Extracellular matrix fragmentation in young, healthy cartilaginous tissues.
Craddock, R J; Hodson, N W; Ozols, M; Shearer, T; Hoyland, J A; Sherratt, M J
2018-02-09
Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC) and the nucleus pulposus (NP) of the intervertebral disc (IVD). Whilst structural heterogeneity of intact aggrecan ( containing three globular domains) is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months), bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 %) were fragmented (lacking one or more globular domains). Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa) comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis). As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2) as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2), it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally) and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.
Extracellular matrix fragmentation in young, healthy cartilaginous tissues
Directory of Open Access Journals (Sweden)
RJ Craddock
2018-02-01
Full Text Available Although the composition and structure of cartilaginous tissues is complex, collagen II fibrils and aggrecan are the most abundant assemblies in both articular cartilage (AC and the nucleus pulposus (NP of the intervertebral disc (IVD. Whilst structural heterogeneity of intact aggrecan ( containing three globular domains is well characterised, the extent of aggrecan fragmentation in healthy tissues is poorly defined. Using young, yet skeletally mature (18-30 months, bovine AC and NP tissues, it was shown that, whilst the ultrastructure of intact aggrecan was tissue-dependent, most molecules (AC: 95 %; NP: 99.5 % were fragmented (lacking one or more globular domains. Fragments were significantly smaller and more structurally heterogeneous in the NP compared with the AC (molecular area; AC: 8543 nm2; NP: 4625 nm2; p < 0.0001. In contrast, fibrillar collagen appeared structurally intact and tissue-invariant. Molecular fragmentation is considered indicative of a pathology; however, these young, skeletally mature tissues were histologically and mechanically (reduced modulus: AC: ≈ 500 kPa; NP: ≈ 80 kPa comparable to healthy tissues and devoid of notable gelatinase activity (compared with rat dermis. As aggrecan fragmentation was prevalent in neonatal bovine AC (99.5 % fragmented, molecular area: 5137 nm2 as compared with mature AC (95.0 % fragmented, molecular area: 8667 nm2, it was hypothesised that targeted proteolysis might be an adaptive process that modified aggrecan packing (as simulated computationally and, hence, tissue charge density, mechanical properties and porosity. These observations provided a baseline against which pathological and/or age-related fragmentation of aggrecan could be assessed and suggested that new strategies might be required to engineer constructs that mimic the mechanical properties of native cartilaginous tissues.
Nuclear fragmentation and the number of particle tracks in tissue
International Nuclear Information System (INIS)
Ponomarev, A. L.; Cucinotta, F. A.
2006-01-01
For high energy nuclei, the number of particle tracks per cell is modified by local nuclear reactions that occur, with large fluctuations expected for heavy ion tracks. Cells near the interaction site of a reaction will experience a much higher number of tracks than estimated by the average fluence. Two types of reaction products are possible and occur in coincidence; projectile fragments, which generally have smaller charge and similar velocity to that of the projectile, and target fragments, which are produced from the fragmentation of the nuclei of water atoms or other cellular constituents with low velocity. In order to understand the role of fragmentation in biological damage a new model of human tissue irradiated by heavy ions was developed. A box of the tissue is modelled with periodic boundary conditions imposed, which extrapolates the technique to macroscopic volumes of tissue. The cross sections for projectile and target fragmentation products are taken from the quantum multiple scattering fragmentation code previously developed at NASA Johnson Space Center. Statistics of fragmentation pathways occurring in a cell monolayer, as well as in a small volume of 10 x 10 x 10 cells are given. A discussion on approaches to extend the model to describe spatial distributions of inactivated or other cell damage types, as well as highly organised tissues of multiple cell types, is presented. (authors)
Han, X G; Wang, D K; Gao, F; Liu, R H; Bi, Z G
2015-09-21
Bone morphogenetic protein 2 (BMP-2) can promote fracture healing. Although the complex role BMP-2 in bone formation is increasingly understood, the role of endogenous BMP-2 in nonunion remains unclear. Decorin (DCN) can promote the formation of bone matrix and calcium deposition to control bone morphogenesis. In this study, tissue composition and expression of BMP-2 and DCN were detected in different parts of old fracture zones to explore inherent anti-fibrotic ability and osteogenesis. Twenty-three patients were selected, including eight cases of delayed union and 15 cases of nonunion. Average duration of delayed union or nonunion was 15 months. Fracture fragments and surrounding tissues, including bone grafts, marrow cavity contents, and sticking scars, were categorically sampled during surgery. Through observation and histological testing, component comparisons were made between fracture fragments and surrounding tissue. The expression levels of DCN and BMP-2 in different tissues were detected by immunohistochemical staining and real-time polymerase chain reaction. The expression of DCN and BMP- 2 in different parts of the nonunion area showed that, compared with bone graft and marrow cavity contents, sticking scars had the highest expression of BMP-2. Compared with the marrow cavity contents and sticking scars, bone grafts had the highest expression of DCN. The low antifibrotic and osteogenic activity of the nonunion area was associated with non-co-expression of BMP-2 and DCN. Therefore, the co-injection of osteogenic factor BMP and DCN into the nonunion area can improve the induction of bone formation and enhance the conversion of the old scar, thereby achieving better nonunion treatment.
DEFF Research Database (Denmark)
Neckelmann, K; Kristensen, B W; Schrøder, H D
2004-01-01
included in the biopsy removed for peroperative frozen section investigation. When the slides with Sonocut tissue fragments were analyzed, the probability of making the most malignant diagnosis increased from 81.3% - 99.1%, when slides from 1 - 5 paraffin blocks were analyzed, respectively. When subgroups...... of small, medium and big tumors were analyzed, it was found that only 2 paraffin blocks from small tumors need to be prepared to reach 98.3% probability of making the most malignant diagnosis, whereas 5 paraffin blocks from big tumors need to be prepared to reach a 96.8% probability. In conclusion......, the study shows that a limited amount of Sonocut ultrasonic tissue fragments improve the diagnostic evaluation of gliomas. These tissue fragments therefore must not be discarded. Only few paraffin blocks need to be prepared to reach close to 100% probability of making the most malignant diagnosis, reducing...
Shavers, M. R.; Poston, J. W.; Cucinotta, F. A.; Wilson, J. W.
1996-01-01
During manned space missions, high-energy nucleons of cosmic and solar origin collide with atomic nuclei of the human body and produce a broad linear energy transfer spectrum of secondary particles, called target fragments. These nuclear fragments are often more biologically harmful than the direct ionization of the incident nucleon. That these secondary particles increase tissue absorbed dose in regions adjacent to the bone-soft tissue interface was demonstrated in a previous publication. To assess radiological risks to tissue near the bone-soft tissue interface, a computer transport model for nuclear fragments produced by high energy nucleons was used in this study to calculate integral linear energy transfer spectra and dose equivalents resulting from nuclear collisions of 1-GeV protons transversing bone and red bone marrow. In terms of dose equivalent averaged over trabecular bone marrow, target fragments emitted from interactions in both tissues are predicted to be at least as important as the direct ionization of the primary protons-twice as important, if recently recommended radiation weighting factors and "worst-case" geometry are used. The use of conventional dosimetry (absorbed dose weighted by aa linear energy transfer-dependent quality factor) as an appropriate framework for predicting risk from low fluences of high-linear energy transfer target fragments is discussed.
Directory of Open Access Journals (Sweden)
Yoshinobu Takahashi
2018-05-01
Full Text Available Summary: Clinical transplantation of tissue fragments, including islets, faces a critical challenge because of a lack of effective strategies that ensure efficient engraftment through the timely integration of vascular networks. We recently developed a complex organoid engineering method by “self-condensation” culture based on mesenchymal cell-dependent contraction, thereby enabling dissociated heterotypic lineages including endothelial cells to self-organize in a spatiotemporal manner. Here, we report the successful adaptation of this method for generating complex tissues from diverse tissue fragments derived from various organs, including pancreatic islets. The self-condensation of human and mouse islets with endothelial cells not only promoted functionalization in culture but also massively improved post-transplant engraftment. Therapeutically, fulminant diabetic mice were more efficiently treated by a vascularized islet transplant compared with the conventional approach. Given the general limitations of post-transplant vascularization associated with 3D tissue-based therapy, our approach offers a promising means of enhancing efficacy in the context of therapeutic tissue transplantation. : Takahashi et al. report on generating vascularized islet tissue from humans and mice. After transplantation, vascularized islets significantly improve survival of diabetic mice, demonstrating the quick normalization of blood glucose compared with conventional islet transplantation. Keywords: tissue engineering, tissue-based therapy, vascularization, islet transplantation, organoid
Directory of Open Access Journals (Sweden)
MW Laschke
2014-10-01
Full Text Available Adipose tissue-derived microvascular fragments are promising vascularisation units for applications in the field of tissue engineering. Elderly patients are the major future target population of such applications due to an increasing human life expectancy. Therefore, we herein investigated the effect of aging on the fragments’ vascularisation capacity. Microvascular fragments were isolated from epididymal fat pads of adult (8 months and aged (16 months C57BL/6 donor mice. These fragments were seeded onto porous polyurethane scaffolds, which were implanted into dorsal skinfold chambers to study their vascularisation using intravital fluorescence microscopy, histology and immunohistochemistry. Scaffolds seeded with fragments from aged donors exhibited a significantly lower functional microvessel density and intravascular blood flow velocity. This was associated with an impaired vessel maturation, as indicated by vessel wall irregularities, constantly elevated diameters and a lower fraction of CD31/α-smooth muscle actin double positive microvessels in the implants’ border and centre zones. Additional in vitro analyses revealed that microvascular fragments from adult and aged donors do not differ in their stem cell content as well as in their release of angiogenic growth factors, survival and proliferative activity under hypoxic conditions. However, fragments from aged donors exhibit a significantly lower number of matrix metalloproteinase -9-positive perivascular cells. Taken together, these findings demonstrate that aging is a crucial determinant for the vascularisation capacity of isolated microvascular fragments.
DEFF Research Database (Denmark)
Maijer, Karen I; Gudmann, Natasja Stæhr; Karsdal, Morten Asser
2016-01-01
Objective: Tissue destruction in rheumatoid arthritis (RA) is predominantly mediated by matrix metalloproteinases (MMPs), thereby generating protein fragments. Previous studies have revealed that these fragments include MMP-mediated collagen type I, II, and III degradation, citrullinated and MMP...
Embedded Fragments from U.S. Military Personnel—Chemical Analysis and Potential Health Implications
Directory of Open Access Journals (Sweden)
José A. Centeno
2014-01-01
microspectroscopy (CLRM. Quantitative chemical analysis of both fragments and available tissues was conducted employing ICP-MS. Results: Over 800 fragments have been characterized and included as part of the Joint Pathology Center Embedded Fragment Registry. Most fragments were obtained from penetrating wounds sustained to the extremities, particularly soft tissue injuries. The majority of the fragments were primarily composed of a single metal such as iron, copper, or aluminum with traces of antimony, titanium, uranium, and lead. One case demonstrated tungsten in both the fragment and the connected tissue, together with lead. Capsular tissue and fragments from a case from the 1991 Kuwait conflict showed evidence of uranium that was further characterized by uranium isotopic ratios analysis to contain depleted uranium. Conclusions: The present study provides a systematic approach for obtaining a full chemical characterization of retained embedded fragments. Given the vast number of combat casualties with retained fragments, it is expected that fragment analysis will have significant implications for the optimal short and long-term care of wounded service members.
International Nuclear Information System (INIS)
Stock, Klaus Wilhelm; Jacob, Augustinus Ludwig; Schnabel, Karl Jakob; Bongartz, Georg; Steinbrich, Wolfgang
1997-01-01
Purpose: To report the results of thrombus fragmentation in combination with local fibrinolysis using recombinant human-tissue plasminogen activator (rtPA) in patients with massive pulmonary embolism. Methods: Five patients with massive pulmonary embolism were treated with thrombus fragmentation followed by intrapulmonary injection of rtPA. Clot fragmentation was performed with a guidewire, angiographic catheter, and balloon catheter. Three patients had undergone recent surgery; one of them received a reduced dosage of rtPA. Results: All patients survived and showed clinical improvement with a resultant significant (p < 0.05) decrease in the pulmonary blood pressure (mean systolic pulmonary blood pressure before treatment, 49 mmHg; 4 hr after treatment, 28 mmHg). Angiographic follow-up in three patients revealed a decrease in thrombus material and an increase in pulmonary perfusion. Two patients developed retroperitoneal hematomas requiring transfusion. Conclusion: Clot fragmentation and local fibrinolysis with rtPA was an effective therapy for massive pulmonary embolism. Bleeding at the puncture site was a frequent complication
International Nuclear Information System (INIS)
Dang Bingrong; Wei Zengquan; Duan Limin; Zhang Baoguo; Li Songlin; Yin Xu; Zhu Yongtai; Li Wenjian; Li Qiang; Yuan Shibin
2002-01-01
By using a 55 MeV/u 40 Ar 17+ beam produced by HIRFL, the distribution of fragments in 1.5 mm lucite on three different directions were measured at the radiobiology terminal. Feasibilities of the phoswich detector composed of fast plastic scintillator and CsI(Tl) detectors for determination of angular distribution of fragments in tissue-equivalent materials were investigated. The results obtained were satisfactory
Cryobiology of coral fragments.
Hagedorn, Mary; Farrell, Ann; Carter, Virginia L
2013-02-01
Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-04-02
The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-01-01
The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089
Directory of Open Access Journals (Sweden)
Mina Jafarabadi
2017-08-01
Full Text Available Background: The animal models of endometriosis could be a valuable alternative tool for clarifying the etiology of endometriosis. Objective: In this study two endometriosis models at the morphological and molecular levels was evaluated and compared. Materials and Methods: The human endometrial tissues were cut into small fragments then they were randomly considered for transplantation into γ irradiated mice as model A; or they were isolated and cultured up to fourth passages. 2×106 cultured stromal cells were transplanted into γ irradiated mice subcutaneously as model B. twenty days later the ectopic tissues in both models were studied morphologically by Periodic acid-Schiff and hematoxylin and eosin staining. The expression of osteopontin (OPN and matrix metalloproteinase 2 (MMP2 genes were also assessed using real time RT-PCR. 17-β estradiol levels of mice sera were compared before and after transplantation. Results: The endometrial like glands and stromal cells were formed in the implanted subcutaneous tissue of both endometriosis models. The gland sections per cubic millimeter, the expression of OPN and MMP2 genes and the level of 17-β estradiol were higher in model B than model A (p=0.03. Conclusion: Our observation demonstrated that endometrial mesenchymal stromal cells showed more efficiency to establish endometriosis model than human endometrial tissue fragments.
Pain, Deborah J; Cromie, Ruth L; Newth, Julia; Brown, Martin J; Crutcher, Eric; Hardman, Pippa; Hurst, Louise; Mateo, Rafael; Meharg, Andrew A; Moran, Annette C; Raab, Andrea; Taggart, Mark A; Green, Rhys E
2010-04-26
Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. Wild-shot gamebirds (6 species) obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing > or =5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg(-1) w.w.) for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat), some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game.
Pain, Deborah J.; Cromie, Ruth L.; Newth, Julia; Brown, Martin J.; Crutcher, Eric; Hardman, Pippa; Hurst, Louise; Mateo, Rafael; Meharg, Andrew A.; Moran, Annette C.; Raab, Andrea; Taggart, Mark A.; Green, Rhys E.
2010-01-01
Background Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. Methodology/Principal Findings Wild-shot gamebirds (6 species) obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing ≥5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg−1 w.w.) for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat), some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. Conclusions/Significance The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game. PMID:20436670
Directory of Open Access Journals (Sweden)
Deborah J Pain
Full Text Available BACKGROUND: Lead is highly toxic to animals. Humans eating game killed using lead ammunition generally avoid swallowing shot or bullets and dietary lead exposure from this source has been considered low. Recent evidence illustrates that lead bullets fragment on impact, leaving small lead particles widely distributed in game tissues. Our paper asks whether lead gunshot pellets also fragment upon impact, and whether lead derived from spent gunshot and bullets in the tissues of game animals could pose a threat to human health. METHODOLOGY/PRINCIPAL FINDINGS: Wild-shot gamebirds (6 species obtained in the UK were X-rayed to determine the number of shot and shot fragments present, and cooked using typical methods. Shot were then removed to simulate realistic practice before consumption, and lead concentrations determined. Data from the Veterinary Medicines Directorate Statutory Surveillance Programme documenting lead levels in raw tissues of wild gamebirds and deer, without shot being removed, are also presented. Gamebirds containing > or =5 shot had high tissue lead concentrations, but some with fewer or no shot also had high lead concentrations, confirming X-ray results indicating that small lead fragments remain in the flesh of birds even when the shot exits the body. A high proportion of samples from both surveys had lead concentrations exceeding the European Union Maximum Level of 100 ppb w.w. (0.1 mg kg(-1 w.w. for meat from bovine animals, sheep, pigs and poultry (no level is set for game meat, some by several orders of magnitude. High, but feasible, levels of consumption of some species could result in the current FAO/WHO Provisional Weekly Tolerable Intake of lead being exceeded. CONCLUSIONS/SIGNIFICANCE: The potential health hazard from lead ingested in the meat of game animals may be larger than previous risk assessments indicated, especially for vulnerable groups, such as children, and those consuming large amounts of game.
Directory of Open Access Journals (Sweden)
Agnes Yasmin Pitombeira Cavalcante
2017-08-01
Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.
Veschgini, M.; Gebert, F.; Khangai, N.; Ito, H.; Suzuki, R.; Holstein, T. W.; Mae, Y.; Arai, T.; Tanaka, M.
2016-03-01
Regeneration of a tissue fragment of freshwater polyp Hydra is accompanied by significant morphological fluctuations, suggesting the generation of active forces. In this study, we utilized a two fingered micro-robotic hand to gain insights into the mechanics of regenerating tissues. Taking advantage of a high force sensitivity (˜1 nN) of our micro-hand, we non-invasively acquired the bulk elastic modulus of tissues by keeping the strain levels low (ɛ < 0.15). Moreover, by keeping the strain at a constant level, we monitored the stress relaxation of the Hydra tissue and determined both viscous modulus and elastic modulus simultaneously, following a simple Maxwell model. We further investigated the correlation between the frequency of force fluctuation and that of morphological fluctuation by monitoring one "tweezed" tissue and the other "intact" tissue at the same time. The obtained results clearly indicated that the magnitude and periodicity of the changes in force and shape are directly correlated, confirming that our two fingered micro-hand can precisely quantify the mechanics of soft, dynamic tissue during the regeneration and development in a non-invasive manner.
Cucinotta, Francis A.; Hajnal, Ferenc; Wilson, John W.
1990-01-01
The transport of nuclear fragmentation recoils produced by high-energy nucleons in the region of the bone-tissue interface is considered. Results for the different flux and absorbed dose for recoils produced by 1 GeV protons are presented in a bidirectional transport model. The energy deposition in marrow cavities is seen to be enhanced by recoils produced in bone. Approximate analytic formulae for absorbed dose near the interface region are also presented for a simplified range-energy model.
Directory of Open Access Journals (Sweden)
P Karschnia
2018-05-01
Full Text Available The seeding of tissue constructs with adipose tissue-derived microvascular fragments (ad-MVF is an emerging pre-vascularisation strategy. Ad-MVF rapidly reassemble into new microvascular networks after in vivo implantation. Herein it was analysed whether this process was improved by erythropoietin (EPO. Ad-MVF were isolated from green fluorescent protein (GFP+ as well as wild-type C57BL/6 mice and cultivated for 24 h in medium supplemented with EPO (20 IU/mL or vehicle. Freshly isolated, non-cultivated ad-MVF served as controls. Protein expression, cell viability and proliferation of ad-MVF were assessed by proteome profiler array and fluorescence microscopy. GFP+ ad-MVF were seeded on collagen-glycosaminoglycan matrices, which were implanted into dorsal skinfold chambers of C57BL/6 mice, to analyse their vascularisation over 14 d by intravital fluorescence microscopy, histology and immunohistochemistry. Cultivation up-regulated the expression of pro- and anti-angiogenic factors within both vehicle- and EPO-treated ad-MVF when compared with non-cultivated controls. Moreover, EPO treatment suppressed cultivation-associated apoptosis and significantly increased the number of proliferating endothelial cells in ad-MVF when compared with vehicle-treated and non-cultivated ad-MVF. Accordingly, implanted matrices seeded with EPO-treated ad-MVF exhibited an improved vascularisation, as indicated by a significantly higher functional microvessel density. The matrices of the three groups contained a comparably large fraction of GFP+ microvessels originating from the ad-MVF, whereas the tissue surrounding the matrices seeded with EPO-treated ad-MVF exhibited a significantly increased microvessel density when compared with the other two groups. These findings indicated that EPO represents a promising cytokine to further boost the excellent vascularisation properties of ad-MVF in tissue-engineering applications.
Davidsson, Pia; Söderling, Ann-Sofi; Svensson, Lena; Ahnmark, Andrea; Flodin, Christine; Wanag, Ewa; Screpanti-Sundqvist, Valentina; Gennemark, Peter
2015-05-01
Tissue distribution and pharmacokinetics (PK) of full-length nontargeted antibody and its antigen-binding fragment (FAb) were evaluated for a range of tissues primarily of interest for cardiovascular and metabolic diseases. Mice were intravenously injected with a dose of 10 mg/kg of either human IgG1or its FAb fragment; perfused tissues were collected at a range of time points over 3 weeks for the human IgG1 antibody and 1 week for the human FAb antibody. Tissues were homogenized and antibody concentrations were measured by specific immunoassays on the Gyros system. Exposure in terms of maximum concentration (Cmax ) and area under the curve was assessed for all nine tissues. Tissue exposure of full-length antibody relative to plasma exposure was found to be between 1% and 10%, except for brain (0.2%). Relative concentrations of FAb antibody were the same, except for kidney tissue, where the antibody concentration was found to be ten times higher than in plasma. However, the absolute tissue uptake of full-length IgG was significantly higher than the absolute tissue uptake of the FAb antibody. This study provides a reference PK state for full-length whole and FAb antibodies in tissues related to cardiovascular and metabolic diseases that do not include antigen or antibody binding. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.
Hokama, Y; Chun, K E; Campora, C E; Higa, N; Suma, C; Hamajima, A; Isobe, M
2006-01-01
It is well established that the targeted receptor for ciguatoxin (CTX) in mammalian tissues is the sodium channel, affecting the influx of sodium into cells and altering the action potential and function of the cell. Since the syntheses of fragments of CTX has become available, our focus has been on the receptor functions of the west sphere AB and east sphere JKLM fragments using the neuroblastoma cell assay, guinea pig atrium assay, and the membrane immunobead assay (MIA). The data presented here suggest that the west sphere AB of the ciguatoxin molecule is the active portion and is responsible for the activation of the sodium channels. (c) 2006 Wiley-Liss, Inc.
Lihavainen, E; Kislin, M; Toptunov, D; Khiroug, L; Ribeiro, A S
2015-12-01
The morphology of mitochondria can inform about their functional state and, thus, about cell vitality. For example, fragmentation of the mitochondrial network is associated with many diseases. Recent advances in neuronal imaging have enabled the observation of mitochondria in live brains for long periods of time, enabling the study of their dynamics in animal models of diseases. To aid these studies, we developed an automatic method, based on supervised learning, for quantifying the degree of mitochondrial fragmentation in tissue images acquired via two-photon microscopy from transgenic mice, which exclusively express Enhanced cyan fluorescent protein (ECFP) under Thy1 promoter, targeted to the mitochondrial matrix in subpopulations of neurons. We tested the method on images prior to and after cardiac arrest, and found it to be sensitive to significant changes in mitochondrial morphology because of the arrest. We conclude that the method is useful in detecting morphological abnormalities in mitochondria and, likely, in other subcellular structures as well. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.
DEFF Research Database (Denmark)
Bengtsson, Camilla F.; Olsen, Maja E.; Brandt, Luise Ørsted
2011-01-01
Keratinous tissues such as nail, hair, horn, scales and feather have been used as a source of DNA for over 20 years. Particular benefits of such tissues include the ease with which they can be sampled, the relative stability of DNA in such tissues once sampled, and, in the context of ancient...... genetic analyses, the fact that sampling generally causes minimal visual damage to valuable specimens. Even when freshly sampled, however, the DNA quantity and quality in the fully keratinized parts of such tissues is extremely poor in comparison to other tissues such as blood and muscle – although little...... systematic research has been undertaken to characterize how such degradation may relate to sample source. In this review paper we present the current understanding of the quality and limitations of DNA in two key keratinous tissues, nail and hair. The findings indicate that although some fragments of nuclear...
Radiobiology in clinical radiation therapy - Part III: Normal tissue damage
International Nuclear Information System (INIS)
Travis, Elizabeth L.
1996-01-01
Objective: This is the third part of a course designed for residents in radiation oncology preparing for their boards. This part of the course will focus on the mechanisms underlying damage in normal tissues. Although conventional wisdom long held that killing and depletion of a critical cell(s) in a tissue was responsible for the later expression of damage, histopathologic changes in normal tissue can now be explained and better understood in terms of the new molecular biology. The concept that depletion of a single cell type is responsible for the observed histopathologic changes in normal tissues has been replaced by the hypothesis that damage results from the interaction of many different cell systems, including epithelial, endothelial, macrophages and fibroblasts, via the production of specific autocrine, paracrine and endocrine growth factors. A portion of this course will discuss the clinical and experimental data on the production and interaction of those cytokines and cell systems considered to be critical to tissue damage. It had long been suggested that interindividual differences in radiation-induced normal tissue damage was genetically regulated, at least in part. Both clinical and experimental data supported this hypothesis but it is the recent advances in human and mouse molecular genetics which have provided the tools to dissect out the genetic component of normal tissue damage. These data will be presented and related to the potential to develop genetic markers to identify sensitive individuals. The impact on clinical outcome of the ability to identify prospectively sensitive patients will be discussed. Clinically it is well-accepted that the volume of tissue irradiated is a critical factor in determining tissue damage. A profusion of mathematical models for estimating dose-volume relationships in a number of organs have been published recently despite the fact that little data are available to support these models. This course will review the
Virtual fragment preparation for computational fragment-based drug design.
Ludington, Jennifer L
2015-01-01
Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.
Perruchini, Claire; Pecorari, Frederic; Bourgeois, Jean-Pierre; Duyckaerts, Charles; Rougeon, François; Lafaye, Pierre
2009-11-01
Camelids produce antibodies made of homodimeric heavy chains, and the antigen-binding region being composed of a single domain called VHH. These VHHs are much smaller than complete IgG. They are also more thermostable and more soluble in water; they should, therefore, diffuse more readily in the tissues. VHHs, expressed in bacteria, are easier to produce than conventional monoclonal antibodies. Because of these special characteristics, these antibody fragments could have interesting developments in immunohistochemistry and in the development of biomarkers. To test the possibility of their use in immunohistochemistry (IHC), we selected the glial fibrillary acidic protein (GFAP), a well-known marker of astrocytes. One alpaca (Lama pacos) was immunized against GFAP. Lymphocytes were isolated; the DNA was extracted; the VHH-coding sequences were selectively amplified. Three VHHs with a high affinity for GFAP and their corresponding mRNA were selected by ribosome display. Large quantities of the recombinant VHHs coupled with different tags were harvested from transfected bacteria. One of them was shown to immunolabel strongly and specifically to GFAP of human astrocytes in tissue sections. The quality of the IHC was comparable or, in some aspects, superior to the quality obtained with conventional IgG. The VHH was shown to diffuse on a longer distance than conventional monoclonal antibodies in fixed cortical tissue: a property that may be useful in immunolabeling of thick sections.
International Nuclear Information System (INIS)
Shi, Sixiang; Hong, Hao; Orbay, Hakan; Yang, Yunan; Ohman, Jakob D.; Graves, Stephen A.; Nickles, Robert J.; Liu, Bai; Wong, Hing C.; Cai, Weibo
2015-01-01
To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and 64 Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of 64 Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of 64 Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. 64 Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management. (orig.)
Shi, Sixiang; Hong, Hao; Orbay, Hakan; Graves, Stephen A; Yang, Yunan; Ohman, Jakob D; Liu, Bai; Nickles, Robert J; Wong, Hing C; Cai, Weibo
2015-07-01
To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and (64)Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of (64)Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of (64)Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. (64)Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management.
Energy Technology Data Exchange (ETDEWEB)
Shi, Sixiang [University of Wisconsin, Materials Science Program, Madison, WI (United States); Hong, Hao; Orbay, Hakan; Yang, Yunan; Ohman, Jakob D. [University of Wisconsin, Department of Radiology, Madison, WI (United States); Graves, Stephen A.; Nickles, Robert J. [University of Wisconsin, Department of Medical Physics, Madison, WI (United States); Liu, Bai; Wong, Hing C. [Altor BioScience, Miramar, FL (United States); Cai, Weibo [University of Wisconsin, Materials Science Program, Madison, WI (United States); University of Wisconsin, Department of Radiology, Madison, WI (United States); University of Wisconsin, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States); University of Wisconsin, Departments of Radiology and Medical Physics, Madison, WI (United States)
2015-07-15
To date, there is no effective therapy for triple-negative breast cancer (TNBC), which has a dismal clinical outcome. Upregulation of tissue factor (TF) expression leads to increased patient morbidity and mortality in many solid tumor types, including TNBC. Our goal was to employ the Fab fragment of ALT-836, a chimeric anti-human TF mAb, for PET imaging of TNBC, which can be used to guide future TNBC therapy. ALT-836-Fab was generated by enzymatic papain digestion. SDS-PAGE and FACS studies were performed to evaluate the integrity and TF binding affinity of ALT-836-Fab before NOTA conjugation and {sup 64}Cu-labeling. Serial PET imaging and biodistribution studies were carried out to evaluate the tumor targeting efficacy and pharmacokinetics in the MDA-MB-231 TNBC model, which expresses high levels of TF on the tumor cells. Blocking studies, histological assessment, as well as RT-PCR were performed to confirm TF specificity of {sup 64}Cu-NOTA-ALT-836-Fab. ALT-836-Fab was produced with high purity, which exhibited superb TF binding affinity and specificity. Serial PET imaging revealed rapid and persistent tumor uptake of {sup 64}Cu-NOTA-ALT-836-Fab (5.1 ± 0.5 %ID/g at 24 h post-injection; n = 4) and high tumor/muscle ratio (7.0 ± 1.2 at 24 h post-injection; n = 4), several-fold higher than that of the blocking group and tumor models that do not express significant level of TF, which was confirmed by biodistribution studies. TF specificity of the tracer was also validated by histology and RT-PCR. {sup 64}Cu-NOTA-ALT-836-Fab exhibited prominent tissue factor targeting efficiency in MDA-MB-231 TNBC model. The use of a Fab fragment led to fast tumor uptake and good tissue/muscle ratio, which may be translated into same-day immunoPET imaging in the clinical setting to improve TNBC patient management. (orig.)
Lirman
2000-08-23
Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.
Fragmentation and flow in central collisions
International Nuclear Information System (INIS)
Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.
1987-01-01
Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs
Directory of Open Access Journals (Sweden)
A. Marmotti
2012-01-01
Full Text Available A promising approach for musculoskeletal repair and regeneration is mesenchymal-stem-cell- (MSC-based tissue engineering. The aim of the study was to apply a simple protocol based on mincing the umbilical cord (UC, without removing any blood vessels or using any enzymatic digestion, to rapidly obtain an adequate number of multipotent UC-MSCs. We obtained, at passage 1 (P1, a mean value of 4,2×106 cells (SD 0,4 from each UC. At immunophenotypic characterization, cells were positive for CD73, CD90, CD105, CD44, CD29, and HLA-I and negative for CD34 and HLA-class II, with a subpopulation negative for both HLA-I and HLA-II. Newborn origin and multilineage potential toward bone, fat, cartilage, and muscle was demonstrated. Telomere length was similar to that of bone-marrow (BM MSCs from young donors. The results suggest that simply collecting UC-MSCs at P1 from minced umbilical cord fragments allows to achieve a valuable population of cells suitable for orthopaedic tissue engineering.
The multi-step prompt particle emission from fission fragments
International Nuclear Information System (INIS)
Zhivopistsev, A.; Oprea, C.; Oprea, I.
2003-01-01
The purpose of this work is the study of non-equilibrium high-energy gamma emission from 252 Cf. In the framework of the formalism of statistical multi-step compound processes in nuclear reactions. A relation was found between the shape of the high-energy part of the gamma spectrum and different mechanisms of excitation of the fission fragments. Agreement with experimental data for different groups of fission fragments was obtained. The analysis of the experimental high-energy part of gamma spectra yields information about the mechanism of excitation of fission fragments. The influence of dissipation of the deformation excess on intrinsic excitation of fission fragments was studied. (authors)
Fresh muscle fiber fragments on a scaffold in rats-a new concept in urogynecology?
DEFF Research Database (Denmark)
Boennelycke, Marie; Christensen, Lise; Nielsen, Lene F
2011-01-01
To investigate if a synthetic, biodegradable scaffold with either autologous in vitro cultured muscle-derived cells or autologous fresh muscle fiber fragments could be used for tissue repair.......To investigate if a synthetic, biodegradable scaffold with either autologous in vitro cultured muscle-derived cells or autologous fresh muscle fiber fragments could be used for tissue repair....
Chappelow, Jonathan; Tomaszewski, John E.; Feldman, Michael; Shih, Natalie; Madabhushi, Anant
2011-01-01
We present an interactive program called HistoStitcher© for accurate and rapid reassembly of histology fragments into a pseudo-whole digitized histological section. HistoStitcher© provides both an intuitive graphical interface to assist the operator in performing the stitch of adjacent histology fragments by selecting pairs of anatomical landmarks, and a set of computational routines for determining and applying an optimal linear transformation to generate the stitched image. Reconstruction of whole histological sections from images of slides containing smaller fragments is required in applications where preparation of whole sections of large tissue specimens is not feasible or efficient, and such whole mounts are required to facilitate (a) disease annotation and (b) image registration with radiological images. Unlike manual reassembly of image fragments in a general purpose image editing program (such as Photoshop), HistoStitcher© provides memory efficient operation on high resolution digitized histology images and a highly flexible stitching process capable of producing more accurate results in less time. Further, by parameterizing the series of transformations determined by the stitching process, the stitching parameters can be saved, loaded at a later time, refined, or reapplied to multi-resolution scans, or quickly transmitted to another site. In this paper, we describe in detail the design of HistoStitcher© and the mathematical routines used for calculating the optimal image transformation, and demonstrate its operation for stitching high resolution histology quadrants of a prostate specimen to form a digitally reassembled whole histology section, for 8 different patient studies. To evaluate stitching quality, a 6 point scoring scheme, which assesses the alignment and continuity of anatomical structures important for disease annotation, is employed by three independent expert pathologists. For 6 studies compared with this scheme, reconstructed sections
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
Biological effectiveness of high-energy protons - Target fragmentation
International Nuclear Information System (INIS)
Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.
1991-01-01
High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs
International Nuclear Information System (INIS)
Buchegger, F.; Chalandon, Y.; Pelegrin, A.; Hardman, N.; Mach, J.P.
1991-01-01
Normal rats were injected intravenously with 131I- and 125I-labeled intact murine and chimeric mouse-human monoclonal antibodies directed against carcinoembryonic antigen or with the corresponding F(ab')2 fragments. At different times after injection, individual animals were killed and radioactivity of blood and major organs, including bones and bone marrow, was determined. Ratios comparing radioactivity concentration in different tissues with that of bone marrow were calculated and found to remain stable during several effective half-lives of the antibodies. Mean bone marrow radioactivity was 35% (range, 29%-40%) of that of blood and 126% (range, 108%-147%) of that of liver after injection of intact Mabs or F(ab')2 fragments. In nude rats bearing human colon carcinoma xenografts producing carcinoembryonic antigen, relative bone marrow radioactivity was slightly lower than that in normal rats
Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.
Dubinets, Nikita; Slipchenko, Lyudmila V
2017-07-20
Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.
Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.
Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N
2016-01-01
Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.
DEFF Research Database (Denmark)
Gozal, D; Qiao, Z; Almendros, I
2016-01-01
BACKGROUND: Sleep fragmentation (SF), a frequent occurrence in multiple sleep and other diseases leads to increased food intake and insulin resistance via increased macrophage activation and inflammation in visceral white adipose tissue (VWAT). Free fatty acid receptor 4 (FFA4) is reduced in pedi...... FFA4 activity may serve as potentially useful adjunctive therapies for sleep disorders accompanied by metabolic morbidity.International Journal of Obesity accepted article preview online, 16 March 2016. doi:10.1038/ijo.2016.37....
DEFF Research Database (Denmark)
Skjøt-Arkil, Helene; Clausen, Rikke E; Nguyen, Quoc Hai Trieu
2012-01-01
Elastin is an essential component of selected connective tissues that provides a unique physiological elasticity. Elastin may be considered a signature protein of lungs where matrix metalloprotease (MMP) -9-and -12, may be considered the signature proteases of the macrophages, which in part...... are responsible for tissue damage during disease progression. Thus, we hypothesized that a MMP-9/-12 generated fragment of elastin may be a relevant biochemical maker for lung diseases....
Fragmentation of Relativistic 56Fe Nuclei in Emulsion
International Nuclear Information System (INIS)
Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.
1983-03-01
Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)
Management of small fragment wounds in war: current research.
Bowyer, G W; Cooper, G J; Rice, P
1995-03-01
The majority of war wounds are caused by antipersonnel fragments from munitions such as mortars and bomblets. Modern munitions aim to incapacitate soldiers with multiple wounds from very small fragments of low available kinetic energy. Many of these fragments may be stopped by helmets and body armour and this has led to a predominance of multiple wounds to limbs in those casualties requiring surgery. The development of an appropriate management strategy for these multiple wounds requires knowledge of the contamination and extent of soft tissue injury; conservative management may be appropriate. The extent of skin and muscle damage associated with a small fragment wound, the way in which these wounds may progress without intervention and their colonisation by bacteria has been determined in an experimental animal model. Results from 12 animals are presented. There was a very small (approximately 1 mm) margin of nonviable skin around the entrance wound. The amount of devitalised muscle in the wound tract was a few hundred milligrams. Some muscles peripheral to the wound track also showed signs of damage 1 h after wounding, but this improved over 24 h; the proportion of fragmented muscle fibres in the tissue around the track decreased as time went on. There was no clinical sign or bacteriological evidence of the track becoming infected up to 24 h after wounding. This preliminary work suggests that, in the absence of infection, the amount of muscle damage caused by small fragment wounds begins to resolve in the first 24 h after injury, even without surgical intervention.
Energy distribution of projectile fragment particles in heavy ion therapeutic beam
Energy Technology Data Exchange (ETDEWEB)
Matsufuji, Naruhiro; Tomura, Hiromi; Futami, Yasuyuki [National Inst. of Radiological Sciences, Chiba (Japan)] [and others
1998-03-01
Production of fragment particles in a patient`s body is one of important problems for heavy charged particle therapy. It is required to know the yield and the energy spectrum for each fragment element - so called `beam quality` to understand the effect of therapeutic beam precisely. In this study, fragment particles produced by practical therapeutic beam of HIMAC were investigated with using tissue-equivalent material and a detector complex. From the results, fragment particles were well identified by difference of their atomic numbers and the beam quality was derived. Responses of the detectors in this energy region were also researched. (author)
Behind-armour Debris Modelling for High- velocity Fragment Impact (Part 2)
National Research Council Canada - National Science Library
Verolme, J
1997-01-01
This report presents the results of impact experiments and a parallel simulation modelling thereof, with the main objective to study the fragmentation properties of tungsten and steel projectiles at impact...
Scaling and universality in binary fragmenting with inhibition
International Nuclear Information System (INIS)
Ploszajczak, M.; Botet, R.
1994-01-01
We investigate a new model of binary fragmentation with inhibition, driven by the white noise. In a broad range of fragmentation probabilities, the power-law spatio-temporal correlations ar found to arise due to self-organized criticality (SOC). We find in the SOC phase a non-trivial power spectrum of the temporal sequence of the fragmentation events. The 1/∫ behaviour is recovered in the irreversible, near-equilibrium part of this phase. (authors). 13 refs., 3 figs., 1 tab
Scaling and universality in binary fragmenting with inhibition
Energy Technology Data Exchange (ETDEWEB)
Ploszajczak, M [Grand Accelerateur National d` Ions Lourds (GANIL), 14 - Caen (France); Botet, R [Paris-11 Univ., 91 - Orsay (France). Lab. de Physique des Solides
1994-12-31
We investigate a new model of binary fragmentation with inhibition, driven by the white noise. In a broad range of fragmentation probabilities, the power-law spatio-temporal correlations ar found to arise due to self-organized criticality (SOC). We find in the SOC phase a non-trivial power spectrum of the temporal sequence of the fragmentation events. The 1/{integral} behaviour is recovered in the irreversible, near-equilibrium part of this phase. (authors). 13 refs., 3 figs., 1 tab.
Assessment of the Risks from Imbedded Fragments of Depleted Uranium
1993-03-01
for chronic kidney toxicity; the impact of fibrotic encapsulation , if it occurs; and the chemical form of the imbedded fragment. The potential for...Effects of Depleted Uranium Imbedded in Tissue Reference: Brigadier General Ronald R. Blanck (SGPS-PSP) letter of 26 February 1992 In response to your...the muscle and fatty tissue will probably occur and will occur in all other tissue types that elicit similar cellular responses to foreign bodies. It
Directory of Open Access Journals (Sweden)
Phoebe A Chapman
Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to
Microbial platform technology for recombinant antibody fragment production: A review.
Gupta, Sanjeev Kumar; Shukla, Pratyoosh
2017-02-01
Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.
Directory of Open Access Journals (Sweden)
Marcin F. Jêdrzejczak
2002-06-01
Full Text Available The effects of the beach community structure of macro- and meiofauna on the process of beach wrack decay were investigated by means of a simple field colonisation experiment in a temperate, fine quartz sediment, sandy beach at the end of the Hel Peninsula in Poland. 1260 replicate litterbags of three mesh sizes (12 mm, 0.5 mm, 48 µm containing fresh wrack were used to assess the role of faunal and non-faunal components in the breakdown of stranded Zostera marina. Wrack breakdown was determined during a three-year field study. This paper presents the first part of the results of this field experiment, which refer to the effects of fragmentation detritivory, leaching and decay rates. Material was lost from the bags at a rapid rate, with only 22-32% of the original dry mass remaining after 27 days in the field. This degradation was not directly related to the faunal succession of the eelgrass tissue, which proceeded in two distinct phases throughout the study period. Exclusion of macrofauna from the wrack by the use of finer-mesh litterbags (< 1 mm had no appreciable effect on the rate of dry matter loss. Microbial decay, and abiotic leaching and fragmentation are probably the major causes of seagrass weight loss from the litterbags.
