WorldWideScience

Sample records for tippkoreograaf patrick chen

  1. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  2. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...

  3. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

  4. Chen's inversion formula

    International Nuclear Information System (INIS)

    Hughes, B.D.; Frankel, N.E.; Ninham, B.W.

    1990-01-01

    An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs

  5. Mendie, Patrick Johnson

    African Journals Online (AJOL)

    Mendie, Patrick Johnson. Vol 15, No 2 (2015) - Articles An examination of the nexus between Thomas Hobbes‟ concept of human nature and theory of the state. Abstract. ISSN: 1119-443X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  6. Interview with Patrick Blackburn

    DEFF Research Database (Denmark)

    Hendricks, Vincent F.; Hansen, Pelle Guldborg

    2005-01-01

    In 2005 Patrick Blackburn, who is Directeur de Recherche for INRIA Lorraine (France's national organization for research in computer science), published together with Johan Bos (Università di Roma "La Sapienza") the book Representation and Inference for Natural Language: A First Course in Computa...

  7. Patrick Moore the autobiography

    CERN Document Server

    Moore, Patrick

    2011-01-01

    Throughout his distinguished career, Patrick Moore has, without a doubt, done more to raise the profile of astronomy among the British public than any other figure in the scientific world. As the presenter of The Sky at Night on BBC television for nearly 50 years he was honored with an OBE in 1968 and a CBE in 1988. In 2001 he was knighted 'for services to the popularisation of science and to broadcasting'. The BBC first aired The Sky at Night in April 1957 and it is now in the record books as the world's longest running TV series with the same presenter. He is also the author of over 60

  8. Horseshoes in modified Chen's attractors

    International Nuclear Information System (INIS)

    Huang Yan; Yang Xiaosong

    2005-01-01

    In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map

  9. Introduction: Patrick Modiano's Dora Bruder

    Directory of Open Access Journals (Sweden)

    Richard J. Golsan

    2007-06-01

    Full Text Available After establishing a reputation as a literary enfant terrible in the late 1960s and early 1970s, Patrick Modiano is now firmly ensconced as a Grand Old Man (perhaps the Grand Old Man of French letters and arguably as France's greatest living novelist…

  10. Patrick Durand (1953 – 2014)

    CERN Multimedia

    2014-01-01

    Patrick arrived at CERN in January 1994 on a temporary contract in the Finance Department (previously FI), where he worked on the packaging of items for the Meyrin self-service stores (located at the time in Building 113) so that goods could be identified using barcodes, just like in a supermarket.   His hard work and initiative were recognised by CERN’s service provider, ISS, who gave him a permanent contract. Following the closure of the self-service stores, Patrick joined the Recuperation and Sales Service, still within the FI Department, where he worked on dismantling many different installations and the disposal of various goods. Here too he impressed his supervisors and departmental managers and became a team leader and, soon after, deputy to the Head of the Sales Service. Patrick’s sociable nature led him to become a member of the CERN Pétanque Club, where he put his talents as a chef to good use by supplying and organising the post-competition meals. ...

  11. Patrick Couvreur: inspiring pharmaceutical innovation.

    Science.gov (United States)

    Stanwix, Hannah

    2014-05-01

    Patrick Couvreur speaks to Hannah Stanwix, Managing Comissioning Editor: Professor Patrick Couvreur received his pharmacy degree from the Université Catholique de Louvain (Louvain-la-Neuve, Belgium) in 1972. He holds a PhD in pharmaceutical technology from the same university and completed a postdoctoral fellowship at the Eidgenössische Technische Hochschule (Zürich, Switzerland). Since 1984, Professor Couvreur has been Full Professor of Pharmacy at the Paris-Sud University (Paris, France) and was holder of the Chair of Innovation Technologique at the prestigious Collège de France (Paris, France). He has published more than 450 peer-reviewed articles and has an H-index of 73, with over 19,000 citations. Professor Coureur has been recognized by numerous national and international awards, including the 2004 Pharmaceutical Sciences World Congress Award, the prestigious Host Madsen Medal, the Prix Galien, the European Pharmaceutical Scientist Award 2011 from the European Federation of Pharmaceutical Sciences, the Médaille de l'Innovation from the Centre National de la Recherche Scientifique, and recently the European Inventor Award 2013 from the European Patent Office.

