ones (surgery, X-rays, chemotherapy). Two hadron-therapy centres for treatment and research are planned in France from 2018 (ARCHADE) in order to benefit from the newest progress and to keep improving this method. Carbon ions energy loss in the matter follows the Bethe-Bloch law. The maximum of energy depth is located in a limited area called 'Bragg peak'. By adjusting the beam position and energy, the whole volume of the tumor can be irradiated. Nevertheless, nuclear reactions of carbon ion in tissues generate the production of lighter fragments (H, He, Li etc.) that deposit their energy beyond the Bragg peak. Models implemented in hadron-therapy simulation codes (FLUKA, GEANT4 etc.) cannot reproduce angular distributions of the lighter fragments and energy distributions at the same time. These poor estimations affect the treatment planning systems accuracy that are clinically used. Indeed, a bad estimation of fragmentation process induces a bias in the dose calculation concerning healthy cells beyond the Bragg peak. In order to better constraint models, two experiments based on fragmentation cross-sections measurements have been performed. The first one in may 2011 with a beam at 95 MeV/u (GANIL) in collaboration with the LPC Caen and the second one in august 2011 with a beam at 400 MeV/u (GSI) with the FIRST collaboration. E600 experiment is devoted to the study of carbon ions fragmentation at 95 MeV/u in several thin targets (Au, C, , Ti etc.) corresponding to the basic building blocks of human body. Five telescopes are designed for the fragments detection. Each one is a three-stage detector (2 silicon detectors and one CsI scintillator

  17. Immunohistochemical abnormalities of fibrillin in cardiovascular tissues in Marfan's syndrome.

    Science.gov (United States)

    Fleischer, K J; Nousari, H C; Anhalt, G J; Stone, C D; Laschinger, J C

    1997-04-01

    Molecular defects in the glycoprotein fibrillin are believed to be responsible for impaired structural integrity of cardiovascular, skeletal, and ocular tissues in Marfan's syndrome (MFS). Traditionally, excellent results have been achieved with the Bentall composite graft repair of aneurysms of the ascending aorta in MFS. However, because of the potential complications associated with prosthetic valves, there is growing interest in techniques that preserve the native aortic valve. Between May 1994 and February 1995, 15 patients with a history of concomitant or remote aortic root aneurysms or dissection underwent operation for valvular heart disease. Specimens of aortic valve, ascending aortic wall, and mitral valve were obtained specifically to observe differences in fibrillin content and architecture between patients with (n = 9) and without (n = 6) MFS. In addition, control specimens of aortic valve, aortic wall, and mitral valve were obtained from 4 patients with isolated valvular or coronary artery disease but no evidence of connective tissue disorders or other aortic pathologic conditions. Fibrillin immunostaining using indirect immunofluorescence was used. Specimens were coded and graded by a blinded observer to determine quantity, homogeneity, and fragmentation of fibrillin. Observed fibrillin abnormalities in MFS and control patients were limited to the midportion (elastin-associated microfibrils) of the aortic valve, aortic wall, and mitral valve tissues. Fibrillin abnormalities of aortic valve, aortic wall, and mitral valve tissues were seen in all patients with MFS and were most severe in those older than 20 years. Similar fibrillin abnormalities of aortic valve and aortic wall specimens were observed in control patients more than 60 years old. Even in the setting of a normal-appearing aortic valve, the current rationale for widespread use of valve-sparing repairs of aortic root aneurysms in patients with MFS and patients older than 60 years should be

  18. Exact and Asymptotic Scaling Solutions for Fragmentation with Mass Loss

    OpenAIRE

    Cai, M.; Edwards, Boyd F.; Han, H.

    1991-01-01

    Exact and asymptotic solutions to a linear rate equation for fragmentation with mass loss are presented. Solutions for spatially discrete random bond annihilation illustrate the mutual exclusiveness of the fragmentation and recession terms in the rate equation. Exact solutions for deterministic equal fragment recession show that continuous mass loss between fragmentation events can be approximated by discrete mass loss during fragmentation events when this mass loss is small. Evidence ...

  19. Modified Fragmentation Function from Quark Recombination

    Energy Technology Data Exchange (ETDEWEB)

    Majumder, A.; Wang, Enke; Wang, Xin-Nian

    2005-07-26

    Within the framework of the constituent quark model, it isshown that the single hadron fragmentation function of a parton can beexpressed as a convolution of shower diquark or triquark distributionfunction and quark recombination probability, if the interference betweenamplitudes of quark recombination with different momenta is neglected.Therecombination probability is determined by the hadron's wavefunction inthe constituent quark model. The shower diquark or triquark distributionfunctions of a fragmenting jet are defined in terms of overlappingmatrices of constituent quarks and parton field operators. They aresimilar in form to dihadron or trihadron fragmentation functions in termsof parton operator and hadron states. Extending the formalism to thefield theory at finite temperature, we automatically derive contributionsto the effective single hadron fragmentation function from therecombination of shower and thermal constituent quarks. Suchcontributions involve single or diquark distribution functions which inturn can be related to diquark or triquark distribution functions via sumrules. We also derive QCD evolution equations for quark distributionfunctions that in turn determine the evolution of the effective jetfragmentation functions in a thermal medium.

  20. Nucleosomal DNA fragments in autoimmune diseases

    NARCIS (Netherlands)

    Holdenrieder, Stefan; Eichhorn, Peter; Beuers, Ulrich; Samtleben, Walter; Schoenermarck, Ulf; Zachoval, Reinhart; Nagel, Dorothea; Stieber, Petra

    2006-01-01

    The inadequate response of immune cells to circulating apoptotic products, such as nucleosomal DNA fragments, is assumed to be a potent stimulus for the production of autoantibodies during the pathogenesis and progression of systemic lupus erythematosus (SLE). Here, we analyzed the levels of

  1. Diquark fragmentation in leptoproduction of hadrons

    International Nuclear Information System (INIS)

    Beavis, D.; Desai, B.R.

    1981-08-01

    In the analysis of the leptoproduction data for the charge ratios of hadrons, the Sukhatme, Lassila and Orava (SLO) model for diquark fragmentation is shown to be consistent with the hypothesis of a diquark acting as a single unit. The baryon contribution to the charge ratio, ignored earlier by SLO, makes a significant effect. (author)

  2. Achieving climate connectivity in a fragmented landscape

    Science.gov (United States)

    Lawler, Joshua J.; McRae, Brad H.; Nuñez, Tristan A.; Theobald, David M.

    2016-01-01

    The contiguous United States contains a disconnected patchwork of natural lands. This fragmentation by human activities limits species’ ability to track suitable climates as they rapidly shift. However, most models that project species movement needs have not examined where fragmentation will limit those movements. Here, we quantify climate connectivity, the capacity of landscape configuration to allow species movement in the face of dynamically shifting climate. Using this metric, we assess to what extent habitat fragmentation will limit species movements in response to climate change. We then evaluate how creating corridors to promote climate connectivity could potentially mitigate these restrictions, and we assess where strategies to increase connectivity will be most beneficial. By analyzing fragmentation patterns across the contiguous United States, we demonstrate that only 41% of natural land area retains enough connectivity to allow plants and animals to maintain climatic parity as the climate warms. In the eastern United States, less than 2% of natural area is sufficiently connected. Introducing corridors to facilitate movement through human-dominated regions increases the percentage of climatically connected natural area to 65%, with the most impactful gains in low-elevation regions, particularly in the southeastern United States. These climate connectivity analyses allow ecologists and conservation practitioners to determine the most effective regions for increasing connectivity. More importantly, our findings demonstrate that increasing climate connectivity is critical for allowing species to track rapidly changing climates, reconfiguring habitats to promote access to suitable climates. PMID:27298349

  3. Element Distribution and Multiplicity of Heavy Fragments

    CERN Multimedia

    2002-01-01

    This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...

  4. Vocabularies Clashing: "The Fragmented Generation" Describes Itself

    Science.gov (United States)

    Collins, Daniel

    2011-01-01

    After reading Scott Seider and Howard Gardner's essay "The Fragmented Generation" (2009) in a college freshman writing class, students responded by providing their own labels for their generation. This article includes excerpts from their essays. Following these excerpts is the instructor's theoretical justification for this kind of classroom…

  5. DNA fragmentation by charged particle tracks

    Science.gov (United States)

    Stenerlöw, B.; Höglund, E.; Carlsson, J.

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons ( 60Co) or 125 keV/μm nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome.

  6. Targeting incentives to reduce habitat fragmentation

    Science.gov (United States)

    David Lewis; Andrew Plantinga; Junjie Wu

    2009-01-01

    This article develops a theoretical model to analyze the spatial targeting of incentives for the restoration of forested landscapes when wildlife habitat can be enhanced by reducing fragmentation. The key theoretical result is that the marginal net benefits of increasing forest can be convex, in which case corner solutions--converting either none or all of the...

  7. The paradox of forest fragmentation genetics

    Science.gov (United States)

    Andrea T. Kramer; Jennifer L. Ison; Mary V. Ashley; Henry F. Howe

    2008-01-01

    Theory predicts widespread loss of genetic diversity from drift and inbreeding in trees subjected to habitat fragmentation, yet empirical support of this theory is scarce. We argue that population genetics theory may be misapplied in light of ecological realities that, when recognized, require scrutiny of underlying evolutionary assumptions. One ecological reality is...

  8. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  9. Distribution and Causes of Global Forest Fragmentation

    Directory of Open Access Journals (Sweden)

    Timothy G. Wade

    2003-12-01

    Full Text Available Because human land uses tend to expand over time, forests that share a high proportion of their borders with anthropogenic uses are at higher risk of further degradation than forests that share a high proportion of their borders with non-forest, natural land cover (e.g., wetland. Using 1-km advanced very high resolution radiometer (AVHRR satellite-based land cover, we present a method to separate forest fragmentation into natural and anthropogenic components, and report results for all inhabited continents summarized by World Wildlife Fund biomes. Globally, over half of the temperate broadleaf and mixed forest biome and nearly one quarter of the tropical rainforest biome have been fragmented or removed by humans, as opposed to only 4% of the boreal forest. Overall, Europe had the most human-caused fragmentation and South America the least. This method may allow for improved risk assessments and better targeting for protection and remediation by identifying areas with high amounts of human-caused fragmentation.

  10. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  11. Fragmentation of forest, grassland, and shrubland

    Science.gov (United States)

    Kurt H. Riitters

    2013-01-01

    As humans introduce competing land uses into natural landscapes, the public concerns regarding landcover patterns are expressed through headline issues such as urban sprawl, forest fragmentation, water quality, and wilderness preservation. The spatial arrangement of an environment affects all human perceptions and ecological processes within that environment, but this...

  12. Habitat fragmentation causes rapid genetic differentiation and ...

    African Journals Online (AJOL)

    ... city buildings. These results were supported by multiple statistical analyses including Mantel's test, PCOORDA and AMOVA. Genetic enrichment and epigenetic variation studies can be included in habitat fragmentation analysis and its implications in inducing homogenization and susceptibility in natural plant populations.

  13. Fragmentation characteristics analysis of sandstone fragments based on impact rockburst test

    Directory of Open Access Journals (Sweden)

    Dongqiao Liu

    2014-06-01

    Full Text Available Impact rockburst test on sandstone samples with a central hole is carried out under true triaxial static loads and vertical dynamic load conditions, and rock fragments after the test are collected. The fragments of sandstone generated from strain rockburst test and uniaxial compression test are also collected. The fragments are weighed and the length, width and thickness of each piece of fragments are measured respectively. The fragment quantities with coarse, medium, fine and micro grains in different size ranges, mass and particles distributions are also analyzed. Then, the fractal dimension of fragments is calculated by the methods of size-frequency, mass-frequency and length-to-thickness ratio-frequency. It is found that the crushing degree of impact rockburst fragments is higher, accompanied with blocky characteristics observably. The mass percentage of small grains, including fine and micro grains, in impact rockburst test is higher than those in strain rockburst test and uniaxial compression test. Energy dissipation from rockburst tests is more than that from uniaxial compression test, as the quantity of micro grains generated does.

  14. Quality control in tissue banking--ensuring the safety of allograft tissues.

    Science.gov (United States)

    Humphries, Linda K; Mansavage, Vicki L

    2006-09-01

    DESPITE FEDERAL REGULATIONS for tissue-banking practices, inadequate quality control led to the largest allograft tissue recall in history in October 2005. THE RECALL INCLUDED all allograft tissues obtained from 761 donors and distributed by five tissue banks. Many of these tissues already had been implanted and were unrecoverable. THIS ARTICLE DESCRIBES the many tissue-banking industry variables, including donor selection and testing and tissue recovery, processing, and preservation. QUESTIONS THAT HEALTH CARE providers can ask to determine which tissue banks' quality control measures best ensure the safety of the allografts they provide also are included.

  15. Fragment Formula Calculator (FFC): Determination of Chemical Formulas for Fragment Ions in Mass Spectrometric Data

    Science.gov (United States)

    Wegner, André; Weindl, Daniel; Jäger, Christian; Sapcariu, Sean C.; Dong, Xiangyi; Stephanopoulos, Gregory; Hiller, Karsten

    2015-01-01

    The accurate determination of mass isotopomer distributions (MID) is of great significance for stable isotope-labeling experiments. Most commonly, MIDs are derived from gas chromatography/electron ionization mass spectrometry (GC/EI-MS) measurements. The analysis of fragment ions formed during EI, which contain only specific parts of the original molecule can provide valuable information on the positional distribution of the label. The chemical formula of a fragment ion is usually applied to derive the correction matrix for accurate MID calculation. Hence, the correct assignment of chemical formulas to fragment ions is of crucial importance for correct MIDs. Moreover, the positional distribution of stable isotopes within a fragment ion is of high interest for stable isotope-assisted metabolomics techniques. For example, 13C-metabolic flux analyses (13C-MFA) are dependent on the exact knowledge of the number and position of retained carbon atoms of the unfragmented molecule. Fragment ions containing different carbon atoms are of special interest, since they can carry different flux information. However, the process of mass spectral fragmentation is complex, and identifying the substructures and chemical formulas for these fragment ions is nontrivial. For that reason, we developed an algorithm, based on a systematic bond cleavage, to determine chemical formulas and retained atoms for EI derived fragment ions. Here, we present the fragment formula calculator (FFC) algorithm that can calculate chemical formulas for fragment ions where the chemical bonding (e.g., Lewis structures) of the intact molecule is known. The proposed algorithm is able to cope with general molecular rearrangement reactions occurring during EI in GC/MS measurements. The FFC algorithm is able to integrate stable isotope labeling experiments into the analysis and can automatically exclude candidate formulas that do not fit the observed labeling patterns.1 We applied the FFC algorithm to create a

  16. Fragment formula calculator (FFC): determination of chemical formulas for fragment ions in mass spectrometric data.

    Science.gov (United States)

    Wegner, André; Weindl, Daniel; Jäger, Christian; Sapcariu, Sean C; Dong, Xiangyi; Stephanopoulos, Gregory; Hiller, Karsten

    2014-02-18

    The accurate determination of mass isotopomer distributions (MID) is of great significance for stable isotope-labeling experiments. Most commonly, MIDs are derived from gas chromatography/electron ionization mass spectrometry (GC/EI-MS) measurements. The analysis of fragment ions formed during EI, which contain only specific parts of the original molecule can provide valuable information on the positional distribution of the label. The chemical formula of a fragment ion is usually applied to derive the correction matrix for accurate MID calculation. Hence, the correct assignment of chemical formulas to fragment ions is of crucial importance for correct MIDs. Moreover, the positional distribution of stable isotopes within a fragment ion is of high interest for stable isotope-assisted metabolomics techniques. For example, (13)C-metabolic flux analyses ((13)C-MFA) are dependent on the exact knowledge of the number and position of retained carbon atoms of the unfragmented molecule. Fragment ions containing different carbon atoms are of special interest, since they can carry different flux information. However, the process of mass spectral fragmentation is complex, and identifying the substructures and chemical formulas for these fragment ions is nontrivial. For that reason, we developed an algorithm, based on a systematic bond cleavage, to determine chemical formulas and retained atoms for EI derived fragment ions. Here, we present the fragment formula calculator (FFC) algorithm that can calculate chemical formulas for fragment ions where the chemical bonding (e.g., Lewis structures) of the intact molecule is known. The proposed algorithm is able to cope with general molecular rearrangement reactions occurring during EI in GC/MS measurements. The FFC algorithm is able to integrate stable isotope labeling experiments into the analysis and can automatically exclude candidate formulas that do not fit the observed labeling patterns.1 We applied the FFC algorithm to create

  17. Elemental mapping of Moon soil and meteorite fragments

    International Nuclear Information System (INIS)

    Vasilescu, A.; Constantinescu, B.; Bugoi, R.; Ceccato, D.

