DEFF Research Database (Denmark)
Neckelmann, K; Kristensen, B W; Schrøder, H D
2004-01-01
included in the biopsy removed for peroperative frozen section investigation. When the slides with Sonocut tissue fragments were analyzed, the probability of making the most malignant diagnosis increased from 81.3% - 99.1%, when slides from 1 - 5 paraffin blocks were analyzed, respectively. When subgroups...... of small, medium and big tumors were analyzed, it was found that only 2 paraffin blocks from small tumors need to be prepared to reach 98.3% probability of making the most malignant diagnosis, whereas 5 paraffin blocks from big tumors need to be prepared to reach a 96.8% probability. In conclusion......, the study shows that a limited amount of Sonocut ultrasonic tissue fragments improve the diagnostic evaluation of gliomas. These tissue fragments therefore must not be discarded. Only few paraffin blocks need to be prepared to reach close to 100% probability of making the most malignant diagnosis, reducing...
Extracellular matrix fragmentation in young, healthy cartilaginous tissues.
Craddock, R J; Hodson, N W; Ozols, M; Shearer, T; Hoyland, J A; Sherratt, M J
2018-02-09
Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC) and the nucleus pulposus (NP) of the intervertebral disc (IVD). Whilst structural heterogeneity of intact aggrecan ( containing three globular domains) is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months), bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 %) were fragmented (lacking one or more globular domains). Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa) comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis). As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2) as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2), it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally) and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.
Extracellular matrix fragmentation in young, healthy cartilaginous tissues
Directory of Open Access Journals (Sweden)
RJ Craddock
2018-02-01
Full Text Available Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC and the nucleus pulposus (NP of the intervertebral disc (IVD. Whilst structural heterogeneity of intact aggrecan ( containing three globular domains is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months, bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 % were fragmented (lacking one or more globular domains. Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p < 0.0001. In contrast, fibrillar collagen appeared structurally intact and tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis. As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2 as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2, it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.
Nuclear fragmentation and the number of particle tracks in tissue
International Nuclear Information System (INIS)
Ponomarev, A. L.; Cucinotta, F. A.
2006-01-01
For high energy nuclei, the number of particle tracks per cell is modified by local nuclear reactions that occur, with large fluctuations expected for heavy ion tracks. Cells near the interaction site of a reaction will experience a much higher number of tracks than estimated by the average fluence. Two types of reaction products are possible and occur in coincidence; projectile fragments, which generally have smaller charge and similar velocity to that of the projectile, and target fragments, which are produced from the fragmentation of the nuclei of water atoms or other cellular constituents with low velocity. In order to understand the role of fragmentation in biological damage a new model of human tissue irradiated by heavy ions was developed. A box of the tissue is modelled with periodic boundary conditions imposed, which extrapolates the technique to macroscopic volumes of tissue. The cross sections for projectile and target fragmentation products are taken from the quantum multiple scattering fragmentation code previously developed at NASA Johnson Space Center. Statistics of fragmentation pathways occurring in a cell monolayer, as well as in a small volume of 10 x 10 x 10 cells are given. A discussion on approaches to extend the model to describe spatial distributions of inactivated or other cell damage types, as well as highly organised tissues of multiple cell types, is presented. (authors)
Schroeteler, Juliane; Reeker, Ralf; Suero Molina, Eric; Brokinkel, Benjamin; Holling, Markus; Grauer, Oliver M; Senner, Volker; Stummer, Walter; Ewelt, Christian
2014-01-01
Ultrasonic aspiration is widely used in the resection of brain tumors. Nevertheless, tumor tissue fragments obtained by ultrasonic aspiration are usually discarded. In this study, we demonstrate that these fragments are possible sources of material for histopathological study and tissue culture and compare their microscopic features and viability in tissue culture of cavitron ultrasonic surgical aspirator tissue fragments. Brain tumor tissue collected by ultrasonic aspiration (CUSA EXcel®; Integra Radionics Inc.) in a simple sterile suction trap during resection was processed for primary cell culture. Cell viability and immunohistological markers were measured by the WST-1 test, microscopy and immunofluorescent evaluation. Six gliomas are presented to demonstrate that these tissue fragments show good preservation of histological detail and tissue viability in culture. Utilization of this material may facilitate pathological interpretation by providing a more representative sample of tumor histology as well as an adequate and sterile biosource of material for tissue culture studies.
International Nuclear Information System (INIS)
Dang Bingrong; Wei Zengquan; Duan Limin; Zhang Baoguo; Li Songlin; Yin Xu; Zhu Yongtai; Li Wenjian; Li Qiang; Yuan Shibin
2002-01-01
By using a 55 MeV/u 40 Ar 17+ beam produced by HIRFL, the distribution of fragments in 1.5 mm lucite on three different directions were measured at the radiobiology terminal. Feasibilities of the phoswich detector composed of fast plastic scintillator and CsI(Tl) detectors for determination of angular distribution of fragments in tissue-equivalent materials were investigated. The results obtained were satisfactory
Shavers, M. R.; Poston, J. W.; Cucinotta, F. A.; Wilson, J. W.
1996-01-01
During manned space missions, high-energy nucleons of cosmic and solar origin collide with atomic nuclei of the human body and produce a broad linear energy transfer spectrum of secondary particles, called target fragments. These nuclear fragments are often more biologically harmful than the direct ionization of the incident nucleon. That these secondary particles increase tissue absorbed dose in regions adjacent to the bone-soft tissue interface was demonstrated in a previous publication. To assess radiological risks to tissue near the bone-soft tissue interface, a computer transport model for nuclear fragments produced by high energy nucleons was used in this study to calculate integral linear energy transfer spectra and dose equivalents resulting from nuclear collisions of 1-GeV protons transversing bone and red bone marrow. In terms of dose equivalent averaged over trabecular bone marrow, target fragments emitted from interactions in both tissues are predicted to be at least as important as the direct ionization of the primary protons-twice as important, if recently recommended radiation weighting factors and "worst-case" geometry are used. The use of conventional dosimetry (absorbed dose weighted by aa linear energy transfer-dependent quality factor) as an appropriate framework for predicting risk from low fluences of high-linear energy transfer target fragments is discussed.
Directory of Open Access Journals (Sweden)
Yoshinobu Takahashi
2018-05-01
Full Text Available Summary: Clinical transplantation of tissue fragments, including islets, faces a critical challenge because of a lack of effective strategies that ensure efficient engraftment through the timely integration of vascular networks. We recently developed a complex organoid engineering method by “self-condensation” culture based on mesenchymal cell-dependent contraction, thereby enabling dissociated heterotypic lineages including endothelial cells to self-organize in a spatiotemporal manner. Here, we report the successful adaptation of this method for generating complex tissues from diverse tissue fragments derived from various organs, including pancreatic islets. The self-condensation of human and mouse islets with endothelial cells not only promoted functionalization in culture but also massively improved post-transplant engraftment. Therapeutically, fulminant diabetic mice were more efficiently treated by a vascularized islet transplant compared with the conventional approach. Given the general limitations of post-transplant vascularization associated with 3D tissue-based therapy, our approach offers a promising means of enhancing efficacy in the context of therapeutic tissue transplantation. : Takahashi et al. report on generating vascularized islet tissue from humans and mice. After transplantation, vascularized islets significantly improve survival of diabetic mice, demonstrating the quick normalization of blood glucose compared with conventional islet transplantation. Keywords: tissue engineering, tissue-based therapy, vascularization, islet transplantation, organoid
Directory of Open Access Journals (Sweden)
MW Laschke
2014-10-01
Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.
Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications
Directory of Open Access Journals (Sweden)
José A. Centeno
2014-01-01
Full Text Available Background: The majority of modern war wounds are characterized by high-energy blast injuries containing a wide range of retained foreign materials of a metallic or composite nature. Health effects of retained fragments range from local or systemic toxicities to foreign body reactions or malignancies, and dependent on the chemical composition and corrosiveness of the fragments in vivo. Information obtained by chemical analysis of excised fragments can be used to guide clinical decisions regarding the need for fragment removal, to develop therapeutic interventions, and to better anticipate future medical problems from retained fragment related injuries. In response to this need, a new U.S Department of Defense (DoD directive has been issued requiring characterization of all removed fragments to provide a database of fragment types occurring in combat injuries. Objectives: The objective of this study is to determine the chemical composition of retained embedded fragments removed from injured military personnel, and to relate results to histological findings in tissue adjacent to fragment material. Methods: We describe an approach for the chemical analysis and characterization of retained fragments and adjacent tissues, and include case examples describing fragments containing depleted uranium (DU, tungsten (W, lead (Pb, and non-metal foreign bodies composed of natural and composite materials. Fragments obtained from four patients with penetrating blast wounds to the limbs were studied employing a wide range of chemical and microscopy techniques. Available adjacent tissues from three of the cases were histologically, microscopically, and chemically examined. The physical and compositional properties of the removed foreign material surfaces were examined with energy dispersive x-ray fluorescence spectrometry (EDXRF, scanning electron microscopy (SEM, laser ablation inductively-coupled plasma mass-spectrometry (LA-ICP-MS, and confocal laser Raman
Histological evaluation of drill fragments obtained during osteoid osteoma radiofrequency ablation
International Nuclear Information System (INIS)
Akhlaghpoor, Shahram; Aziz Ahari, Alireza; Ahmadi, Seyed Ali; Gohari Moghaddam, Katayoun; Arjmand Shabestari, Abbas; Alinaghizadeh, Mohammad Reza
2010-01-01
Osteoid osteoma (OO) is a benign bone tumor diagnosed mainly on the basis of the patient's history and radiological data. Histological evaluation may not be available before treatment. The aim of this study was to assess the diagnostic value of a histological evaluation of the bone fragments obtained during radiofrequency ablation (RFA). During a 2-year period, 39 patients diagnosed clinically with OO were entered into this study. The procedure was performed under computed tomography (CT) guidance. An 11-gauge needle was initially placed as a coaxial guide. After drill removal, RFA was performed. Bone fragments collected from the drill were examined by two experienced pathologists, independently. There was strong association between pathologists' reports (P <0.001). In 27 cases (69.2%) this diagnosis was confirmed pathologically. No significant relationship was found between nidus diameter and positive histological findings (P = 0.35). Histological confirmation of OO based on drill fragments is similarly frequent as previously reported for standard bone biopsy. (orig.)
Veschgini, M.; Gebert, F.; Khangai, N.; Ito, H.; Suzuki, R.; Holstein, T. W.; Mae, Y.; Arai, T.; Tanaka, M.
2016-03-01
Regeneration of a tissue fragment of freshwater polyp Hydra is accompanied by significant morphological fluctuations, suggesting the generation of active forces. In this study, we utilized a two fingered micro-robotic hand to gain insights into the mechanics of regenerating tissues. Taking advantage of a high force sensitivity (˜1 nN) of our micro-hand, we non-invasively acquired the bulk elastic modulus of tissues by keeping the strain levels low (ɛ < 0.15). Moreover, by keeping the strain at a constant level, we monitored the stress relaxation of the Hydra tissue and determined both viscous modulus and elastic modulus simultaneously, following a simple Maxwell model. We further investigated the correlation between the frequency of force fluctuation and that of morphological fluctuation by monitoring one "tweezed" tissue and the other "intact" tissue at the same time. The obtained results clearly indicated that the magnitude and periodicity of the changes in force and shape are directly correlated, confirming that our two fingered micro-hand can precisely quantify the mechanics of soft, dynamic tissue during the regeneration and development in a non-invasive manner.
Pain, Deborah J; Cromie, Ruth L; Newth, Julia; Brown, Martin J; Crutcher, Eric; Hardman, Pippa; Hurst, Louise; Mateo, Rafael; Meharg, Andrew A; Moran, Annette C; Raab, Andrea; Taggart, Mark A; Green, Rhys E
2010-04-26
Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. Wild-shot gamebirds (6 species) obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing > or =5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg(-1) w.w.) for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat), some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game.
Pain, Deborah J.; Cromie, Ruth L.; Newth, Julia; Brown, Martin J.; Crutcher, Eric; Hardman, Pippa; Hurst, Louise; Mateo, Rafael; Meharg, Andrew A.; Moran, Annette C.; Raab, Andrea; Taggart, Mark A.; Green, Rhys E.
2010-01-01
Background Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. Methodology/Principal Findings Wild-shot gamebirds (6 species) obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing ≥5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg−1 w.w.) for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat), some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. Conclusions/Significance The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game. PMID:20436670
DEFF Research Database (Denmark)
Maijer, Karen I; Gudmann, Natasja Stæhr; Karsdal, Morten Asser
2016-01-01
Objective: Tissue destruction in rheumatoid arthritis (RA) is predominantly mediated by matrix metalloproteinases (MMPs), thereby generating protein fragments. Previous studies have revealed that these fragments include MMP-mediated collagen type I, II, and III degradation, citrullinated and MMP...
Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.
Dubinets, Nikita; Slipchenko, Lyudmila V
2017-07-20
Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.
Directory of Open Access Journals (Sweden)
Deborah J Pain
Full Text Available BACKGROUND: Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. METHODOLOGY/PRINCIPAL FINDINGS: Wild-shot gamebirds (6 species obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing > or =5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg(-1 w.w. for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat, some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. CONCLUSIONS/SIGNIFICANCE: The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game.
Directory of Open Access Journals (Sweden)
A. Marmotti
2012-01-01
Full Text Available A promising approach for musculoskeletal repair and regeneration is mesenchymal-stem-cell- (MSC-based tissue engineering. The aim of the study was to apply a simple protocol based on mincing the umbilical cord (UC, without removing any blood vessels or using any enzymatic digestion, to rapidly obtain an adequate number of multipotent UC-MSCs. We obtained, at passage 1 (P1, a mean value of 4,2×106 cells (SD 0,4 from each UC. At immunophenotypic characterization, cells were positive for CD73, CD90, CD105, CD44, CD29, and HLA-I and negative for CD34 and HLA-class II, with a subpopulation negative for both HLA-I and HLA-II. Newborn origin and multilineage potential toward bone, fat, cartilage, and muscle was demonstrated. Telomere length was similar to that of bone-marrow (BM MSCs from young donors. The results suggest that simply collecting UC-MSCs at P1 from minced umbilical cord fragments allows to achieve a valuable population of cells suitable for orthopaedic tissue engineering.
Perruchini, Claire; Pecorari, Frederic; Bourgeois, Jean-Pierre; Duyckaerts, Charles; Rougeon, François; Lafaye, Pierre
2009-11-01
Camelids produce antibodies made of homodimeric heavy chains, and the antigen-binding region being composed of a single domain called VHH. These VHHs are much smaller than complete IgG. They are also more thermostable and more soluble in water; they should, therefore, diffuse more readily in the tissues. VHHs, expressed in bacteria, are easier to produce than conventional monoclonal antibodies. Because of these special characteristics, these antibody fragments could have interesting developments in immunohistochemistry and in the development of biomarkers. To test the possibility of their use in immunohistochemistry (IHC), we selected the glial fibrillary acidic protein (GFAP), a well-known marker of astrocytes. One alpaca (Lama pacos) was immunized against GFAP. Lymphocytes were isolated; the DNA was extracted; the VHH-coding sequences were selectively amplified. Three VHHs with a high affinity for GFAP and their corresponding mRNA were selected by ribosome display. Large quantities of the recombinant VHHs coupled with different tags were harvested from transfected bacteria. One of them was shown to immunolabel strongly and specifically to GFAP of human astrocytes in tissue sections. The quality of the IHC was comparable or, in some aspects, superior to the quality obtained with conventional IgG. The VHH was shown to diffuse on a longer distance than conventional monoclonal antibodies in fixed cortical tissue: a property that may be useful in immunolabeling of thick sections.
International Nuclear Information System (INIS)
Stock, Klaus Wilhelm; Jacob, Augustinus Ludwig; Schnabel, Karl Jakob; Bongartz, Georg; Steinbrich, Wolfgang
1997-01-01
Purpose: To report the results of thrombus fragmentation in combination with local fibrinolysis using recombinant human-tissue plasminogen activator (rtPA) in patients with massive pulmonary embolism. Methods: Five patients with massive pulmonary embolism were treated with thrombus fragmentation followed by intrapulmonary injection of rtPA. Clot fragmentation was performed with a guidewire, angiographic catheter, and balloon catheter. Three patients had undergone recent surgery; one of them received a reduced dosage of rtPA. Results: All patients survived and showed clinical improvement with a resultant significant (p < 0.05) decrease in the pulmonary blood pressure (mean systolic pulmonary blood pressure before treatment, 49 mmHg; 4 hr after treatment, 28 mmHg). Angiographic follow-up in three patients revealed a decrease in thrombus material and an increase in pulmonary perfusion. Two patients developed retroperitoneal hematomas requiring transfusion. Conclusion: Clot fragmentation and local fibrinolysis with rtPA was an effective therapy for massive pulmonary embolism. Bleeding at the puncture site was a frequent complication
Han, X G; Wang, D K; Gao, F; Liu, R H; Bi, Z G
2015-09-21
Bone morphogenetic protein 2 (BMP-2) can promote fracture healing. Although the complex role BMP-2 in bone formation is increasingly understood, the role of endogenous BMP-2 in nonunion remains unclear. Decorin (DCN) can promote the formation of bone matrix and calcium deposition to control bone morphogenesis. In this study, tissue composition and expression of BMP-2 and DCN were detected in different parts of old fracture zones to explore inherent anti-fibrotic ability and osteogenesis. Twenty-three patients were selected, including eight cases of delayed union and 15 cases of nonunion. Average duration of delayed union or nonunion was 15 months. Fracture fragments and surrounding tissues, including bone grafts, marrow cavity contents, and sticking scars, were categorically sampled during surgery. Through observation and histological testing, component comparisons were made between fracture fragments and surrounding tissue. The expression levels of DCN and BMP-2 in different tissues were detected by immunohistochemical staining and real-time polymerase chain reaction. The expression of DCN and BMP- 2 in different parts of the nonunion area showed that, compared with bone graft and marrow cavity contents, sticking scars had the highest expression of BMP-2. Compared with the marrow cavity contents and sticking scars, bone grafts had the highest expression of DCN. The low antifibrotic and osteogenic activity of the nonunion area was associated with non-co-expression of BMP-2 and DCN. Therefore, the co-injection of osteogenic factor BMP and DCN into the nonunion area can improve the induction of bone formation and enhance the conversion of the old scar, thereby achieving better nonunion treatment.
Cryobiology of coral fragments.
Hagedorn, Mary; Farrell, Ann; Carter, Virginia L
2013-02-01
Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-04-02
The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-01-01
The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089
Directory of Open Access Journals (Sweden)
Mina Jafarabadi
2017-08-01
Full Text Available Background: The animal models of endometriosis could be a valuable alternative tool for clarifying the etiology of endometriosis. Objective: In this study two endometriosis models at the morphological and molecular levels was evaluated and compared. Materials and Methods: The human endometrial tissues were cut into small fragments then they were randomly considered for transplantation into γ irradiated mice as model A; or they were isolated and cultured up to fourth passages. 2×106 cultured stromal cells were transplanted into γ irradiated mice subcutaneously as model B. twenty days later the ectopic tissues in both models were studied morphologically by Periodic acid-Schiff and hematoxylin and eosin staining. The expression of osteopontin (OPN and matrix metalloproteinase 2 (MMP2 genes were also assessed using real time RT-PCR. 17-β estradiol levels of mice sera were compared before and after transplantation. Results: The endometrial like glands and stromal cells were formed in the implanted subcutaneous tissue of both endometriosis models. The gland sections per cubic millimeter, the expression of OPN and MMP2 genes and the level of 17-β estradiol were higher in model B than model A (p=0.03. Conclusion: Our observation demonstrated that endometrial mesenchymal stromal cells showed more efficiency to establish endometriosis model than human endometrial tissue fragments.
Directory of Open Access Journals (Sweden)
Agnes Yasmin Pitombeira Cavalcante
2017-08-01
Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.
Cucinotta, Francis A.; Hajnal, Ferenc; Wilson, John W.
1990-01-01
The transport of nuclear fragmentation recoils produced by high-energy nucleons in the region of the bone-tissue interface is considered. Results for the different flux and absorbed dose for recoils produced by 1 GeV protons are presented in a bidirectional transport model. The energy deposition in marrow cavities is seen to be enhanced by recoils produced in bone. Approximate analytic formulae for absorbed dose near the interface region are also presented for a simplified range-energy model.
Directory of Open Access Journals (Sweden)
P Karschnia
2018-05-01
Full Text Available The seeding of tissue constructs with adipose tissue-derived microvascular fragments (ad-MVF is an emerging pre-vascularisation strategy. Ad-MVF rapidly reassemble into new microvascular networks after in vivo implantation. Herein it was analysed whether this process was improved by erythropoietin (EPO. Ad-MVF were isolated from green fluorescent protein (GFP+ as well as wild-type C57BL/6 mice and cultivated for 24 h in medium supplemented with EPO (20 IU/mL or vehicle. Freshly isolated, non-cultivated ad-MVF served as controls. Protein expression, cell viability and proliferation of ad-MVF were assessed by proteome profiler array and fluorescence microscopy. GFP+ ad-MVF were seeded on collagen-glycosaminoglycan matrices, which were implanted into dorsal skinfold chambers of C57BL/6 mice, to analyse their vascularisation over 14 d by intravital fluorescence microscopy, histology and immunohistochemistry. Cultivation up-regulated the expression of pro- and anti-angiogenic factors within both vehicle- and EPO-treated ad-MVF when compared with non-cultivated controls. Moreover, EPO treatment suppressed cultivation-associated apoptosis and significantly increased the number of proliferating endothelial cells in ad-MVF when compared with vehicle-treated and non-cultivated ad-MVF. Accordingly, implanted matrices seeded with EPO-treated ad-MVF exhibited an improved vascularisation, as indicated by a significantly higher functional microvessel density. The matrices of the three groups contained a comparably large fraction of GFP+ microvessels originating from the ad-MVF, whereas the tissue surrounding the matrices seeded with EPO-treated ad-MVF exhibited a significantly increased microvessel density when compared with the other two groups. These findings indicated that EPO represents a promising cytokine to further boost the excellent vascularisation properties of ad-MVF in tissue-engineering applications.
Davidsson, Pia; Söderling, Ann-Sofi; Svensson, Lena; Ahnmark, Andrea; Flodin, Christine; Wanag, Ewa; Screpanti-Sundqvist, Valentina; Gennemark, Peter
2015-05-01
Tissue distribution and pharmacokinetics (PK) of full-length nontargeted antibody and its antigen-binding fragment (FAb) were evaluated for a range of tissues primarily of interest for cardiovascular and metabolic diseases. Mice were intravenously injected with a dose of 10 mg/kg of either human IgG1or its FAb fragment; perfused tissues were collected at a range of time points over 3 weeks for the human IgG1 antibody and 1 week for the human FAb antibody. Tissues were homogenized and antibody concentrations were measured by specific immunoassays on the Gyros system. Exposure in terms of maximum concentration (Cmax ) and area under the curve was assessed for all nine tissues. Tissue exposure of full-length antibody relative to plasma exposure was found to be between 1% and 10%, except for brain (0.2%). Relative concentrations of FAb antibody were the same, except for kidney tissue, where the antibody concentration was found to be ten times higher than in plasma. However, the absolute tissue uptake of full-length IgG was significantly higher than the absolute tissue uptake of the FAb antibody. This study provides a reference PK state for full-length whole and FAb antibodies in tissues related to cardiovascular and metabolic diseases that do not include antigen or antibody binding. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.
Hokama, Y; Chun, K E; Campora, C E; Higa, N; Suma, C; Hamajima, A; Isobe, M
2006-01-01
It is well established that the targeted receptor for ciguatoxin (CTX) in mammalian tissues is the sodium channel, affecting the influx of sodium into cells and altering the action potential and function of the cell. Since the syntheses of fragments of CTX has become available, our focus has been on the receptor functions of the west sphere AB and east sphere JKLM fragments using the neuroblastoma cell assay, guinea pig atrium assay, and the membrane immunobead assay (MIA). The data presented here suggest that the west sphere AB of the ciguatoxin molecule is the active portion and is responsible for the activation of the sodium channels. (c) 2006 Wiley-Liss, Inc.
Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe
2016-05-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.
Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe
2016-01-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
Lihavainen, E; Kislin, M; Toptunov, D; Khiroug, L; Ribeiro, A S
2015-12-01
The morphology of mitochondria can inform about their functional state and, thus, about cell vitality. For example, fragmentation of the mitochondrial network is associated with many diseases. Recent advances in neuronal imaging have enabled the observation of mitochondria in live brains for long periods of time, enabling the study of their dynamics in animal models of diseases. To aid these studies, we developed an automatic method, based on supervised learning, for quantifying the degree of mitochondrial fragmentation in tissue images acquired via two-photon microscopy from transgenic mice, which exclusively express Enhanced cyan fluorescent protein (ECFP) under Thy1 promoter, targeted to the mitochondrial matrix in subpopulations of neurons. We tested the method on images prior to and after cardiac arrest, and found it to be sensitive to significant changes in mitochondrial morphology because of the arrest. We conclude that the method is useful in detecting morphological abnormalities in mitochondria and, likely, in other subcellular structures as well. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.
The spectroscopy of fission fragments
International Nuclear Information System (INIS)
Phillips, W.R.
1998-01-01
High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)
The spectroscopy of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)
1998-12-31
High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.
International Nuclear Information System (INIS)
Karmanov, V.A.
1983-01-01
Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative
Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome
International Nuclear Information System (INIS)
Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie
2008-01-01
Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus
Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory
Energy Technology Data Exchange (ETDEWEB)
Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)
2016-11-15
The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)
Universality of fragment shapes.
Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea
2015-03-16
The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.
Marolla, Ana Paula Cleto; Waisberg, Jaques; Saba, Gabriela Tognini; Waisberg, Daniel Reis; Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva
2015-01-01
To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student'st test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues.
Energy Technology Data Exchange (ETDEWEB)
Marolla, Ana Paula Cleto [Universidade Federal de São Paulo, São Paulo, SP (Brazil); Waisberg, Jaques [Hospital do Servidor Público Estadual, São Paulo, SP (Brazil); Faculdade de Medicina do ABC, Santo André, SP (Brazil); Saba, Gabriela Tognini [Faculdade de Medicina do ABC, Santo André, SP (Brazil); Waisberg, Daniel Reis [Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva [Faculdade de Medicina do ABC, Santo André, SP (Brazil)
2015-07-01
To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student’s t test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues.
International Nuclear Information System (INIS)
Marolla, Ana Paula Cleto; Waisberg, Jaques; Saba, Gabriela Tognini; Waisberg, Daniel Reis; Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva
2015-01-01
To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student’s t test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues
International Nuclear Information System (INIS)
Shi, Sixiang; Hong, Hao; Orbay, Hakan; Yang, Yunan; Ohman, Jakob D.; Graves, Stephen A.; Nickles, Robert J.; Liu, Bai; Wong, Hing C.; Cai, Weibo
2015-01-01
To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and 64 Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of 64 Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of 64 Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. 64 Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management. (orig.)
Shi, Sixiang; Hong, Hao; Orbay, Hakan; Graves, Stephen A; Yang, Yunan; Ohman, Jakob D; Liu, Bai; Nickles, Robert J; Wong, Hing C; Cai, Weibo
2015-07-01
To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and (64)Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of (64)Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of (64)Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. (64)Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management.
Energy Technology Data Exchange (ETDEWEB)
Shi, Sixiang [University of Wisconsin, Materials Science Program, Madison, WI (United States); Hong, Hao; Orbay, Hakan; Yang, Yunan; Ohman, Jakob D. [University of Wisconsin, Department of Radiology, Madison, WI (United States); Graves, Stephen A.; Nickles, Robert J. [University of Wisconsin, Department of Medical Physics, Madison, WI (United States); Liu, Bai; Wong, Hing C. [Altor BioScience, Miramar, FL (United States); Cai, Weibo [University of Wisconsin, Materials Science Program, Madison, WI (United States); University of Wisconsin, Department of Radiology, Madison, WI (United States); University of Wisconsin, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States); University of Wisconsin, Departments of Radiology and Medical Physics, Madison, WI (United States)
2015-07-15
To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and {sup 64}Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of {sup 64}Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of {sup 64}Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. {sup 64}Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management. (orig.)
Temperatures of fragment kinetic energy spectra
International Nuclear Information System (INIS)
Bauer, W.
1995-01-01
Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework
Glioma spheroids obtained via ultrasonic aspiration are viable and express stem cell markers
DEFF Research Database (Denmark)
Jensen, Stine Skov; Aaberg-Jessen, Charlotte; Andersen, Claus
2013-01-01
Ultrasonic aspirators allow safe, rapid, and accurate removal of brain tumors. However, the tissue fragments removed are used surprisingly little in research.......Ultrasonic aspirators allow safe, rapid, and accurate removal of brain tumors. However, the tissue fragments removed are used surprisingly little in research....
Ultrasound elastography assessment of bone/soft tissue interface
International Nuclear Information System (INIS)
Parmar, Biren J; Yang, Xu; Chaudhry, Anuj; Shajudeen, Peer Shafeeq; Nair, Sanjay P; Righetti, Raffaella; Weiner, Bradley K; Tasciotti, Ennio; Krouskop, Thomas A
2016-01-01
We report on the use of elastographic imaging techniques to assess the bone/soft tissue interface, a region that has not been previously investigated but may provide important information about fracture and bone healing. The performance of axial strain elastograms and axial shear strain elastograms at the bone/soft tissue interface was studied ex vivo on intact and fractured canine and ovine tibias. Selected ex vivo results were corroborated on intact sheep tibias in vivo. The elastography results were statistically analyzed using elastographic image quality tools. The results of this study demonstrate distinct patterns in the distribution of the normalized local axial strains and axial shear strains at the bone/soft tissue interface with respect to the background soft tissue. They also show that the relative strength and distribution of the elastographic parameters change in the presence of a fracture and depend on the degree of misalignment between the fracture fragments. Thus, elastographic imaging modalities might be used in the future to obtain information regarding the integrity of bones and to assess the severity of fractures, alignment of bone fragments as well as to follow bone healing. (paper)
Ultrasound elastography assessment of bone/soft tissue interface
Parmar, Biren J.; Yang, Xu; Chaudhry, Anuj; Shafeeq Shajudeen, Peer; Nair, Sanjay P.; Weiner, Bradley K.; Tasciotti, Ennio; Krouskop, Thomas A.; Righetti, Raffaella
2016-01-01
We report on the use of elastographic imaging techniques to assess the bone/soft tissue interface, a region that has not been previously investigated but may provide important information about fracture and bone healing. The performance of axial strain elastograms and axial shear strain elastograms at the bone/soft tissue interface was studied ex vivo on intact and fractured canine and ovine tibias. Selected ex vivo results were corroborated on intact sheep tibias in vivo. The elastography results were statistically analyzed using elastographic image quality tools. The results of this study demonstrate distinct patterns in the distribution of the normalized local axial strains and axial shear strains at the bone/soft tissue interface with respect to the background soft tissue. They also show that the relative strength and distribution of the elastographic parameters change in the presence of a fracture and depend on the degree of misalignment between the fracture fragments. Thus, elastographic imaging modalities might be used in the future to obtain information regarding the integrity of bones and to assess the severity of fractures, alignment of bone fragments as well as to follow bone healing.
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
Wu, Li; Zhang, Bin; Wu, Ping; Liu, Qian; Gong, Hui
2007-05-01
A high-resolution optical imaging system was designed and developed to obtain the serial transverse section images of the biologic tissue, such as the mouse brain, in which new knife-edge imaging technology, high-speed and high-sensitive line-scan CCD and linear air bearing stages were adopted and incorporated with an OLYMPUS microscope. The section images on the tip of the knife-edge were synchronously captured by the reflection imaging in the microscope while cutting the biologic tissue. The biologic tissue can be sectioned at interval of 250 nm with the same resolution of the transverse section images obtained in x and y plane. And the cutting job can be automatically finished based on the control program wrote specially in advance, so we save the mass labor of the registration of the vast images data. In addition, by using this system a larger sample can be cut than conventional ultramicrotome so as to avoid the loss of the tissue structure information because of splitting the tissue sample to meet the size request of the ultramicrotome.
Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio
2014-08-30
The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.
Lirman
2000-08-23
Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.
Jordan, John B; Whittington, Douglas A; Bartberger, Michael D; Sickmier, E Allen; Chen, Kui; Cheng, Yuan; Judd, Ted
2016-04-28
Fragment-based drug discovery (FBDD) has become a widely used tool in small-molecule drug discovery efforts. One of the most commonly used biophysical methods in detecting weak binding of fragments is nuclear magnetic resonance (NMR) spectroscopy. In particular, FBDD performed with (19)F NMR-based methods has been shown to provide several advantages over (1)H NMR using traditional magnetization-transfer and/or two-dimensional methods. Here, we demonstrate the utility and power of (19)F-based fragment screening by detailing the identification of a second-site fragment through (19)F NMR screening that binds to a specific pocket of the aspartic acid protease, β-secretase (BACE-1). The identification of this second-site fragment allowed the undertaking of a fragment-linking approach, which ultimately yielded a molecule exhibiting a more than 360-fold increase in potency while maintaining reasonable ligand efficiency and gaining much improved selectivity over cathepsin-D (CatD). X-ray crystallographic studies of the molecules demonstrated that the linked fragments exhibited binding modes consistent with those predicted from the targeted screening approach, through-space NMR data, and molecular modeling.
Cell Division and Evolution of Biological Tissues
Rivier, Nicolas; Arcenegui-Siemens, Xavier; Schliecker, Gudrun
A tissue is a geometrical, space-filling, random cellular network; it remains in this steady state while individual cells divide. Cell division (fragmentation) is a local, elementary topological transformation which establishes statistical equilibrium of the structure. Statistical equilibrium is characterized by observable relations (Lewis, Aboav) between cell shapes, sizes and those of their neighbours, obtained through maximum entropy and topological correlation extending to nearest neighbours only, i.e. maximal randomness. For a two-dimensional tissue (epithelium), the distribution of cell shapes and that of mother and daughter cells can be obtained from elementary geometrical and physical arguments, except for an exponential factor favouring division of larger cells, and exponential and combinatorial factors encouraging a most symmetric division. The resulting distributions are very narrow, and stationarity severely restricts the range of an adjustable structural parameter
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Dimensional crossover in fragmentation
Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.
2000-11-01
Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
Lazebnik, Mariya; McCartney, Leah; Popovic, Dijana; Watkins, Cynthia B; Lindstrom, Mary J; Harter, Josephine; Sewall, Sarah; Magliocco, Anthony; Booske, John H; Okoniewski, Michal; Hagness, Susan C
2007-05-21
The efficacy of emerging microwave breast cancer detection and treatment techniques will depend, in part, on the dielectric properties of normal breast tissue. However, knowledge of these properties at microwave frequencies has been limited due to gaps and discrepancies in previously reported small-scale studies. To address these issues, we experimentally characterized the wideband microwave-frequency dielectric properties of a large number of normal breast tissue samples obtained from breast reduction surgeries at the University of Wisconsin and University of Calgary hospitals. The dielectric spectroscopy measurements were conducted from 0.5 to 20 GHz using a precision open-ended coaxial probe. The tissue composition within the probe's sensing region was quantified in terms of percentages of adipose, fibroconnective and glandular tissues. We fit a one-pole Cole-Cole model to the complex permittivity data set obtained for each sample and determined median Cole-Cole parameters for three groups of normal breast tissues, categorized by adipose tissue content (0-30%, 31-84% and 85-100%). Our analysis of the dielectric properties data for 354 tissue samples reveals that there is a large variation in the dielectric properties of normal breast tissue due to substantial tissue heterogeneity. We observed no statistically significant difference between the within-patient and between-patient variability in the dielectric properties.
International Nuclear Information System (INIS)
Lazebnik, Mariya; McCartney, Leah; Popovic, Dijana; Watkins, Cynthia B; Lindstrom, Mary J; Harter, Josephine; Sewall, Sarah; Magliocco, Anthony; Booske, John H; Okoniewski, Michal; Hagness, Susan C
2007-01-01
The efficacy of emerging microwave breast cancer detection and treatment techniques will depend, in part, on the dielectric properties of normal breast tissue. However, knowledge of these properties at microwave frequencies has been limited due to gaps and discrepancies in previously reported small-scale studies. To address these issues, we experimentally characterized the wideband microwave-frequency dielectric properties of a large number of normal breast tissue samples obtained from breast reduction surgeries at University of Wisconsin and University of Calgary hospitals. The dielectric spectroscopy measurements were conducted from 0.5 to 20 GHz using a precision open-ended coaxial probe. The tissue composition within the probe's sensing region was quantified in terms of percentages of adipose, fibroconnective and glandular tissues. We fit a one-pole Cole-Cole model to the complex permittivity data set obtained for each sample and determined median Cole-Cole parameters for three groups of normal breast tissues, categorized by adipose tissue content (0-30%, 31-84% and 85-100%). Our analysis of the dielectric properties data for 354 tissue samples reveals that there is a large variation in the dielectric properties of normal breast tissue due to substantial tissue heterogeneity. We observed no statistically significant difference between the within-patient and between-patient variability in the dielectric properties
Velocity distribution of fragments of catastrophic impacts
Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi
1992-01-01
Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.
Fresh muscle fiber fragments on a scaffold in rats-a new concept in urogynecology?
DEFF Research Database (Denmark)
Boennelycke, Marie; Christensen, Lise; Nielsen, Lene F
2011-01-01
To investigate if a synthetic, biodegradable scaffold with either autologous in vitro cultured muscle-derived cells or autologous fresh muscle fiber fragments could be used for tissue repair.......To investigate if a synthetic, biodegradable scaffold with either autologous in vitro cultured muscle-derived cells or autologous fresh muscle fiber fragments could be used for tissue repair....
Chappelow, Jonathan; Tomaszewski, John E.; Feldman, Michael; Shih, Natalie; Madabhushi, Anant
2011-01-01
We present an interactive program called HistoStitcher© for accurate and rapid reassembly of histology fragments into a pseudo-whole digitized histological section. HistoStitcher© provides both an intuitive graphical interface to assist the operator in performing the stitch of adjacent histology fragments by selecting pairs of anatomical landmarks, and a set of computational routines for determining and applying an optimal linear transformation to generate the stitched image. Reconstruction of whole histological sections from images of slides containing smaller fragments is required in applications where preparation of whole sections of large tissue specimens is not feasible or efficient, and such whole mounts are required to facilitate (a) disease annotation and (b) image registration with radiological images. Unlike manual reassembly of image fragments in a general purpose image editing program (such as Photoshop), HistoStitcher© provides memory efficient operation on high resolution digitized histology images and a highly flexible stitching process capable of producing more accurate results in less time. Further, by parameterizing the series of transformations determined by the stitching process, the stitching parameters can be saved, loaded at a later time, refined, or reapplied to multi-resolution scans, or quickly transmitted to another site. In this paper, we describe in detail the design of HistoStitcher© and the mathematical routines used for calculating the optimal image transformation, and demonstrate its operation for stitching high resolution histology quadrants of a prostate specimen to form a digitally reassembled whole histology section, for 8 different patient studies. To evaluate stitching quality, a 6 point scoring scheme, which assesses the alignment and continuity of anatomical structures important for disease annotation, is employed by three independent expert pathologists. For 6 studies compared with this scheme, reconstructed sections
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
Biological effectiveness of high-energy protons - Target fragmentation
International Nuclear Information System (INIS)
Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.
1991-01-01
High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs
I. Klasen (Ina); J. Kool (Jeanette); M.J. Melief (Marie-José); I. Loeve (I.); W.B. van den Berg (Wim); A.J. Severijnen; M.P.H. Hazenberg (Maarten)
1992-01-01
markdownabstract__Abstract__ T cell lines (B13, B19) were isolated from the lymph nodes of Lewis rats 12 days after an arthritogenic injection of cell wall fragments of Eubacterium aerofaciens (ECW), a major resident of the human intestinal flora. These cell wall fragments consist of
Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E
2017-02-01
A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Buchegger, F.; Chalandon, Y.; Pelegrin, A.; Hardman, N.; Mach, J.P.
1991-01-01
Normal rats were injected intravenously with 131I- and 125I-labeled intact murine and chimeric mouse-human monoclonal antibodies directed against carcinoembryonic antigen or with the corresponding F(ab')2 fragments. At different times after injection, individual animals were killed and radioactivity of blood and major organs, including bones and bone marrow, was determined. Ratios comparing radioactivity concentration in different tissues with that of bone marrow were calculated and found to remain stable during several effective half-lives of the antibodies. Mean bone marrow radioactivity was 35% (range, 29%-40%) of that of blood and 126% (range, 108%-147%) of that of liver after injection of intact Mabs or F(ab')2 fragments. In nude rats bearing human colon carcinoma xenografts producing carcinoembryonic antigen, relative bone marrow radioactivity was slightly lower than that in normal rats
Meek, MF; den Dunnen, WFA; Schakenraad, JM; Robinson, PH
The aim of this study was to (1) evaluate the effect of several preparation techniques of denatured muscle tissue to obtain an open three-dimensional structure, and (2) test if this scaffold is suitable for peripheral nerve regeneration. Four samples (A-D) of muscle tissue specimens were evaluated
Fragmentation of atomic clusters: A theoretical study
International Nuclear Information System (INIS)
Lopez, M.J.; Jellinek, J.
1994-01-01
Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time
Medium-scale melt-sodium fragmentation experiments
International Nuclear Information System (INIS)
Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.
1979-01-01
The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments
DEFF Research Database (Denmark)
Gozal, D; Qiao, Z; Almendros, I
2016-01-01
BACKGROUND: Sleep fragmentation (SF), a frequent occurrence in multiple sleep and other diseases leads to increased food intake and insulin resistance via increased macrophage activation and inflammation in visceral white adipose tissue (VWAT). Free fatty acid receptor 4 (FFA4) is reduced in pedi...... FFA4 activity may serve as potentially useful adjunctive therapies for sleep disorders accompanied by metabolic morbidity.International Journal of Obesity accepted article preview online, 16 March 2016. doi:10.1038/ijo.2016.37....