  12. Mechanical analysis of Chen chaotic system

    International Nuclear Information System (INIS)

    Liang, Xiyin; Qi, Guoyuan

    2017-01-01

    The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

  13. Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

    African Journals Online (AJOL)

    Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

  14. Titanisierung von Implantatoberflächen

    Science.gov (United States)

    Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.

    Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.

  15. Eetikata edu ei saavuta / Patrick Dixon

    Index Scriptorium Estoniae

    Dixon, Patrick

    2003-01-01

    Ettevõte on edu saavutanud siis, kui ta on võitnud nii selle töötajate ja juhtide kui avalikkuse usalduse, leiab autor. Lisa: Usalduse loomine vajab igapäevast järjekindlat tööd ; Kes on kes: Patrick Dixon

  16. Chaos control of Chen chaotic dynamical system

    International Nuclear Information System (INIS)

    Yassen, M.T.

    2003-01-01

    This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

  17. Impulsive synchronization of Chen's hyperchaotic system

    International Nuclear Information System (INIS)

    Haeri, Mohammad; Dehghani, Mahsa

    2006-01-01

    In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

  18. Patrick Janot receives the CNRS silver medal

    CERN Multimedia

    2005-01-01

    Patrick Janot during the award ceremony. (Photo Schwemling, Paris) On 25 November, Patrick Janot of the CERN Physics Department received the CNRS silver medal for IN2P3 (Institut national de physique nucléaire et de physique des particules). This prize, one of the most prestigious awarded by the French research centre, is given to scientists for the 'originality, quality and importance of their work, as recognised both nationally and internationally'. Patrick Janot joined the ALEPH collaboration, one of the four experiments at LEP, then under construction, in 1987. First a CERN Fellow, he went on to work for the CNRS at LAL in 1989. Together with his team, he developed innovative algorithms for the reconstruction of events. This work and others earned him the bronze CNRS medal in 1993, which is awarded to scientists for their first achievements. In 1997, he became a permanent physicist at CERN, where he continued to work for ALEPH. He was appointed LEP scientific co-ordinator for the last two years of the ac...

  19. La voz inconformista de Patrick Kavanagh

    Directory of Open Access Journals (Sweden)

    Maximiliano Brina

    2015-03-01

    Full Text Available Patrick Kavanagh, rural and self-taught poet, stands out among the Irish poets of the early twentieth century for his critical consideration of literary and political nationalist programs. Facing the quasi mythical representation of the peasantry built by the Irish Literary Revival, which was later used by the Republicans as a synthesis of Irishness, Kavanagh offers a unique opinion, ranging between despair and satire. The purpose of this article is to examine, from “The Great Hunger” (1942 and previous poems, the way Kavanagh disassembles this urban vision of the Irish peasantry.

  20. Stability analysis of distributed order fractional chen system.

    Science.gov (United States)

    Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.

  1. Stability Analysis of Distributed Order Fractional Chen System

    Science.gov (United States)

    Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508

  2. Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

    International Nuclear Information System (INIS)

    Park, Ju H.

    2005-01-01

    This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

  3. Chaos in the fractional order Chen system and its control

    International Nuclear Information System (INIS)

    Li Chunguang; Chen Guanrong

    2004-01-01

    In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

  4. Complete synchronization of two Chen-Lee systems

    International Nuclear Information System (INIS)

    Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T

    2008-01-01

    This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach

  5. A simple observer of the generalized Chen chaotic systems

    International Nuclear Information System (INIS)

    Sun, Y.-J.