    2009-01-01

    The distributions of minor and trace elements in witnesses of the geological history of the Universe, like meteorites or the Moon, can provide knowledge on the processes, which took place during the formation of the Solar System. Micro-PIXE investigations on some Transylvanian meteorite fragments (Madaras, Moci group) and moon soil samples from the LUNA16 mission were performed at the LNL proton microprobe. The aim of the investigation was to analyze the trace element distributions in the mineral phases, looking for low and high Ti content in lunar rocks and for grains containing Fe, Ni, Cr and Pb in meteorites. Elemental spectra and maps were obtained on the samples and chosen inclusions. Analysis and interpretation of the data was done with the MAPPIX and GUPIX packages. The results are discussed in the context of data obtained on similar samples by other methods. (authors)

  18. Xenografting of sheep testis tissue and isolated cells as a model for preservation of genetic material from endangered ungulates.

    Science.gov (United States)

    Arregui, Lucía; Rathi, Rahul; Megee, Susan O; Honaramooz, Ali; Gomendio, Montserrat; Roldan, Eduardo R S; Dobrinski, Ina

    2008-07-01

    Recovery of germ cells could be an option for preservation of the genetic pool of endangered animals. In immature males, xenografting of testis tissue provides the opportunity to recover sperm from these animals. In adult animals, xenografting has been less successful, but de novo morphogenesis of functional testis tissue from dissociated testis cells could be an alternative. To assess the potential use of these techniques in endangered bovid species, the domestic sheep was used as a model. Testes from 2-week-old lambs were grafted as tissue fragments or cell suspensions into nude mice. Grafts were recovered at 4, 8, 12 and 16 weeks post grafting. For isolated cells, two additional time points at 35 and 40 weeks after grafting were added. In addition, to analyse the possible effect of social stress among mice within a group on the development of the grafts, testis tissue grafts were recovered 13 weeks post grafting from mice housed individually and in groups. Complete spermatogenesis occurred in sheep testis xenografts at 12 weeks, similar to the situation in situ. Isolated sheep testis cells were able to reorganize and form functional testicular tissue de novo. Housing mice individually or in groups did not have any effect on the development of xenografts. Xenografting of testis tissue might be useful to obtain sperm from immature endangered ungulates that die prematurely. Testis tissue de novo morphogenesis from isolated cells could open interesting options to recover germ cells from mature males with impaired spermatogenesis.

  19. Masticator Space Foreign Body in a Child Presenting With Otorrhea and Granulation Tissue of the External Auditory Canal.

    Science.gov (United States)

    Tawfik, Kareem O; Edwards, Colin R; Jones, Blaise V; Myer, Charles M

    2016-10-01

    We report an unusual case of masticator space foreign body in a patient presenting with otorrhea and granulation tissue within the external auditory canal (EAC). Case report. A 16-month-old male presented with fever, unilateral otorrhea, facial swelling, leukocytosis, and granulation tissue within the EAC that failed to respond to conventional medical treatment. Computed tomography scan showed EAC and middle ear opacification and soft tissue swelling involving the masticator space. Given concerns for malignancy, biopsies of tissue within the EAC and of a newly detected right buccal mass were performed, revealing granulation tissue. Concern persisted for neoplasm, however, and magnetic resonance imaging was obtained, showing a masticator space foreign body and possible osteomyelitis of the mandible and pterygoid plates. The patient underwent urgent operative removal of a 3 cm crayon fragment from the masticator space and debridement of granulation tissue arising from a small defect at the inferior medial cartilaginous EAC. He likely sustained foreign body injury several weeks earlier upon falling from standing height while biting a crayon. Postoperatively, he was observed in hospital on intravenous antibiotics and improved significantly. He has since fully recovered. Masticator space foreign bodies may present with erosion and granulation tissue of the EAC. © The Author(s) 2016.

  20. Tissue irradiator

    International Nuclear Information System (INIS)

    Hungate, F.P.; Riemath, W.F.; Bunnell, L.R.

    1975-01-01

    A tissue irradiator is provided for the in-vivo irradiation of body tissue. The irradiator comprises a radiation source material contained and completely encapsulated within vitreous carbon. An embodiment for use as an in-vivo blood irradiator comprises a cylindrical body having an axial bore therethrough. A radioisotope is contained within a first portion of vitreous carbon cylindrically surrounding the axial bore, and a containment portion of vitreous carbon surrounds the radioisotope containing portion, the two portions of vitreous carbon being integrally formed as a single unit. Connecting means are provided at each end of the cylindrical body to permit connections to blood-carrying vessels and to provide for passage of blood through the bore. In a preferred embodiment, the radioisotope is thulium-170 which is present in the irradiator in the form of thulium oxide. A method of producing the preferred blood irradiator is also provided, whereby nonradioactive thulium-169 is dispersed within a polyfurfuryl alcohol resin which is carbonized and fired to form the integral vitreous carbon body and the device is activated by neutron bombardment of the thulium-169 to produce the beta-emitting thulium-170

  1. Drugs obtained by biotechnology processing

    Directory of Open Access Journals (Sweden)

    Hugo Almeida

    2011-06-01

    Full Text Available In recent years, the number of drugs of biotechnological origin available for many different diseases has increased exponentially, including different types of cancer, diabetes mellitus, infectious diseases (e.g. AIDS Virus / HIV as well as cardiovascular, neurological, respiratory, and autoimmune diseases, among others. The pharmaceutical industry has used different technologies to obtain new and promising active ingredients, as exemplified by the fermentation technique, recombinant DNA technique and the hybridoma technique. The expiry of the patents of the first drugs of biotechnological origin and the consequent emergence of biosimilar products, have posed various questions to health authorities worldwide regarding the definition, framework, and requirements for authorization to market such products.Nos últimos anos, tem aumentado exponencialmente o número de fármacos de origem biotecnológica ao dispor das mais diversas patologias, entre elas destacam-se, os diferentes tipos de cancêr, as doenças infecciosas (ex. vírus AIDS/HIV, as doenças autoimunes, as doenças cardiovasculares, a Diabetes Mellitus, as doenças neurológicas, as doenças respiratórias, entre outras. A indústria farmacêutica tem recorrido a diferentes tecnologias para a obtenção de novos e promissores princípios ativos, como são exemplo a fermentação, a técnica de DNA Recombinante, a técnica de hidridoma, entre outras. A queda das patentes dos primeiros fármacos de origem biotecnológica e o consequente aparecimento dos produtos biossimilares têm colocado diferentes questões às autoridades de saúde mundiais, sobre a definição, enquadramento e exigências para a autorização de entrada no mercado deste tipo de produtos.

  2. Fragmentation of neutral carbon clusters formed by high velocity atomic collision; Fragmentation d'agregats de carbone neutres formes par collision atomique a haute vitesse

    Energy Technology Data Exchange (ETDEWEB)

    Martinet, G

    2004-05-01

    The aim of this work is to understand the fragmentation of small neutral carbon clusters formed by high velocity atomic collision on atomic gas. In this experiment, the main way of deexcitation of neutral clusters formed by electron capture with ionic species is the fragmentation. To measure the channels of fragmentation, a new detection tool based on shape analysis of current pulse delivered by semiconductor detectors has been developed. For the first time, all branching ratios of neutral carbon clusters are measured in an unambiguous way for clusters size up to 10 atoms. The measurements have been compared to a statistical model in microcanonical ensemble (Microcanonical Metropolis Monte Carlo). In this model, various structural properties of carbon clusters are required. These data have been calculated with Density Functional Theory (DFT-B3LYP) to find the geometries of the clusters and then with Coupled Clusters (CCSD(T)) formalism to obtain dissociation energies and other quantities needed to compute fragmentation calculations. The experimental branching ratios have been compared to the fragmentation model which has allowed to find an energy distribution deposited in the collision. Finally, specific cluster effect has been found namely a large population of excited states. This behaviour is completely different of the atomic carbon case for which the electron capture in the ground states predominates. (author)

  3. [Importance of 3T3 feeder layer to establish epithelial cultures from cell suspension obtained from corneo-scleral rims].

    Science.gov (United States)

    Cristovam, Priscila Cardoso; Glória, Maria Aparecida da; Melo, Gustavo Barreto; Gomes, José Alvaro Pereira

    2008-01-01

    To evaluate the importance of the presence of 3T3 fibroblasts for establishing limbal epithelial cultures from cell suspension obtained from corneo-scleral rims (CSR). Corneo-scleral rims from different donors (n=6) had their posterior stroma and endothelium stripped away. Each corneo-scleral rim was divided into three equal segments that were set up in tissue culture in three different conditions: one of the segments was placed with the epithelial side up on the bottom of a 6-well culture plate (Group A). The other two fragments were trypsinized and the obtained cell suspension was cultured with (Group B) or without (Group C) irradiaded 3T3 cells. The cells were cultured in supplemental hormonal epithelial medium (SHEM), the epithelial migration and clone formation in groups A, B and C were evaluated with phase contrast microscopy and rodamine B staining. Epithelial cell growth was observed in 4/6 rims (Group A). All epithelial cell suspensions that were cultured with 3T3 cells (Group B) formed clones. No adhesion or true clone formation (holo- or meroclones) was observed in the cell suspensions that were cultivated without 3T3 (Group C) (p=0.009). Epithelial cell suspension obtained from corneo-scleral rims in this model needs to be cultivated with 3T3 cells in order to form clones and establish limbal epithelial cell colonies with the potential to be used for ocular surface reconstruction.

  4. Effect of different gravity environments on DNA fragmentation and cell death in Kalanchoe leaves.

    Science.gov (United States)

    Pedroso, M C; Durzan, D J

    2000-11-01

    Different gravity environments have been shown to significantly affect leaf-plantlet formation and asexual reproduction in Kalanchoë daigremontiana Ham. and Perr. In the present work, we investigated the effect of gravity at tissue and cell levels. Leaves and leaf-plantlets were cultured for different periods of time (min to 15 d) in different levels of gravity stimulation: simulated hypogravity (1 rpm clinostats; 2 x 10(-4) g), 1 g (control) and hypergravity (centrifugation; 20 and 150 g). Both simulated hypogravity and hypergravity affected cell death (apoptosis) in this species, and variations in the number of cells showing DNA fragmentation directly correlated with nitric oxide (NO) formation. Apoptosis in leaves was more common as gravity increased. Apoptotic cells were localized in the epidermis, mainly guard cells, in leaf parenchyma, and in tracheary elements undergoing terminal differentiation. Exposures to acute hypergravity (up to 60 min) showed that chloroplast DNA fragmentation occurred prior to nuclear DNA fragmentation, marginalization of chromatin, nuclear condensation, and nuclear blebbing. Addition of sodium nitroprusside (NO donor) mimicked centrifugation. NO and DNA fragmentation decreased with N(G)-monomethyl-L-arginine (NO-synthase inhibitor). The variations in NO levels, nucleoid DNA fragmentation, and cell death show how chloroplasts, cells and leaves may respond (and adapt) to gravity changes. c 2000 Annals of Botany Company.

  5. First donation of human skin obtained from corpse

    International Nuclear Information System (INIS)

    Reyes F, M.L.; Luna Z, D.

    2007-01-01

    The first donation of human skin coming from a cadaverous donor was obtained in the State of Mexico. The skin was obtained of a 34 year-old multi organic donor, the extraction of the same was carried out in an operating theatre by medical personnel, supported by personal of the Radio sterilized Tissue Bank (BTR) of the ININ. The skin was transported to the BTR for it processing. (Author)

  6. The Flp double cross system a simple efficient procedure for cloning DNA fragments

    Directory of Open Access Journals (Sweden)

    Sadowski Paul D

    2003-07-01

    Full Text Available Abstract Background While conventional cloning methods using restriction enzymes and polynucleotide ligase are adequate for most DNAs, fragments made by the polymerase chain reaction are difficult to clone because the amplifying DNA polymerase tends to add untemplated nucleotides to the 3'-termini of the amplified strands. Conservative site-specific recombinases offer an efficient alternative to conventional cloning methods. Results In this paper I describe the use of the Flp site-specific recombinase for cloning PCR-amplified fragments. A DNA fragment is amplified with primers that contain at their ends inverted target sequences for Flp. Flp readily recombines these fragments in vitro into a vector that also contains two inverted Flp target sequences surrounding the α-complementing region of the lacZ gene of E. coli. The recombinants are conveniently detected as white colonies by the familiar blue/white screening test for lacZ activity. A useful feature of the system is that both orientations of the inserted DNA are usually obtained. If the recipient vector is cut between the two inverted Flp targets, Flp "heals" the double-strand break by inserting a linear fragment flanked by Flp targets. Conclusion This system ("The Flp Double Cross System" should be useful for cloning multiple PCR fragments into many sites in several vectors. It has certain advantages over other available recombinase-based cloning procedures.

  7. Intermediate mass fragments emission in the reaction 96 MeV 19F on 12C

    International Nuclear Information System (INIS)

    Bhattacharya, C.; Bandyopadhyay, D.; Basu, S.K.; Bhattacharya, S.; Krishan, K.; Murthy, G.S.; Chatterjee, A.; Kailas, S.; Singh, P.

    1996-01-01

    The energy distributions of the complex fragments (3≤Z≤11) emitted in the reaction 19 F(96 MeV) + 12 C have been measured in the angular range 10 degree ≤θ lab ≤60 degree. The lighter fragments (3≤Z≤6) have been found to be emitted predominantly due to the asymmetric fissionlike decay of the compound nucleus, whereas the heavier fragments (Z≥10) have been identified as evaporation residues. The shapes of the fragment energy distributions, as well as the total elemental yields for the lighter fragments (3≤Z≤6) have been explained fairly well by the asymmetric binary fission model. The binary fragment yields from the reaction 19 F(96 MeV) + 12 C have been compared with those obtained in α(60 MeV) + 27 Al and 7 Li(47 MeV) + 24 Mg reactions, all producing the same composite 31 P at same excitation energy. No significant entrance channel asymmetry dependence has been observed. copyright 1996 The American Physical Society

  8. Fragment E1 labeled with I-123 in the detection of venous thrombosis

    Energy Technology Data Exchange (ETDEWEB)

    Knight, L.C.; Maurer, A.H.; Robbins, P.S.; Malmud, L.S.; Budzynski, A.Z.

    1985-08-01

    Fragment E1, which has been shown to have specific binding affinity for thrombi in an animal model, was investigated in humans for its safety and ability to bind to venous thrombi. Human Fragment E1 was labeled with I-123 and administered intravenously to patients with proved or suspected deep vein thrombosis. The vascular distribution of radioactivity was documented by obtaining gamma camera images of the patients' legs for 30 minutes following administration of I-123-Fragment E1. All patients (n = 5) with documented venous thrombi had rapid localization of labeled Fragment E1 in the area of thrombus. Patients without evidence of thrombi (n = 5) showed no focal localization, although two of these patients showed diffuse uptake along the length of the veins, due to superficial phlebitis. Analysis of blood samples in four patients indicated that disappearance of Fragment E1 from the circulation was more rapid in individuals with thrombosis (t 1/2 = 20 min) than in individuals without thrombosis (t 1/2 = 90 min), and a radiolabeled species of high molecular weight was found in patients with thrombosis but was absent from patients without thrombosis. These early results suggest that radiolabeled Fragment E1 is a safe and potentially valuable agent for the rapid detection of venous thrombosis.

  9. Fragment E1 labeled with I-123 in the detection of venous thrombosis

    International Nuclear Information System (INIS)

    Knight, L.C.; Maurer, A.H.; Robbins, P.S.; Malmud, L.S.; Budzynski, A.Z.

    1985-01-01

    Fragment E1, which has been shown to have specific binding affinity for thrombi in an animal model, was investigated in humans for its safety and ability to bind to venous thrombi. Human Fragment E1 was labeled with I-123 and administered intravenously to patients with proved or suspected deep vein thrombosis. The vascular distribution of radioactivity was documented by obtaining gamma camera images of the patients' legs for 30 minutes following administration of I-123-Fragment E1. All patients (n = 5) with documented venous thrombi had rapid localization of labeled Fragment E1 in the area of thrombus. Patients without evidence of thrombi (n = 5) showed no focal localization, although two of these patients showed diffuse uptake along the length of the veins, due to superficial phlebitis. Analysis of blood samples in four patients indicated that disappearance of Fragment E1 from the circulation was more rapid in individuals with thrombosis (t 1/2 = 20 min) than in individuals without thrombosis (t 1/2 = 90 min), and a radiolabeled species of high molecular weight was found in patients with thrombosis but was absent from patients without thrombosis. These early results suggest that radiolabeled Fragment E1 is a safe and potentially valuable agent for the rapid detection of venous thrombosis

  10. Dental fragment embedded in the lower lip after facial trauma: Brief review literature and report of a case

    Directory of Open Access Journals (Sweden)

    Dorina Lauritano

    2012-01-01

    Full Text Available Upper incisors are the most frequently involved teeth in traumatic dental injuries. Soft tissues (lips and/or oral mucosa adjacent to incisal edge can receive direct and/or indirect traumas. Laceration of the lower lip is a not rare eventuality and teeth fragments could be embedded in labial soft tissue. The reattachment of these fragments, if possible, is the elective treatment choice, thanks to the modern adhesive and restorative techniques. The authors present a case of a white Caucasian 10-year-old child, who attended the dental clinic for the treatment of both upper central incisors′ crown fractures. The fragment of the left incisor was retrieved embedded in the lower lip. It was successfully surgically removed and reattached using a composite adhesive technique. A careful clinical and radiographic examination with the surgical removal of tooth fragments could prevent undesirable foreign body reaction, infection and scarring. The authors also reviewed the most relevant literature concerning tooth fragment reattachment after removal from oral soft tissues.