The comparison of two methods to obtain human oral keratinocytes in primary culture
International Nuclear Information System (INIS)
Klingbeil, Maria Fatima Guarizo
2006-01-01
The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)
Management of small fragment wounds in war: current research.
Bowyer, G W; Cooper, G J; Rice, P
1995-03-01
The majority of war wounds are caused by antipersonnel fragments from munitions such as mortars and bomblets. Modern munitions aim to incapacitate soldiers with multiple wounds from very small fragments of low available kinetic energy. Many of these fragments may be stopped by helmets and body armour and this has led to a predominance of multiple wounds to limbs in those casualties requiring surgery. The development of an appropriate management strategy for these multiple wounds requires knowledge of the contamination and extent of soft tissue injury; conservative management may be appropriate. The extent of skin and muscle damage associated with a small fragment wound, the way in which these wounds may progress without intervention and their colonisation by bacteria has been determined in an experimental animal model. Results from 12 animals are presented. There was a very small (approximately 1 mm) margin of nonviable skin around the entrance wound. The amount of devitalised muscle in the wound tract was a few hundred milligrams. Some muscles peripheral to the wound track also showed signs of damage 1 h after wounding, but this improved over 24 h; the proportion of fragmented muscle fibres in the tissue around the track decreased as time went on. There was no clinical sign or bacteriological evidence of the track becoming infected up to 24 h after wounding. This preliminary work suggests that, in the absence of infection, the amount of muscle damage caused by small fragment wounds begins to resolve in the first 24 h after injury, even without surgical intervention.
Inclusive breakup of three-fragment weakly bound nuclei
International Nuclear Information System (INIS)
Carlson, B.V.; Frederico, T.; Hussein, M.S.
2017-01-01
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Inclusive breakup of three-fragment weakly bound nuclei
Energy Technology Data Exchange (ETDEWEB)
Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)
2017-04-10
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Energy distribution of projectile fragment particles in heavy ion therapeutic beam
Energy Technology Data Exchange (ETDEWEB)
Matsufuji, Naruhiro; Tomura, Hiromi; Futami, Yasuyuki [National Inst. of Radiological Sciences, Chiba (Japan)] [and others
1998-03-01
Production of fragment particles in a patient`s body is one of important problems for heavy charged particle therapy. It is required to know the yield and the energy spectrum for each fragment element - so called `beam quality` to understand the effect of therapeutic beam precisely. In this study, fragment particles produced by practical therapeutic beam of HIMAC were investigated with using tissue-equivalent material and a detector complex. From the results, fragment particles were well identified by difference of their atomic numbers and the beam quality was derived. Responses of the detectors in this energy region were also researched. (author)
NMR-Fragment Based Virtual Screening: A Brief Overview.
Singh, Meenakshi; Tam, Benjamin; Akabayov, Barak
2018-01-25
Fragment-based drug discovery (FBDD) using NMR has become a central approach over the last twenty years for development of small molecule inhibitors against biological macromolecules, to control a variety of cellular processes. Yet, several considerations should be taken into account for obtaining a therapeutically relevant agent. In this review, we aim to list the considerations that make NMR fragment screening a successful process for yielding potent inhibitors. Factors that may govern the competence of NMR in fragment based drug discovery are discussed, as well as later steps that involve optimization of hits obtained by NMR-FBDD.
NMR-Fragment Based Virtual Screening: A Brief Overview
Directory of Open Access Journals (Sweden)
Meenakshi Singh
2018-01-01
Full Text Available Fragment-based drug discovery (FBDD using NMR has become a central approach over the last twenty years for development of small molecule inhibitors against biological macromolecules, to control a variety of cellular processes. Yet, several considerations should be taken into account for obtaining a therapeutically relevant agent. In this review, we aim to list the considerations that make NMR fragment screening a successful process for yielding potent inhibitors. Factors that may govern the competence of NMR in fragment based drug discovery are discussed, as well as later steps that involve optimization of hits obtained by NMR-FBDD.
Identification of pro-opiomelanocortin and secretion of its peptide fragments in bovine adrenals
Energy Technology Data Exchange (ETDEWEB)
Tennov, A.V.; Dmitriev, A.D.; Kizim, E.A.; Ustinova, E.E.
1986-01-01
This paper describes the results of an investigation to show that biosynthesis of POMC, its proteolytic processing, an secretion of the peptide products of that processing take place in the bovine adrenals. Rabbit antisera against endorphins were obtained and used for radioimmunoassay of peptides. I 125-labeled peptides were obtained by the chloramine method and purified from free I 125 on Sephadex G-10 (0.7 x 5 cm, centrifugation for 10 min at 1500 g). To detect secretion of peptide fragments of POMC in the adrenals experiments were undertaken to determine the beta-endorphin content in perfusates obtained during retrograde perfusion of the bovine adrenals. It was found that immunoreactive compounds, indistinguishable in their immunochemical properties from beta-endorphin, are present in the perfusates, just as in the tissue extracts.
Gluon fragmentation into 3 PJ quarkonium
International Nuclear Information System (INIS)
Ma, J.P.
1995-01-01
The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs
Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator
International Nuclear Information System (INIS)
Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.
1993-10-01
Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)
Assessment of the Risks from Imbedded Fragments of Depleted Uranium
1993-03-01
for chronic kidney toxicity; the impact of fibrotic encapsulation , if it occurs; and the chemical form of the imbedded fragment. The potential for...Effects of Depleted Uranium Imbedded in Tissue Reference: Brigadier General Ronald R. Blanck (SGPS-PSP) letter of 26 February 1992 In response to your...the muscle and fatty tissue will probably occur and will occur in all other tissue types that elicit similar cellular responses to foreign bodies. It
Clustering document fragments using background color and texture information
Chanda, Sukalpa; Franke, Katrin; Pal, Umapada
2012-01-01
Forensic analysis of questioned documents sometimes can be extensively data intensive. A forensic expert might need to analyze a heap of document fragments and in such cases to ensure reliability he/she should focus only on relevant evidences hidden in those document fragments. Relevant document retrieval needs finding of similar document fragments. One notion of obtaining such similar documents could be by using document fragment's physical characteristics like color, texture, etc. In this article we propose an automatic scheme to retrieve similar document fragments based on visual appearance of document paper and texture. Multispectral color characteristics using biologically inspired color differentiation techniques are implemented here. This is done by projecting document color characteristics to Lab color space. Gabor filter-based texture analysis is used to identify document texture. It is desired that document fragments from same source will have similar color and texture. For clustering similar document fragments of our test dataset we use a Self Organizing Map (SOM) of dimension 5×5, where the document color and texture information are used as features. We obtained an encouraging accuracy of 97.17% from 1063 test images.
International Nuclear Information System (INIS)
Alonso Martinez, L. M.; Xiques Castillo, A.; Leyva Montanna, R.; Perez-Malo Cruz, M.; Zamora Barrabi, M.; Manresa Sanchez, Y.
2013-01-01
Antibody-based targeted delivery of radioisotopes to malignant tissues is a promising approach in cancer diagnostics and therapy. However, intact antibody molecules are large glycoproteins (∼150 kDa) that have limited application in molecular imaging and therapy due to their relatively slow clearance from the circulation leading to a high background signal rather both cases the sensitivity can be increased with the use of enzymatically produced Fab' fragments. In this work, the ability to get labeled with 62 Ga and 90 Y of a monoclonal antibody (mAb) Fab' fragment against the transmembrane receptor tyrosine kinase HER-1 was studied for future applications in PET imaging and radioimmunotherapy of tumors. In order to obtain the Fab' fragment the mAb was cleaved with pepsin in molar excess. After separating the reaction mixture in two steps using affinity and ion-exchange chromatography, the Fab' fragment was finally obtained by reduction of the F(ab') 2 with a molar excess of 2-mercaptoethanol followed by a size exclusion purification step. The Fab' fragment was derivatized with 1,4,7,10-tetraaza cyclododecane-1,4,7,10-tetraacetic acid mono N-hydroxysuccinimide commercial ester (DOTA-NHS-ester) applying a simple procedure and the number of DOTA groups linked to Fab' were determinate. The labeling of the conjugate with 68 Ga and 90 Y from 'in-house generators yielded radiochemically pure probes that can become a suitable radioimmunoconjugated in a near future. (Author)
Dual Fragment Impact of PBX Charges
Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team
2017-06-01
Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.
Directory of Open Access Journals (Sweden)
Phoebe A Chapman
Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to
Efficient clustering aggregation based on data fragments.
Wu, Ou; Hu, Weiming; Maybank, Stephen J; Zhu, Mingliang; Li, Bing
2012-06-01
Clustering aggregation, known as clustering ensembles, has emerged as a powerful technique for combining different clustering results to obtain a single better clustering. Existing clustering aggregation algorithms are applied directly to data points, in what is referred to as the point-based approach. The algorithms are inefficient if the number of data points is large. We define an efficient approach for clustering aggregation based on data fragments. In this fragment-based approach, a data fragment is any subset of the data that is not split by any of the clustering results. To establish the theoretical bases of the proposed approach, we prove that clustering aggregation can be performed directly on data fragments under two widely used goodness measures for clustering aggregation taken from the literature. Three new clustering aggregation algorithms are described. The experimental results obtained using several public data sets show that the new algorithms have lower computational complexity than three well-known existing point-based clustering aggregation algorithms (Agglomerative, Furthest, and LocalSearch); nevertheless, the new algorithms do not sacrifice the accuracy.
National Research Council Canada - National Science Library
Niguidula, Nancy
2000-01-01
.... The analysis of the CYP1A2 gene is currently in progress. Due to the difficulty in obtaining large fragments of DNA from the tumor tissue sections required for PCR-RFLP, a new method is under development for genotyping NAT2...
Fragment-based discovery of a potent NAMPT inhibitor.
Korepanova, Alla; Longenecker, Kenton L; Pratt, Steve D; Panchal, Sanjay C; Clark, Richard F; Lake, Marc; Gopalakrishnan, Sujatha M; Raich, Diana; Sun, Chaohong; Petros, Andrew M
2017-12-12
NAMPT expression is elevated in many cancers, making this protein a potential target for anticancer therapy. We have carried out both NMR based and TR-FRET based fragment screens against human NAMPT and identified six novel binders with a range of potencies. Co-crystal structures were obtained for two of the fragments bound to NAMPT while for the other four fragments force-field driven docking was employed to generate a bound pose. Based on structural insights arising from comparison of the bound fragment poses to that of bound FK866 we were able to synthetically elaborate one of the fragments into a potent NAMPT inhibitor. Copyright © 2017 Elsevier Ltd. All rights reserved.
Microbial platform technology for recombinant antibody fragment production: A review.
Gupta, Sanjeev Kumar; Shukla, Pratyoosh
2017-02-01
Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.
Impact failure and fragmentation properties of metals
Energy Technology Data Exchange (ETDEWEB)
Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)
1998-03-01
In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.
Bone fragments a body can make
Energy Technology Data Exchange (ETDEWEB)
Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))
1991-05-01
Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.
International Nuclear Information System (INIS)
Bogatin, V.I.; Ganza, E.A.; Lozhkin, O.V.; Murin, Yu.A.; Oplavin, V.S.; Perfilov, N.A.; Yakovlev, Yu.P.
1981-01-01
An experimental investigation of inclusive characteristics of nuclei-target fragmentation is conducted for further development and test of physical value of the earlier suggested nuclear fragmentation model based on the connection of the fragmentation with fluctuations of the quasiparticle density in the two-component quantum liquid, an experimental investigation of the inclusive characteristics of the nuclei-target fragmentation is carried out. The processes of sup(3, 4, 6, 8)He and sup(6, 7, 8, 9, 11)Li fragment formation during the interaction of relativistic protons (Esub(p)=6.7 GeV) and deutrons (Esub(d)=3.1 GeV) with 112 Sn and 124 Sn isotopes are studied by the method of semiconductive ΔE-E detectors. Differential energy spectra of fragments and isotopic ratio of cross sections of their formation as well as data on the dependence of isotopic ratios of fragmentation cross sections on the energy of incident particles and on the fragment energy are obtained. Presented is a phenomenological model of fragmentation within the frames of which the obtained experimental data are analyzed [ru
Fragmentation Point Detection of JPEG Images at DHT Using Validator
Mohamad, Kamaruddin Malik; Deris, Mustafa Mat
File carving is an important, practical technique for data recovery in digital forensics investigation and is particularly useful when filesystem metadata is unavailable or damaged. The research on reassembly of JPEG files with RST markers, fragmented within the scan area have been done before. However, fragmentation within Define Huffman Table (DHT) segment is yet to be resolved. This paper analyzes the fragmentation within the DHT area and list out all the fragmentation possibilities. Two main contributions are made in this paper. Firstly, three fragmentation points within DHT area are listed. Secondly, few novel validators are proposed to detect these fragmentations. The result obtained from tests done on manually fragmented JPEG files, showed that all three fragmentation points within DHT are successfully detected using validators.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
DEFF Research Database (Denmark)
Multhaupt, H A; Fessler, J N; Warhol, M J
2000-01-01
could be restored in these specimens by antigen retrieval in a low pH citrate buffer using a microwave heat technique. Keratin staining in needle biopsies and total prostatectomies was unaffected. CONCLUSION: In summary, our results indicate the technique of transurethral resection results in a specific......OBJECTIVE: Staining of prostatic basal cells for the expression of high-molecular-weight cytokeratin has been suggested as a way of distinguishing benign from malignant prostate glands. We evaluated the utility of high-molecular-weight cytokeratin in the diagnosis of malignancy in prostate...... specimens obtained in various ways. DESIGN: Prostate tissues obtained from needle biopsies, transurethral resections, and total prostatectomies were immunostained with monoclonal antibody 34betaE12, an antibody directed against high-molecular-weight cytokeratins. RESULTS: Antiserum to high...
Quark fragmentation into 3PJ quarkonium
International Nuclear Information System (INIS)
Ma, J.P.
1996-01-01
The functions of parton fragmentation into 3 P J quarkonium at order α 2 s are calculated, where the parton can be a heavy or a light quark. The obtained functions explicitly satisfy the Altarelli-Parisi equation and they are divergent, behaving as z -1 near z = O. However, if one choses the renormalization scale as twice of the heavy quark mass, the fragmentation functions are regular over the whole range of z. 15 refs., 2 figs
Li, Huiyan; Wan, Huiying; Xia, Tian; Chen, Maohua; Zhang, Yun; Luo, Xiaoming; Li, Xiaohong
2015-07-01
Therapeutic angiogenesis remains the most effective method to re-establish a proper blood flow in ischemic tissues. There is a great clinical need to identify an injectable format to achieve a well accumulation following local administration and a sustained delivery of biological factors at the ischemic sites. In the current study, fragmented nanofibers with loaded traditional Chinese medicines, astragaloside IV (AT), the main active ingredient of astragalus, and ferulic acid (FA), the main ingredient of angelica, were proposed to promote the microvessel formation after intramuscular injection into ischemic hindlimbs. Fragmented fibers with average lengths of 5 (FF-5), 20 (FF-20) and 80 μm (FF-80) were constructed by the cryocutting of aligned electrospun fibers. Their dispersion in sodium alginate solution (0.2%) indicated good injectability. After injection into the quadriceps muscles of the hindlimbs, FF-20 and FF-80 fiber fragments showed higher tissue retentions than FF-5, and around 90% of the injected doses were determined after 7 days. On a hindlimb ischemia model established by ligating the femoral arteries, intramuscular injection of the mixtures of FA-loaded and AT-loaded FF-20 fiber fragments substantially reduced the muscle degeneration with minimal fibrosis formation, significantly enhanced the neovessel formation and hindlimb perfusion in the ischemic tissues, and efficiently promoted the limb salvage with few limb losses. Along with the easy manipulation and lower invasiveness for in vivo administration, fragmented fibers should become potential drug carriers for disease treatment, wound recovery and tissue repair after local injection.
Target fragmentation in 1 A GeV Au + Pb reaction
Grabez, B
1999-01-01
We investigated the production of target fragments in interaction of 1 A GeV Au projectile with Pb. The behaviour of the atomic numbers of fragments and of the relative velocities has been examined in dependence of the centrality of collision. The results have been compared with the data of other authors obtained for projectile fragmentation.
Tsumura, Ryo; Sato, Ryuta; Furuya, Fumiaki; Koga, Yoshikatsu; Yamamoto, Yoshiyuki; Fujiwara, Yuki; Yasunaga, Masahiro; Matsumura, Yasuhiro
2015-12-01
Tissue factor (TF) is expressed strongly in various types of cancer, especially cancers that are often refractory to treatment, such as pancreatic cancer. In this study, we compared the differences in the biophysical and pharmacological properties of whole IgG and the Fab fragment of anti-human TF monoclonal antibody (1849 antibodies), in order to determine their suitability for application in the diagnosis and treatment of cancers. In the biophysical examination, we investigated the characteristics of 1849-whole IgG and 1849-Fab by SPR sensing and confocal fluorescence microscopy analysis using recombinant human TF antigen and TF-overexpressing human pancreatic cancer cell line, BxPC3, respectively. After conjugation with Alexa-Flour-647, in vivo imaging was conducted in mice bearing BxPC3 xenograft tumors. Furthermore, the distribution of the conjugates in tumors and major organs was evaluated by ex vivo study. The in vitro experiments showed that 1849 antibodies had high affinity against TF antigen. In addition, 1849-Fab showed a faster dissociation rate from the antigen than 1849-whole IgG. In mice, 1849-Fab-Alexa-Flour-647 showed rapid renal clearance and faster tumor accumulation, achieving a high contrast signal over nearby normal tissues in the early phase and enhanced tumor penetration after administration. On the other hand, 1849-whole IgG-Alexa-Flour-647 showed slow clearance from the blood and sustained high tumor accumulation. These results suggest that 1849-Fab may be a useful tool for pancreatic cancer diagnosis.
On the nuclear fragmentation mechanisms in nuclear collisions at intermediate and high energies
International Nuclear Information System (INIS)
Jipa, Al; Besliu, C.; Felea, D.
2004-01-01
The nuclear fragmentation mechanisms can be discussed by taking into account different scales related to the fragment sizes. Considering two fragmentation mechanisms of the nuclei at the same incident energy an analysis of the experimental results obtained was done. Goldhaber formula was improved by analyzing the discrepancies between data and theories concerning the projectile fragmentation. We implied that the projectile fragmentation process would be governed by the distribution of nucleon momenta in the projectile after the collision occurred. We used in our analysis protons from the 4 He + 7 Li at 4.5 GeV/c per nucleon incident momentum, as well as from 40 Ar + 12 C at 213 AMeV bombarding energy. We proved that in order to proceed in analyzing the projectile fragmentation process at intermediate and high energies one has to consider the dependence σ 0 on the apparent temperature of projectile nucleus after the collision took place. The generalized Bertsch correction for light projectile nuclei and fragments was used and the number of spatial correlations between identical nucleons having anticorrelated momenta was found. Thus we found apparent temperature values close to the separation energies of the considered fragments per number of fragments. The temperatures associated to kinetic energy spectra of the projectile fragments were calculated following two methods. The results from Bauer's method were compared with those obtained by fitting the kinetic energy distributions of the projectile fragments in the rest frame of the projectile with a Maxwellian curve. We also accomplished the comparison of the experimental results with similar events simulated with RQMD 2.4. All the results obtained suggested two nuclear fragmentation mechanisms: a sudden fragmentation by explosive mechanisms, like shock waves and a slow fragmentation by the 'fission' of the spectator regions, mainly because of the interactions with the particles or fragments emitted from the
Synthesis of arabinoxylan fragments
DEFF Research Database (Denmark)
Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert
, or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...
The biokinetics of uranium migrating from embedded DU fragments
International Nuclear Information System (INIS)
Leggett, R.W.; Pellmar, T.C.
2003-01-01
Military uses of depleted uranium (DU) munitions have resulted in casualties with embedded DU fragments. Assessment of radiological or chemical health risks from these fragments requires a model relating urinary U to the rate of migration of U from the fragments, and its accumulation in systemic tissues. A detailed biokinetic model for U has been published by the International Commission on Radiological Protection (ICRP), but its applicability to U migrating from embedded DU fragments is uncertain. Recently, ) conducted a study at the Armed Forces Radiobiology Research Institute (AFRRI) on the redistribution and toxicology of U in rats with implanted DU pellets, simulating embedded fragments. This paper compares the biokinetic data from that study with the behavior of commonly studied forms of U in rats (e.g., intravenously injected U nitrate). The comparisons indicate that the biokinetics of U migrating from embedded DU is similar to that of commonly studied forms of U with regard to long-term accumulation in kidneys, bone, and liver. The results provide limited support for the application of the ICRP's model to persons with embedded DU fragments. Additional information is needed with regard to the short-term behavior of migrating U and its accumulation in lymph nodes, brain, testicles, and other infrequently studied U repositories
Prompt neutrons from {sup 236}U fission fragments
Energy Technology Data Exchange (ETDEWEB)
Boldeman, J W; Musgrove, A.R. de L.; Walsch, R L
1971-03-01
Measurements were made of prompt neutron emission in the thermal neutron fission of {sup 235}U. The mean neutron emission per fragment was obtained for particular values of the fragment mass and total kinetic energy. A direct neutron counting method was employed and a comparison made with data from previous experiments of this type. (author)
Energy Technology Data Exchange (ETDEWEB)
Panosetti, C.; Sebastianelli, F.; Gianturco, F.A. [Department of Chemistry and CNISM, University of Rome -La Sapienza-, Roma (Italy); Baccarelli, I. [CASPUR, Supercomputing Consortium for University and Research, Roma (Italy)
2010-10-15
We investigate some aspects of the radiation damage mechanisms in biomolecules, focusing on the modelling of resonant fragmentation caused by the attachment of low-energy electrons (LEEs) initially ejected by biological tissues when exposed to ionizing radiation. Scattering equations are formulated within a symmetry-adapted, single-center expansion of both continuum and bound electrons, and the interaction forces are obtained from a combination of ab initio calculations and a nonempirical model of exchange and correlation effects developed in our group. We present total elastic scattering cross-sections and resonance features obtained for the equilibrium geometries of glycine, alanine, proline and valine. Our results at those geometries of the target molecules are briefly shown to qualitatively explain some of the fragmentation patterns obtained in experiments. We further carry out a one-dimensional (1D) modeling for the dynamics of intramolecular energy transfers mediated by the vibrational activation of selected bonds: our calculations indicate that resonant electron attachment to glycine can trigger direct, dissociative evolution of the complex into (Gly-OH)- and -OH losses, while they also find that the same process does not occur via a direct, 1D dissociative path in the larger amino acids of the present study. (authors)
The effective fragment molecular orbital method for fragments connected by covalent bonds.
Directory of Open Access Journals (Sweden)
Casper Steinmann
Full Text Available We extend the effective fragment molecular orbital method (EFMO into treating fragments connected by covalent bonds. The accuracy of EFMO is compared to FMO and conventional ab initio electronic structure methods for polypeptides including proteins. Errors in energy for RHF and MP2 are within 2 kcal/mol for neutral polypeptides and 6 kcal/mol for charged polypeptides similar to FMO but obtained two to five times faster. For proteins, the errors are also within a few kcal/mol of the FMO results. We developed both the RHF and MP2 gradient for EFMO. Compared to ab initio, the EFMO optimized structures had an RMSD of 0.40 and 0.44 Å for RHF and MP2, respectively.
Determination of fragment orbitals and LCFO MO's in semiempirical methods with overlap matrices
International Nuclear Information System (INIS)
Konstantinavicius, K.V.; Lazauskas, V.M.
1988-01-01
We propose a technique for a fragment stage solution of the Roothaan equations, allowing us to obtain fragment orbitals (FO's) and to form molecular orbitals (LCFO MO'S) for the molecule from them. As an example, in the Mulliken-Wolfsberg-Helmholtz (MWH) approximation we obtain the orbitals for fragments of the simplest hydrocarbon molecules and we compare them with the FO's found in the CNDO/2 approximation. We discuss the possibilities in perturbation theory for joining the fragments and for study of the properties of the molecules in the FO basis
Siedek, Vanessa; Betz, Christian S; Hecht, Volkmar; Blagova, Radka; Vogeser, Michael; Zengel, Pamela; Berghaus, Alexander; Leunig, Andreas; Sroka, Ronald
2008-04-01
Clinical laser lithotripsy in urology promises a good fragmentation combined with a minimal risk of soft tissue damage and low medical complications. This in vitro study investigates the fragmentation of salivary stones by means of two clinically used laser systems. The effects induced by the FREDDY laser (WOM, Germany, lambda = 532 nm/1,064 nm, E(pulse) = 120-160 mJ/pulse) and the Ho:YAG (AURIGA, StarMedTec, Germany, lambda = 2,100 nm, E(pulse) = 300-800 mJ/pulse) on clinical salivary calculi (n = 15) and on salivary gland tissue were investigated using clinical laser parameter settings. All experiments were performed in an under water experimental set-up using flexible fibres (core diameter 230 microm) positioned in front of each specimen. In order to assess fragmentation efficacy, each stone was placed on a grating (rhombic mash-diameter 1-3 mm). The fragmentation rate was calculated with respect to the energy applied (mg/J), to the number of pulses (mg/pulse), and to the time needed (mg/minute). In addition the composition of the stones were analysed spectrographically. The soft tissue interaction on human salivary duct mucosa was examined histologically (HE-staining). Spectrographic composition of the salivary stones showed a two component ratio of protein/carbonate apatite varying between 5/95 and 25/75. Stones treated by the Ho:YAG were vaporised in a milling-like process, while using the FREDDY laser stones are cracked into pieces and fragmentation failed in two cases. The fragmentation rates achieved by the FREDDY laser were greater than those of the Ho:YAG laser, but fragments mainly bigger. A dependency on the composition of the stones could not be found. Laser pulse effects on soft tissue were found slightly beyond the mucosa. This study clearly demonstrated the different processes of destroying salivary stones using two different laser systems. While the Ho:YAG vaporises the calculi in a more milling and soft sense, the FREDDY shows a more cracking and
Protocol for Monitoring Gulf War Veterans with Imbedded Fragments of Depleted Uranium
1993-03-01
interest is evidence of total or partial fibrotic encapsulation ; local tissue necrosis; growing granuloma; or if there is evidence of a breakdown, a...formed fibrotic capsule. - If the fragment is encapsulated , remove and save the intact capsule (with the fragment still inside) if possible. If the...0704-0188 Public reporng burden for this owllectlon of infotmation iS estimated to average 1 hour par response , ircluding the time for revewing
International Nuclear Information System (INIS)
Kojima, Shuji; Suzuki, Naomi; Shimura, Noriko; Kubodera, Akiko; Kubota, Kazuhiko; Yamaguchi, Toshiharu; Takahashi, Toshio; Oyamada, Hiyoshimaru
1993-01-01
Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab) 2 fragments were studied in human colon cancer (LS-174T)-bearing nude mice. The authors examined the yield and the immunoreactivity of F(ab) 2 fragments after treatment with ficin as a function of time. The yield of F(ab) 2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab) 2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab') 2 was preferentially taken up by the tumor, cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. The tumor image obtained at an early time using 131 I-F(ab') 2 was much superior in quality to that with intact 131 I-A7 MoAb. The use of F(ab') 2 fragments may be effective for tumor diagnosis and therapy. (author)
Experimental modelling of fragmentation applied to volcanic explosions
Haug, Øystein Thordén; Galland, Olivier; Gisler, Galen R.
2013-12-01
Explosions during volcanic eruptions cause fragmentation of magma and host rock, resulting in fragments with sizes ranging from boulders to fine ash. The products can be described by fragment size distributions (FSD), which commonly follow power laws with exponent D. The processes that lead to power-law distributions and the physical parameters that control D remain unknown. We developed a quantitative experimental procedure to study the physics of the fragmentation process through time. The apparatus consists of a Hele-Shaw cell containing a layer of cohesive silica flour that is fragmented by a rapid injection of pressurized air. The evolving fragmentation of the flour is monitored with a high-speed camera, and the images are analysed to obtain the evolution of the number of fragments (N), their average size (A), and the FSD. Using the results from our image-analysis procedure, we find transient empirical laws for N, A and the exponent D of the power-law FSD as functions of the initial air pressure. We show that our experimental procedure is a promising tool for unravelling the complex physics of fragmentation during phreatomagmatic and phreatic eruptions.
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Mass distribution of fission fragments using SSNTDs based image analysis system
International Nuclear Information System (INIS)
Kolekar, R.V.; Sharma, D.N.
2006-01-01
Lexan polycarbonate track detector was used to obtain mass distribution of fission fragments from 252 Cf planchette source, Normally, if the fission fragments are incident perpendicular to the lexan surface, the diameter of heavy fragment is greater than that of lighter fragment. In practical problems fission fragments are incident on the detector at all angles. So, in the present experiment, lexan detector was exposed to 252 Cf planchette source in 2π geometry. Fission fragments were incident on the detector with various angles. So the projected fission track length for fission fragment of same energy is different because of different angle of incidence. Image analysis software was used to measure the projected track length. But the problem is that for fission fragment having greater angle of incidence the entire track length is not focused on the surface. So reduced track length is measured. This problem is solved by taking two images, one at the surface and one at the tip of track and then overlapping both the images using image analysis software. The projected track length and the depth of the track were used to get the angle of incidence. Fission track lengths were measured for same angle of incidence. In all 500 track lengths were measured and plot for mass distribution for fission fragment was obtained.(author)
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
International Nuclear Information System (INIS)
Kalay, Z; Ben-Naim, E
2015-01-01
We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)
DEFF Research Database (Denmark)
Kruse Aagaard, Anders
2015-01-01
This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....
Energy Technology Data Exchange (ETDEWEB)
Lazebnik, Mariya [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States); Popovic, Dijana [Department of Electrical and Computer Engineering, University of Calgary, Calgary, AB (Canada); McCartney, Leah [Department of Electrical and Computer Engineering, University of Calgary, Calgary, AB (Canada); Watkins, Cynthia B [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States); Lindstrom, Mary J [Department of Biostatistics and Medical Informatics, University of Wisconsin, Madison, WI (United States); Harter, Josephine [Department of Pathology, University of Wisconsin, Madison, WI (United States); Sewall, Sarah [Department of Pathology, University of Wisconsin, Madison, WI (United States); Ogilvie, Travis [Department of Pathology, University of Calgary, Calgary, AB (Canada); Magliocco, Anthony [Department of Pathology, University of Calgary, Calgary, AB (Canada); Breslin, Tara M [Department of Surgery, University of Wisconsin, Madison, WI (United States); Temple, Walley [Department of Surgery and Oncology, University of Calgary, Calgary, AB (Canada); Mew, Daphne [Department of Surgery and Oncology, University of Calgary, Calgary, AB (Canada); Booske, John H [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States); Okoniewski, Michal [Department of Electrical and Computer Engineering, University of Calgary, Calgary, AB (Canada); Hagness, Susan C [Department of Electrical and Computer Engineering, University of Wisconsin, Madison, WI (United States)
2007-10-21
The development of microwave breast cancer detection and treatment techniques has been driven by reports of substantial contrast in the dielectric properties of malignant and normal breast tissues. However, definitive knowledge of the dielectric properties of normal and diseased breast tissues at microwave frequencies has been limited by gaps and discrepancies across previously published studies. To address these issues, we conducted a large-scale study to experimentally determine the ultrawideband microwave dielectric properties of a variety of normal, malignant and benign breast tissues, measured from 0.5 to 20 GHz using a precision open-ended coaxial probe. Previously, we reported the dielectric properties of normal breast tissue samples obtained from reduction surgeries. Here, we report the dielectric properties of normal (adipose, glandular and fibroconnective), malignant (invasive and non-invasive ductal and lobular carcinomas) and benign (fibroadenomas and cysts) breast tissue samples obtained from cancer surgeries. We fit a one-pole Cole-Cole model to the complex permittivity data set of each characterized sample. Our analyses show that the contrast in the microwave-frequency dielectric properties between malignant and normal adipose-dominated tissues in the breast is considerable, as large as 10:1, while the contrast in the microwave-frequency dielectric properties between malignant and normal glandular/fibroconnective tissues in the breast is no more than about 10%.
Lazebnik, Mariya; Popovic, Dijana; McCartney, Leah; Watkins, Cynthia B.; Lindstrom, Mary J.; Harter, Josephine; Sewall, Sarah; Ogilvie, Travis; Magliocco, Anthony; Breslin, Tara M.; Temple, Walley; Mew, Daphne; Booske, John H.; Okoniewski, Michal; Hagness, Susan C.
2007-10-01
The development of microwave breast cancer detection and treatment techniques has been driven by reports of substantial contrast in the dielectric properties of malignant and normal breast tissues. However, definitive knowledge of the dielectric properties of normal and diseased breast tissues at microwave frequencies has been limited by gaps and discrepancies across previously published studies. To address these issues, we conducted a large-scale study to experimentally determine the ultrawideband microwave dielectric properties of a variety of normal, malignant and benign breast tissues, measured from 0.5 to 20 GHz using a precision open-ended coaxial probe. Previously, we reported the dielectric properties of normal breast tissue samples obtained from reduction surgeries. Here, we report the dielectric properties of normal (adipose, glandular and fibroconnective), malignant (invasive and non-invasive ductal and lobular carcinomas) and benign (fibroadenomas and cysts) breast tissue samples obtained from cancer surgeries. We fit a one-pole Cole-Cole model to the complex permittivity data set of each characterized sample. Our analyses show that the contrast in the microwave-frequency dielectric properties between malignant and normal adipose-dominated tissues in the breast is considerable, as large as 10:1, while the contrast in the microwave-frequency dielectric properties between malignant and normal glandular/fibroconnective tissues in the breast is no more than about 10%.
International Nuclear Information System (INIS)
Lazebnik, Mariya; Popovic, Dijana; McCartney, Leah; Watkins, Cynthia B; Lindstrom, Mary J; Harter, Josephine; Sewall, Sarah; Ogilvie, Travis; Magliocco, Anthony; Breslin, Tara M; Temple, Walley; Mew, Daphne; Booske, John H; Okoniewski, Michal; Hagness, Susan C
2007-01-01
The development of microwave breast cancer detection and treatment techniques has been driven by reports of substantial contrast in the dielectric properties of malignant and normal breast tissues. However, definitive knowledge of the dielectric properties of normal and diseased breast tissues at microwave frequencies has been limited by gaps and discrepancies across previously published studies. To address these issues, we conducted a large-scale study to experimentally determine the ultrawideband microwave dielectric properties of a variety of normal, malignant and benign breast tissues, measured from 0.5 to 20 GHz using a precision open-ended coaxial probe. Previously, we reported the dielectric properties of normal breast tissue samples obtained from reduction surgeries. Here, we report the dielectric properties of normal (adipose, glandular and fibroconnective), malignant (invasive and non-invasive ductal and lobular carcinomas) and benign (fibroadenomas and cysts) breast tissue samples obtained from cancer surgeries. We fit a one-pole Cole-Cole model to the complex permittivity data set of each characterized sample. Our analyses show that the contrast in the microwave-frequency dielectric properties between malignant and normal adipose-dominated tissues in the breast is considerable, as large as 10:1, while the contrast in the microwave-frequency dielectric properties between malignant and normal glandular/fibroconnective tissues in the breast is no more than about 10%
Directory of Open Access Journals (Sweden)
Louise Thorlacius-Ussing
Full Text Available A barrier in a pig-to-man xenotransplantation is that the Galα1-3Galβ1-4GlcNAc-R carbohydrate (α-Gal epitope expressed on pig endothelial cells reacts with naturally occurring antibodies in the recipient's blood leading to rejection. Deletion of the α1,3-galactosyltransferase gene prevents the synthesis of the α-Gal epitope. Therefore, knockout models of the α1,3-galactosyltransferase gene are widely used to study xenotransplantation. We have performed proteomic studies on liver and pancreas tissues from wild type and α1,3-galactosyltransferase gene knockout mice. The tissues were analyzed by two-dimensional polyacrylamide gel electrophoresis and liquid chromatography-tandem mass spectrometry. The analyses revealed that a wide variety of proteins and protein fragments are differentially expressed suggesting that knockout of the α1,3-galactosyltransferase gene affects the expression of several other genes.
Robinson, Paulette M; Smith, Tyler S; Patel, Dilan; Dave, Meera; Lewin, Alfred S; Pi, Liya; Scott, Edward W; Tuli, Sonal S; Schultz, Gregory S
2012-12-13
Connective tissue growth factor (CTGF) is a fibrogenic cytokine that is up-regulated by TGF-β and mediates most key fibrotic actions of TGF-β, including stimulation of synthesis of extracellular matrix and differentiation of fibroblasts into myofibroblasts. This study addresses the role of proteolytic processing of CTGF in human corneal fibroblasts (HCF) stimulated with TGF-β, normal ocular tissues and wounded corneas. Proteolytic processing of CTGF in HCF cultures, normal animal eyes, and excimer laser wounded rat corneas were examined by Western blot. The identity of a 21-kDa band was determined by tandem mass spectrometry, and possible alternative splice variants of CTGF were assessed by 5' Rapid Amplification of cDNA Ends (RACE). HCF stimulated by TGF-β contained full length 38-kDa CTGF and fragments of 25, 21, 18, and 13 kDa, while conditioned medium contained full length 38- and a 21-kDa fragment of CTGF that contained the middle "hinge" region of CTGF. Fragmentation of recombinant CTGF incubated in HCF extracts was blocked by the aspartate protease inhibitor, pepstatin. Normal mouse, rat, and rabbit whole eyes and rabbit ocular tissues contained abundant amounts of C-terminal 25- and 21-kDa fragments and trace amounts of 38-kDa CTGF, although no alternative transcripts were detected. All forms of CTGF (38, 25, and 21 kDa) were detected during healing of excimer ablated rat corneas, peaking on day 11. Proteolytic processing of 38-kDa CTGF occurs during corneal wound healing, which may have important implications in regulation of corneal scar formation.
DEFF Research Database (Denmark)
Sjöberg, B.; Pap, S.; Kjems, Jørgen
1985-01-01
A half-molecular fragment of α2-macroglobulin has been prepared by reducing and alkylating the inter-subunit disulfide bonds in the tetrameric α2-macroglobulin molecule with 1 mM dithiothreitol (40 min) and 3 mM iodoacetamide (40 min). Further purification was made by gel chromatography...
The role of fragmentation mechanism in large-scale vapor explosions
International Nuclear Information System (INIS)
Liu, Jie
2003-01-01
A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)
The multi-step prompt particle emission from fission fragments
International Nuclear Information System (INIS)
Zhivopistsev, A.; Oprea, C.; Oprea, I.
2003-01-01
The purpose of this work is the study of non-equilibrium high-energy gamma emission from 252 Cf. In the framework of the formalism of statistical multi-step compound processes in nuclear reactions. A relation was found between the shape of the high-energy part of the gamma spectrum and different mechanisms of excitation of the fission fragments. Agreement with experimental data for different groups of fission fragments was obtained. The analysis of the experimental high-energy part of gamma spectra yields information about the mechanism of excitation of fission fragments. The influence of dissipation of the deformation excess on intrinsic excitation of fission fragments was studied. (authors)
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
ToF-SIMS Parallel Imaging MS/MS of Lipid Species in Thin Tissue Sections.
Bruinen, Anne Lisa; Fisher, Gregory L; Heeren, Ron M A
2017-01-01
Unambiguous identification of detected species is essential in complex biomedical samples. To date, there are not many mass spectrometry imaging techniques that can provide both high spatial resolution and identification capabilities. A new and patented imaging tandem mass spectrometer, exploiting the unique characteristics of the nanoTOF II (Physical Electronics, USA) TOF-SIMS TRIFT instrument, was developed to address this.Tandem mass spectrometry is based on the selection of precursor ions from the full secondary ion spectrum (MS 1 ), followed by energetic activation and fragmentation, and collection of the fragment ions to obtain a tandem MS spectrum (MS 2 ). The PHI NanoTOF II mass spectrometer is equipped with a high-energy collision induced dissociation (CID) fragmentation cell as well as a second time-of-flight analyzer developed for simultaneous ToF-SIMS and tandem MS imaging experiments.We describe here the results of a ToF-SIMS imaging experiment on a thin tissue section of an infected zebrafish as a model organism for tuberculosis. The focus is on the obtained ion distribution plot of a fatty acid as well as its identification by tandem mass spectrometry.
International Nuclear Information System (INIS)
Liu, Jie; Koshizuka, Seiichi; Oka, Yoshiaki
2002-01-01
A computer code PROVER-I is developed for propagation phase of vapor explosion. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The energetics of ex-vessel vapor explosion is investigated based on different fragmentation models. A higher pressure peak and a larger mechanical energy conversion ratio are obtained by spontaneous nucleation fragmentation. A smaller energy conversion ratio results from normal boiling fragmentation. When the delay time in thermal fragmentation model is near 0.0 ms, the pressure propagation behavior tends to be analogous with that in hydrodynamic fragmentation. If the delay time is longer, pressure attenuation occurs at the shock front. The high energy conversion ratio (>4%) is obtained in a small vapor volume fraction together with spontaneous nucleation fragmentation. These results are consistent with fuel-coolant interaction experiments with alumina melt. However, in larger vapor volume fraction conditions (α υ >0.3), the vapor explosion is weak. For corium melt, a coarse mixture with void fraction of more than 30% can be generated in the pre-mixing process because of its physical properties. In the mixture with such a high void fraction the energetic vapor explosion hardly takes place. (author)
Novel approach of fragment-based lead discovery applied to renin inhibitors.
Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki
2016-11-15
A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Malekfar, Azin; Valli, Kusum S; Kanafi, Mohammad Mahboob; Bhonde, Ramesh R
2016-01-01
Human dental pulp stem cells (DPSCs) are becoming an attractive target for therapeutic purposes because of their neural crest origin and propensity. Although DPSCs can be successfully cryopreserved, there are hardly any reports on cryopreservation of dental pulp tissues obtained from teeth diagnosed with symptomatic irreversible pulpitis during endodontic treatment and isolation and characterization of DPSCs from such cryopreserved pulp. The aim of this study was to cryopreserve the said pulp tissues to propagate and characterize isolated DPSCs. A medium consisting of 90% fetal bovine serum and 10% dimethyl sulfoxide was used for cryopreservation of pulp tissues. DPSCs were isolated from fresh and cryopreserved pulp tissues using an enzymatic method. Cell viability and proliferation were determined using the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. DPSC migration and interaction were analyzed with the wound healing assay. Mesenchymal characteristics of DPSCs were verified by flow cytometric analysis of cell surface CD markers. The osteogenic and adipogenic potential of DPSCs was shown by von Kossa and oil red O staining methods, respectively, and the polymerase chain reaction method. We found no significant difference in CD marker expression and osteogenic and adipogenic differentiation potential of DPSCs obtained from fresh and cryopreserved dental pulp tissue. Our study shows that dental pulp can be successfully cryopreserved without losing normal characteristics and differentiation potential of their DPSCs, thus making them suitable for dental banking and future therapeutic purposes. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kay, H. E.M. [Royal Marsden Hospital, Institute of Cancer Research, London (United Kingdom)
1969-07-15
Grafts of lymphoid tissue or of lymphoid stem cells may be appropriate in the treatment of some congenital immune deficiency disorders. The reasons for preferring tissues of foetal origin are discussed and the evidence for foetal immunocompetence is briefly summarized. Methods of storing foetal liver cells and cells or fragments of thymus are mentioned, and the organization of the Foetal Tissue Bank of the Royal Marsden Hospital is described. Clinical data from transplantation of lymphoid cells in various immune deficiency disorders are briefly presented. (author)
Study of Photoionization and Fragmentation on CHClF2 : Experiments and Calculations
International Nuclear Information System (INIS)
Sheng, L.; Yang, B.; Huang, C.; Qi, F.; Zhang, Y.; Wang, Z.; Zhou, S.
2004-01-01
Full text: The photoionization and fragmentation of CHClF 2 are studied with VUV radiation and photoionization mass spectroscopy at NSRL. Ionization potential of Parent molecule CHClF 2 , appearance energies of some fragment ions, and dissociative energy of some fragmentation process are obtained from photoionization efficiency spectroscopy. Dissociative photoionization channels for formation of some fragment ions are proposed on comparison of determined appearance energies and energies predicted with Gaussian-98 calculation
Mass distribution of fission fragments within the Born-Oppenheimer approximation
Energy Technology Data Exchange (ETDEWEB)
Pomorski, K.; Nerlo-Pomorska, B. [M.C.S. University, Department of Theoretical Physics, Lublin (Poland); Ivanyuk, F.A. [Institute for Nuclear Research, Kiev (Ukraine)
2017-03-15
The fission fragments mass-yield of {sup 236} U is obtained by an approximate solution of the eigenvalue problem of the collective Hamiltonian that describes the dynamics of the fission process whose degrees of freedom are: the fission (elongation), the neck and mass-asymmetry modes. The macroscopic-microscopic method is used to evaluate the potential energy surface. The macroscopic energy part is calculated using the liquid drop model and the microscopic corrections are obtained using a Woods-Saxon single-particle levels. The four-dimensional modified Cassini ovals shape parametrization is used to describe the shape of the fissioning nucleus. The mass tensor is taken within a cranking-type approximation. The final fragment mass distribution is obtained by weighting the adiabatic density distribution in the collective space with the neck-dependent fission probability. The neck degree of freedom is found to play a significant role in determining the final fragment mass distribution. (orig.)
Directory of Open Access Journals (Sweden)
Susan M. Burden-Gulley
2010-04-01
Full Text Available We recently found that normal human brain and low-grade astrocytomas express the receptor protein tyrosine phosphatase mu (PTPμ and that the more invasive astrocytomas, glioblastoma multiforme (GBM, downregulate full-length PTPμ expression. Loss of PTPμ expression in GBMs is due to proteolytic cleavage that generates an intracellular and potentially a cleaved and released extracellular fragment of PTPμ. Here, we identify that a cleaved extracellular fragment containing the domains required for PTPμ-mediated adhesion remains associated with GBM tumor tissue. We hypothesized that detection of this fragment would make an excellent diagnostic tool for the localization of tumor tissue within the brain. To this end, we generated a series of fluorescently tagged peptide probes that bind the PTPμ fragment. The peptide probes specifically recognize GBM cells in tissue sections of surgically resected human tumors. To test whether the peptide probes are able to detect GBM tumors in vivo, the PTPμ peptide probes were tested in both mouse flank and intracranial xenograft human glioblastoma tumor model systems. The glial tumors were molecularly labeled with the PTPμ peptide probes within minutes of tail vein injection using the Maestro FLEX In Vivo Imaging System. The label was stable for at least 3 hours. Together, these results indicate that peptide recognition of the PTPμ extracellular fragment provides a novel molecular diagnostic tool for detection of human glioblastomas. Such a tool has clear translational applications and may lead to improved surgical resections and prognosis for patients with this devastating disease.
GROWTH AND ROOTING SYSTEM OF ACACIA MANGIUM OBTAINED BY TISSUE CULTURE
Directory of Open Access Journals (Sweden)
SUPRIYANTO
1991-01-01
Full Text Available Since 1980/1981, the government of Indonesia through the Ministry of Forestry has started to reforest logged-over, alang-alang, unproductive areas and to convert them to Forest Industry Plantation. The target is 300 000 ha per year. It means, 750 million seedlings should be provided per year (planting distance 2 m x 2 m. The tree species to be planted in forest industry plantation should have shorter life cycle (8 - 10 years, good stem-form, good rooting system, and should be fast growing. Acacia mangium has been selected as one of the important tree species for forest industry plantation due to its growth, quality of fiber wood (pulp and paper industry and rooting system (produce a lot of secondary root and nitrogen fixater (Soebardjo 1986. The reforestation of logged-over Dipterocarp forests in Malaysia with A. mangium has also been considered (Appanah and Weinland 1989. Generally, reforestation with A. mangium is done with seedlings obtained by seed germination. A. mangium produce a lot of seeds but its production is still limited by the season, while the conventional method of vegetative propagation through cuttings gave very low percentage of rooted-cuttings (1% (Umboh and Syamsul Yani 1989. The micropropagation of A. mangium through tissue culture is a promising method. The production of A. mangium plantlets through that method has been done at the Forest Genetic Laboratory, Tropical Forest Biology, SEAMEO BIOTROP (Situmorang 1988, Umboh 1988, Umboh et al. 1989, 1990. These rooted-plantlets (plantlings were first put in the green house (acclimatization before planting in the field. Field tests of some agricultural plants have been done but information on forest trees species is still lacking because the production of plantlings through tissue culture is still limited as there are still problems of their rooting. In fact, the progress of reproducing woody plants by tissue culture has been much slower than with herbaceous plants. The major
Advancement of magma fragmentation by inhomogeneous bubble distribution.
Kameda, M; Ichihara, M; Maruyama, S; Kurokawa, N; Aoki, Y; Okumura, S; Uesugi, K
2017-12-01
Decompression times reported in previous studies suggest that thoroughly brittle fragmentation is unlikely in actual explosive volcanic eruptions. What occurs in practice is brittle-like fragmentation, which is defined as the solid-like fracture of a material whose bulk rheological properties are close to those of a fluid. Through laboratory experiments and numerical simulation, the link between the inhomogeneous structure of bubbles and the development of cracks that may lead to brittle-like fragmentation was clearly demonstrated here. A rapid decompression test was conducted to simulate the fragmentation of a specimen whose pore morphology was revealed by X-ray microtomography. The dynamic response during decompression was observed by high-speed photography. Large variation was observed in the responses of the specimens even among specimens with equal bulk rheological properties. The stress fields of the specimens under decompression computed by finite element analysis shows that the presence of satellite bubbles beneath a large bubble induced the stress concentration. On the basis of the obtained results, a new mechanism for brittle-like fragmentation is proposed. In the proposed scenario, the second nucleation of bubbles near the fragmentation surface is an essential process for the advancement of fragmentation in an upward magma flow in a volcanic conduit.
Hyaluronan - a functional and structural sweet spot in the tissue microenvironment
Directory of Open Access Journals (Sweden)
James eMonslow
2015-05-01
Full Text Available Transition from homeostatic to reactive matrix remodeling is a fundamental adaptive tissue response to injury, inflammatory disease, fibrosis and cancer. Alterations in architecture, physical properties and matrix composition result in changes in biomechanical and biochemical cellular signaling. The dynamics of pericellular and extracellular matrices, including matrix protein, proteoglycan and glycosaminoglycan modification are continually emerging as essential regulatory mechanisms underlying cellular and tissue function. Nevertheless, the impact of matrix organization on inflammation and immunity in particular, and the consequent effects on tissue healing and disease outcome are arguably under-studied aspects of adaptive stress responses. Herein, we review how the predominant glycosaminoglycan hyaluronan (HA contributes to the structure and function of the tissue microenvironment. Specifically, we examine the evidence of HA degradation and the generation of biologically-active smaller HA fragments in pathological settings in vivo. We discuss how HA fragments versus nascent HA via alternate receptor-mediated signaling influence inflammatory cell recruitment and differentiation, resident cell activation, as well as tumor growth, survival and metastasis. Finally, we discuss how HA fragmentation impacts restoration of normal tissue function and pathological outcomes in disease.
Barrett, Elizabeth J; Rodgerson, Dwayne H
2014-08-01
To describe an ultrasound assisted arthroscopic approach for removal of non-articular basilar sesamoid fragments in Thoroughbred yearlings. Thoroughbred yearlings (n = 7). Basilar sesamoid fragments identified during pre-sale radiographic examination were removed using a palmar/plantar arthroscopic approach to the fetlock joint and ultrasonographic guidance. Complete fragment removal was confirmed by ultrasonography and radiography. Basilar sesamoid fracture fragments were localized and removed successfully using rongeurs and a radiofrequency probe for soft tissue dissection of the fragment. Complete fragment removal was confirmed by ultrasonography and radiography. No intra- or postoperative complications occurred. At 6-8 months follow-up, no fragments or bony proliferation at the base of the sesamoid was observed. Ultrasonographic guidance can be used to facilitate localization, dissection, and confirmation of removal of basilar fragments of the proximal sesamoid bone. © Copyright 2014 by The American College of Veterinary Surgeons.
Improved description of the fragmentation of nuclear collective states
International Nuclear Information System (INIS)
Soloviev, V.G.
1984-01-01
A mathematical method is deveioped for a more accurate description of the fragmentation of one-phonon states forming giant resonances. The method consists in that the one-phonon states already fragmented are used in the two-phonon terms of wave functions. Strength functions are obtained for the exci excitation of collective charge-exchange states ano giant resonances in spherical nuclei
Quark Fragmentation to Pions in an Effective Chiral Theory
Directory of Open Access Journals (Sweden)
Yazaki K.
2010-04-01
Full Text Available A description of fragmentation functions which satisfy the momentum and isospin sum rules is presented in an effective chiral quark theory of QCD. We concentrate on the pion fragmentation function, taking into account cascade-like processes in a generalized jet-model approach. Numerical results obtained in this NJL-jet model are presented and compared to empirical parametrizations.
Gastric Perforation by Ingested Rabbit Bone Fragment
Directory of Open Access Journals (Sweden)
Giulio Gambaracci
2016-04-01
Full Text Available The majority of accidentally ingested foreign bodies is excreted from the gastrointestinal (GI tract without any complications. Sometimes sharp foreign bodies – like chicken and fish bones – can lead to intestinal perforation and may present insidiously with a wide range of symptoms and, consequently, different diagnoses. We report the case of a 59-year-old woman presenting with fever and a 1-month history of vague abdominal pain. Computed tomography (CT showed the presence of a hyperdense linear image close to the gastric antrum surrounded by a fluid collection and free peritoneal air. At laparotomy, a 4-cm rabbit bone fragment covered in inflamed tissue was detected next to a gastric wall perforation. Rabbit bone fragment ingestion, even if rarely reported, should not be underestimated as a possible cause of GI tract perforation.
Fragmentation of single-particle states and neutron strength functions
International Nuclear Information System (INIS)
Soloviev, V.G.
1975-01-01
Fragmentation of one-particle states in odd deformed nuclei is studied in the framework of a model based on the interaction between quasiparticles and phonons. A principally new semi-microscopic method for calculation of force functions using the data on fragmentation of one-particle states is suggested. Calculated s- and p-wave neutron force functions in 239 U and 169 Er are in good agreement with experiment. The correct description of the s-wave neutron force function in the vicinity of is obtained in particular for Sn isotopes/ of its minimum is obtained in particular for Sn isotopes
Determination of diquark fragmentation functions in pp collisions
Beavis, D
1981-01-01
The recent data of the Aachen-CERN-Harvard-Munich-Northwestern- Riverside collaboration on pp collisions involving a high-p/sub T/ pion trigger at 30 degrees with forward production of pion and proton in the same hemisphere is analyzed in terms of fragmentation functions of the forward diquark and a quantum-chromodynamic model for the ejected parton. The pion diquark fragmentation functions obtained from leptoproduction give excellent fits to the data and confirm the conclusions of ACHMNR that the diquark within a proton act as a single entity. This single-entity hypothesis can also explain proton fragmentation. The gluon contribution (triquark fragmentation) is significant in the proton distribution and accounts for the difference in pi /sup +/ and pi /sup -/ distributions. Its importance in backward-hemisphere production of hadrons with the same pion trigger is emphasized and the cross sections are predicted. (8 refs).
Critical Features of Fragment Libraries for Protein Structure Prediction.
Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel
2017-01-01
The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.
The identification method of the nuclear fragments in emulsions
International Nuclear Information System (INIS)
Jipa, Alexandru; Ocheseanu, Silvia; Caramarcu, Costin; Calin, Marius; Constantin, Florin; Stan, Emil
2003-01-01
The visualization detectors have been successfully used from the beginning of the study of the relativistic nuclear collisions. One of these detectors used in such experiments is the nuclear emulsion. To increase the speed of the passage from pictures to experimental data different methods and tools have been proposed during the time. For identifying the nuclear fragments obtained in the relativistic radioactive beams multiple layers of nuclear emulsions have been exposed in experiments performed at the Synchrophasotron from the JINR Dubna (BECQUEREL Collaboration). The nuclear fragments have been identified using PAVICOM scanning and measuring system. In the present work an identification method based on a real time image processing machine and a reconstruction algorithm based on special conformal transforms is proposed. The results obtained by this method are compared with those obtained using PAVICOM device. Because in this study only pictures have been used, not initial nuclear emulsions, some difficulties in the identification of the nuclear fragments with higher polar angles can appear. Generally, comparable results have been obtained. The authors thank Dr. Pavel Zarubin from JINR Dubna, Laboratory of High Energy Physics, and Dr. Maria Haiduc, Institute of Space Sciences Bucharest-Magurele, for the pictures of the nuclear emulsions exposed in these experiments. (authors)
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
The VERDI fission fragment spectrometer
Directory of Open Access Journals (Sweden)
Frégeau M.O.
2013-12-01
Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.
On the effect of grain burnback on STS-SRM fragment velocity
International Nuclear Information System (INIS)
Eck, M.B.; Mukunda, M.
1991-01-01
Concerns raised during the Ulysses Final Safety Analysis Review (FSAR) process called the solid rocket motor (SRM) fragment velocity prediction model into question. The specific area of concern was that there was a section of the SRM casing which was exposed to SRM chamber pressure as the grain (fuel) was consumed. These questions centered on the velocity of fragments which originated from the field joint region given that failure occurred between 37 and 72 seconds mission elapsed time (MET). Two dimensional coupled Eulerian-Lagrangian calculations were performed to assess the hot gas flow field which resulted from SRM casing fragmentation. The fragment to gas interface-pressure time-history obtained from these analyses was reduced to a boundary condition algorithm which was applied to an explicit-time-integration, finite element, three dimensional shell model of the SRM casing and unburned fuel. The results of these calculations showed that the velocity of fragments originating in the field joint was adequately described by the range of velocities given in the Shuttle Data Book (1988). Based on these results, no further analyses were required, and approval was obtained from the Launch Abort Subpanel of the Interagency Nuclear Safety Review Panel to use the SRM fragment velocity environments presented in the Ulysses FSAR (1990)
Xu, Chen; Liu, Yalan; Ge, Xiaowen; Jiang, Dongxian; Zhang, Ying; Ji, Yuan; Hou, Jun; Huang, Jie; Su, Jieakesu; Zeng, Haiying; Qin, Jing; Hou, Yingyong
2017-05-26
HER2 assessment in biopsy specimens of gastric cancer (GC) is challenging because of the intratumoral heterogeneity. False negative results may be get because of limited biopsy material. The aim of this study is to explore how tumor-containing fragment number and biopsy specimen number affect HER2 immunohistochemistry (IHC) positive rate. Eight hundred and ninety biopsy specimens and 459 paired resected specimens were collected. IHC staining of HER2 was performed. HER2 IHC positive (scored 3+) rate was compared based on tumor-containing fragment number, biopsy specimen number, average size and tumor tissue proportion of tumor-containing fragments. The positive predictability of biopsy specimens to resected specimens was analyzed based on tumor fragment number. HER2 IHC positive rates were 2.0, 3.5, 7.0, 13.2, 17.1, and 15.9% when tumor fragment numbers were 1, 2, 3, 4, 5 and 6 respectively. The rate rose with the increase of tumor fragment number (P = 0.004). ROC curve analysis showed that biopsy specimens exhibited positive predictability when tumor fragment number reached 3, but showed better performance when the number was ≥4 (P fragment number reached 4, no statistic differences were reached in either HER2 IHC positive rate or positive predictability with further increase of the number (P > 0.05). HER2 IHC positive rate was not associated with biopsy number (P = 0.127), average size of tumor fragments (P = 0.397), and tumor tissue proportion of tumor fragments (P = 0.825) directly. The number of tumor-containing fragments influences HER2 IHC positive (scored 3+) rate. Greater than or equal to 4 (≥4) tumor fragments give better results in the positive rate as well as positive predictability. We recommend the number of tumor containing fragments be described in the HER2 IHC pathology reports for clinical reference in endoscopic biopsy specimens of GC.
Prakash, Celine; Haeseler, Arndt Von
2017-03-01
RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.
Experimental study of fission process by fragment-neutron correlation measurement
Energy Technology Data Exchange (ETDEWEB)
Nishio, Katsuhisa; Yamamoto, Hideki; Kanno, Ikuo; Kimura, Itsuro; Nakagome, Yoshihiro [Kyoto Univ. (Japan). Faculty of Engineering
1997-07-01
Fragment-neutron correlation measurement of {sup 235}U(n{sub th}, f) was carried out. The obtained results showed more statistical accuracy than that of reported thermal neutron reaction. Experimental results and it`s analysis made clear the following facts. The minimum values of <{eta}> (m*) are shown at about 90 and 145 {mu} and <{eta}> (m*) showed the symmetrical form with an axis of symmetrical fission. This tendency is same as the distribution of {sup 252}Cf(s.f). -dV/dTKE(m*) indicates the saw-teethed distribution as same as <{nu}>(m*). The distribution seems depend on stiffness of fission fragment affected by the shell effect. The level density parameter a(m*) of fission fragment obtained from {sup 235}U(n{sub th}, f) expresses the saw-teethed distribution as same as that of {sup 252}Cf(s.f). This distribution can be explained by the empirical equation under consideration of the fission fragment depending on the shell effect and the collective motion. (S.Y.)
Plautz, G. L.; Graff, I. L.; Schreiner, W. H.; Bezerra, A. G.
2017-05-01
We investigate the physical properties of Si-based nanoparticles produced by an environment-friendly three-step method relying on: (1) laser ablation of a solid target immersed in water, (2) centrifugation and separation, and (3) laser-assisted fragmentation. The evolution of size distribution is followed after each step by means of dynamic light scattering (DLS) measurements and crosschecked by transmission electron microscopy (TEM). The as-ablated colloidal suspension of Si nanoparticles presents a large size distribution, ranging from a few to hundreds of nanometers. Centrifugation drives the very large particles to the bottom eliminating them from the remaining suspension. Subsequent irradiation of height-separated suspensions with a second high-fluence (40 mJ/pulse) Nd:YAG laser operating at the fourth harmonic (λ =266 nm) leads to size reduction and ultra-small nanoparticles are obtainable depending on the starting size. Si nanoparticles as small as 1.5 nm with low dispersion (± 0.7 nm) are observed for the uppermost part after irradiation. These nanoparticles present a strong blue photoluminescence that remains stable for at least 8 weeks. Optical absorption (UV-Vis) measurements demonstrate an optical gap widening as a consequence of size decrease. Raman spectra present features related to pure silicon and silicon oxides for the irradiated sample. Interestingly, a defect band associated with silicon oxide is also identified, indicating the possible formation of defect states, which, in turn, supports the idea that the blue photoluminescence has its origin in defects.
Fragment-based approaches to the discovery of kinase inhibitors.
Mortenson, Paul N; Berdini, Valerio; O'Reilly, Marc
2014-01-01
Protein kinases are one of the most important families of drug targets, and aberrant kinase activity has been linked to a large number of disease areas. Although eminently targetable using small molecules, kinases present a number of challenges as drug targets, not least obtaining selectivity across such a large and relatively closely related target family. Fragment-based drug discovery involves screening simple, low-molecular weight compounds to generate initial hits against a target. These hits are then optimized to more potent compounds via medicinal chemistry, usually facilitated by structural biology. Here, we will present a number of recent examples of fragment-based approaches to the discovery of kinase inhibitors, detailing the construction of fragment-screening libraries, the identification and validation of fragment hits, and their optimization into potent and selective lead compounds. The advantages of fragment-based methodologies will be discussed, along with some of the challenges associated with using this route. Finally, we will present a number of key lessons derived both from our own experience running fragment screens against kinases and from a large number of published studies.
The matrikine N-α-PGP couples extracellular matrix fragmentation to endothelial permeability
Hahn, Cornelia S; Scott, David W; Xu, Xin; Roda, Mojtaba Abdul; Payne, Gregory A; Wells, J Michael; Viera, Liliana; Winstead, Colleen J; Bratcher, Preston; Sparidans, Rolf W; Redegeld, Frank A; Jackson, Patricia L; Folkerts, Gert; Blalock, J Edwin; Patel, Rakesh P; Gaggar, Amit
2015-01-01
The compartmentalization and transport of proteins and solutes across the endothelium is a critical biologic function altered during inflammation and disease, leading to pathology in multiple disorders. The impact of tissue damage and subsequent extracellular matrix (ECM) fragmentation in regulating
Kertesz, Vilmos; Van Berkel, Gary J; Vavrek, Marissa; Koeplinger, Kenneth A; Schneider, Bradley B; Covey, Thomas R
2008-07-01
Desorption electrospray ionization tandem mass spectrometry (DESI-MS/MS) and whole-body autoradiography (WBA) were used for chemical imaging of whole-body thin tissue sections of mice intravenously dosed with propranolol (7.5 mg/kg). DESI-MS/MS imaging utilized selected reaction monitoring detection performed on an AB/MDS SCIEX 4000 QTRAP mass spectrometer equipped with a prototype extended length particle discriminator interface. Propranolol images of the tissue sections using DESI-MS/MS were obtained at surface scan rates of 0.1, 0.5, 2, and 7 mm/s. Although signal decreased with increasing scan rate, useful whole-body images for propranolol were obtained from the tissues even at 7 mm/s, which required just 79 min of analysis time. Attempts to detect and image the distribution of the known propranolol metabolites were unsuccessful. Regions of the tissue sections showing the most radioactivity from WBA sections were excised and analyzed by high-performance liquid chromatography (HPLC) with radiochemical detection to determine relative levels of propranolol and metabolites present. Comparison of the DESI-MS/MS signal for propranolol and the radioactivity attributed to propranolol from WBA sections indicated nominal agreement between the two techniques for the amount of propranolol in the brain, lung, and liver. Data from the kidney showed an unexplained disparity between the two techniques. The results of this study show the feasibility of using DESI-MS/MS to obtain useful chemical images of a drug in whole-body thin tissue sections following drug administration at a pharmacologically relevant level. Further optimization to improve sensitivity and enable detection of the drug metabolites will be among the requirements necessary to move DESI-MS/MS chemical imaging forward as a practical tool in drug discovery.
DEFF Research Database (Denmark)
Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted
2011-01-01
Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...
Directory of Open Access Journals (Sweden)
Karin Regnström
Full Text Available Surface Plasmon Resonance (SPR is rarely used as a primary High-throughput Screening (HTS tool in fragment-based approaches. With SPR instruments becoming increasingly high-throughput it is now possible to use SPR as a primary tool for fragment finding. SPR becomes, therefore, a valuable tool in the screening of difficult targets such as the ubiquitin E3 ligase Parkin. As a prerequisite for the screen, a large number of SPR tests were performed to characterize and validate the active form of Parkin. A set of compounds was designed and used to define optimal SPR assay conditions for this fragment screen. Using these conditions, more than 5000 pre-selected fragments from our in-house library were screened for binding to Parkin. Additionally, all fragments were simultaneously screened for binding to two off target proteins to exclude promiscuous binding compounds. A low hit rate was observed that is in line with hit rates usually obtained by other HTS screening assays. All hits were further tested in dose responses on the target protein by SPR for confirmation before channeling the hits into Nuclear Magnetic Resonance (NMR and other hit-confirmation assays.
Binding-site assessment by virtual fragment screening.
Directory of Open Access Journals (Sweden)
Niu Huang
2010-04-01
Full Text Available The accurate prediction of protein druggability (propensity to bind high-affinity drug-like small molecules would greatly benefit the fields of chemical genomics and drug discovery. We have developed a novel approach to quantitatively assess protein druggability by computationally screening a fragment-like compound library. In analogy to NMR-based fragment screening, we dock approximately 11,000 fragments against a given binding site and compute a computational hit rate based on the fraction of molecules that exceed an empirically chosen score cutoff. We perform a large-scale evaluation of the approach on four datasets, totaling 152 binding sites. We demonstrate that computed hit rates correlate with hit rates measured experimentally in a previously published NMR-based screening method. Secondly, we show that the in silico fragment screening method can be used to distinguish known druggable and non-druggable targets, including both enzymes and protein-protein interaction sites. Finally, we explore the sensitivity of the results to different receptor conformations, including flexible protein-protein interaction sites. Besides its original aim to assess druggability of different protein targets, this method could be used to identifying druggable conformations of flexible binding site for lead discovery, and suggesting strategies for growing or joining initial fragment hits to obtain more potent inhibitors.
International Nuclear Information System (INIS)
Walker, K.Z.; Seymour-Munn, K.; Axiak, S.M.; Raison, R.L.; Basten, A.; Towson, J.E.; Bautovitch, G.J.; Morris, J.
1988-01-01
Monoclonal antibody (MoAb) fragments are known to have advantages over intact immunoglobulins for radioimmunoscintigraphy. It is less clear whether they are as effective in the delivery of radioimmunotherapy. The imaging and dosimetric properties of an intact MoAb, K-1-21, reactive against human kappa light chains (LC) were compared with that of its F(ab') 2 and Fab fragments using a normal rat model system. Two days after injection of 131 I-K-1-21 into rats bearing antigen-sepharose implants, gamma camera images showed specific localization of the MoAb to the target (kappa LC) but not to the control (lambda LC) implant. Better images were obtained with K-1-21 F(ab') 2 than with Fab or intact antibody. Mean kappa implant: blood ratios were 8.6 ± 3.9 for Fab, 7.9 ± 1.8 for F(ab') 2 and 2.0 ± 0.3 for intact K-1-21. The improvement associated with the use of 131 I-K-1-21 fragments was, however, achieved at the expense of lower absolute values of activity at the target site. Thus the absorbed dose delivered to the implant by the intact K-1-21 was double that delivered with F(ab') 2 and six times that delivered with Fab. As intact K-1-21 also delivered a greater radiation dose to normal tissues, F(ab') 2 fragments may have the greatest overall advantages for therapy with radionuclide MoAb conjugates. (author)
I. M Sandeman
2006-01-01
Coral bleaching involves the detachment of zooxanthellae and the simultaneous fragmentation of the gastrodermis. Results obtained with a cell permeant fluorescent probe for calcium ions (Ca2+) indicates that "thermal" bleaching is the result of a temperature related breakdown of the Ca2+ exclusion system. "Solar" bleaching, which takes place at lower temperatures and is driven by light, is the result of a build-up of photo-synthetically produced hydrogen peroxide in the tissues. Gastrodermal ...
On the nuclear fragmentation mechanisms in nuclear collisions at intermediate and high energies
International Nuclear Information System (INIS)
Jipa, Al.; Besliu, C.; Felea, D.; Iliescu, B.; Ristea, O.; Ristea, M.; Calin, C.; Horbuniev, A.; Arsene, I.; Esanu, T.; Ochesanu, S.; Caramarcu, C.; Bordeianu, C.; Rosu, I.; Grossu, V.; Zgura, I.S.; Stan, E.; Mitu, C.; Potlog, M.; Cherciu, M.; Stefan, I.
2004-01-01
The nuclear fragmentation mechanisms can be discussed taking into account different scales. These scales are related to the fragment sizes. Taking into account the possible different fragmentation mechanisms of the nuclei at the same incident energy an analysis of the experimental results obtained in different experiments performed at the JINR Dubna (Russia), KEK Tsukuba (Japan), GSI Darmstadt (Germany) is done. Results on apparent temperatures, angular distributions, fragment momentum spectra, multiplicities of the intermediate mass fragments are used to analyse the competition between two possible nuclear fragmentation mechanisms, namely: a sudden fragmentation by explosive mechanisms, like shock waves, and a slow fragmentation by the 'fission' of the spectator regions, mainly, because of the interactions with the particles or fragments emitted from the participant region at transverse angles on the incident nucleus, in CMS.Some connections with chaos dynamics and fractal structure of the fragmentation patterns are included. (authors)
International Nuclear Information System (INIS)
Soendergaard, Jimmi; Hoeyer, Morten; Wright, Pauliina; Grau, Cai; Muren, Ludvig Paul; Petersen, Joergen B.
2009-01-01
We have implemented an intensity-modulated radiotherapy (IMRT) protocol for simultaneous irradiation of bladder and lymph nodes. In this report, doses to normal tissue from IMRT and our previous conformal sequential boost technique are compared. Material and methods. Sixteen patients with urinary bladder cancer were treated using a six-field dynamic IMRT beam arrangement delivering 60 Gy to the bladder and 48 Gy to the pelvic lymph nodes. Dose-volume histogram (DVH) parameters for relevant normal tissues (bowel, bowel cavity, rectum and femoral heads) for the IMRT plans were compared with corresponding DVHs from our previous conformal sequential boost technique. Calculations of the generalized Equivalent Uniform Dose (gEUD) were performed for the bowel, with a reference volume of 200 cm 3 and a volume effect parameter k = 4, as well as for the rectum, using k = 12. Acute gastrointestinal (GI) and genitourinary (GU) RTOG toxicity was recorded. Results. Statistical significant normal tissue sparing was obtained by IMRT. For the bowel, a significant reduction was obtained at all dose levels between 20 and 50 Gy (p 3 at 50 Gy, while the gEUD was reduced from 58 to 53 Gy (p 3 at 50 Gy. The rectum gEUD was reduced from 55 to 53 Gy (p < 0.05). For the femoral heads, IMRT reduced the maximum dose as well as the volumes above all dose levels. The rate of acute peak Grade 2 GI RTOG complications was 38% after IMRT. Conclusion. IMRT to the urinary bladder and elective lymph nodes result in considerable normal tissue sparing compared to conformal sequential boost technique. This has paved the way for further studies combining IMRT with image-guided radiotherapy (IGRT) in bladder cancer
Rock fragmentation control in opencast blasting
Directory of Open Access Journals (Sweden)
P.K. Singh
2016-04-01
Full Text Available The blasting operation plays a pivotal role in the overall economics of opencast mines. The blasting sub-system affects all the other associated sub-systems, i.e. loading, transport, crushing and milling operations. Fragmentation control through effective blast design and its effect on productivity are the challenging tasks for practicing blasting engineer due to inadequate knowledge of actual explosive energy released in the borehole, varying initiation practice in blast design and its effect on explosive energy release characteristic. This paper describes the result of a systematic study on the impact of blast design parameters on rock fragmentation at three mines in India. The mines use draglines and shovel–dumper combination for removal of overburden. Despite its pivotal role in controlling the overall economics of a mining operation, the expected blasting performance is often judged almost exclusively on the basis of poorly defined parameters such as powder factor and is often qualitative which results in very subjective assessment of blasting performance. Such an approach is very poor substitutes for accurate assessment of explosive and blasting performance. Ninety one blasts were conducted with varying blast designs and charging patterns, and their impacts on the rock fragmentation were documented. A high-speed camera was deployed to record the detonation sequences of the blasts. The efficiency of the loading machines was also correlated with the mean fragment size obtained from the fragmentation analyses.
Cloning, bacterial expression and crystallization of Fv antibody fragments
E´, Jean-Luc; Boulot, Ginette; Chitarra, V´ronique; Riottot, Marie-Madeleine; Souchon, H´le`ne; Houdusse, Anne; Bentley, Graham A.; Narayana Bhat, T.; Spinelli, Silvia; Poljak, Roberto J.
1992-08-01
The variable Fv fragments of antibodies, cloned in recombinant plasmids, can be expressed in bacteria as functional proteins having immunochemical properties which are very similar or identical with those of the corresponding parts of the parent eukaryotic antibodies. They offer new possibilities for the study of antibody-antigen interactions since the crystals of Fv fragments and of their complexes with antigen reported here diffract X-rays to a higher resolution that those obtained with the cognate Fab fragments. The Fv approach should facilitate the structural study of the combining site of antibodies and the further characterization of antigen-antibody interactions by site-directed mutagenesis experiments.
Phenobarbital: disposition into fetal tissue and the influence of protein binding
International Nuclear Information System (INIS)
McCabe, D.P.; Flynn, E.J.
1986-01-01
Antibodies specific for barbiturates were generated in rabbits by administration of a barbiturate-bovine gamma globulin conjugate. Antibodies with a high degree of specificity for barbiturates were obtained after 2-3 months of immunization. Anti-barbiturate antisera were used to passively immunize pregnant animals on day 15 of gestation. The disposition of 3 H-Phenobarbital (PhB) in fetal tissue in these mice were compared to normal rabbit serum(NRS)-treated pregnant mice. Following intravenous injection of 3 H-PhB (25 pmoles), there were significantly higher levels of radioactivity in the serum of the immunized mice when compared to controls. Both the distribution half-life and the elimination half-life were reduced in the immunized animals (17.2 vs 88.3 min. and 123.7 vs 308.8 min., respectively) when compared to the NRS-treated mice. In contrast, levels of total radioactivity were significantly reduced in whole fetal homogenates in animals pretreated with whole antisera, Fab, or F(ab') 2 fragments as compared to control animals. The data indicate that there was a decrease in the ability of 3 H-PhB or its metabolites to diffuse into fetal tissue at various time points and that antisera or antisera fragments were instrumental in preventing this diffusion
Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.
2018-03-01
It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.
Rates of species loss from Amazonian forest fragments
Ferraz, Gonçalo; Russell, Gareth J.; Stouffer, Philip C.; Bierregaard, Richard O.; Pimm, Stuart L.; Lovejoy, Thomas E.
2003-01-01
In the face of worldwide habitat fragmentation, managers need to devise a time frame for action. We ask how fast do understory bird species disappear from experimentally isolated plots in the Biological Dynamics of Forest Fragments Project, central Amazon, Brazil. Our data consist of mist-net records obtained over a period of 13 years in 11 sites of 1, 10, and 100 hectares. The numbers of captures per species per unit time, analyzed under different simplifying assumptions, reveal a set of species-loss curves. From those declining numbers, we derive a scaling rule for the time it takes to lose half the species in a fragment as a function of its area. A 10-fold decrease in the rate of species loss requires a 1,000-fold increase in area. Fragments of 100 hectares lose one half of their species in <15 years, too short a time for implementing conservation measures. PMID:14614134
Double-arm time-of-flight mass-spectrometer of nuclear fragments
International Nuclear Information System (INIS)
Ajvazian, G.M.; Astabatyan, R.A.
1995-01-01
A double-arm time-of-flight spectrometer of nuclear fragments for the investigation of heavy nuclei photofission in the intermediate energy range is described. The calibration results and working characteristics of the spectrometer, obtained using 252 Cf as a source of spontaneous fission, are presented. A mass resolution of σ m ∼2-3 a.m.u. was obtained within the registered fragments mass range of 80-160 a.m.u. The spectrometer was tested in the experiment on the investigation of 238 U nuclei fission by Bremsstahlung photons with Eγ max=1.75 GeV
Obtaining unique large kernel rice using chemical mutagenesis in tissue culture
International Nuclear Information System (INIS)
Alyoshin, N.E.; Avakyan, E.R.; Alyoshin, E.P.
2001-01-01
Full text: Lines with improved characters have been received by chemical mutagenesis in rice tissue culture. The japonica rice (Oryza sativa L.) varieties 'Krasnodarskii 424', 'Dubovskii 129', 'Slavyanetz', 'Liman', 'Lomello', 'VNIIR 2471' were used for mutation induction. Nnitrozo-N-methylurea (MNH) has been used as a mutagen. Two approaches were applied: 1. Development mutants by mutagenic treatment of seeds 2. Development regenerants from somatic tissue culture. In the first case, dry seeds with removed covering glumes have been treated with a solution of NMH (exposure 24 hours, tested concentrations 0.05%; 0.1%; 0.2%). After treatment seeds have been rinsed and planted into the soil in vessels. The effect of mutagen was very much genotype dependant. The highest frequency of mutants were observed in the following concentrations of MNH: for variety VNIIR 2471 - 0.05-0.1%, for variety Slavyanetz - 0.1%; for Lomello - 0.2%; for Linman - 0.05% and 0.2%. The mutant N 95, which has been selected from variety Liman after treatment with 0.2% concentration of mutagen, had the following improved characters: vegetation period 103 days (110 days for the parent variety); plant height 93.2 cm (98.2 cm - parent variety); length of the main panicle 17.2 cm; 1000 grain mass 44.9 g (39.2 g - parent variety). Mutant line N 101 selected from the same variety Liman after treatment with 0.05% concentration of mutagen mutated also in many characters: vegetation period 103 days; plant height 106 cm; 1000 grain mass was 47.0 g. In the second experiment, a somatic callus of the 2nd passage from varieties Kransnodarskii 424, Dubovskii 129, Slavyanetz, Liman were treated with the solution of mutagen NMH (concentration: 0.05%; 0.1%; 0.2% + 0.1% PABA by 40 minutes at Certomat shaking machine (100 rev./min). The treated callus has been cultivated at MS regeneration media (4 mg 2.4 D + 20 mg /l of sucrose) and MS intermediate media (non-hormonal + PABA) to obtain regenerants. Plant
Universal elements of fragmentation
International Nuclear Information System (INIS)
Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.
2010-01-01
A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.
Rühmann, Eggert; Betz, Michael; Fricke, Marie; Heine, Andreas; Schäfer, Martina; Klebe, Gerhard
2015-04-01
Detailed characterization of the thermodynamic signature of weak binding fragments to proteins is essential to support the decision making process which fragments to take further for the hit-to-lead optimization. Isothermal titration calorimetry (ITC) is the method of choice to record thermodynamic data, however, weak binding ligands such as fragments require the development of meaningful and reliable measuring protocols as usually sigmoidal titration curves are hardly possible to record due to limited solubility. Fragments can be titrated either directly under low c-value conditions (no sigmoidal curve) or indirectly by use of a strong binding ligand displacing the pre-incubated weak fragment from the protein. The determination of Gibbs free energy is reliable and rather independent of the applied titration protocol. Even though the displacement method achieves higher accuracy, the obtained enthalpy-entropy profile depends on the properties of the used displacement ligand. The relative enthalpy differences across different displacement experiments reveal a constant signature and can serve as a thermodynamic fingerprint for fragments. Low c-value titrations are only reliable if the final concentration of the fragment in the sample cell exceeds 2-10 fold its K(D) value. Limited solubility often prevents this strategy. The present study suggests an applicable protocol to characterize the thermodynamic signature of protein-fragment binding. It shows however, that such measurements are limited by protein and fragment solubility. Deviating profiles obtained by use of different displacement ligands indicate that changes in the solvation pattern and protein dynamics most likely take influence on the resulting overall binding signature. Copyright © 2014 Elsevier B.V. All rights reserved.
About total kinetic energy distribution between fragments of binary fission
International Nuclear Information System (INIS)
Khugaev, A.V.; Koblik, Yu.N.; Pikul, V.P.; Ioannou, P.; Dimovasili, E.
2002-01-01
At the investigation of binary fission reactions one of the main characteristic of process is total kinetic energy (TKE) of fission fragments and it distribution between them. From the values of these characteristics it is possible to extract the information about structure of fission fragments in the break up point of initial fissionable nuclear system. In our work TKE dependence from the deformation parameters of shape and density distribution of charge in the fission fragments are investigated. In the end of paper some generalizations of obtaining results are carried out and presented in the form of tables and figures
Tsallis Entropy and the Transition to Scaling in Fragmentation
Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.
2000-12-01
By using the maximum entropy principle with Tsallis entropy we obtain a fragment size distribution function which undergoes a transition to scaling. This distribution function reduces to those obtained by other authors using Shannon entropy. The treatment is easily generalisable to any process of fractioning with suitable constraints.
Fragmentation of high-energy ionic hydrogen clusters by single collision with helium
International Nuclear Information System (INIS)
Ouaskit, S.; Farizon, B.; Farizon, M.; Gaillard, M.J.; Chevarier, A.; Chevarier, N.; Gerlic, E.; Stern, M.
1994-09-01
Fragmentation of mass-selected 60-keV/amu-H n + induced by single collision with helium has been studied for various cluster sizes n (9, 13,21, 25, and 31). The absolute cross sections of the charged fragments H p + are measured from p equal to n-2. The deduced mass distributions are strongly different from those obtained at lower collision energy (where molecular evaporation is mainly involved) due to a strong production of ionic fragments with a size of p/n -τ , where A is the normalized fragment mass (p/n) and τ an exponent close to 2.6. (authors)
Breast Cancer Cell Colonization of the Human Bone Marrow Adipose Tissue Niche.