    2009-01-01

    In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

  6. Comparing numerical methods for the solutions of the Chen system

    International Nuclear Information System (INIS)

    Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

    2007-01-01

    In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

  7. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  8. On a conjecture of Chen-Guo-Wang

    OpenAIRE

    Ning, Bo; Zheng, Yu

    2015-01-01

    Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

  9. Obituary: Patrick L. Nolan (1952-2011)

    Science.gov (United States)

    Digel, Seth

    2011-12-01

    Patrick Lee Nolan died at his home in Palo Alto, California, on November 6, 2011, from complications related to a brain tumor, glioblastoma multiforme, which had been diagnosed less than five months earlier. He was born in Colusa, California, on November 18, 1952. Pat was the only child of John Henry Nolan and Carol Lee Harris Nolan. For most of his childhood they lived in Grass Valley, California, where his father was a butcher and his mother was a surgical nurse. Pat graduated from the California Institute of Technology in 1974 with a B.S. in Physics and completed a Ph.D. at the University of California at San Diego in 1982. His graduate and professional career was devoted to high-energy astronomy. His loss is being keenly felt by his friends and colleagues around the world, including the members of the Chancel Choir of the Menlo Park Presbyterian Church, of which he was a member for 25 years. At U. C. San Diego, Pat worked on construction of the Hard X-ray and Low Energy Gamma Ray Experiment for the first High Energy Astronomy Observatory mission, which was launched in 1977. His Ph.D. thesis, supervised by Prof. Laurence E. Peterson, was based on data from this instrument and addressed variability of the high-energy emission from Cygnus X-1 and other black hole binary systems in the Milky Way. After he completed his Ph.D., Pat took a National Research Council postdoctoral research position at the Naval Research Laboratory in Washington, D.C. He worked there from 1982-1984 developing spectral analysis software and studying gamma-ray bursts using the gamma-ray spectrometer on the Solar Maximum Mission satellite. A paper in Nature setting constraining limits on positron-electron annihilation radiation in the spectra of bursts marked the culmination of his efforts. Pat was hired by Prof. Robert Hofstadter at Stanford University in 1984 to work on the Energetic Gamma-Ray Experiment Telescope (EGRET). As a co-investigator for EGRET, Pat worked on its calorimeter

  10. 'American Psycho': a double portrait of serial yuppie Patrick Bateman

    NARCIS (Netherlands)

    Kooijman, J.; Laine, T.

    2003-01-01

    Kooijman and Laine analyze Mary Harron's "American Psycho," a 2000 film adaptation of the 1980s satirical novel by Bret Easton Ellis in which Patrick Bateman, a narcissistic Wall Street young urban professional ("yuppie"), assumes an alternate identity as a serial killer. The authors examine the

  11. Patrick filmib teismelise tüdruku fantaasiaid / Janno Zõbin

    Index Scriptorium Estoniae

    Zõbin, Janno

    2003-01-01

    Eestis viibib 3 briti režissööri, kes osalevad lühimängufilmide koostööprojektis "The Tyne Tallinn Digital Film Challenge-2003". Lähemalt režissöör Patrick Collertonist ja tema lühimängufilmist "Armuvalu" ("Lovesick")

  12. An interview with Patrick Tam by Kathryn Senior.

    Science.gov (United States)

    Tam, Patrick

    2010-12-01

    Patrick Tam's research is focused on the cellular and molecular mechanisms of body patterning during mouse development. He agreed to be interviewed by Development to talk about his interest in mouse development, new concepts in gastrulation, X-linked diseases and his dream of an African safari.

  13. Response to Patrick Love's "Informal Theory": A Rejoinder

    Science.gov (United States)

    Evans, Nancy J.; Guido, Florence M.

    2012-01-01

    This rejoinder to Patrick Love's article, "Informal Theory: The Ignored Link in Theory-to-Practice," which appears earlier in this issue of the "Journal of College Student Development", was written at the invitation of the Editor. In the critique, we point out the weaknesses of many of Love's arguments and propositions. We provide an alternative…

  14. Profile Interview: Dr. Patrick Dongosolo Kamalo – Consultant ...

    African Journals Online (AJOL)

    Dr. Yohane Gadama (YG), an MMJ intern, interviews Dr. Patrick Dongosolo Kamalo (PDK) on his work as Malawi's only local practicing neurosurgeon, the launch of Blantyre Institute of Neurological Sciences (BINS) and the beginning of Neurosurgery training in Malawi ...