International Nuclear Information System (INIS)
Flanagan, Adrienne M.; Delaney, David; O'Donnell, Paul
2010-01-01
Bone and soft tissue metabolic and neoplastic diseases are increasingly characterized by their molecular signatures. This has resulted from increased knowledge of the human genome, which has contributed to the unraveling of molecular pathways in health and disease. Exploitation of this information has allowed it to be used for practical diagnostic purposes. The aim of the first part of this two-part review is to provide an up-to-date review of molecular genetic investigations that are available and routinely used by specialist musculoskeletal histopathologists in the diagnosis of neoplastic disease. Herein we focus on the benefits of employing well characterized somatic mutations in soft tissue lesions that are commonly employed in diagnostic pathology today. The second part highlights the known somatic and germline mutations implicated in osteoclast-rich lesions of bone, and the genetic changes that disturb phosphate metabolism and result in a variety of musculoskeletal phenotypes. Finally, a brief practical guide of how to use and provide a molecular pathology service is given. (orig.)
Tissue culture of three species of Laurencia complex
Shen, Songdong; Wu, Xunjian; Yan, Binlun; He, Lihong
2010-05-01
To establish a micropropagation system of three Laurencia complex species ( Laurencia okamurai, Laurencia tristicha, and Chondrophycus undulatus) by tissue culture techniques, we studied the regeneration characteristics and optimal culture conditions of axenic algal fragments cultured on solid medium and in liquid medium. Regeneration structures were observed and counted regularly under a reverse microscope to investigate the regeneration process, polarity and optimal illumination, and temperature and salinity levels. The results show that in most cultures of the three species, we obtained bud regeneration on solidified medium with 0.5% agar and in liquid medium. Rhizoid-like regeneration was filamentous and developed from the lower cut surface of fragments in L. okamurai, but was discoid and developed from the apical back side of bud regeneration in L. tristicha and C. undulatus. Regeneration polarity was localized to the apical part of algal fronds in all three species, and on fragments cut from the basal part of algae buds could develop from both the upper and the lower cut surfaces. Buds could develop from both the medullary and the cortical portions in L. okamurai and C. undulatus, while in L. tristicha, buds only emerged from the cortex. The optimal culture conditions for L. okamurai were 4 500 lx, 20°C and 35 (salinity); for C. undulatus, 4 500 lx, 20°C and 30; and for L. tristicha, 4 500 lx, 25°C and 30.
FRAGMENTED IDENTITIES: THE CULTURAL COLLISION ...
African Journals Online (AJOL)
User
Born in the former French and German colony of. Togo, Komla-Ebri ... of how cultural barriers not only lead to isolation and fragmented identities, but also ..... and, in recreating bits of Italy, in the form of music, cinema and food, absorbs parts of ...
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Li, Huiyan; Wan, Huiying; Xia, Tian; Chen, Maohua; Zhang, Yun; Luo, Xiaoming; Li, Xiaohong
2015-07-01
Therapeutic angiogenesis remains the most effective method to re-establish a proper blood flow in ischemic tissues. There is a great clinical need to identify an injectable format to achieve a well accumulation following local administration and a sustained delivery of biological factors at the ischemic sites. In the current study, fragmented nanofibers with loaded traditional Chinese medicines, astragaloside IV (AT), the main active ingredient of astragalus, and ferulic acid (FA), the main ingredient of angelica, were proposed to promote the microvessel formation after intramuscular injection into ischemic hindlimbs. Fragmented fibers with average lengths of 5 (FF-5), 20 (FF-20) and 80 μm (FF-80) were constructed by the cryocutting of aligned electrospun fibers. Their dispersion in sodium alginate solution (0.2%) indicated good injectability. After injection into the quadriceps muscles of the hindlimbs, FF-20 and FF-80 fiber fragments showed higher tissue retentions than FF-5, and around 90% of the injected doses were determined after 7 days. On a hindlimb ischemia model established by ligating the femoral arteries, intramuscular injection of the mixtures of FA-loaded and AT-loaded FF-20 fiber fragments substantially reduced the muscle degeneration with minimal fibrosis formation, significantly enhanced the neovessel formation and hindlimb perfusion in the ischemic tissues, and efficiently promoted the limb salvage with few limb losses. Along with the easy manipulation and lower invasiveness for in vivo administration, fragmented fibers should become potential drug carriers for disease treatment, wound recovery and tissue repair after local injection.
Tsumura, Ryo; Sato, Ryuta; Furuya, Fumiaki; Koga, Yoshikatsu; Yamamoto, Yoshiyuki; Fujiwara, Yuki; Yasunaga, Masahiro; Matsumura, Yasuhiro
2015-12-01
Tissue factor (TF) is expressed strongly in various types of cancer, especially cancers that are often refractory to treatment, such as pancreatic cancer. In this study, we compared the differences in the biophysical and pharmacological properties of whole IgG and the Fab fragment of anti-human TF monoclonal antibody (1849 antibodies), in order to determine their suitability for application in the diagnosis and treatment of cancers. In the biophysical examination, we investigated the characteristics of 1849-whole IgG and 1849-Fab by SPR sensing and confocal fluorescence microscopy analysis using recombinant human TF antigen and TF-overexpressing human pancreatic cancer cell line, BxPC3, respectively. After conjugation with Alexa-Flour-647, in vivo imaging was conducted in mice bearing BxPC3 xenograft tumors. Furthermore, the distribution of the conjugates in tumors and major organs was evaluated by ex vivo study. The in vitro experiments showed that 1849 antibodies had high affinity against TF antigen. In addition, 1849-Fab showed a faster dissociation rate from the antigen than 1849-whole IgG. In mice, 1849-Fab-Alexa-Flour-647 showed rapid renal clearance and faster tumor accumulation, achieving a high contrast signal over nearby normal tissues in the early phase and enhanced tumor penetration after administration. On the other hand, 1849-whole IgG-Alexa-Flour-647 showed slow clearance from the blood and sustained high tumor accumulation. These results suggest that 1849-Fab may be a useful tool for pancreatic cancer diagnosis.
HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS
International Nuclear Information System (INIS)
Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.
2013-01-01
We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.
The lund Monte Carlo for jet fragmentation
International Nuclear Information System (INIS)
Sjoestrand, T.
1982-03-01
We present a Monte Carlo program based on the Lund model for jet fragmentation. Quark, gluon, diquark and hadron jets are considered. Special emphasis is put on the fragmentation of colour singlet jet systems, for which energy, momentum and flavour are conserved explicitly. The model for decays of unstable particles, in particular the weak decay of heavy hadrons, is described. The central part of the paper is a detailed description on how to use the FORTRAN 77 program. (Author)
The biokinetics of uranium migrating from embedded DU fragments
International Nuclear Information System (INIS)
Leggett, R.W.; Pellmar, T.C.
2003-01-01
Military uses of depleted uranium (DU) munitions have resulted in casualties with embedded DU fragments. Assessment of radiological or chemical health risks from these fragments requires a model relating urinary U to the rate of migration of U from the fragments, and its accumulation in systemic tissues. A detailed biokinetic model for U has been published by the International Commission on Radiological Protection (ICRP), but its applicability to U migrating from embedded DU fragments is uncertain. Recently, ) conducted a study at the Armed Forces Radiobiology Research Institute (AFRRI) on the redistribution and toxicology of U in rats with implanted DU pellets, simulating embedded fragments. This paper compares the biokinetic data from that study with the behavior of commonly studied forms of U in rats (e.g., intravenously injected U nitrate). The comparisons indicate that the biokinetics of U migrating from embedded DU is similar to that of commonly studied forms of U with regard to long-term accumulation in kidneys, bone, and liver. The results provide limited support for the application of the ICRP's model to persons with embedded DU fragments. Additional information is needed with regard to the short-term behavior of migrating U and its accumulation in lymph nodes, brain, testicles, and other infrequently studied U repositories
Detection of neuronal tissue in meat using tissue specific DNA modifications
Directory of Open Access Journals (Sweden)
Harris N.
2004-01-01
Full Text Available A method has been developed to differentiate between non-muscle tissues such as liver, kidney and heart and that of muscle in meat samples using tissue specific DNA detection. Only muscle tissue is considered meat from the point of view of labelling (Food Labelling [Amendment] (England Regulations 2003 and Quantitative Ingredient Declaration (QUID, and also certain parts of the carcass are prohibited to be used in raw meat products (Meat Products [England] Regulations 2003. Included in the prohibited offal are brain and spinal cord. The described methodology has therefore been developed primarily to enforce labelling rules but also to contribute to the enforcement of BSE legislation on the detection of Central Nervous System (CNS tissue. The latter requires the removal of Specified Risk Material (SRM, such as bovine and ovine brain and spinal cord, from the food chain. Current methodologies for detection of CNS tissue include histological examination, analysis of cholesterol content and immunodetection. These can potentially be time consuming, less applicable to processed samples and may not be readily adapted to high throughput sample analysis. The objective of this work was therefore to develop a DNAbased detection assay that exploits the sensitivity and specificity of PCR and is potentially applicable to more highly processed food samples. For neuronal tissue, the DNA target selected was the promoter for Glial Fibrillary Acidic Protein (GFAP, a gene whose expression is restricted to astroglial cells within CNS tissue. The promoter fragments from both cattle and sheep have been isolated and key differences in the methylation patterns of certain CpG dinucleotides in the sequences from bovine and sheep brain and spinal cord and the corresponding skeletal muscle identified. These have been used to design a PCR assay exploiting Methylation Specific PCR (MSP to specifically amplify the neuronal tissue derived sequence and therefore identify the
Siedek, Vanessa; Betz, Christian S; Hecht, Volkmar; Blagova, Radka; Vogeser, Michael; Zengel, Pamela; Berghaus, Alexander; Leunig, Andreas; Sroka, Ronald
2008-04-01
Clinical laser lithotripsy in urology promises a good fragmentation combined with a minimal risk of soft tissue damage and low medical complications. This in vitro study investigates the fragmentation of salivary stones by means of two clinically used laser systems. The effects induced by the FREDDY laser (WOM, Germany, lambda = 532 nm/1,064 nm, E(pulse) = 120-160 mJ/pulse) and the Ho:YAG (AURIGA, StarMedTec, Germany, lambda = 2,100 nm, E(pulse) = 300-800 mJ/pulse) on clinical salivary calculi (n = 15) and on salivary gland tissue were investigated using clinical laser parameter settings. All experiments were performed in an under water experimental set-up using flexible fibres (core diameter 230 microm) positioned in front of each specimen. In order to assess fragmentation efficacy, each stone was placed on a grating (rhombic mash-diameter 1-3 mm). The fragmentation rate was calculated with respect to the energy applied (mg/J), to the number of pulses (mg/pulse), and to the time needed (mg/minute). In addition the composition of the stones were analysed spectrographically. The soft tissue interaction on human salivary duct mucosa was examined histologically (HE-staining). Spectrographic composition of the salivary stones showed a two component ratio of protein/carbonate apatite varying between 5/95 and 25/75. Stones treated by the Ho:YAG were vaporised in a milling-like process, while using the FREDDY laser stones are cracked into pieces and fragmentation failed in two cases. The fragmentation rates achieved by the FREDDY laser were greater than those of the Ho:YAG laser, but fragments mainly bigger. A dependency on the composition of the stones could not be found. Laser pulse effects on soft tissue were found slightly beyond the mucosa. This study clearly demonstrated the different processes of destroying salivary stones using two different laser systems. While the Ho:YAG vaporises the calculi in a more milling and soft sense, the FREDDY shows a more cracking and
Laser-assisted shape selective fragmentation of nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Kazakevich, P.V. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation); Simakin, A.V. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation); Shafeev, G.A. [Wave Research Center, General Physics Institute of the Russian Academy of Sciences, 38, Vavilov street, 117942 Moscow (Russian Federation)]. E-mail: shafeev@kapella.gpi.ru; Viau, G. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France); Soumare, Y. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France); Bozon-Verduraz, F. [ITODYS, UMR 7086, Universite Paris 7-Denis Diderot, case 7090, 2 place Jussieu, 75251 Paris Cedex 05 (France)
2007-07-31
Experimental results are presented on laser-assisted fragmentation of gold-containing nanoparticles suspended in liquids (either ethanol or water). Two kinds of nanoparticles are considered: (i) elongated Au nanorods synthesized by laser ablation of a gold target immersed in liquid phase; (ii) gold-covered NiCo nanorods with high aspect ratio ({theta} {approx} 10) synthesized by wet chemistry processes. The shape selectivity induced by laser fragmentation of these nanorods is gained via tuning the wavelength of laser radiation into different parts of the spectrum of their plasmon resonance corresponding to different aspect ratios {theta}. Fragmentation is performed using three laser wavelengths, involving a Cu vapour laser (510 and 578 nm) and a Nd:YAG (1064 nm). Nanoparticles are characterized by UV-vis spectrometry, Transmission Electron Microscopy (TEM). The effect of laser pulse duration (nanosecond against picosecond range) is also studied in the case of fragmentation with an IR laser radiation.
Protocol for Monitoring Gulf War Veterans with Imbedded Fragments of Depleted Uranium
1993-03-01
interest is evidence of total or partial fibrotic encapsulation ; local tissue necrosis; growing granuloma; or if there is evidence of a breakdown, a...formed fibrotic capsule. - If the fragment is encapsulated , remove and save the intact capsule (with the fragment still inside) if possible. If the...0704-0188 Public reporng burden for this owllectlon of infotmation iS estimated to average 1 hour par response , ircluding the time for revewing
2012-01-01
Background Elastin is an essential component of selected connective tissues that provides a unique physiological elasticity. Elastin may be considered a signature protein of lungs where matrix metalloprotease (MMP) -9-and -12, may be considered the signature proteases of the macrophages, which in part are responsible for tissue damage during disease progression. Thus, we hypothesized that a MMP-9/-12 generated fragment of elastin may be a relevant biochemical maker for lung diseases. Methods Elastin fragments were identified by mass-spectrometry and one sequence, generated by MMP-9 and -12 (ELN-441), was selected for monoclonal antibody generation and used in the development of an ELISA. Soluble and insoluble elastin from lung was cleaved in vitro and the time-dependent release of fragments was assessed in the ELN-441 assay. The release of ELN-441 in human serum from patients with chronic obstructive pulmonary disease (COPD) (n = 10) and idiopathic pulmonary fibrosis (IPF) (n = 29) were compared to healthy matched controls (n = 11). Results The sequence ELN-441 was exclusively generated by MMP-9 and -12 and was time-dependently released from soluble lung elastin. ELN-441 levels were 287% higher in patients diagnosed with COPD (p elastin. This fragment was elevated in serum from patients with the lung diseases IPF and COPD, however these data needs to be validated in larger clinical settings. PMID:22818364
Mechanisms Affecting Population Density in Fragmented Habitat
Directory of Open Access Journals (Sweden)
Lutz Tischendorf
2005-06-01
Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation
Directory of Open Access Journals (Sweden)
Guerin Jean F
2011-06-01
Full Text Available Abstract Background The objective of the present study is to assess viability tests and to evaluate follicle ovarian tissue quality after freezing-thawing procedures. Methods Ewe's ovaries were harvested at the slaughterhouse, after dissection each ovarian specimen was divided into two groups: fresh tissue (control group and frozen tissue. In the first part of the study, the follicles viability was assessed by trypan blue staining, calcein AM/ethidium homodimer-1 staining (LIVE/DEAD viability/cytotoxicity kit, Molecular Probes and morphology in the two groups. In the second part of the study the quality of the whole ovarian tissue was evaluated by the quantification of the release of lactate dehydrogenase measurement (Cytotoxicity Detection kit ROCHE, DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labelling (TUNEL in primordial and primary follicles (ApopDETEK Kit system Enzo and morphology in the two groups. 100 Follicles (primordial and primary were counted on both fresh and frozen hemiovary to assess this various tests. Results Ovarian follicle viability assessment was similar using trypan blue or calcein/ethidium staining. Follicles showed a decreased viability after freezing-thawing. After cryopreservation, a significant correlation between the percentage of normal follicles and viability rate was found using trypan blue (r = 0.82, p Conclusion We suggest the use of trypan blue staining for the histological assessment of viability, the use of LDH assay for the cytotoxicity assessement and finally the use of DNA fragmentation assessment to valid different freezing-thawing protocols.
Light fragment formation at intermediate energies
International Nuclear Information System (INIS)
Boal, D.H.
1982-03-01
This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model
Revisiting the even-odd staggering in fission-fragment yields
International Nuclear Information System (INIS)
Caamano, M.; Rejmund, F.; Schmidt, K. H.
2010-01-01
The even-odd staggering observed in the experimental fission-fragment nuclear-charge yields is investigated over a wide systematics of fission fragments measured at Lohengrin in direct kinematics and at GSI in inverse kinematics. The general increase of the even-odd staggering in the fission-fragment charge yields towards asymmetric charge splits is explained by the absorption of the unpaired nucleons by the heavy fragment. As a consequence, the well established trend of even-odd staggering in the fission fragment charge yields to decrease with the fissility is attributed in part to the asymmetry evolution of the charge distribution. This interpretation is strongly supported by the data measured at GSI, which cover the complete charge distribution and include precise yields at symmetry. They reveal that the even-odd effect around symmetry remains constant over a large range of fissility. (authors)
Directory of Open Access Journals (Sweden)
Louise Thorlacius-Ussing
Full Text Available A barrier in a pig-to-man xenotransplantation is that the Galα1-3Galβ1-4GlcNAc-R carbohydrate (α-Gal epitope expressed on pig endothelial cells reacts with naturally occurring antibodies in the recipient's blood leading to rejection. Deletion of the α1,3-galactosyltransferase gene prevents the synthesis of the α-Gal epitope. Therefore, knockout models of the α1,3-galactosyltransferase gene are widely used to study xenotransplantation. We have performed proteomic studies on liver and pancreas tissues from wild type and α1,3-galactosyltransferase gene knockout mice. The tissues were analyzed by two-dimensional polyacrylamide gel electrophoresis and liquid chromatography-tandem mass spectrometry. The analyses revealed that a wide variety of proteins and protein fragments are differentially expressed suggesting that knockout of the α1,3-galactosyltransferase gene affects the expression of several other genes.
Cloning and expression of cell wall acid invertase gene fragment ...
African Journals Online (AJOL)
A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...
Robinson, Paulette M; Smith, Tyler S; Patel, Dilan; Dave, Meera; Lewin, Alfred S; Pi, Liya; Scott, Edward W; Tuli, Sonal S; Schultz, Gregory S
2012-12-13
Connective tissue growth factor (CTGF) is a fibrogenic cytokine that is up-regulated by TGF-β and mediates most key fibrotic actions of TGF-β, including stimulation of synthesis of extracellular matrix and differentiation of fibroblasts into myofibroblasts. This study addresses the role of proteolytic processing of CTGF in human corneal fibroblasts (HCF) stimulated with TGF-β, normal ocular tissues and wounded corneas. Proteolytic processing of CTGF in HCF cultures, normal animal eyes, and excimer laser wounded rat corneas were examined by Western blot. The identity of a 21-kDa band was determined by tandem mass spectrometry, and possible alternative splice variants of CTGF were assessed by 5' Rapid Amplification of cDNA Ends (RACE). HCF stimulated by TGF-β contained full length 38-kDa CTGF and fragments of 25, 21, 18, and 13 kDa, while conditioned medium contained full length 38- and a 21-kDa fragment of CTGF that contained the middle "hinge" region of CTGF. Fragmentation of recombinant CTGF incubated in HCF extracts was blocked by the aspartate protease inhibitor, pepstatin. Normal mouse, rat, and rabbit whole eyes and rabbit ocular tissues contained abundant amounts of C-terminal 25- and 21-kDa fragments and trace amounts of 38-kDa CTGF, although no alternative transcripts were detected. All forms of CTGF (38, 25, and 21 kDa) were detected during healing of excimer ablated rat corneas, peaking on day 11. Proteolytic processing of 38-kDa CTGF occurs during corneal wound healing, which may have important implications in regulation of corneal scar formation.
DEFF Research Database (Denmark)
Olsen, K E; Sletten, K; Westermark, Per
1998-01-01
Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin l...... light chain are a constituent of the AL-amyloid proteins of kappa type. A specific antiserum has identified these fragments in gel filtration fractions where the absorbance approached the base line after the main retarded peak. The fragments are small and have been overlooked previously......Immunoglobulin light chains are the precursor proteins of AL-amyloidosis. In the fibril formation process properties of the variable part of the immunoglobulin light chains are believed to be of major importance. In this work it is shown that fragments of the constant part of the immunoglobulin...... in the purification process. The significance of the constant part in AL-proteins is unclear, but adds new aspects to the discussion of pre- or post-fibrillogenic cleavage of the immunoglobulin light chains....
Schroeteler, Juliane; Reeker, Ralf; Suero Molina, Eric; Brokinkel, Benjamin; Holling, Markus; Grauer, Oliver M; Senner, Volker; Stummer, Walter; Ewelt, Christian
2014-01-01
Ultrasonic aspiration is widely used in the resection of brain tumors. Nevertheless, tumor tissue fragments obtained by ultrasonic aspiration are usually discarded. In this study, we demonstrate that these fragments are possible sources of material for histopathological study and tissue culture and compare their microscopic features and viability in tissue culture of cavitron ultrasonic surgical aspirator tissue fragments. Brain tumor tissue collected by ultrasonic aspiration (CUSA EXcel®; Integra Radionics Inc.) in a simple sterile suction trap during resection was processed for primary cell culture. Cell viability and immunohistological markers were measured by the WST-1 test, microscopy and immunofluorescent evaluation. Six gliomas are presented to demonstrate that these tissue fragments show good preservation of histological detail and tissue viability in culture. Utilization of this material may facilitate pathological interpretation by providing a more representative sample of tumor histology as well as an adequate and sterile biosource of material for tissue culture studies.
Forest fragmentation and bird community dynamics: inference at regional scales
Thierry Boulinier; James D. Nichols; James E. Hines; John R. Sauer; Curtis H. Flather; Kenneth H. Pollock
2001-01-01
With increasing fragmentation of natural areas and a dramatic reduction of forest cover in several parts of the world, quantifying the impact of such changes on species richness and community dynamics has been a subject of much concern. Here, we tested whether in more fragmented landscapes there was a lower number of area-sensitive species and higher local extinction...
Energy Technology Data Exchange (ETDEWEB)
Kay, H. E.M. [Royal Marsden Hospital, Institute of Cancer Research, London (United Kingdom)
1969-07-15
Grafts of lymphoid tissue or of lymphoid stem cells may be appropriate in the treatment of some congenital immune deficiency disorders. The reasons for preferring tissues of foetal origin are discussed and the evidence for foetal immunocompetence is briefly summarized. Methods of storing foetal liver cells and cells or fragments of thymus are mentioned, and the organization of the Foetal Tissue Bank of the Royal Marsden Hospital is described. Clinical data from transplantation of lymphoid cells in various immune deficiency disorders are briefly presented. (author)
Directory of Open Access Journals (Sweden)
Susan M. Burden-Gulley
2010-04-01
Full Text Available We recently found that normal human brain and low-grade astrocytomas express the receptor protein tyrosine phosphatase mu (PTPμ and that the more invasive astrocytomas, glioblastoma multiforme (GBM, downregulate full-length PTPμ expression. Loss of PTPμ expression in GBMs is due to proteolytic cleavage that generates an intracellular and potentially a cleaved and released extracellular fragment of PTPμ. Here, we identify that a cleaved extracellular fragment containing the domains required for PTPμ-mediated adhesion remains associated with GBM tumor tissue. We hypothesized that detection of this fragment would make an excellent diagnostic tool for the localization of tumor tissue within the brain. To this end, we generated a series of fluorescently tagged peptide probes that bind the PTPμ fragment. The peptide probes specifically recognize GBM cells in tissue sections of surgically resected human tumors. To test whether the peptide probes are able to detect GBM tumors in vivo, the PTPμ peptide probes were tested in both mouse flank and intracranial xenograft human glioblastoma tumor model systems. The glial tumors were molecularly labeled with the PTPμ peptide probes within minutes of tail vein injection using the Maestro FLEX In Vivo Imaging System. The label was stable for at least 3 hours. Together, these results indicate that peptide recognition of the PTPμ extracellular fragment provides a novel molecular diagnostic tool for detection of human glioblastomas. Such a tool has clear translational applications and may lead to improved surgical resections and prognosis for patients with this devastating disease.
Hyaluronan - a functional and structural sweet spot in the tissue microenvironment
Directory of Open Access Journals (Sweden)
James eMonslow
2015-05-01
Full Text Available Transition from homeostatic to reactive matrix remodeling is a fundamental adaptive tissue response to injury, inflammatory disease, fibrosis and cancer. Alterations in architecture, physical properties and matrix composition result in changes in biomechanical and biochemical cellular signaling. The dynamics of pericellular and extracellular matrices, including matrix protein, proteoglycan and glycosaminoglycan modification are continually emerging as essential regulatory mechanisms underlying cellular and tissue function. Nevertheless, the impact of matrix organization on inflammation and immunity in particular, and the consequent effects on tissue healing and disease outcome are arguably under-studied aspects of adaptive stress responses. Herein, we review how the predominant glycosaminoglycan hyaluronan (HA contributes to the structure and function of the tissue microenvironment. Specifically, we examine the evidence of HA degradation and the generation of biologically-active smaller HA fragments in pathological settings in vivo. We discuss how HA fragments versus nascent HA via alternate receptor-mediated signaling influence inflammatory cell recruitment and differentiation, resident cell activation, as well as tumor growth, survival and metastasis. Finally, we discuss how HA fragmentation impacts restoration of normal tissue function and pathological outcomes in disease.
Cloning, bacterial expression and crystallization of Fv antibody fragments
E´, Jean-Luc; Boulot, Ginette; Chitarra, V´ronique; Riottot, Marie-Madeleine; Souchon, H´le`ne; Houdusse, Anne; Bentley, Graham A.; Narayana Bhat, T.; Spinelli, Silvia; Poljak, Roberto J.
1992-08-01
The variable Fv fragments of antibodies, cloned in recombinant plasmids, can be expressed in bacteria as functional proteins having immunochemical properties which are very similar or identical with those of the corresponding parts of the parent eukaryotic antibodies. They offer new possibilities for the study of antibody-antigen interactions since the crystals of Fv fragments and of their complexes with antigen reported here diffract X-rays to a higher resolution that those obtained with the cognate Fab fragments. The Fv approach should facilitate the structural study of the combining site of antibodies and the further characterization of antigen-antibody interactions by site-directed mutagenesis experiments.
Barrett, Elizabeth J; Rodgerson, Dwayne H
2014-08-01
To describe an ultrasound assisted arthroscopic approach for removal of non-articular basilar sesamoid fragments in Thoroughbred yearlings. Thoroughbred yearlings (n = 7). Basilar sesamoid fragments identified during pre-sale radiographic examination were removed using a palmar/plantar arthroscopic approach to the fetlock joint and ultrasonographic guidance. Complete fragment removal was confirmed by ultrasonography and radiography. Basilar sesamoid fracture fragments were localized and removed successfully using rongeurs and a radiofrequency probe for soft tissue dissection of the fragment. Complete fragment removal was confirmed by ultrasonography and radiography. No intra- or postoperative complications occurred. At 6-8 months follow-up, no fragments or bony proliferation at the base of the sesamoid was observed. Ultrasonographic guidance can be used to facilitate localization, dissection, and confirmation of removal of basilar fragments of the proximal sesamoid bone. © Copyright 2014 by The American College of Veterinary Surgeons.
Directory of Open Access Journals (Sweden)
Upile Tahwinder
2009-04-01
Full Text Available Abstract Background Although much has been published for the development of cell lines, these were lab based and developed for scientific technical staff. Objective of review We discuss the ethical implications of tissue retention and present a generic consent form (Part II. We also present a simple and successful protocol for the development of cell lines and tissue harvesting for the clinical scientist (Part I. Conclusion Consent is also more proximate and assurance can be given of appropriate usage. Ethical questions concerning tissue ownership are in many institutions raised during the current consenting procedure. We provide a robust ethical framework, based on the current legislation, which allows clinicians to be directly involved in cell and tissue harvesting.
Gastric Perforation by Ingested Rabbit Bone Fragment
Directory of Open Access Journals (Sweden)
Giulio Gambaracci
2016-04-01
Full Text Available The majority of accidentally ingested foreign bodies is excreted from the gastrointestinal (GI tract without any complications. Sometimes sharp foreign bodies – like chicken and fish bones – can lead to intestinal perforation and may present insidiously with a wide range of symptoms and, consequently, different diagnoses. We report the case of a 59-year-old woman presenting with fever and a 1-month history of vague abdominal pain. Computed tomography (CT showed the presence of a hyperdense linear image close to the gastric antrum surrounded by a fluid collection and free peritoneal air. At laparotomy, a 4-cm rabbit bone fragment covered in inflamed tissue was detected next to a gastric wall perforation. Rabbit bone fragment ingestion, even if rarely reported, should not be underestimated as a possible cause of GI tract perforation.
Lacrimal drainage-associated lymphoid tissue (LDALT): a part of the human mucosal immune system.
Knop, E; Knop, N
2001-03-01
Mucosa-associated lymphoid tissue (MALT) specifically protects mucosal surfaces. In a previous study of the human conjunctiva, evidence was also found for the presence of MALT in the lacrimal sac. The present study, therefore, aims to investigate its morphology and topographical distribution in the human lacrimal drainage system. Lacrimal drainage systems (n = 51) obtained from human cadavers were investigated by clearing flat wholemounts or by serial sections of tissue embedded in paraffin, OCT compound, or epoxy resin. These were further analyzed by histology, immunohistochemistry, and electron microscopy. All specimens showed the presence of lymphocytes and plasma cells as a diffuse lymphoid tissue in the lamina propria, together with intraepithelial lymphocytes and occasional high endothelial venules (HEV). It formed a narrow layer along the canaliculi that became thicker in the cavernous parts. The majority of lymphocytes were T cells, whereas B cells were interspersed individually or formed follicular centers. T cells were positive for CD8 and the human mucosa lymphocyte antigen (HML-1). Most plasma cells were positive for IgA and the overlying epithelium expressed its transporter molecule secretory component (SC). Basal mucous glands were present in the lacrimal canaliculi and in the other parts accompanied by alveolar and acinar glands, all producing IgA-rich secretions. Primary and secondary lymphoid follicles possessing HEV were present in about half of the specimens. The term lacrimal drainage-associated lymphoid tissue (LDALT) is proposed here to describe the lymphoid tissue that is regularly present and belongs to the common mucosal immune system and to the secretory immune system. It is suggested that it may form a functional unit together with the lacrimal gland and conjunctiva, connected by tear flow, lymphocyte recirculation, and probably the neural reflex arc, and play a major role in preserving ocular surface integrity.
International Nuclear Information System (INIS)
Saxon, D.H.
1985-10-01
The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)
Xu, Chen; Liu, Yalan; Ge, Xiaowen; Jiang, Dongxian; Zhang, Ying; Ji, Yuan; Hou, Jun; Huang, Jie; Su, Jieakesu; Zeng, Haiying; Qin, Jing; Hou, Yingyong
2017-05-26
HER2 assessment in biopsy specimens of gastric cancer (GC) is challenging because of the intratumoral heterogeneity. False negative results may be get because of limited biopsy material. The aim of this study is to explore how tumor-containing fragment number and biopsy specimen number affect HER2 immunohistochemistry (IHC) positive rate. Eight hundred and ninety biopsy specimens and 459 paired resected specimens were collected. IHC staining of HER2 was performed. HER2 IHC positive (scored 3+) rate was compared based on tumor-containing fragment number, biopsy specimen number, average size and tumor tissue proportion of tumor-containing fragments. The positive predictability of biopsy specimens to resected specimens was analyzed based on tumor fragment number. HER2 IHC positive rates were 2.0, 3.5, 7.0, 13.2, 17.1, and 15.9% when tumor fragment numbers were 1, 2, 3, 4, 5 and 6 respectively. The rate rose with the increase of tumor fragment number (P = 0.004). ROC curve analysis showed that biopsy specimens exhibited positive predictability when tumor fragment number reached 3, but showed better performance when the number was ≥4 (P fragment number reached 4, no statistic differences were reached in either HER2 IHC positive rate or positive predictability with further increase of the number (P > 0.05). HER2 IHC positive rate was not associated with biopsy number (P = 0.127), average size of tumor fragments (P = 0.397), and tumor tissue proportion of tumor fragments (P = 0.825) directly. The number of tumor-containing fragments influences HER2 IHC positive (scored 3+) rate. Greater than or equal to 4 (≥4) tumor fragments give better results in the positive rate as well as positive predictability. We recommend the number of tumor containing fragments be described in the HER2 IHC pathology reports for clinical reference in endoscopic biopsy specimens of GC.
Experiment K-7-29: Connective Tissue Studies. Part 3; Rodent Tissue Repair: Skeletal Muscle
Stauber, W.; Fritz, V. K.; Burkovskaya, T. E.; Ilyina-Kakueva, E. I.
1994-01-01
Myofiber injury-repair was studied in the rat gastrocnemius following a crush injury to the lower leg prior to flight in order to understand if the regenerative responses of muscles are altered by the lack of gravitational forces during Cosmos 2044 flight. After 14 days of flight, the gastrocnemius muscle was removed from the 5 injured flight rodents and various Earth-based treatment groups for comparison. The Earth-based animals consisted of three groups of five rats with injured muscles from a simulated, tail-suspended, and vivarium as well as an uninjured basal group. The gastrocnemius muscle from each was evaluated by histochemical and immunohistochemical techniques to document myofiber, vascular, and connective tissue alterations following injury. In general the repair process was somewhat similar in all injured muscle samples with regard to extracellular matrix organization and myofiber regeneration. Small and large myofibers were present with a newly organized extracellular matrix indicative of myogenesis and muscle regeneration. In the tail-suspended animals, a more complete repair was observed with no enlarged area of non-muscle cells or matrix material visible. In contrast, the muscle samples from the flight animals were less well differentiated with more macrophages and blood vessels in the repair region but small myofibers and proteoglycans, nevertheless, were in their usual configuration. Thus, myofiber repair did vary in muscles from the different groups, but for the most part, resulted in functional muscle tissue.
Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design
2012-01-01
The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472
Antibody Fragments as Potential Biopharmaceuticals for Cancer Therapy: Success and Limitations.
Kholodenko, Roman V; Kalinovsky, Daniel V; Doronin, Igor I; Ponomarev, Eugene D; Kholodenko, Irina V
2017-08-17
Monoclonal antibodies (mAbs) are an important class of therapeutic agents approved for the therapy of many types of malignancies. However, in certain cases applications of conventional mAbs have several limitations in anticancer immunotherapy. These limitations include insufficient efficacy and adverse effects. The antigen-binding fragments of antibodies have a considerable potential to overcome the disadvantages of conventional mAbs, such as poor penetration into solid tumors and Fc-mediated bystander activation of the immune system. Fragments of antibodies retain antigen specificity and part of functional properties of conventional mAbs and at the same time have much better penetration into the tumors and a greatly reduced level of adverse effects. Recent advantages in antibody engineering allowed to produce different types of antibody fragments with improved structure and properties for efficient elimination of tumor cells. These molecules opened up new perspectives for anticancer therapy. Here we will overview the structural features of the various types of antibody fragments and their applications for anticancer therapy as separate molecules and as part of complex conjugates or structures. Mechanisms of antitumor action of antibody fragments as well as their advantages and disadvantages for clinical application will be discussed in this review. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
The matrikine N-α-PGP couples extracellular matrix fragmentation to endothelial permeability
Hahn, Cornelia S; Scott, David W; Xu, Xin; Roda, Mojtaba Abdul; Payne, Gregory A; Wells, J Michael; Viera, Liliana; Winstead, Colleen J; Bratcher, Preston; Sparidans, Rolf W; Redegeld, Frank A; Jackson, Patricia L; Folkerts, Gert; Blalock, J Edwin; Patel, Rakesh P; Gaggar, Amit
2015-01-01
The compartmentalization and transport of proteins and solutes across the endothelium is a critical biologic function altered during inflammation and disease, leading to pathology in multiple disorders. The impact of tissue damage and subsequent extracellular matrix (ECM) fragmentation in regulating
Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles
Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin
2010-01-01
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be
Topology of White Stars in Relativistic Fragmentation of Light Nuclei
Andreeva, N P; Vokal, S; Vokalova, A; Gaitinov, A Sh; Gerassimov, S G; Goncharova, L A; Dronov, V A; Zarubin, P I; Zarubina, I G; Kovalenko, A D; Kravchakova, A; Larionova, V G; Levitskaja, O V; Lepehin, F G; Malakhov, A I; Moiseenko, A A; Orlova, G I; Peresadko, N G; Polukhina, N G; Rukojatkin, P A; Rusakova, V V; Salmanova, N A; Sarkisian, V R; Simonov, B B; Stan, E; Stanoeva, R; Chernyavsky, M M; Haidue, M; Kharlamov, S P; Tsakov, I; Shchedrina, T V
2004-01-01
In the present paper, experimental observation of the multifragmentation processes of light relativistic nuclei carried out by means of emulsions are reviewed. Events of the type of "white stars" in which the dissociation of relativistic nuclei is not accompanied by the production of mesons and the target-nucleus fragments are considered. A distinctive feature of the charge topology in the dissociation of the Ne, Mg, Si and S nuclei is an almost total suppression of the binary splitting of nuclei to fragments with charges higher than 2. The growth of the nuclear fragmentation degree is revealed in an increase in the multiplicity of singly and doubly charged fragments with decreasing charge of the main non-excited part of the fragmenting nucleus. The processes of dissociation of stable Li, Be, B, C, N, and O isotopes to charged fragments were used to study special features of the formation of systems consisting of the lightest nuclei - alpha, d and t. Clustering of the 3He nucleus can be detected in "white sta...
Crystal structure of an Okazaki fragment at 2-A resolution
Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.
1992-01-01
In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.
Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe
2016-05-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.
Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe
2016-01-01
Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825
Zeng, Meijuan; Ximenes, Eduardo; Ladisch, Michael R; Mosier, Nathan S; Vermerris, Wilfred; Huang, Chia-Ping; Sherman, Debra M
2012-02-01
Lignin content, composition, distribution as well as cell wall thickness, structures, and type of tissue have a measurable effect on enzymatic hydrolysis of cellulose in lignocellulosic feedstocks. The first part of our work combined compositional analysis, pretreatment and enzyme hydrolysis for fractionated pith, rind, and leaf tissues from a hybrid stay-green corn, in order to identify the role of structural characteristics on enzyme hydrolysis of cell walls. The extent of enzyme hydrolysis follows the sequence rind cellulose to glucose in 24 h in the best cases. Physical fractionation of corn stalks or other C(4) grasses into soft and hard tissue types could reduce cost of cellulose conversion by enabling reduced enzyme loadings to hydrolyze soft tissue, and directing the hard tissue to other uses such as thermal processing, combustion, or recycle to the land from which the corn was harvested. Copyright © 2011 Wiley Periodicals, Inc.
Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.
2018-03-01
It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.
Marolla, Ana Paula Cleto; Waisberg, Jaques; Saba, Gabriela Tognini; Waisberg, Daniel Reis; Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva
2015-01-01
To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student'st test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues.
Energy Technology Data Exchange (ETDEWEB)
Marolla, Ana Paula Cleto [Universidade Federal de São Paulo, São Paulo, SP (Brazil); Waisberg, Jaques [Hospital do Servidor Público Estadual, São Paulo, SP (Brazil); Faculdade de Medicina do ABC, Santo André, SP (Brazil); Saba, Gabriela Tognini [Faculdade de Medicina do ABC, Santo André, SP (Brazil); Waisberg, Daniel Reis [Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva [Faculdade de Medicina do ABC, Santo André, SP (Brazil)
2015-07-01
To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student’s t test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues.
International Nuclear Information System (INIS)
Marolla, Ana Paula Cleto; Waisberg, Jaques; Saba, Gabriela Tognini; Waisberg, Daniel Reis; Margeotto, Fernando Beani; Pinhal, Maria Aparecida da Silva
2015-01-01
To determine the presence of glycosaminoglycans in the extracellular matrix of connective tissue from neoplastic and non-neoplastic colorectal tissues, since it has a central role in tumor development and progression. Tissue samples from neoplastic and non-neoplastic colorectal tissues were obtained from 64 operated patients who had colorectal carcinoma with no distant metastases. Expressions of heparan sulphate, chondroitin sulphate, dermatan sulphate and their fragments were analyzed by electrospray ionization mass spectrometry, with the technique for extraction and quantification of glycosaminoglycans after proteolysis and electrophoresis. The statistical analysis included mean, standard deviation, and Student’s t test. The glycosaminoglycans extracted from colorectal tissue showed three electrophoretic bands in agarose gel. Electrospray ionization mass spectrometry showed characteristic disaccharide fragments from glycosaminoglycans, indicating their structural characterization in the tissues analyzed. Some peaks in the electrospray ionization mass spectrometry were not characterized as fragments of sugars, indicating the presence of fragments of the protein structure of proteoglycans generated during the glycosaminoglycan purification. The average amount of chondroitin and dermatan increased in the neoplastic tissue compared to normal tissue (p=0.01). On the other hand, the average amount of heparan decreased in the neoplastic tissue compared to normal tissue (p= 0.03). The method allowed the determination of the glycosaminoglycans structural profile in colorectal tissue from neoplastic and non-neoplastic colorectal tissue. Neoplastic tissues showed greater amounts of chondroitin sulphate and dermatan sulphate compared to non-neoplastic tissues, while heparan sulphate was decreased in neoplastic tissues
Vanderperren, Katrien; Raes, Els; Hoegaerts, Michel; Saunders, Jimmy H
2009-02-01
The equine tarsus is the most commonly affected hindlimb region associated with lameness. Diagnostic imaging is routinely applied but because of its complexity, being composed of 10 multifaceted bones and different joints, multiple ligaments, tendons and bursae, imaging this region can be a challenge. This is the first part of a two-part review of the structures and disorders of the equine tarsus. It describes the principal disorders affecting the soft tissues of the tarsal region and addresses some of the technical aspects in taking radiographic, ultrasonographic and scintigraphic images of the different soft tissue lesions. Where applicable, comments on the diagnostic use of contrast radiography, arthroscopy and tenoscopy are made. In current clinical practice a combination of radiography and ultrasonography is still most frequently used to arrive at a diagnosis.
Universal elements of fragmentation
International Nuclear Information System (INIS)
Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.
2010-01-01
A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.