  11. Tumorigenic fragments of APC cause dominant defects in directional cell migration in multiple model systems

    Directory of Open Access Journals (Sweden)

    Scott A. Nelson

    2012-11-01

    Nonsense mutations that result in the expression of truncated, N-terminal, fragments of the adenomatous polyposis coli (APC tumour suppressor protein are found in most sporadic and some hereditary colorectal cancers. These mutations can cause tumorigenesis by eliminating β-catenin-binding sites from APC, which leads to upregulation of β-catenin and thereby results in the induction of oncogenes such as MYC. Here we show that, in three distinct experimental model systems, expression of an N-terminal fragment of APC (N-APC results in loss of directionality, but not speed, of cell motility independently of changes in β-catenin regulation. We developed a system to culture and fluorescently label live pieces of gut tissue to record high-resolution three-dimensional time-lapse movies of cells in situ. This revealed an unexpected complexity of normal gut cell migration, a key process in gut epithelial maintenance, with cells moving with spatial and temporal discontinuity. Quantitative comparison of gut tissue from wild-type mice and APC heterozygotes (APCMin/+; multiple intestinal neoplasia model demonstrated that cells in precancerous epithelia lack directional preference when moving along the crypt-villus axis. This effect was reproduced in diverse experimental systems: in developing chicken embryos, mesoderm cells expressing N-APC failed to migrate normally; in amoeboid Dictyostelium, which lack endogenous APC, expressing an N-APC fragment maintained cell motility, but the cells failed to perform directional chemotaxis; and multicellular Dictyostelium slug aggregates similarly failed to perform phototaxis. We propose that N-terminal fragments of APC represent a gain-of-function mutation that causes cells within tissue to fail to migrate directionally in response to relevant guidance cues. Consistent with this idea, crypts in histologically normal tissues of APCMin/+ intestines are overpopulated with cells, suggesting that a lack of migration might cause cell

  12. Fragment Formula Calculator (FFC): Determination of Chemical Formulas for Fragment Ions in Mass Spectrometric Data

    OpenAIRE

    Wegner, André; Weindl, Daniel; Jäger, Christian; Sapcariu, Sean C.; Dong, Xiangyi; Stephanopoulos, Gregory; Hiller, Karsten

    2014-01-01

    The accurate determination of mass isotopomer distributions (MID) is of great significance for stable isotope-labeling experiments. Most commonly, MIDs are derived from gas chromatography/electron ionization mass spectrometry (GC/EI-MS) measurements. The analysis of fragment ions formed during EI, which contain only specific parts of the original molecule can provide valuable information on the positional distribution of the label. The chemical formula of a fragment ion is usually applied to ...

  13. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    Energy Technology Data Exchange (ETDEWEB)

    Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

    2014-04-10

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  14. Gas-phase fragmentation of peptides to increase the spatial resolution of the Hydrogen Exchange Mass Spectrometry experiment

    DEFF Research Database (Denmark)

    Jensen, Pernille Foged; Rand, Kasper Dyrberg

    2016-01-01

    are produced after precursor ion selection and thus do not add complexity to the LC-MS analysis. The key to obtaining optimal spatial resolution in a hydrogen exchange mass spectrometry (HX-MS) experiment is the fragmentation efficiency. This chapter discusses common fragmentation techniques like collision......-induced dissociation (CID) occur with complete Hydrogen-deuterium (H/D) scrambling, while other techniques that induce dissociation on a faster timescale through radical-based fragmentation channels, like electron-capture dissociation (ECD) and electron-transfer dissociation (ETD), occur inherently without H......Generation of overlapping peptides in solution via multiple proteases requires a very high peak capacity for the LC-MS analysis to minimize signal overlap. An inherent advantage of a gas-phase fragmentation step is that the additional gas-phase fragment ions used to sublocalize deuterium...

  15. Analysis and performance assessment of a fragment retransmission scheme for energy efficient IEEE 802.11 WLANs.

    Science.gov (United States)

    Mafole, Prosper; Aritsugi, Masayoshi

    2016-01-01

    Backoff-free fragment retransmission (BFFR) scheme enhances the performance of legacy MAC layer fragmentation by eliminating contention overhead. The eliminated overhead is the result of backoff executed before a retransmission attempt is made when fragment transmission failure occurs within a fragment burst. This paper provides a mathematical analysis of BFFR energy efficiency and further assesses, by means of simulations, the energy efficiency, throughput and delay obtained when BFFR is used. The validity of the new scheme is evaluated in different scenarios namely, constant bit rate traffic, realistic bursty internet traffic, node mobility, rigid and elastic flows and their combinations at different traffic loads. We also evaluate and discuss the impact of BFFR on MAC fairness when the number of nodes is varied from 4 to 10. It is shown that BFFR has advantages over legacy MAC fragmentation scheme in all the scenarios.

  16. Use of ribbond and panavia F cement in reattaching fractured tooth fragments of vital maxillary anterior teeth

    Directory of Open Access Journals (Sweden)

    Hemalatha Hiremath

    2012-01-01

    Full Text Available Coronal fractures of the anterior teeth are a common form of dental trauma that mainly affects children and adolescents. One of the options for managing coronal tooth fractures when the tooth fragment is available and there is no or minimal violation of the biological width is the reattachment of the fragment. This article presents a novel technique for reattachment of oblique fractured fragment of vital maxillary central and lateral incisor with pulp exposure. Pulp capping was done using mineral trioxide aggregate. Orthodontic extrusion was done to expose the sub gingival fractured site. Polyethylene fiber (ribbond and panavia F cement were used to reattach the fractured fragment using an internal groove technique to provide high fracture strength to restored tooth. Ribbond fibers can be used to give additional strength to the reattached tooth fragment so that the tooth obtains fracture resistance equal to an intact tooth.

  17. Photochemical tissue bonding

    Science.gov (United States)

    Redmond, Robert W [Brookline, MA; Kochevar, Irene E [Charlestown, MA

    2012-01-10

    Photochemical tissue bonding methods include the application of a photosensitizer to a tissue and/or tissue graft, followed by irradiation with electromagnetic energy to produce a tissue seal. The methods are useful for tissue adhesion, such as in wound closure, tissue grafting, skin grafting, musculoskeletal tissue repair, ligament or tendon repair and corneal repair.

  18. Comparison of five protocols to extract DNA from paraffin-embedded tissues for the detection of human papillomavirus.

    Science.gov (United States)

    Alvarez-Aldana, Adalucy; Martínez, José William; Sepúlveda-Arias, Juan C

    2015-02-01

    Formalin-fixed paraffin-embedded (FFPE) tissues are a valuable source of DNA with which to perform large retrospective studies on the epidemiology of HPV infection. Five different DNA extraction protocols were carried out to evaluate the DNA obtained from FFPE samples with polymerase chain reaction (PCR) using two primer sets to amplify a constitutive human gene, β-globin, and two primer sets to detect the L1 and E6 HPV genes. From the five DNA extraction protocols evaluated, the best results were obtained with protocol A, corresponding to a crude extract from the sample. With the procedures described herein, we were able to amplify DNA extracted from archival paraffin blocks stored for six years. However, the amplification products were more efficiently obtained with primers that amplified shorter fragments. This result indicates that a major factor limiting the extraction process in these samples is DNA fragmentation, a factor that will naturally vary between the different specimens evaluated. Also, depending upon the extraction method, PCR amplification of a human gene does not necessarily guarantee the successful extraction of viral DNA. In conclusion, different DNA and HPV detection methods can significantly influence the results. Therefore, the DNA extraction methods and primers used for DNA amplification in fixed tissues need to be chosen carefully, depending on the specific requirements of the study being carried out. Copyright © 2014 Elsevier GmbH. All rights reserved.

  19. Anisotropic Neutron Evaporation from Spinning Fission Fragments

    Science.gov (United States)

    Stuttgé, L.; Dorvaux, O.; Gönnenwein, F.; Mutterer, M.; Kopatch, Yu.; Chernysheva, E.; Hanappe, F.; Hambsch, F.-J.

    2011-10-01

    Neutron evaporation anisotropy in the centre of mass of the rotating fission fragments in the spontaneous fission of 252Cf has been investigated within the CORA experiments. If it is well accepted that the bulk of emitted neutrons originate from an isotropic evaporation in the centre of mass of the moving fragments, discrepancies in experimental as well as in theoretical energy and angular distributions appear throughout many attempts performed by various authors. Scission neutrons most probably contribute but don't allow to explain totally the observed anisotropy. Due to its weak contribution to the total anisotropy, the centre of mass anisotropy is very difficult to be highlighted. A novel experimental approach has been developed to extract this effect and will be presented as well as some first results.

  20. Fragmentation pathways of ethylene after core ionization

    Science.gov (United States)

    Gaire, B.; Bocharova, I.; Sturm, F. P.; Gehrken, N.; Haxton, D. J.; Belkacem, A.; Weber, Th.; Zohrabi, M.; Ben-Itzhak, I.; Gatton, A.; Williams, J.; Reedy, D.; Nook, C.; Landers, A.; Gassert, H.; Zeller, S.; Voigtsberger, J.; Jahnke, T.; Doerner, R.

    2014-05-01

    We have measured the Auger electrons in coincidence with the recoil ions, resulting from the core ionization of ethylene molecules, by employing the COLd Target Recoil Ion Momentum Spectroscopy (COLTRIMS) method. The Auger-electron and recoil-ion energy maps are used to identify the fragmentation pathways and they are compared to the valence photo-double-ionization of ethylene. The dicationic electronic states favored by the propensity rules are identified and their role on the fragmentation pathways is discussed. The molecular-frame Auger electron angular distribution provides further insight into the breakup of this molecule after core ionization. Supported by the Director, Office of Science, Office of Basic Energy Sciences, and by the Division of Chemical Sciences, Geosciences, and Biosciences of the U.S. Department of Energy at LBNL under Contract No. DE-AC02-05CH11231.

  1. Comparison of human mesenchymal stem cells derived from dental pulp, bone marrow, adipose tissue, and umbilical cord tissue by gene expression.

    Science.gov (United States)

    Stanko, Peter; Kaiserova, Katarina; Altanerova, Veronika; Altaner, Cestmir

    2014-09-01

    Our aims were to characterize human mesenchymal stem cells isolated from various tissues by pluripotent stem cells gene expression profile. Four strains of dental pulp stem cells (DP-MSCs) were isolated from dental pulp tissue fragments adhered to plastic tissue culture dishes. Mesenchymal stem cells derived from umbilical cord tissue (UBC-MSCs) were isolated with the same technique. Bone marrow derived mesenchymal stem cells (BM-MSCs) were isolated from nucleated cells of bone marrow obtained by density gradient centrifugation. Human mesenchymal stem cells from adipose tissue (AT-MSCs) were isolated by collagenase digestion. All kinds of MSCs used in this study were cultivated in low glucose DMEM containing 5% or human platelet extract. All stem cell manipulation was performed in GMP conditions. Expression of 15 pluripotent stem cells genes on the level of proteins was measured by Proteome Profiler Human Pluripotent Stem Cell Array. Induction of MSCs to in vitro differentiation to adipocytes, osteoblasts, chondroblasts was achieved by cultivation of cells in appropriate differentiation medium. All MSCs tested were phenotypically similar and of fibroblastoid morphology. DP-MSCs and UBC-MSCs were more proliferative than bone marrow BM-MSCs and AT-MSCs. Protein expression of 15 genes typical for pluripotent stem cells distinguished them into two groups. While the gene expression profiles of BM-MSC, AT-MSCs and UBC-MSCs were similar, DP-MSCS differed in relative gene expression on the level of their products in several genes. Dental pulp mesenchymal stem cells cultivated in vitro under the same conditions as MSCs from bone marrow, adipose tissue and umbilical cord tissue can be distinguished by pluripotent stem cell gene expression profile.

  2. Spin dependence of heavy quark fragmentation

    International Nuclear Information System (INIS)

    Cornet, Fernando; Garcia Canal, Carlos A.

    2008-01-01

    We propose that the non-perturbative part of the fragmentation function describing the transition from a heavy quark to a heavy meson is proportional to the square of the produced meson wave function at the origin, taking into account hyperfine interactions. We analyze the effects of this proposal on the number of pseudoscalar mesons compared to the number of vector mesons produced and find a good agreement with experimental data. Finally, we discuss further experimental checks for our hypothesis

  3. Fragmentation model analysis of EN2700 fireball

    Czech Academy of Sciences Publication Activity Database

    Spurný, Pavel; Ceplecha, Zdeněk

    2005-01-01

    Roč. 95, 1-4 (2005), s. 477-487 ISSN 0167-9295. [Meteoroids 2004. London, Ontario, 16.08.2004-20.08.2004] R&D Projects: GA ČR GA205/03/1404 Institutional research plan: CEZ:AV0Z10030501 Keywords : ablation * fireball * fragmentation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.975, year: 2005

  4. A note on convex renorming and fragmentability

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    winning strategy for the player if he/she wins every s-play. If the space X is fragmentable by a metric d(· , ·), then has an obvious winning strategy s. Indeed, to each partial play pn this strategy puts into correspondence some nonempty subset Bn ⊂ An which is relatively open in An and has d-diameter less than 1/n. Clearly ...

  5. Measurement of fission fragments energy loss

    CERN Document Server

    Benetti, P; Calligarich, E; Cesana, A; Dolfini, R; Ioppolo, T; Raselli, G L; Terrani, M

    2002-01-01

    The mean energy of sup 2 sup 5 sup 2 Cf fission fragments emerging from an absorber and the determination of the capture rate in the absorber itself have been measured using two independent and complementary nuclear techniques. The results can be applied to the measurement of the energy self-absorption in a non-zero thickness source and can be used to validate simulation programs.

  6. A Novel Albumin-Based Tissue Scaffold for Autogenic Tissue Engineering Applications

    OpenAIRE

    Li, Pei-Shan; -Liang Lee, I.; Yu, Wei-Lin; Sun, Jui-Sheng; Jane, Wann-Neng; Shen, Hsin-Hsin

    2014-01-01

    Tissue scaffolds provide a framework for living tissue regeneration. However, traditional tissue scaffolds are exogenous, composed of metals, ceramics, polymers, and animal tissues, and have a defined biocompatibility and application. This study presents a new method for obtaining a tissue scaffold from blood albumin, the major protein in mammalian blood. Human, bovine, and porcine albumin was polymerised into albumin polymers by microbial transglutaminase and was then cast by freeze-drying-b...

  7. Assessment of genetic and epigenetic changes in virus-free garlic (Allium sativum L.) plants obtained by meristem culture followed by in vitro propagation.

    Science.gov (United States)

    Gimenez, Magalí Diana; Yañez-Santos, Anahí Mara; Paz, Rosalía Cristina; Quiroga, Mariana Paola; Marfil, Carlos Federico; Conci, Vilma Cecilia; García-Lampasona, Sandra Claudia

    2016-01-01

    This is the first report assessing epigenetic variation in garlic. High genetic and epigenetic polymorphism during in vitro culture was detected.Sequencing of MSAP fragments revealed homology with ESTs. Garlic (Allium sativum) is a worldwide crop of economic importance susceptible to viral infections that can cause significant yield losses. Meristem tissue culture is the most employed method to sanitize elite cultivars.Often the virus-free garlic plants obtained are multiplied in vitro (micro propagation). However, it was reported that micro-propagation frequently produces somaclonal variation at the phenotypic level, which is an undesirable trait when breeders are seeking to maintain varietal stability. We employed amplification fragment length polymorphism and methylation sensitive amplified polymorphism (MSAP) methodologies to assess genetic and epigenetic modifications in two culture systems: virus-free plants obtained by meristem culture followed by in vitro multiplication and field culture. Our results suggest that garlic exhibits genetic and epigenetic polymorphism under field growing conditions. However, during in vitro culture system both kinds of polymorphisms intensify indicating that this system induces somaclonal variation. Furthermore, while genetic changes accumulated along the time of in vitro culture, epigenetic polymorphism reached the major variation at 6 months and then stabilize, being demethylation and CG methylation the principal conversions.Cloning and sequencing differentially methylated MSAP fragments allowed us to identify coding and unknown sequences of A. sativum, including sequences belonging to LTR Gypsy retrotransposons. Together, our results highlight that main changes occur in the initial 6 months of micro propagation. For the best of our knowledge, this is the first report on epigenetic assessment in garlic.