  15. An equilibrium point stabilization strategy for the Chen system

    International Nuclear Information System (INIS)

    Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

    2004-01-01

    The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

  16. Dynamics of fractional-ordered Chen system with delay

    Indian Academy of Sciences (India)

    Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

  17. Generalized projective synchronization between Lorenz system and Chen's system

    International Nuclear Information System (INIS)

    Li Guohui

    2007-01-01

    On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

  18. Alternative implementation of the chaotic Chen-Lee system

    International Nuclear Information System (INIS)

    Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.

    2009-01-01

    The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

  19. Chaos synchronization between Chen system and Genesio system

    International Nuclear Information System (INIS)

    Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

    2007-01-01

    This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

  20. Patrick Pearse: Psychobiographical Reflections on an Enigmatic, Paradoxical Personality

    Directory of Open Access Journals (Sweden)

    Orr, Patricia Meredith

    2016-06-01

    Full Text Available To date historians have focused almost exclusively on Patrick Pearse’s key role in the 1916 Easter Rising to the extent that there is much less information about his personality development and characteristics. They have portrayed the elusive, paradoxical Patrick as nationalist, revolutionary and martyr or as a flawed and failed human being. Moran, agreeing with comments made at an earlier time by F.S.L. Lyons, suggests that, to have any real understanding of Patrick’s role in the rebellion and the events that led up to it, historians need to focus more attention on understanding the man himself.[1] The approach used in this article is psychobiographical, a methodology that applies psychological theory to biographical information in order to more fully understand an individual’s personality and achievements. In the case of Patrick Pearse the biographical information focuses on consensual aspects of his family background, his life experiences, his role as educator and his emergence as leader and hero. With regard to psychological theory, there are many empirically supported perspectives than could have been applied in this psychobiography. However, for the purposes of this particular article three perspectives have been selected. Drawing on some main tenets of the psychoanalytic, humanistic and trait approaches, the authors hope to provide a broader understanding of the influences and experiences that may have shaped Pearse as son, sibling, peer, educator and ultimately as a main instigator of the 1916 Rising and one of Ireland’s most famous patriots.

  1. [Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

    Science.gov (United States)

    Quan, Xiaohong; Li, Shuqian; Li, Ying

    2017-03-12

    Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

  2. Urban lessons for the modern planner : Patrick Abercrombie and the study of urban development

    NARCIS (Netherlands)

    Dehaene, M.B.M.

    2004-01-01

    As the first editor of the Town Planning Review, Patrick Abercrombie produced a significant number of contributions to early town planning literature. Through the discussion of a great variety of subjects, Abercrombie gradually defined a specific approach towards town planning. Echoing Patrick

  3. Career Development and Social Inclusion at St Patrick's College: A Case Study

    Science.gov (United States)

    Hughes, Cathy

    2010-01-01

    Consistent with the Commonwealth government's social inclusion agenda, the mission statement of St Patrick's College advocates the development and delivery of career development services and programs that promote social justice and social inclusion. This case study describes the evolving career development program at St Patrick's College, which…

  4. Replication and Pedagogy in the History of Psychology IV: Patrick and Gilbert (1896) on Sleep Deprivation

    Science.gov (United States)

    Fuchs, Thomas; Burgdorf, Jeffrey

    2008-01-01

    We report an attempted replication of G. T. W. Patrick and J. A. Gilbert's pioneering sleep deprivation experiment "Studies from the psychological laboratory of the University of Iowa. On the effects of loss of sleep", conducted in 1895/96. Patrick and Gilbert's study was the first sleep deprivation experiment of its kind, performed by some of the…