Sharma, Gaurav; Gn, Kiran Kumar; Khatri, Kavin; Singh, Ravijot; Gamanagatti, Shivanand; Sharma, Vijay
2017-02-01
In this study we describe the morphology of the posteromedial fragment in pertrochanteric fractures using 3D CT scans and answer two questions 1) Do differences exist between the 3D CT appearances of posteromedial fragments and the depictions made in the AO classification 2) Does the posteromedial fragment affect stability in pertrochanteric fractures, in terms of fracture collapse? Preoperative CT scans of eight 31-A1 and fifty 31-A2 fractures were analysed. The presence of PM fragment, its fragmentation, greater trochanter (GT) involvement, lesser trochanter (LT) fragment size (in terms of its posterior and medial extent as well as LT length), LT fragment displacement (in terms of medial displacement and rotation) were determined. All fractures were treated with a DHS. Fracture collapse was determined on postoperative radiographs. The relationship between fracture collapse and patient factors including age, gender, fracture type (A1 versus A2), characteristics of the posteromedial fragment, and the presence of a lateral wall fracture were determined. Three out of eight 31-A1 fractures demonstrated a separate GT fragment (three part fracture). Out of the 50 31-A2 fractures, 12 had a single PM fragment, which included the LT and GT in continuity. The more common four part fractures seem to form by further fragmentation of this basic form. In A2 fractures, the GT was almost always broken and the broken fragment comprised a mean 56% of normal GT. The LT fragment involved an average of 74% of the posterior wall, and an average of 36% of the medial wall of the proximal femur. Larger LT fragments were less displaced as compared to smaller fragments. Univariate regression analyses revealed that fracture collapse was significantly correlated with fracture type (A1 versus A2, p 0.036), GT size (p 0.002) and the presence of a lateral wall fracture (pfragmentation of the posteromedial fragment, nor the size of the lesser trochanter fragment was found to predict stability in
Breast Cancer Cell Colonization of the Human Bone Marrow Adipose Tissue Niche.
Templeton, Zach S; Lie, Wen-Rong; Wang, Weiqi; Rosenberg-Hasson, Yael; Alluri, Rajiv V; Tamaresis, John S; Bachmann, Michael H; Lee, Kitty; Maloney, William J; Contag, Christopher H; King, Bonnie L
2015-12-01
Bone is a preferred site of breast cancer metastasis, suggesting the presence of tissue-specific features that attract and promote the outgrowth of breast cancer cells. We sought to identify parameters of human bone tissue associated with breast cancer cell osteotropism and colonization in the metastatic niche. Migration and colonization patterns of MDA-MB-231-fLuc-EGFP (luciferase-enhanced green fluorescence protein) and MCF-7-fLuc-EGFP breast cancer cells were studied in co-culture with cancellous bone tissue fragments isolated from 14 hip arthroplasties. Breast cancer cell migration into tissues and toward tissue-conditioned medium was measured in Transwell migration chambers using bioluminescence imaging and analyzed as a function of secreted factors measured by multiplex immunoassay. Patterns of breast cancer cell colonization were evaluated with fluorescence microscopy and immunohistochemistry. Enhanced MDA-MB-231-fLuc-EGFP breast cancer cell migration to bone-conditioned versus control medium was observed in 12/14 specimens (P = .0014) and correlated significantly with increasing levels of the adipokines/cytokines leptin (P = .006) and IL-1β (P = .001) in univariate and multivariate regression analyses. Fluorescence microscopy and immunohistochemistry of fragments underscored the extreme adiposity of adult human bone tissues and revealed extensive breast cancer cell colonization within the marrow adipose tissue compartment. Our results show that breast cancer cells migrate to human bone tissue-conditioned medium in association with increasing levels of leptin and IL-1β, and colonize the bone marrow adipose tissue compartment of cultured fragments. Bone marrow adipose tissue and its molecular signals may be important but understudied components of the breast cancer metastatic niche. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Study on tissue culture for Gelidium seedling
Pei, Lu-Qing; Luo, Qi-Jun; Fei, Zhi-Qing; Ma, Bin
1996-06-01
As seedling culture is a crucial factor for successful cultivation of Gelidium, the authors researched tissue culture technology for producing seedlings. The morphogeny and experimental ecology were observed and studied fully in 2 5 mm isolated tissue fragments. Regeneration, appearance of branching creepers and attaching structure and new erect seedlings production and development were studied. Fragments were sown on bamboo slice and vinylon rope. The seedlings were cultured 20 30 days indoor, then cultured in the sea, where the density of erect seedlings was 3 19 seedlings/cm2, growth rate was 3.84% day. The frond arising from seedlings directly was up to 10 cm per year. The ecological conditions for regenerated seedlings are similar to the natural ones. The regenerated seedlings are suitable for raft culture in various sea areas.
Soft tissue tumors occurring in the perinatal/infancy setting: 1st part
Directory of Open Access Journals (Sweden)
Gavino Faa
2018-02-01
Full Text Available Soft tissue sarcomas represent an important chapter of pediatric oncology, accounting for about 10% of all malignancies in childhood. The aim of this work is to summarize the clinical, histological, immunohistochemical and genetic features of the most frequent soft tissue tumors presenting in infants and in young subjects before the age of 10. For each entity, the most relevant data regarding prognosis and treatment will be summarized, and the most important morphological and immunohistochemical features will be reported. The most frequent myofibroblastic tumors, fatty tumors and skeletal muscle tumors occurring in infancy and adolescence will be described in this first part. The aim of this work, mainly based on a practical approach, is to help perinatal and pediatric pathologists in the diagnosis of a group of tumors that are diagnostically challenging, due to their rarity, the contemporary expression of multiple immunohistochemical markers and frequent lack of known genetic abnormalities.
Telomere Restriction Fragment (TRF) Analysis.
Mender, Ilgen; Shay, Jerry W
2015-11-20
While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of
International Nuclear Information System (INIS)
Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August
1997-01-01
Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake
International Nuclear Information System (INIS)
Arnold, Werner
2002-01-01
Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer
Tsuji, L J S; Wainman, B C; Jayasinghe, R K; VanSpronsen, E P; Liberda, E N
2009-04-01
Recently, the use of lead isotope ratios has definitively identified lead ammunition as a source of lead exposure for First Nations people, but the isotope ratios for lead pellets and bullets were indistinguishable. Thus, lead-contaminated meat from game harvested with lead bullets may also be contributing to the lead body burden; however, few studies have determined if lead bullet fragments are present in big game carcasses. We found elevated tissue-lead concentrations (up to 5,726.0 microg/g ww) in liver (5/9) and muscle (6/7) samples of big game harvested with lead bullets and radiographic evidence of lead fragments. Thus, we would advise that the tissue surrounding the wound channel be removed and discarded, as this tissue may be contaminated by lead bullet fragments.
Fragmentation cross sections outside the limiting-fragmentation regime
Sümmerer, K
2003-01-01
The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.
Isolation of llama antibody fragments for prevention of dandruff by phage display in shampoo
Dolk, E.; Vaart, M. van der; Lutje Hulsik, D.; Vriend, G.; Haard, H. de; Spinelli, S.; Cambillau, C.; Frenken, L.; Verrips, T.
As part of research exploring the feasibility of using antibody fragments to inhibit the growth of organisms implicated in dandruff, we isolated antibody fragments that bind to a cell surface protein of Malassezia furfur in the presence of shampoo. We found that phage display of llama
Universality of fragment shapes.
Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea
2015-03-16
The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.
Fragmentation under the Scaling Symmetry and Turbulent Cascade with Intermittency
Gorokhovski, M.
2003-01-01
Fragmentation plays an important role in a variety of physical, chemical, and geological processes. Examples include atomization in sprays, crushing of rocks, explosion and impact of solids, polymer degradation, etc. Although each individual action of fragmentation is a complex process, the number of these elementary actions is large. It is natural to abstract a simple 'effective' scenario of fragmentation and to represent its essential features. One of the models is the fragmentation under the scaling symmetry: each breakup action reduces the typical length of fragments, r (right arrow) alpha r, by an independent random multiplier alpha (0 Saveliev, the fragmentation under the scaling symmetry has been reviewed as a continuous evolution process with new features established. The objective of this paper is twofold. First, the paper synthesizes and completes theoretical part of Gorokhovski & Saveliev. Second, the paper shows a new application of the fragmentation theory under the scale invariance. This application concerns the turbulent cascade with intermittency. We formulate here a model describing the evolution of the velocity increment distribution along the progressively decreasing length scale. The model shows that when the turbulent length scale gets smaller, the velocity increment distribution has central growing peak and develops stretched tails. The intermittency in turbulence is manifested in the same way: large fluctuations of velocity provoke highest strain in narrow (dissipative) regions of flow.
International Nuclear Information System (INIS)
Karmanov, V.A.
1983-01-01
Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative
International Nuclear Information System (INIS)
Tuna, Th.
2008-07-01
This work shows the study of atom-molecule collision processes in the high velocity domain (v=4,5 a.u). The molecules concerned by this work are small unsaturated hydrocarbons C 1-4 H and C 3 H 2 . Molecules are accelerated with the Tandem accelerator in Orsay and their fragmentation is analyzed by the 4π, 100% efficient detector, AGAT. Thanks to a shape analysis of the current signal from the silicon detectors in association with the well known grid method, we are able to measure all the fragmentation channels of the incident molecule. These dissociation measurements have been introduced in the modelization of two objects of the interstellar medium in which a lot of hydrocarbon molecules have been observed (TMC1, horse-head nebula). We have extended our branching ratios obtained by high velocity collision to other electronic processes included in the chemical database like photodissociation and dissociative recombination. This procedure is feasible under an assumption of the statistical point of view of the molecular fragmentation. The deviations following our modification are very small in the modelization of TMC1 but significant in the photodissociation region. The first part is dedicated to the description of the experimental setting that has enabled us to study the fragmentation of C n H m molecules: the Orsay's Tandem accelerator and the Agat detector. The second part deals with negative ion sources and particularly with the Sahat source that is based on electronic impact and has shown good features for the production of anions and correct stability for its use with accelerators. The third part is dedicated to the experimental results in terms of cross-sections, number of fragments and branching ratios, associated to the various collisional processes. The last part presents an application of our measurement of fragmentation data to astro-chemistry. In this field, the simulation codes of the inter-stellar medium require databases of chemical reactions that
Who wants to conserve remaining forest fragments in the ...
African Journals Online (AJOL)
For exam- ple, a small forest that is surrounded by agricultural fields and that is still partly .... 75. 43. 21. Forest fragments [% of forest in village territory]. 5. 20. 100. 100. Market proximity ..... Cas de Manompana – Nord-Est de. Madagascar.
Commissioning the A1900 projectile fragment separator
Morrissey, D J; Steiner, M; Stolz, A; Wiedenhöver, I
2003-01-01
An important part of the recent upgrade of the NSCL facility is the replacement of the A1200 fragment separator with a new high acceptance device called the A1900. The design of the A1900 device represents a third generation projectile fragment separator (relative to the early work at LBL) as it is situated immediately after the primary accelerator, has a very large acceptance, a bending power significantly larger than that of the cyclotron and is constructed from large superconducting magnets (quadrupoles with 20 and 40 cm diameter warm bores). The A1900 can accept over 90% of a large range of projectile fragmentation products produced at the NSCL, leading to large gains in the intensity of the secondary beams. The results of initial tests of the system with a restricted momentum acceptance (+-0.5%) indicate that the A1900 is performing up to specifications. Further large gains in the intensities of primary beams, typically two or three orders of magnitude, will be possible as the many facets of high current...
The rise of fragment-based drug discovery.
Murray, Christopher W; Rees, David C
2009-06-01
The search for new drugs is plagued by high attrition rates at all stages in research and development. Chemists have an opportunity to tackle this problem because attrition can be traced back, in part, to the quality of the chemical leads. Fragment-based drug discovery (FBDD) is a new approach, increasingly used in the pharmaceutical industry, for reducing attrition and providing leads for previously intractable biological targets. FBDD identifies low-molecular-weight ligands (∼150 Da) that bind to biologically important macromolecules. The three-dimensional experimental binding mode of these fragments is determined using X-ray crystallography or NMR spectroscopy, and is used to facilitate their optimization into potent molecules with drug-like properties. Compared with high-throughput-screening, the fragment approach requires fewer compounds to be screened, and, despite the lower initial potency of the screening hits, offers more efficient and fruitful optimization campaigns. Here, we review the rise of FBDD, including its application to discovering clinical candidates against targets for which other chemistry approaches have struggled.
Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome
International Nuclear Information System (INIS)
Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie
2008-01-01
Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus
Neutronics and radiation field studies for the RIA fragmentation target area
Energy Technology Data Exchange (ETDEWEB)
Reyes, Susana [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States)]. E-mail: reyes20@llnl.gov; Boles, Jason L. [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States); Ahle, Larry E. [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States); Stein, Werner [Lawrence Livermore National Laboratory, P.O. Box 808, L-446, Livermore, CA 94550 (United States)
2006-06-23
Neutronics simulations and activation evaluations are currently in progress as part of the pre-conceptual research and development effort for the Rare Isotope Accelerator (RIA). The RIA project involves generating heavy element ion beams with powers up to 400 kw for use in a fragmentation target line to produce selected ion beams for physics research experiments. Designing a fragmentation beam dump for RIA is one of the most critical challenges for such a facility. Here, we present the results from neutronics and radiation field assessments for various beam dump concepts that can meet requirements for the RIA fragmentation line. Preliminary results from heavy ion transport including radiation damage evaluations for the RIA fragmentation beam dump are also presented. Initial neutronics and activation studies will be incorporated with other target area considerations to identify important challenges and explore possible solutions.
Neutronics and radiation field studies for the RIA fragmentation target area
Reyes, Susana; Boles, Jason L.; Ahle, Larry E.; Stein, Werner
2006-06-01
Neutronics simulations and activation evaluations are currently in progress as part of the pre-conceptual research and development effort for the Rare Isotope Accelerator (RIA). The RIA project involves generating heavy element ion beams with powers up to 400 kW for use in a fragmentation target line to produce selected ion beams for physics research experiments. Designing a fragmentation beam dump for RIA is one of the most critical challenges for such a facility. Here, we present the results from neutronics and radiation field assessments for various beam dump concepts that can meet requirements for the RIA fragmentation line. Preliminary results from heavy ion transport including radiation damage evaluations for the RIA fragmentation beam dump are also presented. Initial neutronics and activation studies will be incorporated with other target area considerations to identify important challenges and explore possible solutions.
Ultrasound elastography assessment of bone/soft tissue interface
International Nuclear Information System (INIS)
Parmar, Biren J; Yang, Xu; Chaudhry, Anuj; Shajudeen, Peer Shafeeq; Nair, Sanjay P; Righetti, Raffaella; Weiner, Bradley K; Tasciotti, Ennio; Krouskop, Thomas A
2016-01-01
We report on the use of elastographic imaging techniques to assess the bone/soft tissue interface, a region that has not been previously investigated but may provide important information about fracture and bone healing. The performance of axial strain elastograms and axial shear strain elastograms at the bone/soft tissue interface was studied ex vivo on intact and fractured canine and ovine tibias. Selected ex vivo results were corroborated on intact sheep tibias in vivo. The elastography results were statistically analyzed using elastographic image quality tools. The results of this study demonstrate distinct patterns in the distribution of the normalized local axial strains and axial shear strains at the bone/soft tissue interface with respect to the background soft tissue. They also show that the relative strength and distribution of the elastographic parameters change in the presence of a fracture and depend on the degree of misalignment between the fracture fragments. Thus, elastographic imaging modalities might be used in the future to obtain information regarding the integrity of bones and to assess the severity of fractures, alignment of bone fragments as well as to follow bone healing. (paper)
Ultrasound elastography assessment of bone/soft tissue interface
Parmar, Biren J.; Yang, Xu; Chaudhry, Anuj; Shafeeq Shajudeen, Peer; Nair, Sanjay P.; Weiner, Bradley K.; Tasciotti, Ennio; Krouskop, Thomas A.; Righetti, Raffaella
2016-01-01
We report on the use of elastographic imaging techniques to assess the bone/soft tissue interface, a region that has not been previously investigated but may provide important information about fracture and bone healing. The performance of axial strain elastograms and axial shear strain elastograms at the bone/soft tissue interface was studied ex vivo on intact and fractured canine and ovine tibias. Selected ex vivo results were corroborated on intact sheep tibias in vivo. The elastography results were statistically analyzed using elastographic image quality tools. The results of this study demonstrate distinct patterns in the distribution of the normalized local axial strains and axial shear strains at the bone/soft tissue interface with respect to the background soft tissue. They also show that the relative strength and distribution of the elastographic parameters change in the presence of a fracture and depend on the degree of misalignment between the fracture fragments. Thus, elastographic imaging modalities might be used in the future to obtain information regarding the integrity of bones and to assess the severity of fractures, alignment of bone fragments as well as to follow bone healing.
International Nuclear Information System (INIS)
Chung, K.C.
1989-01-01
An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)
A molecular fragment cheminformatics roadmap for mesoscopic simulation.
Truszkowski, Andreas; Daniel, Mirco; Kuhn, Hubert; Neumann, Stefan; Steinbeck, Christoph; Zielesny, Achim; Epple, Matthias
2014-12-01
Mesoscopic simulation studies the structure, dynamics and properties of large molecular ensembles with millions of atoms: Its basic interacting units (beads) are no longer the nuclei and electrons of quantum chemical ab-initio calculations or the atom types of molecular mechanics but molecular fragments, molecules or even larger molecular entities. For its simulation setup and output a mesoscopic simulation kernel software uses abstract matrix (array) representations for bead topology and connectivity. Therefore a pure kernel-based mesoscopic simulation task is a tedious, time-consuming and error-prone venture that limits its practical use and application. A consequent cheminformatics approach tackles these problems and provides solutions for a considerably enhanced accessibility. This study aims at outlining a complete cheminformatics roadmap that frames a mesoscopic Molecular Fragment Dynamics (MFD) simulation kernel to allow its efficient use and practical application. The molecular fragment cheminformatics roadmap consists of four consecutive building blocks: An adequate fragment structure representation (1), defined operations on these fragment structures (2), the description of compartments with defined compositions and structural alignments (3), and the graphical setup and analysis of a whole simulation box (4). The basis of the cheminformatics approach (i.e. building block 1) is a SMILES-like line notation (denoted f SMILES) with connected molecular fragments to represent a molecular structure. The f SMILES notation and the following concepts and methods for building blocks 2-4 are outlined with examples and practical usage scenarios. It is shown that the requirements of the roadmap may be partly covered by already existing open-source cheminformatics software. Mesoscopic simulation techniques like MFD may be considerably alleviated and broadened for practical use with a consequent cheminformatics layer that successfully tackles its setup subtleties and
First Record of Soft Tissue Preservation in the Upper Devonian of Poland
Zatoń, Michał; Broda, Krzysztof
2015-01-01
Soft tissue preservation is reported from Upper Devonian deposits of the Holy Cross Mountains, central Poland, for the first time. The preserved soft tissues are muscles associated with arthropod cuticle fragments. The muscles are phosphatized with variable states of preservation. Well-preserved specimens display the typical banding of striated muscles. Other muscle fragments are highly degraded and/or recrystallized such that their microstructure is barely visible. The phosphatized muscles and associated cuticle are fragmented, occur in patches and some are scattered on the bedding plane. Due to the state of preservation and the lack of diagnostic features, the cuticle identification is problematic; however, it may have belonged to a phyllocarid crustacean. Taphonomic features of the remains indicate that they do not represent fossilized fecal matter (coprolite) but may represent a regurgitate, but the hypothesis is difficult to test. Most probably they represent the leftover remains after arthropod or fish scavenging. The present study shows that soft tissues, which even earlier were manipulated by scavenger, may be preserved if only special microenvironmental conditions within and around the animal remains are established. PMID:26559060
Fragment mass distribution of proton-induced spallation reaction with intermediate energy
International Nuclear Information System (INIS)
Fan Sheng; Ye Yanlin; Xu Chuncheng; Chen Tao; Sobolevsky, N.M.
2000-01-01
The test of part benchmark of SHIELD code is finished. The fragment cross section and mass distribution and excitation function of the residual nuclei from proton-induced spallation reaction on thin Pb target with intermediate energy have been calculated by SHIELD code. And the results are in good agreement with measured data. The fragment mass distribution of the residual nuclei from proton-induced spallation reaction on thick Pb target with incident energy 1.6 GeV have been simulated
FIRST experiment: Fragmentation of Ions Relevant for Space and Therapy
International Nuclear Information System (INIS)
Agodi, C; Bondì, M; Cavallaro, M; Carbone, D; Cirrone, G A P; Cuttone, G; Abou-Haidar, Z; Alvarez, M A G; Bocci, A; Aumann, T; Durante, M; Balestra, F; Battistoni, G; Bohlen, T T; Boudard, A; Brunetti, A; Carpinelli, M; Cappuzzello, F; Cortes-Giraldo, M A; Napoli, M De
2013-01-01
Nuclear fragmentation processes are relevant in different fields of basic research and applied physics and are of particular interest for tumor therapy and for space radiation protection applications. The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at SIS accelerator of GSI laboratory in Darmstadt, has been designed for the measurement of different ions fragmentation cross sections at different energies between 100 and 1000 MeV/nucleon. The experiment is performed by an international collaboration made of institutions from Germany, France, Italy and Spain. The experimental apparatus is partly based on an already existing setup made of the ALADIN magnet, the MUSIC IV TPC, the LAND2 neutron detector and the TOFWALL scintillator TOF system, integrated with newly designed detectors in the interaction Region (IR) around the carbon removable target: a scintillator Start Counter, a Beam Monitor drift chamber, a silicon Vertex Detector and a Proton Tagger for detection of light fragments emitted at large angles (KENTROS). The scientific program of the FIRST experiment started on summer 2011 with the study of the 400 MeV/nucleon 12C beam fragmentation on thin (8 mm) carbon target.
FIRST experiment: Fragmentation of Ions Relevant for Space and Therapy
Agodi, C.; Abou-Haidar, Z.; Alvarez, M. A. G.; Aumann, T.; Balestra, F.; Battistoni, G.; Bocci, A.; Bohlen, T. T.; Bondì, M.; Boudard, A.; Brunetti, A.; Carpinelli, M.; Cappuzzello, F.; Cavallaro, M.; Carbone, D.; Cirrone, G. A. P.; Cortes-Giraldo, M. A.; Cuttone, G.; De Napoli, M.; Durante, M.; Fernandez-Garcia, J. P.; Finck, C.; Foti, A.; Gallardo, M. I.; Golosio, B.; Iarocci, E.; Iazzi, F.; Ickert, G.; Introzzi, R.; Juliani, D.; Krimmer, J.; Kurz, N.; Labalme, M.; Lavagno, A.; Leifels, Y.; Le Fevre, A.; Leray, S.; Marchetto, F.; Monaco, V.; Morone, M. C.; Nicolosi, D.; Oliva, P.; Paoloni, A.; Patera, V.; Piersanti, L.; Pleskac, R.; Quesada, J. M.; Randazzo, N.; Romano, F.; Rossi, D.; Rosso, V.; Rousseau, M.; Sacchi, R.; Sala, P.; Sarti, A.; Scheidenberger, C.; Schuy, C.; Sciubba, A.; Sfienti, C.; Simon, H.; Sipala, V.; Spiriti, E.; Stuttge, L.; Tropea, S.; Younis, H.
2013-03-01
Nuclear fragmentation processes are relevant in different fields of basic research and applied physics and are of particular interest for tumor therapy and for space radiation protection applications. The FIRST (Fragmentation of Ions Relevant for Space and Therapy) experiment at SIS accelerator of GSI laboratory in Darmstadt, has been designed for the measurement of different ions fragmentation cross sections at different energies between 100 and 1000 MeV/nucleon. The experiment is performed by an international collaboration made of institutions from Germany, France, Italy and Spain. The experimental apparatus is partly based on an already existing setup made of the ALADIN magnet, the MUSIC IV TPC, the LAND2 neutron detector and the TOFWALL scintillator TOF system, integrated with newly designed detectors in the interaction Region (IR) around the carbon removable target: a scintillator Start Counter, a Beam Monitor drift chamber, a silicon Vertex Detector and a Proton Tagger for detection of light fragments emitted at large angles (KENTROS). The scientific program of the FIRST experiment started on summer 2011 with the study of the 400 MeV/nucleon 12C beam fragmentation on thin (8mm) carbon target.
Semenov, F V; Skibitskaya, N F
The objective of the present study was to evaluate the possibility of the application of the cyanoacrylate-based glue for the strengthening of the reconstructed elements of the middle ear and its influence on the regeneration of the cartilaginous tissue. We used the cartilaginous tissue from the auricles of the male California rabbits as a model. The cartilage was destroyed in a standard press. Half of the cartilage thus fragmented was implanted into the left auricle. The remaining part was mixed up with the cyanoacrylate glue and implanted into the right auricle of the same animal. The implanted material was used for the morphological study on day 10, within 1 and 2 months after the beginning of the experiment. The results of the study confirm the absence of the toxic action of the biologically compatible cyanoacrylate-based glue on the regeneration of the cartilaginous and connective tissues which suggests the possibility of its application for the surgical treatment of the diseases of the middle ear.
Hydrodynamic effects in laser cutting of biological tissue phantoms
Zhigarkov, V. S.; Yusupov, V. I.; Tsypina, S. I.; Bagratashvili, V. N.
2017-11-01
We study the thermal and transport processes that occur in the course of incision formation at the surface of a biological tissue phantom under the action of near-IR, moderate-power, continuous-wave laser radiation (λ = 1.94 μm) delivered by means of an optical fibre with an absorbing coating on its exit face. It is shown that in addition to the thermal effect, the laser-induced hydrodynamic effects caused by the explosive boiling of the interstitial water make a large contribution to the phantom destruction mechanism. These effects lead to the tissue rupture accompanied by the ejection of part of the fragmented substance from the site of laser impact and the formation of highly porous structure near the incision surface. We have found that the depth, the width and the relief of the laser incision wall in the case of using the optical fibre moving with a constant velocity, depend on the fibre tilt angle with respect to the phantom surface, as well as the direction of the fibre motion.
Nonlinear transient responses of beams and rings to impulse loading or fragment impact
International Nuclear Information System (INIS)
Witmer, E.A.; Stagliano, T.R.; Rodal, J.J.A.
1977-01-01
Nuclear power plant protective structures may be subjected to various external missiles such as aircraft and tornado-generated missiles: telephone poles, planks, pipes, rods, automobiles, and other blown vehicles. Also, 'internally-generated missiles' such as fragments from powerplant rotors and aircraft engine rotors may impact protective structures. The present paper is concerned with a very limited part of the cited fragment threat; namely, fragments from high speed rotating machinery such as (1) aircraft engine rotors and (2) stationary power plant turbine rotors. Further, it is assumed that the structures intended to contain or control these fragments consist of initially-isotopic elastic-plastic metals. Certain potential containment/control (C/C) structures behave in a planar (or two-dimensional) fashion while other fragment-attacked C/C structures will undergo general three-dimensional deformations. Predictions for only the former category of fragment-attacked structures are discussed in the present paper. Pertinent experimental data discussed on fragment-attacked structures include (a) steel-sphere impact data involving beam targets and (b) engine rotor fragment impact against a steel containment ring. In all of these cases large-deflection, elastic-plastic transient structural responses occur. (Auth.)
String fragmentation; La fragmentation des cordes
Energy Technology Data Exchange (ETDEWEB)
Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)
1997-10-01
The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.
Directory of Open Access Journals (Sweden)
Jokela Anne
2010-02-01
Full Text Available Abstract Background In situ hybridization is a general molecular method typically used for the localization of mRNA transcripts in plants. The method provides a valuable tool to unravel the connection between gene expression and anatomy, especially in species such as pines which show large genome size and shortage of sequence information. Results In the present study, expression of the catalase gene (CAT related to the scavenging of reactive oxygen species (ROS and the polyamine metabolism related genes, diamine oxidase (DAO and arginine decarboxylase (ADC, were localized in developing Scots pine (Pinus sylvestris L. seeds. In addition to specific signals from target mRNAs, the probes continually hybridized non-specifically in the embryo surrounding region (ESR of the megagametophyte tissue, in the remnants of the degenerated suspensors as well as in the cells of the nucellar layers, i.e. tissues exposed to cell death processes and extensive nucleic acid fragmentation during Scots pine seed development. Conclusions In plants, cell death is an integral part of both development and defence, and hence it is a common phenomenon in all stages of the life cycle. Our results suggest that extensive nucleic acid fragmentation during cell death processes can be a considerable source of non-specific signals in traditional in situ mRNA hybridization. Thus, the visualization of potential nucleic acid fragmentation simultaneously with the in situ mRNA hybridization assay may be necessary to ensure the correct interpretation of the signals in the case of non-specific hybridization of probes in plant tissues.
Fission fragment angular momentum
International Nuclear Information System (INIS)
Frenne, D. De
1991-01-01
Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs
Feng, Dilu; Menger, Michael D; Wang, Hongbo; Laschke, Matthias W
2014-02-01
In endometriosis research, endometriosis-like lesions are usually induced in rodents by transplantation of isolated endometrial tissue fragments to ectopic sites. In the present study, we investigated whether this approach is affected by the cellular composition of the grafts. For this purpose, endometrial tissue fragments covered with luminal epithelium (LE(+)) and without luminal epithelium (LE(-)) were transplanted from transgenic green-fluorescent-protein-positive (GFP(+)) donor mice into the dorsal skinfold chamber of GFP(-) wild-type recipient animals to analyze their vascularization, growth and morphology by means of repetitive intravital fluorescence microscopy, histology and immunohistochemistry during a 14-day observation period. LE(-) fragments developed into typical endometriosis-like lesions with cyst-like dilated endometrial glands and a well-vascularized endometrial stroma. In contrast, LE(+) fragments exhibited a polypoid morphology and a significantly reduced blood perfusion after engraftment, because the luminal epithelium prevented the vascular interconnection with the microvasculature of the surrounding host tissue. This was associated with a markedly decreased growth rate of LE(+) lesions compared with LE(-) lesions. In addition, we found that many GFP(+) microvessels grew outside the LE(-) lesions and developed interconnections to the host microvasculature, indicating that inosculation is an important mechanism in the vascularization process of endometriosis-like lesions. Our findings demonstrate that the luminal epithelium crucially affects the vascularization, growth and morphology of endometriosis-like lesions. Therefore, it is of major importance to standardize the cellular composition of endometrial grafts in order to increase the validity and reliability of pre-clinical rodent studies in endometriosis research.
Directory of Open Access Journals (Sweden)
Dilu Feng
2014-02-01
Full Text Available In endometriosis research, endometriosis-like lesions are usually induced in rodents by transplantation of isolated endometrial tissue fragments to ectopic sites. In the present study, we investigated whether this approach is affected by the cellular composition of the grafts. For this purpose, endometrial tissue fragments covered with luminal epithelium (LE+ and without luminal epithelium (LE− were transplanted from transgenic green-fluorescent-protein-positive (GFP+ donor mice into the dorsal skinfold chamber of GFP− wild-type recipient animals to analyze their vascularization, growth and morphology by means of repetitive intravital fluorescence microscopy, histology and immunohistochemistry during a 14-day observation period. LE− fragments developed into typical endometriosis-like lesions with cyst-like dilated endometrial glands and a well-vascularized endometrial stroma. In contrast, LE+ fragments exhibited a polypoid morphology and a significantly reduced blood perfusion after engraftment, because the luminal epithelium prevented the vascular interconnection with the microvasculature of the surrounding host tissue. This was associated with a markedly decreased growth rate of LE+ lesions compared with LE− lesions. In addition, we found that many GFP+ microvessels grew outside the LE− lesions and developed interconnections to the host microvasculature, indicating that inosculation is an important mechanism in the vascularization process of endometriosis-like lesions. Our findings demonstrate that the luminal epithelium crucially affects the vascularization, growth and morphology of endometriosis-like lesions. Therefore, it is of major importance to standardize the cellular composition of endometrial grafts in order to increase the validity and reliability of pre-clinical rodent studies in endometriosis research.
Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.
Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi
2017-01-01
Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory
Energy Technology Data Exchange (ETDEWEB)
Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)
2016-11-15
The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)
Hoffer, Laurent; Renaud, Jean-Paul; Horvath, Dragos
2013-04-22
This paper describes the use and validation of S4MPLE in Fragment-Based Drug Design (FBDD)--a strategy to build drug-like ligands starting from small compounds called fragments. S4MPLE is a conformational sampling tool based on a hybrid genetic algorithm that is able to simulate one (conformer enumeration) or more molecules (docking). The goal of the current paper is to show that due to the judicious design of genetic operators, S4MPLE may be used without any specific adaptation as an in silico FBDD tool. Such fragment-to-lead evolution involves either growing of one or linking of several fragment-like binder(s). The native ability to specifically "dock" a substructure that is covalently anchored to its target (here, some prepositioned fragment formally part of the binding site) enables it to act like dedicated de novo builders and differentiates it from most classical docking tools, which may only cope with non-covalent interactions. Besides, S4MPLE may address growing/linking scenarios involving protein site flexibility, and it might also suggest "growth" moves by bridging the ligand to the site via water-mediated interactions if H2O molecules are simply appended to the input files. Therefore, the only development overhead required to build a virtual fragment→ligand growing/linking strategy based on S4MPLE were two chemoinformatics programs meant to provide a minimalistic management of the linker library. The first creates a duplicate-free library by fragmenting a compound database, whereas the second builds new compounds, attaching chemically compatible linkers to the starting fragments. S4MPLE is subsequently used to probe the optimal placement of the linkers within the binding site, with initial restraints on atoms from initial fragments, followed by an optimization of all kept poses after restraint removal. Ranking is mainly based on two criteria: force-field potential energy and RMSD shifts of the original fragment moieties. This strategy was applied to
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
Gouge, Michael F.
2011-01-01
Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.
Anatomy and classification of the posterior tibial fragment in ankle fractures.
Bartoníček, Jan; Rammelt, Stefan; Kostlivý, Karel; Vaněček, Václav; Klika, Daniel; Trešl, Ivo
2015-04-01
The aim of this study was to analyze the pathoanatomy of the posterior fragment on the basis of a comprehensive CT examination, including 3D reconstructions, in a large patient cohort. One hundred and forty one consecutive individuals with an ankle fracture or fracture-dislocation of types Weber B or Weber C and evidence of a posterior tibial fragment in standard radiographs were included in the study. The mean patient age was 49 years (range 19-83 years). The exclusion criteria were patients below 18 years of age, inability to provide written consent, fractures of the tibial pilon, posttraumatic arthritis and pre-existing deformities. In all patients, post-injury radiographs were obtained in anteroposterior, mortise and lateral views. All patients underwent CT scanning in transverse, sagittal and frontal planes. 3D CT reconstruction was performed in 91 patients. We were able to classify 137 cases into one of the following four types with constant pathoanatomic features: type 1: extraincisural fragment with an intact fibular notch, type 2: posterolateral fragment extending into the fibular notch, type 3: posteromedial two-part fragment involving the medial malleolus, type 4: large posterolateral triangular fragment. In the 4 cases it was not possible to classify the type of the posterior tibial fragment. These were collectively termed type 5 (irregular, osteoporotic fragments). It is impossible to assess the shape and size of the posterior malleolar fragment, involvement of the fibular notch, or the medial malleolus, on the basis of plain radiographs. The system that we propose for classification of fractures of the posterior malleolus is based on CT examination and takes into account the size, shape and location of the fragment, stability of the tibio-talar joint and the integrity of the fibular notch. It may be a useful indication for surgery and defining the most useful approach to these injuries.
Wind energy's subtle effect - habitat fragmentation
Energy Technology Data Exchange (ETDEWEB)
Pruett, Jay
2011-07-01
Full text: New wind energy production facilities are being built to accommodate demands for more, renewable, emission-free energy. This development is most often in windy, remote parts of the United States, so new transmission infrastructure capacity is also needed for shipment of energy from prairies, hilltops and shorelines to distant population centres. Well known environmental effects from wind energy development have included direct mortality to birds and bats. However, there is a more subtle effect also at play. 'Habitat fragmentation' is an impact caused by the siting and presence of infrastructure features on wildlife species. Instead of direct mortality, there is behavioural avoidance of such features because of activity, noise and even simply the presence of vertical structures that are different from the original nature of the habitat. This fragmentation threatens to make some of the last remaining habitat for declining species, especially grassland birds, unusable by them. Prairie grouse such as prairie chickens and sage grouse appear to be particularly susceptible to habitat fragmentation due to the presence of vertical structures. Other species such as the grasshopper sparrow have also been shown to avoid such features. It is believed that these species have evolved to avoid any vertical structure because it can serve as a perch for bird-eating raptors, including eagles, hawks, falcons and owls. Certain life cycle stages, such as nesting and chick rearing, appear to be most vulnerable to these fragmentation influences. Some of the research contributing to concern over habitat fragmentation, along with the mechanism of such fragmentation, will be presented. Solutions will also be offered for the siting of wind energy facilities and transmission lines to avoid this negative environmental impact. (Author)
Payne, Lloyd R.; Cole, David L.
2010-03-30
A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.
The Kosice meteorite fall: atmospheric trajectory and fragmentation from videos and radiometers
Borovicka, J.
2012-01-01
On 28 February 2010, 22h24m46s UT, a huge bolide of absolute magnitude -18 appeared over eastern Slovakia. Although this country is covered by the European Fireball Network (EN) and the Slovak Video Network, bad weather prevented direct imaging of the bolide by dedicated meteor cameras. Fortunately, three surveillance video cameras in Hungary recorded, at least partly, the event. These recordings allowed us to reconstruct the trajectory of the bolide and recover the meteorites. In addition, the light curve of the bolide was recorded by several EN camera radiometers, and sonic booms were registered by seismic stations in the region. The meteorites were classified as ordinary chondrites of type H5 (see Meteoritical Bulletin 100). I developed a model of atmospheric meteoroid fragmentation to fit the observed light curve. The model is based on the fact that meteoroid fragmentation leads to a sudden increase of a bolide's brightness, because the total meteoroid surface area increases after the fragmentation. A bright flare is produced if large numbers of small fragments or dust particles are released. I tried to model the whole light curve rigorously by setting up the mass distribution of fragments and/or dust particles released at each fragmentation point. The dust particles were allowed to be released either instantaneously or gradually. The ablation and radiation of individual particles were computed independently, and the summary light curve was computed. The deceleration at the end of the trajectory was taken into account as well. Based on the approximate calibration of the light curve, the initial mass of the meteoroid was estimated to 3500 kg (corresponding to diameter of 1.2 m). The major fragmentation occurred at a height of 39 km. Only few (probably three) large compact fragments of masses 20-100 kg survived this disruption. All of them fragmented again at lower heights below 30 km, producing minor flares on the light curve. In summary, Kosice was a weak
Directory of Open Access Journals (Sweden)
S. C. Oukouomi Noutchie
2014-01-01
Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.
Land fragmentation and production diversification
Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.
2018-01-01
We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
In vivo tissue engineering: Part I. Concept genesis and guidelines for its realization.
Zdrahala, R J; Zdrahala, I J
1999-10-01
A loss of function of an organ often represents a life-threatening situation. Transplantations are successful, but "replacement" availability, its compatibility with the host, and subsequent healing often pose serious questions. Tissue engineering, where a carefully prepared scaffold is populated, in vitro, by cells to form an artificial organ, addresses some of the problems mentioned above. Trauma associated with the implant introduction to the host often complicates the process. The novel concept of in vivo tissue engineering which is designed to mediate the healing and tissue regeneration process by providing an in vitro formed porous, microcellular scaffold is proposed. The scaffold (part or entire organ) is then populated by cells either spontaneously (the surrounding cells will spread and populate to inhabit the scaffold) or by cellular augmentation (encapsulated cells are delivered to this in statu nascendi scaffold). Minimally traumatic arthroscopic surgery combined with a unique polymer delivery system is envisioned for the introduction of this implant to a site to be repaired. Such an approach will require the formation of polymer in-situ, in a reasonable time. The scaffold-forming polymers will be, in principle, biodegradable. We propose to utilize biodegradable polyurethane systems for in vivo tissue engineering. Diversity of their structure/property relationships, relative "ease" of their preparation, and excellent biocompatibility predetermine polyurethanes to be the materials of choice. This paper describes the genesis of this concept and potentials for its realization. It is intended to initiate and stimulate discussion among the related scientific disciplines to form a basis for this field. The synthesis, application, and biodegradation of selected polyurethanes and variety of its medical utilization will be discussed in upcoming papers.
Fragmentation processes in nuclear reactions
International Nuclear Information System (INIS)
Legrain, R.
1984-08-01
Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed
Radioimmunodetection of human tumor xenografts by monoclonal antibody F(ab')/sub 2/ fragments
Energy Technology Data Exchange (ETDEWEB)
Herlyn, D.; Munz, D.L.; Herlyn, M.; Koprowski, H.; Powe, J.; Alavi, A.; Meinken, G.E.; Srivastava, S.C.
1986-01-01
Procedures are described for the radiolocalization of human tumors by murine monoclonal antibodies (MAb) in animal model systems. Visualization of tumor xenografts was clearer in nude mice compared to experimentally immunosuppressed mice due to the higher tumor viability. MAb localization in tumor tissue was greatly enhanced when F(ab')/sub 2/ fragments rather than intact antibody molecules were used. Although tumors could be visualized with /sup 131/I-, /sup 123/I-or /sup 111/In-labeled MAb fragments without background subtraction, tumor-to-background ratios of radioactivity were highest for /sup 131/I-labeled fragments. /sup 131/I-labeled F(ab')/sub 2/ fragments of eight MAb against human colorectal carcinoma, melanoma or lung carcinoma localized specifically only in those tumors that bound the MAb in vitro and not in unrelated tumors. Radiolabeled fragments of MAb with other specificities (anti-hepatitis virus MAb) did not localize in tumors. All MAb that inhibited tumor growth in nude mice effectively localized these tumors by ..gamma..-scintigraphy. Some MAb were effective in localizing tumors but ineffective in inhibiting their growth. The ability of the specific radiolabeled F(ab')/sub 2/ fragments to localize in tumor grafts correlated significantly with MAb binding affinity and density of antigenic sites on tumor cells together, but not with either in vitro binding parameter alone.
Tissue bioengineering and artificial organs.
Llames, Sara; García, Eva; Otero Hernández, Jesús; Meana, Alvaro
2012-01-01
The scarcity of organs and tissues for transplant and the need of immunosuppressive drugs to avoid rejection constitute two reasons that justify organ and tissue production in the laboratory. Tissue engineering based tissues (TE) could allow to regenerate the whole organ from a fragment or even to produce several organs from an organ donor for grafting purposes. TE is based in: (1) the ex vivo expansion of cells, (2) the seeding of these expanded cells in tridimensional structures that mimic physiological conditions and, (3) grafting the prototype. In order to graft big structures it is necessary that the organ or tissue produced "ex vivo" bears a vascular tree to ensure the nutrition of its deep layers. At present, no technology has been developed to provide this vascular tree to TE derived products. Thus, these tissues must be thin enough to acquire nutrients during the first days by diffusion from surrounding tissues. This fact constitutes nowadays the greatest limitation of technologies for organ development in the laboratory.In this chapter, all these problems and their possible solutions are commented. Also, the present status of TE techniques in the regeneration of different organ systems is reviewed.