  8. Isolation of tissues and preservation of RNA from intact, germinated barley grain.

    Science.gov (United States)

    Betts, Natalie S; Berkowitz, Oliver; Liu, Ruijie; Collins, Helen M; Skadhauge, Birgitte; Dockter, Christoph; Burton, Rachel A; Whelan, James; Fincher, Geoffrey B

    2017-08-01

    Isolated barley (Hordeum vulgare L.) aleurone layers have been widely used as a model system for studying gene expression and hormonal regulation in germinating cereal grains. A serious technological limitation of this approach has been the inability to confidently extrapolate conclusions obtained from isolated tissues back to the whole grain, where the co-location of several living and non-living tissues results in complex tissue-tissue interactions and regulatory pathways coordinated across the multiple tissues. Here we have developed methods for isolating fragments of aleurone, starchy endosperm, embryo, scutellum, pericarp-testa, husk and crushed cell layers from germinated grain. An important step in the procedure involves the rapid fixation of the intact grain to freeze the transcriptional activity of individual tissues while dissection is effected for subsequent transcriptomic analyses. The developmental profiles of 19 611 gene transcripts were precisely defined in the purified tissues and in whole grain during the first 24 h of germination by RNA sequencing. Spatial and temporal patterns of transcription were validated against well-defined data on enzyme activities in both whole grain and isolated tissues. Transcript profiles of genes involved in mitochondrial assembly and function were used to validate the very early stages of germination, while the profiles of genes involved in starch and cell wall mobilisation matched existing data on activities of corresponding enzymes. The data will be broadly applicable for the interrogation of co-expression and differential expression patterns and for the identification of transcription factors that are important in the early stages of grain and seed germination. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  9. Characterization of a half-molecular fragment obtained by reduction of human α2-macroglobulin with dithiothreitol

    DEFF Research Database (Denmark)

    Sjöberg, B.; Pap, S.; Kjems, Jørgen

    1985-01-01

    ,000; the latter value is associated with a relatively large error due to the uncertainty in the concentration determination. Shape analysis indicates that the best-fitting scattering-equivalent threeaxial bodies are oblate shaped, with two of their axial dimensions about three to four times larger than the third......, is at 43% D2O; the data are consistent with a particle having a higher scattering density at large distances from the particle centre. From the X-ray and neutron intensities scattered at zero angle, the specific volume was determined to be 0.73 cm3/g at+5°C and the molecular weight to be 390...

  10. Stability of the fragments and thermalization at the peak centre-of ...

    Indian Academy of Sciences (India)

    hot and dense nuclear matter) a power-law dependence was obtained. Keywords. Quantum molecular dynamics; intermediate mass fragments; thermalization. PACS Nos 24.10.Cn; 24.10.Lx. 1. Introduction. The heavy-ion collisions at intermediate energies are excellent for studying the nuclear matter at high density and ...

  11. Use of Restriction Fragment Length Polymorphism of 18S rRNA ...

    African Journals Online (AJOL)

    The restriction fragment length polymorphism (RFLP) pattern of PCR products obtained was the same for T. brucei subspecies: T.b. brucei and T.b. gambiense but different for other trypanosome species and L. donovani. RFLP analysis was also done with genomic DNA from different trypanosome species, subspecies and ...

  12. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  13. [Structure of tryptic fragments of a neurotoxin from black widow spider venom].

    Science.gov (United States)

    Volkova, T M; Galkina, T G; Kudelin, A B; Grishin, E V

    1991-04-01

    The N-terminal amino acid sequence of a neurotoxin from the venom of Latrodectus mactans tredecimguttatus (alpha-latrotoxin) was determined. Latrotoxin was subjected to the tryptic cleavage and total or partial amino acid sequences of 25 peptides were established. In total the tryptic fragments contained 252 amino acid residues. Essential structural information on cloning of the latrotoxin structural gene was obtained.

  14. Global extraction of the parton-to-pion fragmentation functions at NLO accuracy in QCD

    International Nuclear Information System (INIS)

    Hernández-Pinto, R. J.; Epele, M.; De Florian, D.; Sassot, R.; Stratmann, M.

    2016-01-01

    In this review, we discuss the results on the parton-to-pion fragmentation functions obtained in a combined NLO fit to data of single-inclusive hadron production in electron-positron annihilation, proton-proton collisions, and lepton-nucleon deep-inelastic scattering. A more complete discussion can be found in Ref. [1]. (paper)

  15. Global patterns of tropical forest fragmentation

    Science.gov (United States)

    Taubert, Franziska; Fischer, Rico; Groeneveld, Jürgen; Lehmann, Sebastian; Müller, Michael S.; Rödig, Edna; Wiegand, Thorsten; Huth, Andreas

    2018-02-01

    Remote sensing enables the quantification of tropical deforestation with high spatial resolution. This in-depth mapping has led to substantial advances in the analysis of continent-wide fragmentation of tropical forests. Here we identified approximately 130 million forest fragments in three continents that show surprisingly similar power-law size and perimeter distributions as well as fractal dimensions. Power-law distributions have been observed in many natural phenomena such as wildfires, landslides and earthquakes. The principles of percolation theory provide one explanation for the observed patterns, and suggest that forest fragmentation is close to the critical point of percolation; simulation modelling also supports this hypothesis. The observed patterns emerge not only from random deforestation, which can be described by percolation theory, but also from a wide range of deforestation and forest-recovery regimes. Our models predict that additional forest loss will result in a large increase in the total number of forest fragments—at maximum by a factor of 33 over 50 years—as well as a decrease in their size, and that these consequences could be partly mitigated by reforestation and forest protection.

  16. Antibody Fragments as Probe in Biosensor Development

    Directory of Open Access Journals (Sweden)

    Serge Muyldermans

    2008-08-01

    Full Text Available Today’s proteomic analyses are generating increasing numbers of biomarkers, making it essential to possess highly specific probes able to recognize those targets. Antibodies are considered to be the first choice as molecular recognition units due to their target specificity and affinity, which make them excellent probes in biosensor development. However several problems such as difficult directional immobilization, unstable behavior, loss of specificity and steric hindrance, may arise from using these large molecules. Luckily, protein engineering techniques offer designed antibody formats suitable for biomarker analysis. Minimization strategies of antibodies into Fab fragments, scFv or even single-domain antibody fragments like VH, VL or VHHs are reviewed. Not only the size of the probe but also other issues like choice of immobilization tag, type of solid support and probe stability are of critical importance in assay development for biosensing. In this respect, multiple approaches to specifically orient and couple antibody fragments in a generic one-step procedure directly on a biosensor substrate are discussed.

  17. Metastable fragmentation of silver bromide clusters

    International Nuclear Information System (INIS)

    L'Hermite, J.M.; Rabilloud, F.; Marcou, L.; Labastie, P.

    2001-01-01

    The abundance spectra and the fragmentation channels of silver bromide clusters have been measured and analyzed. The most abundant species are Ag n Br n - 1 + and Ag n Br n + 1 - and Ag 14 Br 13 + is a magic number, revealing their ionic nature. However, some features depart from what is generally observed for alkali-halide ionic clusters. From a certain size, Ag n Br n - 1 + is no more the main series, and Ag n Br n - 2, 3 + series become almost as important. The fast fragmentation induced by a UV laser makes the cations lose more bromine than silver ions and lead to more silver-rich clusters. Negative ions mass spectra contain also species with more silver atoms than required by stoichiometry. We have investigated the metastable fragmentation of the cations using a new experimental method. The large majority of the cations release mainly a neutral Ag 3 Br 3 cluster. These decay channels are in full agreement with our recent ab initio DFT calculations, which show that Ag + -Ag + repulsion is reduced due to a globally attractive interaction of their d orbitals. This effect leads to a particularly stable trimer (AgBr) 3 and to quasi-planar cyclic structures of (AgBr) n clusters up to n = 6. We have shown that these two features may be extended to other silver halides, to silver hydroxides (AgOH) n , and to cuprous halide compounds. (orig.)

  18. Cationized Carbohydrate Gas-Phase Fragmentation Chemistry

    Science.gov (United States)

    Bythell, Benjamin J.; Abutokaikah, Maha T.; Wagoner, Ashley R.; Guan, Shanshan; Rabus, Jordan M.

    2017-04-01

    We investigate the fragmentation chemistry of cationized carbohydrates using a combination of tandem mass spectrometry, regioselective labeling, and computational methods. Our model system is D-lactose. Barriers to the fundamental glyosidic bond cleavage reactions, neutral loss pathways, and structurally informative cross-ring cleavages are investigated. The most energetically favorable conformations of cationized D-lactose were found to be similar. In agreement with the literature, larger group I cations result in structures with increased cation coordination number which require greater collision energy to dissociate. In contrast with earlier proposals, the B n -Y m fragmentation pathways of both protonated and sodium-cationized analytes proceed via protonation of the glycosidic oxygen with concerted glycosidic bond cleavage. Additionally, for the sodiated congeners our calculations support sodiated 1,6-anhydrogalactose B n ion structures, unlike the preceding literature. This affects the subsequent propensity of formation and prediction of B n /Y m branching ratio. The nature of the anomeric center (α/β) affects the relative energies of these processes, but not the overall ranking. Low-energy cross-ring cleavages are observed for the metal-cationized analytes with a retro-aldol mechanism producing the 0,2 A 2 ion from the sodiated forms . Theory and experiment support the importance of consecutive fragmentation processes, particularly for the protonated congeners at higher collision energies.

  19. Equilibrium and non equilibrium in fragmentation

    International Nuclear Information System (INIS)

    Dorso, C.O.; Chernomoretz, A.; Lopez, J.A.

    2001-01-01

    Full text: In this communication we present recent results regarding the interplay of equilibrium and non equilibrium in the process of fragmentation of excited finite Lennard Jones drops. Because the general features of such a potential resemble the ones of the nuclear interaction (fact that is reinforced by the similarity between the EOS of both systems) these studies are not only relevant from a fundamental point of view but also shed light on the problem of nuclear multifragmentation. We focus on the microscopic analysis of the state of the fragmenting system at fragmentation time. We show that the Caloric Curve (i e. the functional relationship between the temperature of the system and the excitation energy) is of the type rise plateau with no vapor branch. The usual rise plateau rise pattern is only recovered when equilibrium is artificially imposed. This result puts a serious question on the validity of the freeze out hypothesis. This feature is independent of the dimensionality or excitation mechanism. Moreover we explore the behavior of magnitudes which can help us determine the degree of the assumed phase transition. It is found that no clear cut criteria is presently available. (Author)

  20. Formation and fragmentation of protostellar dense cores

    International Nuclear Information System (INIS)

    Maury, Anaelle

    2009-01-01

    Stars form in molecular clouds, when they collapse and fragment to produce protostellar dense cores. These dense cores are then likely to contract under their own gravity, and form young protostars, that further evolve while accreting their circumstellar mass, until they reach the main sequence. The main goal of this thesis was to study the formation and fragmentation of protostellar dense cores. To do so, two main studies, described in this manuscript, were carried out. First, we studied the formation of protostellar cores by quantifying the impact of protostellar outflows on clustered star formation. We carried out a study of the protostellar outflows powered by the young stellar objects currently formed in the NGc 2264-C proto-cluster, and we show that protostellar outflows seem to play a crucial role as turbulence progenitors in clustered star forming regions, although they seem unlikely to significantly modify the global infall processes at work on clump scales. Second, we investigated the formation of multiple systems by core fragmentation, by using high - resolution observations that allow to probe the multiplicity of young protostars on small scales. Our results suggest that the multiplicity rate of protostars on small scales increase while they evolve, and thus favor dynamical scenarios for the formation of multiple systems. Moreover, our results favor magnetized scenarios of core collapse to explain the small-scale properties of protostars at the earliest stages. (author) [fr

  1. Commissioning the A1900 projectile fragment separator

    CERN Document Server

    Morrissey, D J; Steiner, M; Stolz, A; Wiedenhöver, I

    2003-01-01

    An important part of the recent upgrade of the NSCL facility is the replacement of the A1200 fragment separator with a new high acceptance device called the A1900. The design of the A1900 device represents a third generation projectile fragment separator (relative to the early work at LBL) as it is situated immediately after the primary accelerator, has a very large acceptance, a bending power significantly larger than that of the cyclotron and is constructed from large superconducting magnets (quadrupoles with 20 and 40 cm diameter warm bores). The A1900 can accept over 90% of a large range of projectile fragmentation products produced at the NSCL, leading to large gains in the intensity of the secondary beams. The results of initial tests of the system with a restricted momentum acceptance (+-0.5%) indicate that the A1900 is performing up to specifications. Further large gains in the intensities of primary beams, typically two or three orders of magnitude, will be possible as the many facets of high current...

  2. Isotopic production cross-sections and recoil velocities of spallation-fission fragments in the reaction 238U(1A GeV)+e

    CERN Document Server

    Pereira, J; Wlazlo, W; Benlliure, J; Casarejos, E; Armbruster, P; Bernas, M; Enqvist, T; Legrain, R; Leray, S; Rejmund, F; Mustapha, B; Schmidt, K.-H; Stéphan, C; Taïeb, J; Tassan-Got, L; Volant, C; Boudard, A; Czajkowski, S; 10.1103/PhysRevC.75.014602

    2007-01-01

    Fission fragments of 1A GeV 238U nuclei interacting with a deuterium target have been investigatedwith the Fragment Separator (FRS) at GSI (Darmstadt) by measuring their isotopicproduction cross-sections and recoil velocities. The results, along with those obtained recently forspallation-evaporation fragments, provide a comprehensive analysis of the spallation nuclear productionsin the reaction 238U(1A GeV)+d. Details about experiment performance, data reductionand results will be presented.

  3. Fish responses to experimental fragmentation of seagrass habitat.

    Science.gov (United States)

    Macreadie, Peter I; Hindell, Jeremy S; Jenkins, Gregory P; Connolly, Rod M; Keough, Michael J

    2009-06-01

    Understanding the consequences of habitat fragmentation has come mostly from comparisons of patchy and continuous habitats. Because fragmentation is a process, it is most accurately studied by actively fragmenting large patches into multiple smaller patches. We fragmented artificial seagrass habitats and evaluated the impacts of fragmentation on fish abundance and species richness over time (1 day, 1 week, 1 month). Fish assemblages were compared among 4 treatments: control (single, continuous 9-m(2) patches); fragmented (single, continuous 9-m(2) patches fragmented to 4 discrete 1-m(2) patches); prefragmented/patchy (4 discrete 1-m(2) patches with the same arrangement as fragmented); and disturbance control (fragmented then immediately restored to continuous 9-m(2) patches). Patchy seagrass had lower species richness than actively fragmented seagrass (up to 39% fewer species after 1 week), but species richness in fragmented treatments was similar to controls. Total fish abundance did not vary among treatments and therefore was unaffected by fragmentation, patchiness, or disturbance caused during fragmentation. Patterns in species richness and abundance were consistent 1 day, 1 week, and 1 month after fragmentation. The expected decrease in fish abundance from reduced total seagrass area in fragmented and patchy seagrass appeared to be offset by greater fish density per unit area of seagrass. If fish prefer to live at edges, then the effects of seagrass habitat loss on fish abundance may have been offset by the increase (25%) in seagrass perimeter in fragmented and patchy treatments. Possibly there is some threshold of seagrass patch connectivity below which fish abundances cannot be maintained. The immediate responses of fish to experimental habitat fragmentation provided insights beyond those possible from comparisons of continuous and historically patchy habitat. ©2009 Society for Conservation Biology.

  4. In vivo tissue engineering of musculoskeletal tissues.

    Science.gov (United States)

    McCullen, Seth D; Chow, Andre G Y; Stevens, Molly M

    2011-10-01

    Tissue engineering of musculoskeletal tissues often involves the in vitro manipulation and culture of progenitor cells, growth factors and biomaterial scaffolds. Though in vitro tissue engineering has greatly increased our understanding of cellular behavior and cell-material interactions, this methodology is often unable to recreate tissue with the hierarchical organization and vascularization found within native tissues. Accordingly, investigators have focused on alternative in vivo tissue engineering strategies, whereby the traditional triad (cells, growth factors, scaffolds) or a combination thereof are directly implanted at the damaged tissue site or within ectopic sites capable of supporting neo-tissue formation. In vivo tissue engineering may offer a preferential route for regeneration of musculoskeletal and other tissues with distinct advantages over in vitro methods based on the specific location of endogenous cultivation, recruitment of autologous cells, and patient-specific regenerated tissues. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  6. Shell effects at the touching point of nuclear fragments

    International Nuclear Information System (INIS)

    Poenaru, D.N.; Gherghescu, R.A.; Greiner, W.