Templeton, Zach S; Lie, Wen-Rong; Wang, Weiqi; Rosenberg-Hasson, Yael; Alluri, Rajiv V; Tamaresis, John S; Bachmann, Michael H; Lee, Kitty; Maloney, William J; Contag, Christopher H; King, Bonnie L
2015-12-01
Bone is a preferred site of breast cancer metastasis, suggesting the presence of tissue-specific features that attract and promote the outgrowth of breast cancer cells. We sought to identify parameters of human bone tissue associated with breast cancer cell osteotropism and colonization in the metastatic niche. Migration and colonization patterns of MDA-MB-231-fLuc-EGFP (luciferase-enhanced green fluorescence protein) and MCF-7-fLuc-EGFP breast cancer cells were studied in co-culture with cancellous bone tissue fragments isolated from 14 hip arthroplasties. Breast cancer cell migration into tissues and toward tissue-conditioned medium was measured in Transwell migration chambers using bioluminescence imaging and analyzed as a function of secreted factors measured by multiplex immunoassay. Patterns of breast cancer cell colonization were evaluated with fluorescence microscopy and immunohistochemistry. Enhanced MDA-MB-231-fLuc-EGFP breast cancer cell migration to bone-conditioned versus control medium was observed in 12/14 specimens (P = .0014) and correlated significantly with increasing levels of the adipokines/cytokines leptin (P = .006) and IL-1β (P = .001) in univariate and multivariate regression analyses. Fluorescence microscopy and immunohistochemistry of fragments underscored the extreme adiposity of adult human bone tissues and revealed extensive breast cancer cell colonization within the marrow adipose tissue compartment. Our results show that breast cancer cells migrate to human bone tissue-conditioned medium in association with increasing levels of leptin and IL-1β, and colonize the bone marrow adipose tissue compartment of cultured fragments. Bone marrow adipose tissue and its molecular signals may be important but understudied components of the breast cancer metastatic niche. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Study on tissue culture for Gelidium seedling
Pei, Lu-Qing; Luo, Qi-Jun; Fei, Zhi-Qing; Ma, Bin
1996-06-01
As seedling culture is a crucial factor for successful cultivation of Gelidium, the authors researched tissue culture technology for producing seedlings. The morphogeny and experimental ecology were observed and studied fully in 2 5 mm isolated tissue fragments. Regeneration, appearance of branching creepers and attaching structure and new erect seedlings production and development were studied. Fragments were sown on bamboo slice and vinylon rope. The seedlings were cultured 20 30 days indoor, then cultured in the sea, where the density of erect seedlings was 3 19 seedlings/cm2, growth rate was 3.84% day. The frond arising from seedlings directly was up to 10 cm per year. The ecological conditions for regenerated seedlings are similar to the natural ones. The regenerated seedlings are suitable for raft culture in various sea areas.
Simulation of natural fragmentation of rings cut from warheads
Directory of Open Access Journals (Sweden)
John F. Moxnes
2015-12-01
Full Text Available Natural fragmentation of warheads that detonates causes the casing of the warhead to split into various sized fragments through shear or radial fractures depending on the toughness, density, and grain size of the material. The best known formula for the prediction of the size distribution is the Mott formulae, which is further examined by Grady and Kipp by investigating more carefully the statistical most random way of portioning a given area into a number of entities. We examine the fragmentation behavior of radially expanding steel rings cut from a 25 mm warhead by using an in house smooth particle hydrodynamic (SPH simulation code called REGULUS. Experimental results were compared with numerical results applying varying particle size and stochastic fracture strain. The numerically obtained number of fragments was consistent with experimental results. Increasing expansion velocity of the rings increases the number of fragments. Statistical variation of the material parameters influences the fragment characteristics, especially for low expansion velocities. A least square regression fit to the cumulative number of fragments by applying a generalized Mott distribution shows that the shape parameter is around 4 for the rings, which is in contrast to the Mott distribution with a shape parameter of ½. For initially polar distributed particles, we see signs of a bimodal cumulative fragment distribution. Adding statistical variation in material parameters of the fracture model causes the velocity numerical solutions to become less sensitive to changes in resolution for Cartesian distributed particles.
Telomere Restriction Fragment (TRF) Analysis.
Mender, Ilgen; Shay, Jerry W
2015-11-20
While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of
Energy-weighted moments in the problems of fragmentation
International Nuclear Information System (INIS)
Kuz'min, V.A.
1986-01-01
The problem of fragmentation of simple nuclear states on the complex ones is reduced to real symmetrical matrix eigenvectors and eigenvalue problem. Based on spectral decomposition of this matrix the simple and economical from computing point of view algorithm to calculate energetically-weighted strength function moments is obtained. This permitted one to investigate the sensitivity of solving the fragmentation problem to reducing the basis of complex states. It is shown that the full width of strength function is determined only by the complex states connected directly with the simple ones
Navarrete-Perea, José; Moguel, Bárbara; Bobes, Raúl José; Villalobos, Nelly; Carrero, Julio César; Sciutto, Edda; Soberón, Xavier; Laclette, Juan Pedro
2017-01-01
Taeniasis/cysticercosis caused by the tapeworm Taenia solium is a parasite disease transmitted among humans and pigs, the main intermediate host. The larvae/cysts can lodge in several tissues of the pig, i.e. skeletal muscles and different locations of the central nervous system. The molecular mechanisms associated to tissue preferences of the cysts remain poorly understood. The major public health concern about this zoonosis is due to the human infections by the larval form in the central nervous system, causing a highly pleomorphic and debilitating disease known as neurocysticercosis. This study was aimed to explore the 2DE protein maps of T. solium cysts obtained from skeletal muscles and central nervous system of naturally infected pigs. The gel images were analyzed through a combination of PDQuest™ and multivariate analysis. Results showed that differences in the protein patterns of cysts obtained from both tissues were remarkably discrete. Only 7 protein spots were found specifically associated to the skeletal muscle localization of the cysts; none was found significantly associated to the central nervous system. The use of distinct protein fractions of cysts allowed preliminary identification of several tissue-specific antigenic bands. The implications of these findings are discussed, as well as several strategies directed to achieve the complete characterization of this parasite's proteome, in order to extend our understanding of the molecular mechanisms underlying tissue localization of the cysts and to open avenues for the development of immunological tissue-specific diagnosis of the disease. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August
1997-01-01
Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake
Fragmentation of water on swift {sup 3}He{sup 2+} ion impact
Energy Technology Data Exchange (ETDEWEB)
Sabin, John R. [Quantum Theory Project, Departments of Chemistry and Physics, P.O. Box 118435, University of Florida, Gainesville, FL 32611-8435 (United States); Institut for Fysik og Kemi, Suddansk Universitet, 5230 Odense M (Denmark)], E-mail: sabin@qtp.ufl.edu; Cabrerra-Trujillo, Remigio [Instituto de Ciencias Fisicas, Universidad Nacional Autonoma de Mexico, Apartado Postal 48-3, Cuernavaca, Morelos 62251 (Mexico); Stolterfoht, Nikolaus [Hahn-Meitner Institut, Glienickerstrasse 100, D-14109 Berlin (Germany); Deumens, Erik; Ohrn, Yngve [Quantum Theory Project, Departments of Chemistry and Physics, P.O. Box 118435, University of Florida, Gainesville, FL 32611-8435 (United States)
2009-01-15
Charge exchange and fragmentation are the usual results in ion-molecule collision systems, and the specifics of the fragmentation process determine the chemical destiny of the target system. In this paper, we report recent progress on calculations of the fragmentation patterns for the model system He{sup 2+} + H{sub 2}O for projectile energies of a few keV. The calculations are obtained using the electron-nuclear dynamics (END) method for solution of the time-dependent Schroedinger equation.
Study of fission fragments produced by 14N + 235U reaction
International Nuclear Information System (INIS)
Yalcinkaya, M.; Erduran, M.N.; Ganioglu, E.; Akkus, B.; Bostan, M.; Gurdal, G.; Erturk, S.; Balabanski, D.; Minkova, A.; Danchev, M.
2005-01-01
This work was performed to understand the structure of neutron rich fission fragments around ∼ 130 region. A thin metallic 235 U target was bombarded by 14 N beam with 10 MeV/A from the Separated Sector Cyclotron at the National Accelerator Centre, Cape Town, South Africa. The main goal to detect and identify fission fragments and to obtain their mass distribution was achieved by using Solar Cell detectors in the AFRODITE (African Omnipurpose Detector for Innovative Techniques and Experiments) spectrometer. The X-rays emitted from fission fragments were detected by LEP detectors and γ rays emitted from excited states of the fission fragments were detected by CLOVER detectors in the spectrometer. (author)
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Tsuji, L J S; Wainman, B C; Jayasinghe, R K; VanSpronsen, E P; Liberda, E N
2009-04-01
Recently, the use of lead isotope ratios has definitively identified lead ammunition as a source of lead exposure for First Nations people, but the isotope ratios for lead pellets and bullets were indistinguishable. Thus, lead-contaminated meat from game harvested with lead bullets may also be contributing to the lead body burden; however, few studies have determined if lead bullet fragments are present in big game carcasses. We found elevated tissue-lead concentrations (up to 5,726.0 microg/g ww) in liver (5/9) and muscle (6/7) samples of big game harvested with lead bullets and radiographic evidence of lead fragments. Thus, we would advise that the tissue surrounding the wound channel be removed and discarded, as this tissue may be contaminated by lead bullet fragments.
Modelling the fragmentation mechanisms
International Nuclear Information System (INIS)
Bougault, R.; Durand, D.; Gulminelli, F.
1998-01-01
We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
DNA damage in preserved specimens and tissue samples: a molecular assessment
Directory of Open Access Journals (Sweden)
Cantin Elizabeth
2008-10-01
Full Text Available Abstract The extraction of genetic information from preserved tissue samples or museum specimens is a fundamental component of many fields of research, including the Barcode of Life initiative, forensic investigations, biological studies using scat sample analysis, and cancer research utilizing formaldehyde-fixed, paraffin-embedded tissue. Efforts to obtain genetic information from these sources are often hampered by an inability to amplify the desired DNA as a consequence of DNA damage. Previous studies have described techniques for improved DNA extraction from such samples or focused on the effect of damaging agents – such as light, oxygen or formaldehyde – on free nucleotides. We present ongoing work to characterize lesions in DNA samples extracted from preserved specimens. The extracted DNA is digested to single nucleosides with a combination of DNase I, Snake Venom Phosphodiesterase, and Antarctic Phosphatase and then analyzed by HPLC-ESI-TOF-MS. We present data for moth specimens that were preserved dried and pinned with no additional preservative and for frog tissue samples that were preserved in either ethanol, or formaldehyde, or fixed in formaldehyde and then preserved in ethanol. These preservation methods represent the most common methods of preserving animal specimens in museum collections. We observe changes in the nucleoside content of these samples over time, especially a loss of deoxyguanosine. We characterize the fragmentation state of the DNA and aim to identify abundant nucleoside lesions. Finally, simple models are introduced to describe the DNA fragmentation based on nicks and double-strand breaks.
Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.
2005-06-01
For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)
A method to obtain reference images for evaluation of ultrasonic tissue characterization techniques
DEFF Research Database (Denmark)
Jensen, M.S.; Wilhjelm, Jens E.; Sahl, B.
2002-01-01
of the macroscopic photograph, due to the histological preparation process. The histological information was "mapped back" into the format of the ultrasound images the following way: On the macroscopic images, outlines were drawn manually which defined the border of the tissue. These outlines were superimposed...... of the various tissue types. Specifically, the macroscopic image revealed the borders between the different tissues, while the histological image identified the four tissue types. A set of 12 reference images based on modified macroscopic outlines was created. The overlap between the ultrasound images...... and the macroscopic images-which are the geometrical basis for the final reference images-was between 77% and 93%. A set of 12 reference images spaced 2.5 mm, identifying spatial location of four different tissue types in porcine muscle has been created. With the reference images, it is possible to quantitatively...
Chromosome aberrations in cultured skin cells obtained from atomic bomb survivors
International Nuclear Information System (INIS)
Honda, Takeo; Sadamori, Naoki.
1989-01-01
Skin specimens were obtained from 11 A-bomb survivors, 10 of whom had been exposed at ≤2300 m from the hypocenter, and 7 non-exposed controls. There was a higher frequency (12%, 147/1222 cells) of chromosome aberrations in the exposed group compared with 1.2% (4/341 cells) in the control group. This suggests that aberrant cells are still present in the skin tissue 40 years or more after the bombing. Of 147 cells, 136 cells (91.3%) showed translocation of chromosome. Other aberrations, such as inversion, deletion, dicentric chromosome and acentric fragment, were observed in only 3.8%. These aberrant cells tended to be observed in A-bomb survivors exposed to high doses and with a history of severe acute symptoms. One hundred and twenty two (83%) of 136 aberrant cells were obtained from 3 A-bomb survivors, which has important implications for marked proliferation of specific clone cells. In an analysis by B-band staining technique for the 122 cells, band sites of break point were found to correspond to loci of protooncogenes, suggesting the involvement in aggressive proliferation of clone cells. (Namekawa, K)
Energy Technology Data Exchange (ETDEWEB)
Busquet, Gemma; Girart, Josep Miquel [Institut de Ciències de l’Espai (CSIC-IEEC), Campus UAB, Carrer de Can Magrans, S/N, E-08193, Cerdanyola del Vallès, Catalunya (Spain); Estalella, Robert [Departament d’Astronomia i Meteorologia, Institut de Ciències del Cosmos (ICC), Universitat de Barcelona (IEEC-UB), Martí i Franquès, 1, E-08028 Barcelona, Catalunya (Spain); Palau, Aina [Instituto de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán, México (Mexico); Liu, Hauyu Baobab; Ho, Paul T. P. [Academia Sinica Institute of Astronomy and Astrophysics, Taipei, Taiwan (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); De Gregorio-Monsalvo, Itziar [European Southern Observatory (ESO), Karl-Schwarzschild-Str. 2, D-85748 Garching (Germany); Pillai, Thushara [Max Planck Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Anglada, Guillem, E-mail: busquet@ice.cat [Instituto de Astrofísica de Andalucía, CSIC, Glorieta de la Astronomía, s/n, E-18008, Granada (Spain)
2016-03-20
We present observations of the 1.3 mm continuum emission toward hub-N and hub-S of the infrared dark cloud G14.225–0.506 carried out with the Submillimeter Array, together with observations of the dust emission at 870 and 350 μm obtained with APEX and CSO telescopes. The large-scale dust emission of both hubs consists of a single peaked clump elongated in the direction of the associated filament. At small scales, the SMA images reveal that both hubs fragment into several dust condensations. The fragmentation level was assessed under the same conditions and we found that hub-N presents 4 fragments while hub-S is more fragmented, with 13 fragments identified. We studied the density structure by means of a simultaneous fit of the radial intensity profile at 870 and 350 μm and the spectral energy distribution adopting a Plummer-like function to describe the density structure. The parameters inferred from the model are remarkably similar in both hubs, suggesting that density structure could not be responsible for determining the fragmentation level. We estimated several physical parameters, such as the level of turbulence and the magnetic field strength, and we found no significant differences between these hubs. The Jeans analysis indicates that the observed fragmentation is more consistent with thermal Jeans fragmentation compared with a scenario in which turbulent support is included. The lower fragmentation level observed in hub-N could be explained in terms of stronger UV radiation effects from a nearby H ii region, evolutionary effects, and/or stronger magnetic fields at small scales, a scenario that should be further investigated.
International Nuclear Information System (INIS)
Busquet, Gemma; Girart, Josep Miquel; Estalella, Robert; Palau, Aina; Liu, Hauyu Baobab; Ho, Paul T. P.; Zhang, Qizhou; De Gregorio-Monsalvo, Itziar; Pillai, Thushara; Anglada, Guillem
2016-01-01
We present observations of the 1.3 mm continuum emission toward hub-N and hub-S of the infrared dark cloud G14.225–0.506 carried out with the Submillimeter Array, together with observations of the dust emission at 870 and 350 μm obtained with APEX and CSO telescopes. The large-scale dust emission of both hubs consists of a single peaked clump elongated in the direction of the associated filament. At small scales, the SMA images reveal that both hubs fragment into several dust condensations. The fragmentation level was assessed under the same conditions and we found that hub-N presents 4 fragments while hub-S is more fragmented, with 13 fragments identified. We studied the density structure by means of a simultaneous fit of the radial intensity profile at 870 and 350 μm and the spectral energy distribution adopting a Plummer-like function to describe the density structure. The parameters inferred from the model are remarkably similar in both hubs, suggesting that density structure could not be responsible for determining the fragmentation level. We estimated several physical parameters, such as the level of turbulence and the magnetic field strength, and we found no significant differences between these hubs. The Jeans analysis indicates that the observed fragmentation is more consistent with thermal Jeans fragmentation compared with a scenario in which turbulent support is included. The lower fragmentation level observed in hub-N could be explained in terms of stronger UV radiation effects from a nearby H ii region, evolutionary effects, and/or stronger magnetic fields at small scales, a scenario that should be further investigated
DEFF Research Database (Denmark)
Jensen, Pernille Foged; Rand, Kasper Dyrberg
2016-01-01
are produced after precursor ion selection and thus do not add complexity to the LC-MS analysis. The key to obtaining optimal spatial resolution in a hydrogen exchange mass spectrometry (HX-MS) experiment is the fragmentation efficiency. This chapter discusses common fragmentation techniques like collision....../D scrambling, thus making them suitable for HX applications. By combining the classic bottom-up HX-MS workflow with gas-phase fragmentation by ETD, detailed information on protein HX can be obtained....
Yields of correlated fragment pairs and neutron multiplicity in spontaneous fission of {sup 242}Pu
Energy Technology Data Exchange (ETDEWEB)
Veselsky, M.; Kliman, J.; Morhaccaron, M. [Institute of Physics of Slovak Academy of Sciences, Dubravska 9, 84228 Bratislava (Slovakia); Ramayya, A.V.; Kormicki, J.; Daniel, A.V. [Physics Department, Vanderbilt University, Nashville (United States)] Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley (United States)] Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore (United States); Daniel, A.V.; Popeko, G.S.; Oganessian, Yu. Ts. [Joint Institute for Nuclear Research, Dubna (Russia)] Greiner, W. [Institut fur Theoretische Physik, J. W. Goethe Universitaet, Frankfurt a. M. (Germany); Aryaeinejad, R. [Idaho National Engineering Laboratory, Idaho Falls (United States)
1998-10-01
Yields of correlated fragment pairs were obtained in spontaneous fission of {sup 242}Pu. Charge, mass and neutron multiplicity distributions of fragment pairs were determined and compared to available data. The yield of cold fission without neutron emission was determined to about 10{percent} for the set of observed correlated fragment pairs. {copyright} {ital 1998 American Institute of Physics.}
International Nuclear Information System (INIS)
Chung, K.C.
1989-01-01
An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)
Tissue culture of three species of Laurencia complex
Shen, Songdong; Wu, Xunjian; Yan, Binlun; He, Lihong
2010-05-01
To establish a micropropagation system of three Laurencia complex species ( Laurencia okamurai, Laurencia tristicha, and Chondrophycus undulatus) by tissue culture techniques, we studied the regeneration characteristics and optimal culture conditions of axenic algal fragments cultured on solid medium and in liquid medium. Regeneration structures were observed and counted regularly under a reverse microscope to investigate the regeneration process, polarity and optimal illumination, and temperature and salinity levels. The results show that in most cultures of the three species, we obtained bud regeneration on solidified medium with 0.5% agar and in liquid medium. Rhizoid-like regeneration was filamentous and developed from the lower cut surface of fragments in L. okamurai, but was discoid and developed from the apical back side of bud regeneration in L. tristicha and C. undulatus. Regeneration polarity was localized to the apical part of algal fronds in all three species, and on fragments cut from the basal part of algae buds could develop from both the upper and the lower cut surfaces. Buds could develop from both the medullary and the cortical portions in L. okamurai and C. undulatus, while in L. tristicha, buds only emerged from the cortex. The optimal culture conditions for L. okamurai were 4 500 lx, 20°C and 35 (salinity); for C. undulatus, 4 500 lx, 20°C and 30; and for L. tristicha, 4 500 lx, 25°C and 30.
Scierski, Wojciech; Polok, Aleksandra; Namysłowski, Grzegorz; Nozyński, Jerzy; Turecka, Lucyna; Urbaniec, Natalia; Pamuła, Elzbieta
2009-09-01
The surgical treatment of large cartilage defects in the region of head and neck is often impossible because of the atrophy of surrounding tissues and lack of suitable material for reconstruction. In the surgical treatment many of methods and reconstructive materials have been used. For many years the suitable synthetic material for the cartilage defects reconstruction has been searched for. Was to evaluate two different biomaterials with proper mechanical and biological features for the cartilage replacement. Two type of biomaterials in this study were used: resorbable polymer - poly(L-lactide-co-glycolide) (PLG) acting as a supportive matrix. A thin layer of sodium hyaluronate (Hyal) was also deposited on the surface as well in the pore walls of PLG scaffolds in order to provide biologically active molecules promoting differentiation and regeneration of the tissue. The studies were performed on the 50 animals--rabbits divided into 2 groups. The animals were operated in the general anaesthesia. The incision was done along the edge of the rabbit's auricle. Perichondrium and cartilage of the auricle on the surface 4 x 3 cm were prepared. Subperichondrically 1 x 1 cm fragment of the cartilage was removed by the scissors. This fragment was then replaced by the biomaterials: PLG in first group of 25 rabbits and PLG-Hyal in second group 25 rabbits. The tissues were sutured with polyglycolide Safil 3-0. The animals obtained Enrofloxacin for three days after the operation. Then 1, 4 and 12 weeks after the surgery the animals were painlessly euthanized by an overdose of Morbital. Implants and surrounding tissues were excised and observed macroscopically and using an optical microscope. In all the observation periods we observed proper macroscopic healing process of biomaterials. We didn't stated strong inflammatory process and necrosis around the implanted biomaterials. The histological and macroscopic examinations indicated that both materials developed in this study have
Metagenome Fragment Classification Using -Mer Frequency Profiles
Directory of Open Access Journals (Sweden)
Gail Rosen
2008-01-01
Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.
Fission fragment distributions within dynamical approach
Energy Technology Data Exchange (ETDEWEB)
Mazurek, K. [Institute of Nuclear, Physics Polish Academy of Sciences, Krakow (Poland); Nadtochy, P.N. [Omsk State Technical University, Omsk (Russian Federation); Ryabov, E.G.; Adeev, G.D. [Omsk State University, Physics Department, Omsk (Russian Federation)
2017-04-15
The review covers recent developments and achievements in the dynamical description of fission process at high excitation energy. It is shown that the dynamical approach based on multidimensional Langevin equations combined with the statistical description of nuclear decay by particles evaporation is capable of fairly well describing the formation of fission fragment mass-energy, charge, and angular distributions of fission fragments in coincidence with the pre- and post-scission particle emission. The final yields of fission and evaporation residues channels products could be obtained. The detailed description of fission dynamics allows studying different stages of fission process, indicating the most important ingredients governing fission process and studying in detail such fundamental nuclear properties as nuclear viscosity and fission timescale. The tasks and perspectives of multidimensional dynamical approach are also discussed. (orig.)
Testing independence of fragment lengths within VNTR loci
Energy Technology Data Exchange (ETDEWEB)
Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))
1993-11-01
Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.
Multiplicity distributions in the binary fragmenting with inhibition at the transition line
Energy Technology Data Exchange (ETDEWEB)
Botet, R. [Paris-11 Univ., 91 - Orsay (France); Ploszajczak, M. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France)
1996-03-01
Properties of the fragment multiplicity distribution obtained in the sequential binary fragmentation process at the transition line are investigated. It is shown that the multifragment cumulant correlation functions have the hierarchical, linked-pair structure. Several distinct classes of multiplicity domains are clearly identified, and the asymptotic appearance of the Koba - Nielsen - Olesen scaling is discussed. (author). 36 refs.
Multiplicity distributions in the binary fragmenting with inhibition at the transition line
International Nuclear Information System (INIS)
Botet, R.; Ploszajczak, M.
1996-03-01
Properties of the fragment multiplicity distribution obtained in the sequential binary fragmentation process at the transition line are investigated. It is shown that the multifragment cumulant correlation functions have the hierarchical, linked-pair structure. Several distinct classes of multiplicity domains are clearly identified, and the asymptotic appearance of the Koba - Nielsen - Olesen scaling is discussed. (author)
First Record of Soft Tissue Preservation in the Upper Devonian of Poland
Zatoń, Michał; Broda, Krzysztof
2015-01-01
Soft tissue preservation is reported from Upper Devonian deposits of the Holy Cross Mountains, central Poland, for the first time. The preserved soft tissues are muscles associated with arthropod cuticle fragments. The muscles are phosphatized with variable states of preservation. Well-preserved specimens display the typical banding of striated muscles. Other muscle fragments are highly degraded and/or recrystallized such that their microstructure is barely visible. The phosphatized muscles and associated cuticle are fragmented, occur in patches and some are scattered on the bedding plane. Due to the state of preservation and the lack of diagnostic features, the cuticle identification is problematic; however, it may have belonged to a phyllocarid crustacean. Taphonomic features of the remains indicate that they do not represent fossilized fecal matter (coprolite) but may represent a regurgitate, but the hypothesis is difficult to test. Most probably they represent the leftover remains after arthropod or fish scavenging. The present study shows that soft tissues, which even earlier were manipulated by scavenger, may be preserved if only special microenvironmental conditions within and around the animal remains are established. PMID:26559060
Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes
2005-10-01
1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as
An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments
Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.
2015-01-01
The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.
International Nuclear Information System (INIS)
Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo
2011-01-01
Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.
Synthesis and NMR of {sup 15}N-labeled DNA fragments
Energy Technology Data Exchange (ETDEWEB)
Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)
1994-12-01
DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.
International Nuclear Information System (INIS)
Gorokhovski, M A; Saveliev, V L
2008-01-01
This paper analyses statistical universalities that arise over time during constant frequency fragmentation under scaling symmetry. The explicit expression of particle-size distribution obtained from the evolution kinetic equation shows that, with increasing time, the initial distribution tends to the ultimate steady-state delta function through at least two intermediate universal asymptotics. The earlier asymptotic is the well-known log-normal distribution of Kolmogorov (1941 Dokl. Akad. Nauk. SSSR 31 99-101). This distribution is the first universality and has two parameters: the first and the second logarithmic moments of the fragmentation intensity spectrum. The later asymptotic is a power function (stronger universality) with a single parameter that is given by the ratio of the first two logarithmic moments. At large times, the first universality implies that the evolution equation can be reduced exactly to the Fokker-Planck equation instead of making the widely used but inconsistent assumption about the smallness of higher than second order moments. At even larger times, the second universality shows evolution towards a fractal state with dimension identified as a measure of the fracture resistance of the medium
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Kinematics of current region fragmentation in semi-inclusive deeply inelastic scattering
Energy Technology Data Exchange (ETDEWEB)
Boglione, M., E-mail: elena.boglione@to.infn.it [Dipartimento di Fisica, Università di Torino, INFN - Sezione Torino, Via P. Giuria 1, 10125 Torino (Italy); Collins, J., E-mail: jcc8@psu.edu [Department of Physics, Penn State University, University Park, PA 16802 (United States); Gamberg, L., E-mail: lpg10@psu.edu [Science Division, Penn State University Berks, Reading, PA 19610 (United States); Gonzalez-Hernandez, J.O., E-mail: jogh@jlab.org [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Rogers, T.C., E-mail: trogers@odu.edu [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Sato, N., E-mail: nsato@jlab.org [Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States)
2017-03-10
Different kinematical regions of semi-inclusive deeply inelastic scattering (SIDIS) processes correspond to different underlying partonic pictures, and it is important to understand the transition between them. We find criteria in semi-inclusive deeply inelastic scattering (SIDIS) for identifying the current fragmentation region — the kinematical region where a factorization picture with fragmentation functions is appropriate, especially for studies of transverse-momentum-dependent (TMD) functions. This region is distinguished from the central (soft) and target fragmentation regions. The basis of our argument is in the errors in approximations used in deriving factorization. As compared with previous work, we show that it is essential to take account of the transverse momentum of the detected hadron, and we find a much more restricted range for genuine current fragmentation. We show that it is important to develop an extended factorization formulation to treat hadronization in the central region, as well as the current and target fragmentation regions, and to obtain a unified formalism spanning all rapidities for the detected hadron.
HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS
International Nuclear Information System (INIS)
Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.
2013-01-01
We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.
Exploration of the fragmentation of laser shock-melted aluminum using x-ray backlighting
Directory of Open Access Journals (Sweden)
Lin Zhang
2016-05-01
Full Text Available The fragmentation of shock-melted metal material is an important scientific problem in shock physics and is suitable for experimentally investigating by the laser-driven x-ray backlighting technique. This letter reports on the exploration of laser shock-melted aluminum fragmentation by means of x-ray backlighting at the SGII high energy facility in China. High-quality and high-resolution radiographs with negligible motion blur were obtained and these images enabled analysis of the mass distribution of the fragmentation product.
International Nuclear Information System (INIS)
Perlt, H.
1980-01-01
Scale breaking quark and gluon fragmentation functions obtained by solving numerically Altarelli-Parisi type equations are presented. Analytical parametrizations are given for the fragmentation of u and d quarks into pions. The calculated Q 2 dependent fragmentation functions are compared with experimental data. With these scale breaking fragmentation functions the average charged multiplicity is calculated in e + e - annihilation, which rises with energy more than logarithmically and is in good agreement with experiment. (author)
van Dongen, Joris A.; Stevens, Hieronymus P.; Parvizi, Mojtaba; van der Lei, Berend; Harmsen, Martin C.
2016-01-01
Autologous adipose tissue transplantation is clinically used to reduce dermal scarring and to restore volume loss. The therapeutic benefit on tissue damage more likely depends on the stromal vascular fraction of adipose tissue than on the adipocyte fraction. This stromal vascular fraction can be
Neutron-fragment angular correlations in /sup 235/U(n/sub th/,f)
International Nuclear Information System (INIS)
Franklyn, C.B.
1985-01-01
Neutron-fragment angular correlations in /sup 235/U(n/sub th/,f) as a function of neutron energy and fragment mass are presented. The results obtained in this experiment, together with data for neutron-neutron angular correlations, are compared with a Monte Carlo simulation of the fission process incorporating both a scission neutron component and an anisotropic neutron emission component
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
Feng, Dilu; Menger, Michael D; Wang, Hongbo; Laschke, Matthias W
2014-02-01
In endometriosis research, endometriosis-like lesions are usually induced in rodents by transplantation of isolated endometrial tissue fragments to ectopic sites. In the present study, we investigated whether this approach is affected by the cellular composition of the grafts. For this purpose, endometrial tissue fragments covered with luminal epithelium (LE(+)) and without luminal epithelium (LE(-)) were transplanted from transgenic green-fluorescent-protein-positive (GFP(+)) donor mice into the dorsal skinfold chamber of GFP(-) wild-type recipient animals to analyze their vascularization, growth and morphology by means of repetitive intravital fluorescence microscopy, histology and immunohistochemistry during a 14-day observation period. LE(-) fragments developed into typical endometriosis-like lesions with cyst-like dilated endometrial glands and a well-vascularized endometrial stroma. In contrast, LE(+) fragments exhibited a polypoid morphology and a significantly reduced blood perfusion after engraftment, because the luminal epithelium prevented the vascular interconnection with the microvasculature of the surrounding host tissue. This was associated with a markedly decreased growth rate of LE(+) lesions compared with LE(-) lesions. In addition, we found that many GFP(+) microvessels grew outside the LE(-) lesions and developed interconnections to the host microvasculature, indicating that inosculation is an important mechanism in the vascularization process of endometriosis-like lesions. Our findings demonstrate that the luminal epithelium crucially affects the vascularization, growth and morphology of endometriosis-like lesions. Therefore, it is of major importance to standardize the cellular composition of endometrial grafts in order to increase the validity and reliability of pre-clinical rodent studies in endometriosis research.
Directory of Open Access Journals (Sweden)
Dilu Feng
2014-02-01
Full Text Available In endometriosis research, endometriosis-like lesions are usually induced in rodents by transplantation of isolated endometrial tissue fragments to ectopic sites. In the present study, we investigated whether this approach is affected by the cellular composition of the grafts. For this purpose, endometrial tissue fragments covered with luminal epithelium (LE+ and without luminal epithelium (LE− were transplanted from transgenic green-fluorescent-protein-positive (GFP+ donor mice into the dorsal skinfold chamber of GFP− wild-type recipient animals to analyze their vascularization, growth and morphology by means of repetitive intravital fluorescence microscopy, histology and immunohistochemistry during a 14-day observation period. LE− fragments developed into typical endometriosis-like lesions with cyst-like dilated endometrial glands and a well-vascularized endometrial stroma. In contrast, LE+ fragments exhibited a polypoid morphology and a significantly reduced blood perfusion after engraftment, because the luminal epithelium prevented the vascular interconnection with the microvasculature of the surrounding host tissue. This was associated with a markedly decreased growth rate of LE+ lesions compared with LE− lesions. In addition, we found that many GFP+ microvessels grew outside the LE− lesions and developed interconnections to the host microvasculature, indicating that inosculation is an important mechanism in the vascularization process of endometriosis-like lesions. Our findings demonstrate that the luminal epithelium crucially affects the vascularization, growth and morphology of endometriosis-like lesions. Therefore, it is of major importance to standardize the cellular composition of endometrial grafts in order to increase the validity and reliability of pre-clinical rodent studies in endometriosis research.
Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.
Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi
2017-01-01
Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
Heavy Flavor Fragmentation and Decay at SLD
Energy Technology Data Exchange (ETDEWEB)
Plano, Richard M
1999-02-24
Results on heavy quark fragmentation obtained using the SLD detector at the SLAC Linear Collider are presented. This talk will cover the ratio of vector to pseudoscalar charmed meson production, the inclusive B hadron energy distribution, the inclusive particle production in heavy jets compared to their production in light jets, and charged and neutral B meson lifetimes.
Development of an experimental model of brain tissue heterotopia in the lung
Quemelo, Paulo Roberto Veiga; Sbragia, Lourenço; Peres, Luiz Cesar
2007-01-01
Summary The presence of heterotopic brain tissue in the lung is a rare abnormality. The cases reported thus far are usually associated with neural tube defects (NTD). As there are no reports of experimental models of NTD that present this abnormality, the objective of the present study was to develop a surgical method of brain tissue heterotopia in the lung. We used 24 pregnant Swiss mice divided into two groups of 12 animals each, denoted 17GD and 18GD according to the gestational day (GD) when caesarean section was performed to collect the fetuses. Surgery was performed on the 15th GD, one fetus was removed by hysterectomy and its brain tissue was cut into small fragments and implanted in the lung of its litter mates. Thirty-four live fetuses were obtained from the 17GD group. Of these, eight (23.5%) were used as control (C), eight (23.5%) were sham operated (S) and 18 (52.9%) were used for pulmonary brain tissue implantation (PBI). Thirty live fetuses were obtained from the females of the 18GD group. Of these, eight (26.6%) were C, eight (26.6%) S and 14 (46.6%) were used for PBI. Histological examination of the fetal trunks showed implantation of GFAP-positive brain tissue in 85% of the fetuses of the 17GD group and in 100% of those of the 18GD group, with no significant difference between groups for any of the parameters analysed. The experimental model proved to be efficient and of relatively simple execution, showing complete integration of the brain tissue with pulmonary and pleural tissue and thus representing a model that will permit the study of different aspects of cell implantation and interaction. PMID:17877535
Prompt Gamma Radiation from Fragments in the Thermal Fission of 235U
International Nuclear Information System (INIS)
Albinsson, H.; Lindow, L.
1970-06-01
Measurements were made on the gamma radiation emitted from fission fragments in slow neutron induced fission of 235 U. The fragments were detected with solid state detectors of the surface barrier type and the gamma radiation with a Nal(Tl) scintillator. Mass selection was used so that the gamma radiation could be measured as a function of fragment mass. Time discrimination between the fission gammas and the prompt neutrons released in the fission process was employed to reduce the background. The gamma radiation emitted during different time intervals after the fission event was studied with the help of a collimator, the position of which was changed along the path of the fission fragments. In this way a decay curve was obtained from which the life-time of one of the gamma-emitting states could be estimated. The relative yield of the gamma-rays was determined as a function of mass for different gamma-ray energy portions and two specific time intervals after the fission events. Comparisons were made with data obtained from 252 Cf-fission. Attention is drawn to some features which seem to be the same in 235 U and 252 Cf-fission
Energy Technology Data Exchange (ETDEWEB)
Klingbeil, Maria Fatima Guarizo
2006-07-01
The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)
Toroidal and rotating bubble nuclei and the nuclear fragmentation
International Nuclear Information System (INIS)
Royer, G.; Fauchard, C.; Haddad, F.; Jouault, B.
1997-01-01
The energy of rotating bubble and toroidal nuclei predicted to be formed in central heavy ion collisions at intermediate energies is calculated within the generalized rotating liquid drop model. Previously, a one-parameter shape sequence has been defined to describe the path leading to pumpkin-like configurations and toroidal shapes. New analytical expressions for the shape dependent functions have been obtained. The potential barriers standing in these exotic deformation paths are compared with the three-dimensional and plane-fragmentation barriers. Metastable bubble-like minima only appear at very high angular momentum and above the three dimensional fragmentation barriers. In the toroidal deformation path of the heaviest systems exists a large potential pocket localized below the plane-fragmentation barriers. This might allow the temporary survival of heavy nuclear toroids before the final clusterization induced by the surface and proximity tension
Fragmentation, labeling and biodistribution studies of KS1/4, a monoclonal antibody
International Nuclear Information System (INIS)
Mohd, S.B.
1987-01-01
In this study, an IgG2a (KS1/4), a monoclonal antibody (MoAb) specific against a human lung adenocarcinoma (UCLA P-3) was successfully fragmented enzymatically to yield F(ab') 2 and Fab by using pepsin and papain, respectively. The kinetic of fragmentation of the MoAb was compared to that of human immunoglobulin G (IgG). A similar pattern of fragmentation was observed with both antibodies with a higher percentage yield of the F(ab') 2 and Fab obtained upon the fragmentation of the IgG by the enzymes. The KS1/4 and the two fragments were labeled with three different radionuclides, namely iodine-131, indium-111 and selenium-75. The radioiodination of the MoAb and the fragments was carried out by using a modified chloramine-T method. Radiometal labeling of the MoAb and the fragments with indium-111 was performed by using DTPA as a bifunctional chelating agent, while intrinsic labeling of the MoAb was done by culturing the hybridoma in the presence of 75 Se-methionine. The biodistribution of the radiolabeled MoAb, F(ab') 2 and Fab fragments were performed by injecting the preparations intravenously into nude mice bearing human lung adenocarcinoma
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
An Efficient Genome Fragment Assembling Using GA with Neighborhood Aware Fitness Function
Directory of Open Access Journals (Sweden)
Satoko Kikuchi
2012-01-01
Full Text Available To decode a long genome sequence, shotgun sequencing is the state-of-the-art technique. It needs to properly sequence a very large number, sometimes as large as millions, of short partially readable strings (fragments. Arranging those fragments in correct sequence is known as fragment assembling, which is an NP-problem. Presently used methods require enormous computational cost. In this work, we have shown how our modified genetic algorithm (GA could solve this problem efficiently. In the proposed GA, the length of the chromosome, which represents the volume of the search space, is reduced with advancing generations, and thereby improves search efficiency. We also introduced a greedy mutation, by swapping nearby fragments using some heuristics, to improve the fitness of chromosomes. We compared results with Parsons’ algorithm which is based on GA too. We used fragments with partial reads on both sides, mimicking fragments in real genome assembling process. In Parsons’ work base-pair array of the whole fragment is known. Even then, we could obtain much better results, and we succeeded in restructuring contigs covering 100% of the genome sequences.
Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima
2015-09-01
To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
Directory of Open Access Journals (Sweden)
S. C. Oukouomi Noutchie
2014-01-01
Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.
Land fragmentation and production diversification
Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.
2018-01-01
We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Light nuclides observed in the fission and fragmentation of 238U
International Nuclear Information System (INIS)
Ricciardi, M.V.; Schmidt, K.H.; Benlliure, J.
2001-05-01
Light nuclides produced in collisions of 1 A.GeV 238 U with protons and titanium have been fully identified with a high-resolution forward magnetic spectrometer, the fragment separator (FRS), at GSI, and for each nuclide an extremely precise determination of the velocity has been performed. The so-obtained information on the velocity shows that the very asymmetric fission of uranium, in the 238 U + p reaction, produces neutron-rich isotopes of elements down to around charge 10. New important features of the fragmentation of 238 U, concerning the velocity and the N/Z-ratio of these light fragments, and a peculiar even-odd structure in N=Z nuclei, have also been observed. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Faraggi, H; Garin-Bonnet, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1958-07-01
The measurement of total number of fissiongments emerging from an homogeneous, thick alloy composed of uranium plus another element (the concentration of uranium being known) allows to obtain the range of the fragments in this alloy. By varying the concentration, the range of the fragments in uranium and in the other element can be deduced. (author)Fren. [French] La mesure du nombre total de fragments de fission sortant d'un alliage homogene epais d'uranium et d'un autre element, pour lequel la concentration en uranium est donnee, permet la mesure du parcours des fragments dans cet alliage. En faisant varier la concentration, on peut deduire de ces mesures le parcours des fragments dans l'uranium et dans l'autre element. (auteur)
Fragmentation processes in nuclear reactions
International Nuclear Information System (INIS)
Legrain, R.
1984-08-01
Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed
Radioimmunodetection of human tumor xenografts by monoclonal antibody F(ab')/sub 2/ fragments
Energy Technology Data Exchange (ETDEWEB)
Herlyn, D.; Munz, D.L.; Herlyn, M.; Koprowski, H.; Powe, J.; Alavi, A.; Meinken, G.E.; Srivastava, S.C.