Rotationally induced fragmentation in the prestellar core L1544
Energy Technology Data Exchange (ETDEWEB)
Klapp, Jaime; Zavala, Miguel [Departamento de Física, Instituto Nacional de Investigaciones Nucleares (ININ), Km. 36.5, Carretera México-Toluca, La Marquesa 52750, Estado de México (Mexico); Sigalotti, Leonardo Di G.; Peña-Polo, Franklin; Troconis, Jorge [Centro de Física, Instituto Venezolano de Investigaciones Científicas (IVIC), Apartado Postal 20632, Caracas 1020A (Venezuela, Bolivarian Republic of)
2014-01-10
Recent observations indicate that there is no correlation between the level of turbulence and fragmentation in detected protostellar cores, suggesting that turbulence works mainly before gravitationally bound prestellar cores form and that their inner parts are likely to be velocity coherent. Based on this evidence, we simulate the collapse and fragmentation of an isolated, initially centrally condensed, uniformly rotating core of total mass M = 5.4 M {sub ☉}, using the smoothed particle hydrodynamics code GADGET-2 modified with the inclusion of sink particles, in order to compare the statistical properties of the resulting stellar ensembles with previous gravoturbulent fragmentation models. The initial conditions are intended to fit the observed properties of the prestellar core L1544. We find that for ratios of the rotational to the gravitational energy β ≥ 0.05, a massive disk is formed at the core center from which a central primary condenses after ∼50 kyr. Soon thereafter the disk fragments into secondary protostars, consistent with an intermediate mode of star formation in which groups of 10-100 stars form from a single core. The models predict peak accretion rates between ∼10{sup –5} and 10{sup –4} M {sub ☉} yr{sup –1} for all stars and reproduce many of the statistical properties predicted from gravoturbulent fragmentation, suggesting that on the small scales of low-mass, dense cores these are independent of whether the contracting gas is turbulent or purely rotating.
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Disturbance driven colony fragmentation as a driver of a coral disease outbreak.
Directory of Open Access Journals (Sweden)
Marilyn E Brandt
Full Text Available In September of 2010, Brewer's Bay reef, located in St. Thomas (U.S. Virgin Islands, was simultaneously affected by abnormally high temperatures and the passage of a hurricane that resulted in the mass bleaching and fragmentation of its coral community. An outbreak of a rapid tissue loss disease among coral colonies was associated with these two disturbances. Gross lesion signs and lesion progression rates indicated that the disease was most similar to the Caribbean coral disease white plague type 1. Experiments indicated that the disease was transmissible through direct contact between colonies, and five-meter radial transects showed a clustered spatial distribution of disease, with diseased colonies being concentrated within the first meter of other diseased colonies. Disease prevalence and the extent to which colonies were bleached were both significantly higher on unattached colony fragments than on attached colonies, and disease occurred primarily on fragments found in direct contact with sediment. In contrast to other recent studies, disease presence was not related to the extent of bleaching on colonies. The results of this study suggest that colony fragmentation and contact with sediment played primary roles in the initial appearance of disease, but that the disease was capable of spreading among colonies, which suggests secondary transmission is possible through some other, unidentified mechanism.
Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H
2011-01-01
Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.
Fragment informatics and computational fragment-based drug design: an overview and update.
Sheng, Chunquan; Zhang, Wannian
2013-05-01
Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.
Lead bullet fragments in venison from rifle-killed deer: potential for human dietary exposure.
Directory of Open Access Journals (Sweden)
W Grainger Hunt
Full Text Available Human consumers of wildlife killed with lead ammunition may be exposed to health risks associated with lead ingestion. This hypothesis is based on published studies showing elevated blood lead concentrations in subsistence hunter populations, retention of ammunition residues in the tissues of hunter-killed animals, and systemic, cognitive, and behavioral disorders associated with human lead body burdens once considered safe. Our objective was to determine the incidence and bioavailability of lead bullet fragments in hunter-killed venison, a widely-eaten food among hunters and their families. We radiographed 30 eviscerated carcasses of White-tailed Deer (Odocoileus virginianus shot by hunters with standard lead-core, copper-jacketed bullets under normal hunting conditions. All carcasses showed metal fragments (geometric mean = 136 fragments, range = 15-409 and widespread fragment dispersion. We took each carcass to a separate meat processor and fluoroscopically scanned the resulting meat packages; fluoroscopy revealed metal fragments in the ground meat packages of 24 (80% of the 30 deer; 32% of 234 ground meat packages contained at least one fragment. Fragments were identified as lead by ICP in 93% of 27 samples. Isotope ratios of lead in meat matched the ratios of bullets, and differed from background lead in bone. We fed fragment-containing venison to four pigs to test bioavailability; four controls received venison without fragments from the same deer. Mean blood lead concentrations in pigs peaked at 2.29 microg/dL (maximum 3.8 microg/dL 2 days following ingestion of fragment-containing venison, significantly higher than the 0.63 microg/dL averaged by controls. We conclude that people risk exposure to bioavailable lead from bullet fragments when they eat venison from deer killed with standard lead-based rifle bullets and processed under normal procedures. At risk in the U.S. are some ten million hunters, their families, and low
Nonlinear transient responses of beams and rings to impulse loading or fragment impact
International Nuclear Information System (INIS)
Witmer, E.A.; Stagliano, T.R.; Rodal, J.J.A.
1977-01-01
The present paper is concerned with a very limited part of the cited fragment threat; namely, fragments from high speed rotating machinery such as (1) aircraft engine rotors and (2) stationary power plant turbine rotors. Further, it is assumed that the structures intended to contain or control these fragments consist of initially-isotropic elastic-plastic metals. Certain potential containment/control (C/C) structures behave in a planar (or two-dimensional) fashion while other fragment-attacked C/C structures will undergo general three-dimensional deformations. Predictions for only the former category of fragment-attacked structures are discussed in the present paper. Pertinent experimental data discussed here on fragment-attacked structures include (a) steel-sphere impact data involving beam targets and (b) engine rotor fragment impact against a steel containment ring. In all of these cases large-deflection, elastic-plastic transient structural response occur. The governing equations employed are presented in the present analysis to predict the responses of protective (metal) structures to engine-rotor-fragment impact. The protective structure is intended either to contain or to deflect the attacking fragments away from important regions; large-deflection, elasic-plastic structural response is expected because these protective structures must have the least feasible weight. Concise geometric and assumed-displacement-field descriptions of the several types of finite elements to be utilized in subsequent examples are given, together with several categories of strain displacement relations. Both low- and higher-order elements are discussed
The fragmentation instability of a black hole with f( R) global monopole under GUP
Chen, Lingshen; Cheng, Hongbo
2018-03-01
Having studied the fragmentation of the black holes containing f( R) global monopole under the generalized uncertainty principle (GUP), we show the influences from this kind of monopole, f( R) theory, and GUP on the evolution of black holes. We focus on the possibility that the black hole breaks into two parts by means of the second law of thermodynamics. We derive the entropies of the initial black hole and the broken parts while the generalization of Heisenberg's uncertainty principle is introduced. We find that the f( R) global monopole black hole keeps stable instead of splitting without the generalization because the entropy difference is negative. The fragmentation of the black hole will happen if the black hole entropies are limited by the GUP and the considerable deviation from the general relativity leads to the case that the mass of one fragmented black hole is smaller and the other one's mass is larger.
Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio
2014-08-30
The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971
Fractal statistics of brittle fragmentation
Directory of Open Access Journals (Sweden)
M. Davydova
2013-04-01
Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.
International Nuclear Information System (INIS)
Tagami, Keiko; Uchida, Shigeo
2015-01-01
To estimate the radiocesium decreasing rates from persimmon trees during a period of about 3 y following the accident at Tokyo Electric Power Company's Fukushima Dai-ichi Nuclear Power Plant (FDNPP), we conducted measurements of tree tissue parts collected in 2011–2013. The sampling was carried out in Chiba, 220 km south of FDNPP; radioactive fallouts discharged from FDNPP had mainly been observed in March–April 2011 on the sampling site. We measured 137 Cs concentrations in the tree tissue parts, i.e., fruits (flesh, skin and seeds), leaves and newly emerged branches, and then the effective half-lives (T eff ) of 137 Cs were calculated. Leaf samples were classified into two types by sampling months according to the growing stages, that is, immature (April–May) and mature (June–November) leaves. All these parts showed exponential declines in 137 Cs concentration with good adjusted contribution ratios of higher than ca. 0.7. The calculated T eff values from all tissue parts were similar with the average of 229 d (range: 216–243 d). From these results, we concluded that each tree tissue was representative for the calculation of T eff . For comparison to these observation results, open source food monitoring data from 2011 to 2013 including 137 Cs data for persimmon fruits collected in Fukushima Prefecture were used to calculate T eff for persimmon trees. Values of T eff were obtained for persimmon fruits grown in each local government area in Fukushima Prefecture and they ranged from 303 to 475 d. - Highlights: • 137 Cs decreased exponentially from persimmon trees in Chiba after the Fukushima accident. • The effective half-lives (T eff ) of 137 Cs from fruit, leaf and new branch tissues were similar. • The Food monitoring data were used to calculate effective half-lives for persimmon trees in Fukushima. • The average of T eff in Chiba was ca. 230 d while that in Fukushima was ca. 400 d
Kobayashi, Yasukazu; Yasuda, Kazunori; Kondo, Eiji; Katsura, Taro; Tanabe, Yoshie; Kimura, Masashi; Tohyama, Harukazu
2010-04-01
Concerning meniscal tissue regeneration, many investigators have studied the development of a tissue-engineered meniscus. However, the utility still remains unknown. Implantation of autogenous meniscal fragments wrapped with a fascia sheath into the donor site meniscal defect may significantly enhance fibrocartilage regeneration in vivo in the defect. Controlled laboratory study. Seventy-five mature rabbits were used in this study. In each animal, an anterior one-third of the right medial meniscus was resected. Then, the animals were divided into the following 3 groups of 25 rabbits each: In group 1, no treatment was applied to the meniscal defect. In group 2, the defect was covered with a fascia sheath. In group 3, after the resected meniscus was fragmented into small pieces, the fragments were grafted into the defect. Then, the defect with the meniscal fragments was covered with a fascia sheath. In each group, 5 rabbits were used for histological evaluation at 3, 6, and 12 weeks after surgery, and 5 rabbits were used for biomechanical evaluation at 6 and 12 weeks after surgery. Histologically, large round cells in group 3 were scattered in the core portion of the meniscus-shaped tissue, and the matrix around these cells was positively stained by safranin O and toluisin blue at 12 weeks. The histological score of group 3 was significantly higher than that of group 1 and group 2. Biomechanically, the maximal load and stiffness of group 3 were significantly greater than those of groups 1 and 2. This study clearly demonstrated that implantation of autogenous meniscal fragments wrapped with a fascia sheath into the donor site meniscal defect significantly enhanced fibrocartilage regeneration in vivo in the defect at 12 weeks after implantation in the rabbit. This study proposed a novel strategy to treat a large defect after a meniscectomy.
International Nuclear Information System (INIS)
Vojtsitskij, V.M.; Fedorov, A.N.; Lugovskoj, Eh.B.; Derzskaya, S.G.; Khizhnyak, S.V.; Kurskij, M.D.; Kucherenko, N.E.
1990-01-01
Early (1 and 24 h) after X-irradiation with a dose of 0.21 C/kg changes occurred in the acceptibility of the polypeptide chain parts of sarcoplasmic reticulum Ca-ATPase for the effect of trypsin. The analysis of the results of studying the structural and functional properties of a hydrophobic fragment of this enzyme in the control and after irradiation permitted to define the part of the Ca-ATPase polypeptide chain that provided ion selectivity of the fragment
Nuclear fragmentation reactions in extended media studied with Geant4 toolkit
Energy Technology Data Exchange (ETDEWEB)
Pshenichnov, Igor, E-mail: pshenich@fias.uni-frankfurt.d [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Institute for Nuclear Research, Russian Academy of Science, 117312 Moscow (Russian Federation); Botvina, Alexander [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Institute for Nuclear Research, Russian Academy of Science, 117312 Moscow (Russian Federation); Mishustin, Igor [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Kurchatov Institute, Russian Research Center, 123182 Moscow (Russian Federation); Greiner, Walter [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany)
2010-03-15
It is well-known from numerous experiments that nuclear multifragmentation is a dominating mechanism for production of intermediate mass fragments in nucleus-nucleus collisions at energies above 100AMeV. In this paper we investigate the validity and performance of the Fermi break-up model and the statistical multifragmentation model implemented as parts of the Geant4 toolkit. We study the impact of violent nuclear disintegration reactions on the depth-dose profiles and yields of secondary fragments for beams of light and medium-weight nuclei propagating in extended media. Implications for ion-beam cancer therapy and shielding from cosmic radiation are discussed.
Nuclear fragmentation reactions in extended media studied with Geant4 toolkit
International Nuclear Information System (INIS)
Pshenichnov, Igor; Botvina, Alexander; Mishustin, Igor; Greiner, Walter
2010-01-01
It is well-known from numerous experiments that nuclear multifragmentation is a dominating mechanism for production of intermediate mass fragments in nucleus-nucleus collisions at energies above 100AMeV. In this paper we investigate the validity and performance of the Fermi break-up model and the statistical multifragmentation model implemented as parts of the Geant4 toolkit. We study the impact of violent nuclear disintegration reactions on the depth-dose profiles and yields of secondary fragments for beams of light and medium-weight nuclei propagating in extended media. Implications for ion-beam cancer therapy and shielding from cosmic radiation are discussed.
Pinna, Baingio; Uccula, Arcangelo; Tanca, Maria
2010-09-01
In this work it is suggested that color induces phenomenal wholeness, part-whole organization and fragmentation. The phenomenal wholeness subsumes the set of its main attributes: homogeneity, continuity, univocality, belongingness, and oneness. If color induces wholeness, it can also induce fragmentation. Therefore, in order to understand the role played by color within the process of part-whole organization, color is used both as a wholeness and as a fragmentation tool, thus operating synergistically or antagonistically with other wholeness processes. Therefore, color is expected to influence figure-ground segregation, grouping, shape formation and other visual processes that are related to the phenomenal wholeness. The purpose of this study is to rate the influence of color in inducing whole and part-whole organization and, consequently, in determining the perception of figure-ground segregation, grouping, shape formation, numerousness evaluation and time reading. We manipulated experimental conditions by using equiluminant colors to favor or break (parcel-out) the wholeness of objects like geometrical composite figures and words. The results demonstrated that color is aimed, among other psychological and biological purposes, at: (1) relating each chromatic component of an object, thus favoring the emergence of the whole object; (2) eliciting a part-whole organization, whose components are interdependent; (3) eliciting fragments and then breaking up the whole and favoring the emergence of single components. Wholeness, part-whole organization and fragmentation can be considered as three further purposes of color. © 2010 The Authors, Ophthalmic and Physiological Optics © 2010 The College of Optometrists.
Mass distribution of fission fragments within the Born-Oppenheimer approximation
Energy Technology Data Exchange (ETDEWEB)
Pomorski, K.; Nerlo-Pomorska, B. [M.C.S. University, Department of Theoretical Physics, Lublin (Poland); Ivanyuk, F.A. [Institute for Nuclear Research, Kiev (Ukraine)
2017-03-15
The fission fragments mass-yield of {sup 236} U is obtained by an approximate solution of the eigenvalue problem of the collective Hamiltonian that describes the dynamics of the fission process whose degrees of freedom are: the fission (elongation), the neck and mass-asymmetry modes. The macroscopic-microscopic method is used to evaluate the potential energy surface. The macroscopic energy part is calculated using the liquid drop model and the microscopic corrections are obtained using a Woods-Saxon single-particle levels. The four-dimensional modified Cassini ovals shape parametrization is used to describe the shape of the fissioning nucleus. The mass tensor is taken within a cranking-type approximation. The final fragment mass distribution is obtained by weighting the adiabatic density distribution in the collective space with the neck-dependent fission probability. The neck degree of freedom is found to play a significant role in determining the final fragment mass distribution. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Tuna, Th
2008-07-15
This work shows the study of atom-molecule collision processes in the high velocity domain (v=4,5 a.u). The molecules concerned by this work are small unsaturated hydrocarbons C{sub 1-4}H and C{sub 3}H{sub 2}. Molecules are accelerated with the Tandem accelerator in Orsay and their fragmentation is analyzed by the 4{pi}, 100% efficient detector, AGAT. Thanks to a shape analysis of the current signal from the silicon detectors in association with the well known grid method, we are able to measure all the fragmentation channels of the incident molecule. These dissociation measurements have been introduced in the modelization of two objects of the interstellar medium in which a lot of hydrocarbon molecules have been observed (TMC1, horse-head nebula). We have extended our branching ratios obtained by high velocity collision to other electronic processes included in the chemical database like photodissociation and dissociative recombination. This procedure is feasible under an assumption of the statistical point of view of the molecular fragmentation. The deviations following our modification are very small in the modelization of TMC1 but significant in the photodissociation region. The first part is dedicated to the description of the experimental setting that has enabled us to study the fragmentation of C{sub n}H{sub m} molecules: the Orsay's Tandem accelerator and the Agat detector. The second part deals with negative ion sources and particularly with the Sahat source that is based on electronic impact and has shown good features for the production of anions and correct stability for its use with accelerators. The third part is dedicated to the experimental results in terms of cross-sections, number of fragments and branching ratios, associated to the various collisional processes. The last part presents an application of our measurement of fragmentation data to astro-chemistry. In this field, the simulation codes of the inter-stellar medium require databases
Energy Technology Data Exchange (ETDEWEB)
Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)
2014-02-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.
International Nuclear Information System (INIS)
Brax, Philippe; Upadhye, Amol
2014-01-01
A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments
Evaluation of tumor targeting with radiolabeled F(ab2 fragment of a humanized monoclonal antibody
Directory of Open Access Journals (Sweden)
"Babaei MH
2002-08-01
Full Text Available Humanized monoclonal antibody U36 and its F(ab'2 fragment, radio labeled with 125I, were tested for tumor localization in nude mice bearing a squamous cell carcinoma xenograft line derived from a head and neck carcinoma. Monoclonal antibody IgG or F(ab'2 fragment were injected in parallel and at days 1, 2 and 3, mice were dissected for determination of isotope biodistribution. IgG as well as F(ab'2 showed highly specific localization in tumor tissue. The mean tumor uptake (n=3 is expressed as the percentage of the injected dose per gram of tumor tissue (%ID/g. %ID/g of IgG was 11.7% at day 1 and decreased to 10.9% at day 3 whereas %ID/g of F(ab'2 was 2.9% at day 1 and decreased on following days. Tumor to blood ratios (T/B at day 1 were 0.86 for IgG and 1.32 for F(ab'2 and reached a maximum at day 3 with values of 4.41 and 1.84 respectively. These findings suggest that the superior tumor to non-tumor ratios in the day of 1 render the F(ab'2 fragment more qualified for specific targeting radioisotopes to tumor xenografts in this exprimental setting.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
The Munich accelerator for fission fragments MAFF
International Nuclear Information System (INIS)
Habs, D.; Gross, M.; Assmann, W.; Ames, F.; Bongers, H.; Emhofer, S.; Heinz, S.; Henry, S.; Kester, O.; Neumayr, J.; Ospald, F.; Reiter, P.; Sieber, T.; Szerypo, J.; Thirolf, P.G.; Varentsov, V.; Wilfart, T.; Faestermann, T.; Kruecken, R.; Maier-Komor, P.
2003-01-01
The Munich Accelerator for Fission Fragments MAFF has been designed for the new Munich research reactor FRM-II. It will deliver several intense beams (∼3x10 11 s -1 ) of very neutron-rich fission fragments with a final energy of 30 keV (low-energy beam) or energies between 3.7 and 5.9 MeV·A (high-energy beam). Such beams are of interest for the creation of super-heavy elements by fusion reactions, nuclear spectroscopy of exotic nuclei, but they also have a potential for applications, e.g. in medicine. Presently the Munich research reactor FRM-II is ready for operation, but authorities delay the final permission to turn the reactor critical probably till the end of 2002. Only after this final permission the financing of the major parts of MAFF can start. On the other hand all major components have been designed and special components have been tested in separate setups
Inclusive projectile fragmentation in the spectator model
International Nuclear Information System (INIS)
Hussein, M.S.; McVoy, K.W.
1985-01-01
Crazing-angle single spectra for projectile fragments from nuclear collisions exhibit a broad peak centered near the beam velocity, suggesting that these observed fragments play only a 'spectator' role in the reaction. Using only this spectator assumption (but not DWBA), it is found that a 'prior form' formulation of the reaction leads, via closure, to a -type estimate of the inclusive spectator spectrum, thus relating it to the reaction cross section for the 'participant' with the target. It is shown explicitly that this expression includes an improved multi-channel version of the Udagawa-Tamura formula for the 'breakup-fusion' or incomplete fusion cross section, and identifies it as the fluctuation part of the participant-target reaction cross section. A Glauber-type estimate of the distorted wave functions which enter clearly shows how the width of the peak in the spectator spectrum arises from the 'Fermi motion' within the projectile, as in the simple Serber model, but is modified by the 'overlap geometry' of the collision. (Author) [pt
Recursive model for the fragmentation of polarized quarks
Kerbizi, A.; Artru, X.; Belghobsi, Z.; Bradamante, F.; Martin, A.
2018-04-01
We present a model for Monte Carlo simulation of the fragmentation of a polarized quark. The model is based on string dynamics and the 3P0 mechanism of quark pair creation at string breaking. The fragmentation is treated as a recursive process, where the splitting function of the subprocess q →h +q' depends on the spin density matrix of the quark q . The 3P0 mechanism is parametrized by a complex mass parameter μ , the imaginary part of which is responsible for single spin asymmetries. The model has been implemented in a Monte Carlo program to simulate jets made of pseudoscalar mesons. Results for single hadron and hadron pair transverse-spin asymmetries are found to be in agreement with experimental data from SIDIS and e+e- annihilation. The model predictions on the jet-handedness are also discussed.
Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L
2015-01-01
Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.
Fragmentation, dissipative expansion, and freeze-out in medium energy heavy-ion collisions
International Nuclear Information System (INIS)
Gross, D.H.E.; Li Baoan; DeAngelis, A.R.
1992-01-01
The collision dynamics of 96 Mo + 96 Mo at 55 A MeV is simulated by solving numerically the Boltzmann-Uehling-Uhlenbeck (BUU) transport equation for the one-body phase-space distribution-function of nucleons with and without Coulomb interaction. A scatter-plot of the one-body density distribution shows an initial compression, subsequent homogeneous expansion, a breaking into ''fragments'', a very slow creeping expansion up to a freeze-out and in the case of included Coulomb-interaction a Coulomb-explosion. In the calculation which included Coulomb-interaction the overall shape of the ensemble of dense fragments is spherical. The fragments are created over the entire volume of the dense part of the source and not at the surface only. In the simulation without Coulomb interaction a doughnut-like shape may develop. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Flores, Dyan V.; Smitaman, Edward; Huang, Brady K.; Resnick, Donald L. [University of California San Diego Medical Center, Department of Radiology, San Diego, CA (United States)
2016-12-15
To re-evaluate the Segond fragment emphasizing those structures that attach to the fragment in patients with reported acute/subacute anterior cruciate ligament (ACL) injuries, and to clarify the nomenclature used to describe these structures. A search of databases of knee MR examinations over 4.5 years with reported ACL tears yielded 19,726 studies. Using strict exclusion criteria, a total of 146 MR studies with acute/subacute ACL tears were re-assessed with respect to the Segond fragment's size, shape, orientation, location, displacement, attaching soft tissue structures, and associated osseous and/or soft tissue injuries. Segond fractures were present in 1.25 % of reported acute/subacute ACL tears. The fragment measured 11.9 x 7.3 x 3.27 mm, being thin, ovoid, vertically oriented, situated anterolaterally along the proximal tibial epiphysis, posterior to Gerdy's tubercle and inferior to the lateral tibial plateau, and displaced up to 6 mm laterally. The attached structures were the meniscotibial component of the mid-third lateral capsular ligament (mt-MTLCL) in 58.9 %, both the mt-MTLCL and the posterior fibers of the ITB (pf-ITB) in 35.6 %, and the pf-ITB in 5.48 % of cases. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. The mt-MTLCL most commonly attaches to the Segond fragment, but the pf-ITB can also attach to this fragment. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. (orig.)
Telomere length in normal and neoplastic canine tissues.
Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R
2007-12-01
To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.
Raising an Antibody Specific to Breast Cancer Subpopulations Using Phage Display on Tissue Sections
DEFF Research Database (Denmark)
Larsen, Simon Asbjørn; Meldgaard, Theresa; Fridriksdottir, Agla Jael Rubner
2016-01-01
BACKGROUND/AIM: Primary tumors display a great level of intra-tumor heterogeneity in breast cancer. The current lack of prognostic and predictive biomarkers limits accurate stratification and the ability to predict response to therapy. The aim of the present study was to select recombinant antibody...... fragments specific against breast cancer subpopulations, aiding the discovery of novel biomarkers. MATERIALS AND METHODS: Recombinant antibody fragments were selected by phage display. A novel shadowstick technology enabled the direct selection using tissue sections of antibody fragments specific against...
Fracture mechanics model of stone comminution in ESWL and implications for tissue damage
Lokhandwalla, Murtuza; Sturtevant, Bradford
2000-07-01
Focused shock waves administered during extracorporeal shock-wave lithotripsy (ESWL) cause stone fragmentation. The process of stone fragmentation is described in terms of a dynamic fracture process. As is characteristic of all brittle materials, fragmentation requires nucleation, growth and coalescence of flaws, caused by a tensile or shear stress. The mechanisms, operative in the stone, inducing these stresses have been identified as spall and compression-induced tensile microcracks, nucleating at pre-existing flaws. These mechanisms are driven by the lithotripter-generated shock wave and possibly also by cavitation effects in the surrounding fluid. In this paper, the spall mechanism has been analysed, using a cohesive-zone model for the material. The influence of shock wave parameters, and physical properties of stone, on stone comminution is described. The analysis suggests a potential means to exploit the difference between the stone and tissue physical properties, so as to make stone comminution more effective, without increasing tissue damage.
Universality of projectile fragmentation model
International Nuclear Information System (INIS)
Chaudhuri, G.; Mallik, S.; Das Gupta, S.
2012-01-01
Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
Suitability of the Cellient (TM) cell block method for diagnosing soft tissue and bone tumors
Song, W.; van Hemel, B. M.; Suurmeijer, A. J. H.
BACKGROUNDThe diagnosis of tumors of soft tissue and bone (STB) heavily relies on histological biopsies, whereas cytology is not widely used. Cellient(TM) cell blocks often contain small tissue fragments. In addition to Hematoxylin and Eosin (H&E) interpretation of histological features,
Sulistyawan, Barano Siswa; Eichelberger, Bradley A.; Verweij, Pita; Boot, Rene’ G A; Hardian, Oki; Adzan, Gemasakti; Sukmantoro, Wisnu
2017-01-01
The trend of wildlife habitat fragmentation worldwide continues as a result of anthropogenic activities on development of a linear infrastructure and land use changes, which is often implemented as part of spatial planning policies. In this paper we expand upon an existing approach to design
International Nuclear Information System (INIS)
Buchegger, F.; Halpern, S.E.; Sutherland, R.M.; Schreyer, M.; Mach, J.P.; Rochester Univ., NY
1986-01-01
Colon carcinoma multicellular spheroids were incubated in vitro with radiolabelled MAbs. The more rapid penetration of fragments as compared to intact MAbs was clearly demonstrated. For the study of antibody localization in tumors in vivo, the model of nude mice with ligated kidneys was used. Although very artificial, this model allowed to demonstrate that, without urinary excretion, Fab fragments accumulated more rapidly into the tumor than intact MAbs and disappeared faster from the blood. This difference was less striking for F(ab') 2 fragments. In the liver a decreased accumulation of both types of fragments as compared to intact MAbs was observed. Concerning radio-immunotherapy we think that Fab fragments are not useful because of their too short half-life the circulation and in tumor and because they will probably be too toxic for the kidneys. Intact MAbs and F(ab') 2 fragments have each their advantages. Intact MAbs show highest tumor accumulation in mice without ligated kidney, however, they remain mostly on the periphery of tumor nodules, as shown by autoradiography. F(ab') 2 fragments have been found to penetrate deeper into the tumor and to accumulate less in the liver. It might be therefore an advantage to combine intact MAbs with F(ab') 2 fragments, so that in the tumor two different regions could be attacked whereas in normal tissues toxicity could be distributed to different organs such as to the liver with intact MAbs and to the kidney with F(ab') 2 fragments. (orig.) [de
Transport of Calcareous Fragments by Reef Fishes.
Bardach, J E
1961-01-13
The weight of sand, coral scrapings, algal fragments, and other calcareous materials which pass through the intestines of reef fishes was calculated on a hectare-per-year basis. It was found that browsing omnivorous reef fishes which rely, in part, on a plant diet ingested and redeposited at least 2300 kg of such material on a 1-hectare study reef near Bermuda. Reasons are presented why this estimate, certainly in order of magnitude, should be applicable to coral reefs in general.
Robust Object Tracking Using Valid Fragments Selection.
Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang
Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.
Loneliness is associated with sleep fragmentation in a communal society.
Kurina, Lianne M; Knutson, Kristen L; Hawkley, Louise C; Cacioppo, John T; Lauderdale, Diane S; Ober, Carole
2011-11-01
Loneliness has been shown to predict poor health. One hypothesized mechanism is that lonely individuals do not sleep as well as individuals who feel more connected to others. Our goal was to test whether loneliness is associated with sleep fragmentation or sleep duration. Cross-sectional study. Members of a traditional, communal, agrarian society living in South Dakota. Ninety-five participants (mean age 39.8 years, 55% female) who were ≥ 19 years of age at the study's inception. Not applicable. We conducted interviews querying loneliness, depression, anxiety, and stress, as well as subjective sleep quality and daytime sleepiness. Study participants wore a wrist actigraph for one week to measure objective sleep properties; the two studied here were sleep fragmentation and sleep duration. Higher loneliness scores were associated with significantly higher levels of sleep fragmentation (β = 0.073, t = 2.55, P = 0.01), controlling for age, sex, body mass index, risk of sleep apnea, and negative affect (a factor comprising symptoms of depression and anxiety, and perceived stress). Loneliness was not associated with sleep duration or with either subjective sleep measure. Loneliness was a significant predictor of sleep fragmentation. Humans' social nature may partly be manifest through our dependence on feeling secure in our social environment to sleep well.
Self-organized criticality in fragmenting
DEFF Research Database (Denmark)
Oddershede, L.; Dimon, P.; Bohr, J.
1993-01-01
The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...
Energy production using fission fragment rockets
International Nuclear Information System (INIS)
Chapline, G.; Matsuda, Y.
1991-08-01
Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs
Chimenti, Michael S; Bulfer, Stacie L; Neitz, R Jeffrey; Renslo, Adam R; Jacobson, Matthew P; James, Thomas L; Arkin, Michelle R; Kelly, Mark J S
2015-07-01
The ubiquitous AAA+ ATPase p97 functions as a dynamic molecular machine driving several cellular processes. It is essential in regulating protein homeostasis, and it represents a potential drug target for cancer, particularly when there is a greater reliance on the endoplasmic reticulum-associated protein degradation pathway and ubiquitin-proteasome pathway to degrade an overabundance of secreted proteins. Here, we report a case study for using fragment-based ligand design approaches against this large and dynamic hexamer, which has multiple potential binding sites for small molecules. A screen of a fragment library was conducted by surface plasmon resonance (SPR) and followed up by nuclear magnetic resonance (NMR), two complementary biophysical techniques. Virtual screening was also carried out to examine possible binding sites for the experimental hits and evaluate the potential utility of fragment docking for this target. Out of this effort, 13 fragments were discovered that showed reversible binding with affinities between 140 µM and 1 mM, binding stoichiometries of 1:1 or 2:1, and good ligand efficiencies. Structural data for fragment-protein interactions were obtained with residue-specific [U-(2)H] (13)CH3-methyl-labeling NMR strategies, and these data were compared to poses from docking. The combination of virtual screening, SPR, and NMR enabled us to find and validate a number of interesting fragment hits and allowed us to gain an understanding of the structural nature of fragment binding. © 2015 Society for Laboratory Automation and Screening.
Fragmentation of relativistic nuclei
International Nuclear Information System (INIS)
Cork, B.
1975-06-01
Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)
Energy Technology Data Exchange (ETDEWEB)
Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1965-07-01
This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de
Ryder, Graham; Norman, Marc D.; Taylor, G. Jeffrey
1997-01-01
Large impact basins are natural drill holes into the Moon, and their ejecta carries unique information about the rock types and stratigraphy of the lunar crust. We have conducted an electron microprobe study of mineral fragments in the poikilitic melt breccias collected from the Taurus Mountains at the Apollo 17 landing site. These breccias are virtually unanimously agreed to be impact melt produced in the Serenitatis impact event. They contain lithic fragments and much more abundant mineral fragments of crustal origin. We have made precise microprobe analyses of minor element abundances in fragments of olivine, pyroxene, and plagioclase to provide new information on the possible source rocks and the crustal stratigraphy in the Serenitatis region. These data were also intended to elucidate the nature of the cryptic geochemical component in breccias such as these with low-K Fra Mauro basalt compositions. We chose the finest-grained (i.e., most rapidly quenched) breccias for study, to avoid reacted and partly assimilated fragments as much as possible. Most of the mineral fragments appear to have been derived from rocks that would fall into the pristine igneous Mg-suite as represented by lithic fragments in the Apollo collection, or reasonable extensions of it. Gabbroic rocks were more abundant in the target stratigraphy than is apparent from the Apollo sample collection. Some pyroxene and plagiociase, but probably not much olivine, could be derived from feldspathic granulites, which are metamorphosed polymict breccias. Some mineral fragments are from previously unknown rocks. These include highly magnesian olivines (up to Fo(sub 94)), possibly volcanic in origin, that exacerbate the difficulty in explaining highly magnesian rocks in the lunar crust. It appears that some part of the lunar interior has an mg*(= 100 x Mg/(Mg/Fe) atomic) greater than the conventional bulk Moon value of 80-84. Other volcanic rocks, including mare basalts, and rapidly- cooled impact melt
Thermodynamics of the fuel fragmentation gas
International Nuclear Information System (INIS)
Perez, R.B.; Alsmiller, R.G. Jr.
1977-01-01
In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented
Formation of fission-fragment mass distribution for nuclei lighter than thorium
International Nuclear Information System (INIS)
Itkis, M.G.; Mul'gin, S.I.; Rusanov, A.Y.; Okolovich, A.N.; Smirenkin, G.N.
1986-01-01
A phenomenological approach to description of fission-fragment mass distribution Y(M) for nuclei in the vicinity of Pb is developed and used to extract from the experimental Y(M) data the nuclear deformation potential energy V(M) and its components: the macroscopic (liquid-drop) part and the shell correction in the transition state. The results of the analysis are compared with the theoretically obtained V(M) and Y(M). The three-hump fragment-mass distributions observed in Ra fission are satisfactorily described within the framework of the approach developed. The properties of the symmetric and asymmetric fission valleys and the related Y(M) components are discussed
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
Models of fragmentation with composite power laws
Tavassoli, Z.; Rodgers, G. J.
1999-06-01
Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.
Kinetics of fragmentation-annihilation processes
Filipe, JAN; Rodgers, GJ
1996-01-01
We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...
Fission fragment spins and spectroscopy
International Nuclear Information System (INIS)
Durell, J.L.
1988-01-01
Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission
Tissue-engineering as an adjunct to pelvic reconstructive surgery
DEFF Research Database (Denmark)
Jangö, Hanna
of pelvic organ prolapse (POP) are warranted. Traditional native tissue repair may be associated with poor long-term outcome and augmentation with permanent polypropylene meshes is associated with frequent and severe adverse effects. Tissue-engineering is a regenerative strategy that aims at creating...... functional tissue using stem cells, scaffolds and trophic factors. The aim of this thesis was to investigate the potential adjunctive use of a tissue-engineering technique for pelvic reconstructive surgery using two synthetic biodegradable materials; methoxypolyethyleneglycol-poly(lactic-co-glycolic acid......) (MPEG-PLGA) and electrospun polycaprolactone (PCL) - with or without seeded muscle stem cells in the form of autologous fresh muscle fiber fragments (MFFs).To simulate different POP repair scenarios different animal models were used. In Study 1 and 2, MPEG-PLGA was evaluated in a native tissue repair...
Analysis of DNA methylation in various swine tissues.
Directory of Open Access Journals (Sweden)
Chun Yang
Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.
On spallation and fragmentation of heavy ions at intermediate energies
International Nuclear Information System (INIS)
Musulmanbekov, G.; Al-Haidary, A.
2002-01-01
A new code for simulation of spallation and (multi)fragmentation of nuclei in proton and nucleus induced collisions at intermediate and high energies is developed. The code is a combination of modified intranuclear cascade model with traditional fission - evaporation part and multifragmentation part based on lattice representation of nuclear structure and percolation approach. The production of s-wave resonances and formation time concept included into standard intranuclear cascade code provides correct calculation of excitation energy of residues. This modified cascade code served as a bridge between low and high energy model descriptions of nucleus-nucleus collisions. A good agreement with experiments has been obtained for multiparticle production at intermediate and relatively high energies. Nuclear structure of colliding nuclei is represented as face centered cubic lattice. This representation, being isomorphic to the shell model of nuclear structure, allows to apply percolation approach for nuclear fragmentation. The offered percolation model includes both site and bond percolation. Broken sites represent holes left by nucleons knocked out at cascade state. Therefore, in the first cascade stage mutual rescattering of the colliding nuclei results in knocking some nucleons out of them. After this fast stage paltrily destruct and excited residues remain. On the second stage residual nuclei either evaporate nucleons and light nuclei up to alpha-particles or fragment into pieces with intermediate masses. The choice depends on residue's destruction degree. At low excitation energy and small destruction of the residue the evaporation and fission mechanisms are preferable. The more excitation energy and destruction the more probability of (multi)fragmentation process. Moreover, the more destruction degree of the residual the more the site percolation probability. It is concluded, that at low and intermediate excitation energies the fragmentation of nuclei is slow
Yang, S M; Fang, D C; Luo, Y H; Lu, R; Battle, P D; Liu, W W
2001-08-01
In order to explore the role of alterations of telomerase activity and terminal restriction fragment (TRF) length in the development and progression of gastric cancer. Telomerase activity was detected in 176 specimens of gastric mucosa obtained through an operation or endoscopical biopsy by using the telomeric repeat amplification protocol (TRAP) assay. Meanwhile, the mean length of TRF was measured with the use of a Southern blot in part of those samples. Telomerase activity was detected in 14 of 57 (24.6%) chronic atrophy gastritis patients, six of 18 (33.3%) intestinal metaplasia patients, three of eight (37.5%) dysplasia patients and 60 of 65 (92.3%) gastric cancer patients, respectively. Normal gastric mucosa revealed no telomerase activity. No association was found between telomerase activity and any clinicopathological parameters. The mean TRF length was decreased gradually with age in normal mucosa and in gastric cancer tissue. Regression analysis demonstrated that the reduction rate in these tissues was 41 +/- 12 base pairs/year. Among 35 gastric cancers, TRF length was shown to be shorter in 20 cases (57.1%), similar in 12 cases (34.3%) and elongated in three cases (7.6%), compared to the corresponding adjacent tissues. The mean TRF length tended to decrease as the mucosa underwent chronic atrophy gastritis, intestinal metaplasia, dysplasia and into gastric cancer. The mean TRF length in gastric cancer was not statistically correlated with clinicopathological parameters and telomerase activity. Our results suggest that telomerase is expressed during the early stage of gastric carcinogenesis, and that the clinical significance of TRF length appears to be limited in gastric cancer.
Energy Technology Data Exchange (ETDEWEB)
George, T.G.; Tate, R.E.; Axler, K.M.
1985-05-01
The radioisotope thermoelectric generator (RTG) that will provide power for space missions contains 18 General-Purpose Heat Source (GPHS) modules. Each module contains four /sup 238/PuO/sub 2/-fueled clads and generates 250 W/sub (t)/. Because a launch-pad or post-launch explosion is always possible, we need to determine the ability of GPHS fueled clads within a module to survive fragment impact. The bullet/fragment test series, part of the Safety Verification Test Plan, was designed to provide information on clad response to impact by a compact, high-energy, aluminum-alloy fragment and to establish a threshold value of fragment energy required to breach the iridium cladding. Test results show that a velocity of 555 m/s (1820 ft/s) with an 18-g bullet is at or near the threshold value of fragment velocity that will cause a clad breach. Results also show that an exothermic Ir/Al reaction occurs if aluminum and hot iridium are in contact, a contact that is possible and most damaging to the clad within a narrow velocity range. The observed reactions between the iridium and the aluminum were studied in the laboratory and are reported in the Appendix.
Detonation and fragmentation modeling for the description of large scale vapor explosions
International Nuclear Information System (INIS)
Buerger, M.; Carachalios, C.; Unger, H.
1985-01-01
The thermal detonation modeling of large-scale vapor explosions is shown to be indispensable for realistic safety evaluations. A steady-state as well as transient detonation model have been developed including detailed descriptions of the dynamics as well as the fragmentation processes inside a detonation wave. Strong restrictions for large-scale vapor explosions are obtained from this modeling and they indicate that the reactor pressure vessel would even withstand explosions with unrealistically high masses of corium involved. The modeling is supported by comparisons with a detonation experiment and - concerning its key part - hydronamic fragmentation experiments. (orig.) [de
Gozal, David; Khalyfa, Abdelnaby; Qiao, Zhuanghong; Akbarpour, Mahzad; Maccari, Rosanna; Ottanà, Rosaria
2017-09-01
Sleep fragmentation (SF) is highly prevalent and has emerged as an important contributing factor to obesity and metabolic syndrome. We hypothesized that SF-induced increases in protein tyrosine phosphatase-1B (PTP-1B) expression and activity underlie increased food intake, inflammation, and leptin and insulin resistance. Wild-type (WT) and ObR-PTP-1b-/- mice (Tg) were exposed to SF and control sleep (SC), and food intake was monitored. WT mice received a PTP-1B inhibitor (RO-7d; Tx) or vehicle (Veh). Upon completion of exposures, systemic insulin and leptin sensitivity tests were performed as well as assessment of visceral white adipose tissue (vWAT) insulin receptor sensitivity and macrophages (ATM) polarity. SF increased food intake in either untreated or Veh-treated WT mice. Leptin-induced hypothalamic STAT3 phosphorylation was decreased, PTP-1B activity was increased, and reduced insulin sensitivity emerged both systemic and in vWAT, with the latter displaying proinflammatory ATM polarity changes. All of the SF-induced effects were abrogated following PTP-1B inhibitor treatment and in Tg mice. SF induces increased food intake, reduced leptin signaling in hypothalamus, systemic insulin resistance, and reduced vWAT insulin sensitivity and inflammation that are mediated by increased PTP-1B activity. Thus, PTP-1B may represent a viable therapeutic target in the context of SF-induced weight gain and metabolic dysfunction. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.