    1999-01-01

    Shell correction energy of the fission fragments remains practically unchanged when the separation distance increases from the sum of their radii up to infinity. The variation with mass asymmetry of the total deformation energy at the touching point configuration shows the valleys corresponding to different decay modes, which are produced when the two proton and/or the two neutron numbers are magic or almost magic. We present a potential energy surface of the proton-rich α-emitter 106 Te, showing the α-decay valley, obtained with a phenomenological shell correction. We discuss the difficulties to produce such a valley on a potential energy surface of 236 Pu, calculated with the macroscopic-microscopic method, in which the nuclear level scheme is found within the two center shell model. The valleys mainly due to the double magic nuclei 100,132 Sn, 208 Pb, and other magic numbers, are illustrated by plotting the deformation energy at the touching point versus the proton number of the fragment, for the following parent nuclei: 106 Te, 116 Ce, 212 Po, 238 Th, 258 Fm and 264 Fm. For ternary fission the gain in energy of compact configurations as compared to aligned ones is analysed. (authors)

  7. Construction of Lambda Libraries from Large PFGE Fragments.

    Science.gov (United States)

    Pritchard, C; Burmeister, M

    1992-01-01

    Pulsed-field gel electrophoresis (PFGE) has the capacity to fractionate large fragments of DNA up to thousands of kilobases in size. This aspect of the technique has been exploited for constructing long-range restriction maps of chromosomes from many different species including humans (see Chapters 14 , 15 , and 18 ). Besides its use for analytical purposes, PFGE has also been used as a preparative tool. Intact DNA obtained from preparative PFGE gels has been used for cloning into yeast artificial chromosome (MC) vectors (see Chapter 16 ) and for constructing jumping libraries (1). In addition, DNAeluted from PFGE gels has been used for generating libraries with a smaller insert size (2-7). In this latter procedure, DNA from a somatic cell hybrid is digested with a rare-cutting restriction enzyme, separated by PFGE, and the DNA from a particular PFGE fragment is eluted, digested, and cloned into a plasmid or phage vector. The resulting library is then screened with a species-specific probe to identify DNA segments from the donor chromosome of the hybrid. This use of preparative PFGE has had widespread application in the cloning of DNA close to several important disease genes, namely cystic fibrosis (4,6), Duchenne muscular dystrophy (2), choroideremia (7), polycystic kidney disease (3), and Huntington disease (5).

  8. [Computerized logP prediction using fragment methods].

    Science.gov (United States)

    Takácsné, N K

    1998-01-01

    Lipophilicity, expressed by the logarithm of octanol/water partition coefficient (logP) is an important physico-chemical property in rational drug design. Beside the experimental determination, the calculation of logP based on the chemical structure is frequently necessary. This has led to the development of numerous logP prediction methods. In the present paper the fragment type approaches and their computer softwares are surveyed (Table I.). The compilation is extended to the introduction and evaluation of a recently developed method of Meylan and Howard [21]: Atom/Fragment Contribution, AFC method (KOWWIN for Windows, software) which possesses the unique option, the Experimental Value Adjusted, EVA logP prediction. The author compared the highly precise experimental logP values of 28 drugs measured in her laboratory with calculated logP values obtained by four approaches: KOWWIN, CLOGP, PROLOGP, ACD/logP. The best prediction was found as follows in decreasing order: KOWWIN (r = 0.983), CLOGP (r = 0.978), PROLOGP/Combined (r = 0.953), ACD/logP (r = 0.942), PROLOGP/Atomic5 (r = 0.940), PROLOGP/Rekker (r = 0.909). The limits of current logP prediction methods (intramolecular H-bond formation, tautomerization, conformation changes, etc.) and the promising future of the molecular lipophilicity potential, MLP, [42] in drug design is also discussed.

  9. Mechanism of intermediate mass fragment emission at low energy

    International Nuclear Information System (INIS)

    Dhara, A.K.; Bhattacharya, C.; Bhattacharya, S.; Krishan, K.

    1993-01-01

    The study of the dynamics of intermediate mass fragment emission in fusion-fission processes has been carried out. The average kinetic energies and relative yield ratio of different fragments are calculated and compared with experimental values

  10. Fragmentation reactions of protonated peptides containing glutamine or glutamic acid.

    Science.gov (United States)

    Harrison, Alex G

    2003-02-01

    A variety of protonated dipeptides and tripeptides containing glutamic acid or glutamine were prepared by electrospray ionization or by fast atom bombardment ionization and their fragmentation pathways elucidated using metastable ion studies, energy-resolved mass spectrometry and triple-stage mass spectrometry (MS(3)) experiments. Additional mechanistic information was obtained by exchanging the labile hydrogens for deuterium. Protonated H-Gln-Gly-OH fragments by loss of NH(3) and loss of H(2)O in metastable ion fragmentation; under collision-induced dissociation (CID) conditions loss of H-Gly-OH + CO from the [MH - NH(3)](+) ion forms the base peak C(4)H(6)NO(+) (m/z 84). Protonated dipeptides with an alpha-linkage, H-Glu-Xxx-OH, are characterized by elimination of H(2)O and by elimination of H-Xxx-OH plus CO to form the glutamic acid immonium ion of m/z 102. By contrast, protonated dipeptides with a gamma-linkage, H-Glu(Xxx-OH)-OH, do not show elimination of H(2)O or formation of m/z 102 but rather show elimination of NH(3), particularly in metastable ion fragmentation, and elimination of H-Xxx-OH to form m/z 130. Both the alpha- and gamma-dipeptides show formation of [H-Xxx-OH]H(+), with this reaction channel increasing in importance as the proton affinity (PA) of H-Xxx-OH increases. The characteristic loss of H(2)O and formation of m/z 102 are observed for the protonated alpha-tripeptide H-Glu-Gly-Phe-OH whereas the protonated gamma-tripeptide H-Glu(Gly-Gly-OH)-OH shows loss of NH(3) and formation of m/z 130 as observed for dipeptides with the gamma-linkage. Both tripeptides show abundant formation of the y(2)'' ion under CID conditions, presumably because a stable anhydride neutral structure can be formed. Under metastable ion conditions protonated dipeptides of structure H-Xxx-Glu-OH show abundant elimination of H(2)O whereas those of structure H-Xxx-Gln-OH show abundant elimination of NH(3). The importance of these reaction channels is much reduced under CID

  11. Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

    Science.gov (United States)

    Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

    2018-03-01

    It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

  12. Effects of Neutron Emission on Fragment Mass and Kinetic Energy Distribution from Thermal Neutron-Induced Fission of 235U

    International Nuclear Information System (INIS)

    Montoya, M.; Rojas, J.; Saetone, E.

    2007-01-01

    The mass and kinetic energy distribution of nuclear fragments from thermal neutron-induced fission of 235 U(n th ,f) have been studied using a Monte-Carlo simulation. Besides reproducing the pronounced broadening in the standard deviation of the kinetic energy at the final fragment mass number around m = 109, our simulation also produces a second broadening around m = 125. These results are in good agreement with the experimental data obtained by Belhafaf et al. and other results on yield of mass. We conclude that the obtained results are a consequence of the characteristics of the neutron emission, the sharp variation in the primary fragment kinetic energy and mass yield curves. We show that because neutron emission is hazardous to make any conclusion on primary quantities distribution of fragments from experimental results on final quantities distributions

  13. Cross sections and kinematics of proton induced fragmentation of carbon

    International Nuclear Information System (INIS)

    Streibel, T.; Roecher, H.; Huentrup, G.; Heinrich, W.

    1997-01-01

    Charge changing fragmentation cross sections for C at a proton energy of about 70 MeV were measured. The discrepancies between measurement and model predictions indicate the necessity of further investigations. We have also measured distributions of fragment emission angles which can be described using a model with a momentum transfer to the fragmenting nucleus. The developed model leads to predictions for momentum distributions of proton induced target fragments of C at small energies. (orig.)

  14. Cross sections and kinematics of proton induced fragmentation of carbon

    Energy Technology Data Exchange (ETDEWEB)

    Streibel, T.; Roecher, H.; Huentrup, G.; Heinrich, W. [Siegen Univ. (Germany). Dept. of Physics

    1997-09-01

    Charge changing fragmentation cross sections for C at a proton energy of about 70 MeV were measured. The discrepancies between measurement and model predictions indicate the necessity of further investigations. We have also measured distributions of fragment emission angles which can be described using a model with a momentum transfer to the fragmenting nucleus. The developed model leads to predictions for momentum distributions of proton induced target fragments of C at small energies. (orig.)

  15. Global patterns of fragmentation and connectivity of mammalian carnivore habitat

    OpenAIRE

    Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; Rondinini, Carlo; Boitani, Luigi

    2011-01-01

    Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges...

  16. Monte Carlo simulation for fragment mass and kinetic energy distributions from the neutron-induced fission of {sup 235}U

    Energy Technology Data Exchange (ETDEWEB)

    Montoya, M.; Rojas, J. [Instituto Peruano de Energia Nuclear, Av. Canada 1470, Lima 41 (Peru); Saettone, E. [Facultad de Ciencias, Universidad Nacional de lngenieria, Av. Tupac Amaru 210, Apartado 31-139, Lima (Peru)

    2007-07-01

    The mass and kinetic energy distribution of nuclear fragments from the thermal neutron-induced fission of {sup 235}U have been studied using a Monte Carlo simulation. Besides reproducing the pronounced broadening on the standard deviation of the final fragment kinetic energy distribution ({sigma}{sub e}(m)) around the mass number m = 109, our simulation also produces a second broadening around m = 125 that is in agreement with the experimental data obtained by Belhafaf et al. These results are a consequence of the characteristics of the neutron emission, the variation in the primary fragment mean kinetic energy, and the yield as a function of the mass. (Author)

  17. Tissue engineering; strategies, tissues, and biomaterials.

    Science.gov (United States)

    Bakhshandeh, Behnaz; Zarrintaj, Payam; Oftadeh, Mohammad Omid; Keramati, Farid; Fouladiha, Hamideh; Sohrabi-Jahromi, Salma; Ziraksaz, Zarrintaj

    2017-10-01

    Current tissue regenerative strategies rely mainly on tissue repair by transplantation of the synthetic/natural implants. However, limitations of the existing strategies have increased the demand for tissue engineering approaches. Appropriate cell source, effective cell modification, and proper supportive matrices are three bases of tissue engineering. Selection of appropriate methods for cell stimulation, scaffold synthesis, and tissue transplantation play a definitive role in successful tissue engineering. Although the variety of the players are available, but proper combination and functional synergism determine the practical efficacy. Hence, in this review, a comprehensive view of tissue engineering and its different aspects are investigated.

  18. Excited State Contributions to the Heavy Baryon Fragmentation Functions in a Quark-Diquark Model

    CERN Document Server

    Adamov, A D; Goldstein, Gary R.

    2001-01-01

    Spin dependent fragmentation functions for heavy flavor quarks to fragment into heavy baryons are calculated in a quark-diquark model. The production of intermediate spin 1/2 and 3/2 excited states is explicity included. The resulting $\\Lambda_b$ production rate and polarization at LEP energies are in agreement with experiment. The $\\Lambda_c$ and $\\Xi_c$ functions are also obtained. The spin independent $f_1(z)$ is compared to data. The integrated values for production rates agree with the data.

  19. Angular distribution of photofission fragments in 238U at 5.43 MeV

    International Nuclear Information System (INIS)

    Kuniyoshi, Susumo

    1973-01-01

    The angular distribution of photofission fragments of 238 U, produced by 5.43 MeV monochromatic photons from the η,γ reaction in sulphur, has been measured using glass plates as detectors. In the analysis of the results only the contributions from the (J π , K) 1= (1 - ,0), (1 - ,1) and (2 + ,0) terms were considered. The coefficients of the angular distributions of the fission fragments were obtained. An analysis of the data available in the literature on the angular distribution near the photofission threshold is also presented. (author)

  20. Ionization and fragmentation of isomeric van der Waals complexes embedded in helium nanodroplets

    Science.gov (United States)

    Lewis, William K.; Lindsay, C. Michael; Miller, Roger E.

    2008-11-01

    The ionization and charge transfer processes, which occur when a doped helium droplet undergoes electron impact, are studied for droplets doped with van der Waals complexes with various structures and electrostatic moments. The mass spectra of the two isomers of hydrogen cyanide complexed with either cyanoacetylene or acetylene in helium droplets were obtained using optically selected mass spectrometry, and show that the structure of the complex has a large effect on the fragmentation pattern. The resulting fragmentation pattern is consistent with an ionization process in which charge steering strongly influences the site of initial ionization. The observed dissociation products may also be subject to caging by the helium matrix.

  1. $D^{0}, D^{+}, D_{s}^{+}$, and $\\Lambda_{c}^{+}$ Fragmentation Functions from CERN LEP1

    CERN Document Server

    Kniehl, Bernd A; Kniehl, Bernd A.; Kramer, Gustav

    2005-01-01

    We present new sets of nonperturbative fragmentation functions for D^0, D^+, and D_s^+ mesons as well as for Lambda_c^+ baryons, both at leading and next-to-leading order in the MSbar factorization scheme with five massless quark flavors. They are determined by fitting data of e^+e^- annihilation taken by the OPAL Collaboration at CERN LEP1. We take the charm-quark fragmentation function to be of the form proposed by Peterson et al. and thus obtain new values of the epsilon_c parameter, which are specific for our choice of factorization scheme.

  2. A fragment-based approach towards ab-initio treatment of polymeric ...

    Indian Academy of Sciences (India)

    Reshma S Pingale

    2017-06-20

    Jun 20, 2017 ... table 1, for the case of PA oligomer, performing a full optimization on this system, the energy (Efull) obtained is −775.28656 a.u. and the required time. (Tfull) for this calculation is 12.14 min. When we perform fragment optimization-based calculations, the energy (Efrag) obtained is −775.28565 a.u. which is.

  3. Regional Forest Fragmentation and the Nesting Success of Migratory Birds

    Science.gov (United States)

    Scott K. Robinson; Frank R. Thompson III; Therese M. Donovan; Donald R. Whitehead; John Faaborg

    1995-01-01

    Forest fragmentation, the disruption in the continuity of forest habitat, is hypothesized to be a major cause of population decline for, some species of forest birds because fragmentation reduces nesting (reproductive) success. Nest predation and parasitism by cowbirds increased with forest fragmentation in nine midwestern (United States)landscapes that varied from 6...

  4. Habitat fragmentation in the temperate zone: a perspective for managers

    Science.gov (United States)

    John Faaborg; Margaret Brittingham; Therese Donovan; John Blake

    1993-01-01

    Habitat fragmentation occurs when a large, fairly continuous tract of vegetation is converted to other vegetation types such that only scattered fragments of the original type remain. Problems associated with habitat fragmentation include overall habitat loss, increase in edge habitat and edge effects (particularly higher parasitism and nest predation rates), and...

  5. Fragment and particle size distribution of impacted ceramic tiles

    NARCIS (Netherlands)

    Carton, E.P.; Weerheijm, J.; Ditzhuijzen, C.; Tuinman, I.

    2014-01-01

    The fragmentation of ceramic tiles under ballistic impact has been studied. Fragments and aerosol (respirable) particles were collected and analyzed to determine the total surface area generated by fracturing (macro-cracking and comminution) of armor grade ceramics. The larger fragments were

  6. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  7. Reattachment of dehydrated tooth fragments: Two case reports ...

    African Journals Online (AJOL)

    Delayed reattachment may lead to unesthetic results because of the dehydration of fragments. The purpose of this study was to present 1-year follow-ups of reattachment of dehydrated fragments using dentin bondings and flowable composites in two different cases. The color of the dehydrated fragments was natural in the ...

  8. Multiplicity distributions of shower particles and target fragments in ...

    Indian Academy of Sciences (India)

    Figure 1. Multiplicity distributions of (a) shower particles, (b) grey fragments, (c) black fragments, and (d) heavily ionized fragments produced in 3Li–Em collisions at 3 A GeV/c. The histograms and curves are our experimental data and modelling results respectively. Table 1. Parameter values and the corresponding χ2/dof ...

  9. Fragmentation of small molecules induced by 46 keV/amu N+ and N2+ projectiles

    International Nuclear Information System (INIS)

    Kovacs, S.T.S.; Juhasz, Z.; Herczku, P.; Sulik, B.

    2012-01-01

    Complete text of publication follows. Collisional molecule fragmentation experiments has gain increasing attention in several research and applied fields. In order to understand the fundamental processes of molecule fragmentation one has to start with collisions of small few-atomic molecules. Moreover, fragments of small molecules such as water can cause damages of large molecules (DNA) very effectively in living tissues. In the last few years a new experimental setup was developed at Atomki. It was designed especially for molecule fragmentation experiments. Now the measurements using this system are running routinely. In 2012 the studied targets were water vapor, methane and nitrogen gases, injected into the collision area by an effusive molecular gas jet system. 650 keV N + and 1,3 MeV N 2 + ions were used as projectiles produced by the VdG-5 electrostatic accelerator. The velocity of the two types of projectiles was the same. Energy and angular distribution of the produced fragments was measured by an energy dispersive electrostatic spectrometer. For atomic ionization a symmetric, diatomic molecular projectile (e.g. N 2 + ) yields about twice more electrons compared to those of singly charged ion projectiles of the same atom (N + ) at the same velocity. In such cases the two atomic centers in the molecular ion can be considered as two individual atomic centers. For the fragmentation of molecular targets the picture is not so simple because in this case close collision of two extended systems is investigated. As figure 1 and 2 show, the measured yields for molecular projectile is not simply twice of the ones for atomic projectile. The shape of the energy spectra are different. The measured data are under evaluation. Acknowledgements. This work was supported by the Hungarian National Science Foundation OTKA (Grant: K73703) and by the TAMOP-4.2.2/B-10/1-2010-0024 project. The project is cofinanced by the European Union and the European Social Fund.