1986-01-01
Procedures are described for the radiolocalization of human tumors by murine monoclonal antibodies (MAb) in animal model systems. Visualization of tumor xenografts was clearer in nude mice compared to experimentally immunosuppressed mice due to the higher tumor viability. MAb localization in tumor tissue was greatly enhanced when F(ab')/sub 2/ fragments rather than intact antibody molecules were used. Although tumors could be visualized with /sup 131/I-, /sup 123/I-or /sup 111/In-labeled MAb fragments without background subtraction, tumor-to-background ratios of radioactivity were highest for /sup 131/I-labeled fragments. /sup 131/I-labeled F(ab')/sub 2/ fragments of eight MAb against human colorectal carcinoma, melanoma or lung carcinoma localized specifically only in those tumors that bound the MAb in vitro and not in unrelated tumors. Radiolabeled fragments of MAb with other specificities (anti-hepatitis virus MAb) did not localize in tumors. All MAb that inhibited tumor growth in nude mice effectively localized these tumors by ..gamma..-scintigraphy. Some MAb were effective in localizing tumors but ineffective in inhibiting their growth. The ability of the specific radiolabeled F(ab')/sub 2/ fragments to localize in tumor grafts correlated significantly with MAb binding affinity and density of antigenic sites on tumor cells together, but not with either in vitro binding parameter alone.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Effectiveness in detecting fission fragments with ionization chambers
International Nuclear Information System (INIS)
Manrique Garcia, J.; Monne, G.
1991-01-01
Detection of fission fragments is important in nuclear measurements. When a high detection accuracy is required it is necessary to take in account the detection losses due to the absorption of fragments in the fissionable material. The losses corrections might change the final results in 2-3%. The traditional expression used in the calculation of the detection efficiency does not consider neither the density variation of the fissionable substance with its width, because it depends on the target material. That's why actually in many labs it is being searched new methods that allow to find the efficiency for each target. In this work a new method for determination of absorption efficiency is presented. The obtained results are analyzed
Heavy quark fragmentation into polarized quarkonium in the heavy quark effective theory
International Nuclear Information System (INIS)
Martynenko, A.P.; Saleev, V.A.
1996-01-01
Fragmentation of b-antiquark into polarized B* c -mesons is investigated within the framework of effective theory of heavy quarks. Functions of b fragmentation into longitudinally polarized and transversely polarized S-wave states of b c are calculated with an exact regard tot he first order corrections by 1/m b . Agreement of the results obtained with the corresponding calculations, performed in the quantum chromodynamics, is shown. 17 refs.; 2 figs
Tissue bioengineering and artificial organs.
Llames, Sara; García, Eva; Otero Hernández, Jesús; Meana, Alvaro
2012-01-01
The scarcity of organs and tissues for transplant and the need of immunosuppressive drugs to avoid rejection constitute two reasons that justify organ and tissue production in the laboratory. Tissue engineering based tissues (TE) could allow to regenerate the whole organ from a fragment or even to produce several organs from an organ donor for grafting purposes. TE is based in: (1) the ex vivo expansion of cells, (2) the seeding of these expanded cells in tridimensional structures that mimic physiological conditions and, (3) grafting the prototype. In order to graft big structures it is necessary that the organ or tissue produced "ex vivo" bears a vascular tree to ensure the nutrition of its deep layers. At present, no technology has been developed to provide this vascular tree to TE derived products. Thus, these tissues must be thin enough to acquire nutrients during the first days by diffusion from surrounding tissues. This fact constitutes nowadays the greatest limitation of technologies for organ development in the laboratory.In this chapter, all these problems and their possible solutions are commented. Also, the present status of TE techniques in the regeneration of different organ systems is reviewed.
Jet mass dependence of fragmentation in positron-proton collisions
Energy Technology Data Exchange (ETDEWEB)
Urmossy, K. [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan, Shandong (China)
2017-02-15
We propose the characterization of fragmentation functions by the energy fraction x a hadron takes away from the energy of the jet measured in the frame co-moving with the jet. Besides, we propose the usage of the jet mass as the fragmentation scale Q. We show that these two Lorentz-invariant variables emerge naturally in a microcanonical ensemble with conserved four-momentum. Then, we construct a statistical hadronisation model, in which, two features of the hadronic final states in various high-energy reactions (power law spectra and negative-binomial multiplicity distributions) can be connected simply. Finally, we analyse the scale dependence of the parameters of the model (power of the spectrum and mean energy per hadron) in the φ{sup 3} theory. Fitting fragmentation functions in diffractive positron-proton collisions, we obtain a prediction for the jet mass dependence of the hadron multiplicity distribution inside jets. (orig.)
International Nuclear Information System (INIS)
Kosaka, T.; Kuwabara, M.; Koide, F.
1992-01-01
Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking
AFM picking-up manipulation of the metaphase chromosome fragment by using the tweezers-type probe
International Nuclear Information System (INIS)
Yamanaka, Keiichiro; Saito, Masato; Shichiri, Motoharu; Sugiyama, Sigeru; Takamura, Yuzuru; Hashiguchi, Gen; Tamiya, Eiichi
2008-01-01
We have studied the development of a new procedure based on atomic force microscopy (AFM) for the analysis of metaphase chromosome. The aim of this study was to obtain detailed information about the specific locations of genes on the metaphase chromosome. In this research, we performed the manipulation of the metaphase chromosome by using novel AFM probes to obtain chromosome fragments of a smaller size than the ones obtained using the conventional methods, such as glass microneedles. We could pick up the fragment of the metaphase chromosome dissected by the knife-edged probe by using our tweezers-type probe
Prompt neutron emission from fragments in spontaneous fission of {sup 244,248}Cm and {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Vorobyev, A. S.; Shcherbakov, O. A. [Petersburg Nuclear Physics Institute, Gatchina, Leningrad district, 188300 (Russian Federation); Dushin, V. N.; Jakovlev, V. A.; Kalinin, V. A.; Petrov, B. F. [V.G. Khlopin Radium Institute, St. Petersburg, 194021 (Russian Federation); Hambsch, F.J [EC-JRC-Institute for Reference Materials and Measurements Retieseweg 111, B-2440 Geel (Belgium); Laptev, A. B. [Petersburg Nuclear Physics Institute, Gatchina, Leningrad district, 188300 (Russian Federation); Japan Nuclear Cycle Development Institute, Tokai-mura, Naka-gun, Ibaraki 319-1194 (Japan)
2005-07-01
Neutrons emitted in fission were measured separately for each complementary fragment in correlation with fission fragment energies. Two high efficiency Gd-loaded liquid scintillator tanks were used for neutron registration. Fission fragment energies were measured using a twin Frisch gridded ionization chamber with a pin-hole collimator. The neutron multiplicity distributions were obtained for each value of the fission fragment mass and energy and corrected for neutron registration efficiency, background and pile-up. The dependencies of these distributions on fragment mass and energy for different energy and mass bins, as well as the mass and energy distribution of the fission fragments are presented and discussed. (authors)
Research at the fragment mass analyser at ATLAS
International Nuclear Information System (INIS)
Davids, C.N.; Back, B.; Bearden, I.G.
1993-01-01
The experimental program at the Fragment Mass Analyzer (FMA) at the ATLAS heavy ion accelerator of the Argonne National Laboratory is described. The brief description and operational properties of the FMA are presented. The highest mass resolution obtained with the FMA is 525/1. Some experimental results are presented. 5 refs., 7 figs
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Mercury-induced fragmentation of n-decane and n-undecane in positive mode ion mobility spectrometry.
Gunzer, F
2015-09-21
Ion mobility spectrometry is a well-known technique for trace gas analysis. Using soft ionization techniques, fragmentation of analytes is normally not observed, with the consequence that analyte spectra of single substances are quite simple, i.e. showing in general only one peak. If the concentration is high enough, an extra cluster peak involving two analyte molecules can often be observed. When investigating n-alkanes, different results regarding the number of peaks in the spectra have been obtained in the past using this spectrometric technique. Here we present results obtained when analyzing n-alkanes (n-hexane to n-undecane) with a pulsed electron source, which show no fragmentation or clustering at all. However, when investigating a mixture of mercury and an n-alkane, a situation quite typical in the oil and gas industry, a strong fragmentation and cluster formation involving these fragments has been observed exclusively for n-decane and n-undecane.
The Y4-RNA fragment, a potential diagnostic marker, exists in saliva
Directory of Open Access Journals (Sweden)
Tatsuya Ishikawa
2017-06-01
Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon
Disturbance driven colony fragmentation as a driver of a coral disease outbreak.
Directory of Open Access Journals (Sweden)
Marilyn E Brandt
Full Text Available In September of 2010, Brewer's Bay reef, located in St. Thomas (U.S. Virgin Islands, was simultaneously affected by abnormally high temperatures and the passage of a hurricane that resulted in the mass bleaching and fragmentation of its coral community. An outbreak of a rapid tissue loss disease among coral colonies was associated with these two disturbances. Gross lesion signs and lesion progression rates indicated that the disease was most similar to the Caribbean coral disease white plague type 1. Experiments indicated that the disease was transmissible through direct contact between colonies, and five-meter radial transects showed a clustered spatial distribution of disease, with diseased colonies being concentrated within the first meter of other diseased colonies. Disease prevalence and the extent to which colonies were bleached were both significantly higher on unattached colony fragments than on attached colonies, and disease occurred primarily on fragments found in direct contact with sediment. In contrast to other recent studies, disease presence was not related to the extent of bleaching on colonies. The results of this study suggest that colony fragmentation and contact with sediment played primary roles in the initial appearance of disease, but that the disease was capable of spreading among colonies, which suggests secondary transmission is possible through some other, unidentified mechanism.
Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H
2011-01-01
Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.
Fragment informatics and computational fragment-based drug design: an overview and update.
Sheng, Chunquan; Zhang, Wannian
2013-05-01
Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.
Collins fragmentation function for pions and kaons in a spectator model
Energy Technology Data Exchange (ETDEWEB)
Bacchetta, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gamberg, L.P. [Penn State Univ., Berks, PA (United States). Dept. of Physics; Goldstein, G.R. [Tufts Univ., Medford, MA (United States). Dept. of Physics and Astronomy; Mukherjee, A. [Indian Institute of Technology Bombay, Mumbai (India). Physics Dept.
2007-07-15
We calculate the Collins fragmentation function in the framework of a spectator model with pseudoscalar pion-quark coupling and a Gaussian form factor at the vertex. We determine the model parameters by fitting the unpolarized fragmentation function for pions and kaons. We show that the Collins function for the pions in this model is in reasonable agreement with recent parametrizations obtained by fits of the available data. In addition, we compute for the first time the Collins function for the kaons. (orig.)
Anatomy and classification of the posterior tibial fragment in ankle fractures.
Bartoníček, Jan; Rammelt, Stefan; Kostlivý, Karel; Vaněček, Václav; Klika, Daniel; Trešl, Ivo
2015-04-01
The aim of this study was to analyze the pathoanatomy of the posterior fragment on the basis of a comprehensive CT examination, including 3D reconstructions, in a large patient cohort. One hundred and forty one consecutive individuals with an ankle fracture or fracture-dislocation of types Weber B or Weber C and evidence of a posterior tibial fragment in standard radiographs were included in the study. The mean patient age was 49 years (range 19-83 years). The exclusion criteria were patients below 18 years of age, inability to provide written consent, fractures of the tibial pilon, posttraumatic arthritis and pre-existing deformities. In all patients, post-injury radiographs were obtained in anteroposterior, mortise and lateral views. All patients underwent CT scanning in transverse, sagittal and frontal planes. 3D CT reconstruction was performed in 91 patients. We were able to classify 137 cases into one of the following four types with constant pathoanatomic features: type 1: extraincisural fragment with an intact fibular notch, type 2: posterolateral fragment extending into the fibular notch, type 3: posteromedial two-part fragment involving the medial malleolus, type 4: large posterolateral triangular fragment. In the 4 cases it was not possible to classify the type of the posterior tibial fragment. These were collectively termed type 5 (irregular, osteoporotic fragments). It is impossible to assess the shape and size of the posterior malleolar fragment, involvement of the fibular notch, or the medial malleolus, on the basis of plain radiographs. The system that we propose for classification of fractures of the posterior malleolus is based on CT examination and takes into account the size, shape and location of the fragment, stability of the tibio-talar joint and the integrity of the fibular notch. It may be a useful indication for surgery and defining the most useful approach to these injuries.
Lead bullet fragments in venison from rifle-killed deer: potential for human dietary exposure.
Directory of Open Access Journals (Sweden)
W Grainger Hunt
Full Text Available Human consumers of wildlife killed with lead ammunition may be exposed to health risks associated with lead ingestion. This hypothesis is based on published studies showing elevated blood lead concentrations in subsistence hunter populations, retention of ammunition residues in the tissues of hunter-killed animals, and systemic, cognitive, and behavioral disorders associated with human lead body burdens once considered safe. Our objective was to determine the incidence and bioavailability of lead bullet fragments in hunter-killed venison, a widely-eaten food among hunters and their families. We radiographed 30 eviscerated carcasses of White-tailed Deer (Odocoileus virginianus shot by hunters with standard lead-core, copper-jacketed bullets under normal hunting conditions. All carcasses showed metal fragments (geometric mean = 136 fragments, range = 15-409 and widespread fragment dispersion. We took each carcass to a separate meat processor and fluoroscopically scanned the resulting meat packages; fluoroscopy revealed metal fragments in the ground meat packages of 24 (80% of the 30 deer; 32% of 234 ground meat packages contained at least one fragment. Fragments were identified as lead by ICP in 93% of 27 samples. Isotope ratios of lead in meat matched the ratios of bullets, and differed from background lead in bone. We fed fragment-containing venison to four pigs to test bioavailability; four controls received venison without fragments from the same deer. Mean blood lead concentrations in pigs peaked at 2.29 microg/dL (maximum 3.8 microg/dL 2 days following ingestion of fragment-containing venison, significantly higher than the 0.63 microg/dL averaged by controls. We conclude that people risk exposure to bioavailable lead from bullet fragments when they eat venison from deer killed with standard lead-based rifle bullets and processed under normal procedures. At risk in the U.S. are some ten million hunters, their families, and low
Prompt Gamma Radiation from Fragments in the Thermal Fission of {sup 235}U
Energy Technology Data Exchange (ETDEWEB)
Albinsson, H [Chalmers Univ. of Technology, Goteborg (Sweden); Lindow, L [AB Atomenergi, Nykoeping (Sweden)
1970-06-15
Measurements were made on the gamma radiation emitted from fission fragments in slow neutron induced fission of {sup 235}U. The fragments were detected with solid state detectors of the surface barrier type and the gamma radiation with a Nal(Tl) scintillator. Mass selection was used so that the gamma radiation could be measured as a function of fragment mass. Time discrimination between the fission gammas and the prompt neutrons released in the fission process was employed to reduce the background. The gamma radiation emitted during different time intervals after the fission event was studied with the help of a collimator, the position of which was changed along the path of the fission fragments. In this way a decay curve was obtained from which the life-time of one of the gamma-emitting states could be estimated. The relative yield of the gamma-rays was determined as a function of mass for different gamma-ray energy portions and two specific time intervals after the fission events. Comparisons were made with data obtained from {sup 252} Cf-fission. Attention is drawn to some features which seem to be the same in {sup 235}U and {sup 252} Cf-fission.
Directory of Open Access Journals (Sweden)
Predrag Elek
2003-07-01
Full Text Available U radu se razmatra problem optimizacije mase parčadi koja nastaju fragmentacijom projektila parčadnog dejstva. Pokazano je da optimalna masa parčeta prvenstveno zavisi od njegovih kinetičkih karakteristika na cilju kao i od usvojenog kriterijuma efikasnosti. Proračuni pokazuju da su postojeći kriterijumi, minimalna zahtevana kinetička energija fragmenta odnosno minimalna kinetička energija po jedinici napadne površine, nesaglasni - odnosno da daju bitno različite vrednosti optimalne mase. Zaključeno je da kriterijum specifične energije parčeta podrazumeva manju masu optimalnog parčeta i ukazuje na značaj parčadi veoma male mase sa stanovišta efikasnosti. Jasno je da ovako određena optimalna masa efikasnog parčeta predstavlja veoma važan parametar projektila parčadnog dejstva, pa je neophodna eksperimentalna verifikacija dobijenih teorijskih rezultata. / This paper considers the problem of optimizing the mass of HE projectile fragments. It is shown that the optimum fragment mass is a function of its kinetic characteristics at the target and an adopted efficiency criterion. Computations show that the most prominent criteria, minimum required kinetic energy and minimum kinetic energy per unit of cross--sectional area, are incompatible - i. e. they provide significantly different values of the optimum mass. It is concluded that the criterion of specific kinetic energy corresponds to a lower optimum fragment mass, which indicates the importance of fragments of low masses from the aspect of efficiency. The theoretically determined optimum fragment mass represents a very significant parameter for design optimization of fragmentation projectiles, but experimental verification of obtained results is essentially important as well.
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971
Fragmentation Energy-Saving Theory of Full Face Rock Tunnel Boring Machine Disc Cutters
Zhang, Zhao-Huang; Gong, Guo-Fang; Gao, Qing-Feng; Sun, Fei
2017-07-01
Attempts to minimize energy consumption of a tunnel boring machine disc cutter during the process of fragmentation have largely focused on optimizing disc-cutter spacing, as determined by the minimum specific energy required for fragmentation; however, indentation tests showed that rock deforms plastically beneath the cutters. Equations for thrust were developed for both the traditional, popularly employed disc cutter and anew design based on three-dimensional theory. The respective energy consumption for penetration, rolling, and side-slip fragmentations were obtained. A change in disc-cutter fragmentation angles resulted in a change in the nature of the interaction between the cutter and rock, which lowered the specific energy of fragmentation. During actual field excavations to the same penetration length, the combined energy consumption for fragmentation using the newly designed cutters was 15% lower than that when using the traditional design. This paper presents a theory for energy saving in tunnel boring machines. Investigation results showed that the disc cutters designed using this theory were more durable than traditional designs, and effectively lowered the energy consumption.
Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.
Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N
2016-01-01
Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.
Fractal statistics of brittle fragmentation
Directory of Open Access Journals (Sweden)
M. Davydova
2013-04-01
Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.
International Nuclear Information System (INIS)
Heinrich, S.
2006-01-01
Nucleus fission process is a very complex phenomenon and, even nowadays, no realistic models describing the overall process are available. The work presented here deals with a theoretical description of fission fragments distributions in mass, charge, energy and deformation. We have reconsidered and updated the B.D. Wilking Scission Point model. Our purpose was to test if this statistic model applied at the scission point and by introducing new results of modern microscopic calculations allows to describe quantitatively the fission fragments distributions. We calculate the surface energy available at the scission point as a function of the fragments deformations. This surface is obtained from a Hartree Fock Bogoliubov microscopic calculation which guarantee a realistic description of the potential dependence on the deformation for each fragment. The statistic balance is described by the level densities of the fragment. We have tried to avoid as much as possible the input of empirical parameters in the model. Our only parameter, the distance between each fragment at the scission point, is discussed by comparison with scission configuration obtained from full dynamical microscopic calculations. Also, the comparison between our results and experimental data is very satisfying and allow us to discuss the success and limitations of our approach. We finally proposed ideas to improve the model, in particular by applying dynamical corrections. (author)
Kobayashi, Yasukazu; Yasuda, Kazunori; Kondo, Eiji; Katsura, Taro; Tanabe, Yoshie; Kimura, Masashi; Tohyama, Harukazu
2010-04-01
Concerning meniscal tissue regeneration, many investigators have studied the development of a tissue-engineered meniscus. However, the utility still remains unknown. Implantation of autogenous meniscal fragments wrapped with a fascia sheath into the donor site meniscal defect may significantly enhance fibrocartilage regeneration in vivo in the defect. Controlled laboratory study. Seventy-five mature rabbits were used in this study. In each animal, an anterior one-third of the right medial meniscus was resected. Then, the animals were divided into the following 3 groups of 25 rabbits each: In group 1, no treatment was applied to the meniscal defect. In group 2, the defect was covered with a fascia sheath. In group 3, after the resected meniscus was fragmented into small pieces, the fragments were grafted into the defect. Then, the defect with the meniscal fragments was covered with a fascia sheath. In each group, 5 rabbits were used for histological evaluation at 3, 6, and 12 weeks after surgery, and 5 rabbits were used for biomechanical evaluation at 6 and 12 weeks after surgery. Histologically, large round cells in group 3 were scattered in the core portion of the meniscus-shaped tissue, and the matrix around these cells was positively stained by safranin O and toluisin blue at 12 weeks. The histological score of group 3 was significantly higher than that of group 1 and group 2. Biomechanically, the maximal load and stiffness of group 3 were significantly greater than those of groups 1 and 2. This study clearly demonstrated that implantation of autogenous meniscal fragments wrapped with a fascia sheath into the donor site meniscal defect significantly enhanced fibrocartilage regeneration in vivo in the defect at 12 weeks after implantation in the rabbit. This study proposed a novel strategy to treat a large defect after a meniscectomy.
Vitrification and xenografting of human ovarian tissue.
Amorim, Christiani Andrade; Dolmans, Marie-Madeleine; David, Anu; Jaeger, Jonathan; Vanacker, Julie; Camboni, Alessandra; Donnez, Jacques; Van Langendonckt, Anne
2012-11-01
To assess the efficiency of two vitrification protocols to cryopreserve human preantral follicles with the use of a xenografting model. Pilot study. Gynecology research unit in a university hospital. Ovarian biopsies were obtained from seven women aged 30-41 years. Ovarian tissue fragments were subjected to one of three cryopreservation protocols (slow freezing, vitrification protocol 1, and vitrification protocol 2) and xenografted for 1 week to nude mice. The number of morphologically normal follicles after cryopreservation and grafting and fibrotic surface area were determined by histologic analysis. Apoptosis was assessed by the TUNEL method. Morphometric analysis of TUNEL-positive surface area also was performed. Follicle proliferation was evaluated by immunohistochemistry. After xenografting, a difference was observed between the cryopreservation procedures applied. According to TUNEL analysis, both vitrification protocols showed better preservation of preantral follicles than the conventional freezing method. Moreover, histologic evaluation showed a significantly higher proportion of primordial follicles in vitrified (protocol 2)-warmed ovarian tissue than in frozen-thawed tissue. The proportion of growing follicles and fibrotic surface area was similar in all groups. Vitrification procedures appeared to preserve not only the morphology and survival of preantral follicles after 1 week of xenografting, but also their ability to resume folliculogenesis. In addition, vitrification protocol 2 had a positive impact on the quiescent state of primordial follicles after xenografting. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Evaluation of thyroid tissue by Raman spectroscopy
Teixeira, C. S. B.; Bitar, R. A.; Santos, A. B. O.; Kulcsar, M. A. V.; Friguglietti, C. U. M.; Martinho, H. S.; da Costa, R. B.; Martin, A. A.
2010-02-01
Thyroid gland is a small gland in the neck consisting of two lobes connected by an isthmus. Thyroid's main function is to produce the hormones thyroxine (T4), triiodothyronine (T3) and calcitonin. Thyroid disorders can disturb the production of these hormones, which will affect numerous processes within the body such as: regulating metabolism and increasing utilization of cholesterol, fats, proteins, and carbohydrates. The gland itself can also be injured; for example, neoplasias, which have been considered the most important, causing damage of to the gland and are difficult to diagnose. There are several types of thyroid cancer: Papillary, Follicular, Medullary, and Anaplastic. The occurrence rate, in general is between 4 and 7%; which is on the increase (30%), probably due to new technology that is able to find small thyroid cancers that may not have been found previously. The most common method used for thyroid diagnoses are: anamnesis, ultrasonography, and laboratory exams (Fine Needle Aspiration Biopsy- FNAB). However, the sensitivity of those test are rather poor, with a high rate of false-negative results, therefore there is an urgent need to develop new diagnostic techniques. Raman spectroscopy has been presented as a valuable tool for cancer diagnosis in many different tissues. In this work, 27 fragments of the thyroid were collected from 18 patients, comprising the following histologic groups: goitre adjacent tissue, goitre nodular tissue, follicular adenoma, follicular carcinoma, and papillary carcinoma. Spectral collection was done with a commercial FTRaman Spectrometer (Bruker RFS100/S) using a 1064 nm laser excitation and Ge detector. Principal Component Analysis, Cluster Analysis, and Linear Discriminant Analysis with cross-validation were applied as spectral classification algorithm. Comparing the goitre adjacent tissue with the goitre nodular region, an index of 58.3% of correct classification was obtained. Between goitre (nodular region and
Directory of Open Access Journals (Sweden)
Zhengqi Chang
Full Text Available To date, various types of cells for seeding regenerative scaffolds have been used for bone tissue engineering. Among seed cells, the mesenchymal stem cells derived from human umbilical cord Wharton's jelly (hUCMSCs represent a promising candidate and hold potential for bone tissue engineering due to the the lack of ethical controversies, accessibility, sourced by non-invasive procedures for donors, a reduced risk of contamination, osteogenic differentiation capacities, and higher immunomodulatory capacity. However, the current culture methods are somewhat complicated and inefficient and often fail to make the best use of the umbilical cord (UC tissues. Moreover, these culture processes cannot be performed on a large scale and under strict quality control. As a result, only a small quantity of cells can be harvested using the current culture methods. To solve these problems, we designed and evaluated an UC Wharton's jelly repeated culture device. Using this device, hUCMSCs were obtained from the repeated cultures and their quantities and biological characteristics were compared. We found that using our culture device, which retained all tissue blocks on the bottom of the dish, the total number of obtained cells increased 15-20 times, and the time required for the primary passage was reduced. Moreover, cells harvested from the repeated cultures exhibited no significant difference in their immunophenotype, potential for multilineage differentiation, or proliferative, osteoinductive capacities, and final osteogenesis. The application of the repeated culture frame (RCF not only made full use of the Wharton's jelly but also simplified and specified the culture process, and thus, the culture efficiency was significantly improved. In summary, abundant hUCMSCs of dependable quality can be acquired using the RCF.
Liou, Jer-Chyi; Clark, S.; Fitz-Coy, N.; Huynh, T.; Opiela, J.; Polk, M.; Roebuck, B.; Rushing, R.; Sorge, M.; Werremeyer, M.
2013-01-01
The goal of the DebriSat project is to characterize fragments generated by a hypervelocity collision involving a modern satellite in low Earth orbit (LEO). The DebriSat project will update and expand upon the information obtained in the 1992 Satellite Orbital Debris Characterization Impact Test (SOCIT), which characterized the breakup of a 1960 s US Navy Transit satellite. There are three phases to this project: the design and fabrication of DebriSat - an engineering model representing a modern, 60-cm/50-kg class LEO satellite; conduction of a laboratory-based hypervelocity impact to catastrophically break up the satellite; and characterization of the properties of breakup fragments down to 2 mm in size. The data obtained, including fragment size, area-to-mass ratio, density, shape, material composition, optical properties, and radar cross-section distributions, will be used to supplement the DoD s and NASA s satellite breakup models to better describe the breakup outcome of a modern satellite.
Fragmentation of anthracene induced by collisions with 40 keV Ar8+ ions
International Nuclear Information System (INIS)
Brédy, R; Ortéga, C; Ji, M; Bernard, J; Chen, L; Montagne, G; Martin, S
2013-01-01
We report on the fragmentation of anthracene molecular ions C 14 H 10 r+ as a function of the parent ion initial charge r (= 1–4). Neutral anthracene molecules in the gas phase were ionized and excited in collisions with Ar 8+ ions at 40 keV and the mass-to-charge spectra of the parent ions C 14 H 10 r+ (1 ⩽ r ⩽ 4) were obtained. Stable molecular ions C 14 H 10 r+ (1 ⩽ r ⩽ 3) are observed. Branching ratios for the competitive evaporation (loss of neutral fragments) and fragmentation (charge separation) processes were measured for C 14 H 10 2+ parent ions. For C 14 H 10 3+ parent ions, the results indicate that fragmentation is the only dominant process and quasi-symmetric fission is observed. (paper)
Renormalization of the fragmentation equation: Exact self-similar solutions and turbulent cascades
Saveliev, V. L.; Gorokhovski, M. A.
2012-12-01
Using an approach developed earlier for renormalization of the Boltzmann collision integral [Saveliev and Nanbu, Phys. Rev. E1539-375510.1103/PhysRevE.65.051205 65, 051205 (2002)], we derive an exact divergence form for the fragmentation operator. Then we reduce the fragmentation equation to the continuity equation in size space, with the flux given explicitly. This allows us to obtain self-similar solutions and to find the integral of motion for these solutions (we call it the bare flux). We show how these solutions can be applied as a description of cascade processes in three- and two-dimensional turbulence. We also suggested an empirical cascade model of impact fragmentation of brittle materials.
Gimenez, Magalí Diana; Yañez-Santos, Anahí Mara; Paz, Rosalía Cristina; Quiroga, Mariana Paola; Marfil, Carlos Federico; Conci, Vilma Cecilia; García-Lampasona, Sandra Claudia
2016-01-01
This is the first report assessing epigenetic variation in garlic. High genetic and epigenetic polymorphism during in vitro culture was detected.Sequencing of MSAP fragments revealed homology with ESTs. Garlic (Allium sativum) is a worldwide crop of economic importance susceptible to viral infections that can cause significant yield losses. Meristem tissue culture is the most employed method to sanitize elite cultivars.Often the virus-free garlic plants obtained are multiplied in vitro (micro propagation). However, it was reported that micro-propagation frequently produces somaclonal variation at the phenotypic level, which is an undesirable trait when breeders are seeking to maintain varietal stability. We employed amplification fragment length polymorphism and methylation sensitive amplified polymorphism (MSAP) methodologies to assess genetic and epigenetic modifications in two culture systems: virus-free plants obtained by meristem culture followed by in vitro multiplication and field culture. Our results suggest that garlic exhibits genetic and epigenetic polymorphism under field growing conditions. However, during in vitro culture system both kinds of polymorphisms intensify indicating that this system induces somaclonal variation. Furthermore, while genetic changes accumulated along the time of in vitro culture, epigenetic polymorphism reached the major variation at 6 months and then stabilize, being demethylation and CG methylation the principal conversions.Cloning and sequencing differentially methylated MSAP fragments allowed us to identify coding and unknown sequences of A. sativum, including sequences belonging to LTR Gypsy retrotransposons. Together, our results highlight that main changes occur in the initial 6 months of micro propagation. For the best of our knowledge, this is the first report on epigenetic assessment in garlic.
Energy Technology Data Exchange (ETDEWEB)
Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)
2014-02-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.
International Nuclear Information System (INIS)
Brax, Philippe; Upadhye, Amol
2014-01-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments
Evaluation of tumor targeting with radiolabeled F(ab2 fragment of a humanized monoclonal antibody
Directory of Open Access Journals (Sweden)
"Babaei MH
2002-08-01
Full Text Available Humanized monoclonal antibody U36 and its F(ab'2 fragment, radio labeled with 125I, were tested for tumor localization in nude mice bearing a squamous cell carcinoma xenograft line derived from a head and neck carcinoma. Monoclonal antibody IgG or F(ab'2 fragment were injected in parallel and at days 1, 2 and 3, mice were dissected for determination of isotope biodistribution. IgG as well as F(ab'2 showed highly specific localization in tumor tissue. The mean tumor uptake (n=3 is expressed as the percentage of the injected dose per gram of tumor tissue (%ID/g. %ID/g of IgG was 11.7% at day 1 and decreased to 10.9% at day 3 whereas %ID/g of F(ab'2 was 2.9% at day 1 and decreased on following days. Tumor to blood ratios (T/B at day 1 were 0.86 for IgG and 1.32 for F(ab'2 and reached a maximum at day 3 with values of 4.41 and 1.84 respectively. These findings suggest that the superior tumor to non-tumor ratios in the day of 1 render the F(ab'2 fragment more qualified for specific targeting radioisotopes to tumor xenografts in this exprimental setting.
International Nuclear Information System (INIS)
Daskalova, A; Kasperski, G; Rousseau, P; Domaracka, A; Lawicki, A
2014-01-01
TOF-SIMS mass spectroscopy data are presented on ion irradiation of hard dental tissue using a beam of 129 Xe 20+ (15 kV) ions delivered in the ARIBE facility by an ECR source. The investigation was focused on the mass distribution of the fragment ions. A comparison is made between the mass spectra from hard dental tissue treated by olaflur-(C 27 H 60 F 2 N 2 O 3 ) and untreated hard dental tissue obtained under irradiation by low-energy highly-charged ions (HCIs). We found significant differences between the mass spectra of enamel after introducing amine fluoride (olaflur) and the mass spectra of pure untreated enamel. Further, we separated out the effects caused by radiation induced in the tooth enamel from those induced in dentin, which has not been performed before. In order to conduct a further detailed analysis, it is necessary to extend the research scope to include the influence of fluorine compounds on enamel and dentin.
Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L
2015-01-01
Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.
Chung, Hee Sok
2016-01-01
We compute leading-power fragmentation corrections to hadroproduction of charmonium states J/ψ, χcJ , and ψ(2S) in the nonrelativistic QCD factorization formalism. We include fragmentation functions through order α 2 s and parton production cross sections through order α 3 s . We also resum leading logarithms of the transverse momentum divided by the charm-quark mass to all orders in αs . We find that the fragmentation corrections have a significant impact on the hadroproduction cross section of charmonia. We obtain good fits to the hadroproduction cross sections measured at the Tevatron and the LHC. Using the long-distance matrix elements obtained from the fits, we make predictions for prompt J/ψ polarization that are in good agreement with the LHC data.
Energy Technology Data Exchange (ETDEWEB)
Flores, Dyan V.; Smitaman, Edward; Huang, Brady K.; Resnick, Donald L. [University of California San Diego Medical Center, Department of Radiology, San Diego, CA (United States)
2016-12-15
To re-evaluate the Segond fragment emphasizing those structures that attach to the fragment in patients with reported acute/subacute anterior cruciate ligament (ACL) injuries, and to clarify the nomenclature used to describe these structures. A search of databases of knee MR examinations over 4.5 years with reported ACL tears yielded 19,726 studies. Using strict exclusion criteria, a total of 146 MR studies with acute/subacute ACL tears were re-assessed with respect to the Segond fragment's size, shape, orientation, location, displacement, attaching soft tissue structures, and associated osseous and/or soft tissue injuries. Segond fractures were present in 1.25 % of reported acute/subacute ACL tears. The fragment measured 11.9 x 7.3 x 3.27 mm, being thin, ovoid, vertically oriented, situated anterolaterally along the proximal tibial epiphysis, posterior to Gerdy's tubercle and inferior to the lateral tibial plateau, and displaced up to 6 mm laterally. The attached structures were the meniscotibial component of the mid-third lateral capsular ligament (mt-MTLCL) in 58.9 %, both the mt-MTLCL and the posterior fibers of the ITB (pf-ITB) in 35.6 %, and the pf-ITB in 5.48 % of cases. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. The mt-MTLCL most commonly attaches to the Segond fragment, but the pf-ITB can also attach to this fragment. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. (orig.)
Telomere length in normal and neoplastic canine tissues.
Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R
2007-12-01
To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.
Raising an Antibody Specific to Breast Cancer Subpopulations Using Phage Display on Tissue Sections
DEFF Research Database (Denmark)
Larsen, Simon Asbjørn; Meldgaard, Theresa; Fridriksdottir, Agla Jael Rubner
2016-01-01
BACKGROUND/AIM: Primary tumors display a great level of intra-tumor heterogeneity in breast cancer. The current lack of prognostic and predictive biomarkers limits accurate stratification and the ability to predict response to therapy. The aim of the present study was to select recombinant antibody...... fragments specific against breast cancer subpopulations, aiding the discovery of novel biomarkers. MATERIALS AND METHODS: Recombinant antibody fragments were selected by phage display. A novel shadowstick technology enabled the direct selection using tissue sections of antibody fragments specific against...
Fracture mechanics model of stone comminution in ESWL and implications for tissue damage
Lokhandwalla, Murtuza; Sturtevant, Bradford
2000-07-01
Focused shock waves administered during extracorporeal shock-wave lithotripsy (ESWL) cause stone fragmentation. The process of stone fragmentation is described in terms of a dynamic fracture process. As is characteristic of all brittle materials, fragmentation requires nucleation, growth and coalescence of flaws, caused by a tensile or shear stress. The mechanisms, operative in the stone, inducing these stresses have been identified as spall and compression-induced tensile microcracks, nucleating at pre-existing flaws. These mechanisms are driven by the lithotripter-generated shock wave and possibly also by cavitation effects in the surrounding fluid. In this paper, the spall mechanism has been analysed, using a cohesive-zone model for the material. The influence of shock wave parameters, and physical properties of stone, on stone comminution is described. The analysis suggests a potential means to exploit the difference between the stone and tissue physical properties, so as to make stone comminution more effective, without increasing tissue damage.
Universality of projectile fragmentation model
International Nuclear Information System (INIS)
Chaudhuri, G.; Mallik, S.; Das Gupta, S.
2012-01-01
Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation
Fragment emission in the interaction of xenon with 1-20 GeV protons
International Nuclear Information System (INIS)
Porile, N.T.; Bujak, A.J.; Carmony, D.D.; Chung, Y.H.; Gutay, L.J.; Hirsch, A.S.; Mahi, M.; Paderewski, G.L.; Sangster, T.C.; Scharenberg, R.P.; Stringfellow, B.C.
1989-01-01
Differential cross sections for the emission of intermediate mass fragments in the interaction of xenon with 1-20 GeV protons have been measured. The cross sections increase sharply with energy up to 10 GeV and then level off. The energy spectra were fitted with an expression based on the phase transition droplet model and excellent fits were obtained above 9 GeV. Below 6 GeV, the fits show an increasing contribution from another mechanism, believed to be binary breakup. A droplet model fit to the cross sections ascribed to the multi-fragmentation component is able to reproduce their variation with both fragment mass and proton energy
Suitability of the Cellient (TM) cell block method for diagnosing soft tissue and bone tumors
Song, W.; van Hemel, B. M.; Suurmeijer, A. J. H.
BACKGROUNDThe diagnosis of tumors of soft tissue and bone (STB) heavily relies on histological biopsies, whereas cytology is not widely used. Cellient(TM) cell blocks often contain small tissue fragments. In addition to Hematoxylin and Eosin (H&E) interpretation of histological features,
Immunohistochemical abnormalities of fibrillin in cardiovascular tissues in Marfan's syndrome.
Fleischer, K J; Nousari, H C; Anhalt, G J; Stone, C D; Laschinger, J C
1997-04-01
Molecular defects in the glycoprotein fibrillin are believed to be responsible for impaired structural integrity of cardiovascular, skeletal, and ocular tissues in Marfan's syndrome (MFS). Traditionally, excellent results have been achieved with the Bentall composite graft repair of aneurysms of the ascending aorta in MFS. However, because of the potential complications associated with prosthetic valves, there is growing interest in techniques that preserve the native aortic valve. Between May 1994 and February 1995, 15 patients with a history of concomitant or remote aortic root aneurysms or dissection underwent operation for valvular heart disease. Specimens of aortic valve, ascending aortic wall, and mitral valve were obtained specifically to observe differences in fibrillin content and architecture between patients with (n = 9) and without (n = 6) MFS. In addition, control specimens of aortic valve, aortic wall, and mitral valve were obtained from 4 patients with isolated valvular or coronary artery disease but no evidence of connective tissue disorders or other aortic pathologic conditions. Fibrillin immunostaining using indirect immunofluorescence was used. Specimens were coded and graded by a blinded observer to determine quantity, homogeneity, and fragmentation of fibrillin. Observed fibrillin abnormalities in MFS and control patients were limited to the midportion (elastin-associated microfibrils) of the aortic valve, aortic wall, and mitral valve tissues. Fibrillin abnormalities of aortic valve, aortic wall, and mitral valve tissues were seen in all patients with MFS and were most severe in those older than 20 years. Similar fibrillin abnormalities of aortic valve and aortic wall specimens were observed in control patients more than 60 years old. Even in the setting of a normal-appearing aortic valve, the current rationale for widespread use of valve-sparing repairs of aortic root aneurysms in patients with MFS and patients older than 60 years should be
Preparation of UO2 fragments for fuel-debris experiments
International Nuclear Information System (INIS)
Tinkle, M.C.; Kircher, J.A.; Zinn, R.M.; Eash, D.T.
1982-01-01
A unique process was developed for preparing multi-kilogram quantities of > 90% dense fragments of enriched and depleted UO 2 sized 20 mm to 0.038 mm for fuel debris experiments. Precipitates of UO 4 . xH 2 O were treated to obtain UO 2 powders that would yield large cohesive green pieces when isostatically pressed to 206 MPa. The pressed pieces were crushed into fragments that were about 30% oversized, and heated to 1800 0 C for 24 h in H 2 . Oversizing compensates for shrinkage during densification. Effort was dramatically reduced by working on a large scale and by presizing the green UO 2 instead of directly crushing densified pellets
Computational medicinal chemistry in fragment-based drug discovery: what, how and when.
Rabal, Obdulia; Urbano-Cuadrado, Manuel; Oyarzabal, Julen
2011-01-01
The use of fragment-based drug discovery (FBDD) has increased in the last decade due to the encouraging results obtained to date. In this scenario, computational approaches, together with experimental information, play an important role to guide and speed up the process. By default, FBDD is generally considered as a constructive approach. However, such additive behavior is not always present, therefore, simple fragment maturation will not always deliver the expected results. In this review, computational approaches utilized in FBDD are reported together with real case studies, where applicability domains are exemplified, in order to analyze them, and then, maximize their performance and reliability. Thus, a proper use of these computational tools can minimize misleading conclusions, keeping the credit on FBDD strategy, as well as achieve higher impact in the drug-discovery process. FBDD goes one step beyond a simple constructive approach. A broad set of computational tools: docking, R group quantitative structure-activity relationship, fragmentation tools, fragments management tools, patents analysis and fragment-hopping, for example, can be utilized in FBDD, providing a clear positive impact if they are utilized in the proper scenario - what, how and when. An initial assessment of additive/non-additive behavior is a critical point to define the most convenient approach for fragments elaboration.