  5. Eine praktische Anwendung von CMC-Flächen in der Bionik

    OpenAIRE

    Apeltauer, Christian

    2011-01-01

    Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

  6. How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

    Science.gov (United States)

    Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

    2017-01-01

    In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

  7. Ühendriigid otsivad NATOs taas liitlast / Jamie Patrick Shea ; interv. Kadri Liik

    Index Scriptorium Estoniae

    Shea, Jamie Patrick

    2004-01-01

    NATO asepeasekretäri asetäitja räägib alliansi kaitseplaneerimisest, rahukaitsest, arengust, tegevusest Afganistanis, rollist Iraagis, võitlusest terrorismiga, koostööst USA-ga. Lisa: Jamie Patrick Shea

  8. Initial Remedial Action Plan for Expanded Bioventing System BX Service Station, Patrick Air Force Base, Florida

    National Research Council Canada - National Science Library

    1995-01-01

    This initial remedial action plan presents the scope for an expanded bioventing system for in situ treatment of fuel-contaminated soils at the BX Service Station at Patrick Air Force Base (AFB), Florida...

  9. Patrick Blanc'i rippuvad aiad / Urmas Grišakov

    Index Scriptorium Estoniae

    Grišakov, Urmas, 1942-2013

    2010-01-01

    Prantsuse botaaniku ja aiakujundaja Patrick Blanc'i taeva poole kõrguvad rohelised seinad võimaldavad tänapäeval imetleda inimese loovuse ja teadmiste koostöös sündinut. Kujundaja on oma töödega tõestanud, et taimed võivad edukalt kasvada ka vertikaalselt üksteise kohal. Patrick Blanc'i kodulehekülg: www.verticalgardenpatrickblanc.com

  10. Camille Flammarion's the planet Mars as translated by Patrick Moore

    CERN Document Server

    2015-01-01

    Camille Flammarion (1842-1925) began his career at 16 as a human computer under the great mathematician U. J. J. Le Verrier at the Paris Observatory.  He soon tired of the drudgery; he was drawn to more romantic vistas, and at 19 wrote a book on an idea that he was to make his own—the habitability of other worlds.  There followed a career as France’s greatest popularizer of astronomy, with over 60 titles to his credit.  An admirer granted him a chateau at Juvisy-sur-l’Orge, and he set up a first-rate observatory dedicated to the study of the planet Mars. Finally, in 1892, he published his masterpiece, La Planete Mars et ses conditions d’habitabilite, a comprehensive summary of three centuries’ worth of literature on Mars, much of it based on his own personal research into rare memoirs and archives.  As a history of that era, it has never been surpassed, and remains one of a handful of indispensable books on the red planet. Sir Patrick Moore (1923-2012) needs no introduction; his record of popula...

  11. Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

    Science.gov (United States)

    Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

    2018-03-01

    This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

  12. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

    Science.gov (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

    2015-12-11

    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  13. Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

    OpenAIRE

    Spinner, Kaspar H.

    2014-01-01

    Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

  14. Replication and Pedagogy in the History of Psychology IV: Patrick and Gilbert (1896) on Sleep Deprivation

    Science.gov (United States)

    Fuchs, Thomas; Burgdorf, Jeffrey

    2008-05-01

    We report an attempted replication of G. T. W. Patrick and J. A. Gilbert’s pioneering sleep deprivation experiment ‘Studies from the psychological laboratory of the University of Iowa. On the effects of loss of sleep’, conducted in 1895/96. Patrick and Gilbert’s study was the first sleep deprivation experiment of its kind, performed by some of the first formally trained psychologists. We attempted to recreate the original experience in two subjects, using similar apparatus and methodology, and drawing direct comparisons to the original study whenever possible. We argue for a strong influence of an ‘Americanized’ Wundtian psychology on Patrick and Gilbert, a claim supported biographically by their education and by their experimental methods. The replication thus opens interesting new perspectives, which are unlikely to be generated by any other historical approach.