Manifestation of the halo structure in momentum distributions from {sup 6}He fragmentation
Energy Technology Data Exchange (ETDEWEB)
Aumann, T. [Mainz Univ. (Germany). Inst. fuer Kernchemie; Chulkov, L.V.; Pribora, V.N. [Rossijskij Nauchnyj Tsentr ``Kurchatovskij Inst.``, Moscow (Russian Federation); Smedberg, M.H. [Chalmers Univ. of Technology, Goeteborg (Sweden)
1998-03-01
Experimental data on momentum distribution in the fragmentation of a 240 MeV/u {sup 6}He beam on a carbon target are compared with several models of the {sup 6}He nucleus based on different physical assumptions. It is shown that a lack of a strict theoretical description of the fragmentation mechanism and, in particular, of the final state interaction prevents from any contra or versa arguments for these models. The requirement of a fragment ({sup 5}He) survival or spatial localization of a fragment in the {sup 6}He wave function is an essential point in the reaction mechanism. The analysis of the {sup 5}He momentum (sum of the neutron and the {alpha}-particle momenta) distribution is free from the effect of final state interaction and thus more promising. It is shown that due to the requirement of fragment survival this distribution is determined mainly by the asymptotic of the {sup 6}He wave function. Large sensitivity to the outer part of the halo structure gives a unique possibility to estimate the admixture of s-waves in the ground states of {sup 11}Li and {sup 14}Be directly from the momentum distribution of {sup 10}Li (in fragmentation of {sup 11}Li) and from the momentum distribution of {sup 13}Be (in fragmentation of {sup 14}Be). The shell structure of these nuclei is of great interest in understanding the neutron-halo properties. (orig.)
Fragmentation of atomic clusters: A theoretical study
International Nuclear Information System (INIS)
Lopez, M.J.; Jellinek, J.
1994-01-01
Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time
Vranckx, Guy; Jacquemyn, Hans; Muys, Bart; Honnay, Olivier
2012-04-01
Shrubs and trees are assumed less likely to lose genetic variation in response to habitat fragmentation because they have certain life-history characteristics such as long lifespans and extensive pollen flow. To test this assumption, we conducted a meta-analysis with data on 97 woody plant species derived from 98 studies of habitat fragmentation. We measured the weighted response of four different measures of population-level genetic diversity to habitat fragmentation with Hedge's d and Spearman rank correlation. We tested whether the genetic response to habitat fragmentation was mediated by life-history traits (longevity, pollination mode, and seed dispersal vector) and study characteristics (genetic marker and plant material used). For both tests of effect size habitat fragmentation was associated with a substantial decrease in expected heterozygosity, number of alleles, and percentage of polymorphic loci, whereas the population inbreeding coefficient was not associated with these measures. The largest proportion of variation among effect sizes was explained by pollination mechanism and by the age of the tissue (progeny or adult) that was genotyped. Our primary finding was that wind-pollinated trees and shrubs appeared to be as likely to lose genetic variation as insect-pollinated species, indicating that severe habitat fragmentation may lead to pollen limitation and limited gene flow. In comparison with results of previous meta-analyses on mainly herbaceous species, we found trees and shrubs were as likely to have negative genetic responses to habitat fragmentation as herbaceous species. We also found that the genetic variation in offspring was generally less than that of adult trees, which is evidence of a genetic extinction debt and probably reflects the genetic diversity of the historical, less-fragmented landscape. ©2011 Society for Conservation Biology.
Nap, Annemiek W; Groothuis, Patrick G; Demir, Ayse Y; Maas, Jacques W M; Dunselman, Gerard A J; de Goeij, Anton F P M; Evers, Johannes L H
2003-01-01
Not all women with patent tubes develop clinically manifest endometriosis. Quality and quantity of endometrium in retrograde menstruation may be the determining factor in the development of the disease. We hypothesize that retrograde shedding of endometrial fragments with preserved integrity facilitates implantation of endometrium in ectopic locations, resulting in endometriotic lesion development. We evaluate the impact of tissue integrity on the success of endometriosis-like lesion development in the chicken embryo chorioallantoic membrane (CAM) model. Menstrual and non-menstrual (cyclic) endometrium were collected by biopsy, and either minced or enzymatically dispersed. Spontaneously shed menstrual effluent was collected by a menstrual cup, and cells and tissue were isolated. We evaluated whether infiltration or lesion formation in the CAM occurred after transplantation of endometrium onto the CAM. Transplantation of biopsied menstrual and cyclic endometrium fragments, and of endometrium fragments >1 mm(3) isolated from menstrual effluent, resulted in lesion formation. Transplantation of endometrial cells isolated from menstrual effluent did not lead to lesion formation. After transplantation of digested biopsied cyclic endometrium, infiltration in the CAM but no lesions were observed. In the CAM assay, integrity of tissue architecture determines success of implantation of human endometrium in ectopic locations.
Physics-Based Fragment Acceleration Modeling for Pressurized Tank Burst Risk Assessments
Manning, Ted A.; Lawrence, Scott L.
2014-01-01
As part of comprehensive efforts to develop physics-based risk assessment techniques for space systems at NASA, coupled computational fluid and rigid body dynamic simulations were carried out to investigate the flow mechanisms that accelerate tank fragments in bursting pressurized vessels. Simulations of several configurations were compared to analyses based on the industry-standard Baker explosion model, and were used to formulate an improved version of the model. The standard model, which neglects an external fluid, was found to agree best with simulation results only in configurations where the internal-to-external pressure ratio is very high and fragment curvature is small. The improved model introduces terms that accommodate an external fluid and better account for variations based on circumferential fragment count. Physics-based analysis was critical in increasing the model's range of applicability. The improved tank burst model can be used to produce more accurate risk assessments of space vehicle failure modes that involve high-speed debris, such as exploding propellant tanks and bursting rocket engines.
Designer genes. Recombinant antibody fragments for biological imaging
Energy Technology Data Exchange (ETDEWEB)
Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology
2000-09-01
Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering
Designer genes. Recombinant antibody fragments for biological imaging
International Nuclear Information System (INIS)
Wu, A.M.; Yazaki, P.J.
2000-01-01
Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and
Powers, Thomas W; Neely, Benjamin A; Shao, Yuan; Tang, Huiyuan; Troyer, Dean A; Mehta, Anand S; Haab, Brian B; Drake, Richard R
2014-01-01
A recently developed matrix-assisted laser desorption/ionization imaging mass spectrometry (MALDI-IMS) method to spatially profile the location and distribution of multiple N-linked glycan species in frozen tissues has been extended and improved for the direct analysis of glycans in clinically derived formalin-fixed paraffin-embedded (FFPE) tissues. Formalin-fixed tissues from normal mouse kidney, human pancreatic and prostate cancers, and a human hepatocellular carcinoma tissue microarray were processed by antigen retrieval followed by on-tissue digestion with peptide N-glycosidase F. The released N-glycans were detected by MALDI-IMS analysis, and the structural composition of a subset of glycans could be verified directly by on-tissue collision-induced fragmentation. Other structural assignments were confirmed by off-tissue permethylation analysis combined with multiple database comparisons. Imaging of mouse kidney tissue sections demonstrates specific tissue distributions of major cellular N-linked glycoforms in the cortex and medulla. Differential tissue distribution of N-linked glycoforms was also observed in the other tissue types. The efficacy of using MALDI-IMS glycan profiling to distinguish tumor from non-tumor tissues in a tumor microarray format is also demonstrated. This MALDI-IMS workflow has the potential to be applied to any FFPE tissue block or tissue microarray to enable higher throughput analysis of the global changes in N-glycosylation associated with cancers.
The significance of monitoring sex hormones levels after ovarian tissue auto-transplantation
International Nuclear Information System (INIS)
Wang Qiuwei; Xu Peizhen; Yu Bin; Zhou Hong
2003-01-01
Objective: To evaluate the significance of monitoring serum sex hormones levels after ovarian tissue auto-transplantation. Methods: Twenty-five patients with stage IV recurrent endometriosis after one or two times of conservative surgeries underwent radical surgery. Their ovarian tissue fragments were transplanted to greater omentum. Serum follicle-stimulation hormone (FSH), Luteinizing hormone (LH) and estradiol (E 2 ) levels were measured monthly since fourth month post-operatively. After E 2 was increased, based body temperature was measured and vaginal hormone cytology was examined weekly for maturation index (MI) to assess the ovulatory phase and luteal phase in those with viable ovarian tissues. Serum levels of FSH, LH and E 2 in ovulatory phase and luteal phase were determined 20 women with viable ovarian tissues for three cycles as well as in 20 normal sexually mature women and 20 operative menopausal women. Results: There were 12 cases who had increasing of E 2 at four months post operatively and 8 cases more at six months. The other 5 cases with low serum E 2 levels and high FSH and LH levels at 12 months were designated as failures. The survival rate of transplanted ovarian tissue was 80.0%. There were no significant differences of the serum FSH, LH and E 2 levels in ovulatory phase and luteal phase between women with viable grafted ovarian tissues and normal sexually mature women. Conclusion: Monitoring of sex hormones is a good means to assess the viability of the transplanted ovarian tissue fragments
Sun, S; Henriksen, K; Karsdal, M A; Armbrecht, G; Belavý, D L; Felsenberg, D; Rittweger, J; Wang, Y; Zheng, Q; Nedergaard, A F
2014-10-01
In this study we sought to determine whether a Titin peptide fragment can serve as a clinical biomarker for changes in muscle mass. Mass spectrometry was used to identify Titin fragment in urine. An antibody against this Titin sequence was raised and used to develop a competitive ELISA assay for measurement in serum. Rat tissue extractions in the presence or absence of a series of proteases of interest were used to identify its enzymatic origin. A rat model of dexamethasone (DEX) induced muscle atrophy and a human 56-day bed rest study with and without vibration therapy were used to assess biological and clinical relevance. A technically robust ELISA measuring the Titin fragment was developed against a Titin peptide fragment identified in human urine. The fragment was shown to be produced primarily by MMP-2 cleavage of Titin. In the rat muscle DEX induced atrophy model, Titin-MMP2 fragment was decreased in the beginning of DEX treatment, and then significantly increased later on during DEX administration. In the human bed rest study, the Titin-MMP2 fragment was initially decreased 11.9 (±3.7) % after 1day of bed rest, and then gradually increased ending up at a 16.4 (±4.6) % increase at day 47. We developed a robust ELISA measuring a muscle derived MMP-2 generated Titin degradation fragment in rat and human serum. Importantly, the fragment can be measured in serum and that these levels are related to induction of skeletal muscle atrophy. Copyright © 2014 Elsevier Inc. All rights reserved.
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
International Nuclear Information System (INIS)
Park, Jee Won; Jo, Jung Hyun; Park, Byeong Ho
2007-01-01
The fracture of a central venous catheter is a rare but potentially serious complication. Moreover, removal of the broken catheter pieces is considerably challenging, especially for premature infants. We report 3 case studies of the percutaneous transcatheter retrieval of broken catheter parts in 3 premature infants. We confirmed the location of the catheter fragments via a DSA venogram with diluted contrast media. Using the minimum amount of contrast, and extreme caution, we made certain no contrast-induced nephrotoxicity of air embolism occurred during catheter manipulation. In addition, when the broken fragment was curled or attached to the cardiac wall, we used a hook-shaped catheter to facilitate the capturing of the catheter with a loopsnare. This report demonstrates the feasibility of removing a retained catheter fragment in a premature infant using a percutaneous transcatheter approach
Autologous Adipose-Derived Tissue Matrix Part I: Biologic Characteristics.
Schendel, Stephen A
2017-10-01
Autologous collagen is an ideal soft tissue filler and may serve as a matrix for stem cell implantation and growth. Procurement of autologous collagen has been limited, though, secondary to a sufficient source. Liposuction is a widely performed and could be a source of autologous collagen. The amount of collagen and its composition in liposuctioned fat remains unknown. The purpose of this research was to characterize an adipose-derived tissue-based product created using ultrasonic cavitation and cryo-grinding. This study evaluated the cellular and protein composition of the final product. Fat was obtained from individuals undergoing routine liposuction and was processed by a 2 step process to obtain only the connective tissue. The tissue was then evaluated by scanning electronic microscope, Western blot analysis, and flow cytometry. Liposuctioned fat was obtained from 10 individuals with an average of 298 mL per subject. After processing an average of 1 mL of collagen matrix was obtained from each 100 mL of fat. Significant viable cell markers were present in descending order for adipocytes > CD90+ > CD105+ > CD45+ > CD19+ > CD144+ > CD34+. Western blot analysis showed collagen type II, III, IV, and other proteins. Scanning electronic microscope study showed a regular pattern of cross-linked, helical collagen. Additionally, vital staing demonstrated that the cells were still viable after processing. Collagen and cells can be easily obtained from liposuctioned fat by ultrasonic separation without alteration of the overall cellular composition of the tissue. Implantation results in new collagen and cellular growth. Collagen matrix with viable cells for autologous use can be obtained from liposuctioned fat and may provide long term results. 5. © 2017 The American Society for Aesthetic Plastic Surgery, Inc. Reprints and permission: journals.permissions@oup.com
Photon-hadron fragmentation: theoretical situation
International Nuclear Information System (INIS)
Peschanski, R.
1983-07-01
Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory
Measurement of Gene Expression in Archival Paraffin-Embedded Tissues
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316
Recent progress on perturbative QCD fragmentation functions
International Nuclear Information System (INIS)
Cheung, K.
1995-05-01
The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons
David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda
2010-01-01
Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...
Mass spectrometry for fragment screening.
Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris
2017-11-08
Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Horejs, Christine-Maria; St-Pierre, Jean-Philippe; Ojala, Juha R. M.; Steele, Joseph A. M.; da Silva, Patricia Barros; Rynne-Vidal, Angela; Maynard, Stephanie A.; Hansel, Catherine S.; Rodríguez-Fernández, Clara; Mazo, Manuel M.; You, Amanda Y. F.; Wang, Alex J.; von Erlach, Thomas; Tryggvason, Karl; López-Cabrera, Manuel; Stevens, Molly M.
2017-01-01
Matrix metalloproteinases (MMPs) contribute to the breakdown of tissue structures such as the basement membrane, promoting tissue fibrosis. Here we developed an electrospun membrane biofunctionalized with a fragment of the laminin β1-chain to modulate the expression of MMP2 in this context. We demonstrate that interfacing of the β1-fragment with the mesothelium of the peritoneal membrane via a biomaterial abrogates the release of active MMP2 in response to transforming growth factor β1 and rescues tissue integrity ex vivo and in vivo in a mouse model of peritoneal fibrosis. Importantly, our data demonstrate that the membrane inhibits MMP2 expression. Changes in the expression of epithelial-to-mesenchymal transition (EMT)-related molecules further point towards a contribution of the modulation of EMT. Biomaterial-based presentation of regulatory basement membrane signals directly addresses limitations of current therapeutic approaches by enabling a localized and specific method to counteract MMP2 release applicable to a broad range of therapeutic targets. PMID:28593951
Horejs, Christine-Maria; St-Pierre, Jean-Philippe; Ojala, Juha R. M.; Steele, Joseph A. M.; da Silva, Patricia Barros; Rynne-Vidal, Angela; Maynard, Stephanie A.; Hansel, Catherine S.; Rodríguez-Fernández, Clara; Mazo, Manuel M.; You, Amanda Y. F.; Wang, Alex J.; von Erlach, Thomas; Tryggvason, Karl; López-Cabrera, Manuel; Stevens, Molly M.
2017-06-01
Matrix metalloproteinases (MMPs) contribute to the breakdown of tissue structures such as the basement membrane, promoting tissue fibrosis. Here we developed an electrospun membrane biofunctionalized with a fragment of the laminin β1-chain to modulate the expression of MMP2 in this context. We demonstrate that interfacing of the β1-fragment with the mesothelium of the peritoneal membrane via a biomaterial abrogates the release of active MMP2 in response to transforming growth factor β1 and rescues tissue integrity ex vivo and in vivo in a mouse model of peritoneal fibrosis. Importantly, our data demonstrate that the membrane inhibits MMP2 expression. Changes in the expression of epithelial-to-mesenchymal transition (EMT)-related molecules further point towards a contribution of the modulation of EMT. Biomaterial-based presentation of regulatory basement membrane signals directly addresses limitations of current therapeutic approaches by enabling a localized and specific method to counteract MMP2 release applicable to a broad range of therapeutic targets.
Mei, B.; Tu, X. L.; Wang, M.
2018-04-01
An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.
Physics of projectile fragments
International Nuclear Information System (INIS)
Minamisono, Tadanori
1982-01-01
This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)
Szmidt, Monika; Górski, Maciej; Barczak, Katarzyna; Buczkowska-Radlińska, Jadwiga
This article presents a clinical protocol to reconstruct two accidentally damaged maxillary central incisors using composite resin material and a fractured tooth component. A patient was referred to the clinic with fracture of the two maxillary central incisors. Clinical examination revealed that both teeth were fractured in the middle third of the crown and that the fractures involved enamel and dentin with no pulp exposure. The patient had also suffered a lower lip laceration. When the lip was evaluated, a fractured fragment of the maxillary right central incisor was found inside the wound. The missing part of the tooth was replaced via adhesive attachment. Due to the damage of the fractured part of the maxillary left central incisor, direct composite restoration of this tooth was performed. With the advent of adhesive dentistry, the process of fragment reattachment has become simplified and more reliable. This procedure provides improved function, is faster to perform, and provides long-lasting effects, indicating that reattachment of a coronal fragment is a realistic alternative to placement of conventional resin composite restorations.
Howard, Danny Dwayne
Part I - Shock waves are focused in extracorporeal shock wave lithotripsy (ESWL) machines to strengths sufficient to fracture kidney stones. Substantial side effects-most of them acute-have resulted from this procedure, including injury to soft tissue. The focusing of shock waves through various layers of tissue is a complex process which stimulates many bio-mechano-chemical responses.This thesis presents results of an in vitro study of the initial mechanical stimulus. Planar nitrocellulose membranes of order 10 um thick were used as models of thin tissue structures. Two modes of failure were recorded: Failure due to cavitation collapsing on or near the membranes, and failure induced by altering the structure of shock waves. Tests were done in water at and around F2 to characterize the extent of cavitation damage, and was found to be confined within the focal region, 1.2 cm along the axis of focus.Scattering media were used to simulate the effects of acoustic nonuniformity of tissue and to alter the structure of focusing shock waves. 40 um diameter (average) hollow glass spheres were added to ethylene glycol, glycerine and castor oil to vary the properties of the scattering media. Multiple layer samples of various types of phantom tissue were tested in degassed castor oil to gauge the validity of the scattering media. The scattering media and tissue samples increased the rise time decreased strain rate in a similar fashion. Membranes were damaged by the decreased strain rate and accumulated effects of the altered structure: After about 20 or so shocks immersed in the scattering media and after about 100 shocks behind the tissue samples. The mode of failure was tearing with multiple tears in some cases from about .1 cm to about 3 cm depending of the number of shocks and membrane thickness.Part II - This work examines the exsolution of volatiles-carbon dioxide from water-in a cylindrical test cell under different pressure conditions. Water was supersaturated with
Natural aminoacyl tRNA synthetase fragment enhances cardiac function after myocardial infarction.
Directory of Open Access Journals (Sweden)
Margaret E McCormick
Full Text Available A naturally-occurring fragment of tyrosyl-tRNA synthetase (TyrRS has been shown in higher eukaryotes to 'moonlight' as a pro-angiogenic cytokine in addition to its primary role in protein translation. Pro-angiogenic cytokines have previously been proposed to be promising therapeutic mechanisms for the treatment of myocardial infarction. Here, we show that systemic delivery of the natural fragment of TyRS, mini-TyrRS, improves heart function in mice after myocardial infarction. This improvement is associated with reduced formation of scar tissue, increased angiogenesis of cardiac capillaries, recruitment of c-kitpos cells and proliferation of myocardial fibroblasts. This work demonstrates that mini-TyrRS has beneficial effects on cardiac repair and regeneration and offers support for the notion that elucidation of the ever expanding repertoire of noncanonical functions of aminoacyl tRNA synthetases offers unique opportunities for development of novel therapeutics.
MRI of displaced meniscal fragments
International Nuclear Information System (INIS)
Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal
2012-01-01
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
MRI of displaced meniscal fragments
Energy Technology Data Exchange (ETDEWEB)
Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)
2012-01-15
A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)
Dimensional crossover in fragmentation
Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.
2000-11-01
Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.
Energy Technology Data Exchange (ETDEWEB)
Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)
2013-09-21
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.
International Nuclear Information System (INIS)
Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.
2013-01-01
The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections
Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen
2009-01-30
In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.
Comparing forest fragmentation and its drivers in China and the USA with Globcover v2.2
Chen, Mingshi; Mao, Lijun; Zhou, Chunguo; Vogelmann, James E.; Zhu, Zhiliang
2010-01-01
Forest loss and fragmentation are of major concern to the international community, in large part because they impact so many important environmental processes. The main objective of this study was to assess the differences in forest fragmentation patterns and drivers between China and the conterminous United States (USA). Using the latest 300-m resolution global land cover product, Globcover v2.2, a comparative analysis of forest fragmentation patterns and drivers was made. The fragmentation patterns were characterized by using a forest fragmentation model built on the sliding window analysis technique in association with landscape indices. Results showed that China’s forests were substantially more fragmented than those of the USA. This was evidenced by a large difference in the amount of interior forest area share, with China having 48% interior forest versus the 66% for the USA. China’s forest fragmentation was primarily attributed to anthropogenic disturbances, driven particularly by agricultural expansion from an increasing and large population, as well as poor forest management practices. In contrast, USA forests were principally fragmented by natural land cover types. However, USA urban sprawl contributed more to forest fragmentation than in China. This is closely tied to the USA’s economy, lifestyle and institutional processes. Fragmentation maps were generated from this study, which provide valuable insights and implications regarding habitat planning for rare and endangered species. Such maps enable development of strategic plans for sustainable forest management by identifying areas with high amounts of human-induced fragmentation, which improve risk assessments and enable better targeting for protection and remediation efforts. Because forest fragmentation is a long-term, complex process that is highly related to political, institutional, economic and philosophical arenas, both nations need to take effective and comprehensive measures to mitigate
Energy Technology Data Exchange (ETDEWEB)
Bonneau, L
2003-11-01
A lot of experimental data on nuclear fission has been being collected for the last 65 years, allowing theoreticians to confront their models with reality. The first part of this work is dedicated to the computation of fission barriers. We have extended the HF + BCS (Hartree Fock + Bandeen-Cooper-Schrieffer) method in order to include a new set of polynomials on which wave functions can be broken to, more accurately than on Hermite's polynomials in the 2 fragment configuration. The fission barriers of 26 heavy nuclei from Thorium-230 to Nobelium-256 have been assessed and compared to experimental data, it appears that differences are no greater than 1 MeV. We have discovered a neat correlation between the variation of the experimental fission lifetimes of even Fermium isotopes and the computed heights of second barriers. Moreover our model reproduces the hyper-deformed well of Thorium-230 with a good agreement on the well depth. The second part deals with the scission region. We have performed Hartree-Fock calculations in order to explore different ways of fragmentation. We have shown that the harmonic oscillator gives a valid description of such ways. In order to compute the mean value of J{sup 2} in the fragments we have been driven to propose an adequate definition of that quantity consistent with the non-locality property of the J{sup 2} operator. (A.C.)
Gravitational fragmentation caught in the act: the filamentary Musca molecular cloud
Kainulainen, J.; Hacar, A.; Alves, J.; Beuther, H.; Bouy, H.; Tafalla, M.
2016-02-01
Context. Filamentary structures are common in molecular clouds. Explaining how they fragment to dense cores is a missing step in understanding their role in star formation. Aims: We perform a case study of whether low-mass filaments are close to hydrostatic prior to their fragmentation, and whether their fragmentation agrees with gravitational fragmentation models. To accomplish this, we study the ~6.5 pc long Musca molecular cloud, which is an ideal candidate for a filament at an early stage of fragmentation. Methods: We employ dust extinction mapping, in conjunction with near-infrared JHKS-band data from the CTIO/NEWFIRM instrument, and 870 μm dust continuum emission data from the APEX/LABOCA instrument to estimate column densities in Musca. We use the data to identify fragments from the cloud and to determine the radial density distribution of its filamentary part. We compare the cloud's morphology with 13CO and C18O line emission observed with the APEX/SHeFI instrument. Results: The Musca cloud is pronouncedly fragmented at its ends, but harbors a remarkably well-defined, ~1.6 pc long filament in its center region. The line mass of the filament is 21-31 M⊙ pc-1 and the full width at half maximum (FWHM) 0.07 pc. The radial profile of the filament can be fitted with a Plummer profile, which has the power-index of 2.6 ± 11% and is flatter than that of an infinite hydrostatic filament. The profile can also be fitted with a hydrostatic cylinder truncated by external pressure. These models imply a central density of ~5-10 × 104 cm-3. The fragments in the cloud have a mean separation of ~0.4 pc, in agreement with gravitational fragmentation. These properties, together with the subsonic and velocity-coherent nature of the cloud, suggest a scenario in which an initially hydrostatic cloud is currently gravitationally fragmenting. The fragmentation started a few tenths of a Myr ago from the ends of the cloud, leaving its center still relatively nonfragmented
Reframing landscape fragmentation's effects on ecosystem services.
Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R
2015-04-01
Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fragment Size Distribution of Blasted Rock Mass
Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris
2017-12-01
Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.
Fragmented medial coronoid process
International Nuclear Information System (INIS)
Juhasz, Cs.; Juhasz, T.
1997-01-01
Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established
International Nuclear Information System (INIS)
Alberts, W.G.; Dietz, E.; Guldbakke, S.; Kluge, H.; Schumacher, H.
1988-04-01
This report describes the irradiation conditions and procedures of Part II of an international intercomparison of tissue-equivalent proportional counters used for radiation protection measurements. The irradiations took place in monoenergetic reference neutron fields produced by the research reactor and accelerator facilities of the PTB Braunschweig in the range from thermal neutrons to 14.8 MeV. In addition measurements were performed in 60 Co and D 2 O-moderated 252 Cf radiation fields. Prototype instruments from 7 European groups were investigated. The results of the measurements are summarized and compared with the reference data of the irradiations. (orig.) [de
Cheruvallath, Zacharia; Tang, Mingnam; McBride, Christopher; Komandla, Mallareddy; Miura, Joanne; Ton-Nu, Thu; Erikson, Phil; Feng, Jun; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase 2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. Pre-clinical and clinical studies suggest that MetAP2 inhibitors could be used as a novel treatment for obesity. Herein we describe our use of fragment screening methods and structural biology to quickly identify and elaborate an indazole fragment into a series of reversible MetAP2 inhibitors with <10nM potency, excellent selectivity, and favorable in vitro safety profiles. Copyright © 2016 Elsevier Ltd. All rights reserved.
Influence of primary fragment excitation energy and spin distributions on fission observables
Litaize, Olivier; Thulliez, Loïc; Serot, Olivier; Chebboubi, Abdelaziz; Tamagno, Pierre
2018-03-01
Fission observables in the case of 252Cf(sf) are investigated by exploring several models involved in the excitation energy sharing and spin-parity assignment between primary fission fragments. In a first step the parameters used in the FIFRELIN Monte Carlo code "reference route" are presented: two parameters for the mass dependent temperature ratio law and two constant spin cut-off parameters for light and heavy fragment groups respectively. These parameters determine the initial fragment entry zone in excitation energy and spin-parity (E*, Jπ). They are chosen to reproduce the light and heavy average prompt neutron multiplicities. When these target observables are achieved all other fission observables can be predicted. We show here the influence of input parameters on the saw-tooth curve and we discuss the influence of a mass and energy-dependent spin cut-off model on gamma-rays related fission observables. The part of the model involving level densities, neutron transmission coefficients or photon strength functions remains unchanged.
A fragment of alpha-actinin promotes monocyte/macrophage maturation in vitro.
Luikart, S; Wahl, D; Hinkel, T; Masri, M; Oegema, T
1999-02-01
Conditioned media (CM) from cultures of HL-60 myeloid leukemia cells grown on extracellular bone marrow matrix contains a factor that induces macrophage-like maturation of HL-60 cells. This factor was purified from the CM of HL-60 cells grown on bone marrow stroma by ammonium sulfate precipitation, then sequential chromatography on DEAE, affi-gel blue affinity, gel exclusion, and wheat germ affinity columns, followed by C-4 reverse phase HPLC, and SDS-PAGE. The maturation promoting activity of the CM was identified in a single 31 kD protein. Amino acid sequence analysis of four internal tryptic peptides of this protein confirmed significant homology with amino acid residues 48-60, 138-147, 215-220, and 221-236 of human cytoskeletal alpha-actinin. An immunoaffinity purified rabbit polyclonal anti-chicken alpha-actinin inhibited the activity of HL-60 conditioned media. A 27 kD amino-terminal fragment of alpha-actinin produced by thermolysin digestion of chicken gizzard alpha-actinin, but not intact alpha-actinin, had maturation promoting activity on several cell types, including blood monocytes, as measured by lysozyme secretion and tartrate-resistant acid phosphatase staining. We conclude that an extracellular alpha-actinin fragment can promote monocyte/macrophage maturation. This represents the first example of a fragment of a cytoskeletal component, which may be released during tissue remodeling and repair, playing a role in phagocyte maturation.
Effects of Habitat Fragmentation on Genetic Diversity in Cycas Balansae (Cycadaceae
Directory of Open Access Journals (Sweden)
Nguyen Minh Tam
2017-11-01
Full Text Available Habitat fragmentation is a serious threat to species survival. In Vietnam, Cycas balansae has been considered as threatened species because of the reduction and fragmentation of its habitats and over-exploitation. We assessed genetic variability and the pattern of population structure among six populations sampled in four provinces: Hoa Binh, Ha Nam, Ninh Binh and Quang Ninh. Polyacrylamide gel electrophoresis was performed on leaf tissues from 152 individuals representing 6 populations of C. balansae. Six of twelve enzyme systems were used to estimate genetic diversity at population and species levels. Eleven loci were examined. The allozyme data showed high levels of genetic diversity within all populations, ranging from 0.538 in Ba Sao to 0.628 in Tan Dan (average 0.576. The maintenance of high levels of expected heterozygosity (average 0.571 and low in observed heterozygosity (average 0.347 might be related to great heterozygote deficiency and increased frequencies of rare alleles. Genetic differentiation among populations was low (Dst = 0.036 and Gst = 0.064, indicating high level of gene flow (Nm = 3.22. Isolation by geographical distance was observed, however, no significant relationship between genetic distances and geographical distances was recorded. Our studies suggest small population sizes of cycads brought about by fragmentation of its habitats, over-exploitation, and increasing number of inbred individuals within populations.
Medium-scale melt-sodium fragmentation experiments
International Nuclear Information System (INIS)
Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.
1979-01-01
The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments
Dual Fragment Impact of PBX Charges
Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team
2017-06-01
Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.
International Nuclear Information System (INIS)
Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James
2014-01-01
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Energy Technology Data Exchange (ETDEWEB)
Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)
2014-04-10
In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.
Gallstone fragmentation by control electrohydraulic lithotripsy
International Nuclear Information System (INIS)
Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.
1989-01-01
The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy
Acoustic radiation force due to arbitrary incident fields on spherical particles in soft tissue
Energy Technology Data Exchange (ETDEWEB)
Treweek, Benjamin C., E-mail: btreweek@utexas.edu; Ilinskii, Yurii A.; Zabolotskaya, Evgenia A.; Hamilton, Mark F. [Applied Research Laboratories, The University of Texas at Austin, P.O. Box 8029, Austin, TX 78713-8029 (United States)
2015-10-28
Acoustic radiation force is of interest in a wide variety of biomedical applications ranging from tissue characterization (e.g. elastography) to tissue treatment (e.g. high intensity focused ultrasound, kidney stone fragment removal). As tissue mechanical properties are reliable indicators of tissue health, the former is the focus of the present contribution. This is accomplished through an investigation of the acoustic radiation force on a spherical scatterer embedded in tissue. Properties of both the scatterer and the surrounding tissue are important in determining the magnitude and the direction of the force. As these properties vary, the force computation shows changes in magnitude and direction, which may enable more accurate noninvasive determination of tissue properties.
On the fragmentation of filaments in a molecular cloud simulation
Chira, R.-A.; Kainulainen, J.; Ibáñez-Mejía, J. C.; Henning, Th.; Mac Low, M.-M.
2018-03-01
Context. The fragmentation of filaments in molecular clouds has attracted a lot of attention recently as there seems to be a close relation between the evolution of filaments and star formation. The study of the fragmentation process has been motivated by simple analytical models. However, only a few comprehensive studies have analysed the evolution of filaments using numerical simulations where the filaments form self-consistently as part of large-scale molecular cloud evolution. Aim. We address the early evolution of parsec-scale filaments that form within individual clouds. In particular, we focus on three questions: How do the line masses of filaments evolve? How and when do the filaments fragment? How does the fragmentation relate to the line masses of the filaments? Methods: We examine three simulated molecular clouds formed in kiloparsec-scale numerical simulations performed with the FLASH adaptive mesh refinement magnetohydrodynamic code. The simulations model a self-gravitating, magnetised, stratified, supernova-driven interstellar medium, including photoelectric heating and radiative cooling. We follow the evolution of the clouds for 6 Myr from the time self-gravity starts to act. We identify filaments using the DisPerSe algorithm, and compare the results to other filament-finding algorithms. We determine the properties of the identified filaments and compare them with the predictions of analytic filament stability models. Results: The average line masses of the identified filaments, as well as the fraction of mass in filamentary structures, increases fairly continuously after the onset of self-gravity. The filaments show fragmentation starting relatively early: the first fragments appear when the line masses lie well below the critical line mass of Ostriker's isolated hydrostatic equilibrium solution ( 16 M⊙ pc-1), commonly used as a fragmentation criterion. The average line masses of filaments identified in three-dimensional volume density cubes
Fragmentation functions approach in pQCD fragmentation phenomena
International Nuclear Information System (INIS)
Rolli, S.
1996-07-01
Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines
Divide and conquer: intermediate levels of population fragmentation maximize cultural accumulation.
Derex, Maxime; Perreault, Charles; Boyd, Robert
2018-04-05
Identifying the determinants of cumulative cultural evolution is a key issue in the interdisciplinary field of cultural evolution. A widely held view is that large and well-connected social networks facilitate cumulative cultural evolution because they promote the spread of useful cultural traits and prevent the loss of cultural knowledge through factors such as drift. This view stems from models that focus on the transmission of cultural information, without considering how new cultural traits actually arise. In this paper, we review the literature from various fields that suggest that, under some circumstances, increased connectedness can decrease cultural diversity and reduce innovation rates. Incorporating this idea into an agent-based model, we explore the effect of population fragmentation on cumulative culture and show that, for a given population size, there exists an intermediate level of population fragmentation that maximizes the rate of cumulative cultural evolution. This result is explained by the fact that fully connected, non-fragmented populations are able to maintain complex cultural traits but produce insufficient variation and so lack the cultural diversity required to produce highly complex cultural traits. Conversely, highly fragmented populations produce a variety of cultural traits but cannot maintain complex ones. In populations with intermediate levels of fragmentation, cultural loss and cultural diversity are balanced in a way that maximizes cultural complexity. Our results suggest that population structure needs to be taken into account when investigating the relationship between demography and cumulative culture.This article is part of the theme issue 'Bridging cultural gaps: interdisciplinary studies in human cultural evolution'. © 2018 The Author(s).
Fragmentation of neck-like structures
International Nuclear Information System (INIS)
Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI
1994-01-01
Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)
International Nuclear Information System (INIS)
Nygren, A.; Bergman, T.; Matthews, T.; Joernvall, H.; Wigzell, H.
1988-01-01
Iodine-125-labeled gp120 (120-kDa envelope glycoprotein) from the BH10 isolate of human immunodeficiency virus is cleaved to a limited extend with the glutamate-specific protease from Staphylococcus aureus. After disulfide bond reduction, fragments with approximate molecular masses of 95, 60, 50, and 25 kDa are produced. Tests for binding to CD4-positive cells show that only two fragments, the 95- and 25- kDa peptides, are observed in cleavage products that retain the selective binding capacity of gp120. Radiosequence analysis of the fragments after sodium dodecyl sulfate/polyacrylamide gel electrophoresis and electroblotting demonstrates that the 95-kDa fragment lacks the N-terminal region of gp120 and starts at position 143 of the mature envelope protein. The 50-kDa fragment starts at the same position. The 25-kDa binding fragment was similarly deduced to be generated as a small fragment from a cleavage site in the C-terminal part of gp120. The identifications of these fragments demonstrate that radiosequence analysis utilizing 125 I-labeled tyrosine residues can function as a useful and reliable method for small-scale determination of cleavage sites in proteins. Combined, the data suggest domain-like subdivisions of gp120, define at least two intervening segments especially sensitive to proteolytic cleavage, and demonstrate the presence of a functional region for receptor binding in the C-terminal part of the molecule
Directory of Open Access Journals (Sweden)
Paula Eveline Ribeiro D’Anunciação
2013-01-01
Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.
Non-invasive examination of a skull fragment recovered from a World War Two aircraft crash site.
Gapert, René; Rieder, Kurt
2013-09-01
The discovery of human remains dating to the time of the Second World War is a common occurrence in Europe and the Pacific regions. This case report demonstrates the analysis of a bone fragment recovered from a Luftwaffe crash site in Austria during the summer of 2007. Eye-witness statements and official reports were used to reconstruct the historical background of the case. A recovered German military identity tag helped to identify the pilot. Aircraft parts, also discovered at the crash site in 2007, aided the identification of the aircraft type and corroborated the eye-witness reports of the final moments before and during the crash. The bone was analyzed chiefly to establish its human or non-human origin and to identify from which anatomic region the fragment could have arisen. It was identified as part of a human adult skull which exhibited peri-mortem fractures and heat damage as well as post-mortem vegetation staining. The historical background information in connection with the morphological analysis led to the presumptive identification of the cranial fragment as belonging to a downed German pilot.
McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
A. E. Karateev
2015-01-01
Full Text Available Rheumatic diseases of juxta-articular soft tissues (RDJAST (tendinitis, tenosynovitis, bursitis, etc. are one of the most common causes of disability and one the most common reasons for seeking medical advice. To manage patients with RDJAST is an important part of practising rheumatologists’ work. But unfortunately, the issues of diagnosis and therapy of this pathology have been relatively rarely discussed on the pages of Russian medical journals and at the scientific congresses and conferences of rheumatologists in recent years. This review is to refresh physicians’interest in this problem. Part 1 of this review briefly considers the general issues relating to the epidemiology, pathogenesis, and diagnosis of RDJAST of the upper extremity, such as rotator cuff tendinitis, lateral and medial epicondylitis, stenosing flexor tenosynovitis, de Quervain’s syndrome, and carpal tunnel syndrome.
Fragmentation of Ceramics in Rapid Expansion Mode
Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan
The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.
International Nuclear Information System (INIS)
Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin
1990-01-01
The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)
The formation of planets by disc fragmentation
Directory of Open Access Journals (Sweden)
Stamatellos Dimitris
2013-04-01
Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.
Extraction of 16th Century Calender Fragments
DEFF Research Database (Denmark)
Holck, Jakob Povl; Etheridge, Christian
at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....
Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E
2017-02-01
A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.
Fluctuations in the fragmentation process
International Nuclear Information System (INIS)
Botet, R.; Ploszajczak, M.
1993-01-01
Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs
The spectroscopy of fission fragments
International Nuclear Information System (INIS)
Phillips, W.R.
1998-01-01
High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)
[Fragment-based drug discovery: concept and aim].
Tanaka, Daisuke
2010-03-01
Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.
Energy Technology Data Exchange (ETDEWEB)
Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor
2001-09-15
We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.
Tylosin depletion in edible tissues of turkeys.
Montesissa, C; De Liguoro, M; Santi, A; Capolongo, F; Biancotto, G
1999-10-01
The depletion of tylosin residues in edible turkey tissues was followed after 3 days of administration of tylosin tartrate at 500 mg l-1 in drinking water, to 30 turkeys. Immediately after the end of the treatment (day 0) and at day 1, 3, 5 and 10 of withdrawal, six turkeys (three males and three females) per time were sacrificed and samples of edible tissues were collected. Tissue homogenates were extracted, purified and analysed by HPLC according to a method previously published for the analysis of tylosin residues in pig tissues. In all tissues, tylosin residues were already below the detection limits of 50 micrograms kg-1 at time zero. However, in several samples of tissues (skin + fat, liver, kidney, muscle), from the six turkeys sacrificed at that time, one peak corresponding to an unknown tylosin equivalent was detected at measurable concentrations. The identification of this unknown compound was performed by LC-MS/MS analysis of the extracts from incurred samples. The mass fragmentation of the compound was consistent with the structure of tylosin D (the alcoholic derivative of tylosin A), the major metabolite of tylosin previously recovered and identified in tissues and/or excreta from treated chickens, cattle and pigs.
Velocity distribution of fragments of catastrophic impacts
Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi
1992-01-01
Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator
Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.
2018-04-01
The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.
Computational identification of antigen-binding antibody fragments.
Burkovitz, Anat; Leiderman, Olga; Sela-Culang, Inbal; Byk, Gerardo; Ofran, Yanay
2013-03-01
Determining which parts of the Ab are essential for Ag recognition and binding is crucial for understanding B cell-mediated immunity. Identification of fragments of Abs that maintain specificity to the Ag will also allow for the development of improved Ab-based therapy and diagnostics. In this article, we show that structural analysis of Ab-Ag complexes reveals which fragments of the Ab may bind the Ag on their own. In particular, it is possible to predict whether a given CDR is likely to bind the Ag as a peptide by analyzing the energetic contribution of each CDR to Ag binding and by assessing to what extent the interaction between that CDR and the Ag depends on other CDRs. To demonstrate this, we analyzed five Ab-Ag complexes and predicted for each of them which of the CDRs may bind the Ag on its own as a peptide. We then show that these predictions are in agreement with our experimental analysis and with previously published experimental results. These findings promote our understanding of the modular nature of Ab-Ag interactions and lay the foundation for the rational design of active CDR-derived peptides.
Current fragmentation in deep inelastic scattering
International Nuclear Information System (INIS)
Hamer, C.J.
1975-04-01
It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)
Fragment emission from modestly excited nuclear systems
Energy Technology Data Exchange (ETDEWEB)
Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.
1996-07-08
Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).
The spectroscopy of fission fragments
Energy Technology Data Exchange (ETDEWEB)
Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)
1998-12-31
High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.
Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T
2018-06-01
To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically
Dynamics of tissue topology during cancer invasion and metastasis
International Nuclear Information System (INIS)
Munn, Lance L
2013-01-01
During tumor progression, cancer cells mix with other cell populations including epithelial and endothelial cells. Although potentially important clinically as well as for our understanding of basic tumor biology, the process of mixing is largely a mystery. Furthermore, there is no rigorous, analytical measure available for quantifying the mixing of compartments within a tumor. I present here a mathematical model of tissue repair and tumor growth based on collective cell migration that simulates a wide range of observed tumor behaviors with correct tissue compartmentalization and connectivity. The resulting dynamics are analyzed in light of the Euler characteristic number (χ), which describes key topological features such as fragmentation, looping and cavities. The analysis predicts a number of regimes in which the cancer cells can encapsulate normal tissue, form a co-interdigitating mass, or become fragmented and encapsulated by endothelial or epithelial structures. Key processes that affect the topological changes are the production of provisional matrix in the tumor, and the migration of endothelial or epithelial cells on this matrix. Furthermore, the simulations predict that topological changes during tumor invasion into blood vessels may contribute to metastasis. The topological analysis outlined here could be useful for tumor diagnosis or monitoring response to therapy and would only require high resolution, 3D image data to resolve and track the various cell compartments. (paper)
Dynamics of tissue topology during cancer invasion and metastasis
Munn, Lance L.