  10. Radiation Resistant Magnets for the RIA Fragment Separator

    CERN Document Server

    Zeller, Al; Gupta, Ramesh C; Ronningen, Reginald; Sherrill, Bradley

    2005-01-01

    The high radiation fields around the production target and the beam dump in the fragment separator at the Rare Isotope Accelerator requires that radiation resistant magnets be used. Because large apertures and high gradients are required for the quadrupoles and similar demanding requirements for the dipole and sextupoles, resistive coils are difficult to justify. The radiation heating of any materials at liquid helium temperatures also requires that superconducting versions of the magnets have low cold-masses. The final optical design has taken the practical magnets limits into account and sizes and fields adjusted to what is believed to be achievable with technology that is possible with sufficient R&D. Designs with higher obtainable current densities and having good radiation tolerances that use superconducting coils are presented, as well as the radiation transport calculations that drive the material parameters.

  11. Stochastic dynamics of spatial effects in fragmentation of clusters

    International Nuclear Information System (INIS)

    Salinas-Rodriguez, E.; Rodriguez, R.F.; Zamora, J.M.

    1991-01-01

    We use a stochastic approach to study the effects of spatial in homogeneities in the kinetics of a fragmentation model which occurs in cluster breakup and polymer degradation. The analytical form of the cluster size distribution function is obtained for both the discrete and continuous limits. From it we calculate numerically the average size and volume of the clusters, their total concentration and the total scattering of the dispersion in both limits. The influence of spatial effects is explicitly shown in the last two quantities. From our description the equations for the equal-time and the two times density correlation functions are also derived in the continuous limit. Finally, the perspectives and limitations of our approach are discussed (Author)

  12. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  13. 252Cf spontaneous prompt fission neutron spectrum measured at 0 degree and 180 degree relative to the fragment motion

    International Nuclear Information System (INIS)

    Bao Shanglian; Liu Jinquan; Batenkov, O.I.; Blinov, M.V.; Smirnov, S.N.

    1994-09-01

    The 252 Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of 'forward' and 'backward' for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process

  14. Human/murine chimeric 81C6 F(ab')2 fragment: preclinical evaluation of a potential construct for the targeted radiotherapy of malignant glioma

    International Nuclear Information System (INIS)

    Boskovitz, Abraham; Akabani, Gamal H.; Pegram, Charles N.; Bigner, Darrell D.; Zalutsky, Michael R.

    2004-01-01

    We have obtained encouraging responses in recent Phase I studies evaluating 131 I-labeled human/murine chimeric 81C6 anti-tenascin monoclonal antibody (ch81C6) administered into surgically-created tumor resection cavities in brain tumor patients. However, because the blood clearance is slow, hematologic toxicity has been higher than seen with murine 81C6 (mu81C6). In the current study, a series of paired-label experiments were performed in athymic mice bearing subcutaneous D-245 MG human glioma xenografts to compare the biodistribution of the fragment ch81C6 F(ab') 2 labeled using Iodogen to a) intact ch81C6, b) mu81C6, and c) ch81C6 F(ab') 2 labeled using N-succinimidyl 3-[ 131 I]iodobenzoate. Tumor retention of radioiodine activity for the F(ab') 2 fragment was comparable to that for intact ch81C6 for the first 24 h and to that for mu81C6 for the first 48 h; as expected, blood and other normal tissue levels declined faster for ch81C6 F(ab') 2. Radiation dosimetry calculations suggest that 131 I-labeled ch81C6 F(ab') 2 may warrant further evaluation as a targeted radiotherapeutic for the treatment of brain tumors

  15. Human/murine chimeric 81C6 F(ab'){sub 2} fragment: preclinical evaluation of a potential construct for the targeted radiotherapy of malignant glioma

    Energy Technology Data Exchange (ETDEWEB)

    Boskovitz, Abraham; Akabani, Gamal H.; Pegram, Charles N.; Bigner, Darrell D.; Zalutsky, Michael R. E-mail: zalut001@mc.duke.edu

    2004-04-01

    We have obtained encouraging responses in recent Phase I studies evaluating {sup 131}I-labeled human/murine chimeric 81C6 anti-tenascin monoclonal antibody (ch81C6) administered into surgically-created tumor resection cavities in brain tumor patients. However, because the blood clearance is slow, hematologic toxicity has been higher than seen with murine 81C6 (mu81C6). In the current study, a series of paired-label experiments were performed in athymic mice bearing subcutaneous D-245 MG human glioma xenografts to compare the biodistribution of the fragment ch81C6 F(ab'){sub 2} labeled using Iodogen to a) intact ch81C6, b) mu81C6, and c) ch81C6 F(ab'){sub 2} labeled using N-succinimidyl 3-[{sup 131}I]iodobenzoate. Tumor retention of radioiodine activity for the F(ab'){sub 2} fragment was comparable to that for intact ch81C6 for the first 24 h and to that for mu81C6 for the first 48 h; as expected, blood and other normal tissue levels declined faster for ch81C6 F(ab'){sub 2.} Radiation dosimetry calculations suggest that {sup 131}I-labeled ch81C6 F(ab'){sub 2} may warrant further evaluation as a targeted radiotherapeutic for the treatment of brain tumors.

  16. First in-situ measurements of a highly fragmented comet: ACE SWICS and WIND STICS measurements

    Science.gov (United States)

    Lepri, S. T.; Gilbert, J. A.; Rubin, M.; Zurbuchen, T.; Combi, M. R.

    2011-12-01

    While many of the characteristics of comets and their local plasma environment are obtained using remote sensing via spectroscopic methods, space-based mass spectrometers allow a unique opportunity to directly sample cometary material in situ. To date there have been only a handful of in-situ spacecraft encounters with comets, such as 1P/Halley, 103P/Hartley, 81P/Wild and others. Comet 73P/Schwassmann-Wachmann started to disintegrate in 1995, two major components B and C were recovered in 2001, and it burst into more than 36 pieces during its passage near the Earth in 2006. Serendipitously, some very distant fragmentation members, well-separated from the major identified fragments, passed between the Earth and Sun. Cometary pickup ions and possibly recombined solar wind minor ions convected past the Earth in late May 2006 and were observed by both the ACE/SWICS and WIND/STICS mass spectrometers, which are located in halo orbits around the Earth-Sun L1 Lagrange point. Most of these observations took place a few days after the main comet fragments passed through the ecliptic, when their orbits crossed the spacecraft-Sun line, suggesting additional pieces lagging far behind the main fragments. In this paper, we present the first in-situ observation of these pieces that passed very close to the spacecraft (<0.07AU) and conduct a comparative analysis of composition and characteristics of pick-up ions originating from a number of the cometary fragments. We find that the pick-up ion trail related to the comet fragments is much longer than expected. We constrain the C+/O+ and He+/He++ ratio and discuss the implications for the production rates of different fragments.

  17. Study of the fragmentation of astrophysical interest molecules (CnHm) induced by high velocity collision

    International Nuclear Information System (INIS)

    Tuna, Th.

    2008-07-01

    This work shows the study of atom-molecule collision processes in the high velocity domain (v=4,5 a.u). The molecules concerned by this work are small unsaturated hydrocarbons C 1-4 H and C 3 H 2 . Molecules are accelerated with the Tandem accelerator in Orsay and their fragmentation is analyzed by the 4π, 100% efficient detector, AGAT. Thanks to a shape analysis of the current signal from the silicon detectors in association with the well known grid method, we are able to measure all the fragmentation channels of the incident molecule. These dissociation measurements have been introduced in the modelization of two objects of the interstellar medium in which a lot of hydrocarbon molecules have been observed (TMC1, horse-head nebula). We have extended our branching ratios obtained by high velocity collision to other electronic processes included in the chemical database like photodissociation and dissociative recombination. This procedure is feasible under an assumption of the statistical point of view of the molecular fragmentation. The deviations following our modification are very small in the modelization of TMC1 but significant in the photodissociation region. The first part is dedicated to the description of the experimental setting that has enabled us to study the fragmentation of C n H m molecules: the Orsay's Tandem accelerator and the Agat detector. The second part deals with negative ion sources and particularly with the Sahat source that is based on electronic impact and has shown good features for the production of anions and correct stability for its use with accelerators. The third part is dedicated to the experimental results in terms of cross-sections, number of fragments and branching ratios, associated to the various collisional processes. The last part presents an application of our measurement of fragmentation data to astro-chemistry. In this field, the simulation codes of the inter-stellar medium require databases of chemical reactions that

  18. Disruption of lactogenesis by retained placental fragments.

    Science.gov (United States)

    Anderson, A M

    2001-05-01

    This case report describes a situation in which lack of milk production led the mother to seek help from a lactation consultant in private practice. Despite extensive breast stimulation with the baby at breast and mechanical breast expression, no milk was produced. Retained placenta was suspected by the lactation consultant. The mother was later diagnosed with placenta increta. Only when this condition was diagnosed and resolved did milk onset occur. It is important to evaluate for retained placental fragments when lactation appears to be delayed.

  19. Routes to carbon schwarzites from fullerene fragments

    International Nuclear Information System (INIS)

    Spadoni, S.; Colombo, L.; Benedek, G.; Milani, P.

    1997-01-01

    We investigated by tight-binding molecular dynamics the coalescence of fullerenic fragments and carbon clusters by following the evolution of the topological connectivity. Though different temperature variation protocols lead to irregular structures, their connectivity is found to stabilize at values corresponding either to three-branched schwarzites or tubulenes, indicating that long-time evolution at constant connectivity is potentially able to yield regular shapes. These results can be related to experiments on laser-induced transformations of fullerite occasionally yielding branched structures with a schwarzite shape. (orig.)

  20. Deciding Security for a Fragment of ASLan

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander

    situations in security such as the interaction between the work ow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding \\type-confusions" similar to some tagging results for security protocols....

  1. Deciding Security for a Fragment of ASLan

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander

    2012-01-01

    situations in security such as the interaction between the workflow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding “type-confusions” similar to some tagging results for security protocols....

  2. Summary of the oil shale fragmentation program at Anvil Points Mine, Colorado

    Energy Technology Data Exchange (ETDEWEB)

    Dick, R.D.; Young, C.; Fourney, W.L.

    1984-01-01

    During 1981 and 1982, an extensive oil shale fragmentation research program was conducted at the Anvil Points Mine near Rifle, Colorado. The primary goals were to investigate factors involved for adequate fragmentation of oil shale and to evaluate the feasibility of using the modified in situ retort (MIS) method for recovery of oil from oil shale. The test program included single-deck, single-borehole tests to obtain basic fragmentation data; multiple-borehole, multiple-deck explosive tests to evaluate practical aspects for developing an in situ retort; and the development of a variety of instrumentation techniques to diagnose the blasting event. This paper will present an outline of the field program, the type of instrumentation used, some typical results from the instrumentation, and a discussion of explosive engineering problems encountered over the course of the program. 4 references, 21 figures, 1 table.

  3. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs......RI genomic DNA fragment, and a short, degenerated, oligonucleotide covering the remaining TspRI cohesive ends. Other cohesive ends are covered by a short degenerated oligonucleotide lacking the primer site. The ligation mixture is used as a template for amplification using a single primer corresponding...... for differentiation of the organisms without previous knowledge of their DNA sequence. The usefulness of the method is confirmed by genotyping of 70 previously characterized clinical E. coli isolates. The grouping obtained was identical to the results of REA-PFGE. Versatility of the method is highlighted, i.e. its...

  4. Finite size effects in the intermittency analysis of the fragment-size correlations

    International Nuclear Information System (INIS)

    Bozek, P.; Ploszajczak, M.; Tucholski, A.

    1991-01-01

    An influence of the finite size effect on the fragment-size correlations in the nuclear multifragmentation is studied using the method of scaled factorial moments for a 1 - dim percolation model and for a statistical model of the fragmentation process, which for a certain value of a tuning parameter yields the power-law behaviour of the fragment-size distribution. It is shown that the statistical models of this type contain only repulsive correlations due to the conservation laws. The comparison of the results with those obtained in the non-critical 1 - dim percolation and in the 3 - dim percolation at around the critical point is presented. Correlations in the 1 - dim percolation model are analysed analytically and the mechanism of the attractive correlations in 1 - dim and 3 - dim is identified. (author) 30 refs., 7 figs

  5. Peptide fragments induce a more rapid immune response than intact proteins in earthworms.

    Science.gov (United States)

    Hanusová, R; Tucková, L; Halada, P; Bezouska, K; Bilej, M

    1999-01-01

    The effect of in vivo proteolytic processing of protein antigen was studied in Eisenia foetida earthworms. Parenteral administration of the protein antigen induces elevated levels of an antigen-binding protein (ABP) which recognizes the protein used for stimulation. When the protein antigen is administered simultaneously with nontoxic serine proteinase inhibitor, ABP levels remain close to background. On the other hand, the in vivo adaptive response of earthworms to peptide fragments obtained by coelomic fluid digestion of the foreign antigen occurs even in the presence of proteinase inhibitor and, moreover, is significantly faster as compared to the response to intact antigen. These findings confirm the role of proteolytic processing in earthworms. MALDI mass spectrometric analysis of the fragments after coelomic fluid digestion has revealed the presence of the peptide fragments with molecular weights in the mass range 700-1100 Da.

  6. Hydrogen rearrangement to and from radical z fragments in electron capture dissociation of peptides

    DEFF Research Database (Denmark)

    Savitski, Mikhail M; Kjeldsen, Frank; Nielsen, Michael L

    2007-01-01

    Hydrogen rearrangement is an important process in radical chemistry. A high degree of H. rearrangement to and from z. ionic fragments (combined occurrence frequency 47% compared with that of z.) is confirmed in analysis of 15,000 tandem mass spectra of tryptic peptides obtained with electron...... capture dissociation (ECD), including previously unreported double H. losses. Consistent with the radical character of H. abstraction, the residue determining the formation rate of z' = z. + H. species is found to be the N-terminal residue in z. species. The size of the complementary c(m)' fragment turned...... that other factors than thermochemistry are responsible for directing the site of ECD cleavage. Understanding hydrogen attachment to and loss from ECD fragments should facilitate automatic interpretation ECD mass spectra in protein identification and characterization, including de novo sequencing....

  7. Goodness of isospin in neutron rich systems from the fission fragment distribution

    Science.gov (United States)

    Garg, Swati; Jain, Ashok Kumar

    2017-09-01

    We present the results of our calculations for the relative yields of neutron-rich fission fragments emitted in 208Pb (18O, fission) reaction by using the concept of the conservation of isospin and compare with the experimental data. We take into account a range of isospin values allowed by the isospin algebra and assume that the fission fragments are formed in isobaric analog states. We also take into account the neutron multiplicity data for various neutron-emission channels in each partition, and use them to obtain the weight factors in calculating the yields. We then calculate the relative yields of the fission fragments. Our calculated results are able to reproduce the experimental trends reasonably well. This is the first direct evidence of the isospin conservation in neutron-rich systems and may prove a very useful tool in their studies.

  8. Light nuclides observed in the fission and fragmentation of 238U

    International Nuclear Information System (INIS)

    Ricciardi, M.V.; Schmidt, K.H.; Benlliure, J.

    2001-05-01

    Light nuclides produced in collisions of 1 A.GeV 238 U with protons and titanium have been fully identified with a high-resolution forward magnetic spectrometer, the fragment separator (FRS), at GSI, and for each nuclide an extremely precise determination of the velocity has been performed. The so-obtained information on the velocity shows that the very asymmetric fission of uranium, in the 238 U + p reaction, produces neutron-rich isotopes of elements down to around charge 10. New important features of the fragmentation of 238 U, concerning the velocity and the N/Z-ratio of these light fragments, and a peculiar even-odd structure in N=Z nuclei, have also been observed. (orig.)

  9. IMPACT OF ROCK HARDNESS ON FRAGMENTATION BY HYDRAULIC HAMMER AND CRUSHING IN JAW CRUSHER

    Directory of Open Access Journals (Sweden)

    Trpimir Kujundžić

    2008-12-01

    Full Text Available The physical and mechanical characteristics of intact rocks depend on the way of their formation, sustained deformations and the process of wearing a specific rock has been exposed to. These characteristics have a rather high influence on the technological process of extraction and dressing of mineral raw materials. However, the mechanical characteristics of rocks due to use of explosives for their extraction in the open pit have a more significant impact. The rock blocks extracted by blasting which are larger than the opening of the primary crusher are usually fragmented by hydraulic hammer. The paper presents the results of the testing of impact of rock hardness on fragmentation of rocks by means of hydraulic hammer and during crushing in jaw crusher. The testing was carried out on the rock samples from five quarries. According to the obtained results the hardness has a considerably larger impact on the fragmentation energy by hydraulic hammer than on the crushing energy in jaw crusher.