  15. Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

    Directory of Open Access Journals (Sweden)

    Ana Maria Candela

    2015-08-01

    Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

  16. Review of Patrick Chabal, Africa: The Politics of Suffering and Smiling, and Pierre Englebert, Africa: Unity, Sovereignty and Sorrow

    DEFF Research Database (Denmark)

    Kaarsholm, Preben

    2012-01-01

    Review article discussing Patrick Chabal, Africa: The Politics of Suffering and Smiling (London: Zed Books, 2009) and Pierre Englebert, Africa: Unity, Sovereignty and Sorrow (Bodulder, CO: Lynne Rienner, 2009).......Review article discussing Patrick Chabal, Africa: The Politics of Suffering and Smiling (London: Zed Books, 2009) and Pierre Englebert, Africa: Unity, Sovereignty and Sorrow (Bodulder, CO: Lynne Rienner, 2009)....

  17. Hopf bifurcation analysis of Chen circuit with direct time delay feedback

    International Nuclear Information System (INIS)

    Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu

    2010-01-01

    Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

  18. Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

    International Nuclear Information System (INIS)

    Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

    2009-01-01

    This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

  19. 33 CFR 334.560 - Banana River at Patrick Air Force Base, Fla.; restricted area.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Banana River at Patrick Air Force Base, Fla.; restricted area. 334.560 Section 334.560 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.560 Banana...

  20. Turner : ettevõtjaks ei sünnita / Patrick Turner ; interv. Erik Aru

    Index Scriptorium Estoniae

    Turner, Patrick

    2007-01-01

    Intervjuu rahvusvahelise ärikooli INSEAD õppejõu Patrick Turneriga, kes vastab küsimustele, mis puudutavad ettevõtlust. Ta leiab, et nii nagu inimene peab omama luba auto juhtimiseks, peaks luba olema ka firma loomiseks. Vt. samas: Kes ta on?

  1. 1787 and 1776: Patrick Henry, James Madison, and the Revolutionary Legitimacy of the Constitution.

    Science.gov (United States)

    Banning, Lance

    1988-01-01

    Discusses Patrick Henry's and James Madison's opinions on how the U.S. Constitution should be constructed. Describes how Henry introduced a set of substantive objections which were shared by Antifederalists throughout the country and persuaded many Revolutionaries that the Constitution was essentially at odds with the principles of 1776. (BSR)

  2. (dis)Ability and Music Education: Paralympian Patrick Anderson and the Experience of Disability in Music

    Science.gov (United States)

    Bell, Adam Patrick

    2017-01-01

    What does it mean to experience disability in music? Based on interviews with Patrick Anderson--arguably the greatest wheelchair basketball player of all time--this article presents insights into the complexities of the experience of disability in sports and music. Contrasted with music education's tendency to adhere to a medicalized model of…

  3. His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.

  4. TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

    Directory of Open Access Journals (Sweden)

    Denis Dolinar

    2015-12-01

    Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

  5. 76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

    Science.gov (United States)

    2011-11-16

    ... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

  6. 'Transatlantic Print Culture, 1880-1940: Emerging Media, Emerging Modernisms', edited by Ann Ardis and Patrick Collier

    Directory of Open Access Journals (Sweden)

    Janet Floyd

    2009-11-01

    Full Text Available A review of 'Transatlantic Print Culture, 1880-1940: Emerging Media, Emerging Modernisms', edited by Ann Ardis and Patrick Collier (London: Palgrave Macmillan, 2008. Hardback, 259 pages, £50, ISBN 9780554269.