2013-12-01
During tumor progression, cancer cells mix with other cell populations including epithelial and endothelial cells. Although potentially important clinically as well as for our understanding of basic tumor biology, the process of mixing is largely a mystery. Furthermore, there is no rigorous, analytical measure available for quantifying the mixing of compartments within a tumor. I present here a mathematical model of tissue repair and tumor growth based on collective cell migration that simulates a wide range of observed tumor behaviors with correct tissue compartmentalization and connectivity. The resulting dynamics are analyzed in light of the Euler characteristic number (χ), which describes key topological features such as fragmentation, looping and cavities. The analysis predicts a number of regimes in which the cancer cells can encapsulate normal tissue, form a co-interdigitating mass, or become fragmented and encapsulated by endothelial or epithelial structures. Key processes that affect the topological changes are the production of provisional matrix in the tumor, and the migration of endothelial or epithelial cells on this matrix. Furthermore, the simulations predict that topological changes during tumor invasion into blood vessels may contribute to metastasis. The topological analysis outlined here could be useful for tumor diagnosis or monitoring response to therapy and would only require high resolution, 3D image data to resolve and track the various cell compartments.
Avinash, Alok; Dubey, Alok; Singh, Rajeev Kumar; Prasad, Swati
2014-01-01
Dental fractures of the permanent maxillary anterior teeth are relatively frequent accidents during childhood. The Efficient diagnosis and treatment of dental injury are important elements in clinical dentistry. This article describes a case of trauma in permanent right central maxillary incisors with tooth fragments embedded in the lower lip. Thorough clinical examination followed by soft tissue radiographs confirmed the presence of a fractured incisal fragment, which was surgically retrieved under local anesthesia. Direct composite restoration was placed. After finishing and polishing, an esthetic and natural-looking restoration was achieved; this completely satisfied the functional and esthetic expectation of the patient and dental team. How to cite this article: Avinash A, Dubey A, Singh RK, Prasad S. Surgical Removal of Coronal Fragment of Tooth Embedded in Lower Lip and Esthetic Management of Fractured Crown Segment. Int J Clin Pediatr Dent 2014;7(1):65-68.
Fission of heavy nuclei: microscopic study of fission barriers and fragments angular momentum
International Nuclear Information System (INIS)
Bonneau, L.
2003-11-01
A lot of experimental data on nuclear fission has been being collected for the last 65 years, allowing theoreticians to confront their models with reality. The first part of this work is dedicated to the computation of fission barriers. We have extended the HF + BCS (Hartree Fock + Bandeen-Cooper-Schrieffer) method in order to include a new set of polynomials on which wave functions can be broken to, more accurately than on Hermite's polynomials in the 2 fragment configuration. The fission barriers of 26 heavy nuclei from Thorium-230 to Nobelium-256 have been assessed and compared to experimental data, it appears that differences are no greater than 1 MeV. We have discovered a neat correlation between the variation of the experimental fission lifetimes of even Fermium isotopes and the computed heights of second barriers. Moreover our model reproduces the hyper-deformed well of Thorium-230 with a good agreement on the well depth. The second part deals with the scission region. We have performed Hartree-Fock calculations in order to explore different ways of fragmentation. We have shown that the harmonic oscillator gives a valid description of such ways. In order to compute the mean value of J 2 in the fragments we have been driven to propose an adequate definition of that quantity consistent with the non-locality property of the J 2 operator. (A.C.)
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
International Nuclear Information System (INIS)
Al-Gubory, Kais H.
2005-01-01
The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals
Fragger: a protein fragment picker for structural queries.
Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J
2017-01-01
Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.
Ligand deconstruction: Why some fragment binding positions are conserved and others are not
Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor
2015-01-01
Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377
Ligand deconstruction: Why some fragment binding positions are conserved and others are not.
Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor
2015-05-19
Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.
Liaw, Lucy; Prudovsky, Igor; Koza, Robert A.; Anunciado-Koza, Rea V.; Siviski, Matthew E.; Lindner, Volkhard; Friesel, Robert E.; Rosen, Clifford J.; Baker, Paul R.S.; Simons, Brigitte; Vary, Calvin P.H.
2016-01-01
Our objective was to characterize lipid profiles in cell models of adipocyte differentiation in comparison to mouse adipose tissues in vivo. A novel lipid extraction strategy was combined with global lipid profiling using direct infusion and sequential precursor ion fragmentation, termed MS/MSALL. Perirenal and inguinal white adipose tissue and interscapular brown adipose tissues from adult C57BL/6J mice were analyzed. 3T3-L1 preadipocytes, ear mesenchymal progenitor cells, and brown adipose-...
International Nuclear Information System (INIS)
Phulpin, Berengere
2011-01-01
Radiation therapy induced acute and late sequelae within healthy tissue included in the irradiated area. In general, lesions are characterized by ischemia, cell apoptosis and fibrosis. In this context, cell therapy using bone marrow mesenchymal stem cells (BMSC) might represent an attractive new therapeutic approach, based partly on their angiogenic ability and their involvement in the natural processes of tissue repair. The first part of this work consisted in the development of experimental mouse model of radio-induced tissue degeneration similar to that occurring after radiotherapy. The aim was to better understand the physiopathological mechanisms of radiation-induced tissue damage and to determine the best treatment strategy. The second part of this work investigated the feasibility of autologous BMSC therapy on the murine model of radiation previously established with emphasis on two pre-requisites: the retention of the injected cells within the target tissue and the evaluation of the graft on bone metabolism. This preclinical investigation in a mouse model constitutes an essential step allowing an evaluation of the benefit of cell therapy for the treatment of radiation-induced tissue injury. Data from these studies could allow the proposal of clinical studies [fr
Kaon fragmentation function from NJL-jet model
International Nuclear Information System (INIS)
Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang
2010-01-01
The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.
Fragmentation of rotating protostellar clouds
International Nuclear Information System (INIS)
Tohline, J.E.
1980-01-01
We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution
Fragment-based approaches to TB drugs.
Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris
2018-02-01
Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.
Li, M.; Zhu, Z.; Vogelmann, James E.; Xu, D.; Wen, W.; Liu, A.
2011-01-01
Tropical and subtropical forests provide important ecosystem goods and services including carbon sequestration and biodiversity conservation. These forests are facing increasing socioeconomic pressures and are rapidly being degraded and fragmented. This analysis focuses on the rate of change and patterns of fragmentation in a collective forest area in Zhejiang province, China, during the time period 1988–2005. The research consisted of two parts. The first was the development of general land cover maps and the identification of land cover changes by interpreting Landsat Thematic Mapper (TM) and Enhanced Thematic Mapper Plus (ETM+) time series imagery. The second part involved the computation and analysis of forest fragmentation metrics. For this portion of the study, fragmentation statistics were analyzed, and images were developed to depict forest fragmentation patterns and trends. Results revealed that there was a net loss of 7.8% in forest coverage, dropping from 66.8% in 1988 to 59.0% in 2005, primarily caused by agricultural expansion and poor forest management practices. An acceleration of forest fragmentation was also witnessed during the time intervals, which was evidenced by a decreasing trend in interior forest (57.2% in 1988, 55.0% in 1996 and 54.8% in 2005 respectively) coupled with the scales of the selected geospatial metrics. Continued forest loss and fragmentation are closely correlated with the existing political, educational, institutional and economic processes of contemporary China. To unlock the developmental potentials of the collective forests and to effectively mitigate the rate of forest loss and fragmentation, reforms of forest tenure and ecological immigration practices are recognized as a prospective alternative. The produced fragmentation maps further illustrates the importance of assessing landscape change history, especially the spatiotemporal patterns of forest fragments, when developing landscape level plans for biodiversity
Energy Technology Data Exchange (ETDEWEB)
Bonneau, L
2003-11-01
A lot of experimental data on nuclear fission has been being collected for the last 65 years, allowing theoreticians to confront their models with reality. The first part of this work is dedicated to the computation of fission barriers. We have extended the HF + BCS (Hartree Fock + Bandeen-Cooper-Schrieffer) method in order to include a new set of polynomials on which wave functions can be broken to, more accurately than on Hermite's polynomials in the 2 fragment configuration. The fission barriers of 26 heavy nuclei from Thorium-230 to Nobelium-256 have been assessed and compared to experimental data, it appears that differences are no greater than 1 MeV. We have discovered a neat correlation between the variation of the experimental fission lifetimes of even Fermium isotopes and the computed heights of second barriers. Moreover our model reproduces the hyper-deformed well of Thorium-230 with a good agreement on the well depth. The second part deals with the scission region. We have performed Hartree-Fock calculations in order to explore different ways of fragmentation. We have shown that the harmonic oscillator gives a valid description of such ways. In order to compute the mean value of J{sup 2} in the fragments we have been driven to propose an adequate definition of that quantity consistent with the non-locality property of the J{sup 2} operator. (A.C.)
The Zero-Degree Detector system for fragmentation studies
International Nuclear Information System (INIS)
Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.
2007-01-01
The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan
Klinge, R Furseth; Dean, M C; Risnes, S; Erambert, M; Gunnaes, A E
2009-01-01
The aim of this study was to explore further the preservation of tissues and the mineral distribution in 1.6 million-year-old fossil hominin material from Koobi Fora, Kenya attributed to Paranthropus boisei (KNM-ER 1817). Bone, dentine and cementum microstructure were well preserved. Electron microprobe analysis of dentine and bone revealed an F-bearing apatite. Calcite now filled the original soft tissue spaces. The average Ca/P atomic ratio was 1.93, as compared to 1.67 in biological hydroxyapatite, indicating that the Ca-content had increased during fossilization. Analytical sums for mineral content were approximately 90 wt%. Some of the remaining 10 wt% may be preserved organic material. Demineralized dentine fragments showed irregularly distributed tubules encircled with a fibrous-like electron-dense material. A similar material was observed in demineralized dentine. Within this, structures resembling bacteria were seen. In demineralized bone an electron-dense material with a fibrous appearance and a banding pattern that repeated every 64 nm, similar to that of collagen, was noted. SEM of an enamel fragment (KNM-ER 6081) showed signs of demineralization/remineralization. Retzius lines, Hunter-Schreger bands and prism cross-striations spaced 3.7-7.1.microm apart were noted. Prisms were arranged in a pattern 3 configuration and deeper areas containing aprismatic enamel were occasionally observed. We conclude that a great deal of informative microstructure and ultrastructure remains preserved in this fossil material. We also hypothesize that the high mineral content of the tissues may 'protect' parts of the organic matrix from degradation, since our findings indicate that some organic matrix may still be present. Copyright (c) 2009 S. Karger AG, Basel.
Introduction to fragment-based drug discovery.
Erlanson, Daniel A
2012-01-01
Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.
Lutz, David; Wolters-Eisfeld, Gerrit; Joshi, Gunjan; Djogo, Nevena; Jakovcevski, Igor; Schachner, Melitta; Kleene, Ralf
2012-01-01
The functions of the cell adhesion molecule L1 in the developing and adult nervous system are triggered by homophilic and heterophilic interactions that stimulate signal transductions that activate cellular responses. Here, we show that stimulation of signaling by function-triggering L1 antibodies or L1-Fc leads to serine protease-dependent cleavage of full-length L1 at the plasma membrane and generation of a sumoylated transmembrane 70-kDa fragment comprising the intracellular and transmembrane domains and part of the extracellular domain. The 70-kDa transmembrane fragment is transported from the plasma membrane to a late endosomal compartment, released from endosomal membranes into the cytoplasm, and transferred from there into the nucleus by a pathway that depends on importin and chromatin-modifying protein 1. Mutation of the sumoylation site at Lys1172 or of the nuclear localization signal at Lys1147 abolished L1-stimulated generation or nuclear import of the 70-kDa fragment, respectively. Nuclear import of the 70-kDa fragment may activate cellular responses in parallel or in association with phosphorylation-dependent signaling pathways. Alterations in the levels of the 70-kDa fragment during development and in the adult after spinal cord injury or in a mouse model of Alzheimer disease suggest that this fragment is functionally implicated in development, regeneration, neurodegeneration, tumorigenesis, and possibly synaptic plasticity in the mature nervous system. PMID:22431726
Quark fragmentation in e+e- collisions
International Nuclear Information System (INIS)
Oddone, P.
1984-12-01
This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman
Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator
International Nuclear Information System (INIS)
Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.
1993-10-01
Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
DEFF Research Database (Denmark)
Bang, Jacob Sebastian
2018-01-01
I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....
Chemical Production using Fission Fragments
International Nuclear Information System (INIS)
Dawson, J. K.; Moseley, F.
1960-01-01
Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr
The dynamics of fragment formation
International Nuclear Information System (INIS)
Keane, D.
1994-09-01
We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy
DEFF Research Database (Denmark)
Vassiliadis, Efstathios; Veidal, Sanne Skovgård; Simonsen, Henrik
2011-01-01
AIM: Liver fibrosis involves excessive remodeling and deposition of fibrillar extracellular matrix (ECM) components, which leads to malfunction of the organ, causing significant morbidity and mortality. The aim of this study was to assess whether levels of a type V collagen fragment, the propepti...
Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.
Warwicker, J; Ollis, D; Richards, F M; Steitz, T A
1985-12-05
The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.
Landscape responses of bats to habitat fragmentation in Atlantic forest of paraguay
Gorresen, P.M.; Willig, M.R.
2004-01-01
Understanding effects of habitat loss and fragmentation on populations or communities is critical to effective conservation and restoration. This is particularly important for bats because they provide vital services to ecosystems via pollination and seed dispersal, especially in tropical and subtropical habitats. Based on more than 1,000 h of survey during a 15-month period, we quantified species abundances and community structure of phyllostomid bats at 14 sites in a 3,000-km2 region of eastern Paraguay. Abundance was highest for Artibeus lituratus in deforested landscapes and for Chrotopterus auritus in forested habitats. In contrast, Artibeus fimbriatus, Carollia perspicillata, Glossophaga soricina, Platyrrhinus lineatus, Pygoderma bilabiatum, and Sturnira lilium attained highest abundance in moderately fragmented forest landscapes. Forest cover, patch size, and patch density frequently were associated with abundance of species. At the community level, species richness was highest in partly deforested landscapes, whereas evenness was greatest in forested habitat. In general, the highest diversity of bats occurred in landscapes comprising moderately fragmented forest habitat. This underscores the importance of remnant habitat patches to conservation strategies.
Radiosterilization of Tissues Preserved for Clinical Purposes: Effect on Tissue Antigenicity
International Nuclear Information System (INIS)
Ostrowski, K.; Kossowska, B.; Moskalewski, S.; Komender, A.; Kurnatowski, W.
1967-01-01
The first part of the paper contains practical considerations on the radiosterilization of preserved human bone, human and calf cartilage, cow’s fascia and aponeurosis, based on material from the Tissue Bank which produces about 2500 transplants yearly. The method of preservation and packing of each type of tissue is mentioned briefly. The preserved tissues are irradiated in a cobalt bomb or in a nuclear reactor. The conditions of irradiation and the control of sterility are described. The advantages and disadvantages of radiosterilization are discussed on the basis of the authors’ own experience and clinical reports of surgeons using radiosterilized tissues in practice. In the second part of the paper, experimental studies on the influence of freezing, lyophilization and radiosterilization on tissue antigenicity are reported. The regional lymph node reacts to an antigenic stimulus by an increased production of large, pyroninophylic cells, so-called ''blast'' cells. The rabbits used as recipients received grafts of allogeneic cancellous bone, fresh or subjected to different experimental procedures. Smears from lymph node cell suspension were prepared and the percentage of blast cells was estimated. On the basis of the lymph node response, it appears that freezing and lyophilization, as well as radiosterilization, may abolish the antigenicity of cancellous bone. The practical implication of these results for methods of preservation of tissues for clinical purposes is discussed. (author)
Hands as markers of fragmentation
Directory of Open Access Journals (Sweden)
A. Barnard
2005-07-01
Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.
International Nuclear Information System (INIS)
Silisteanu, I.
1991-06-01
The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs
2004-12-01
the absence of dilatation, aneurysm formation or neointimal hyperplasia . The 2003 report described the failure to provide appropriate carotid grafts...growth of fibrovascular tissue, sometimes accompanied by inflammatory cells and pigment-laden macrophages. Fragmentation of the umbilical vein...were also present within the device interstices. A fibrovascular stroma (all animals, mild to marked) was also noted within the lumen of the ePTFE
An Algebra for Program Fragments
DEFF Research Database (Denmark)
Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger
1985-01-01
Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...
Energy Technology Data Exchange (ETDEWEB)
Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-09-05
The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.
A model for projectile fragmentation
International Nuclear Information System (INIS)
Chaudhuri, G; Mallik, S; Gupta, S Das
2013-01-01
A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.
Gamma Radiation from Fission Fragments
International Nuclear Information System (INIS)
Higbie, Jack
1969-10-01
The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass
Gamma Radiation from Fission Fragments
Energy Technology Data Exchange (ETDEWEB)
Higbie, Jack
1969-10-15
The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.
Influences of gentrification on identity shift of an urban fragment: A case study
Directory of Open Access Journals (Sweden)
Nedučin Dejana
2009-01-01
Full Text Available This paper discusses the process of gentrification, researched through a perspective of its positive and negative aspects. It underlines the importance of reasonable proportioning, sensible structuring and long-term planning of transformation of urban spaces, which contributes to an upgrade of living conditions and qualitative advancement of social consciousness and development of needs of the local inhabitants, regardless of their socio-economic profile. Despite not perceiving gentrification as an a priori negative process, influences of alterations of urban tissue carried out through radical and narrowly interpreted modifications of their character may cause undesired changes in the perception and use of the space and were analyzed as well. A case study of the gentrification of Grbavica, an urban fragment in Novi Sad, Serbia, is presented. The goal of this research was to critically valorize the over-all transformation of the aforementioned fragment, taking into account architectural, urban, social, cultural, economic and other facets.
Lee, J R; Kim, H-J; Lee, K-B
2016-04-01
The femoral shaft fractures with large fragments makes anatomical reduction challenging and often results in non-union. In some studies, the degree of fragment displacement was reported to have affected non-union, but the association between the one fragment size and degree of displacement has not been fully clarified. Therefore we performed a retrospective study to assess: (1) the more influential factor of non-union: the degree of fragment displacement, or the fragment size? (2) the non-union rates according to different sizes and degrees of displacement. The degree of displacement is the more potent factor of non-union than the third fragment size in femoral shaft fractures. We assessed retrospectively 64 cases, which could be followed up for longer than one year. Fragments were divided according to the length of their long axis into three groups: group A (0-3.9cm), (n=21); group B (4-7.9cm), (n=22); group C (8cm or more), (n=21). Fragment displacement was also assessed in the proximal (P) or distal (D) end to the nearest cortex of the femoral shaft, and divided into the following groups: group P1 (n=44) or D1 (n=47), (0-9mm); group P2 (n=10) or D2 (n=11), (10-19mm); group P3 (n=7) or D3 (n=3), (20-29mm); and group P4 (n=3) or D4 (n=3), (30mm or more). The bone union rate was 86% in the small (less than 8cm) fragment groups and 71% in the large (8cm or more) fragment group (P=0.046). With respect to the degree of displacement, the union rate was lower (P=0.001) and the average union time was longer (P=0.012) in the 20mm or more group for both the proximal fragment part and the distal fragment part (P=0.002, P=0.014). A logistic regression analysis underlined the displacement in the proximal site (OR: 0.298, 95% CI: 0.118-0.750) as in the distal site (OR: 0.359, 95% CI: 0.162-0.793) as a larger effect on union rate than the fragment size that as no effect in logistic regression (OR 3.8, 95% CI: 0.669-21.6). Non-union develops significantly more frequently in
DEFF Research Database (Denmark)
Sumrein, Bakir O; Mattila, Ville M; Lepola, Vesa
2018-01-01
BACKGROUND: Optimal fracture classification should be simple and reproducible and should guide treatment. For proximal humeral fractures, the Neer classification is commonly used. However, intraobserver and interobserver reliability of the Neer classification has been shown to be poor. In clinical...... for interobserver reliability showed substantial correlation (0.61-0.73) and was as follows: 0.73 for radiographs alone, 0.61 for CT scans alone, and 0.72 for radiographs and CT scans viewed together. After 24 weeks, the process was repeated and intraobserver reliability was calculated.The κ coefficient...... for intraobserver reliability showed substantial correlation (0.62-0.75) and was as follows: 0.62 for radiographs alone, 0.64 for CT scans alone, and 0.75 for radiographs and CT scans viewed together. CONCLUSION: Clinicians were able to differentiate 2-part surgical neck fractures from multi-fragmented fractures...
Energy Technology Data Exchange (ETDEWEB)
Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)
2014-06-14
We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.
Remarks about the hypothesis of limiting fragmentation
International Nuclear Information System (INIS)
Chou, T.T.; Yang, C.N.
1987-01-01
Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs
Polarization and alignment of nucleus fission fragments
International Nuclear Information System (INIS)
Barabanov, A.L.; Grechukhin, D.P.
1987-01-01
Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists
Nuclear energy release from fragmentation
Energy Technology Data Exchange (ETDEWEB)
Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)
2016-08-15
It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.
''Normal'' tissues from humans exposed to radium contain an alteration in the c-mos locus
International Nuclear Information System (INIS)
Huberman, E.; Schlenker, R.A.; Hardwick, J.P.
1989-01-01
The structures of a number of human proto-oncogenes from persons with internal systemic exposure to radium were analyzed by restriction enzyme digestion and southern blotting of their DNA. Two extra c-mos Eco R1 restriction-fragment-length bands of 5.0 kb and 5.5 kb were found in tissue DNA from six of seven individuals. The extra c-mos bands were detected in DNA from many, but not all, of the tissues of the individuals exposed to radium. Our results suggest that the c-mos restriction-fragment-length alterations (RFLA) found in individuals exposed to radium were induced rather than inherited, are epigenetic in origin, and most likely result from changes in the methylation of bases surrounding the single exon of the c-mos proto-oncogene. 7 refs., 3 figs., 2 tabs
Dihadron fragmentation function and its evolution
International Nuclear Information System (INIS)
Majumder, A.; Wang Xinnian
2004-01-01
Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest
Fragment-Based Discovery of Pyrimido[1,2-b]indazole PDE10A Inhibitors.
Chino, Ayaka; Seo, Ryushi; Amano, Yasushi; Namatame, Ichiji; Hamaguchi, Wataru; Honbou, Kazuya; Mihara, Takuma; Yamazaki, Mayako; Tomishima, Masaki; Masuda, Naoyuki
2018-01-01
In this study, we report the identification of potent pyrimidoindazoles as phosphodiesterase10A (PDE10A) inhibitors by using the method of fragment-based drug discovery (FBDD). The pyrazolopyridine derivative 2 was found to be a fragment hit compound which could occupy a part of the binding site of PDE10A enzyme by using the method of the X-ray co-crystal structure analysis. On the basis of the crystal structure of compound 2 and PDE10A protein, a number of compounds were synthesized and evaluated, by means of structure-activity relationship (SAR) studies, which culminated in the discovery of a novel pyrimidoindazole derivative 13 having good physicochemical properties.
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
International Nuclear Information System (INIS)
Wilbur, D.S.; Hadley, S.W.; Grant, L.M.; Hylarides, M.D.
1991-01-01
A comparative investigation of the biodistributions of radioiodinated p- and m-iodobenzoyl conjugates of a monoclonal antibody Fab fragment, NR-LU-10 Fab, and the same antibody Fab fragment radioiodinated by the chloramine-T (ChT) method has been carried out in mice. Coinjected, dual-isotope studies in athymic mice with tumor xenografts have demonstrated that there are only minor differences in the in vivo distributions of the iodobenzoyl-labeled Fabs, except in the excretory organs, kidneys, and intestines, where major differences were observed. Similarly, coinjection of either the p-iodobenzoyl or m-iodobenzoyl conjugate of NR-LU-10 Fab with the Fab radioiodinated with ChT/radioiodide into BALB/c mice provided additional data that indicated that the two iodobenzoyl conjugates distributed similar in a number of selected tissues. The tissue-distribution differences of the regioisomeric iodobenzoyl conjugates in relation to the ChT-radioiodinated Fab were large for the stomach and neck, consistent with previous studies. The most notable difference between the two iodobenzoyl conjugates was the kidney activity, where the m-iodobenzoyl conjugate was similar to the directly labeled Fab, but the p-iodobenzoyl-conjugated Fab was higher by nearly a factor of 2
Radioisotopic method for the measurement of lipolysis in small samples of human adipose tissue
International Nuclear Information System (INIS)
Leibel, R.L.; Hirsch, J.; Berry, E.M.; Gruen, R.K.
1984-01-01
To facilitate the study of adrenoreceptor response in small needle biopsy samples of human subcutaneous adipose tissue, we developed a dual radioisotopic technique for measuring lipolysis rate. Aliquots (20-75 mg) of adipose tissue fragments were incubated in a buffered albumin medium containing [ 3 H]palmitate and [ 14 C]glucose, each of high specific activity. In neutral glycerides synthesized in this system, [ 14 C]glucose is incorporated exclusively into the glyceride-glycerol moiety and 3 H appears solely in the esterified fatty acid. Alpha-2 and beta-1 adrenoreceptor activation of tissue incubated in this system does not alter rates of 14 C-labeled glyceride accumulation, but does produce a respective increase or decrease in the specific activity of fatty acids esterified into newly synthesized glycerides. This alteration in esterified fatty acid specific activity is reflected in the ratio of 14 C: 3 H in newly synthesized triglycerides extracted from the incubated adipose tissue. There is a high correlation (r . 0.90) between the 14 C: 3 H ratio in triglycerides and the rate of lipolysis as reflected in glycerol release into the incubation medium. The degree of adrenoreceptor activation by various concentrations of lipolytic and anti-lipolytic substances can be assessed by comparing this ratio in stimulated tissue to that characterizing unstimulated tissue or the incubation medium. This technique permits the study of very small, unweighed tissue biopsy fragments, the only limitation on sensitivity being the specific activity of the medium glucose and palmitate. It is, therefore, useful for serial examinations of adipose tissue adrenoreceptor dose-response characteristics under a variety of clinical circumstances
Evolution equations for extended dihadron fragmentation functions
International Nuclear Information System (INIS)
Ceccopieri, F.A.; Bacchetta, A.
2007-03-01
We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)
Quantitative experimental modelling of fragmentation during explosive volcanism
Thordén Haug, Ø.; Galland, O.; Gisler, G.
2012-04-01
Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of
Impact failure and fragmentation properties of metals
Energy Technology Data Exchange (ETDEWEB)
Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)
1998-03-01
In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.
Fabresse, Nicolas; Allard, Julien; Sardaby, Marine; Thompson, Adrian; Clutton, R Eddie; Eddleston, Michael; Alvarez, Jean-Claude
2017-08-15
Clinical evaluation of a colchicine specific antigen-binding fragment (Fab) in order to treat colchicine poisoning required the development of an accurate method allowing quantification of free and Fab-bound colchicine in plasma and urine, and free colchicine in tissues, to measure colchicine redistribution after Fab administration. Three methods have been developed for this purpose, and validated in plasma, urine and liver: total colchicine was determined after denaturation of Fab by dilution in water and heating; free colchicine was separated from Fab-bound colchicine by filtration with 30KDa micro-filters; tissues were homogenized in a tissue mixer. Deuterated colchicine was used as internal standard. Samples were extracted by liquid-liquid extraction and analyzed with a LC-MS/MS. LOQ were 0.5ng/mL in plasma and urine for free and total colchicine and 5pg/mg in tissues. The methods were linear in the 0.5-100ng/mL range in plasma and urine, and 5-300pg/mg in tissues with determination coefficients>0.99. Precision and accuracy of QC samples presented a CVFab fragments. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparison of renal and osseous binding of parathyroid hormone and hormonal fragments
International Nuclear Information System (INIS)
Demay, M.; Mitchell, J.; Goltzman, D.
1985-01-01
The authors compared receptor binding and adenylate cyclase stimulation of intact bovine parathyroid hormone (bPTH)-(1-84) and the synthetic amino-terminal fragments, bPTH-(1-34) and rat PTH (rPTH)-(1-34). In both canine renal membranes and cloned rat osteosarcoma cells the amino-terminal fragments bound to a single order of sites; the affinity of rPTH-(1-34) exceeded that of bPTH-(1-34), correlating with its higher potency in stimulating adenylate cyclase. In studies with oxidized bPTH-(1--84), the middle and carboxyl regions of intact PTH were found to bind to both tissues but with higher affinity to osteosarcoma cells than to renal membranes. Our results demonstrate that rPTH-(1--34) is the most favorable probe of amino-terminal PTH binding and the most potent of the PTH peptides in stimulating renal and osseous adenylate cyclase. The results also show that midregion and carboxyl determinants within intact PTH contribute to hormone binding, which does not correlate with adenylate cyclase activation and appears more significant for skeletal than for renal binding
Predicting "Hot" and "Warm" Spots for Fragment Binding.
Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L
2017-05-11
Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .
Scaling and critical behaviour in nuclear fragmentation
International Nuclear Information System (INIS)
Campi, X.
1990-09-01
These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling
The politics of municipal fragmentation in Ghana
Directory of Open Access Journals (Sweden)
Abdulai Kuyini Mohammed
2015-06-01
Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.
Heart Rate Fragmentation: A Symbolic Dynamical Approach
Directory of Open Access Journals (Sweden)
Madalena D. Costa
2017-11-01
Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to
Baculovirus display of functional antibody Fab fragments.
Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki
2015-08-01
The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.
Target-fragment angular distributions for the interaction of 86 MeV/A 12C with 197Au
International Nuclear Information System (INIS)
Kraus, R.H. Jr.; Loveland, W.; McGaughey, P.L.; Seaborg, G.T.; Morita, Y.; Hageboe, E.; Haldorsen, I.R.; Sugihara, T.T.
1985-01-01
Target-fragment angular distributions were measured using radiochemical techniques for 69 different fragments (44 12 C with 197 Au. The angular distributions in the laboratory system are forward-peaked with some distributions also showing a backward peaking. The shapes of the laboratory system distributions were compared with the predictions of the nuclear firestreak model. The measured angular distributions differed markedly from the predictions of the firestreak model in most cases. This discrepancy could be due, in part, to overestimation of the transferred longitudinal momentum by the firestreak model, the assumption of isotropic angular distributions for fission and particle emission in the moving frame and incorrect assumptions about how the lightest (A 145) fragment distributions were symmetric about 90 0 . (orig.)
Molten aluminum alloy fuel fragmentation experiments
International Nuclear Information System (INIS)
Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.
1992-01-01
Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water
Simulations of High Speed Fragment Trajectories
Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis
2017-11-01
Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.
Energy Technology Data Exchange (ETDEWEB)
Filippo, E. de; Arena, N.; Cardella, G.; Lanzano, G.; Lanzalone, G.; Lo Nigro, S.; Pagano, A.; Papa, M.; Pirrone, S.; Politi, G. [Catania Univ., INFN Catania and Dipt. di Fisica e Astronomia (Italy); Alderighi, M.; Sechi, G. [INFN Milano and Ist. di Fisica Cosmica, CNR, Milano (Italy); Amorini, F.; Anzalone, A.; Baran, V.; Bonasera, A.; Cavallaro, S.; Colonna, M.; Di Toro, M.; Giustolisi, F.; Iacono Manno, M.; La Guidara, E.; Maiolino, C.; Porto, F.; Rizzo, F.; Russotto, P.; Sperduto, M.L. [Catania, Univ., INFN-LNS and Dipt. di Fisica e Astronomia (Italy); Auditore, L.; Trifiro, A.; Trimarchi, M. [Messina Univ., INFN and Dipt. di Fisica (Italy); Bartolucci, M.; Guazzoni, P.; Manfredi, G.; Petrovici, M.; Russo, S.; Zetta, L. [Milano Univ., INFN Milano and Dipt. di Fisica (Italy); Berceanu, I.; Paduszynski, T.; Pop, A.; Simion, V. [Inst. for Physics and Nuclear Engineering, Bucharest (Romania); Blicharska, J.; Grzeszczuk, A.; Kowalski, S.; Schmidt, K.; Zipper, W. [Univ. of Silesia, Inst. of Physics, Katowice (Poland); Brzychczyk, J.; Gawlikowicz, W.; Planeta, R. [Jagellonian Univ., M. Smoluchowski Inst. of Physics, Cracow (Poland); Borderie, B.; Le Neindre, N.; Rivet, M.F. [Paris-11 Univ., IPN, IN2P3-CNRS, 91 - Orsay (France); Bougault, R.; Steckmeyer, J.C. [Caen Univ., LPC, Ensi, 14 (France); Bruno, M.; D' Agostino, M.; Geraci, E.; Vannini, G. [Bologna Univ., INFN Bologna and Dipt. di Fisica (Italy); Chatterjee, M.B. [Saha Inst. Of Nuclear Physics, Kolkata (India); Chbihi, A.; Wieleczko, J.P. [GANIL, CEA, IN2P3-CNRS, 14 - Caen (France); Cibor, J. [H. Niewodniczanski Inst. of Nuclear Physics, Cracow (Poland); Dayras, R.; Majka, Z. [CEA Saclay, Dept. d' Astrophysique, de Physique des Particules, de Physique Nucleaire et de l' Instrumentation Associee, SPhN, 91- Gif sur Yvette (France); Piasecki, E.; Guinet, D.; Li, S.; Wu, H.; Xiao, Z.; Rosato, E.; Vigilante, M.; Siwek-Wilczynska, K.; Skwira, I.; Swiderski, L.; Wilczynski, J.
2003-07-01
The forward part of the 4{pi} CHIMERA detector is used to study the intermediate mass fragments (IMF) production in semi-peripheral collisions. A method is presented to disentangle intermediate mass fragments produced in the initial dynamical stage of the collision from the ones coming from sequential decay of a projectile-like or target-like sources. For these dynamical produced fragments also an iso-scaling analysis is presented. Comparison between theoretical Boltzmann Nordheim Vlasov simulations and experimental data suggests that a neck fragmentation mechanism in the overlapping zone between interacting projectile and target is at the origin of the fragments production. (authors)
DEFF Research Database (Denmark)
Jangö, Hanna; Gräs, Søren; Christensen, Lise
2017-01-01
INTRODUCTION AND HYPOTHESIS: Alternative approaches to reinforce the native tissue in patients with pelvic organ prolapse (POP) are needed to improve surgical outcome. Our aims were to develop a weakened abdominal wall in a rat model to mimic the weakened vaginal wall in women with POP and then e...... showed a significantly higher strength than the group with MPEG-PLGA alone (p = 0.034). CONCLUSION: Tissue-engineering with MFFs seeded on a scaffold of biodegradable MPEG-PLGA might be an interesting adjunct to future POP repair.......INTRODUCTION AND HYPOTHESIS: Alternative approaches to reinforce the native tissue in patients with pelvic organ prolapse (POP) are needed to improve surgical outcome. Our aims were to develop a weakened abdominal wall in a rat model to mimic the weakened vaginal wall in women with POP...
Transformation and fragmentation behavior of molten aluminum in sodium pool
International Nuclear Information System (INIS)
Nishimura, S.; Kinoshita, I.; Ueda, N.; Sugiyama, K. I.
2003-01-01
In order to investigate the possibility of fragmentation of the metallic alloy fuel on liquid phase formed by metallurgical reactions, which is important in evaluating the sequence of core disruptive accidents for metallic fuel fast reactors, a series of experiments was carried out using molten aluminum and sodium under the condition that the boiling of sodium on the surface of the melt does not occur. The melting point of aluminum (933K) is roughly equivalent to the liquefaction temperature between the U-Pu-Zr alloy fuel and the SUS cladding (about 923K). The thermal fragmentation of a molten aluminum with a solid crust in the sodium pool is caused by the transient pressurization within the melt confined by the solid crust even under the condition that the instantaneous contact interface temperature between the melt and the sodium is below the boiling point of sodium. This indicates the possibility that the metallic alloy fuel on liquid phase formed by metallurgical reactions can be fragmented without occurring the boiling of sodium on the surface of the melt. The transient pressurization within the melt is considered to be caused by following two mechanisms. i) the overheating of the coolant entrapped hydrodynamically inside the aluminum melt confined by solid crust ii) the progression of solid crust inward and the squeeze of inner liquid part of the aluminum melt confined by solid crust It is found that the degree of fragmentation defined by mass median diameter has the same tendency for different dropping modes (drop or jet) with different mass and ambient Weber number of the melt in the present experimental conditions
Microstructural characterization of pipe bomb fragments
International Nuclear Information System (INIS)
Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher
2010-01-01
Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.
MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.
The, Matthew; Käll, Lukas
2016-03-04
Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).
Fragment approaches in structure-based drug discovery
International Nuclear Information System (INIS)
Hubbard, Roderick E.
2008-01-01
Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets
Campbell, Mason J; Edwards, Will; Magrach, Ainhoa; Alamgir, Mohammed; Porolak, Gabriel; Mohandass, D; Laurance, William F
2018-04-01
Closed-canopy forests are being rapidly fragmented across much of the tropical world. Determining the impacts of fragmentation on ecological processes enables better forest management and improves species-conservation outcomes. Lianas are an integral part of tropical forests but can have detrimental and potentially complex interactions with their host trees. These effects can include reduced tree growth and fecundity, elevated tree mortality, alterations in tree-species composition, degradation of forest succession, and a substantial decline in forest carbon storage. We examined the individual impacts of fragmentation and edge effects (0-100-m transect from edge to forest interior) on the liana community and liana-host tree interactions in rainforests of the Atherton Tableland in north Queensland, Australia. We compared the liana and tree community, the traits of liana-infested trees, and determinants of the rates of tree infestation within five forest fragments (23-58 ha in area) and five nearby intact-forest sites. Fragmented forests experienced considerable disturbance-induced degradation at their edges, resulting in a significant increase in liana abundance. This effect penetrated to significantly greater depths in forest fragments than in intact forests. The composition of the liana community in terms of climbing guilds was significantly different between fragmented and intact forests, likely because forest edges had more small-sized trees favoring particular liana guilds which preferentially use these for climbing trellises. Sites that had higher liana abundances also exhibited higher infestation rates of trees, as did sites with the largest lianas. However, large lianas were associated with low-disturbance forest sites. Our study shows that edge disturbance of forest fragments significantly altered the abundance and community composition of lianas and their ecological relationships with trees, with liana impacts on trees being elevated in fragments relative
International Nuclear Information System (INIS)
Lau, K.H.
1985-01-01
This thesis has two major parts. The first part of the thesis will describe a high energy cosmic ray detector - the High Energy Isotope Spectrometer Telescope (HEIST). HEIST is a large area (0.25 m 2 sr) balloon-borne isotope spectrometer designed to make high-resolution measurements of isotopes in the element range from neon to nickel (10 less than or equal to Z less than or equal to 28) at energies of about 2 GeV/nucleon. The instrument consists of a stack of 12 NaI(Tl) scintillators, two Cerenkov counters, and two plastic scintillators. The second part of this thesis presents an experimental measurement of the isotopic composition of the fragments from the breakup of high energy 40 Ar and 56 Fe nuclei. Cosmic ray composition studies rely heavily on semi-empirical estimates of the cross-sections for the nuclear fragmentation reactions which alter the composition during propagation through the interstellar medium. Experimentally measured yields of isotopes from the fragmentation of 40 Ar and 56 Fe are compared with calculated yields based on semi-empirical cross-section formulae
Fragmentation properties of 6Li
International Nuclear Information System (INIS)
Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.
1987-01-01
The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs
Geometrical scaling of jet fragmentation photons
Energy Technology Data Exchange (ETDEWEB)
Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)
2016-12-15
We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.
DEFF Research Database (Denmark)
Kruse Aagaard, Anders
2017-01-01
The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...
Sudek, M.; Work, Thierry M.; Aeby, G.S.; Davy, S.K.
2012-01-01
The scleractinian finger coral Porites compressa is affected by the coral disease Porites bleaching with tissue loss (PBTL). This disease initially manifests as bleaching of the coenenchyme (tissue between polyps) while the polyps remain brown with eventual tissue loss and subsequent algal overgrowth of the bare skeleton. Histopathological investigation showed a loss of symbiont and melanin-containing granular cells which was more pronounced in the coenenchyme than the polyps. Cell counts confirmed a 65% reduction in symbiont density. Tissue loss was due to tissue fragmentation and necrosis in affected areas. In addition, a reduction in putative bacterial aggregate densities was found in diseased samples but no potential pathogens were observed.
[The fragmentation of representational space in schizophrenia].
Plagnol, A; Oïta, M; Montreuil, M; Granger, B; Lubart, T
2003-01-01
Existent neurocognitive models of schizophrenia converge towards a core of impairments involving working memory, context processing, action planning, controlled and intentional processing. However, the emergence of this core remains itself difficult to explain and more specific hypotheses do not explain the heterogeneity of schizophrenia. To overcome these limits, we propose a new paradigm based on representational theory from cognitive science. Some recent developments of this theory enable us to describe a subjective universe as a representational space which is displayed from memory. We outline a conceptual framework to construct such a representational space from analogical -representations that can be activated in working memory and are connected to a network of symbolic structures. These connections are notably made through an analytic process of the analogical fragments, which involves the attentional focus. This framework allows us to define rigorously some defense processes in response to traumatic tensions that are expressed on the representational space. The fragmentation of representational space is a consequence of a defensive denial based on an impairment of the analytic process. The fragmentation forms some parasitic areas in memory which are excluded from the main part of the representational space and disturb information processing. The key clinical concepts of paranoid syndromes can be defined in this conceptual framework: mental automatism, delusional intuition, acute destructuration, psychotic dissociation, and autistic withdrawal. We show that these syndromes imply each other, which in return increases the fragmentation of the representational space. Some new concepts emerge naturally in this framework, such as the concept of "suture" which is defined as a link between a parasitic area and the main representational space. Schizophrenia appears as a borderline case of fragmentation of the representational space. This conceptual framework is
Work, Thierry M.; Forsman, Zac H.; Szabo, Zoltan; Lewis, Teresa D.; Aeby, Greta S.; Toonen, Robert J.