  10. How forest marsupials are affected by habitat degradation and fragmentation? A meta-analysis.

    Science.gov (United States)

    Fontúrbel, Francisco E; Candia, Alina B; Salazar, Daniela A; Malebrán, Javiera; González-Browne, Catalina; Botto-Mahan, Carezza

    2014-07-01

    Habitat fragmentation and degradation are important biodiversity change drivers worldwide. Their effects have been described for many animal groups, but little is known about marsupials. We conducted a meta-analysis aiming to evaluate the actual effects of habitat fragmentation and degradation on forest marsupials. From a literature survey, we obtained 85 case studies reporting disturbance comparisons. We found a negative overall effect, as well as a negative effect for habitat fragmentation, but not for habitat degradation. Marsupials from Oceania were negatively affected by habitat disturbance, whereas there was no effect for those from South America. Arboreal marsupials were negatively affected, whereas terrestrial marsupials did not. Species from the families Dasyuridae (Antechinus spp.) and Microbiotheriidae (Dromiciops gliroides) showed to be sensitive to habitat disturbance.

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. AFM picking-up manipulation of the metaphase chromosome fragment by using the tweezers-type probe

    International Nuclear Information System (INIS)

    Yamanaka, Keiichiro; Saito, Masato; Shichiri, Motoharu; Sugiyama, Sigeru; Takamura, Yuzuru; Hashiguchi, Gen; Tamiya, Eiichi

    2008-01-01

    We have studied the development of a new procedure based on atomic force microscopy (AFM) for the analysis of metaphase chromosome. The aim of this study was to obtain detailed information about the specific locations of genes on the metaphase chromosome. In this research, we performed the manipulation of the metaphase chromosome by using novel AFM probes to obtain chromosome fragments of a smaller size than the ones obtained using the conventional methods, such as glass microneedles. We could pick up the fragment of the metaphase chromosome dissected by the knife-edged probe by using our tweezers-type probe

  13. Ex-vivo Potential of Cadaveric and Fresh Limbal Tissues to Regenerate Cultured Epithelium

    Directory of Open Access Journals (Sweden)

    Vemuganti Geeta

    2004-01-01

    56% (9/16 of MK medium preserved tissues and 46.7% (7/15 of Optisol preserved tissues. This was statistically significant (P=0.0131 There was no significant statistical difference in the growth properties, i.e, the mean percentage of fragments showing growth (P=0.229 or the mean diameter of growth (P=0.479 in the cultures obtained from fresh and preserved tissues. The time lapse at various stages between death and utilisation and donor age had no significant influence on the growth potential of the limbal tissues. Conclusion: The potential for generating cultured corneal epithelium from fresh limbal tissues obtained from living subjects is higher than that observed with preserved tissues. It would also be worthwhile to address the factors that could further enhance the proliferative potential of the cadaveric tissues obtained from eye banks

  14. Ionic fragmentation of the isoprene molecule in the VUV energy range (12 to 310 eV)

    Energy Technology Data Exchange (ETDEWEB)

    Bernini, R.B., E-mail: rafael.bernini@ifrj.edu.br [Instituto Federal de Ciência e Tecnologia do Rio de Janeiro (IFRJ), 25050-100 Duque de Caxias, RJ (Brazil); Coutinho, L.H. [Instituto de Física, Universidade Federal do Rio De Janeiro (UFRJ), 21941-972 Rio de Janeiro, RJ (Brazil); Nunez, C.V. [Laboratório de Bioprospecção e Biotecnologia, Coordenação de Tecnologia e Inovação, Instituto Nacional de Pesquisas da Amazônia (INPA), 69060-001 Manaus, AM (Brazil); Castilho, R.B. de [Departamento de Química, Instituto de Ciências Exatas, Universidade Federal do Amazonas (UFAM), 69077-000 Manaus, AM (Brazil); Souza, G.G.B. de [Instituto de Química, Universidade Federal do Rio de Janeiro (UFRJ), 21949-900 Rio de Janeiro, RJ (Brazil)

    2015-07-15

    Highlights: • Ionic fragmentation of isoprene following valence-shell and C 1s excitation. • Experimental observation of single and double ionization processes. • Large increase in fragmentation following core excitation. • Similar dissociation pattern bellow (270 eV) and above (310 eV) core edge. • Stable molecular ion observed at all photon energies. - Abstract: Isoprene, C{sub 5}H{sub 8}, is a biogenic volatile compound emitted from plants and animals, playing an important role in atmospheric chemistry. In this work, we have studied the ionic fragmentation of the isoprene molecule induced by high energy photons (synchrotron radiation), both at the valence (12.0, 14.0, 16.0, 18.0, and 21.0 eV) and carbon 1s edge (270 and 310 eV, respectively, below and above edge) energies. The ionic fragments were mass-analyzed using a Wiley–McLaren time-of-flight spectrometer (TOF) and single (PEPICO) and double ionization coincidence (PEPIPICO) spectra were obtained. As expected, the fragmentation degree increases with increasing energy. Below and above the carbon 1s edge, the fragmentation patterns are quite similar, and basically the same fragments are observed as compared to the spectra following valence-shell ionization. Stable doubly-charged ions were not observed. A PEPIPICO spectrum has shown that the main dissociation route for doubly-ionized species corresponds to the [CH{sub 3}]{sup +}/[C{sub 4}H{sub 2–5}]{sup +} ion pair. Intense fragmentation of the isoprene molecule has been observed following valence shell and core electron ionization. The observance of basically the same fragments when moving from valence to inner-shell suggests that basically the same fragmentation routes are present in both cases. All doubly (or multiply)-charged cations are unstable, at least on a microsecond scale.

  15. Laser induced fragmentation of salivary stones: an in vitro comparison of two different clinically approved laser systems

    Science.gov (United States)

    Sroka, R.; Siedek, V.; Betz, C. S.; Zengel, P.; Hecht, V.; Leunig, A.

    2009-02-01

    Background: Clinical laser lithotripsy in urology promises a good fragmentation combined with a minimal risk of soft tissue damage and low medical complications. This in vitro study investigates the fragmentation of salivary stones by means of two clinically used laser systems. Materials and Methods: The effects induced by the FREDDY laser (WOM, Germany, λ=532 nm / 1,064 nm, Epulse=120-160 mJ/pulse) and the Ho:YAG (AURIGA, StarMedTec, Germany, λ=2,100 nm,Epulse=300-800 mJ/ pulse) on clinical salivary calculi (n=15) and on salivary gland tissue were investigated using clinical laser parameter settings. All experiments were performed in an under water experimental set-up using flexible fibres (core diameter 230μm) positioned in front of each specimen. In order to assess fragmentation efficacy, each stone was placed on a grating (rhombic mash-diameter 1-3 mm). The fragmentation rate was calculated with respect to the energy applied (mg/J), to the number of pulses (mg/pulse), and to the time needed (mg/minute). In addition the composition of the stones were analysed spectrographically. The soft tissue interaction on human salivary duct mucosa was examined histologically (HE-staining). Results: Spectrographic composition of the salivary stones showed a two component ratio of protein/carbonate apatite varying between 5/95 and 25/75. Stones treated by the Ho:YAG were vaporised in a milling-like process, while using the FREDDY laser stones are cracked into pieces and fragmentation failed in two cases. The fragmentation rates achieved by the FREDDY laser were greater than those of the Ho:YAG laser, but fragments mainly bigger. A dependency on the composition of the stones could not be found. Laser pulse effects on soft tissue were found slightly beyond the mucosa. Conclusion: This study clearly demonstrated the different processes of destroying salivary stones using two different laser systems. While the Ho:YAG vaporises the calculi in a more milling and soft sense, the

  16. Laser induced fragmentation of salivary stones: an in vitro comparison of two different, clinically approved laser systems.

    Science.gov (United States)

    Siedek, Vanessa; Betz, Christian S; Hecht, Volkmar; Blagova, Radka; Vogeser, Michael; Zengel, Pamela; Berghaus, Alexander; Leunig, Andreas; Sroka, Ronald

    2008-04-01

    Clinical laser lithotripsy in urology promises a good fragmentation combined with a minimal risk of soft tissue damage and low medical complications. This in vitro study investigates the fragmentation of salivary stones by means of two clinically used laser systems. The effects induced by the FREDDY laser (WOM, Germany, lambda = 532 nm/1,064 nm, E(pulse) = 120-160 mJ/pulse) and the Ho:YAG (AURIGA, StarMedTec, Germany, lambda = 2,100 nm, E(pulse) = 300-800 mJ/pulse) on clinical salivary calculi (n = 15) and on salivary gland tissue were investigated using clinical laser parameter settings. All experiments were performed in an under water experimental set-up using flexible fibres (core diameter 230 microm) positioned in front of each specimen. In order to assess fragmentation efficacy, each stone was placed on a grating (rhombic mash-diameter 1-3 mm). The fragmentation rate was calculated with respect to the energy applied (mg/J), to the number of pulses (mg/pulse), and to the time needed (mg/minute). In addition the composition of the stones were analysed spectrographically. The soft tissue interaction on human salivary duct mucosa was examined histologically (HE-staining). Spectrographic composition of the salivary stones showed a two component ratio of protein/carbonate apatite varying between 5/95 and 25/75. Stones treated by the Ho:YAG were vaporised in a milling-like process, while using the FREDDY laser stones are cracked into pieces and fragmentation failed in two cases. The fragmentation rates achieved by the FREDDY laser were greater than those of the Ho:YAG laser, but fragments mainly bigger. A dependency on the composition of the stones could not be found. Laser pulse effects on soft tissue were found slightly beyond the mucosa. This study clearly demonstrated the different processes of destroying salivary stones using two different laser systems. While the Ho:YAG vaporises the calculi in a more milling and soft sense, the FREDDY shows a more cracking and

  17. Efficient exploration of chemical space by fragment-based screening.

    Science.gov (United States)

    Hall, Richard J; Mortenson, Paul N; Murray, Christopher W

    2014-01-01

    Screening methods seek to sample a vast chemical space in order to identify starting points for further chemical optimisation. Fragment based drug discovery exploits the superior sampling of chemical space that can be achieved when the molecular weight is restricted. Here we show that commercially available fragment space is still relatively poorly sampled and argue for highly sensitive screening methods to allow the detection of smaller fragments. We analyse the properties of our fragment library versus the properties of X-ray hits derived from the library. We particularly consider properties related to the degree of planarity of the fragments. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. The plant tissue culture

    International Nuclear Information System (INIS)

    Crocomo, O.J.; Sharp, W.R.

    1973-01-01

    Progress in the field of plant tissue culture at the Plant Biochemistry Sector, Centro de Energia na Agricultura (CENA), Piracicaba, S.P., Brazil, pertains to the simplification of development in 'Phaseolus vulgaris' by dividing the organism into its component organs, tissues, and cells and the maintenance of these components on defined culture media 'in vitro'. This achievement has set the stage for probing the basis for the stability of the differentiated states and/or the reentry of mature differentiated cells into the mitotic cell cycle and their subsequent redifferentiation. Data from such studies at the cytological and biochemical level have been invaluable in the elucidation of the control mechanisms responsible for expression of the cellular phenotype. Unlimited possibilities exist for the application of tissue culture in the vegetative propagation of 'Phaseolus' and other important cultivars in providing genocopies or a large scale and/or readily obtaining plantlets from haploid cell lines or from protoplast (wall-less cells) hybridization products following genetic manipulation. These tools are being applied in this laboratory for the development and selection of high protein synthesizing 'Phaseolus' cultivars

  19. [Construction and pathogenicity tests of a mutated specific fragment SCF73 in Verticillium dahliae].

    Science.gov (United States)

    Wang, Jinlong; Chen, Jieyin; Liu, Shaoyan; Li, Lei; Dai, Xiaofeng

    2012-11-04

    To identify preliminarily the specific fragment SCF73's function in Verticillium dahlia virulence. The specific fragment SCF73 exposed to be existed in the high-virulent V. dahliae strain VDG1 and not in the mild one VDG2. The SCF73 fragment was obtained from comparatively aligned genome sequences of the two strains and its existence was confirmed using PCR method. According to SCF73's DNA sequence, a homologous recombination plasmid was constructed to knock out the fragment. The Agrobacterium tumefaciens-mediated transformation technique was used to initiate the mutant deltaSCF73, followed by antibiotic resistance screening, and PCR verification. The mutant's ability to secrete carbohydrate hydrolase was analyzed using pectin, cellulose and starch media and its virulence to the susceptible cotton cultivar Gossypium hirsutum cv. Junmian1 was assessed. SCF73 (27.1 kb) contains 5 genes, two of them have glycosyl hydrolase activity. Although the, mutant deltaSCF73's carbohydrate hydrolase secretion was not significantly different from the control VDG1, virulence of the mutant to cotton plants decreased significantly accompanied with disease outburst delay. The specific fragment SCF73 plays an important role in the virulence of V. dahlia towards its cotton host plants.

  20. Fragmentation of neutral carbon clusters formed by high velocity atomic collision

    International Nuclear Information System (INIS)

    Martinet, G.

    2004-05-01

    The aim of this work is to understand the fragmentation of small neutral carbon clusters formed by high velocity atomic collision on atomic gas. In this experiment, the main way of deexcitation of neutral clusters formed by electron capture with ionic species is the fragmentation. To measure the channels of fragmentation, a new detection tool based on shape analysis of current pulse delivered by semiconductor detectors has been developed. For the first time, all branching ratios of neutral carbon clusters are measured in an unambiguous way for clusters size up to 10 atoms. The measurements have been compared to a statistical model in microcanonical ensemble (Microcanonical Metropolis Monte Carlo). In this model, various structural properties of carbon clusters are required. These data have been calculated with Density Functional Theory (DFT-B3LYP) to find the geometries of the clusters and then with Coupled Clusters (CCSD(T)) formalism to obtain dissociation energies and other quantities needed to compute fragmentation calculations. The experimental branching ratios have been compared to the fragmentation model which has allowed to find an energy distribution deposited in the collision. Finally, specific cluster effect has been found namely a large population of excited states. This behaviour is completely different of the atomic carbon case for which the electron capture in the ground states predominates. (author)

  1. Kinematics of current region fragmentation in semi-inclusive deeply inelastic scattering

    International Nuclear Information System (INIS)

    Different kinematical regions of semi-inclusive deeply inelastic scattering (SIDIS) processes correspond to different underlying partonic pictures, and it is important to understand the transition between them. We find criteria in semi-inclusive deeply inelastic scattering (SIDIS) for identifying the current fragmentation region — the kinematical region where a factorization picture with fragmentation functions is appropriate, especially for studies of transverse-momentum-dependent (TMD) functions. This region is distinguished from the central (soft) and target fragmentation regions. The basis of our argument is in the errors in approximations used in deriving factorization. As compared with previous work, we show that it is essential to take account of the transverse momentum of the detected hadron, and we find a much more restricted range for genuine current fragmentation. We show that it is important to develop an extended factorization formulation to treat hadronization in the central region, as well as the current and target fragmentation regions, and to obtain a unified formalism spanning all rapidities for the detected hadron.

  2. Cytotoxicity and the effect of cationic peptide fragments against cariogenic bacteria under planktonic and biofilm conditions.

    Science.gov (United States)

    Kreling, Paula Fernanda; Aida, Kelly Limi; Massunari, Loiane; Caiaffa, Karina Sampaio; Percinoto, Célio; Bedran, Telma Blanca Lombardo; Spolidorio, Denise Madalena Palomari; Abuna, Gabriel Flores; Cilli, Eduardo Maffud; Duque, Cristiane

    2016-10-01

    This study evaluated the cytotoxicity and effect of fragments derived from three oral cationic peptides (CP): LL-37, D6-17 and D1-23 against cariogenic bacteria under planktonic and biofilm conditions. For cytotoxicity analysis, two epithelial cell lines were used. The minimum inhibitory concentration and the minimal bactericidal concentration were determined for the CP fragments and the control (chlorhexidine-CHX) against cariogenic bacteria. The fractional inhibitory concentration was obtained for the combinations of CP fragments on Streptococcus mutans. Biofilm assays were conducted with the best antimicrobial CP fragment against S. mutans. The results indicated that D6-17 was not cytotoxic. D1-23, LL-37 and CHX were not cytotoxic in low concentrations. D1-23 presented the best bactericidal activity against S. mutans, S. mitis and S. salivarius. Combinations of CP fragments did not show a synergic effect. D1-23 presented a higher activity against S. mutans biofilm than CHX. It was concluded that D1-23 showed a substantial effect against cariogenic bacteria and low cytotoxicity.

  3. DYNAMICS OF LARGE FRAGMENTS IN THE TAIL OF ACTIVE ASTEROID P/2010 A2

    International Nuclear Information System (INIS)

    Agarwal, Jessica; Jewitt, David; Weaver, Harold

    2013-01-01

    We examine the motions of large fragments at the head of the dust tail of the active asteroid P/2010 A2. In previous work, we showed that these fragments were ejected from the primary nucleus in early 2009, either following a hypervelocity impact or by rotationally induced breakup. Here, we follow their positions through a series of Hubble Space Telescope images taken during the first half of 2010. The orbital evolution of each fragment allows us to constrain its velocity relative to the main nucleus after leaving its sphere of gravitational influence. We find that the fragments constituting a prominent X-shaped tail feature were emitted in a direction opposite to the motion of the asteroid and toward the south of its orbital plane. Derived emission velocities of these primary fragments range between 0.02 and 0.3 m s –1 , comparable to the ∼0.08 m s –1 gravitational escape speed from the nucleus. Their sizes are on the order of decimeters or larger. We obtain the best fits to our data with ejection velocity vectors lying in a plane that includes the nucleus. This may suggest that the cause of the disruption of P/2010 A2 is rotational breakup.