International Nuclear Information System (INIS)
Buchegger, F.; Halpern, S.E.; Sutherland, R.M.; Schreyer, M.; Mach, J.P.; Rochester Univ., NY
1986-01-01
Colon carcinoma multicellular spheroids were incubated in vitro with radiolabelled MAbs. The more rapid penetration of fragments as compared to intact MAbs was clearly demonstrated. For the study of antibody localization in tumors in vivo, the model of nude mice with ligated kidneys was used. Although very artificial, this model allowed to demonstrate that, without urinary excretion, Fab fragments accumulated more rapidly into the tumor than intact MAbs and disappeared faster from the blood. This difference was less striking for F(ab') 2 fragments. In the liver a decreased accumulation of both types of fragments as compared to intact MAbs was observed. Concerning radio-immunotherapy we think that Fab fragments are not useful because of their too short half-life the circulation and in tumor and because they will probably be too toxic for the kidneys. Intact MAbs and F(ab') 2 fragments have each their advantages. Intact MAbs show highest tumor accumulation in mice without ligated kidney, however, they remain mostly on the periphery of tumor nodules, as shown by autoradiography. F(ab') 2 fragments have been found to penetrate deeper into the tumor and to accumulate less in the liver. It might be therefore an advantage to combine intact MAbs with F(ab') 2 fragments, so that in the tumor two different regions could be attacked whereas in normal tissues toxicity could be distributed to different organs such as to the liver with intact MAbs and to the kidney with F(ab') 2 fragments. (orig.) [de
Robust Object Tracking Using Valid Fragments Selection.
Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang
Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
Es-Safi, Nour-Eddine; Kerhoas, Lucien; Ducrot, Paul-Henri
2007-01-01
Mass spectrometric methodology based on the combined use of positive and negative electrospray ionization, collision-induced dissociation (CID) and tandem mass spectrometry (MS/MS) has been applied to the mass spectral study of a series of six naturally occurring iridoids through in-source fragmentation of the protonated [M+H]+, deprotonated [M--H]- and sodiated [M+Na]+ ions. This led to the unambiguous determination of the molecular masses of the studied compounds and allowed CID spectra of the molecular ions to be obtained. Valuable structural information regarding the nature of both the glycoside and the aglycone moiety was thus obtained. Glycosidic cleavage and ring cleavages of both aglycone and sugar moieties were the major fragmentation pathways observed during CID, where the losses of small molecules, the cinnamoyl and the cinnamate parts were also observed. The formation of the ionized aglycones, sugars and their product ions was thus obtained giving information on their basic skeleton. The protonated, i.e. [M+H]+ and deprotonated [M--H]-, ions were found to fragment mainly by glycosidic cleavages. MS/MS spectra of the [M+Na]+ ions gave complementary information for the structural characterization of the studied compounds. Unlike the dissociation of protonated molecular ions, that of sodiated molecules also provided sodiated sugar fragments where the C0+ fragment corresponding to the glucose ion was obtained as base peak for all the studied compounds. Copyright (c) 2007 John Wiley & Sons, Ltd.
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Self-organized criticality in fragmenting
DEFF Research Database (Denmark)
Oddershede, L.; Dimon, P.; Bohr, J.
1993-01-01
The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...
In silico fragmentation for computer assisted identification of metabolite mass spectra
Directory of Open Access Journals (Sweden)
Müller-Hannemann Matthias
2010-03-01
Full Text Available Abstract Background Mass spectrometry has become the analytical method of choice in metabolomics research. The identification of unknown compounds is the main bottleneck. In addition to the precursor mass, tandem MS spectra carry informative fragment peaks, but the coverage of spectral libraries of measured reference compounds are far from covering the complete chemical space. Compound libraries such as PubChem or KEGG describe a larger number of compounds, which can be used to compare their in silico fragmentation with spectra of unknown metabolites. Results We created the MetFrag suite to obtain a candidate list from compound libraries based on the precursor mass, subsequently ranked by the agreement between measured and in silico fragments. In the evaluation MetFrag was able to rank most of the correct compounds within the top 3 candidates returned by an exact mass query in KEGG. Compared to a previously published study, MetFrag obtained better results than the commercial MassFrontier software. Especially for large compound libraries, the candidates with a good score show a high structural similarity or just different stereochemistry, a subsequent clustering based on chemical distances reduces this redundancy. The in silico fragmentation requires less than a second to process a molecule, and MetFrag performs a search in KEGG or PubChem on average within 30 to 300 seconds, respectively, on an average desktop PC. Conclusions We presented a method that is able to identify small molecules from tandem MS measurements, even without spectral reference data or a large set of fragmentation rules. With today's massive general purpose compound libraries we obtain dozens of very similar candidates, which still allows a confident estimate of the correct compound class. Our tool MetFrag improves the identification of unknown substances from tandem MS spectra and delivers better results than comparable commercial software. MetFrag is available through a web
Energy Technology Data Exchange (ETDEWEB)
Martinet, G
2004-05-01
The aim of this work is to understand the fragmentation of small neutral carbon clusters formed by high velocity atomic collision on atomic gas. In this experiment, the main way of deexcitation of neutral clusters formed by electron capture with ionic species is the fragmentation. To measure the channels of fragmentation, a new detection tool based on shape analysis of current pulse delivered by semiconductor detectors has been developed. For the first time, all branching ratios of neutral carbon clusters are measured in an unambiguous way for clusters size up to 10 atoms. The measurements have been compared to a statistical model in microcanonical ensemble (Microcanonical Metropolis Monte Carlo). In this model, various structural properties of carbon clusters are required. These data have been calculated with Density Functional Theory (DFT-B3LYP) to find the geometries of the clusters and then with Coupled Clusters (CCSD(T)) formalism to obtain dissociation energies and other quantities needed to compute fragmentation calculations. The experimental branching ratios have been compared to the fragmentation model which has allowed to find an energy distribution deposited in the collision. Finally, specific cluster effect has been found namely a large population of excited states. This behaviour is completely different of the atomic carbon case for which the electron capture in the ground states predominates. (author)
Energy production using fission fragment rockets
International Nuclear Information System (INIS)
Chapline, G.; Matsuda, Y.
1991-08-01
Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs
International Nuclear Information System (INIS)
Ghaffary, Tooraj
2016-01-01
By the use of data from the annihilation process of electron-positron in AMY detector at 60 GeV center of mass energy, charged particles multiplicity distribution is obtained and fitted with the KNO scaling. Then, momentum spectra of charged particles and momentum distribution with respect to the jet axis are obtained, and the results are compared to the different models of QCD; also, the distribution of fragmentation functions and scaling violations are studied. It is being expected that the scaling violations of the fragmentation functions of gluon jets are stronger than the quark ones. One of the reasons for such case is that splitting function of quarks is larger than splitting function of gluon.
Fragmentation of relativistic nuclei
International Nuclear Information System (INIS)
Cork, B.
1975-06-01
Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)
Energy Technology Data Exchange (ETDEWEB)
Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-07-01
This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de
Thermodynamics of the fuel fragmentation gas
International Nuclear Information System (INIS)
Perez, R.B.; Alsmiller, R.G. Jr.
1977-01-01
In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented
Directory of Open Access Journals (Sweden)
Julio A. Alonso
2013-02-01
Full Text Available Density Functional Theory has been used to model the Diels-Alder reactions of the fullerene fragments triindenetriphenilene and pentacyclopentacorannulene with ethylene and 1,3-butadiene. The purpose is to prove the feasibility of using Diels-Alder cycloaddition reactions to grow fullerene fragments step by step, and to dimerize fullerene fragments, as a way to obtain C60. The dienophile character of the fullerene fragments is dominant, and the reaction of butadiene with pentacyclopentacorannulene is favored.
Deformation energy of a toroidal nucleus and plane fragmentation barriers
International Nuclear Information System (INIS)
Fauchard, C.; Royer, G.
1996-01-01
The path leading to pumpkin-like configurations and toroidal shapes is investigated using a one-parameter shape sequence. The deformation energy is determined within the analytical expressions obtained for the various shape-dependent functions and the generalized rotating liquid drop model taking into account the proximity energy and the temperature. With increasing mass and angular momentum, a potential well appears in the toroidal shape path. For the heaviest systems, the pocket is large and locally favourable with respect to the plane fragmentation barriers which might allow the formation of evanescent toroidal systems which would rapidly decay in several fragments to minimize the surface tension. (orig.)
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Models of fragmentation with composite power laws
Tavassoli, Z.; Rodgers, G. J.
1999-06-01
Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.
Thermodynamical string fragmentation
Energy Technology Data Exchange (ETDEWEB)
Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)
2017-01-31
The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.
Kinetics of fragmentation-annihilation processes
Filipe, JAN; Rodgers, GJ
1996-01-01
We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...
Energy Technology Data Exchange (ETDEWEB)
Takagi, K; Kawai, T [Jichi Medical School, Kawachi, Tochigi (Japan)
1978-02-01
Upon the plasmin digestion of human fibrinogen, an early cleavage product, which has been designated as fragment A, was isolated, and to study the action of plasmin in the circulation, radioimmunoassay for fragment A was carried out. This assay used rabbit immune serum obtained by injection of fragment A mixed with complete Freund's adjuvant, and fragment A was labelled with /sup 125/I using the Chloramin-T method. In 20 normal healthy donors its serum level was 3.57 +- 1.62..mu..g/ml (mean+-SD), and it was increased significantly in certain diseases, such as acute leukemias, candiovascular disorders, malignancies, renal failure, systemic lupus erythematosus and sepsis.
Fission fragment spins and spectroscopy
International Nuclear Information System (INIS)
Durell, J.L.
1988-01-01
Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission
Energy Technology Data Exchange (ETDEWEB)
Nishio, Katsuhisa; Yamamoto, Hideki; Kimura, Itsuro; Nakagome, Yoshihiro [Kyoto Univ. (Japan)
1997-03-01
Simultaneous measurement of fission fragments and prompt neutrons following the thermal neutron induced fission of U-235 has been performed in order to obtain the neutron multiplicity (v) and its emission energy ({eta}) against the specified mass (m{sup *}) and the total kinetic energy (TKE). The obtained value of -dv/dTKE(m{sup *}) showed a saw-tooth distribution. The average neutron energy <{eta}>(m{sup *}) had a distribution with a reflection symmetry around the half mass division. The measurement also gave the level density parameters of the specified fragment, a(m{sup *}), and this parameters showed a saw-tooth trend too. The analysis by a phenomenological description of this parameters including the shell and collective effects suggested the existence of a collective motion of the fission fragments. (author)
Directory of Open Access Journals (Sweden)
Laura Morelli
2014-10-01
Full Text Available A vaccine to prevent infections from the emerging Neisseria meningitidis X (MenX is becoming an urgent issue. Recently MenX capsular polysaccharide (CPS fragments conjugated to CRM197 as carrier protein have been confirmed at preclinical stage as promising candidates for vaccine development. However, more insights about the minimal epitope required for the immunological activity of MenX CPS are needed. We report herein the chemical conjugation of fully synthetic MenX CPS oligomers (monomer, dimer, and trimer to CRM197. Moreover, improvements in some crucial steps leading to the synthesis of MenX CPS fragments are described. Following immunization with the obtained neoglycoconjugates, the conjugated trimer was demonstrated as the minimal fragment possessing immunogenic activity, even though significantly lower than a pentadecamer obtained from the native polymer and conjugated to the same protein. This finding suggests that oligomers longer than three repeating units are possibly needed to mimic the activity of the native polysaccharide.
Isolation of tissues and preservation of RNA from intact, germinated barley grain.
Betts, Natalie S; Berkowitz, Oliver; Liu, Ruijie; Collins, Helen M; Skadhauge, Birgitte; Dockter, Christoph; Burton, Rachel A; Whelan, James; Fincher, Geoffrey B
2017-08-01
Isolated barley (Hordeum vulgare L.) aleurone layers have been widely used as a model system for studying gene expression and hormonal regulation in germinating cereal grains. A serious technological limitation of this approach has been the inability to confidently extrapolate conclusions obtained from isolated tissues back to the whole grain, where the co-location of several living and non-living tissues results in complex tissue-tissue interactions and regulatory pathways coordinated across the multiple tissues. Here we have developed methods for isolating fragments of aleurone, starchy endosperm, embryo, scutellum, pericarp-testa, husk and crushed cell layers from germinated grain. An important step in the procedure involves the rapid fixation of the intact grain to freeze the transcriptional activity of individual tissues while dissection is effected for subsequent transcriptomic analyses. The developmental profiles of 19 611 gene transcripts were precisely defined in the purified tissues and in whole grain during the first 24 h of germination by RNA sequencing. Spatial and temporal patterns of transcription were validated against well-defined data on enzyme activities in both whole grain and isolated tissues. Transcript profiles of genes involved in mitochondrial assembly and function were used to validate the very early stages of germination, while the profiles of genes involved in starch and cell wall mobilisation matched existing data on activities of corresponding enzymes. The data will be broadly applicable for the interrogation of co-expression and differential expression patterns and for the identification of transcription factors that are important in the early stages of grain and seed germination. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Tissue-engineering as an adjunct to pelvic reconstructive surgery
DEFF Research Database (Denmark)
Jangö, Hanna
of pelvic organ prolapse (POP) are warranted. Traditional native tissue repair may be associated with poor long-term outcome and augmentation with permanent polypropylene meshes is associated with frequent and severe adverse effects. Tissue-engineering is a regenerative strategy that aims at creating...... functional tissue using stem cells, scaffolds and trophic factors. The aim of this thesis was to investigate the potential adjunctive use of a tissue-engineering technique for pelvic reconstructive surgery using two synthetic biodegradable materials; methoxypolyethyleneglycol-poly(lactic-co-glycolic acid......) (MPEG-PLGA) and electrospun polycaprolactone (PCL) - with or without seeded muscle stem cells in the form of autologous fresh muscle fiber fragments (MFFs).To simulate different POP repair scenarios different animal models were used. In Study 1 and 2, MPEG-PLGA was evaluated in a native tissue repair...
Analysis of DNA methylation in various swine tissues.
Directory of Open Access Journals (Sweden)
Chun Yang
Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.
Restricted fragmentation of poliovirus type 1, 2, and 3 RNAs by ribonuclease III
Energy Technology Data Exchange (ETDEWEB)
Nomoto, A. (State Univ. of New York, Stony Brook); Lee, Y.F.; Babich, A.; Jacobson, A.; Dunn, J.J.; Wimmer, E.
1979-01-01
Cleavage of the genome RNAs of poliovirus type 1, 2, and 3 with the ribonuclease III of Escherichia coli has been investigated with the following results: (1) at or above physiological salt concentration, the RNAs are completely resistant to the action of the enzyme, an observation suggesting that the RNAs lack primary cleavage sites; (2) lowering the salt concentration to 0.1 M or below allows RNase III to cleave the RNAs at secondary sites. Both large and small fragments can be obtained in a reproducible manner depending on salt conditions chosen for cleavage. Fingerprints of three large fragments of poliovirus type 2 RNA show that they originate from unique segments and represent most if not all sequences of the genome. Based upon binding to poly(U) filters of poly(A)-linked fragments, a physical map of the large fragments of poliovirus type 2 RNA was constructed. The data suggest that RNase III cleavage of single-stranded RNA provides a useful method to fragment the RNA for further studies.
Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L
2018-04-12
Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Gozal, David; Khalyfa, Abdelnaby; Qiao, Zhuanghong; Akbarpour, Mahzad; Maccari, Rosanna; Ottanà, Rosaria
2017-09-01
Sleep fragmentation (SF) is highly prevalent and has emerged as an important contributing factor to obesity and metabolic syndrome. We hypothesized that SF-induced increases in protein tyrosine phosphatase-1B (PTP-1B) expression and activity underlie increased food intake, inflammation, and leptin and insulin resistance. Wild-type (WT) and ObR-PTP-1b-/- mice (Tg) were exposed to SF and control sleep (SC), and food intake was monitored. WT mice received a PTP-1B inhibitor (RO-7d; Tx) or vehicle (Veh). Upon completion of exposures, systemic insulin and leptin sensitivity tests were performed as well as assessment of visceral white adipose tissue (vWAT) insulin receptor sensitivity and macrophages (ATM) polarity. SF increased food intake in either untreated or Veh-treated WT mice. Leptin-induced hypothalamic STAT3 phosphorylation was decreased, PTP-1B activity was increased, and reduced insulin sensitivity emerged both systemic and in vWAT, with the latter displaying proinflammatory ATM polarity changes. All of the SF-induced effects were abrogated following PTP-1B inhibitor treatment and in Tg mice. SF induces increased food intake, reduced leptin signaling in hypothalamus, systemic insulin resistance, and reduced vWAT insulin sensitivity and inflammation that are mediated by increased PTP-1B activity. Thus, PTP-1B may represent a viable therapeutic target in the context of SF-induced weight gain and metabolic dysfunction. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.
Vranckx, Guy; Jacquemyn, Hans; Muys, Bart; Honnay, Olivier
2012-04-01
Shrubs and trees are assumed less likely to lose genetic variation in response to habitat fragmentation because they have certain life-history characteristics such as long lifespans and extensive pollen flow. To test this assumption, we conducted a meta-analysis with data on 97 woody plant species derived from 98 studies of habitat fragmentation. We measured the weighted response of four different measures of population-level genetic diversity to habitat fragmentation with Hedge's d and Spearman rank correlation. We tested whether the genetic response to habitat fragmentation was mediated by life-history traits (longevity, pollination mode, and seed dispersal vector) and study characteristics (genetic marker and plant material used). For both tests of effect size habitat fragmentation was associated with a substantial decrease in expected heterozygosity, number of alleles, and percentage of polymorphic loci, whereas the population inbreeding coefficient was not associated with these measures. The largest proportion of variation among effect sizes was explained by pollination mechanism and by the age of the tissue (progeny or adult) that was genotyped. Our primary finding was that wind-pollinated trees and shrubs appeared to be as likely to lose genetic variation as insect-pollinated species, indicating that severe habitat fragmentation may lead to pollen limitation and limited gene flow. In comparison with results of previous meta-analyses on mainly herbaceous species, we found trees and shrubs were as likely to have negative genetic responses to habitat fragmentation as herbaceous species. We also found that the genetic variation in offspring was generally less than that of adult trees, which is evidence of a genetic extinction debt and probably reflects the genetic diversity of the historical, less-fragmented landscape. ©2011 Society for Conservation Biology.
Nap, Annemiek W; Groothuis, Patrick G; Demir, Ayse Y; Maas, Jacques W M; Dunselman, Gerard A J; de Goeij, Anton F P M; Evers, Johannes L H
2003-01-01
Not all women with patent tubes develop clinically manifest endometriosis. Quality and quantity of endometrium in retrograde menstruation may be the determining factor in the development of the disease. We hypothesize that retrograde shedding of endometrial fragments with preserved integrity facilitates implantation of endometrium in ectopic locations, resulting in endometriotic lesion development. We evaluate the impact of tissue integrity on the success of endometriosis-like lesion development in the chicken embryo chorioallantoic membrane (CAM) model. Menstrual and non-menstrual (cyclic) endometrium were collected by biopsy, and either minced or enzymatically dispersed. Spontaneously shed menstrual effluent was collected by a menstrual cup, and cells and tissue were isolated. We evaluated whether infiltration or lesion formation in the CAM occurred after transplantation of endometrium onto the CAM. Transplantation of biopsied menstrual and cyclic endometrium fragments, and of endometrium fragments >1 mm(3) isolated from menstrual effluent, resulted in lesion formation. Transplantation of endometrial cells isolated from menstrual effluent did not lead to lesion formation. After transplantation of digested biopsied cyclic endometrium, infiltration in the CAM but no lesions were observed. In the CAM assay, integrity of tissue architecture determines success of implantation of human endometrium in ectopic locations.
Evidence for anomalous nuclei among relativistic projectile fragments at Bevalac energies
International Nuclear Information System (INIS)
Heckman, H.H.
1981-01-01
Two independent emulsion experiments using beams of 16 O and 56 Fe at approximately 2 GeV/nucleon find that the reaction mean free paths of projectile fragments (PF) with Z between 3 and 26 are shorter for a few centimeters after their emission than at larger distances, or than predicted from experiments on beam nuclei. Under the assumption that there are two populations of PF, a best fit to the data is obtained when approximately 6% of the PF have an anomalously short mean free path. The anomalous property of PF persists in subsequent fragmentation reactions. 6 figures
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Powers, Thomas W; Neely, Benjamin A; Shao, Yuan; Tang, Huiyuan; Troyer, Dean A; Mehta, Anand S; Haab, Brian B; Drake, Richard R
2014-01-01
A recently developed matrix-assisted laser desorption/ionization imaging mass spectrometry (MALDI-IMS) method to spatially profile the location and distribution of multiple N-linked glycan species in frozen tissues has been extended and improved for the direct analysis of glycans in clinically derived formalin-fixed paraffin-embedded (FFPE) tissues. Formalin-fixed tissues from normal mouse kidney, human pancreatic and prostate cancers, and a human hepatocellular carcinoma tissue microarray were processed by antigen retrieval followed by on-tissue digestion with peptide N-glycosidase F. The released N-glycans were detected by MALDI-IMS analysis, and the structural composition of a subset of glycans could be verified directly by on-tissue collision-induced fragmentation. Other structural assignments were confirmed by off-tissue permethylation analysis combined with multiple database comparisons. Imaging of mouse kidney tissue sections demonstrates specific tissue distributions of major cellular N-linked glycoforms in the cortex and medulla. Differential tissue distribution of N-linked glycoforms was also observed in the other tissue types. The efficacy of using MALDI-IMS glycan profiling to distinguish tumor from non-tumor tissues in a tumor microarray format is also demonstrated. This MALDI-IMS workflow has the potential to be applied to any FFPE tissue block or tissue microarray to enable higher throughput analysis of the global changes in N-glycosylation associated with cancers.
DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser
de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson
2015-03-01
Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.
The significance of monitoring sex hormones levels after ovarian tissue auto-transplantation
International Nuclear Information System (INIS)
Wang Qiuwei; Xu Peizhen; Yu Bin; Zhou Hong
2003-01-01
Objective: To evaluate the significance of monitoring serum sex hormones levels after ovarian tissue auto-transplantation. Methods: Twenty-five patients with stage IV recurrent endometriosis after one or two times of conservative surgeries underwent radical surgery. Their ovarian tissue fragments were transplanted to greater omentum. Serum follicle-stimulation hormone (FSH), Luteinizing hormone (LH) and estradiol (E 2 ) levels were measured monthly since fourth month post-operatively. After E 2 was increased, based body temperature was measured and vaginal hormone cytology was examined weekly for maturation index (MI) to assess the ovulatory phase and luteal phase in those with viable ovarian tissues. Serum levels of FSH, LH and E 2 in ovulatory phase and luteal phase were determined 20 women with viable ovarian tissues for three cycles as well as in 20 normal sexually mature women and 20 operative menopausal women. Results: There were 12 cases who had increasing of E 2 at four months post operatively and 8 cases more at six months. The other 5 cases with low serum E 2 levels and high FSH and LH levels at 12 months were designated as failures. The survival rate of transplanted ovarian tissue was 80.0%. There were no significant differences of the serum FSH, LH and E 2 levels in ovulatory phase and luteal phase between women with viable grafted ovarian tissues and normal sexually mature women. Conclusion: Monitoring of sex hormones is a good means to assess the viability of the transplanted ovarian tissue fragments
Direct access to dithiobenzoate RAFT agent fragmentation rate coefficients by ESR spin-trapping.
Ranieri, Kayte; Delaittre, Guillaume; Barner-Kowollik, Christopher; Junkers, Thomas
2014-12-01
The β-scission rate coefficient of tert-butyl radicals fragmenting off the intermediate resulting from their addition to tert-butyl dithiobenzoate-a reversible addition-fragmentation chain transfer (RAFT) agent-is estimated via the recently introduced electron spin resonance (ESR)-trapping methodology as a function of temperature. The newly introduced ESR-trapping methodology is critically evaluated and found to be reliable. At 20 °C, a fragmentation rate coefficient of close to 0.042 s(-1) is observed, whereas the activation parameters for the fragmentation reaction-determined for the first time-read EA = 82 ± 13.3 kJ mol(-1) and A = (1.4 ± 0.25) × 10(13) s(-1) . The ESR spin-trapping methodology thus efficiently probes the stability of the RAFT adduct radical under conditions relevant for the pre-equilibrium of the RAFT process. It particularly indicates that stable RAFT adduct radicals are indeed formed in early stages of the RAFT poly-merization, at least when dithiobenzoates are employed as controlling agents as stipulated by the so-called slow fragmentation theory. By design of the methodology, the obtained fragmentation rate coefficients represent an upper limit. The ESR spin-trapping methodology is thus seen as a suitable tool for evaluating the fragmentation rate coefficients of a wide range of RAFT adduct radicals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bastarrachea, Raúl A; López-Alvarenga, Juan Carlos; Kent, Jack W; Laviada-Molina, Hugo A; Cerda-Flores, Ricardo M; Calderón-Garcidueñas, Ana Laura; Torres-Salazar, Amada; Torres-Salazar, Amanda; Nava-González, Edna J; Solis-Pérez, Elizabeth; Gallegos-Cabrales, Esther C; Cole, Shelley A; Comuzzie, Anthony G
2008-01-01
We describe the methodology used to analyze multiple transcripts using microarray techniques in simultaneous biopsies of muscle, adipose tissue and lymphocytes obtained from the same individual as part of the standard protocol of the Genetics of Metabolic Diseases in Mexico: GEMM Family Study. We recruited 4 healthy male subjects with BM1 20-41, who signed an informed consent letter. Subjects participated in a clinical examination that included anthropometric and body composition measurements, muscle biopsies (vastus lateralis) subcutaneous fat biopsies anda blood draw. All samples provided sufficient amplified RNA for microarray analysis. Total RNA was extracted from the biopsy samples and amplified for analysis. Of the 48,687 transcript targets queried, 39.4% were detectable in a least one of the studied tissues. Leptin was not detectable in lymphocytes, weakly expressed in muscle, but overexpressed and highly correlated with BMI in subcutaneous fat. Another example was GLUT4, which was detectable only in muscle and not correlated with BMI. Expression level concordance was 0.7 (p< 0.001) for the three tissues studied. We demonstrated the feasibility of carrying out simultaneous analysis of gene expression in multiple tissues, concordance of genetic expression in different tissues, and obtained confidence that this method corroborates the expected biological relationships among LEPand GLUT4. TheGEMM study will provide a broad and valuable overview on metabolic diseases, including obesity and type 2 diabetes.
DNA degrades during storage in formalin-fixed and paraffin-embedded tissue blocks.
Guyard, Alice; Boyez, Alice; Pujals, Anaïs; Robe, Cyrielle; Tran Van Nhieu, Jeanne; Allory, Yves; Moroch, Julien; Georges, Odette; Fournet, Jean-Christophe; Zafrani, Elie-Serge; Leroy, Karen
2017-10-01
Formalin-fixed paraffin-embedded (FFPE) tissue blocks are widely used to identify clinically actionable molecular alterations or perform retrospective molecular studies. Our goal was to quantify degradation of DNA occurring during mid to long-term storage of samples in usual conditions. We selected 46 FFPE samples of surgically resected carcinomas of lung, colon, and urothelial tract, of which DNA had been previously extracted. We performed a second DNA extraction on the same blocks under identical conditions after a median period of storage of 5.5 years. Quantitation of DNA by fluorimetry showed a 53% decrease in DNA quantity after storage. Quantitative PCR (qPCR) targeting KRAS exon 2 showed delayed amplification of DNA extracted after storage in all samples but one. The qPCR/fluorimetry quantification ratio decreased from 56 to 15% after storage (p DNA analyzable by qPCR represented only 11% of the amount obtained at first extraction. Maximal length of amplifiable DNA fragments assessed with a multiplex PCR was reduced in DNA extracted from stored tissue, indicating that DNA fragmentation had increased in the paraffin blocks during storage. Next-generation sequencing was performed on 12 samples and showed a mean 3.3-fold decrease in library yield and a mean 4.5-fold increase in the number of single-nucleotide variants detected after storage. In conclusion, we observed significant degradation of DNA extracted from the same FFPE block after 4 to 6 years of storage. Better preservation strategies should be considered for storage of FFPE biopsy specimens.
Sun, S; Henriksen, K; Karsdal, M A; Armbrecht, G; Belavý, D L; Felsenberg, D; Rittweger, J; Wang, Y; Zheng, Q; Nedergaard, A F
2014-10-01
In this study we sought to determine whether a Titin peptide fragment can serve as a clinical biomarker for changes in muscle mass. Mass spectrometry was used to identify Titin fragment in urine. An antibody against this Titin sequence was raised and used to develop a competitive ELISA assay for measurement in serum. Rat tissue extractions in the presence or absence of a series of proteases of interest were used to identify its enzymatic origin. A rat model of dexamethasone (DEX) induced muscle atrophy and a human 56-day bed rest study with and without vibration therapy were used to assess biological and clinical relevance. A technically robust ELISA measuring the Titin fragment was developed against a Titin peptide fragment identified in human urine. The fragment was shown to be produced primarily by MMP-2 cleavage of Titin. In the rat muscle DEX induced atrophy model, Titin-MMP2 fragment was decreased in the beginning of DEX treatment, and then significantly increased later on during DEX administration. In the human bed rest study, the Titin-MMP2 fragment was initially decreased 11.9 (±3.7) % after 1day of bed rest, and then gradually increased ending up at a 16.4 (±4.6) % increase at day 47. We developed a robust ELISA measuring a muscle derived MMP-2 generated Titin degradation fragment in rat and human serum. Importantly, the fragment can be measured in serum and that these levels are related to induction of skeletal muscle atrophy. Copyright © 2014 Elsevier Inc. All rights reserved.
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
Photon-hadron fragmentation: theoretical situation
International Nuclear Information System (INIS)
Peschanski, R.
1983-07-01
Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory
Measurement of Gene Expression in Archival Paraffin-Embedded Tissues
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316
International Nuclear Information System (INIS)
Montoya, M.; Rojas, J.; Saetone, E.
2007-01-01
The mass and kinetic energy distribution of nuclear fragments from thermal neutron-induced fission of 235 U(n th ,f) have been studied using a Monte-Carlo simulation. Besides reproducing the pronounced broadening in the standard deviation of the kinetic energy at the final fragment mass number around m = 109, our simulation also produces a second broadening around m = 125. These results are in good agreement with the experimental data obtained by Belhafaf et al. and other results on yield of mass. We conclude that the obtained results are a consequence of the characteristics of the neutron emission, the sharp variation in the primary fragment kinetic energy and mass yield curves. We show that because neutron emission is hazardous to make any conclusion on primary quantities distribution of fragments from experimental results on final quantities distributions
Recent progress on perturbative QCD fragmentation functions
International Nuclear Information System (INIS)
Cheung, K.
1995-05-01
The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons
Fragmentation and flow in central collisions
International Nuclear Information System (INIS)
Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.
1987-01-01
Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs
David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda
2010-01-01
Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...
Mass spectrometry for fragment screening.
Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris
2017-11-08
Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Directory of Open Access Journals (Sweden)
Luciana Coe Girão
Full Text Available Functional diversity has been postulated to be critical for the maintenance of ecosystem functioning, but the way it can be disrupted by human-related disturbances remains poorly investigated. Here we test the hypothesis that habitat fragmentation changes the relative contribution of tree species within categories of reproductive traits (frequency of traits and reduces the functional diversity of tree assemblages. The study was carried out in an old and severely fragmented landscape of the Brazilian Atlantic forest. We used published information and field observations to obtain the frequency of tree species and individuals within 50 categories of reproductive traits (distributed in four major classes: pollination systems, floral biology, sexual systems, and reproductive systems in 10 fragments and 10 tracts of forest interior (control plots. As hypothesized, populations in fragments and control plots differed substantially in the representation of the four major classes of reproductive traits (more than 50% of the categories investigated. The most conspicuous differences were the lack of three pollination systems in fragments--pollination by birds, flies and non-flying mammals--and that fragments had a higher frequency of both species and individuals pollinated by generalist vectors. Hermaphroditic species predominate in both habitats, although their relative abundances were higher in fragments. On the contrary, self-incompatible species were underrepresented in fragments. Moreover, fragments showed lower functional diversity (H' scores for pollination systems (-30.3%, floral types (-23.6%, and floral sizes (-20.8% in comparison to control plots. In contrast to the overwhelming effect of fragmentation, patch and landscape metrics such as patch size and forest cover played a minor role on the frequency of traits. Our results suggest that habitat fragmentation promotes a marked shift in the relative abundance of tree reproductive traits and
Horejs, Christine-Maria; St-Pierre, Jean-Philippe; Ojala, Juha R. M.; Steele, Joseph A. M.; da Silva, Patricia Barros; Rynne-Vidal, Angela; Maynard, Stephanie A.; Hansel, Catherine S.; Rodríguez-Fernández, Clara; Mazo, Manuel M.; You, Amanda Y. F.; Wang, Alex J.; von Erlach, Thomas; Tryggvason, Karl; López-Cabrera, Manuel; Stevens, Molly M.
2017-01-01
Matrix metalloproteinases (MMPs) contribute to the breakdown of tissue structures such as the basement membrane, promoting tissue fibrosis. Here we developed an electrospun membrane biofunctionalized with a fragment of the laminin β1-chain to modulate the expression of MMP2 in this context. We demonstrate that interfacing of the β1-fragment with the mesothelium of the peritoneal membrane via a biomaterial abrogates the release of active MMP2 in response to transforming growth factor β1 and rescues tissue integrity ex vivo and in vivo in a mouse model of peritoneal fibrosis. Importantly, our data demonstrate that the membrane inhibits MMP2 expression. Changes in the expression of epithelial-to-mesenchymal transition (EMT)-related molecules further point towards a contribution of the modulation of EMT. Biomaterial-based presentation of regulatory basement membrane signals directly addresses limitations of current therapeutic approaches by enabling a localized and specific method to counteract MMP2 release applicable to a broad range of therapeutic targets. PMID:28593951
Horejs, Christine-Maria; St-Pierre, Jean-Philippe; Ojala, Juha R. M.; Steele, Joseph A. M.; da Silva, Patricia Barros; Rynne-Vidal, Angela; Maynard, Stephanie A.; Hansel, Catherine S.; Rodríguez-Fernández, Clara; Mazo, Manuel M.; You, Amanda Y. F.; Wang, Alex J.; von Erlach, Thomas; Tryggvason, Karl; López-Cabrera, Manuel; Stevens, Molly M.
2017-06-01
Matrix metalloproteinases (MMPs) contribute to the breakdown of tissue structures such as the basement membrane, promoting tissue fibrosis. Here we developed an electrospun membrane biofunctionalized with a fragment of the laminin β1-chain to modulate the expression of MMP2 in this context. We demonstrate that interfacing of the β1-fragment with the mesothelium of the peritoneal membrane via a biomaterial abrogates the release of active MMP2 in response to transforming growth factor β1 and rescues tissue integrity ex vivo and in vivo in a mouse model of peritoneal fibrosis. Importantly, our data demonstrate that the membrane inhibits MMP2 expression. Changes in the expression of epithelial-to-mesenchymal transition (EMT)-related molecules further point towards a contribution of the modulation of EMT. Biomaterial-based presentation of regulatory basement membrane signals directly addresses limitations of current therapeutic approaches by enabling a localized and specific method to counteract MMP2 release applicable to a broad range of therapeutic targets.
Mei, B.; Tu, X. L.; Wang, M.
2018-04-01
An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.
Fragment E1 labeled with I-123 in the detection of venous thrombosis
International Nuclear Information System (INIS)
Knight, L.C.; Maurer, A.H.; Robbins, P.S.; Malmud, L.S.; Budzynski, A.Z.
1985-01-01
Fragment E1, which has been shown to have specific binding affinity for thrombi in an animal model, was investigated in humans for its safety and ability to bind to venous thrombi. Human Fragment E1 was labeled with I-123 and administered intravenously to patients with proved or suspected deep vein thrombosis. The vascular distribution of radioactivity was documented by obtaining gamma camera images of the patients' legs for 30 minutes following administration of I-123-Fragment E1. All patients (n = 5) with documented venous thrombi had rapid localization of labeled Fragment E1 in the area of thrombus. Patients without evidence of thrombi (n = 5) showed no focal localization, although two of these patients showed diffuse uptake along the length of the veins, due to superficial phlebitis. Analysis of blood samples in four patients indicated that disappearance of Fragment E1 from the circulation was more rapid in individuals with thrombosis (t 1/2 = 20 min) than in individuals without thrombosis (t 1/2 = 90 min), and a radiolabeled species of high molecular weight was found in patients with thrombosis but was absent from patients without thrombosis. These early results suggest that radiolabeled Fragment E1 is a safe and potentially valuable agent for the rapid detection of venous thrombosis
The size distributions of fragments ejected at a given velocity from impact craters
O'Keefe, John D.; Ahrens, Thomas J.
1987-01-01
The mass distribution of fragments that are ejected at a given velocity for impact craters is modeled to allow extrapolation of laboratory, field, and numerical results to large scale planetary events. The model is semi-empirical in nature and is derived from: (1) numerical calculations of cratering and the resultant mass versus ejection velocity, (2) observed ejecta blanket particle size distributions, (3) an empirical relationship between maximum ejecta fragment size and crater diameter, (4) measurements and theory of maximum ejecta size versus ejecta velocity, and (5) an assumption on the functional form for the distribution of fragments ejected at a given velocity. This model implies that for planetary impacts into competent rock, the distribution of fragments ejected at a given velocity is broad, e.g., 68 percent of the mass of the ejecta at a given velocity contains fragments having a mass less than 0.1 times a mass of the largest fragment moving at that velocity. The broad distribution suggests that in impact processes, additional comminution of ejecta occurs after the upward initial shock has passed in the process of the ejecta velocity vector rotating from an initially downward orientation. This additional comminution produces the broader size distribution in impact ejecta as compared to that obtained in simple brittle failure experiments.
D'Amour, Pierre; Brossard, Jean-Hugues; Rousseau, Louise; Nguyen-Yamamoto, Loan; Nassif, Edgard; Lazure, Claude; Gauthier, Dany; Lavigne, Jeffrey R; Zahradnik, Richard J
2005-09-01
Non-(1-84) parathyroid hormone (PTH) fragments are large circulating carboxyl-terminal (C) fragments with a partially preserved amino-terminal (N) structure. hPTH (7-84), a synthetic surrogate, has been demonstrated to exert biologic effects in vivo and in vitro which are opposite to those of hPTH (1-34) on the PTH/PTHrP type I receptor through a C-PTH receptor. We wanted to determine the N structure of non-(1-84) PTH fragments. Parathyroid cells isolated from glands obtained at surgery from three patients with primary hyperparathyroidism and three patients with secondary hyperparathyroidism were incubated with 35S-methionine to internally label their secretion products. Incubations were performed for 8 hours at the patient-ionized calcium concentration and in the presence of various protease inhibitors. The supernatant was fractionated by high-performance liquid chromatography (HPLC) and fractions were analyzed with PTH assays having (1 to 4) and (12 to 23) epitopes, respectively. The serum of each patient was similarly analyzed. Peaks of immunoreactivity identified were submitted to sequence analysis to recover the 35S-methionine residues in positions 8 and 18. Three regions of interest were identified with PTH assays. They corresponded to non-(1-84) PTH fragments (further divided in regions 3 and 4), a peak of N-PTH migrating in front of hPTH (1-84) (region 2) and a peak of immunoreactivity corresponding to the elution position of hPTH (1-84) (region 1). The last corresponded to a single sequence starting at position 1. Region 2 gave similar results in all cases (a major signal starting at position 1) but also sometimes minor sequences starting at position 4 or 7. Regions 3 and 4 always identified a major sequence starting at positions 7 and minor sequences starting at positions 8, 10, and 15. Surprisingly, a major signal starting at position 1 was also present in region 3. The HPLC profile obtained from a given patient's parathyroid cells was qualitatively
Physics of projectile fragments
International Nuclear Information System (INIS)
Minamisono, Tadanori
1982-01-01
This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)
Directory of Open Access Journals (Sweden)
Ji Soo Choi
Full Text Available The purpose of this study was to determine whether metabolic profiling of core needle biopsy (CNB samples using high-resolution magic angle spinning (HR-MAS magnetic resonance spectroscopy (MRS could be used for predicting pathologic response to neoadjuvant chemotherapy (NAC in patients with locally advanced breast cancer. After institutional review board approval and informed consent were obtained, CNB tissue samples were collected from 37 malignant lesions in 37 patients before NAC treatment. The metabolic profiling of CNB samples were performed by HR-MAS MRS. Metabolic profiles were compared according to pathologic response to NAC using the Mann-Whitney test. Multivariate analysis was performed with orthogonal projections to latent structure-discriminant analysis (OPLS-DA. Various metabolites including choline-containing compounds were identified and quantified by HR-MAS MRS in all 37 breast cancer tissue samples obtained by CNB. In univariate analysis, the metabolite concentrations and metabolic ratios of CNB samples obtained with HR-MAS MRS were not significantly different between different pathologic response groups. However, there was a trend of lower levels of phosphocholine/creatine ratio and choline-containing metabolite concentrations in the pathologic complete response group compared to the non-pathologic complete response group. In multivariate analysis, the OPLS-DA models built with HR-MAS MR metabolic profiles showed visible discrimination between the pathologic response groups. This study showed OPLS-DA multivariate analysis using metabolic profiles of pretreatment CNB samples assessed by HR- MAS MRS may be used to predict pathologic response before NAC, although we did not identify the metabolite showing statistical significance in univariate analysis. Therefore, our preliminary results raise the necessity of further study on HR-MAS MR metabolic profiling of CNB samples for a large number of cancers.
Fragmentation of neutral carbon clusters formed by high velocity atomic collision
International Nuclear Information System (INIS)
Martinet, G.