2011-01-01
Montipora white syndrome (MWS) results in tissue-loss that is often lethal to Montipora capitata, a major reef building coral that is abundant and dominant in the Hawai'ian Archipelago. Within some MWS-affected colonies in Kane'ohe Bay, Oahu, Hawai'i, we saw unusual motile multicellular structures within gastrovascular canals (hereafter referred to as invasive gastrovascular multicellular structure-IGMS) that were associated with thinning and fragmentation of the basal body wall. IGMS were in significantly greater densities in coral fragments manifesting tissue-loss compared to paired normal fragments. Mesenterial filaments from these colonies yielded typical M. capitata mitochondrial haplotypes (CO1, CR), while IGMS from the same colony consistently yielded distinct haplotypes previously only found in a different Montipora species (Montipora flabellata). Protein profiles showed consistent differences between paired mesenterial filaments and IGMS from the same colonies as did seven microsatellite loci that also exhibited an excess of alleles per locus inconsistent with a single diploid organism. We hypothesize that IGMS are a parasitic cellular lineage resulting from the chimeric fusion between M. capitata and M. flabellata larvae followed by morphological reabsorption of M. flabellata and subsequent formation of cell-lineage parasites. We term this disease Montiporaiasis. Although intra-specific chimerism is common in colonial animals, this is the first suspected inter-specific example and the first associated with tissue loss.
Fracture mechanics model of fragmentation
International Nuclear Information System (INIS)
Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.
1986-01-01
A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates
Polymer fragmentation in extensional flow
Energy Technology Data Exchange (ETDEWEB)
Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech
2001-06-01
In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.
International Nuclear Information System (INIS)
Kojima, Shuji; Suzuki, Naomi; Shimura, Noriko; Kubodera, Akiko; Kubota, Kazuhiko; Yamaguchi, Toshiharu; Takahashi, Toshio; Oyamada, Hiyoshimaru
1993-01-01
Differences of pharmacokinetics and tumor imaging ability between intact monoclonal antibody A7 (A7 MoAb) and F(ab) 2 fragments were studied in human colon cancer (LS-174T)-bearing nude mice. The authors examined the yield and the immunoreactivity of F(ab) 2 fragments after treatment with ficin as a function of time. The yield of F(ab) 2 fragments reached about 50% after ficin treatment for 8 h, and the F(ab) 2 retained about 80% of the immunoreactivity of the corresponding MoAb. Longer digestion with ficin produced smaller fragments (less than 92 kDa) with a lower yield and most of the immunoreactivity was lost. In pharmacokinetics studies, the F(ab') 2 was preferentially taken up by the tumor, cleared more rapidly from the blood circulation and seemed to have less non-specific tissue binding than intact A7 MoAb. The tumor image obtained at an early time using 131 I-F(ab') 2 was much superior in quality to that with intact 131 I-A7 MoAb. The use of F(ab') 2 fragments may be effective for tumor diagnosis and therapy. (author)
Heavy-Quark Production in the Target Fragmentation Region
Graudenz, Dirk
1997-01-01
Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...
Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgos, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K. H.
2016-01-01
Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for
International Nuclear Information System (INIS)
McInroy, J.F.; Boyd, H.A.; Eutsler, B.C.; Romero, D.
1985-01-01
Los Alamos National Laboratory has analyzed autopsy tissue for the USTR, as a part of its study of the uptake, distribution and retention of Pu and other transuranic elements in occupationally exposed workers since 1978. In April 1979, Los Alamos received the internal organs and bone samples from the first whole-body donation to the USTR. The donor was known to have an internal deposition of 241 Am. All soft tissue, the bones from the right half of the skeleton, and the odd-numbered vertebrae were received at Los Alamos in February 1980. The bones were subdivided along anatomical areas of interest. All soft tissues and bone specimens were analyzed for their 241 Am content. A total deposition of 147.4 nCi 241 Am was measured. Approximately 18% of the 241 Am remaining in the body (disregarding that in the left hand), was found in the soft tissues, and 82% was in the bones and teeth. The soft tissues and organs containing the largest amounts of 241 Am were the combined soft tissue (striated muscle, connective tissue and skin) 8.8%; liver, 6.4% and respiratory tract, 1.5%. The remaining organs accounted for 0.9% of the systemic burden
Experimental modelling of fragmentation applied to volcanic explosions
Haug, Øystein Thordén; Galland, Olivier; Gisler, Galen R.
2013-12-01
Explosions during volcanic eruptions cause fragmentation of magma and host rock, resulting in fragments with sizes ranging from boulders to fine ash. The products can be described by fragment size distributions (FSD), which commonly follow power laws with exponent D. The processes that lead to power-law distributions and the physical parameters that control D remain unknown. We developed a quantitative experimental procedure to study the physics of the fragmentation process through time. The apparatus consists of a Hele-Shaw cell containing a layer of cohesive silica flour that is fragmented by a rapid injection of pressurized air. The evolving fragmentation of the flour is monitored with a high-speed camera, and the images are analysed to obtain the evolution of the number of fragments (N), their average size (A), and the FSD. Using the results from our image-analysis procedure, we find transient empirical laws for N, A and the exponent D of the power-law FSD as functions of the initial air pressure. We show that our experimental procedure is a promising tool for unravelling the complex physics of fragmentation during phreatomagmatic and phreatic eruptions.
Neighbouring charge fragmentations in low energy fission
International Nuclear Information System (INIS)
Montoya, M.
1986-10-01
Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs
Aspect Ratio Dependence of Impact Fragmentation
International Nuclear Information System (INIS)
Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.
1997-01-01
A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society
Quantum mechanical fragment methods based on partitioning atoms or partitioning coordinates.
Wang, Bo; Yang, Ke R; Xu, Xuefei; Isegawa, Miho; Leverentz, Hannah R; Truhlar, Donald G
2014-09-16
Conspectus The development of more efficient and more accurate ways to represent reactive potential energy surfaces is a requirement for extending the simulation of large systems to more complex systems, longer-time dynamical processes, and more complete statistical mechanical sampling. One way to treat large systems is by direct dynamics fragment methods. Another way is by fitting system-specific analytic potential energy functions with methods adapted to large systems. Here we consider both approaches. First we consider three fragment methods that allow a given monomer to appear in more than one fragment. The first two approaches are the electrostatically embedded many-body (EE-MB) expansion and the electrostatically embedded many-body expansion of the correlation energy (EE-MB-CE), which we have shown to yield quite accurate results even when one restricts the calculations to include only electrostatically embedded dimers. The third fragment method is the electrostatically embedded molecular tailoring approach (EE-MTA), which is more flexible than EE-MB and EE-MB-CE. We show that electrostatic embedding greatly improves the accuracy of these approaches compared with the original unembedded approaches. Quantum mechanical fragment methods share with combined quantum mechanical/molecular mechanical (QM/MM) methods the need to treat a quantum mechanical fragment in the presence of the rest of the system, which is especially challenging for those parts of the rest of the system that are close to the boundary of the quantum mechanical fragment. This is a delicate matter even for fragments that are not covalently bonded to the rest of the system, but it becomes even more difficult when the boundary of the quantum mechanical fragment cuts a bond. We have developed a suite of methods for more realistically treating interactions across such boundaries. These methods include redistributing and balancing the external partial atomic charges and the use of tuned fluorine
Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S
2016-01-01
Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gluon fragmentation in T(1S) decays
International Nuclear Information System (INIS)
Bienlein, J.K.
1983-05-01
In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)
DEFF Research Database (Denmark)
Svendsen, Casper Steinmann; Jensen, Jan; Fedorov, Dmitri
2013-01-01
We extend the Effective Fragment Molecular Orbital (EFMO) method to the frozen domain approach where only the geometry of an active part is optimized, while the many-body polarization effects are considered for the whole system. The new approach efficiently mapped out the entire reaction path of ...
A new location to split Cre recombinase for protein fragment complementation.
Rajaee, Maryam; Ow, David W
2017-11-01
We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Cell Division and Evolution of Biological Tissues
Rivier, Nicolas; Arcenegui-Siemens, Xavier; Schliecker, Gudrun
A tissue is a geometrical, space-filling, random cellular network; it remains in this steady state while individual cells divide. Cell division (fragmentation) is a local, elementary topological transformation which establishes statistical equilibrium of the structure. Statistical equilibrium is characterized by observable relations (Lewis, Aboav) between cell shapes, sizes and those of their neighbours, obtained through maximum entropy and topological correlation extending to nearest neighbours only, i.e. maximal randomness. For a two-dimensional tissue (epithelium), the distribution of cell shapes and that of mother and daughter cells can be obtained from elementary geometrical and physical arguments, except for an exponential factor favouring division of larger cells, and exponential and combinatorial factors encouraging a most symmetric division. The resulting distributions are very narrow, and stationarity severely restricts the range of an adjustable structural parameter
Percutaneous transhepatic fragmentation of gall stones and extraction of fragments
International Nuclear Information System (INIS)
Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.
1983-01-01
Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de
The role of fragmentation mechanism in large-scale vapor explosions
International Nuclear Information System (INIS)
Liu, Jie
2003-01-01
A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)
Sex identification of polar bears from blood and tissue samples
Amstrup, Steven C.; Garner, G.W.; Cronin, M.A.; Patton, J.C.
1993-01-01
Polar bears (Ursus maritimus) can be adversely affected by hunting and other human perturbations because of low population densities and low reproduction rates. The sustainable take of adult females may be as low as 1.5% of the population. Females and accompanying young are most vulnerable to hunting, and hunters have not consistently reported the sex composition of the harvest, therefore a method to confirm the sexes of polar bears harvested in Alaska is needed. Evidence of the sex of harvested animals is often not available, but blood or other tissue samples often are. We extracted DNA from tissue and blood samples, and amplified segments of zinc finger (ZFX and ZFY) genes from both X and Y chromosomes with the polymerase chain reaction. Digestion of amplified portions of the X chromosome with the restriction enzyme HaeIII resulted in subdivision of the original amplified segment into four smaller fragments. Digestion with HaeIII did not subdivide the original segment amplified from the Y chromosome. The differing fragment sizes produced patterns in gel electrophoresis that distinguished samples from male and female bears 100% of the time. This technique is applicable to the investigation of many wildlife management and research questions.
Memory effects in nuclear fragmentation?
International Nuclear Information System (INIS)
Colonna, M.; Di Toro, M.; Guarnera, A.
1994-01-01
A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))
Origin of fragments in multifragmentation reactions
International Nuclear Information System (INIS)
Zbiri, K.; Aichelin, J.
2003-01-01
Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)
Gluon fragmentation into 3 PJ quarkonium
International Nuclear Information System (INIS)
Ma, J.P.
1995-01-01
The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs
Origin of fragments in multifragmentation reactions
International Nuclear Information System (INIS)
Zbiri, K.; Aichelin, J.
2005-01-01
Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)
Fuel fragmentation data review and separate effects testing
International Nuclear Information System (INIS)
Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.
2014-01-01
A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)
Regrowth of Cirsium arvense from intact roots and root fragments at different soil depths
Directory of Open Access Journals (Sweden)
Thomsen, Mette Goul
2014-02-01
Full Text Available In the present work we measured the shoot rate from intact roots and from root fragments of Cirsium arvense at different digging depths and the number of leaves were used as estimate of minimum regenerative capacity. The experiments were performed on four sites with three or four repetitions of each treatment. On each site plot, the soil was removed down to a given depth within a 1 x 1 m square. All plant parts was excavated from the soil and the soil was either replaced without any root material, or roots of C. arvense was cut into 10 cm long fragments and replaced into the source hole. Shoot number, aboveground biomass and number of leaves were measured. Digging depth and time explained 50% - 60% of the variation in biomass (P<0.001. Replacement of root fragments increased the shoot number in one out of four treatments but did not affect biomass produced compared to production from undisturbed root systems. Number of leaves showed that shoots from all digging depths passed the level of minimum regenerative capacity. We conclude that the intact root system from all depths was able to regenerate within one season and it has a high contribution to the produced biomass compared with root fragments in the upper soil layers.
High-throughput fragment screening by affinity LC-MS.
Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten
2013-02-01
Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.
Bootstrap embedding: An internally consistent fragment-based method
Energy Technology Data Exchange (ETDEWEB)
Welborn, Matthew; Tsuchimochi, Takashi; Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)
2016-08-21
Strong correlation poses a difficult problem for electronic structure theory, with computational cost scaling quickly with system size. Fragment embedding is an attractive approach to this problem. By dividing a large complicated system into smaller manageable fragments “embedded” in an approximate description of the rest of the system, we can hope to ameliorate the steep cost of correlated calculations. While appealing, these methods often converge slowly with fragment size because of small errors at the boundary between fragment and bath. We describe a new electronic embedding method, dubbed “Bootstrap Embedding,” a self-consistent wavefunction-in-wavefunction embedding theory that uses overlapping fragments to improve the description of fragment edges. We apply this method to the one dimensional Hubbard model and a translationally asymmetric variant, and find that it performs very well for energies and populations. We find Bootstrap Embedding converges rapidly with embedded fragment size, overcoming the surface-area-to-volume-ratio error typical of many embedding methods. We anticipate that this method may lead to a low-scaling, high accuracy treatment of electron correlation in large molecular systems.
Fragmentation of molten core material by sodium
International Nuclear Information System (INIS)
Chu, T.Y.
1982-01-01
A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed
Quark fragmentation functions in NJL-jet model
Bentz, Wolfgang; Matevosyan, Hrayr; Thomas, Anthony
2014-09-01
We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. Supported by Grant in Aid for Scientific Research, Japanese Ministry of Education, Culture, Sports, Science and Technology, Project No. 20168769.
Fragment-based drug discovery using rational design.
Jhoti, H
2007-01-01
Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.
Fragmentation of small molecules induced by 46 keV/amu N+ and N2+ projectiles
International Nuclear Information System (INIS)
Kovacs, S.T.S.; Juhasz, Z.; Herczku, P.; Sulik, B.
2012-01-01
Complete text of publication follows. Collisional molecule fragmentation experiments has gain increasing attention in several research and applied fields. In order to understand the fundamental processes of molecule fragmentation one has to start with collisions of small few-atomic molecules. Moreover, fragments of small molecules such as water can cause damages of large molecules (DNA) very effectively in living tissues. In the last few years a new experimental setup was developed at Atomki. It was designed especially for molecule fragmentation experiments. Now the measurements using this system are running routinely. In 2012 the studied targets were water vapor, methane and nitrogen gases, injected into the collision area by an effusive molecular gas jet system. 650 keV N + and 1,3 MeV N 2 + ions were used as projectiles produced by the VdG-5 electrostatic accelerator. The velocity of the two types of projectiles was the same. Energy and angular distribution of the produced fragments was measured by an energy dispersive electrostatic spectrometer. For atomic ionization a symmetric, diatomic molecular projectile (e.g. N 2 + ) yields about twice more electrons compared to those of singly charged ion projectiles of the same atom (N + ) at the same velocity. In such cases the two atomic centers in the molecular ion can be considered as two individual atomic centers. For the fragmentation of molecular targets the picture is not so simple because in this case close collision of two extended systems is investigated. As figure 1 and 2 show, the measured yields for molecular projectile is not simply twice of the ones for atomic projectile. The shape of the energy spectra are different. The measured data are under evaluation. Acknowledgements. This work was supported by the Hungarian National Science Foundation OTKA (Grant: K73703) and by the TAMOP-4.2.2/B-10/1-2010-0024 project. The project is cofinanced by the European Union and the European Social Fund.
Critical Features of Fragment Libraries for Protein Structure Prediction.
Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel
2017-01-01
The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.
Developments in SPR Fragment Screening.
Chavanieu, Alain; Pugnière, Martine
2016-01-01
Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.
Directory of Open Access Journals (Sweden)
Barano Siswa Sulistyawan
2017-01-01
Full Text Available The trend of wildlife habitat fragmentation worldwide continues as a result of anthropogenic activities on development of a linear infrastructure and land use changes, which is often implemented as part of spatial planning policies. In this paper we expand upon an existing approach to design wildlife corridors through habitat quality assessment. We used models of Habitat Quality of Integrated Valuation of Ecosystem Services and Trade-offs (InVEST and Corridor Design tools. The habitat quality model of InVEST provides a rapid approach to assess status and change of biodiversity, and can contribute to enhanced corridor design of fragmented wildlife habitat. We conducted an assessment of habitat quality of the RIMBA corridor landscape, which is part of Riau, Jambi and West Sumatra provinces of central Sumatra Island. The result of the habitat quality model was used as the main input to evaluate habitat connectivity and assess the target segment of roads that cross the modelled corridor. We found 20 wildland blocks, the total area of the corridor modelled including wildland blocks was calculated as about 0.77 million hectares. We have obtained accurate quantitative measurement of the length of roads crossing the corridor, with a total of 417.78 km (artery 10.31 km; collector 19.52 km; and local 1987.9 km roads. This method can be replicated as an approach in valuing the quality of habitat as part of the implementation of the presidential decree of Sumatra Island Spatial Planning. This may also be applied to the spatial planning of other major islands in Indonesia and elsewhere.
The VERDI fission fragment spectrometer
Directory of Open Access Journals (Sweden)
Frégeau M.O.
2013-12-01
Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Cortese, R; Khalyfa, A; Bao, R; Andrade, J; Gozal, D
2015-07-01
Sleep fragmentation during late gestation (LG-SF) is one of the major perturbations associated with sleep apnea and other sleep disorders during pregnancy. We have previously shown that LG-SF induces metabolic dysfunction in offspring mice during adulthood. To investigate the effects of late LG-SF on metabolic homeostasis in offspring and to determine the effects of LG-SF on the epigenome of visceral white adipose tissue (VWAT) in the offspring. Time-pregnant mice were exposed to LG-SF or sleep control during LG (LG-SC) conditions during the last 6 days of gestation. At 24 weeks of age, lipid profiles and metabolic parameters were assessed in the offspring. We performed large-scale DNA methylation analyses using methylated DNA immunoprecipitation (MeDIP) coupled with microarrays (MeDIP-chip) in VWAT of 24-week-old LG-SF and LG-SC offspring (n=8 mice per group). Univariate multiple-testing adjusted statistical analyses were applied to identify differentially methylated regions (DMRs) between the groups. DMRs were mapped to their corresponding genes, and tested for potential overlaps with biological pathways and gene networks. We detected significant increases in body weight (31.7 vs 28.8 g; P=0.001), visceral (642.1 vs 497.0 mg; P=0.002) and subcutaneous (293.1 vs 250.1 mg; P=0.001) fat mass, plasma cholesterol (110.6 vs 87.6 mg dl(-1); P=0.001), triglycerides (87.3 vs 84.1 mg dl(-1); P=0.003) and homeostatic model assessment-insulin resistance values (8.1 vs 6.1; P=0.007) in the LG-SF group. MeDIP analyses revealed that 2148 DMRs (LG-SF vs LG-SC; Pgenes have reported functions that are altered in obesity and metabolic syndrome, such as Cartpt, Akt2, Apoe, Insr1 and so on. Overrepresented pathways and gene networks were related to metabolic regulation and inflammatory response. Our findings show a major role for epigenomic regulation of pathways associated with the metabolic processes and inflammatory responses in VWAT. LG-SF-induced epigenetic
First chelonian eggs and carapace fragments from the Pliocene of Rhodes, Greece
DEFF Research Database (Denmark)
Mueller-Töwe, Inken J.; Kjeldahl-Vallon, Tina A.; Milàn, Jesper
2011-01-01
Well-preserved fossil eggs and eggshell fragments from the Pliocene Apolakkia Formation of Rhodes (Greece) are described. The eggs were found in-situ in a clutch. They are sub-spherical with lengths of 53-60 mm and widths of about 40 mm. All eggs are diagenetically compressed and their original...... diameters are estimated at 45-50 mm. The eggshells are 0.3-0.5 mm thick, partly recrystallized, but widely still aragonitic. They consist of needle-like crystals that form individual shell units. A few pores are preserved between these shell units. This shell-structure allows assignment to chelonian eggs...... in the oofamily Testudoolithidae and the oogenus Testudolithus. The external morphology, microstructure and mineralogical composition of the eggshells show close resemblance to eggs of the extant tortoise Geochelone elephantopus. Together with a small association of turtle carapace fragments from the same...
Directory of Open Access Journals (Sweden)
Krystal Cole
Full Text Available High throughput screening technologies such as acoustic droplet ejection (ADE greatly increase the rate at which X-ray diffraction data can be acquired from crystals. One promising high throughput screening application of ADE is to rapidly combine protein crystals with fragment libraries. In this approach, each fragment soaks into a protein crystal either directly on data collection media or on a moving conveyor belt which then delivers the crystals to the X-ray beam. By simultaneously handling multiple crystals combined with fragment specimens, these techniques relax the automounter duty-cycle bottleneck that currently prevents optimal exploitation of third generation synchrotrons. Two factors limit the speed and scope of projects that are suitable for fragment screening using techniques such as ADE. Firstly, in applications where the high throughput screening apparatus is located inside the X-ray station (such as the conveyor belt system described above, the speed of data acquisition is limited by the time required for each fragment to soak into its protein crystal. Secondly, in applications where crystals are combined with fragments directly on data acquisition media (including both of the ADE methods described above, the maximum time that fragments have to soak into crystals is limited by evaporative dehydration of the protein crystals during the fragment soak. Here we demonstrate that both of these problems can be minimized by using small crystals, because the soak time required for a fragment hit to attain high occupancy depends approximately linearly on crystal size.
Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard
2004-09-01
Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.
Cosmic-ray exposure ages of six chondritic Almahata Sitta fragments
Riebe, M. E. I.; Welten, K. C.; Meier, M. M. M.; Wieler, R.; Barth, M. I. F.; Ward, D.; Laubenstein, M.; Bischoff, A.; Caffee, M. W.; Nishiizumi, K.; Busemann, H.
2017-11-01
The Almahata Sitta strewn field is dominated by ureilites, but contains a large fraction of chondritic fragments of various types. We analyzed stable isotopes of He, Ne, Ar, Kr, and Xe, and the cosmogenic radionuclides 10Be, 26Al, and 36Cl in six chondritic Almahata Sitta fragments (EL6 breccia, EL6, EL3-5, CB, LL4/5, R-like). The cosmic-ray exposure (CRE) ages of five of the six samples have an average of 19.2 ± 3.3 Ma, close to the average of 19.5 ± 2.5 Ma for four ureilites. The cosmogenic radionuclide concentrations in the chondrites indicate a preatmospheric size consistent with Almahata Sitta. This corroborates that Almahata Sitta chondrite samples were part of the same asteroid as the ureilites. However, MS-179 has a lower CRE age of 11.0 ± 1.4 Ma. Further analysis of short-lived radionuclides in fragment MS-179 showed that it fell around the same time, and from an object of similar size as Almahata Sitta, making it almost certain that MS-179 is an Almahata Sitta fragment. Instead, its low CRE age could be due to gas loss, chemical heterogeneity that may have led to an erroneous 21Ne production-rate, or, perhaps most likely, MS-179 could represent the true 4π exposure age of Almahata Sitta (or an upper limit thereof), while all other samples analyzed so far experienced exposure on the parent body of similar lengths. Finally, MS-179 had an extraordinarily high activity of neutron-capture 36Cl, 600 dpm kg-1, the highest activity observed in any meteorite to date, related to a high abundance of the Cl-bearing mineral lawrencite.
Prakash, Celine; Haeseler, Arndt Von
2017-03-01
RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.
Overview of Optical and Thermal Laser-Tissue Interaction and Nomenclature
Welch, Ashley J.; van Gemert, Martin J. C.
The development of a unified theory for the optical and thermal response of tissue to laser radiation is no longer in its infancy, though it is still not fully developed. This book describes our current understanding of the physical events that can occur when light interacts with tissue, particularly the sequence of formulations that estimate the optical and thermal responses of tissue to laser radiation. This overview is followed by an important chapter that describes the basic interactions of light with tissue. Part I considers basic tissue optics. Tissue is treated as an absorbing and scattering medium and methods are presented for calculating and measuring light propagation, including polarized light. Also, methods for estimating tissue optical properties from measurements of reflection and transmission are discussed. Part II concerns the thermal response of tissue owing to absorbed light, and rate reactions are presented for predicting the extent of laser induced thermal damage. Methods for measuring temperature, thermal properties, rate constants, pulsed ablation and laser tissue interactions are detailed. Part III is devoted to examples that use the theory presented in Parts I and II to analyze various medical applications of lasers. Discussions of Optical Coherence Tomography (OCT), forensic optics, and light stimulation of nerves are also included.
Improvements to a model of projectile fragmentation
International Nuclear Information System (INIS)
Mallik, S.; Chaudhuri, G.; Das Gupta, S.
2011-01-01
In a recent paper [Phys. Rev. C 83, 044612 (2011)] we proposed a model for calculating cross sections of various reaction products which arise from disintegration of projectile-like fragments resulting from heavy-ion collisions at intermediate or higher energy. The model has three parts: (1) abrasion, (2) disintegration of the hot abraded projectile-like fragment (PLF) into nucleons and primary composites using a model of equilibrium statistical mechanics, and (3) possible evaporation of hot primary composites. It was assumed that the PLF resulting from abrasion has one temperature T. Data suggested that, while just one value of T seemed adequate for most cross-section calculations, a single value failed when dealing with very peripheral collisions. We have now introduced a variable T=T(b) where b is the impact parameter of the collision. We argue that there are data which not only show that T must be a function of b but, in addition, also point to an approximate value of T for a given b. We propose a very simple formula: T(b)=D 0 +D 1 [A s (b)/A 0 ] where A s (b) is the mass of the abraded PLF and A 0 is the mass of the projectile; D 0 and D 1 are constants. Using this model we compute cross sections for several collisions and compare with data.
Effective Fragmentation and Flyrock Control Strategies at Quarries
Directory of Open Access Journals (Sweden)
Sedat Esen
2017-01-01
Full Text Available This paper presents the effective fragmentation and flyrock control strategies that could be applied at quarries to improve the productivity and safety. Fragmentation measurement and modelling as well as a comprehensive drill and blast audit are essential for improving the fragmentation. Face profiling and bore tracking are good tools to manage the ―as-designed‖ and ―as-drilled‖ conditions to get reasonable fragmentation from face burden zone and minimise the flyrock risk. In general, a large scatter in fragmentation data was observed at sites and the causes should be analysed by a detailed root-cause analysis technique. Two case studies were presented in this paper showing some of the effective fragmentation strategies. Finally, a flyrock model was shown to determine the safe blast exclusion zone for the mining equipment and personnel. Some key guidelines were suggested to minimise the occurrence of the flyrock.
Release and characteristics of fungal fragments in various conditions
Energy Technology Data Exchange (ETDEWEB)
Mensah-Attipoe, Jacob [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Saari, Sampo [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Veijalainen, Anna-Maria; Pasanen, Pertti [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Keskinen, Jorma [Department of Physics, Tampere University of Technology, Korkeakoulunkatu 3, 33720 Tampere (Finland); Leskinen, Jari T.T. [SIB Labs, University of Eastern Finland, Yliopistonranta 1E, P. O. Box 1627, FI-70211, Kuopio (Finland); Reponen, Tiina, E-mail: reponeta@ucmail.uc.edu [Department of Environmental Science, University of Eastern Finland, Yliopistonranta 1D, P. O. Box 1627, FI-70211 Kuopio (Finland); Department of Environmental Health, University of Cincinnati, P.O. Box 670056, Cincinnati, OH 45267-0056 (United States)
2016-03-15
Intact spores and submicrometer size fragments are released from moldy building materials during growth and sporulation. It is unclear whether all fragments originate from fungal growth or if small pieces of building materials are also aerosolized as a result of microbial decomposition. In addition, particles may be formed through nucleation from secondary metabolites of fungi, such as microbial volatile organic compounds (MVOCs). In this study, we used the elemental composition of particles to characterize the origin of submicrometer fragments released from materials contaminated by fungi. Particles from three fungal species (Aspergillus versicolor, Cladosporium cladosporioides and Penicillium brevicompactum), grown on agar, wood and gypsum board were aerosolized using the Fungal Spore Source Strength Tester (FSSST) at three air velocities (5, 16 and 27 m/s). Released spores (optical size, d{sub p} ≥ 0.8 μm) and fragments (d{sub p} ≤ 0.8 μm) were counted using direct-reading optical aerosol instruments. Particles were also collected on filters, and their morphology and elemental composition analyzed using scanning electron microscopes (SEMs) coupled with an Energy-Dispersive X-ray spectroscopy (EDX). Among the studied factors, air velocity resulted in the most consistent trends in the release of fungal particles. Total concentrations of both fragments and spores increased with an increase in air velocity for all species whereas fragment–spore (F/S) ratios decreased. EDX analysis showed common elements, such as C, O, Mg and Ca, for blank material samples and fungal growth. However, N and P were exclusive to the fungal growth, and therefore were used to differentiate biological fragments from non-biological ones. Our results indicated that majority of fragments contained N and P. Because we observed increased release of fragments with increased air velocities, nucleation of MVOCs was likely not a relevant process in the formation of fungal fragments. Based
Graph Theory. 1. Fragmentation of Structural Graphs
Directory of Open Access Journals (Sweden)
Lorentz JÄNTSCHI
2002-12-01
Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.
Route to three-dimensional fragments using diversity-oriented synthesis.
Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W
2011-04-26
Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.
Sudek, M; Work, T M; Aeby, G S; Davy, S K
2012-10-01
The scleractinian finger coral Porites compressa is affected by the coral disease Porites bleaching with tissue loss (PBTL). This disease initially manifests as bleaching of the coenenchyme (tissue between polyps) while the polyps remain brown with eventual tissue loss and subsequent algal overgrowth of the bare skeleton. Histopathological investigation showed a loss of symbiont and melanin-containing granular cells which was more pronounced in the coenenchyme than the polyps. Cell counts confirmed a 65% reduction in symbiont density. Tissue loss was due to tissue fragmentation and necrosis in affected areas. In addition, a reduction in putative bacterial aggregate densities was found in diseased samples but no potential pathogens were observed. Copyright © 2012 Elsevier Inc. All rights reserved.
Frasson, L; Neubert, J; Reina, S; Oldfield, M; Davies, B L; Rodriguez Y Baena, F
2010-01-01
The popularity of minimally invasive surgical procedures is driving the development of novel, safer and more accurate surgical tools. In this context a multi-part probe for soft tissue surgery is being developed in the Mechatronics in Medicine Laboratory at Imperial College, London. This study reports an optimization procedure using finite element methods, for the identification of an interlock geometry able to limit the separation of the segments composing the multi-part probe. An optimal geometry was obtained and the corresponding three-dimensional finite element model validated experimentally. Simulation results are shown to be consistent with the physical experiments. The outcome of this study is an important step in the provision of a novel miniature steerable probe for surgery.
Fragment-based discovery of a potent NAMPT inhibitor.
Korepanova, Alla; Longenecker, Kenton L; Pratt, Steve D; Panchal, Sanjay C; Clark, Richard F; Lake, Marc; Gopalakrishnan, Sujatha M; Raich, Diana; Sun, Chaohong; Petros, Andrew M
2017-12-12
NAMPT expression is elevated in many cancers, making this protein a potential target for anticancer therapy. We have carried out both NMR based and TR-FRET based fragment screens against human NAMPT and identified six novel binders with a range of potencies. Co-crystal structures were obtained for two of the fragments bound to NAMPT while for the other four fragments force-field driven docking was employed to generate a bound pose. Based on structural insights arising from comparison of the bound fragment poses to that of bound FK866 we were able to synthetically elaborate one of the fragments into a potent NAMPT inhibitor. Copyright © 2017 Elsevier Ltd. All rights reserved.
Measuring the temperature of hot nuclear fragments
International Nuclear Information System (INIS)
Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.
2010-01-01
A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.
Production of photofission fragments and study of their nuclear structure by laser spectroscopy
International Nuclear Information System (INIS)
Gangrskij, Yu.P.; Zemlyanoj, S.G.; Karaivanov, D.V.; Marinova, K.P.; Markov, B.N.; Mel'nikova, L.M.; Myshinskij, G.V.; Penionzhkevich, Yu.Eh.; Zhemenik, V.I.
2005-01-01
The prospective nuclear structure investigations of the fission fragments by resonance laser spectroscopy methods are discussed. Research in this field is currently being carried out as part of the DRIBs project, which is under development at the Laboratory of Nuclear Reactions, JINR. The fission fragments under study are mainly very neutron-rich nuclei near the proton (Z=50) and neutron (N=50 and 82) closed shells, nuclei in the region of strong deformation (N>60 and N>90) and nuclei with high-spin isomeric states. Resonance laser spectroscopy is used successfully in the study of the structure of such nuclei. It allows one to determine a number of nuclear parameters (mean-square charge radius, magnetic dipole and electric quadrupole moments) and to make conclusions about the collective and single particle properties of the nuclei
QGP and Modified Jet Fragmentation
International Nuclear Information System (INIS)
Wang, Xin-Nian
2005-01-01
Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed
Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgós, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K H
2016-08-01
Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for biological targets. We report the synergistic combination of fragment linking and DCC to identify inhibitors of the aspartic protease endothiapepsin. Based on X-ray crystal structures of endothiapepsin in complex with fragments, we designed a library of bis-acylhydrazones and used DCC to identify potent inhibitors. The most potent inhibitor exhibits an IC50 value of 54 nm, which represents a 240-fold improvement in potency compared to the parent hits. Subsequent X-ray crystallography validated the predicted binding mode, thus demonstrating the efficiency of the combination of fragment linking and DCC as a hit-identification strategy. This approach could be applied to a range of biological targets, and holds the potential to facilitate hit-to-lead optimization. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Zuo, S.; Dai, S.; Ren, Y.; Yu, Z.
2017-12-01
Scientifically revealing the spatial heterogeneity and the relationship between the fragmentation of urban landscape and the direct carbon emissions are of great significance to land management and urban planning. In fact, the linear and nonlinear effects among the various factors resulted in the carbon emission spatial map. However, there is lack of the studies on the direct and indirect relations between the carbon emission and the city functional spatial form changes, which could not be reflected by the land use change. The linear strength and direction of the single factor could be calculated through the correlation and Geographically Weighted Regression (GWR) analysis, the nonlinear power of one factor and the interaction power of each two factors could be quantified by the Geodetector analysis. Therefore, we compared the landscape fragmentation metrics of the urban land cover and functional district patches to characterize the landscape form and then revealed the relations between the landscape fragmentation level and the direct the carbon emissions based on the three methods. The results showed that fragmentation decreased and the fragmented patches clustered at the coarser resolution. The direct CO2 emission density and the population density increased when the fragmentation level aggregated. The correlation analysis indicated the weak linear relation between them. The spatial variation of GWR output indicated the fragmentation indicator (MESH) had the positive influence on the carbon emission located in the relatively high emission region, and the negative effects regions accounted for the small part of the area. The Geodetector which explores the nonlinear relation identified the DIVISION and MESH as the most powerful direct factor for the land cover patches, NP and PD for the functional district patches, and the interactions between fragmentation indicator (MESH) and urban sprawl metrics (PUA and DIS) had the greatly increased explanation powers on the
Experimental studies of N/Z equilibration in peripheral collisions using fragment yield ratios
International Nuclear Information System (INIS)
Keksis, A. L.; May, L. W.; Kohley, Z.; Soisson, S. N.; Stein, B. C.; Wuenschel, S.; Yennello, S. J.; Souliotis, G. A.; Veselsky, M.; Galanopoulos, S.; Shetty, D. V.; Tripathi, R.; Li, B. A.
2010-01-01
Peripheral collisions of 40 Ca and 48 Ca projectiles at 32 MeV/nucleon on 112 Sn and 124 Sn targets were studied in this work. The fragments of the projectile-like source (quasiprojectile) were collected with a charged-particle multidetector array. The average value of the neutron-to-proton ratio N/Z of the quasiprojectiles formed in the reactions was determined with two approaches. The first is a direct reconstruction approach using isotopically resolved fragments and is hindered by undetected neutrons leading to lower N/Z values. The second approach, based on the assumption of early fragment formation, employs yield ratios of fragment isobars and is not hindered by undetected neutrons. Using this approach, the amount of N/Z mixing that occurred in the quasiprojectiles (compared to a fully N/Z equilibrated system) was found to be approximately 53%. The experimental results were compared with model calculations. First, the phenomenological DIT (deep inelastic transfer) model was used, followed by the statistical multifragmentation model (SMM). The results of these calculations are in close agreement with the data and indicate that the mean number of undetected neutrons increases with the N/Z of the composite system, accounting for the difference observed between the two approaches of quasiprojectile N/Z determination. Second, the microscopic transport model IBUU (isospin-dependent Boltzmann-Uehling-Uhlenbeck) was employed, providing preliminary results in reasonable agreement with the data. The determination of the degree of N/Z equilibration employing the present fragment yield ratio approach may provide a valuable probe to study the isospin part of the nuclear equation of state in conjunction with detailed microscopic models of the collisions in the Fermi energy regime.
Regularity and mass conservation for discrete coagulation–fragmentation equations with diffusion
Cañizo, J.A.
2010-03-01
We present a new a priori estimate for discrete coagulation-fragmentation systems with size-dependent diffusion within a bounded, regular domain confined by homogeneous Neumann boundary conditions. Following from a duality argument, this a priori estimate provides a global L2 bound on the mass density and was previously used, for instance, in the context of reaction-diffusion equations. In this paper we demonstrate two lines of applications for such an estimate: On the one hand, it enables to simplify parts of the known existence theory and allows to show existence of solutions for generalised models involving collision-induced, quadratic fragmentation terms for which the previous existence theory seems difficult to apply. On the other hand and most prominently, it proves mass conservation (and thus the absence of gelation) for almost all the coagulation coefficients for which mass conservation is known to hold true in the space homogeneous case. © 2009 Elsevier Masson SAS. All rights reserved.
Fragmentation of dimethyl ether in femtosecond intense field
Zhu, Jingyi; Guo, Wei; Wang, Yanqiu; Wang, Li
2006-08-01
The fragmentation of dimethyl ether (DME) in intense femtosecond laser field has been studied at 810, 405 and 270 nm with intensities up to 2.48 × 10 15, 3.86 × 10 15 and 1.62 × 10 14 W/cm 2, respectively. At 405 nm, DME is possibly firstly ionized by multiphoton absorption, and then parent ion DME + dissociates into fragments via filed-induced dissociation. For 810 and 270 nm laser fields, DME firstly dissociates into CH 3O and CH 3 fragments and then these neutral fragments are ionized by field tunneling. Another possible way for DME to dissociate at 810 and 270 nm is that DME is ionized by intense field ejection of inner valance electron and then the excited DME + dissociates into fragment ions. Ultrafast rearrangement of DME or DME + in intense field may be responsible to the unpredictable fragment ions, CHO+/C2H5+andH2+.
DEFF Research Database (Denmark)
Christiansen, Steen Ledet
Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...
Identifying Interactions that Determine Fragment Binding at Protein Hotspots.
Radoux, Chris J; Olsson, Tjelvar S G; Pitt, Will R; Groom, Colin R; Blundell, Tom L
2016-05-12
Locating a ligand-binding site is an important first step in structure-guided drug discovery, but current methods do little to suggest which interactions within a pocket are the most important for binding. Here we illustrate a method that samples atomic hotspots with simple molecular probes to produce fragment hotspot maps. These maps specifically highlight fragment-binding sites and their corresponding pharmacophores. For ligand-bound structures, they provide an intuitive visual guide within the binding site, directing medicinal chemists where to grow the molecule and alerting them to suboptimal interactions within the original hit. The fragment hotspot map calculation is validated using experimental binding positions of 21 fragments and subsequent lead molecules. The ligands are found in high scoring areas of the fragment hotspot maps, with fragment atoms having a median percentage rank of 97%. Protein kinase B and pantothenate synthetase are examined in detail. In each case, the fragment hotspot maps are able to rationalize a Free-Wilson analysis of SAR data from a fragment-based drug design project.
Tooth fragment reattachment techniques-A systematic review.
Garcia, Fernanda Cristina P; Poubel, Déborah L N; Almeida, Júlio César F; Toledo, Isabela P; Poi, Wilson R; Guerra, Eliete N S; Rezende, Liliana V M L
2018-03-07
Several strategies have been developed for tooth fragment reattachment following fracture. Although many techniques have been reported, there is no consensus on which one has the best results in terms of the bond strength between the fragment and the dentin over time. The aim of this study was to assess the currently reported tooth fragment reattachment techniques for fractured crowns of anterior teeth. The PubMed, LILACS, Web of Science, Cochrane, and Scopus databases were searched in October 2016, and the search was updated in February 2017. A search of the gray literature was performed in Google Scholar and OpenGrey. Reference lists of eligible studies were cross-checked to identify additional studies; gray literature and ongoing trials were investigated. Two authors assessed studies to determine inclusion and undertook data extraction. Case reports/series of three or more cases, cross-sectional studies, cohort studies, and in vivo clinical trials in all languages were included. Five articles remained after screening. These studies predominantly reported on fragment reattachment with composite resin and resin cement. There was little consistency among the studies in regard to the technique used for tooth fragment reattachment and length of the follow-up period. According to the evidence found in the studies included in this review, simple tooth fragment reattachment was the preferred reattachment technique. An increase in the bond strength between tooth fragment and dentin was observed when an intermediate material was used. Further investigation is needed, using standard follow-up periods and larger samples. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Moshonov, J; Stabholz, A; Leopold, Y; Rosenberg, I; Stabholz, A
2001-10-01
The interaction of laser energy with target tissue is mainly determined by two non operator-dependent factors: the specific wavelength of the laser and the optical properties of the target tissues. Power density, energy density, pulse repetition rate, pulse duration and the mode of energy transferring to the tissue are dictated by the clinician. Combination of these factors enables to control optimal response for the clinical application. Four responses are described when the laser beam hits the target tissue: reflection, absorption, transmission and scattering. Three main mechanisms of interaction between the laser and the biological tissues exist: photothermic, photoacoustic and photochemical. The effect of lasers on the soft tissues of the oral cavity is based on transformation of light energy into thermal energy which, in turn heats the target tissue to produce the desirable effect. In comparison to the scalpel used in surgical procedures, the laser beam is characterized by tissue natural sterility and by minimum bleeding during the surgical procedures due to blood vessels welding. The various effects achieved by the temperature elevation during the laser application on the soft tissue are: I. coagulation and hemostasis II. tissue sterilization III. tissue welding IV. incision and excision V. ablation and vaporization Ablation and melting are the two basic modalities by which the effect of lasers on the hard tissues of the tooth is produced. When discussing the effect of laser on dental hard tissues, the energy absorption in the hydroxyapatite plays a major role in addition to its absorption in water. When laser energy is absorbed in the water of the hard tissues, a rapid volume expansion of the evaporating water occurs as a result of a substantial temperature elevation in the interaction site. Microexplosions are produced causing hard tissue disintegration. If pulp temperatures are raised beyond 5 degrees C level, damage to the dental pulp is irreversible
Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...
Habitat Fragmentation and Native Bees: a Premature Verdict?