  4. Application of microtomography and image analysis to the quantification of fragmentation in ceramics after impact loading

    Science.gov (United States)

    Forquin, Pascal; Ando, Edward

    2017-01-01

    Silicon carbide ceramics are widely used in personal body armour and protective solutions. However, during impact, an intense fragmentation develops in the ceramic tile due to high-strain-rate tensile loadings. In this work, microtomography equipment was used to analyse the fragmentation patterns of two silicon carbide grades subjected to edge-on impact (EOI) tests. The EOI experiments were conducted in two configurations. The so-called open configuration relies on the use of an ultra-high-speed camera to visualize the fragmentation process with an interframe time set to 1 µs. The so-called sarcophagus configuration consists in confining the target in a metallic casing to avoid any dispersion of fragments. The target is infiltrated after impact so the final damage pattern is entirely scanned using X-ray tomography and a microfocus source. Thereafter, a three-dimensional (3D) segmentation algorithm was tested and applied in order to separate fragments in 3D allowing a particle size distribution to be obtained. Significant differences between the two specimens of different SiC grades were noted. To explain such experimental results, numerical simulations were conducted considering the Denoual-Forquin-Hild anisotropic damage model. According to the calculations, the difference of crack pattern in EOI tests is related to the population of defects within the two ceramics. This article is part of the themed issue 'Experimental testing and modelling of brittle materials at high strain rates'.

  5. Raising an Antibody Specific to Breast Cancer Subpopulations Using Phage Display on Tissue Sections

    DEFF Research Database (Denmark)

    Larsen, Simon Asbjørn; Meldgaard, Theresa; Fridriksdottir, Agla Jael Rubner

    2016-01-01

    fragments specific against breast cancer subpopulations, aiding the discovery of novel biomarkers. MATERIALS AND METHODS: Recombinant antibody fragments were selected by phage display. A novel shadowstick technology enabled the direct selection using tissue sections of antibody fragments specific against...... small subpopulations of breast cancer cells. Selections were performed against a subpopulation of breast cancer cells expressing CD271(+), as these previously have been indicated to be potential breast cancer stem cells. The selected antibody fragments were screened by phage ELISA on both breast cancer...

  6. A general approach to the screening and confirmation of tryptamines and phenethylamines by mass spectral fragmentation.

    Science.gov (United States)

    Chen, Bo-Hong; Liu, Ju-Tsung; Chen, Wen-Xiong; Chen, Hung-Ming; Lin, Cheng-Huang

    2008-01-15

    Certain characteristic fragmentations of tryptamines (indoleethylamine) and phenethylamines are described. Based on the GC-EI/MS, LC-ESI/MS and MALDI/TOFMS, the mass fragmentations of 13 standard compounds, including alpha-methyltryptamine (AMT), N,N-dimethyltryptamine (DMT), 5-methoxy-alpha-methyltryptamine (5-MeO-AMT), N,N-diethyltryptamine (DET), N,N-dipropyltryptamine (DPT), N,N-dibutyltryptamine (DBT), N,N-diisopropyltryptamine (DIPT), 5-methoxy-N,N-dimethyltryptamine (5-MeO-DMT), 5-methoxy-N,N-diisopropyltryptamine (5-MeO-DIPT), methamphetamine (MAMP), 3,4-methylenedioxyamphetamine (3,4-MDA), 3,4-methylenedioxymethamphetamine (3,4-MDMA) and 2-methylamino-1-(3,4-methylenedioxyphenyl)butane (MBDB), were compared. As a result, the parent ions of these analytes were hard to be obtained by GC/MS whereas the protonated molecular ions can be observed clearly by means of ESI/MS and MALDI/TOFMS. Furthermore, two major characteristic fragmentations, namely and alpha-cleavage ([M+H](+)-->[3-vinylindole](+)) and beta-cleavage ([M+H](+)-->[CH(2)N(+)R(N1)R(N2)]), are produced when the ESI and MALDI modes are used, respectively. In the case of ESI/MS, the fragment obtained from alpha-cleavage is the major process. In contrast to this, in the case of MALDI/TOFMS, the major fragment is produced via beta-cleavage. The ionization efficiency and fragments formed from either alpha- or beta-cleavages are closely related to the degree of alkylation of the side chain nitrogen in both cases.

  7. SCEDS: protein fragments for molecular replacement in Phaser

    International Nuclear Information System (INIS)

    McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

    2013-01-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

  8. SCEDS: protein fragments for molecular replacement in Phaser

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

    2013-11-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

  9. Heavy-Quark Production in the Target Fragmentation Region

    CERN Document Server

    Graudenz, Dirk

    1997-01-01

    Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...

  10. Predicting "Hot" and "Warm" Spots for Fragment Binding.

    Science.gov (United States)

    Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L

    2017-05-11

    Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .

  11. The Munich accelerator for fission fragments MAFF

    Science.gov (United States)

    Habs, D.; Groß, M.; Assmann, W.; Ames, F.; Bongers, H.; Emhofer, S.; Heinz, S.; Henry, S.; Kester, O.; Neumayr, J.; Ospald, F.; Reiter, P.; Sieber, T.; Szerypo, J.; Thirolf, P. G.; Varentsov, V.; Wilfart, T.; Faestermann, T.; Krücken, R.; Maier-Komor, P.

    2003-05-01

    The Munich Accelerator for Fission Fragments MAFF has been designed for the new Munich research reactor FRM-II. It will deliver several intense beams (˜3×10 11 s -1) of very neutron-rich fission fragments with a final energy of 30 keV (low-energy beam) or energies between 3.7 and 5.9 MeV· A (high-energy beam). Such beams are of interest for the creation of super-heavy elements by fusion reactions, nuclear spectroscopy of exotic nuclei, but they also have a potential for applications, e.g. in medicine. Presently the Munich research reactor FRM-II is ready for operation, but authorities delay the final permission to turn the reactor critical probably till the end of 2002. Only after this final permission the financing of the major parts of MAFF can start. On the other hand all major components have been designed and special components have been tested in separate setups.

  12. Alkaline glass as induced fission fragment detectors

    International Nuclear Information System (INIS)

    Amorim, A.M.M.

    1986-01-01

    The slide glass, registered trade marks INLAB, INVICT and PERFECTA were compared. For the three kinds of glasses the following studies were done: chemical composition; general dissolution rate for hydrofluoric acid solutions of concentrations between 1 and 10M, at 30 0 C and ultrasound shaking; relative efficiency for recording fission fragment tracks from 252 Cf. The INLAB glass was selected due to the better quality of its surface after chemical etching. The HF concentration 2.5M was determined for chemical etching of INLAB glass, and the optimum etching time was chosen between 8 and 10 minutes. The thermal attenuation of latent tracks in the environmental temperature was observed for intervals uo to 31 days between the detector exposure to the fission fragment source and etching of tracks. Several methods were used for determining the detector parameters, such as: critical angle, angle of the cone and efficiency of etching. The effects of gamma irradiation from 60 Co and reactor neutrons in material properties as track detector were studied. Attenuation of latent tracks and saturation of color centers were observed for doses over 100M Rad. Since this kind of material contains uranium as impurity, uniformely distributed, slide glass were calibrated to be applied as a monitor of thermal neutron flux in nuclear reactor. (Author) [pt

  13. The Munich accelerator for fission fragments MAFF

    International Nuclear Information System (INIS)

    Habs, D.; Gross, M.; Assmann, W.; Ames, F.; Bongers, H.; Emhofer, S.; Heinz, S.; Henry, S.; Kester, O.; Neumayr, J.; Ospald, F.; Reiter, P.; Sieber, T.; Szerypo, J.; Thirolf, P.G.; Varentsov, V.; Wilfart, T.; Faestermann, T.; Kruecken, R.; Maier-Komor, P.

    2003-01-01

    The Munich Accelerator for Fission Fragments MAFF has been designed for the new Munich research reactor FRM-II. It will deliver several intense beams (∼3x10 11 s -1 ) of very neutron-rich fission fragments with a final energy of 30 keV (low-energy beam) or energies between 3.7 and 5.9 MeV·A (high-energy beam). Such beams are of interest for the creation of super-heavy elements by fusion reactions, nuclear spectroscopy of exotic nuclei, but they also have a potential for applications, e.g. in medicine. Presently the Munich research reactor FRM-II is ready for operation, but authorities delay the final permission to turn the reactor critical probably till the end of 2002. Only after this final permission the financing of the major parts of MAFF can start. On the other hand all major components have been designed and special components have been tested in separate setups

  14. Evaluation of tumor targeting with radiolabeled F(ab2 fragment of a humanized monoclonal antibody

    Directory of Open Access Journals (Sweden)

    "Babaei MH

    2002-08-01

    Full Text Available Humanized monoclonal antibody U36 and its F(ab'2 fragment, radio labeled with 125I, were tested for tumor localization in nude mice bearing a squamous cell carcinoma xenograft line derived from a head and neck carcinoma. Monoclonal antibody IgG or F(ab'2 fragment were injected in parallel and at days 1, 2 and 3, mice were dissected for determination of isotope biodistribution. IgG as well as F(ab'2 showed highly specific localization in tumor tissue. The mean tumor uptake (n=3 is expressed as the percentage of the injected dose per gram of tumor tissue (%ID/g. %ID/g of IgG was 11.7% at day 1 and decreased to 10.9% at day 3 whereas %ID/g of F(ab'2 was 2.9% at day 1 and decreased on following days. Tumor to blood ratios (T/B at day 1 were 0.86 for IgG and 1.32 for F(ab'2 and reached a maximum at day 3 with values of 4.41 and 1.84 respectively. These findings suggest that the superior tumor to non-tumor ratios in the day of 1 render the F(ab'2 fragment more qualified for specific targeting radioisotopes to tumor xenografts in this exprimental setting.

  15. Treatment of oblique crown fractures in maxillary premolars using adhesive tooth fragment reattachment: 19 years of follow up.

    Science.gov (United States)

    Ferraz, José Antonio Brufato; Pécora, Jesus Djalma; Saquy, Paulo Cesar; Sousa-Neto, Manoel Damião

    2011-12-01

    This report presents an oblique crown fracture in the maxillary right premolars of an adolescent because of fall, which was treated using adhesive tooth fragment reattachment. The impact of the mandible base to the floor caused minor fractures in multiple teeth, severe fracture of teeth 14 and 15, and condylar fractures. The fragments of teeth 43, 45, 46, and 16 were lost at the site of accident. The condylar fractures were managed with a non-surgical conservative approach combining mandibular immobilization and stabilization of temporomandibular joints with maxillomandibular fixation using acrylic splints. After 3 months, the interocclusal splints were removed, and the patient was referred for dental care. Teeth 14 and 15 presented complicated oblique crown fractures causing separation of the buccal and palatal fragments, which were in place, attached to the gingival tissue. Tooth 15 presented chronic hyperplastic pulpits. The fragments were banded for stabilization during the endodontic treatment, and the bands served as matrix for adhesive tooth fragment reattachment. The other fractured teeth received direct composite resin restorations. After 8 years, tooth 16 developed pulp necrosis and was treated endodontically and restored with composite resin. Clinical and radiographic examination 19 years after trauma showed a good adaptation of the tooth fragment/composite resin restoration, good periodontal health, no signs of root resorption, and intact lamina dura. © 2011 John Wiley & Sons A/S.

  16. Fragment Merger: An Online Tool to Merge Overlapping Long Sequence Fragments

    Directory of Open Access Journals (Sweden)

    Anna Kramvis

    2013-03-01

    Full Text Available While PCR amplicons extend to a few thousand bases, the length of sequences from direct Sanger sequencing is limited to 500–800 nucleotides. Therefore, several fragments may be required to cover an amplicon, a gene or an entire genome. These fragments are typically sequenced in an overlapping fashion and assembled by manually sliding and aligning the sequences visually. This is time-consuming, repetitive and error-prone, and further complicated by circular genomes. An online tool merging two to twelve long overlapping sequence fragments was developed. Either chromatograms or FASTA files are submitted to the tool, which trims poor quality ends of chromatograms according to user-specified parameters. Fragments are assembled into a single sequence by repeatedly calling the EMBOSS merger tool in a consecutive manner. Output includes the number of trimmed nucleotides, details of each merge, and an optional alignment to a reference sequence. The final merge sequence is displayed and can be downloaded in FASTA format. All output files can be downloaded as a ZIP archive. This tool allows for easy and automated assembly of overlapping sequences and is aimed at researchers without specialist computer skills. The tool is genome- and organism-agnostic and has been developed using hepatitis B virus sequence data.

  17. Neutron emission effects on fragment mass and kinetic energy distribution from fission of 239Pu induced by thermal neutrons

    International Nuclear Information System (INIS)

    Montoya, M.; Rojas, J.; Lobato, I.

    2010-01-01

    The average of fragment kinetic energy (E-bar sign*) and the multiplicity of prompt neutrons (ν(bar sign)) as a function of fragment mass (m*), as well as the fragment mass yield (Y(m*)) from thermal neutron-induced fission of 239 Pu have been measured by Tsuchiya et al.. In that work the mass and kinetic energy are calculated from the measured kinetic energy of one fragment and the difference of time of flight of the two complementary fragments. However they do not present their results about the standard deviation σ E *(m*). In this work we have made a numerical simulation of that experiment which reproduces its results, assuming an initial distribution of the primary fragment kinetic energy (E(A)) with a constant value of the standard deviation as function of fragment mass (σ E (A)). As a result of the simulation we obtain the dependence σ E *(m*) which presents an enhancement between m* = 92 and m* = 110, and a peak at m* = 121.

  18. Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

    Directory of Open Access Journals (Sweden)

    Paula Eveline Ribeiro D’Anunciação

    2013-01-01

    Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

  19. Nuclear Fragmentation in Clinical Heavy Ion Beams, Should We Worry?

    DEFF Research Database (Denmark)

    Bassler, Niels; Hansen, David Christoffer; Toftegaard, Jakob

    Particle therapy with fast ions is increasingly applied as a treatment option for localized inoperable tumour sites. One of the reasons for the increased complications of understanding heavy ion dosimetry and radiobiology stems from the mixed particle spectrum which occurs due to nuclear fragment......Particle therapy with fast ions is increasingly applied as a treatment option for localized inoperable tumour sites. One of the reasons for the increased complications of understanding heavy ion dosimetry and radiobiology stems from the mixed particle spectrum which occurs due to nuclear....... However, the dose is by convention expressed in dose relative to water. The link between these different ways of calculating dose is primarily provided by stopping power ratios, i.e. atomic physics, however since the average stopping powers are weighted by fluence, one might expect a weak dependence...... the secondary neutron spectrum in surrounding tissue, and the production of secondary radiation for retrospective (or online) treatment plan verification. We change essential parameters in the underlying nuclear models of the Monte Carlo particle transport code SHIELD-HIT10A, in order to quantify...

  20. Modelling rock fragmentation of Extremely Energetic Rockfalls

    Science.gov (United States)

    De Blasio, Fabio; Dattola, Giuseppe; Battista Crosta, Giovanni

    2017-04-01

    Extremely energetic rockfalls (EER) are phenomena for which the combination of a large volume (at least some thousands of m ) and a free fall height of hundreds of metres, results in a large released energy. We fix a threshold value of around 1/50 of kilotons to define such a type of events. Documented examples include several events with dif-ferent size in the Alps (Dru, 2005, 2011, 265,000, 59,200 m3; val Fiscalina - Cima Una, 2007, 40,000 m3; Thurwieser 2004, ca 2 Mm3; Cengalo, 2011, 1.5*105 m3 in 2016, in Switzerland; Civetta, 2013, ca 50,000 m3;), in the Apennines (Gran Sasso, 2006, 30,000 m3), Rocky Mountains (Yosemite, Happy Isles, 38,000 m3), and Himalaya. EERs may become more frequent on steep and sharp mountain peaks as a consequence of permafrost thawing at higher altitudes. In contrast to low energy rockfalls where block disintegration is limited, in EERs the impact after free fall causes an immediate and efficient release of energy much like an explosion. The severe disintegration of the rock and the corresponding air blast are capable of snapping trees many hundreds of metres ahead of the fall area. Pulverized rock at high speed can abrade tree logs, and the resulting suspension flow may travel much further the impact zone, blanketing vast surrounding areas. Using both published accounts of some of these events and collecting direct data for some of them, we present some basic models to describe the involved processes based on analogies with explosions and explosive fragmentation. Of the initial energy, one part is used up in the rock disintegration, and the rest is shared between the shock wave and air blast. The fragmentation energy is calculated based on the fitting of the dust size spectrum by using different proba-bilistic distribution laws and the definition of a surface energy and by considering the involved strain rate. We find the fragmentation is around one third of the initial boulder energy. Finally, we evaluate the velocity of the