2004-05-01
The aim of this work is to understand the fragmentation of small neutral carbon clusters formed by high velocity atomic collision on atomic gas. In this experiment, the main way of deexcitation of neutral clusters formed by electron capture with ionic species is the fragmentation. To measure the channels of fragmentation, a new detection tool based on shape analysis of current pulse delivered by semiconductor detectors has been developed. For the first time, all branching ratios of neutral carbon clusters are measured in an unambiguous way for clusters size up to 10 atoms. The measurements have been compared to a statistical model in microcanonical ensemble (Microcanonical Metropolis Monte Carlo). In this model, various structural properties of carbon clusters are required. These data have been calculated with Density Functional Theory (DFT-B3LYP) to find the geometries of the clusters and then with Coupled Clusters (CCSD(T)) formalism to obtain dissociation energies and other quantities needed to compute fragmentation calculations. The experimental branching ratios have been compared to the fragmentation model which has allowed to find an energy distribution deposited in the collision. Finally, specific cluster effect has been found namely a large population of excited states. This behaviour is completely different of the atomic carbon case for which the electron capture in the ground states predominates. (author)
Binary projectile fragmentation of 12C at an incident energy of 33.3 MeV/nucleon
Förtsch, S V; Gadioli, E; Bassini, R; Buthelezi, E Z; Cerutti, F; Connell, S H; Cowley, A A; Fujita, H; Mabiala, J; Mairani, A; Mira, J; Papka, P; Neveling, R; Smit, F D
2010-01-01
Direct binary projectile fragmentation is being investigated for the case where a 400 MeV 12C projectile breaks up into an particle and a 8Be fragment in the interaction with a thin 93Nb and 197Au target. While the 8Be fragments were measured at 9 , the correlated particles were detected in an angular range between 16 and 30 on the opposite side of the beam. From the preliminary results presented here one may obtain information on the amount of quasi-elastic fragmentation (both fragments do not suffer any further interactions after they are produced). These experimental results indicate that the quasi-elastic break-up process is the dominant contribution to the measured correlation spectra. As was also observed in earlier work, the most forward quasi-elastically emitted particles have energies exceeding the beam velocity.
Mafole, Prosper; Aritsugi, Masayoshi
2016-01-01
Backoff-free fragment retransmission (BFFR) scheme enhances the performance of legacy MAC layer fragmentation by eliminating contention overhead. The eliminated overhead is the result of backoff executed before a retransmission attempt is made when fragment transmission failure occurs within a fragment burst. This paper provides a mathematical analysis of BFFR energy efficiency and further assesses, by means of simulations, the energy efficiency, throughput and delay obtained when BFFR is used. The validity of the new scheme is evaluated in different scenarios namely, constant bit rate traffic, realistic bursty internet traffic, node mobility, rigid and elastic flows and their combinations at different traffic loads. We also evaluate and discuss the impact of BFFR on MAC fairness when the number of nodes is varied from 4 to 10. It is shown that BFFR has advantages over legacy MAC fragmentation scheme in all the scenarios.
Natural aminoacyl tRNA synthetase fragment enhances cardiac function after myocardial infarction.
Directory of Open Access Journals (Sweden)
Margaret E McCormick
Full Text Available A naturally-occurring fragment of tyrosyl-tRNA synthetase (TyrRS has been shown in higher eukaryotes to 'moonlight' as a pro-angiogenic cytokine in addition to its primary role in protein translation. Pro-angiogenic cytokines have previously been proposed to be promising therapeutic mechanisms for the treatment of myocardial infarction. Here, we show that systemic delivery of the natural fragment of TyRS, mini-TyrRS, improves heart function in mice after myocardial infarction. This improvement is associated with reduced formation of scar tissue, increased angiogenesis of cardiac capillaries, recruitment of c-kitpos cells and proliferation of myocardial fibroblasts. This work demonstrates that mini-TyrRS has beneficial effects on cardiac repair and regeneration and offers support for the notion that elucidation of the ever expanding repertoire of noncanonical functions of aminoacyl tRNA synthetases offers unique opportunities for development of novel therapeutics.
MRI of displaced meniscal fragments
International Nuclear Information System (INIS)
Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal
2012-01-01
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
MRI of displaced meniscal fragments
Energy Technology Data Exchange (ETDEWEB)
Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)
2012-01-15
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
Yang, S M; Fang, D C; Luo, Y H; Lu, R; Battle, P D; Liu, W W
2001-08-01
In order to explore the role of alterations of telomerase activity and terminal restriction fragment (TRF) length in the development and progression of gastric cancer. Telomerase activity was detected in 176 specimens of gastric mucosa obtained through an operation or endoscopical biopsy by using the telomeric repeat amplification protocol (TRAP) assay. Meanwhile, the mean length of TRF was measured with the use of a Southern blot in part of those samples. Telomerase activity was detected in 14 of 57 (24.6%) chronic atrophy gastritis patients, six of 18 (33.3%) intestinal metaplasia patients, three of eight (37.5%) dysplasia patients and 60 of 65 (92.3%) gastric cancer patients, respectively. Normal gastric mucosa revealed no telomerase activity. No association was found between telomerase activity and any clinicopathological parameters. The mean TRF length was decreased gradually with age in normal mucosa and in gastric cancer tissue. Regression analysis demonstrated that the reduction rate in these tissues was 41 +/- 12 base pairs/year. Among 35 gastric cancers, TRF length was shown to be shorter in 20 cases (57.1%), similar in 12 cases (34.3%) and elongated in three cases (7.6%), compared to the corresponding adjacent tissues. The mean TRF length tended to decrease as the mucosa underwent chronic atrophy gastritis, intestinal metaplasia, dysplasia and into gastric cancer. The mean TRF length in gastric cancer was not statistically correlated with clinicopathological parameters and telomerase activity. Our results suggest that telomerase is expressed during the early stage of gastric carcinogenesis, and that the clinical significance of TRF length appears to be limited in gastric cancer.
Energy Technology Data Exchange (ETDEWEB)
Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)
2013-09-21
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.
International Nuclear Information System (INIS)
Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.
2013-01-01
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections
Catana, Cornel
2009-03-01
Using a well-defined set of fragments/pharmacophores, a new methodology to calculate fragment/ pharmacophore descriptors for any molecule onto which at least one fragment/pharmacophore can be mapped is presented. To each fragment/pharmacophore present in a molecule, we attach a descriptor that is calculated by identifying the molecule's atoms onto which it maps and summing over its constituent atomic descriptors. The attached descriptors are named C-fragment/pharmacophore descriptors, and this methodology can be applied to any descriptors defined at the atomic level, such as the partition coefficient, molar refractivity, electrotopological state, etc. By using this methodology, the same fragment/pharmacophore can be shown to have different values in different molecules resulting in better discrimination power. As we know, fragment and pharmacophore fingerprints have a lot of applications in chemical informatics. This study has attempted to find the impact of replacing the traditional value of "1" in a fingerprint with real numbers derived form C-fragment/pharmacophore descriptors. One way to do this is to assess the utility of C-fragment/ pharmacophore descriptors in modeling different end points. Here, we exemplify with data from CYP and hERG. The fact that, in many cases, the obtained models were fairly successful and C-fragment descriptors were ranked among the top ones supports the idea that they play an important role in correlation. When we modeled hERG with C-pharmacophore descriptors, however, the model performances decreased slightly, and we attribute this, mainly to the fact that there is no technique capable of handling multiple instances (states). We hope this will open new research, especially in the emerging field of machine learning. Further research is needed to see the impact of C-fragment/pharmacophore descriptors in similarity/dissimilarity applications.
Formation of fission-fragment mass distribution for nuclei lighter than thorium
International Nuclear Information System (INIS)
Itkis, M.G.; Mul'gin, S.I.; Rusanov, A.Y.; Okolovich, A.N.; Smirenkin, G.N.
1986-01-01
A phenomenological approach to description of fission-fragment mass distribution Y(M) for nuclei in the vicinity of Pb is developed and used to extract from the experimental Y(M) data the nuclear deformation potential energy V(M) and its components: the macroscopic (liquid-drop) part and the shell correction in the transition state. The results of the analysis are compared with the theoretically obtained V(M) and Y(M). The three-hump fragment-mass distributions observed in Ra fission are satisfactorily described within the framework of the approach developed. The properties of the symmetric and asymmetric fission valleys and the related Y(M) components are discussed
Simultaneous measurement of neutrons and fission fragments of thermal neutron fission of U-233
International Nuclear Information System (INIS)
Itsuro Kimura; Katsuhisa Nishio; Yoshihiro Nakagome
2000-01-01
The multiplicity and the energy of prompt neutrons from the fragments for 233 U(n th , f) were measured as functions of fragment mass and total kinetic energy. Average neutron energy against the fragment mass showed a nearly symmetric distribution about the half mass division with two valleys at 98 and 145 u. The slope of the neutron multiplicity with total kinetic energy depended on the fragment mass and showed the minimum at about 130 u. The obtained neutron data were applied to determine the total excitation energy of the system, and the resulting value in the typical asymmetric fission lied between 22 and 25 MeV. The excitation energy agreed with that determined by subtracting the total kinetic energy from the Q-value within 1 MeV, thus satisfied the energy conservation. In the symmetric fission, where the mass yield was drastically suppresses, the total excitation energy is significantly large and reaches to about 40 MeV, suggesting that fragment pairs are preferentially formed in a compact configuration at the scission point [ru
Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen
2009-01-30
In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.
Finite size effects in the intermittency analysis of the fragment-size correlations
International Nuclear Information System (INIS)
Bozek, P.; Ploszajczak, M.; Tucholski, A.
1991-01-01
An influence of the finite size effect on the fragment-size correlations in the nuclear multifragmentation is studied using the method of scaled factorial moments for a 1 - dim percolation model and for a statistical model of the fragmentation process, which for a certain value of a tuning parameter yields the power-law behaviour of the fragment-size distribution. It is shown that the statistical models of this type contain only repulsive correlations due to the conservation laws. The comparison of the results with those obtained in the non-critical 1 - dim percolation and in the 3 - dim percolation at around the critical point is presented. Correlations in the 1 - dim percolation model are analysed analytically and the mechanism of the attractive correlations in 1 - dim and 3 - dim is identified. (author) 30 refs., 7 figs
Goodness of isospin in neutron rich systems from the fission fragment distribution
Garg, Swati; Jain, Ashok Kumar
2017-09-01
We present the results of our calculations for the relative yields of neutron-rich fission fragments emitted in 208Pb (18O, fission) reaction by using the concept of the conservation of isospin and compare with the experimental data. We take into account a range of isospin values allowed by the isospin algebra and assume that the fission fragments are formed in isobaric analog states. We also take into account the neutron multiplicity data for various neutron-emission channels in each partition, and use them to obtain the weight factors in calculating the yields. We then calculate the relative yields of the fission fragments. Our calculated results are able to reproduce the experimental trends reasonably well. This is the first direct evidence of the isospin conservation in neutron-rich systems and may prove a very useful tool in their studies.
Energy dissipation in fragmented geomaterials associated with impacting oscillators
Khudyakov, Maxim; Pasternak, Elena; Dyskin, Arcady
2016-04-01
In wave propagation through fragmented geomaterials forced by periodic loadings, the elements (fragments) strike against each other when passing through the neutral position (position with zero mutual rotation), quickly damping the oscillations. Essentially the impacts act as shock absorbers albeit localised at the neutral points. In order to analyse the vibrations of and wave propagation in such structures, a differential equation of a forced harmonic oscillator was investigated, where the each time the system passes through the neutral point the velocity gets reduced by multiplying it with the restitution coefficient which characterise the impact of the fragments. In forced vibrations the impact times depend on both the forced oscillations and the restitution coefficient and form an irregular sequence. Numerical solution of the differential equation was performed using Mathematica software. Along with vibration diagrams, the dependence of the energy dissipation on the ratio of the forcing frequency to the natural frequency was obtained. For small positive values of the restitution coefficient (less than 0.5), the asymmetric oscillations were found, and the phase of the forced vibrations determined the direction of the asymmetry. Also, at some values of the forcing frequencies and the restitution coefficient chaotic behaviour was found.
Reframing landscape fragmentation's effects on ecosystem services.
Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R
2015-04-01
Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fragment Size Distribution of Blasted Rock Mass
Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris
2017-12-01
Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.
Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study
Directory of Open Access Journals (Sweden)
Dalia Mohamed Ali
2016-06-01
Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.
The b Quark Fragmentation Function, From LEP to TeVatron
Energy Technology Data Exchange (ETDEWEB)
Ben-haim, Eli [Univ. Pierre et Marie Curie, Paris (France)
2004-12-01
The b quark fragmentation distribution has been measured, using data registered by the DELPHI experiment at the Z pole, in the years 1994-1995. The measurement made use of 176000 inclusively reconstructed B meson candidates. The errors of this measurement are dominated by systematic effects, the principal ones being related to the energy calibration. The distribution has been established in a nine bin histogram. Its mean value has been found to be
Detection of neuronal tissue in meat using tissue specific DNA modifications
Directory of Open Access Journals (Sweden)
Harris N.
2004-01-01
Full Text Available A method has been developed to differentiate between non-muscle tissues such as liver, kidney and heart and that of muscle in meat samples using tissue specific DNA detection. Only muscle tissue is considered meat from the point of view of labelling (Food Labelling [Amendment] (England Regulations 2003 and Quantitative Ingredient Declaration (QUID, and also certain parts of the carcass are prohibited to be used in raw meat products (Meat Products [England] Regulations 2003. Included in the prohibited offal are brain and spinal cord. The described methodology has therefore been developed primarily to enforce labelling rules but also to contribute to the enforcement of BSE legislation on the detection of Central Nervous System (CNS tissue. The latter requires the removal of Specified Risk Material (SRM, such as bovine and ovine brain and spinal cord, from the food chain. Current methodologies for detection of CNS tissue include histological examination, analysis of cholesterol content and immunodetection. These can potentially be time consuming, less applicable to processed samples and may not be readily adapted to high throughput sample analysis. The objective of this work was therefore to develop a DNAbased detection assay that exploits the sensitivity and specificity of PCR and is potentially applicable to more highly processed food samples. For neuronal tissue, the DNA target selected was the promoter for Glial Fibrillary Acidic Protein (GFAP, a gene whose expression is restricted to astroglial cells within CNS tissue. The promoter fragments from both cattle and sheep have been isolated and key differences in the methylation patterns of certain CpG dinucleotides in the sequences from bovine and sheep brain and spinal cord and the corresponding skeletal muscle identified. These have been used to design a PCR assay exploiting Methylation Specific PCR (MSP to specifically amplify the neuronal tissue derived sequence and therefore identify the
A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.
Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T
1999-02-01
Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.
Effects of Habitat Fragmentation on Genetic Diversity in Cycas Balansae (Cycadaceae
Directory of Open Access Journals (Sweden)
Nguyen Minh Tam
2017-11-01
Full Text Available Habitat fragmentation is a serious threat to species survival. In Vietnam, Cycas balansae has been considered as threatened species because of the reduction and fragmentation of its habitats and over-exploitation. We assessed genetic variability and the pattern of population structure among six populations sampled in four provinces: Hoa Binh, Ha Nam, Ninh Binh and Quang Ninh. Polyacrylamide gel electrophoresis was performed on leaf tissues from 152 individuals representing 6 populations of C. balansae. Six of twelve enzyme systems were used to estimate genetic diversity at population and species levels. Eleven loci were examined. The allozyme data showed high levels of genetic diversity within all populations, ranging from 0.538 in Ba Sao to 0.628 in Tan Dan (average 0.576. The maintenance of high levels of expected heterozygosity (average 0.571 and low in observed heterozygosity (average 0.347 might be related to great heterozygote deficiency and increased frequencies of rare alleles. Genetic differentiation among populations was low (Dst = 0.036 and Gst = 0.064, indicating high level of gene flow (Nm = 3.22. Isolation by geographical distance was observed, however, no significant relationship between genetic distances and geographical distances was recorded. Our studies suggest small population sizes of cycads brought about by fragmentation of its habitats, over-exploitation, and increasing number of inbred individuals within populations.
Detonation and fragmentation modeling for the description of large scale vapor explosions
International Nuclear Information System (INIS)
Buerger, M.; Carachalios, C.; Unger, H.
1985-01-01
The thermal detonation modeling of large-scale vapor explosions is shown to be indispensable for realistic safety evaluations. A steady-state as well as transient detonation model have been developed including detailed descriptions of the dynamics as well as the fragmentation processes inside a detonation wave. Strong restrictions for large-scale vapor explosions are obtained from this modeling and they indicate that the reactor pressure vessel would even withstand explosions with unrealistically high masses of corium involved. The modeling is supported by comparisons with a detonation experiment and - concerning its key part - hydronamic fragmentation experiments. (orig.) [de
Vargas, Hugo E; Laskus, Tomasz; Radkowski, Marek; Wilkinson, Jeff; Balan, Vijay; Douglas, David D; Harrison, M Edwyn; Mulligan, David C; Olden, Kevin; Adair, Debra; Rakela, Jorge
2002-11-01
Patients with chronic hepatitis C frequently report tiredness, easy fatigability, and depression. The aim of this study is to determine whether hepatitis C virus (HCV) replication could be found in brain tissue in patients with hepatitis C and depression. We report two patients with recurrent hepatitis C after liver transplantation who also developed severe depression. One patient died of multiorgan failure and the other, septicemia caused by Staphylococcus aureussis. Both patients had evidence of severe hepatitis C recurrence with features of cholestatic fibrosing hepatitis. We were able to study samples of their central nervous system obtained at autopsy for evidence of HCV replication. The presence of HCV RNA-negative strand, which is the viral replicative form, was determined by strand-specific Tth-based reverse-transcriptase polymerase chain reaction. Viral sequences were compared by means of single-strand conformation polymorphism and direct sequencing. HCV RNA-negative strands were found in subcortical white matter from one patient and cerebral cortex from the other patient. HCV RNA-negative strands amplified from brain tissue differed by several nucleotide substitutions from serum consensus sequences in the 5' untranslated region. These findings support the concept of HCV neuroinvasion, and we speculate that it may provide a biological substrate to neuropsychiatric disorders observed in patients with chronic hepatitis C. The exact lineage of cells permissive for HCV replication and the possible interaction between viral replication and cerebral function that may lead to depression remain to be elucidated.
Directory of Open Access Journals (Sweden)
A. Parvaneroo
2004-12-01
Full Text Available Statement of Problem: Many studies have indicated that genetic disturbances are common findings in patients with Oral Squamous Cell Carcinoma (OSCC. Identification of these changes can be helpful in diagnostic procedures of these tumors.Purpose: The aim of this study was to appraise the chromosomal disorders in blood and tissue patients with OSCC.Methods and Materials: In this descriptive study, the study group consisted of all OSCC patients who were referred to the Faculty of Dentistry, Tehran University of Medical Sciences, Maxillofacial Surgery Clinic of Shariati Hospital, and Amir Aalam Hospital fromSeptember 2000 to November 2002. In order to study chromosomal disorders in the peripheral blood lymphocytes, 5 mL of blood was obtained from each patient In patients with the large lesion, a piece of involved tissue were obtained and cultured for 24 hours.This led to 29 blood samples and 16 tissue specimens and any relation between OSCC and age, sex, smoking and alcohol use were evaluated.Results: In this study, OSCC was more common in males than in females (3 to 5. 31% of our patients were smokers, and one had a history of alcoholic consumption. There was an increase in incidence of OSCC with age. In this study, all patients had numerical(aneuploidy, polyploidy and structural chromosomal disorders (double minute, fragment,breakage and dicentric. There was significant difference between blood and tissue chromosomal disorders (aneuploidy, polyploidy,breakage in OSCC patients.Conclusion: It can be concluded that chromosomes in patients with OSCC might show some genetic aberration and evaluation of involved tissue might be better way for determining this disorders.
International Nuclear Information System (INIS)
Kweon, Dae Cheol
2016-01-01
The objective of this study was to detect the fragments generated during IV (intravenous) catheter injection of contrast medium and drug administration in a clinical setting and removal was performed by experimentally producing a phantom, and to compare the radiography, ultrasonography, and multi-detector computed tomography (MDCT) imaging and radiation dose. A 1 cm fragment of an 18 gage Teflon® IV catheter with saline was inserted into the IV control line. Radiography, CT, and ultrasonography were performed and radiography and CT dose were calculated. CT and ultrasonography showed an IV catheter fragment clinically and radiography showed no visible difference in the ability to provide a useful image of an IV catheter fragment modality (p >.05). Radiography of effective dose (0.2139 mSv·Gy-1·cm-2) form DAP DAP (0.93 μGy·m2 ), and dose length product (DLP) (201 mGy·cm) to effective dose was calculated as 0.483 mSv. IV catheter fragment were detected of radiography, ultrasonography and CT. These results can be obtained by menas of an excellent IV catheter fragment of detection capability CT. However, CT is followed by radiation exposure. IV catheter fragment confirming the position and information recommend an ultrasonography
International Nuclear Information System (INIS)
Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James
2014-01-01
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)
2014-04-10
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Gallstone fragmentation by control electrohydraulic lithotripsy
International Nuclear Information System (INIS)
Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.
1989-01-01
The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy
Angular distribution of photofission fragments in 238U at 5.43 MeV
International Nuclear Information System (INIS)
Kuniyoshi, S.; Mafra, O.Y.; Renner, C.; Goldemberg, J.
1974-01-01
The angular distribution of photofission fragments of 238 U, produced by 5.43 MeV monochromatic photons from the eta,γ reaction in sulphur, has been measured using glass plates as detectors. In the analysis of the results only the contributions from the (J sup(π), K) 1= (1 - ,0), (1 - ,1) and (2 + ,0) terms were considered. The coefficients of the angular distributions of the fission fragments were obtained. An analysis of the data available in the literature on the angular distribution near the photofission threshold is also presented
Angular distribution of photofission fragments in 238U at 5.43 MeV
International Nuclear Information System (INIS)
Kuniyoshi, Susumo
1973-01-01
The angular distribution of photofission fragments of 238 U, produced by 5.43 MeV monochromatic photons from the η,γ reaction in sulphur, has been measured using glass plates as detectors. In the analysis of the results only the contributions from the (J π , K) 1= (1 - ,0), (1 - ,1) and (2 + ,0) terms were considered. The coefficients of the angular distributions of the fission fragments were obtained. An analysis of the data available in the literature on the angular distribution near the photofission threshold is also presented. (author)
Acoustic radiation force due to arbitrary incident fields on spherical particles in soft tissue
Energy Technology Data Exchange (ETDEWEB)
Treweek, Benjamin C., E-mail: btreweek@utexas.edu; Ilinskii, Yurii A.; Zabolotskaya, Evgenia A.; Hamilton, Mark F. [Applied Research Laboratories, The University of Texas at Austin, P.O. Box 8029, Austin, TX 78713-8029 (United States)
2015-10-28
Acoustic radiation force is of interest in a wide variety of biomedical applications ranging from tissue characterization (e.g. elastography) to tissue treatment (e.g. high intensity focused ultrasound, kidney stone fragment removal). As tissue mechanical properties are reliable indicators of tissue health, the former is the focus of the present contribution. This is accomplished through an investigation of the acoustic radiation force on a spherical scatterer embedded in tissue. Properties of both the scatterer and the surrounding tissue are important in determining the magnitude and the direction of the force. As these properties vary, the force computation shows changes in magnitude and direction, which may enable more accurate noninvasive determination of tissue properties.
Fragmentation functions approach in pQCD fragmentation phenomena
International Nuclear Information System (INIS)
Rolli, S.
1996-07-01
Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines
Fragmentation of neck-like structures
International Nuclear Information System (INIS)
Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI
1994-01-01
Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)
Directory of Open Access Journals (Sweden)
Paula Eveline Ribeiro D’Anunciação
2013-01-01
Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.
Valjakka, J; Hemminki, A; Teerinen, T; Takkinen, K; Rouvinen, J
2000-02-01
Recombinant anti-testosterone wild-type Fab fragment and mutant Fab fragments with high binding selectivity developed by protein engineering have been crystallized with and without ligands. Crystals of these Fab fragments were obtained by the vapour-diffusion technique at room temperature using solutions of PEG 3350 with various biological buffers and with a wide pH range. So far, five data sets have been collected from crystals of three Fab-antigen complexes and from two uncomplexed Fab fragments, with resolutions ranging from 2.10 to 3.1 A. Crystallization conditions for Fab fragments were found by using modifications of the low ionic strength PEG 3350 series. Suitable concentrations of PEG 400, MPD and glycerol solutions for use as cryoprotectants in PEG 3350 solutions have been determined. One useful observation was that PEG 3350 is able to work alone as a cryoprotectant. The screening protocol used requires a smaller amount of protein material to achieve auspicious pre-crystals than previously. Results support the claim that PEG 3350 is more suitable for the crystallization of Fab fragments than higher molecular weight PEGs.
Excited State Contributions to the Heavy Baryon Fragmentation Functions in a Quark-Diquark Model
Adamov, A D; Goldstein, Gary R.
2001-01-01
Spin dependent fragmentation functions for heavy flavor quarks to fragment into heavy baryons are calculated in a quark-diquark model. The production of intermediate spin 1/2 and 3/2 excited states is explicity included. The resulting $\\Lambda_b$ production rate and polarization at LEP energies are in agreement with experiment. The $\\Lambda_c$ and $\\Xi_c$ functions are also obtained. The spin independent $f_1(z)$ is compared to data. The integrated values for production rates agree with the data.
Fragment angular momentum and descent dynamics in {sup 252}Cf spontaneous fission
Energy Technology Data Exchange (ETDEWEB)
Popeko, G.S.; Ter-Akopian, G.M.; Daniel, A.V.; Oganessian, Y.T.; Kliman, J. [JINR, Dubna, 141980 (Russia); Ter-Akopian, G.M.; Hamilton, J.H.; Kormicki, J.; Daniel, A.V.; Ramayya, A.V.; Hwang, J.K.; Sandulescu, A.; Florescu, A.; Greiner, W. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Ter-Akopian, G.M.; Daniel, A.V.; Florescu, A.; Greiner, W. [JIHIR, Oak Ridge, Tennessee 37831 (United States); Greiner, W. [ITP, J.W. Goethe University, D-60054, Frankfurt am Main (Germany); Florescu, A. [IAP, Bucharest, P.O. Box MG-6, (Russian Federation); Kliman, J.; Morhac, M. [IP SASc, Bratislava (Slovak Republic); Rasmussen, J.O. [LBNL, Berkeley, California 94720 (United States); Stoyer, M.A. [LLNL, Livermore , California 94550 (United States); Cole, J.D. [INEL, Idaho Falls, Idaho 83415 (United States)
1998-12-01
Fragment angular momenta as a function of neutron multiplicity were extracted for the first time for the Mo-Ba and Zr-Ce charge splits of {sup 252}Cf by studying prompt coincident {gamma}-rays. The obtained primary fragment angular momenta do not continuously rise with the increase in the number of neutrons evaporated. In frame of the scission point bending oscillation model such regularity is explained due the decrease of the bending temperature. Adiabatic bending oscillations (T=0) are obtained at large ({nu}{sub tot}{gt}5) and small ({nu}{sub tot}=0) scission point elongation. These oscillations are excited to the temperature of 2{endash}3 MeV for the most probable scission configurations indicating a weak coupling between collective and internal degrees of freedom. A strong coupling between the collective bending and dipole oscillations was found. {copyright} {ital 1998 American Institute of Physics.}
Fragmentation of Ceramics in Rapid Expansion Mode
Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan
The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.
International Nuclear Information System (INIS)
Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin
1990-01-01
The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)
The formation of planets by disc fragmentation
Directory of Open Access Journals (Sweden)
Stamatellos Dimitris
2013-04-01
Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.
Extraction of 16th Century Calender Fragments
DEFF Research Database (Denmark)
Holck, Jakob Povl; Etheridge, Christian
at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....
Fragmentation of single-particle states in deformed nuclei
International Nuclear Information System (INIS)
Malov, L.A.; Soloviev, V.G.
1975-01-01
Fragmentation of single-particle states on levels of deformed nuclei is studied on the example of 239 U and 169 Er nuclei in the framework of the model taking into consideration the interaction of quasiparticles with phonons. The dependence of fragmentation on the Fermi surface is considered from the viewpoint of single-particle levels. It is shown that in the distribution of single-particle strength functions a second maximum appears together with the large asymmetry maximum at high-energy excitation, and the distribution has a long ''tail''. A semimicroscopic approach is proposed for calculating the neutron strength functions. The following values of the strength functions are obtained: for sub(239)U-Ssub(0)sup(cal)=1.2x10sup(-4), Ssub(1)sup(cal)=2.7x10sub(-4) and for sub(169)Er-Ssub(0)sup(cal)=1.10sup(-4), Ssub(1)sup(cal)=1.2x10sup(-4)
Fluctuations in the fragmentation process
International Nuclear Information System (INIS)
Botet, R.; Ploszajczak, M.
1993-01-01
Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs
[Fragment-based drug discovery: concept and aim].
Tanaka, Daisuke
2010-03-01
Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.
Tylosin depletion in edible tissues of turkeys.
Montesissa, C; De Liguoro, M; Santi, A; Capolongo, F; Biancotto, G
1999-10-01
The depletion of tylosin residues in edible turkey tissues was followed after 3 days of administration of tylosin tartrate at 500 mg l-1 in drinking water, to 30 turkeys. Immediately after the end of the treatment (day 0) and at day 1, 3, 5 and 10 of withdrawal, six turkeys (three males and three females) per time were sacrificed and samples of edible tissues were collected. Tissue homogenates were extracted, purified and analysed by HPLC according to a method previously published for the analysis of tylosin residues in pig tissues. In all tissues, tylosin residues were already below the detection limits of 50 micrograms kg-1 at time zero. However, in several samples of tissues (skin + fat, liver, kidney, muscle), from the six turkeys sacrificed at that time, one peak corresponding to an unknown tylosin equivalent was detected at measurable concentrations. The identification of this unknown compound was performed by LC-MS/MS analysis of the extracts from incurred samples. The mass fragmentation of the compound was consistent with the structure of tylosin D (the alcoholic derivative of tylosin A), the major metabolite of tylosin previously recovered and identified in tissues and/or excreta from treated chickens, cattle and pigs.
Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator
Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.
2018-04-01
The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.
Knockout and fragmentation reactions using a broad range of tin isotopes
Rodríguez-Sánchez, J. L.; Benlliure, J.; Bertulani, C. A.; Vargas, J.; Ayyad, Y.; Alvarez-Pol, H.; Atkinson, J.; Aumann, T.; Beceiro-Novo, S.; Boretzky, K.; Caamaño, M.; Casarejos, E.; Cortina-Gil, D.; Díaz-Cortes, J.; Fernández, P. Díaz; Estrade, A.; Geissel, H.; Kelić-Heil, A.; Litvinov, Yu. A.; Mostazo, M.; Paradela, C.; Pérez-Loureiro, D.; Pietri, S.; Prochazka, A.; Takechi, M.; Weick, H.; Winfield, J. S.
2017-09-01
Production cross sections of residual nuclei obtained by knockout and fragmentation reactions of different tin isotopes accelerated at 1 A GeV have been measured with the fragment separator (FRS) at GSI, Darmstadt. The new measurements are used to investigate the neutron-excess dependence of the neutron- and proton-knockout cross sections. These cross sections are compared to Glauber model calculations coupled to a nuclear de-excitation code in order to investigate the role of the remnant excitations. This bench marking shows an overestimation of the cross sections for the removal of deeply bound nucleons. A phenomenological increase in the excitation energy induced in the remnants produced in these cases allows us to reproduce the measured cross sections.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W.D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J.E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K.H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P.S.L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, N.; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, S.U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M.J.; Crennell, D.; Cuevas, J.; D'Hondt, J.; da Silva, T.; Da Silva, W.; Della Ricca, G.; De Angelis, A.; De Boer, W.; De Clercq, C.; De Lotto, B.; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Drees, J.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Espirito Santo, M.C.; Fanourakis, G.; Fassouliotis, D.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, E.; Gokieli, R.; Golob, B.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Hoffman, J.; Holmgren, S.O.; Holt, P.J.; Houlden, M.A.; Jackson, J.N.; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, E.K.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, F.; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kersevan, B.P.; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J.C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; McNulty, R.; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Moenig, K.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nemecek, S.; Nicolaidou, R.; Nikolenko, M.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, H.; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Podobnik, T.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Radojicic, D.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Roudeau, P.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Savoy-Navarro, A.; Schwickerath, U.; Sekulin, R.; Siebel, M.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Tegenfeldt, F.; Timmermans, J.; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Turluer, M.L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; Van Dam, P.; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimine, N.I.; Zintchenko, A.; Zupan, M.
2011-01-01
The nature of b-quark jet hadronisation has been investigated using data taken at the Z peak by the DELPHI detector at LEP. Two complementary methods are used to reconstruct the energy of weakly decaying b-hadrons, E^weak_B. The average value of x^weak_B = E^weak_B/E_beam is measured to be 0.699 +/- 0.011. The resulting x^weak_B distribution is then analysed in the framework of two choices for the perturbative contribution (parton shower and Next to Leading Log QCD calculation) in order to extract measurements of the non-perturbative contribution to be used in studies of b-hadron production in other experimental environments than LEP. In the parton shower framework, data favour the Lund model ansatz and corresponding values of its parameters have been determined within PYTHIA~6.156 from DELPHI data: a= 1.84^{+0.23}_{-0.21} and b=0.642^{+0.073}_{-0.063} GeV^-2, with a correlation factor rho = 92.2%. Combining the data on the b-quark fragmentation distributions with those obtained at the Z peak by ALEPH, OPAL a...
Fragment emission from modestly excited nuclear systems
Energy Technology Data Exchange (ETDEWEB)
Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.
1996-07-08
Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).
Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T
2018-06-01
To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically
Dynamics of tissue topology during cancer invasion and metastasis
International Nuclear Information System (INIS)
Munn, Lance L
2013-01-01
During tumor progression, cancer cells mix with other cell populations including epithelial and endothelial cells. Although potentially important clinically as well as for our understanding of basic tumor biology, the process of mixing is largely a mystery. Furthermore, there is no rigorous, analytical measure available for quantifying the mixing of compartments within a tumor. I present here a mathematical model of tissue repair and tumor growth based on collective cell migration that simulates a wide range of observed tumor behaviors with correct tissue compartmentalization and connectivity. The resulting dynamics are analyzed in light of the Euler characteristic number (χ), which describes key topological features such as fragmentation, looping and cavities. The analysis predicts a number of regimes in which the cancer cells can encapsulate normal tissue, form a co-interdigitating mass, or become fragmented and encapsulated by endothelial or epithelial structures. Key processes that affect the topological changes are the production of provisional matrix in the tumor, and the migration of endothelial or epithelial cells on this matrix. Furthermore, the simulations predict that topological changes during tumor invasion into blood vessels may contribute to metastasis. The topological analysis outlined here could be useful for tumor diagnosis or monitoring response to therapy and would only require high resolution, 3D image data to resolve and track the various cell compartments. (paper)
Dynamics of tissue topology during cancer invasion and metastasis
Munn, Lance L.
2013-12-01
During tumor progression, cancer cells mix with other cell populations including epithelial and endothelial cells. Although potentially important clinically as well as for our understanding of basic tumor biology, the process of mixing is largely a mystery. Furthermore, there is no rigorous, analytical measure available for quantifying the mixing of compartments within a tumor. I present here a mathematical model of tissue repair and tumor growth based on collective cell migration that simulates a wide range of observed tumor behaviors with correct tissue compartmentalization and connectivity. The resulting dynamics are analyzed in light of the Euler characteristic number (χ), which describes key topological features such as fragmentation, looping and cavities. The analysis predicts a number of regimes in which the cancer cells can encapsulate normal tissue, form a co-interdigitating mass, or become fragmented and encapsulated by endothelial or epithelial structures. Key processes that affect the topological changes are the production of provisional matrix in the tumor, and the migration of endothelial or epithelial cells on this matrix. Furthermore, the simulations predict that topological changes during tumor invasion into blood vessels may contribute to metastasis. The topological analysis outlined here could be useful for tumor diagnosis or monitoring response to therapy and would only require high resolution, 3D image data to resolve and track the various cell compartments.
Delayed β ray spectrum of 235U fission fragments
International Nuclear Information System (INIS)
Pascholati, P.R.
1973-01-01
The time-dependent electron spectra of fission fragments from the thermal-neutron-induced fission of 235 U are calculated. The Gross theory of nuclear beta decay is used to obtain the decay constant and individual electron spectra. The mean energy per fission carried by the electrons and the number of electrons per fission are also calculated. Comparison of these calculated spectra to experimental ones shows good agreements. (Author) [pt
Avinash, Alok; Dubey, Alok; Singh, Rajeev Kumar; Prasad, Swati
2014-01-01
Dental fractures of the permanent maxillary anterior teeth are relatively frequent accidents during childhood. The Efficient diagnosis and treatment of dental injury are important elements in clinical dentistry. This article describes a case of trauma in permanent right central maxillary incisors with tooth fragments embedded in the lower lip. Thorough clinical examination followed by soft tissue radiographs confirmed the presence of a fractured incisal fragment, which was surgically retrieved under local anesthesia. Direct composite restoration was placed. After finishing and polishing, an esthetic and natural-looking restoration was achieved; this completely satisfied the functional and esthetic expectation of the patient and dental team. How to cite this article: Avinash A, Dubey A, Singh RK, Prasad S. Surgical Removal of Coronal Fragment of Tooth Embedded in Lower Lip and Esthetic Management of Fractured Crown Segment. Int J Clin Pediatr Dent 2014;7(1):65-68.
Fragmentation of C2H4 by charge-changing collisions of O2+ ions
International Nuclear Information System (INIS)
Sato, S.; Mizuno, T.; Yamada, T.; Imai, M.; Shibata, H.; Itoh, A.; Tsuchida, H.
2009-01-01
We investigated molecular fragmentation of C 2 H 4 in charge-changing collisions of 1.14MeV O 2+ ions. Branching ratios associated with decaying from temporary produced (C 2 H 4 ) r+ ions into various fragment channels were obtained. Dissociation via a C-C bond breaking is preferential in 1-electron loss collisions in comparison with 1-electron capture collisions. We confirmed that multiple ionization and dissociation rarely occur in electron capture collisions, while they occur rather strongly in electron loss collisions. (author)
International Nuclear Information System (INIS)
Montoya, M.; Rojas, J.; Lobato, I.
2010-01-01
The average of fragment kinetic energy (E-bar sign*) and the multiplicity of prompt neutrons (ν(bar sign)) as a function of fragment mass (m*), as well as the fragment mass yield (Y(m*)) from thermal neutron-induced fission of 239 Pu have been measured by Tsuchiya et al.. In that work the mass and kinetic energy are calculated from the measured kinetic energy of one fragment and the difference of time of flight of the two complementary fragments. However they do not present their results about the standard deviation σ E *(m*). In this work we have made a numerical simulation of that experiment which reproduces its results, assuming an initial distribution of the primary fragment kinetic energy (E(A)) with a constant value of the standard deviation as function of fragment mass (σ E (A)). As a result of the simulation we obtain the dependence σ E *(m*) which presents an enhancement between m* = 92 and m* = 110, and a peak at m* = 121.
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
International Nuclear Information System (INIS)
Al-Gubory, Kais H.
2005-01-01
The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals
Fragger: a protein fragment picker for structural queries.
Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J
2017-01-01
Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.
Liaw, Lucy; Prudovsky, Igor; Koza, Robert A.; Anunciado-Koza, Rea V.; Siviski, Matthew E.; Lindner, Volkhard; Friesel, Robert E.; Rosen, Clifford J.; Baker, Paul R.S.; Simons, Brigitte; Vary, Calvin P.H.
2016-01-01
Our objective was to characterize lipid profiles in cell models of adipocyte differentiation in comparison to mouse adipose tissues in vivo. A novel lipid extraction strategy was combined with global lipid profiling using direct infusion and sequential precursor ion fragmentation, termed MS/MSALL. Perirenal and inguinal white adipose tissue and interscapular brown adipose tissues from adult C57BL/6J mice were analyzed. 3T3-L1 preadipocytes, ear mesenchymal progenitor cells, and brown adipose-...
International Nuclear Information System (INIS)
Quinn, T.P.
2003-01-01
The successful clinical application of targeted-radiopharmaceuticals depends on the development of molecules that optimize tumor specific radionuclide deposition and minimize non-specific organ irradiation. To this end, this proposal outlines a research effort to identify and evaluate novel antibodies and antibody fragments that bind breast tumors. The tumor-avid antibodies will be investigated for as imaging and therapeutic agents and to gain a better understanding of the pharmacokinetics and metabolism of radiolabeled tumor-avid antibody fragments through the use of site-specifically labeled molecules. Antibodies or antibody fragments, that bind breast carcinoma carbohydrate antigens, will be obtained from hybridoma or bacteriophage library screening. More specifically, antibody fragments that bind the carcinoma-associated Thomsen-Friedenreich (T) antigen will be radiolabeled with 99m Tc and 188 Re at a natural amino acid chelation site and will be investigated in vivo for their abilities to target human breast tumors. In addition, site-specific radiolabeled antibody fragments will be biosynthesized using misacylated suppressor tRNAs. Homogeneously radiolabeled populations of antibody fragments will be used to investigate the effects of radionuclide location and chelation chemistries on their biodistribution and metabolism. It is hypothesized that site-specifically radiolabeled antibody fragments will possess enhanced tumor imaging and therapeutic properties due to optimal label location and conjugation chemistries. New insights into the factors that govern antibody metabolism in vivo are also expected from this work. Results from these studies should enhance our ability to design and synthesize radiolabeled antibody fragments that have improved pharmacokinetic properties. The studies in this proposal involve basic research into the development of antibody-based radiopharmaceuticals, with the ultimate goal of application in humans. This type of basic nuclear
Kaon fragmentation function from NJL-jet model
International Nuclear Information System (INIS)
Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang
2010-01-01
The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.
Fragmentation of rotating protostellar clouds
International Nuclear Information System (INIS)
Tohline, J.E.
1980-01-01
We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution
Fragment-based approaches to TB drugs.
Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris
2018-02-01
Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.
Peptide fragments induce a more rapid immune response than intact proteins in earthworms.