Directory of Open Access Journals (Sweden)
James H. Cane
2001-06-01
Full Text Available Few studies directly address the consequences of habitat fragmentation for communities of pollinating insects, particularly for the key pollinator group, bees (Hymenoptera: Apiformes. Bees typically live in habitats where nesting substrates and bloom are patchily distributed and spatially dissociated. Bee studies have all defined habitat fragments as remnant patches of floral hosts or forests, overlooking the nesting needs of bees. Several authors conclude that habitat fragmentation is broadly deleterious, but their own data show that some native species proliferate in sampled fragments. Other studies report greater densities and comparable diversities of native bees at flowers in some fragment size classes relative to undisrupted habitats, but find dramatic shifts in species composition. Insightful studies of habitat fragmentation and bees will consider fragmentation, alteration, and loss of nesting habitats, not just patches of forage plants, as well as the permeability of the surrounding matrix to interpatch movement. Inasmuch as the floral associations and nesting habits of bees are often attributes of species or subgenera, ecological interpretations hinge on authoritative identifications. Study designs must accommodate statistical problems associated with bee community samples, especially non-normal data and frequent zero values. The spatial scale of fragmentation must be appreciated: bees of medium body size can regularly fly 1-2 km from nest site to forage patch. Overall, evidence for prolonged persistence of substantial diversity and abundances of native bee communities in habitat fragments of modest size promises practical solutions for maintaining bee populations. Provided that reserve selection, design, and management can address the foraging and nesting needs of bees, networks of even small reserves may hold hope for sustaining considerable pollinator diversity and the ecological services pollinators provide.
Fragmentation Point Detection of JPEG Images at DHT Using Validator
Mohamad, Kamaruddin Malik; Deris, Mustafa Mat
File carving is an important, practical technique for data recovery in digital forensics investigation and is particularly useful when filesystem metadata is unavailable or damaged. The research on reassembly of JPEG files with RST markers, fragmented within the scan area have been done before. However, fragmentation within Define Huffman Table (DHT) segment is yet to be resolved. This paper analyzes the fragmentation within the DHT area and list out all the fragmentation possibilities. Two main contributions are made in this paper. Firstly, three fragmentation points within DHT area are listed. Secondly, few novel validators are proposed to detect these fragmentations. The result obtained from tests done on manually fragmented JPEG files, showed that all three fragmentation points within DHT are successfully detected using validators.
International Nuclear Information System (INIS)
Alonso Martinez, L. M.; Xiques Castillo, A.; Leyva Montanna, R.; Perez-Malo Cruz, M.; Zamora Barrabi, M.; Manresa Sanchez, Y.
2013-01-01
Antibody-based targeted delivery of radioisotopes to malignant tissues is a promising approach in cancer diagnostics and therapy. However, intact antibody molecules are large glycoproteins (∼150 kDa) that have limited application in molecular imaging and therapy due to their relatively slow clearance from the circulation leading to a high background signal rather both cases the sensitivity can be increased with the use of enzymatically produced Fab' fragments. In this work, the ability to get labeled with 62 Ga and 90 Y of a monoclonal antibody (mAb) Fab' fragment against the transmembrane receptor tyrosine kinase HER-1 was studied for future applications in PET imaging and radioimmunotherapy of tumors. In order to obtain the Fab' fragment the mAb was cleaved with pepsin in molar excess. After separating the reaction mixture in two steps using affinity and ion-exchange chromatography, the Fab' fragment was finally obtained by reduction of the F(ab') 2 with a molar excess of 2-mercaptoethanol followed by a size exclusion purification step. The Fab' fragment was derivatized with 1,4,7,10-tetraaza cyclododecane-1,4,7,10-tetraacetic acid mono N-hydroxysuccinimide commercial ester (DOTA-NHS-ester) applying a simple procedure and the number of DOTA groups linked to Fab' were determinate. The labeling of the conjugate with 68 Ga and 90 Y from 'in-house generators yielded radiochemically pure probes that can become a suitable radioimmunoconjugated in a near future. (Author)
Dynamical effects in the Colomb expansion following nuclear fragmentation
International Nuclear Information System (INIS)
Chung, K.C.; Donangelo, R.J.; Schechter, H.
1987-01-01
The effects of the Colomb expansion on the fragment Kinetic energy spectrum for a fragmentating hot nuclear system is investigated. In particular, 12 C fragment spectra are calculated and compared with those predicted by the uniform expansion approximation. The results indicate that energy spectra of fragments are quite sensitive to the details of the Coulomb expansion treatment. (Author) [pt
Newmark, William D; Stanley, Thomas R
2011-07-12
Ecologists have long hypothesized that fragmentation of tropical landscapes reduces avian nest success. However, this hypothesis has not been rigorously assessed because of the difficulty of finding large numbers of well-hidden nests in tropical forests. Here we report that in the East Usambara Mountains in Tanzania, which are part of the Eastern Arc Mountains, a global biodiversity hotspot, that daily nest survival rate and nest success for seven of eight common understory bird species that we examined over a single breeding season were significantly lower in fragmented than in continuous forest, with the odds of nest failure for these seven species ranging from 1.9 to 196.8 times higher in fragmented than continuous forest. Cup-shaped nests were particularly vulnerable in fragments. We then examined over six breeding seasons and 14 study sites in a multivariable survival analysis the influence of landscape structure and nest location on daily nest survival for 13 common species representing 1,272 nests and four nest types (plate, cup, dome, and pouch). Across species and nest types, area, distance of nest to edge, and nest height had a dominant influence on daily nest survival, with area being positively related to nest survival and distance of nest to edge and nest height being both positively and negatively associated with daily nest survival. Our results indicate that multiple environmental factors contribute to reduce nest survival within a tropical understory bird community in a fragmented landscape and that maintaining large continuous forest is important for enhancing nest survival for Afrotropical understory birds.
Santangelo, G M; Tornow, J
1997-12-01
As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Accurate phylogenetic classification of DNA fragments based onsequence composition
Energy Technology Data Exchange (ETDEWEB)
McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore
2006-05-01
Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.
Kaminski, Bartlomiej; Ng, Francis
2001-01-01
Developments driven by trade liberalization and tehcnological progress mean that old development strategies, based on state intervention and trade protection, no longer work. Global competition has brought a growing emphasis on product standards, rapid innovation, adaptability, and speedy response. Technology has made possible the fragmentation of production. Firms that become part of glob...
The impact of habitat fragmentation on tsetse abundance on the plateau of eastern Zambia.
Ducheyne, E; Mweempwa, C; De Pus, C; Vernieuwe, H; De Deken, R; Hendrickx, G; Van den Bossche, P
2009-09-01
Tsetse-transmitted human or livestock trypanosomiasis is one of the major constraints to rural development in sub-Saharan Africa. The epidemiology of the disease is determined largely by tsetse fly density. A major factor, contributing to tsetse population density is the availability of suitable habitat. In large parts of Africa, encroachment of people and their livestock resulted in a destruction and fragmentation of such suitable habitat. To determine the effect of habitat change on tsetse density a study was initiated in a tsetse-infested zone of eastern Zambia. The study area represents a gradient of habitat change, starting from a zone with high levels of habitat destruction and ending in an area where livestock and people are almost absent. To determine the distribution and density of the fly, tsetse surveys were conducted throughout the study area in the dry and in the rainy season. Landsat ETM+ imagery covering the study area were classified into four land cover classes (munga, miombo, agriculture and settlements) and two auxiliary spectral classes (clouds and shadow) using a Gaussian Maximum Likelihood Classifier. The classes were regrouped into natural vegetation and agricultural zone. The binary images were overlaid with hexagons to obtain the spatial spectrum of spatial pattern. Hexagonal coverage was selected because of its compact and regular form. To identify scale-specific spatial patterns and associated entomological phenomena, the size of the hexagonal coverage was varied (250 and 500 m). Per coverage, total class area, mean patch size, number of patches and patch size standard deviation were used as fragmentation indices. Based on the fragmentation index values, the study zone was classified using a Partitioning Around Mediods (PAM) method. The number of classes was determined using the Wilks' lambda coefficient. To determine the impact of habitat fragmentation on tsetse abundance, the correlation between the fragmentation indices and the index
Bone fragments a body can make
Energy Technology Data Exchange (ETDEWEB)
Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))
1991-05-01
Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.
HETC-3STEP included fragmentation process
Energy Technology Data Exchange (ETDEWEB)
Shigyo, Nobuhiro; Iga, Kiminori; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering
1997-03-01
High Energy Transport Code (HETC) based on the cascade-evaporation model is modified to calculate the fragmentation cross section. For the cascade process, nucleon-nucleon cross sections are used for collision computation; effective in-medium-corrected cross sections are adopted instead of the original free-nucleon collision. The exciton model is adopted for improvement of backward nucleon-emission cross section for low-energy nucleon-incident events. The fragmentation reaction is incorporated into the original HETC as a subroutine set by the use of the systematics of the reaction. The modified HETC (HETC-3STEP/FRG) reproduces experimental fragment yields to a reasonable degree. (author)
Integration of fragment screening and library design.
Siegal, Gregg; Ab, Eiso; Schultz, Jan
2007-12-01
With more than 10 years of practical experience and theoretical analysis, fragment-based drug discovery (FBDD) has entered the mainstream of the pharmaceutical and biotech industries. An array of biophysical techniques has been used to detect the weak interaction between a fragment and the target. Each technique presents its own requirements regarding the fragment collection and the target; therefore, in order to optimize the potential of FBDD, the nature of the target should be a driving factor for simultaneous development of both the library and the screening technology. A roadmap is now available to guide fragment-to-lead evolution when structural information is available. The next challenge is to apply FBDD to targets for which high-resolution structural information is not available.
Energy Technology Data Exchange (ETDEWEB)
Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)
1976-01-01
Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)
2017-12-01
series used improved experimental techniques to reduce obscuration due to smoke and fire which, again, increased the number of observed fragments (iii...minimally-reinforced concrete masonry unit (CMU) wall, and one 8-ft x 8-ft reinforced concrete panel, each carefully fabricated and mounted to replicate...develops a vertical compressive force that resists horizontal flexure. Figure 4. A view of CMU sample set-up used in Test 20. 6 Figure 5
Cell density signal protein suitable for treatment of connective tissue injuries and defects
Schwarz, Richard I.
2002-08-13
Identification, isolation and partial sequencing of a cell density protein produced by fibroblastic cells. The cell density signal protein comprising a 14 amino acid peptide or a fragment, variant, mutant or analog thereof, the deduced cDNA sequence from the 14 amino acid peptide, a recombinant protein, protein and peptide-specific antibodies, and the use of the peptide and peptide-specific antibodies as therapeutic agents for regulation of cell differentiation and proliferation. A method for treatment and repair of connective tissue and tendon injuries, collagen deficiency, and connective tissue defects.
Light particles emitted with the fission fragments of thorium
Energy Technology Data Exchange (ETDEWEB)
San-Tsiang, T; Faraggi, H
1947-01-01
The traces produced by the fission of thorium with fast neutrons have been recorded photographically and studied. The formation of a light fragment of long range by either quadripartition or tripartition was not observed. The release of a short-range light fragment by bipartition was observed about one hundred times more frequently than was the release of such a fragment by tripartition. The ratio of the range of the two heavy fragments produced by tripartition was 1:2; this compares with a ratio of 1:3 for the heavy fragments produced by bipartition.
Complex fragment emission from hot compound nuclei
International Nuclear Information System (INIS)
Moretto, L.G.
1986-03-01
The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs
Apparatus for enhancing tissue repair in mammals
Goodwin, Thomas J. (Inventor); Parker, Clayton R. (Inventor)
2007-01-01
An apparatus is disclosed for enhancing tissue repair in mammals, with the apparatus comprising: a sleeve for encircling a portion of a mammalian body part, said sleeve comprising an electrically conductive coil capable of generating an electromagnetic field when an electrical current is applied thereto, means for supporting the sleeve on the mammalian body part; and means for supplying the electrically conductive coil with a square wave time varying electrical current sufficient to create a time varying electromagnetic force of from approximately 0.05 gauss to 0.05 gauss within the interior of the coil in order that when the sleeve is placed on a mammalian body part and the time varying electromagnetic force of from approximately 0.05 gauss to 0.05 gauss is generated on the mammalian body part for an extended period of time, tissue regeneration within the mammalian body part is increased to a rate in excess of the normal tissue regeneration rate that would occur without application of the time varying electromagnetic force.
TRANSPLANTATION AND POTENTIAL IMMORTALITY OF MAMMALIAN TISSUES.
Loeb, L
1926-06-20
1. Serial transplantation of tumors made it possible in 1901 and following years to draw the conclusion that various mammalian tissues have potential immortality. Serial transplantations of normal tissues did not succeed at first, because the homoioreaction on the part of the lymphocytes and connective tissue of the host injures the transplant. 2. In continuation of these experiments we found that cartilage of the rat can be transplanted serially to other rats at least for a period of 3 years. At the end of that time great parts of the transplanted cartilage and perichondrium are alive. 3. Not only the cartilage of young rats can be homoiotransplanted, but also the cartilage of very old rats which are nearing the end of life. By using such animals we have been able to obtain cartilage and perichondrium approaching an age of 6 years which is almost double the average age of a rat. 4. We found that cartilage can be homoiotransplanted more readily than other tissues for the following reasons: (a) While in principle the homoioreaction towards cartilage is the same as against other tissues, cartilage elicits this reaction with less intensity; (b) cartilage is better able to resist the invasion of lymphocytes and connective tissue than the majority of other tissues; (c) a gradual adaptation between transplant and host seems to take place in the case of cartilage transplantation, as a result of which the lymphocytic reaction on the part of the host tissue decreases progressively the longer the cartilage is kept in the strange host. 5. At time of examination we not only found living transplanted cartilage tissue, but also perichondrial tissue, which in response to a stimulus apparently originating in the necrotic central cartilage, had been proliferating and replacing it. These results suggest that it may perhaps be possible under favorable conditions to keep cartilage alive indefinitely through serial transplantations. 6. At the same time these experiments permit the
Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V
2016-06-20
Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.
Advancement of magma fragmentation by inhomogeneous bubble distribution.
Kameda, M; Ichihara, M; Maruyama, S; Kurokawa, N; Aoki, Y; Okumura, S; Uesugi, K
2017-12-01
Decompression times reported in previous studies suggest that thoroughly brittle fragmentation is unlikely in actual explosive volcanic eruptions. What occurs in practice is brittle-like fragmentation, which is defined as the solid-like fracture of a material whose bulk rheological properties are close to those of a fluid. Through laboratory experiments and numerical simulation, the link between the inhomogeneous structure of bubbles and the development of cracks that may lead to brittle-like fragmentation was clearly demonstrated here. A rapid decompression test was conducted to simulate the fragmentation of a specimen whose pore morphology was revealed by X-ray microtomography. The dynamic response during decompression was observed by high-speed photography. Large variation was observed in the responses of the specimens even among specimens with equal bulk rheological properties. The stress fields of the specimens under decompression computed by finite element analysis shows that the presence of satellite bubbles beneath a large bubble induced the stress concentration. On the basis of the obtained results, a new mechanism for brittle-like fragmentation is proposed. In the proposed scenario, the second nucleation of bubbles near the fragmentation surface is an essential process for the advancement of fragmentation in an upward magma flow in a volcanic conduit.
Global-Scale Patterns of Forest Fragmentation
Directory of Open Access Journals (Sweden)
Kurt Riitters
2000-12-01
Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.
Global-scale patterns of forest fragmentation
Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.
2000-01-01
We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.
International Nuclear Information System (INIS)
Mons, Michel
1988-01-01
In this research thesis, the author reports the use of laser resonance-enhanced multi-photon ionization and of time-of-flight mass spectrometry for a detailed characterization of fragments produced by a photo-dissociation process. The author more particularly addressed the case of a NO 2 molecule excited at low energies above the dissociation threshold. In the first part, the author discusses issues and problems related to molecular photo-dissociation. In the second part, he presents the developed method and shows that the combined use of both techniques allows a precise characterisation of photo-fragments in terms of internal or translational energies as well as in terms of angle distributions. Finally, the author presents and discusses results obtained in the case of NO 2 [fr
Fragman: an R package for fragment analysis.
Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan
2016-04-21
Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.
Advances in fragment-based drug discovery platforms.
Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya
2009-11-01
Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.
Temperatures of fragment kinetic energy spectra
International Nuclear Information System (INIS)
Bauer, W.
1995-01-01
Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework
Aortic microcalcification is associated with elastin fragmentation in Marfan syndrome.
Wanga, Shaynah; Hibender, Stijntje; Ridwan, Yanto; van Roomen, Cindy; Vos, Mariska; van der Made, Ingeborg; van Vliet, Nicole; Franken, Romy; van Riel, Luigi Amjg; Groenink, Maarten; Zwinderman, Aeilko H; Mulder, Barbara Jm; de Vries, Carlie Jm; Essers, Jeroen; de Waard, Vivian
2017-11-01
Marfan syndrome (MFS) is a connective tissue disorder in which aortic rupture is the major cause of death. MFS patients with an aortic diameter below the advised limit for prophylactic surgery (elastin fragments play a causal role in aortic calcification in MFS, and that microcalcification serves as a marker for aortic disease severity. To address this hypothesis, we analysed MFS patient and mouse aortas. MFS patient aortic tissue showed enhanced microcalcification in areas with extensive elastic lamina fragmentation in the media. A causal relationship between medial injury and microcalcification was revealed by studies in vascular smooth muscle cells (SMCs); elastin peptides were shown to increase the activity of the calcification marker alkaline phosphatase (ALP) and reduce the expression of the calcification inhibitor matrix GLA protein in human SMCs. In murine Fbn1 C1039G/+ MFS aortic SMCs, Alpl mRNA and activity were upregulated as compared with wild-type SMCs. The elastin peptide-induced ALP activity was prevented by incubation with lactose or a neuraminidase inhibitor, which inhibit the elastin receptor complex, and a mitogen-activated protein kinase kinase-1/2 inhibitor, indicating downstream involvement of extracellular signal-regulated kinase-1/2 (ERK1/2) phosphorylation. Histological analyses in MFS mice revealed macrocalcification in the aortic root, whereas the ascending aorta contained microcalcification, as identified with the near-infrared fluorescent bisphosphonate probe OsteoSense-800. Significantly, microcalcification correlated strongly with aortic diameter, distensibility, elastin breaks, and phosphorylated ERK1/2. In conclusion, microcalcification co-localizes with aortic elastin degradation in MFS aortas of humans and mice, where elastin-derived peptides induce a calcification process in SMCs via the elastin receptor complex and ERK1/2 activation. We propose microcalcification as a novel imaging marker to monitor local elastin degradation and
The ways and means of fragment-based drug design.
Doak, Bradley C; Norton, Raymond S; Scanlon, Martin J
2016-11-01
Fragment-based drug design (FBDD) has emerged as a mainstream approach for the rapid and efficient identification of building blocks that can be used to develop high-affinity ligands against protein targets. One of the strengths of FBDD is the relative ease and low cost of the primary screen to identify fragments that bind. However, the fragments that emerge from primary screens often have low affinities, with K D values in the high μM to mM range, and a significant challenge for FBDD is to develop the initial fragments into more potent ligands. Successful fragment elaboration often requires co-structures of the fragments bound to their target proteins, as well as a range of biophysical and biochemical assays to track potency and efficacy. These challenges have led to the development of specific chemical strategies for the elaboration of weakly-binding fragments into more potent "hits" and lead compounds. In this article we review different approaches that have been employed to meet these challenges and describe some of the strategies that have resulted in several fragment-derived compounds entering clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.
Temporal change in fragmentation of continental US forests
James D. Wickham; Kurt H. Riitters; Timothy G. Wade; Collin Homer
2008-01-01
Changes in forest ecosystem function and condition arise from changes in forest fragmentation. Previous studies estimated forest fragmentation for the continental United States (US). In this study, new temporal land-cover data from the National Land Cover Database (NLCD) were used to estimate changes in forest fragmentation at multiple scales for the continental US....
Inclusive breakup of three-fragment weakly bound nuclei
International Nuclear Information System (INIS)
Carlson, B.V.; Frederico, T.; Hussein, M.S.
2017-01-01
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Inclusive breakup of three-fragment weakly bound nuclei
Energy Technology Data Exchange (ETDEWEB)
Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)
2017-04-10
The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.
Conceptual Analysis of Fission Fragment Magnetic Collimator Reactors
International Nuclear Information System (INIS)
Tsvetkov, Pavel V.; Parish, Theodore A.
2002-01-01
As part of the current research work within the US DOE NERI Direct Electricity Conversion (DEC) Project on methods for utilizing direct electricity conversion in nuclear reactors, a detailed study of a Fission Fragment Magnetic Collimator Reactor (FFMCR) has been performed. The FFMCR concept is an advanced DEC system that combines advantageous design solutions proposed for application in both fission and fusion reactors. The present study was focused on determining the electrical efficiency and other important operational aspects of the FFMCR concept. In principle, acceptable characteristics have been demonstrated, and results obtained are presented in the paper. Technological visibility of the FFMCR concept and required further design development are discussed. Preliminary characteristics of the promising design are outlined. (authors)
Agricultural matrices affect ground ant assemblage composition inside forest fragments.
Directory of Open Access Journals (Sweden)
Diego Santana Assis
Full Text Available The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates; sugarcane (3; and pasture (3. At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart. Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.
Agricultural matrices affect ground ant assemblage composition inside forest fragments.
Assis, Diego Santana; Dos Santos, Iracenir Andrade; Ramos, Flavio Nunes; Barrios-Rojas, Katty Elena; Majer, Jonathan David; Vilela, Evaldo Ferreira
2018-01-01
The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices) on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates); sugarcane (3); and pasture (3). At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart). Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.
Energy Technology Data Exchange (ETDEWEB)
Amouroux, V
1996-12-17
We study light fragment production in Au + Au collisions at energies between 150 and 400 A.MeV. Experimental data are extracted from Phase I experiments performed with the FOPI detector at GSI-Darmstadt. We first give centrality criteria and the method used in order to have an evaluation of the impact parameter; that permit comparison between experiment and IQMD or FREESCO models. A first study concerns charge distributions and the reduced variance {gamma}{sub 2}. We observe that the amplitude of the reduced variance decreases rapidly as the centrality of the collision increases; this last point shows that there is no liquid-gas phase transition in central collisions. Such a conclusion agrees with theoretical studies made by the Nantes group concerning fragment formation. A second part concerns a systematic study of differential cross sections of fragment production. We show that IQMD model gives a good qualitative agreement with experimental data; nevertheless, charge distributions are not correctly reproduced by theory. A study of the parameter which fix the width of the Gaussian associated with the nucleons of the interacting system can improve the shape of the charge distributions. Finally, we give at the end of the thesis a systematic presentation of experimental invariant cross sections of fragment production. (author) 80 refs.
Soft and Hard Tissue Management in Implant Therapy—Part I: Surgical Concepts
Directory of Open Access Journals (Sweden)
Antonio D'Addona
2012-01-01
Full Text Available Implant therapy has become a reliable and predictable treatment alternative for the replacement of missing teeth with conventional removable and fixed partial dentures. Recently though, in the pursuit for improved esthetics, the literature has dedicated a considerable amount of its research on the successful maintenance and regeneration of the surrounding gingiva and bone, which are lost following extraction of a tooth. Thoroughly analyzing the anatomic situation and well-planned treatment has become a requirement, because incorrectly planned and positioned implants may jeopardize long-term esthetic and functional prognosis. In addition, many types of biocompatible materials, autogenous hard and soft tissue grafts, and different surgical techniques have been developed, and their viability has been investigated. As a result, implant specialists have gained a greater understanding of the dynamics and anatomical and biological concepts of the periodontium and peri-implant tissues both at the surgical and prosthetic phases of treatment, which contributes to better soft and hard tissue management (SHTM. This may further contribute to achieving a superior final result which is obtained by having a harmonious soft tissue profile, a correctly placed and contoured final restoration, and the reestablishment of masticatory function and phonetics.
Fragmentation and structure of silicon microclusters
International Nuclear Information System (INIS)
Feuston, B.P.; Kalia, R.K.; Vashishta, P.
1987-01-01
It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature
Modelling of the PELE fragmentation dynamics
Verreault, J.
2014-05-01
The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.
Modelling of the PELE fragmentation dynamics
International Nuclear Information System (INIS)
Verreault, J
2014-01-01
The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Projectile rapidity dependence in target fragmentation
International Nuclear Information System (INIS)
Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.
1979-01-01
The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references
The split comets: gravitational interaction between the fragments
International Nuclear Information System (INIS)
Sekanina, Z.
1979-01-01
The n-body computer program by Schubart and Stumpff (1966) has been slightly modified to study the gravitational interaction between two fragments of a split comet nucleus in the sun's gravitational field. All calculations refer to the orbit of Comet West (1976 VI), the velocity of separation of the fragments is assumed to be equal in magnitude to the velocity of escape from the parent nucleus, and the numerical integration of the relative motion of one fragment (called the companion) with respect to the other (principal fragment) is carried over the period of 200 days from separation. (Auth.)
Directory of Open Access Journals (Sweden)
Vladimir Isachenko
2016-11-01
Full Text Available Abstract Background Phosphatidylserine is the phospholipid component which plays a key role in cell cycle signaling, specifically in regards to necrosis and apoptosis. When a cell affected by some negative factors, phosphatidylserine is no longer restricted to the intracellular side of membrane and can be translocated to the extracellular surface of the cell. Cryopreservation can induce translocation of phosphatidylserine in response to hypoxia, increasing intracellular Ca2+, osmotic disruption of cellular membranes, generation of reactive oxygen species and lipid peroxidation. As such the aim of this study was to test the level of phosphatidylserine translocation in frozen human medulla-contained and medulla-free ovarian tissue fragments. Methods Ovarian fragments from twelve patients were divided into small pieces of two types, medulla-free cortex (Group 1, n = 42, 1.5–3.0 × 1.5–3.0 × 0.5–0.8 mm and cortex with medulla (Group 2, n = 42, 1.5–3.0 × 1.5–3.0 × 1.5–2.0 mm, pre-cooled after operative removal to 5 °C for 24 h and then conventionally frozen with 6 % dimethyl sulfoxide, 6 % ethylene glycol and 0.15 M sucrose in standard 5-ml cryo-vials. After thawing at +100 °C and step-wise removal of cryoprotectants in 0.5 M sucrose, ovarian pieces were xenografted to SCID mice for 45 days. The efficacy of tissues cryopreservation, taking into account the presence or absence of medulla, was evaluated by the development of follicles (histology with hematoxylin-eosin and through the intensity of translocation of phosphatidylserine (FACS with FITC-Annexin V and Propidium Iodide. Results For Groups 1 and 2, the mean densities of follicles per 1 mm3 were 9.8, and 9.0, respectively. In these groups, 90 and 90 % preantral follicles appeared morphologically normal. However, FACS analysis showed a significantly decreased intensity of translocation of phosphatidylserine (FITC-Annexin V positive after
Ou-Lee, T M; Turgeon, R; Wu, R
1988-01-01
The interaction between the DNA sequences of an alpha-amylase (EC 3.2.1.1) gene and a tissue-specific factor induced in rice (Oryza sativa L.) aleurone tissue by gibberellin was studied. DNA mobility-shift during electrophoresis indicated that a 500-base-pair sequence (HS500) of a rice alpha-amylase genomic clone (OSamy-a) specifically interacted with a factor from gibberellin-induced rice aleurone tissue. The amount of complex formed between the HS500 DNA fragment and the gibberellin-induced...
International Nuclear Information System (INIS)
Walker, K.Z.; Seymour-Munn, K.; Axiak, S.M.; Raison, R.L.; Basten, A.; Towson, J.E.; Bautovitch, G.J.; Morris, J.
1988-01-01
Monoclonal antibody (MoAb) fragments are known to have advantages over intact immunoglobulins for radioimmunoscintigraphy. It is less clear whether they are as effective in the delivery of radioimmunotherapy. The imaging and dosimetric properties of an intact MoAb, K-1-21, reactive against human kappa light chains (LC) were compared with that of its F(ab') 2 and Fab fragments using a normal rat model system. Two days after injection of 131 I-K-1-21 into rats bearing antigen-sepharose implants, gamma camera images showed specific localization of the MoAb to the target (kappa LC) but not to the control (lambda LC) implant. Better images were obtained with K-1-21 F(ab') 2 than with Fab or intact antibody. Mean kappa implant: blood ratios were 8.6 ± 3.9 for Fab, 7.9 ± 1.8 for F(ab') 2 and 2.0 ± 0.3 for intact K-1-21. The improvement associated with the use of 131 I-K-1-21 fragments was, however, achieved at the expense of lower absolute values of activity at the target site. Thus the absorbed dose delivered to the implant by the intact K-1-21 was double that delivered with F(ab') 2 and six times that delivered with Fab. As intact K-1-21 also delivered a greater radiation dose to normal tissues, F(ab') 2 fragments may have the greatest overall advantages for therapy with radionuclide MoAb conjugates. (author)
International Nuclear Information System (INIS)
Li, B.
2010-01-01
Since the dissociation of small molecules might play key roles in the understanding of radiation induced damages of living tissues at the primary steps and at the molecular levels, fragmentation dynamics of small biomolecules have drawn much attention. The knowledge of the internal energy is of fundamental importance for understanding its fragmentation dynamics following external excitation. For a long time however, it was difficult to measure this parameter in coincidence with the fragmentation patterns until the development of CIDEC (Collision Induced Dissociation under Energy Control) method in 2007. In this work, the CIDEC method was extended to study the fragmentation of gas-phase biomolecules adenine (Ade: H 5 C 5 N 5 ) and porphyrin chloride FeTPPCl (C 44 H 28 N 4 FeCl). The population distribution for each dissociation channel as a function of the excitation energy of the parent molecular ions at a well-determined initial charge state has been experimentally determined, which could shed some light on the fragmentation dynamics of these molecules. In collisions between Cl + and Ade at 3 keV, the fragmentation pattern of Ade 2+ is dominated by the loss of H 2 CN + and the successive emission of HCN. The energy distribution of the parent dication confirms the successive emission dynamics. A specific decay channel is observed, i.e. the emission of a charged H 2 CN + followed by the emission of HC 2 N 2 . The measured mean excitation energies of this channel and other competitive channels are compared. In Kr 8+ - FeTPPCl collisions at 80 keV, parent ions FeTPPCL 1+,2+,3+ are observed, along with the corresponding decay patterns. It is found that, in the first step the dominant low-energy-cost decay channel is the emission of Cl 0 independent of the initial charge state of FeTPPCl r+ . For the resulted dication FeTPP 2+ , the dominant fragmentation channel is the neutral evaporation; for the tri-cation however, the dominant fragmentation channel is the
Chimeric recombinant antibody fragments in cardiac troponin I immunoassay.
Hyytiä, Heidi; Heikkilä, Taina; Brockmann, Eeva-Christine; Kekki, Henna; Hedberg, Pirjo; Puolakanaho, Tarja; Lövgren, Timo; Pettersson, Kim
2015-03-01
To introduce a novel nanoparticle-based immunoassay for cardiac troponin I (cTnI) utilizing chimeric antibody fragments and to demonstrate that removal of antibody Fc-part and antibody chimerization decrease matrix related interferences. A sandwich-type immunoassay for cTnI based on recombinant chimeric (mouse variable/human constant) antigen binding (cFab) antibodies and intrinsically fluorescent nanoparticles was developed. To test whether using chimeric antibody fragments helps to avoid matrix related interferences, samples (n=39) with known amounts of triglycerides, bilirubin, rheumatoid factor (RF) or human anti-mouse antibodies (HAMAs) were measured with the novel assay, along with a previously published nanoparticle-based research assay with the same antibody epitopes. The limit of detection (LoD) was 3.30ng/L. Within-laboratory precision for 29ng/L and 2819ng/L cTnI were 13.7% and 15.9%, respectively. Regression analysis with Siemens ADVIA Centaur® yielded a slope (95% confidence intervals) of 0.18 (0.17-1.19) and a y-intercept of 1.94 (-1.28-3.91) ng/L. When compared to a previously published nanoparticle-based assay, the novel assay showed substantially reduced interference in the tested interference prone samples, 15.4 vs. 51.3%. A rheumatoid factor containing sample was decreased from 241ng/L to
Momentum sum rules for fragmentation functions
International Nuclear Information System (INIS)
Meissner, S.; Metz, A.; Pitonyak, D.
2010-01-01
Momentum sum rules for fragmentation functions are considered. In particular, we give a general proof of the Schaefer-Teryaev sum rule for the transverse momentum dependent Collins function. We also argue that corresponding sum rules for related fragmentation functions do not exist. Our model-independent analysis is supplemented by calculations in a simple field-theoretical model.
21 CFR 1271.150 - Current good tissue practice requirements.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Current good tissue practice requirements. 1271... HUMAN CELLS, TISSUES, AND CELLULAR AND TISSUE-BASED PRODUCTS Current Good Tissue Practice § 1271.150 Current good tissue practice requirements. (a) General. This subpart D and subpart C of this part set...
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Human papillomavirus detection in paraffin-embedded colorectal cancer tissues.
Tanzi, Elisabetta; Bianchi, Silvia; Frati, Elena R; Amicizia, Daniela; Martinelli, Marianna; Bragazzi, Nicola L; Brisigotti, Maria Pia; Colzani, Daniela; Fasoli, Ester; Zehender, Gianguglielmo; Panatto, Donatella; Gasparini, Roberto
2015-01-01
Human papillomavirus (HPV) has a well-recognized aetiological role in the development of cervical cancer and other anogenital tumours. Recently, an association between colorectal cancer and HPV infection has been suggested, although this is still controversial. This study aimed at detecting and characterizing HPV infection in 57 paired biopsies from colorectal cancers and adjacent intact tissues using a degenerate PCR approach. All amplified fragments were genotyped by means of sequencing. Overall, HPV prevalence was 12.3 %. In particular, 15.8 % of tumour tissues and 8.8 % of non-cancerous tissue samples were HPV DNA-positive. Of these samples, 85.7 % were genotyped successfully, with 41.7 % of sequences identifying four genotypes of the HR (high oncogenic risk) clade Group 1; the remaining 58.3 % of HPV-genotyped specimens had an unclassified β-HPV. Examining additional cases and analysing whole genomes will help to outline the significance of these findings.
Rock fragmentation control in opencast blasting
Directory of Open Access Journals (Sweden)
P.K. Singh
2016-04-01
Full Text Available The blasting operation plays a pivotal role in the overall economics of opencast mines. The blasting sub-system affects all the other associated sub-systems, i.e. loading, transport, crushing and milling operations. Fragmentation control through effective blast design and its effect on productivity are the challenging tasks for practicing blasting engineer due to inadequate knowledge of actual explosive energy released in the borehole, varying initiation practice in blast design and its effect on explosive energy release characteristic. This paper describes the result of a systematic study on the impact of blast design parameters on rock fragmentation at three mines in India. The mines use draglines and shovel–dumper combination for removal of overburden. Despite its pivotal role in controlling the overall economics of a mining operation, the expected blasting performance is often judged almost exclusively on the basis of poorly defined parameters such as powder factor and is often qualitative which results in very subjective assessment of blasting performance. Such an approach is very poor substitutes for accurate assessment of explosive and blasting performance. Ninety one blasts were conducted with varying blast designs and charging patterns, and their impacts on the rock fragmentation were documented. A high-speed camera was deployed to record the detonation sequences of the blasts. The efficiency of the loading machines was also correlated with the mean fragment size obtained from the fragmentation analyses.
ACFIS: a web server for fragment-based drug discovery
Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu
2016-01-01
In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown ‘chemical space’ to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for ‘chemical space’, which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. PMID:27150808
The effective fragment molecular orbital method for fragments connected by covalent bonds.
Directory of Open Access Journals (Sweden)
Casper Steinmann
Full Text Available We extend the effective fragment molecular orbital method (EFMO into treating fragments connected by covalent bonds. The accuracy of EFMO is compared to FMO and conventional ab initio electronic structure methods for polypeptides including proteins. Errors in energy for RHF and MP2 are within 2 kcal/mol for neutral polypeptides and 6 kcal/mol for charged polypeptides similar to FMO but obtained two to five times faster. For proteins, the errors are also within a few kcal/mol of the FMO results. We developed both the RHF and MP2 gradient for EFMO. Compared to ab initio, the EFMO optimized structures had an RMSD of 0.40 and 0.44 Å for RHF and MP2, respectively.
arXiv Generalized Fragmentation Functions for Fractal Jet Observables
Elder, Benjamin T.; Thaler, Jesse; Waalewijn, Wouter J.; Zhou, Kevin
2017-06-15
We introduce a broad class of fractal jet observables that recursively probe the collective properties of hadrons produced in jet fragmentation. To describe these collinear-unsafe observables, we generalize the formalism of fragmentation functions, which are important objects in QCD for calculating cross sections involving identified final-state hadrons. Fragmentation functions are fundamentally nonperturbative, but have a calculable renormalization group evolution. Unlike ordinary fragmentation functions, generalized fragmentation functions exhibit nonlinear evolution, since fractal observables involve correlated subsets of hadrons within a jet. Some special cases of generalized fragmentation functions are reviewed, including jet charge and track functions. We then consider fractal jet observables that are based on hierarchical clustering trees, where the nonlinear evolution equations also exhibit tree-like structure at leading order. We develop a numeric code for performing this evolution and study its phen...
Impact fragmentation of a brittle metal compact
Tang, Megan; Hooper, Joseph P.
2018-05-01
The fragmentation behavior of a metal powder compact which is ductile in compression but brittle in tension is studied via impact experiments and analytical models. Consolidated metal compacts were prepared via cold-isostatic pressing of powder at 380 MPa followed by moderate annealing at 365 °C. The resulting zinc material is ductile and strain-hardening in high-rate uniaxial compression like a traditional metal, but is elastic-brittle in tension with a fracture toughness comparable to a ceramic. Cylindrical samples were launched up to 800 m/s in a gas gun into thin aluminum perforation targets, subjecting the projectile to a complex multiaxial and time-dependent stress state that leads to catastrophic fracture. A soft-catch mechanism using low-density artificial snow was developed to recover the impact debris, and collected fragments were analyzed to determine their size distribution down to 30 μm. Though brittle fracture occurs along original particle boundaries, no power-law fragmentation behavior was observed as is seen in other low-toughness materials. An analytical theory is developed to predict the characteristic fragment size accounting for both the sharp onset of fragmentation and the effect of increasing impact velocity.
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Matyasova, J.; Skalka, M.; Cejkova, M.
1979-01-01
The chromatin changes are reevaluated occurring in lymphoid tissues of mice treated with alkylating agents of the nitrogen-mustard type in relation to recent evidence on the nucleosomal organization of chromatin and to our new data on the regular character of chromatin degradation in lymphoid tissues of irradiated mice. DNA was isolated from nuclei at various intervals (1 to 18 h) after treatment of mice and subjected to gel electrophoresis in polyacrylamide gels. Thymus chromatin from treated mice has been shown to degrade in a regular fashion and to yield discrete DNA fragments, resembling those that originate in lymphoid tissues of irradiated mice or in thymus nuclei digested with micrococcal nuclease in vitro. With increasing interval after treatment higher amounts of smaller DNA fragments appear. Chromatin in spleen cells responds to treatment in a similar way, whilst no degradation in vivo takes place in liver chromatin. Chromatin of LS/BL lymphosarcoma cells in mice treated with alkylating agents or with irradiation suffers from a similar regular degradation. The results stress the significance of the action of liberated or activated endogenous nuclease(s) in the development of chromatin damage in lymphoid cells after treatment with alkylating agents. (author)
Armstrong, P B; Armstrong, M T
1981-08-01
The identity of the chemical factors controlling the spreading behaviour of sheets of cells was examined in organ culture. When aggregates of two dissimilar tissues are apposed in organ culture, one tissue spreads reproducibly over the surface of the second. The present study employed indirect immunofluorescent localization techniques to evaluate the hypothesis that the spreading behaviour of chick embryonic heart tissue in culture is dominated by the presence or absence of the cell-surface and extracellular matrix protein fibronectin in the surface layers of the aggregates. Specifically, the hypothesis proposes that aggregates that display surface fibronectin earlier after culturing and/or in higher quantities segregate internally to aggregates that are slower to develop a surface layer of fibronectin or in which this layer contains reduced amounts of fibronectin. The hypothesis has been supported for 3 categories of behaviour of chick embryo heart tissue: (1) myocyte aggregates spread over myocyte aggregates containing a 20% admixture of heart fibroblasts, which in turn spread over heart fibroblast aggregates; (2) 5-day embryonic ventricle-tissue fragments maintained in culture for 0.5 days spread over ventricle fragments cultured for 2.5 days; and (3) 2-day embryonic ventricle spreads over 5-day ventricle. In all these situations, the aggregate type that segregates to an internal position displays more fibronectin at its surface than aggregate types that spread to occupy an external position. Evidence is presented that the fibronectin in heart tissue aggregates is elaborated by heart fibroblasts.
An improved algorithm for MFR fragment assembly
International Nuclear Information System (INIS)
Kontaxis, Georg
2012-01-01
A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.
Analysis of the fragmentation of hot drops with film boiling in a water flow
International Nuclear Information System (INIS)
Malmazet, Erik de
2009-01-01
The goal of this work is to study different aspects of the fragmentation of very hot drops placed in a uniform flow, a phenomenon related to vapor explosion studies. First, a theoretical study of the isothermal hydrodynamic fragmentation of drops by the Boundary Layer Stripping (BLS) mechanism is done by developing two models. The first model, contrary to past studies which dismissed the BLS, includes deformation and acceleration effects and this is shown to greatly enhance the mass loss by BLS, which enables this mechanism to become a much more effective mechanism when the external flow is gaseous. But it is still ineffective in the liquid case. The second model describes transient aspects of the BLS, and by coupling it with a stripping criteria for the internal boundary layer, it is possible to predict the time of the initiation of fragmentation. Then, a model for film boiling over horizontal cylinders and axisymmetric bodies which is able to properly describe the inertial and convection terms in the vapor flow is presented. This has never been done before, although these terms cannot be neglected in physical conditions close to vapor explosions. The model is able to predict all the experimental results of TREPAM, the only existing forced convection film boiling experiment in conditions close to a vapor explosion, and which results could not be predicted by other models. In the last part, an experimental study of the fragmentation of hot tin drops in a water flow which uses digital fast camera and flash X ray imagery is presented. This study has allowed the observation of several new features of the drop fragmentation mechanism. (author) [fr
Modelling the fragmentation mechanisms
International Nuclear Information System (INIS)
Bougault, R.; Durand, D.; Gulminelli, F.
1998-01-01
We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way
Limestone fragmentation and attrition during fluidized bed oxyfiring
Energy Technology Data Exchange (ETDEWEB)
Fabrizio Scala; Piero Salatino [Istituto di Ricerche sulla Combustione - CNR, Napoli (Italy)
2010-04-15
Attrition/fragmentation of limestone under simulated fluidized bed oxyfiring conditions was investigated by means of an experimental protocol that had been previously developed for characterization of attrition/fragmentation of sorbents in air-blown atmospheric fluidized bed combustors. The protocol was based on the use of different and mutually complementary techniques. The extent and pattern of attrition by surface wear in the dense phase of a fluidized bed were assessed in experiments carried out with a bench scale fluidized bed combustor under simulated oxyfiring conditions. Sorbent samples generated during simulated oxyfiring tests were further characterized from the standpoint of fragmentation upon high velocity impact by means of a purposely designed particle impactor. Results showed that under calcination-hindered conditions attrition and fragmentation patterns are much different from those occurring under air-blown atmospheric combustion conditions. Noteworthy, attrition/fragmentation enhanced particle sulfation by continuously regenerating the exposed particle surface. 13 refs., 8 figs.