Hanusová, R; Tucková, L; Halada, P; Bezouska, K; Bilej, M
1999-01-01
The effect of in vivo proteolytic processing of protein antigen was studied in Eisenia foetida earthworms. Parenteral administration of the protein antigen induces elevated levels of an antigen-binding protein (ABP) which recognizes the protein used for stimulation. When the protein antigen is administered simultaneously with nontoxic serine proteinase inhibitor, ABP levels remain close to background. On the other hand, the in vivo adaptive response of earthworms to peptide fragments obtained by coelomic fluid digestion of the foreign antigen occurs even in the presence of proteinase inhibitor and, moreover, is significantly faster as compared to the response to intact antigen. These findings confirm the role of proteolytic processing in earthworms. MALDI mass spectrometric analysis of the fragments after coelomic fluid digestion has revealed the presence of the peptide fragments with molecular weights in the mass range 700-1100 Da.
The Zero-Degree Detector system for fragmentation studies
International Nuclear Information System (INIS)
Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.
2007-01-01
The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan
Introduction to fragment-based drug discovery.
Erlanson, Daniel A
2012-01-01
Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.
Mechanisms Affecting Population Density in Fragmented Habitat
Directory of Open Access Journals (Sweden)
Lutz Tischendorf
2005-06-01
Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation
Quark fragmentation in e+e- collisions
International Nuclear Information System (INIS)
Oddone, P.
1984-12-01
This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman
The use of many-body expansions and geometry optimizations in fragment-based methods.
Fedorov, Dmitri G; Asada, Naoya; Nakanishi, Isao; Kitaura, Kazuo
2014-09-16
Conspectus Chemists routinely work with complex molecular systems: solutions, biochemical molecules, and amorphous and composite materials provide some typical examples. The questions one often asks are what are the driving forces for a chemical phenomenon? How reasonable are our views of chemical systems in terms of subunits, such as functional groups and individual molecules? How can one quantify the difference in physicochemical properties of functional units found in a different chemical environment? Are various effects on functional units in molecular systems additive? Can they be represented by pairwise potentials? Are there effects that cannot be represented in a simple picture of pairwise interactions? How can we obtain quantitative values for these effects? Many of these questions can be formulated in the language of many-body effects. They quantify the properties of subunits (fragments), referred to as one-body properties, pairwise interactions (two-body properties), couplings of two-body interactions described by three-body properties, and so on. By introducing the notion of fragments in the framework of quantum chemistry, one obtains two immense benefits: (a) chemists can finally relate to quantum chemistry, which now speaks their language, by discussing chemically interesting subunits and their interactions and (b) calculations become much faster due to a reduced computational scaling. For instance, the somewhat academic sounding question of the importance of three-body effects in water clusters is actually another way of asking how two hydrogen bonds affect each other, when they involve three water molecules. One aspect of this is the many-body charge transfer (CT), because the charge transfers in the two hydrogen bonds are coupled to each other (not independent). In this work, we provide a generalized view on the use of many-body expansions in fragment-based methods, focusing on the general aspects of the property expansion and a contraction of a
DEFF Research Database (Denmark)
Bang, Jacob Sebastian
2018-01-01
I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....
Chemical Production using Fission Fragments
International Nuclear Information System (INIS)
Dawson, J. K.; Moseley, F.
1960-01-01
Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr
The dynamics of fragment formation
International Nuclear Information System (INIS)
Keane, D.
1994-09-01
We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy
DEFF Research Database (Denmark)
Vassiliadis, Efstathios; Veidal, Sanne Skovgård; Simonsen, Henrik
2011-01-01
AIM: Liver fibrosis involves excessive remodeling and deposition of fibrillar extracellular matrix (ECM) components, which leads to malfunction of the organ, causing significant morbidity and mortality. The aim of this study was to assess whether levels of a type V collagen fragment, the propepti...
Hands as markers of fragmentation
Directory of Open Access Journals (Sweden)
A. Barnard
2005-07-01
Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.
International Nuclear Information System (INIS)
Silisteanu, I.
1991-06-01
The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs
2004-12-01
the absence of dilatation, aneurysm formation or neointimal hyperplasia . The 2003 report described the failure to provide appropriate carotid grafts...growth of fibrovascular tissue, sometimes accompanied by inflammatory cells and pigment-laden macrophages. Fragmentation of the umbilical vein...were also present within the device interstices. A fibrovascular stroma (all animals, mild to marked) was also noted within the lumen of the ePTFE
An Algebra for Program Fragments
DEFF Research Database (Denmark)
Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger
1985-01-01
Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...
Energy Technology Data Exchange (ETDEWEB)
Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-09-05
The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.
A model for projectile fragmentation
International Nuclear Information System (INIS)
Chaudhuri, G; Mallik, S; Gupta, S Das
2013-01-01
A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.
Gamma Radiation from Fission Fragments
International Nuclear Information System (INIS)
Higbie, Jack
1969-10-01
The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass
Gamma Radiation from Fission Fragments
Energy Technology Data Exchange (ETDEWEB)
Higbie, Jack
1969-10-15
The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.
Influences of gentrification on identity shift of an urban fragment: A case study
Directory of Open Access Journals (Sweden)
Nedučin Dejana
2009-01-01
Full Text Available This paper discusses the process of gentrification, researched through a perspective of its positive and negative aspects. It underlines the importance of reasonable proportioning, sensible structuring and long-term planning of transformation of urban spaces, which contributes to an upgrade of living conditions and qualitative advancement of social consciousness and development of needs of the local inhabitants, regardless of their socio-economic profile. Despite not perceiving gentrification as an a priori negative process, influences of alterations of urban tissue carried out through radical and narrowly interpreted modifications of their character may cause undesired changes in the perception and use of the space and were analyzed as well. A case study of the gentrification of Grbavica, an urban fragment in Novi Sad, Serbia, is presented. The goal of this research was to critically valorize the over-all transformation of the aforementioned fragment, taking into account architectural, urban, social, cultural, economic and other facets.
Fragment emission in reactions of 18.5-GeV 12C ions with complex nuclei
International Nuclear Information System (INIS)
Porile, N.T.; Cole, G.D.
1982-01-01
The emission of fragments ranging from 24 Na to 52 Mn in reactions of 18.5 GeV 12 C ions with Cu, Ag, Gd, Ta, Au, and U targets has been studied by means of activation techniques. The experiments involved determination of the fragment production cross sections and thick-target recoil properties. The latter were used to obtain mean fragment kinetic energies and values of β/sub parallel to/, the forward velocity component of the struck nucleus (in units of c). The results are compared with similar data for incident protons of the same total kinetic energy. The data may be used to assess the importance of central collisions in fragment production. Such collisions lead to the near total destruction of both interacting nuclei and the resulting fragments are emitted by a system of intermediate rapidity. In such a process, the factorization hypothesis, which has been shown to be valid for target and projectile fragmentation reactions, should not be obeyed. A test for factorization is performed by means of a relation which states that the ratio of the cross sections for producing fragment /sup A/Z in 12 C reactions to that for producing the same fragment in proton reactions with the same target is unity, provided both cross sections are reduced by the values of the corresponding total reaction cross sections sigma/sub R/, and evaluated for the same total kinetic energy of the projectile. The results of this comparison for the targets studied are presented and discussed
Energy Technology Data Exchange (ETDEWEB)
Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)
2014-06-14
We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.
Remarks about the hypothesis of limiting fragmentation
International Nuclear Information System (INIS)
Chou, T.T.; Yang, C.N.
1987-01-01
Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs
Pereira, J; Wlazlo, W; Benlliure, J; Casarejos, E; Armbruster, P; Bernas, M; Enqvist, T; Legrain, R; Leray, S; Rejmund, F; Mustapha, B; Schmidt, K.-H; Stéphan, C; Taïeb, J; Tassan-Got, L; Volant, C; Boudard, A; Czajkowski, S; 10.1103/PhysRevC.75.014602
2007-01-01
Fission fragments of 1A GeV 238U nuclei interacting with a deuterium target have been investigatedwith the Fragment Separator (FRS) at GSI (Darmstadt) by measuring their isotopicproduction cross-sections and recoil velocities. The results, along with those obtained recently forspallation-evaporation fragments, provide a comprehensive analysis of the spallation nuclear productionsin the reaction 238U(1A GeV)+d. Details about experiment performance, data reductionand results will be presented.
Polarization and alignment of nucleus fission fragments
International Nuclear Information System (INIS)
Barabanov, A.L.; Grechukhin, D.P.
1987-01-01
Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists
Nuclear energy release from fragmentation
Energy Technology Data Exchange (ETDEWEB)
Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)
2016-08-15
It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.
Isegawa, Miho; Gao, Jiali; Truhlar, Donald G
2011-08-28
Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics
''Normal'' tissues from humans exposed to radium contain an alteration in the c-mos locus
International Nuclear Information System (INIS)
Huberman, E.; Schlenker, R.A.; Hardwick, J.P.
1989-01-01
The structures of a number of human proto-oncogenes from persons with internal systemic exposure to radium were analyzed by restriction enzyme digestion and southern blotting of their DNA. Two extra c-mos Eco R1 restriction-fragment-length bands of 5.0 kb and 5.5 kb were found in tissue DNA from six of seven individuals. The extra c-mos bands were detected in DNA from many, but not all, of the tissues of the individuals exposed to radium. Our results suggest that the c-mos restriction-fragment-length alterations (RFLA) found in individuals exposed to radium were induced rather than inherited, are epigenetic in origin, and most likely result from changes in the methylation of bases surrounding the single exon of the c-mos proto-oncogene. 7 refs., 3 figs., 2 tabs
Dihadron fragmentation function and its evolution
International Nuclear Information System (INIS)
Majumder, A.; Wang Xinnian
2004-01-01
Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
Monte Carlo simulation as a tool to predict blasting fragmentation based on the Kuz Ram model
Morin, Mario A.; Ficarazzo, Francesco
2006-04-01
Rock fragmentation is considered the most important aspect of production blasting because of its direct effects on the costs of drilling and blasting and on the economics of the subsequent operations of loading, hauling and crushing. Over the past three decades, significant progress has been made in the development of new technologies for blasting applications. These technologies include increasingly sophisticated computer models for blast design and blast performance prediction. Rock fragmentation depends on many variables such as rock mass properties, site geology, in situ fracturing and blasting parameters and as such has no complete theoretical solution for its prediction. However, empirical models for the estimation of size distribution of rock fragments have been developed. In this study, a blast fragmentation Monte Carlo-based simulator, based on the Kuz-Ram fragmentation model, has been developed to predict the entire fragmentation size distribution, taking into account intact and joints rock properties, the type and properties of explosives and the drilling pattern. Results produced by this simulator were quite favorable when compared with real fragmentation data obtained from a blast quarry. It is anticipated that the use of Monte Carlo simulation will increase our understanding of the effects of rock mass and explosive properties on the rock fragmentation by blasting, as well as increase our confidence in these empirical models. This understanding will translate into improvements in blasting operations, its corresponding costs and the overall economics of open pit mines and rock quarries.
International Nuclear Information System (INIS)
Wilbur, D.S.; Hadley, S.W.; Grant, L.M.; Hylarides, M.D.
1991-01-01
A comparative investigation of the biodistributions of radioiodinated p- and m-iodobenzoyl conjugates of a monoclonal antibody Fab fragment, NR-LU-10 Fab, and the same antibody Fab fragment radioiodinated by the chloramine-T (ChT) method has been carried out in mice. Coinjected, dual-isotope studies in athymic mice with tumor xenografts have demonstrated that there are only minor differences in the in vivo distributions of the iodobenzoyl-labeled Fabs, except in the excretory organs, kidneys, and intestines, where major differences were observed. Similarly, coinjection of either the p-iodobenzoyl or m-iodobenzoyl conjugate of NR-LU-10 Fab with the Fab radioiodinated with ChT/radioiodide into BALB/c mice provided additional data that indicated that the two iodobenzoyl conjugates distributed similar in a number of selected tissues. The tissue-distribution differences of the regioisomeric iodobenzoyl conjugates in relation to the ChT-radioiodinated Fab were large for the stomach and neck, consistent with previous studies. The most notable difference between the two iodobenzoyl conjugates was the kidney activity, where the m-iodobenzoyl conjugate was similar to the directly labeled Fab, but the p-iodobenzoyl-conjugated Fab was higher by nearly a factor of 2
DYNAMICS OF LARGE FRAGMENTS IN THE TAIL OF ACTIVE ASTEROID P/2010 A2
International Nuclear Information System (INIS)
Agarwal, Jessica; Jewitt, David; Weaver, Harold
2013-01-01
We examine the motions of large fragments at the head of the dust tail of the active asteroid P/2010 A2. In previous work, we showed that these fragments were ejected from the primary nucleus in early 2009, either following a hypervelocity impact or by rotationally induced breakup. Here, we follow their positions through a series of Hubble Space Telescope images taken during the first half of 2010. The orbital evolution of each fragment allows us to constrain its velocity relative to the main nucleus after leaving its sphere of gravitational influence. We find that the fragments constituting a prominent X-shaped tail feature were emitted in a direction opposite to the motion of the asteroid and toward the south of its orbital plane. Derived emission velocities of these primary fragments range between 0.02 and 0.3 m s –1 , comparable to the ∼0.08 m s –1 gravitational escape speed from the nucleus. Their sizes are on the order of decimeters or larger. We obtain the best fits to our data with ejection velocity vectors lying in a plane that includes the nucleus. This may suggest that the cause of the disruption of P/2010 A2 is rotational breakup.
Radioisotopic method for the measurement of lipolysis in small samples of human adipose tissue
International Nuclear Information System (INIS)
Leibel, R.L.; Hirsch, J.; Berry, E.M.; Gruen, R.K.
1984-01-01
To facilitate the study of adrenoreceptor response in small needle biopsy samples of human subcutaneous adipose tissue, we developed a dual radioisotopic technique for measuring lipolysis rate. Aliquots (20-75 mg) of adipose tissue fragments were incubated in a buffered albumin medium containing [ 3 H]palmitate and [ 14 C]glucose, each of high specific activity. In neutral glycerides synthesized in this system, [ 14 C]glucose is incorporated exclusively into the glyceride-glycerol moiety and 3 H appears solely in the esterified fatty acid. Alpha-2 and beta-1 adrenoreceptor activation of tissue incubated in this system does not alter rates of 14 C-labeled glyceride accumulation, but does produce a respective increase or decrease in the specific activity of fatty acids esterified into newly synthesized glycerides. This alteration in esterified fatty acid specific activity is reflected in the ratio of 14 C: 3 H in newly synthesized triglycerides extracted from the incubated adipose tissue. There is a high correlation (r . 0.90) between the 14 C: 3 H ratio in triglycerides and the rate of lipolysis as reflected in glycerol release into the incubation medium. The degree of adrenoreceptor activation by various concentrations of lipolytic and anti-lipolytic substances can be assessed by comparing this ratio in stimulated tissue to that characterizing unstimulated tissue or the incubation medium. This technique permits the study of very small, unweighed tissue biopsy fragments, the only limitation on sensitivity being the specific activity of the medium glucose and palmitate. It is, therefore, useful for serial examinations of adipose tissue adrenoreceptor dose-response characteristics under a variety of clinical circumstances
Evolution equations for extended dihadron fragmentation functions
International Nuclear Information System (INIS)
Ceccopieri, F.A.; Bacchetta, A.
2007-03-01
We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)
Quantitative experimental modelling of fragmentation during explosive volcanism
Thordén Haug, Ø.; Galland, O.; Gisler, G.
2012-04-01
Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of
Characterization of a recombinant humanized anti-cocaine monoclonal antibody and its Fab fragment.
Kirley, Terence L; Norman, Andrew B
2015-01-01
Variations of post-translational modifications are important for stability and in vivo behavior of therapeutic antibodies. A recombinant humanized anti-cocaine monoclonal antibody (h2E2) was characterized for heterogeneity of N-linked glycosylation and disulfide bonds. In addition, charge heterogeneity, which is partially due to the presence or absence of C-terminal lysine on the heavy chains, was examined. For cocaine overdose therapy, Fab fragments may be therapeutic, and thus, a simplified method of generation, purification, and characterization of the Fab fragment generated by Endoproteinase Lys-C digestion was devised. Both the intact h2E2 antibody and purified Fab fragments were analyzed for their affinities for cocaine and 2 of its metabolites, benzoylecgonine and cocaethylene, by fluorescence quenching of intrinsic antibody tyrosine and tryptophan fluorescence resulting from binding of these drugs. Binding constants obtained from fluorescence quenching measurements are in agreement with recently published radioligand and ELISA binding assays. The dissociation constants determined for the h2E2 monoclonal and its Fab fragment are approximately 1, 5, and 20 nM for cocaethylene, cocaine, and benzoylecgonine, respectively. Tryptophan fluorescence quenching (emission at 330 nm) was measured after either excitation of tyrosine and tryptophan (280 nm) or selective excitation of tryptophan alone (295 nm). More accurate binding constants are obtained using tryptophan selective excitation at 295 nm, likely due to interfering absorption of cocaine and metabolites at 280 nm. These quenching results are consistent with multiple tryptophan and tyrosine residues in or near the predicted binding location of cocaine in a previously published 3-D model of this antibody's variable region.
Fabresse, Nicolas; Allard, Julien; Sardaby, Marine; Thompson, Adrian; Clutton, R Eddie; Eddleston, Michael; Alvarez, Jean-Claude
2017-08-15
Clinical evaluation of a colchicine specific antigen-binding fragment (Fab) in order to treat colchicine poisoning required the development of an accurate method allowing quantification of free and Fab-bound colchicine in plasma and urine, and free colchicine in tissues, to measure colchicine redistribution after Fab administration. Three methods have been developed for this purpose, and validated in plasma, urine and liver: total colchicine was determined after denaturation of Fab by dilution in water and heating; free colchicine was separated from Fab-bound colchicine by filtration with 30KDa micro-filters; tissues were homogenized in a tissue mixer. Deuterated colchicine was used as internal standard. Samples were extracted by liquid-liquid extraction and analyzed with a LC-MS/MS. LOQ were 0.5ng/mL in plasma and urine for free and total colchicine and 5pg/mg in tissues. The methods were linear in the 0.5-100ng/mL range in plasma and urine, and 5-300pg/mg in tissues with determination coefficients>0.99. Precision and accuracy of QC samples presented a CVFab fragments. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparison of renal and osseous binding of parathyroid hormone and hormonal fragments
International Nuclear Information System (INIS)
Demay, M.; Mitchell, J.; Goltzman, D.
1985-01-01
The authors compared receptor binding and adenylate cyclase stimulation of intact bovine parathyroid hormone (bPTH)-(1-84) and the synthetic amino-terminal fragments, bPTH-(1-34) and rat PTH (rPTH)-(1-34). In both canine renal membranes and cloned rat osteosarcoma cells the amino-terminal fragments bound to a single order of sites; the affinity of rPTH-(1-34) exceeded that of bPTH-(1-34), correlating with its higher potency in stimulating adenylate cyclase. In studies with oxidized bPTH-(1--84), the middle and carboxyl regions of intact PTH were found to bind to both tissues but with higher affinity to osteosarcoma cells than to renal membranes. Our results demonstrate that rPTH-(1--34) is the most favorable probe of amino-terminal PTH binding and the most potent of the PTH peptides in stimulating renal and osseous adenylate cyclase. The results also show that midregion and carboxyl determinants within intact PTH contribute to hormone binding, which does not correlate with adenylate cyclase activation and appears more significant for skeletal than for renal binding
Predicting "Hot" and "Warm" Spots for Fragment Binding.
Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L
2017-05-11
Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .
Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.
2000-01-01
DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.
Scaling and critical behaviour in nuclear fragmentation
International Nuclear Information System (INIS)
Campi, X.
1990-09-01
These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling
The politics of municipal fragmentation in Ghana
Directory of Open Access Journals (Sweden)
Abdulai Kuyini Mohammed
2015-06-01
Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA
Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen
2010-01-01
This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…
Heart Rate Fragmentation: A Symbolic Dynamical Approach
Directory of Open Access Journals (Sweden)
Madalena D. Costa
2017-11-01
Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to
Relativistic effects and the fragmentation processes with the microscopic framework
International Nuclear Information System (INIS)
Maruyama, Tomoyuki
1995-01-01
We simulate the fragmentation processes in the Ca + Ca collisions at the bombarding energy 1.05 GeV/u using the Lorentz covariant RQMD and the non-covariant usual QMD approaches. The statistical decay calculation is connected to obtain the final state. By comparing the results of RQMD with those of QMD we examine the relativistic effects and show the necessity of the Lorentz covariance of the mean-field. (author)
Fragment-separator at the U-400 cyclotron. (The Technical proposal)
International Nuclear Information System (INIS)
Majdikov, V.Z.; Bashevoj, V.V.
1998-01-01
The ion-optical calculations together with graphical modeling show some possibility to create the low-energy fragment-separator for the RIB experiments performed at the Coulomb barrier of interactions at the U-400 cyclotron. Combination of two available magnetic dipoles SP-95 and SP-97 without any additional focussing elements at the cyclotron switchyard permits one to obtain the parameters of the RIB separator adequate for the modern experiments performance
Molten aluminum alloy fuel fragmentation experiments
International Nuclear Information System (INIS)
Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.
1992-01-01
Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water
Simulations of High Speed Fragment Trajectories
Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis
2017-11-01
Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.
DEFF Research Database (Denmark)
Jangö, Hanna; Gräs, Søren; Christensen, Lise
2017-01-01
INTRODUCTION AND HYPOTHESIS: Alternative approaches to reinforce the native tissue in patients with pelvic organ prolapse (POP) are needed to improve surgical outcome. Our aims were to develop a weakened abdominal wall in a rat model to mimic the weakened vaginal wall in women with POP and then e...... showed a significantly higher strength than the group with MPEG-PLGA alone (p = 0.034). CONCLUSION: Tissue-engineering with MFFs seeded on a scaffold of biodegradable MPEG-PLGA might be an interesting adjunct to future POP repair.......INTRODUCTION AND HYPOTHESIS: Alternative approaches to reinforce the native tissue in patients with pelvic organ prolapse (POP) are needed to improve surgical outcome. Our aims were to develop a weakened abdominal wall in a rat model to mimic the weakened vaginal wall in women with POP...
Jets and quark fragmentations in Higgs boson decays
International Nuclear Information System (INIS)
Kalyniak, P.; Ng, J.N.
1983-02-01
We have calculated the first order QCD to the rate of the Higgs boson decaying into two heavy quarks. Our corrections are found to be numerically smaller than previously obtained. By constructing a hybrid heavy quark fragmentation model we calculated the average momentum fraction carried off by rank one and two mesons in the decay. We also found that the average charge multiplicity from Higgs boson decay is high and is estimated to be approximately 17 charged particles for a Higgs with mass of 20 GeV/c 2
$D^{0}, D^{+}, D_{s}^{+}$, and $\\Lambda_{c}^{+}$ Fragmentation Functions from CERN LEP1
Kniehl, Bernd A; Kniehl, Bernd A.; Kramer, Gustav
2005-01-01
We present new sets of nonperturbative fragmentation functions for D^0, D^+, and D_s^+ mesons as well as for Lambda_c^+ baryons, both at leading and next-to-leading order in the MSbar factorization scheme with five massless quark flavors. They are determined by fitting data of e^+e^- annihilation taken by the OPAL Collaboration at CERN LEP1. We take the charm-quark fragmentation function to be of the form proposed by Peterson et al. and thus obtain new values of the epsilon_c parameter, which are specific for our choice of factorization scheme.
Microstructural characterization of pipe bomb fragments
International Nuclear Information System (INIS)
Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher
2010-01-01
Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.
MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.
The, Matthew; Käll, Lukas
2016-03-04
Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).
Vitrification of human ovarian tissue: effect of different solutions and procedures.
Amorim, Christiani Andrade; David, Anu; Van Langendonckt, Anne; Dolmans, Marie-Madeleine; Donnez, Jacques
2011-03-01
To test the effect of different vitrification solutions and procedures on the morphology of human preantral follicles. Pilot study. Gynecology research unit in a university hospital. Ovarian biopsies were obtained from nine women aged 22-35 years. Ovarian tissue fragments were subjected to [1] different vitrification solutions to test their toxicity or [2] different vitrification methods using plastic straws, medium droplets, or solid-surface vitrification before in vitro culture. Number of morphologically normal follicles after toxicity testing or vitrification with the different treatments determined by histologic analysis. In the toxicity tests, only VS3 showed similar results to fresh tissue before and after in vitro culture (fresh controls 1 and 2). In addition, this was the only solution able to completely vitrify. In all vitrification procedures, the percentage of normal follicles was lower than in controls. However, of the three protocols, the droplet method yielded a significantly higher proportion of normal follicles. Our experiments showed VS3 to have no deleterious effect on follicular morphology and to be able to completely vitrify, although vitrification procedures were found to affect human follicles. Nevertheless, the droplet method resulted in a higher percentage of morphologically normal follicles. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Fragment approaches in structure-based drug discovery
International Nuclear Information System (INIS)
Hubbard, Roderick E.
2008-01-01
Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets
Ionic fragmentation of the isoprene molecule in the VUV energy range (12 to 310 eV)
Energy Technology Data Exchange (ETDEWEB)
Bernini, R.B., E-mail: rafael.bernini@ifrj.edu.br [Instituto Federal de Ciência e Tecnologia do Rio de Janeiro (IFRJ), 25050-100 Duque de Caxias, RJ (Brazil); Coutinho, L.H. [Instituto de Física, Universidade Federal do Rio De Janeiro (UFRJ), 21941-972 Rio de Janeiro, RJ (Brazil); Nunez, C.V. [Laboratório de Bioprospecção e Biotecnologia, Coordenação de Tecnologia e Inovação, Instituto Nacional de Pesquisas da Amazônia (INPA), 69060-001 Manaus, AM (Brazil); Castilho, R.B. de [Departamento de Química, Instituto de Ciências Exatas, Universidade Federal do Amazonas (UFAM), 69077-000 Manaus, AM (Brazil); Souza, G.G.B. de [Instituto de Química, Universidade Federal do Rio de Janeiro (UFRJ), 21949-900 Rio de Janeiro, RJ (Brazil)
2015-07-15
Highlights: • Ionic fragmentation of isoprene following valence-shell and C 1s excitation. • Experimental observation of single and double ionization processes. • Large increase in fragmentation following core excitation. • Similar dissociation pattern bellow (270 eV) and above (310 eV) core edge. • Stable molecular ion observed at all photon energies. - Abstract: Isoprene, C{sub 5}H{sub 8}, is a biogenic volatile compound emitted from plants and animals, playing an important role in atmospheric chemistry. In this work, we have studied the ionic fragmentation of the isoprene molecule induced by high energy photons (synchrotron radiation), both at the valence (12.0, 14.0, 16.0, 18.0, and 21.0 eV) and carbon 1s edge (270 and 310 eV, respectively, below and above edge) energies. The ionic fragments were mass-analyzed using a Wiley–McLaren time-of-flight spectrometer (TOF) and single (PEPICO) and double ionization coincidence (PEPIPICO) spectra were obtained. As expected, the fragmentation degree increases with increasing energy. Below and above the carbon 1s edge, the fragmentation patterns are quite similar, and basically the same fragments are observed as compared to the spectra following valence-shell ionization. Stable doubly-charged ions were not observed. A PEPIPICO spectrum has shown that the main dissociation route for doubly-ionized species corresponds to the [CH{sub 3}]{sup +}/[C{sub 4}H{sub 2–5}]{sup +} ion pair. Intense fragmentation of the isoprene molecule has been observed following valence shell and core electron ionization. The observance of basically the same fragments when moving from valence to inner-shell suggests that basically the same fragmentation routes are present in both cases. All doubly (or multiply)-charged cations are unstable, at least on a microsecond scale.
International Nuclear Information System (INIS)
Albino, S.; Kniehl, B.A.; Kramer, G.; Sandoval, C.
2006-11-01
Predictions for light charged hadron production data in the current fragmentation region of deeply inelastic scattering from the H1 and ZEUS experiments are calculated using perturbative Quantum Chromodynamics at next-to-leading order, and using fragmentation functions obtained by fitting to similar data from e + e - reactions. General good agreement is found when the magnitude Q 2 of the hard photon's virtuality is sufficiently large. The discrepancy at low Q and small scaled momentum x p is reduced by incorporating mass effects of the detected hadron. By performing quark tagging, the contributions to the overall fragmentation from the various quark flavours in the ep reactions are studied and compared to the contributions in e + e - reactions. The yields of the various hadron species are also calculated. (orig.)
Fragmentation properties of 6Li
International Nuclear Information System (INIS)
Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.
1987-01-01
The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs
Fragmentation and direct transfer reactions for 40Ar incident beam on 27Al target at 1760 MeV
International Nuclear Information System (INIS)
Cisse, Ousmane
1985-01-01
Peripheral collision studies performed with 40 Ar projectiles at 44 MeV/A and 27 Al target show that both fragmentation and transfer reactions can be discerned in this type of interaction. The experimental observation of fragments with masses charges and velocities close to those of the incident beam are the signature of transfer reactions and a detailed analysis of the energy spectra of such fragments has been carried out and interpreted in terms of a direct diffraction transfer model. On the other hand, for large mass transfer reactions, abrasion is the suitable mechanism. Inclusive fragment measurement together with the appropriate residual nuclei-fragment coincidence results then provides experimental data in good agreement with the theoretical predictions obtained from a participant spectator model. These investigations also indicate that the separation energies of the participant from the spectator nucleus, at least within the framework of the above model, can be interpreted in terms of a friction force which becomes more efficient as the projectile energy decreases. (author) [fr
Geometrical scaling of jet fragmentation photons
Energy Technology Data Exchange (ETDEWEB)
Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)
2016-12-15
We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.
Study of the shape of fragmentation events in central collisions
International Nuclear Information System (INIS)
Nguyen, A.D.; Durand, D.; Bocage, F.; Bougault, R.; Brou, R.; Colin, J; Cussol, D.; Genouin-Duhamel, E.; Gulminelli, F.; Lecolley, J.F.; Lefort, T.; Le Neindre, N.; Lopez, O.; Louvel, M.; Peter, J.; Steckmeyer, J.C.; Tamain, B.; Vient, E.
1997-01-01
The study of the most central collisions resulting in the fragmentation of nuclear systems requires a precise as highly possible knowledge of the space-time configuration of matter. Particularly, it is important to be able to define the event shapes in order to estimate the equilibrium degree reached by the system in the moment of its breakup. To do that, an tensor analysis was developed end applied to data from INDRA for the system Xe + Sn at 50 MeV/u. The obtained results were compared with the predictions of the SIMON generator. The analysis indicates a quasi-sphericity of the fragmentation source. This result is a convincing evidence in favor of formation of a highly excited system in equilibrium the life-time of which is long enough to relax the shape degrees of freedom as well as the internal freedom degrees. A comparison between the experimental results corresponding to the Xe + Sn central collisions at 50 MeV/u and the predictions of a SIMON calculation for different shapes of the fragmenting source is presented as a function of the variables D and C, which are linear combinations of the eigenvalues of the tensor of the moments used for characterisation of the event shape
Ion induced fragmentation of biomolecular systems at low collision energies
International Nuclear Information System (INIS)
Bernigaud, V; Adoui, L; Chesnel, J Y; Rangama, J; Huber, B A; Manil, B; Alvarado, F; Bari, S; Hoekstra, R; Postma, J; Schlathoelter, T
2009-01-01
In this paper, we present results of different collision experiments between multiply charged ions at low collision energies (in the keV-region) and biomolecular systems. This kind of interaction allows to remove electrons form the biomolecule without transferring a large amount of vibrational excitation energy. Nevertheless, following the ionization of the target, fragmentation of biomolecular species may occur. It is the main objective of this work to study the physical processes involved in the dissociation of highly electronically excited systems. In order to elucidate the intrinsic properties of certain biomolecules (porphyrins and amino acids) we have performed experiments in the gas phase with isolated systems. The obtained results demonstrate the high stability of porphyrins after electron removal. Furthermore, a dependence of the fragmentation pattern produced by multiply charged ions on the isomeric structure of the alanine molecule has been shown. By considering the presence of other surrounding biomolecules (clusters of nucleobases), a strong influence of the environment of the biomolecule on the fragmentation channels and their modification, has been clearly proven. This result is explained, in the thymine and uracil case, by the formation of hydrogen bonds between O and H atoms, which is known to favor planar cluster geometries.
Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S
2005-01-01
Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.
DEFF Research Database (Denmark)
Kruse Aagaard, Anders
2017-01-01
The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...
Sudek, M.; Work, Thierry M.; Aeby, G.S.; Davy, S.K.
2012-01-01
The scleractinian finger coral Porites compressa is affected by the coral disease Porites bleaching with tissue loss (PBTL). This disease initially manifests as bleaching of the coenenchyme (tissue between polyps) while the polyps remain brown with eventual tissue loss and subsequent algal overgrowth of the bare skeleton. Histopathological investigation showed a loss of symbiont and melanin-containing granular cells which was more pronounced in the coenenchyme than the polyps. Cell counts confirmed a 65% reduction in symbiont density. Tissue loss was due to tissue fragmentation and necrosis in affected areas. In addition, a reduction in putative bacterial aggregate densities was found in diseased samples but no potential pathogens were observed.
Work, Thierry M.; Forsman, Zac H.; Szabo, Zoltan; Lewis, Teresa D.; Aeby, Greta S.; Toonen, Robert J.
2011-01-01
Montipora white syndrome (MWS) results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS) that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR), while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata). Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.
Fracture mechanics model of fragmentation
International Nuclear Information System (INIS)
Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.
1986-01-01
A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates
Polymer fragmentation in extensional flow
Energy Technology Data Exchange (ETDEWEB)
Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech
2001-06-01
In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.
DEFF Research Database (Denmark)
On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.
2004-01-01
Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...
Heavy-Quark Production in the Target Fragmentation Region
Graudenz, Dirk
1997-01-01
Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...
Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgos, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K. H.
2016-01-01
Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for
International Nuclear Information System (INIS)
Shen Wenqing; Zhan Wenlong; Zhu Yongtai
1988-01-01
In a coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16 O on 27 Al, the contour plot of Galilean-invariant cross section of the coincidence between C-fragments and α-particles in the velocity plane, and the coincident angular correlation have been obtained. The correlated α-particles measured at positive angles (on the same side of the beam as the projectile-like fragments) were emitted mainly from the projectile-like fragments;the α-particles at large negative angles were emitted from the target-like fragments;the α-particles at small negative angles came from the fragmentation of the 16 O projectile. A possible reaction mechanism in which the residue produced in the fragmentation of the projectile continues the dissipation process during the interaction with the target has been discussed. It is also pointed out that in the large yield of C-fragments observed in the inclusive experiment, the contribution of C-fragments produced by the excited 16 O of DIC product via α-emission is quite small
Study of the dynamic fragmentation of laser shock-loaded metallic target
International Nuclear Information System (INIS)
Lescoute, E.
2010-01-01
The irradiation of a metallic target by a high power laser pulse induces a shock wave in the material. Under some conditions, it leads to the production of high velocity ejecta which can damage the optical environment (lenses, mirrors, windows, etc.). With the ongoing development of high energy laser facilities designed to achieve inertial confinement fusion, such as the Laser MegaJoule in France or the National Ignition Facility in the USA, the question of debris ejection from metallic samples subjected to intense laser irradiation has become a key issue. It is necessary to understand fragmentation processes induced by laser shock, and to anticipate and quantify generated fragments, in order to design suitable protections and experiments, and to preserve laser facilities. The main fragmentation processes which can occur in a laser-shock-loaded metallic target and generate high velocity ejecta are: (i) micro-jetting, which occurs upon reflection of the incident compressive front from the free surface, (ii) spallation, which is due to the later interaction of the release wave reflected from that surface with the incident unloading wave and (iii) dynamic punching of thin targets. Experimental campaigns have been performed on high energy laser facilities in the Centre d'Etudes Scientifiques et Techniques d'Aquitaine (CESTA, CEA, Alise facility) and in the Laboratoire pour l'Utilisation des Lasers Intenses (LULI, Ecole Polytechnique, LULI 2000 facility). Gold and aluminium have been mainly studied because they are the two main metallic components of the target which will be used to achieved the inertial confinement fusion. Specific diagnostics have been developed and used during these experiments to study the dynamic fragmentation: transverse shadowgraphy, free surface velocity measurement and recovery of generated fragments. Experimental results have been compared with numerical predictions obtained with a bi-dimensional hydrodynamic code, where a specific numerical
2012-01-01
Background Elastin is an essential component of selected connective tissues that provides a unique physiological elasticity. Elastin may be considered a signature protein of lungs where matrix metalloprotease (MMP) -9-and -12, may be considered the signature proteases of the macrophages, which in part are responsible for tissue damage during disease progression. Thus, we hypothesized that a MMP-9/-12 generated fragment of elastin may be a relevant biochemical maker for lung diseases. Methods Elastin fragments were identified by mass-spectrometry and one sequence, generated by MMP-9 and -12 (ELN-441), was selected for monoclonal antibody generation and used in the development of an ELISA. Soluble and insoluble elastin from lung was cleaved in vitro and the time-dependent release of fragments was assessed in the ELN-441 assay. The release of ELN-441 in human serum from patients with chronic obstructive pulmonary disease (COPD) (n = 10) and idiopathic pulmonary fibrosis (IPF) (n = 29) were compared to healthy matched controls (n = 11). Results The sequence ELN-441 was exclusively generated by MMP-9 and -12 and was time-dependently released from soluble lung elastin. ELN-441 levels were 287% higher in patients diagnosed with COPD (p elastin. This fragment was elevated in serum from patients with the lung diseases IPF and COPD, however these data needs to be validated in larger clinical settings. PMID:22818364
Neighbouring charge fragmentations in low energy fission
International Nuclear Information System (INIS)
Montoya, M.
1986-10-01
Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs
About dynamic model of limiting fragmentation of heavy nuclei
International Nuclear Information System (INIS)
Kuchin, I.A.
2001-01-01
Full text: As is known, during last years defined progress in understanding of static aspect of a dynamic structure organization of massive nuclei was reached. The offered model of a 'crystalline' structure of the nucleus generalizes drop, shell and cluster models in a natural way. Now increased interest induces the phenomenon of limiting fragmentation of heavy nuclei. There is a hope, that clearing up the general regularities of a soft disintegration of the massive nuclei on nucleons, component it, in a broad range of high energies can give a valuable information about dynamics of origin of nuclear structures and nature of their qualitative difference from a quark system structure, i.e. from nucleons. The key for understanding the indicated phenomenon can be it's study in connection with other aspects of disintegration of the nuclei - Coulomb and diffraction dissociation, fission etc. The sequential analysis of all these a processes from a single point of view is possible only within the framework of results and methods of the dynamic system theory. The purpose of the present research is clearing up a possibility to understand the nature of limiting fragmentation as a consequence of development of dynamic instability in a system of the nuclei as a result of ions interaction at high energy. In the analysis we based on data of the phenomenological analysis of heavy ion interactions at ultra-relativistic energies obtained by many authors for a number of years. As a result we came to a conclusion about general stochastic nature of an investigated phenomenon. In it development the fragmentation passes three different stages. On the first there is a process of preparation of chaos at a quantum level in an outcome of a Coulomb dissociation of the approaching nuclei and isotopic recharge of their nucleons, carrying a random character. A dominant here - viscous dissociation of nuclei under an operation of Coulomb forces. (A two body initial state). Then the multiparticle
Aspect Ratio Dependence of Impact Fragmentation
International Nuclear Information System (INIS)
Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.
1997-01-01
A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society
Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S
2016-01-01
Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gluon fragmentation in T(1S) decays
International Nuclear Information System (INIS)
Bienlein, J.K.
1983-05-01
In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)
Fragmentation of Relativistic 56Fe Nuclei in Emulsion
International Nuclear Information System (INIS)
Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.
1983-03-01
Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)
Soft tissue engineering with micronized-gingival connective tissues.
Noda, Sawako; Sumita, Yoshinori; Ohba, Seigo; Yamamoto, Hideyuki; Asahina, Izumi
2018-01-01
The free gingival graft (FGG) and connective tissue graft (CTG) are currently considered to be the gold standards for keratinized gingival tissue reconstruction and augmentation. However, these procedures have some disadvantages in harvesting large grafts, such as donor-site morbidity as well as insufficient gingival width and thickness at the recipient site post-treatment. To solve these problems, we focused on an alternative strategy using micronized tissue transplantation (micro-graft). In this study, we first investigated whether transplantation of micronized gingival connective tissues (MGCTs) promotes skin wound healing. MGCTs (≤100 µm) were obtained by mincing a small piece (8 mm 3 ) of porcine keratinized gingiva using the RIGENERA system. The MGCTs were then transplanted to a full skin defect (5 mm in diameter) on the dorsal surface of immunodeficient mice after seeding to an atelocollagen matrix. Transplantations of atelocollagen matrixes with and without micronized dermis were employed as experimental controls. The results indicated that MGCTs markedly promote the vascularization and epithelialization of the defect area 14 days after transplantation compared to the experimental controls. After 21 days, complete wound closure with low contraction was obtained only in the MGCT grafts. Tracking analysis of transplanted MGCTs revealed that some mesenchymal cells derived from MGCTs can survive during healing and may function to assist in wound healing. We propose here that micro-grafting with MGCTs represents an alternative strategy for keratinized tissue reconstruction that is characterized by low morbidity and ready availability. © 2017 Wiley Periodicals, Inc.
Percutaneous transhepatic fragmentation of gall stones and extraction of fragments
International Nuclear Information System (INIS)
Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.
1983-01-01
Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de
International Nuclear Information System (INIS)
Montoya, M.; Rojas, J.; Saettone, E.
2007-01-01
The mass and kinetic energy distribution of nuclear fragments from the thermal neutron-induced fission of 235 U have been studied using a Monte Carlo simulation. Besides reproducing the pronounced broadening on the standard deviation of the final fragment kinetic energy distribution (σ e (m)) around the mass number m = 109, our simulation also produces a second broadening around m = 125 that is in agreement with the experimental data obtained by Belhafaf et al. These results are a consequence of the characteristics of the neutron emission, the variation in the primary fragment mean kinetic energy, and the yield as a function of the mass. (Author)