  7. L’analyse hypertextuelle de L’Empreinte à Crusoé de Patrick Chamoiseau // Hypertextual analysis of Patrick Chamoiseau’s Crusoe’s footprint

    Directory of Open Access Journals (Sweden)

    Damian Paweł Masłowski

    2015-12-01

    Full Text Available Over centuries, the subject of robinsonade does not seem to be a thoroughly investigated field in literary criticism. In this context, the role of Defoe’s work is still considered as the fundamental hypotext for every future robinsonade. Nevertheless, the twentieth century brings writers such as Michel Tournier, Patrick Chamoiseau or Yann Martel who began to transvalorize their robinsonades. This postmodern and sometimes postcolonial approach questions the topicality of modern and colonial masterpiece. In his recent novel, Patrick Chamoiseau explores the literary myth of Robinson Crusoe. He indicates the equiponderant influence of Daniel Defoe’s Robinson Crusoe and Michel Tournier’s Friday, or, the Other Island. The purpose of this paper is to analyze said hypertextuality in Crusoe’s footprint. It attempts to focus notably on the dialogue between Chamoiseau and Tournier and to see Michel Tournier’s impact not only as the primordial hypotext in case of Crusoe’s footprint but also as the basic reference for robinsonades reversing the ideological message of Daniel Defoe’s text in the XXth and XXIth centuries.

  8. Book Review: Critical Condition: Replacing Critical Thinking with Creativity by Patrick Finn

    OpenAIRE

    Matthews, Jodie

    2016-01-01

    In Critical Condition: Replacing Critical Thinking with Creativity, Patrick Finn expands upon his 2011 TEDx Talk, ‘Loving Communication’, to suggest that critical thinking implies disapproval and unnecessary judgement originating from a particular mode of Classical thought. Jodie Matthews argues that Finn’s discussion is dependent upon a crudely drawn straw man and neglects to consider thinking critically as a necessary corollary, rather than antithesis, to thinking creatively.

  9. Environmental Assessment for Airfield Safety and Drainage Improvements at Patrick Air Force Base, Florida

    Science.gov (United States)

    2011-12-22

    of Cocoa Beach, and covers approximately 2,000 acres bounded by the Atlantic Ocean on the east and the Banana River on the west. The PAFB airfield...significance for greenhouse gas emissions, but the Federal government recognizes the need to reduce energy consumption and shift to renewable and...Historical and Architectural Documentation Reports of Patrick Air Force Base, Cocoa Beach, Florida. U.S. Army Construction Engineering Research

  10. Patrick Air Force Base integrated resource assessment. Volume 2, Baseline detail

    Energy Technology Data Exchange (ETDEWEB)

    Wahlstrom, R.R.; King, D.A.; Parker, S.A.; Sandusky, W.F.

    1993-08-01

    The US Air Force has tasked the Pacific Northwest Laboratory (PNL), in support of the US Department of Energy (DOE) Federal Energy Management Program (FEMP), to assess energy use at Patrick Air Force Base (AFB). The information obtained from this assessment will be used in identifying energy resource opportunities to reduce overall energy consumption on the base. The primary focus of this report is to assess the current baseline energy consumption at Patrick AFB. It is a comparison report to Volume 1, the Executive Summary, and Volume 3, the Resource Assessment. This assessment requires that information be obtained and characterized for buildings, utilities, energy sources, energy uses, and load profile information to be used to improve the characterization of energy use on the base. The characteristics of electricity, natural gas, and No. 2 fuel oil are analyzed for on-base facilities and housing. The assessment examines basic regional information used to determine energy-use intensity (EUI) values for Patrick AFB facilities by building, fuel type, and energy end use. It also provides a summary of electricity consumption from Florida Power and Light Company (FPL) metered data for 1985-1991. Load profile information obtained from FPL data is presented for the north and south substations for the four seasons of the year, including weekdays and weekends.

  11. Patrick Moore’s observer’s year 366 nights of the universe : 2015-2020

    CERN Document Server

    2015-01-01

    Observers no longer need to wonder what they will turn their attention to each night of the year with this updated text of a beloved favorite from Sir Partick Moore. His night-by-night account of the stars is the best possible guide an observer could ask for, and now includes the latest data for the years 2015-2020, preserving and extending Sir Patrick Moore's legacy. This new edition of his classic text makes it easy to see why Sir Patrick Moore was such a helpful guide to generations of budding astronomers, professional and amateur alike. For every night of the year Patrick gives the reader details of interesting objects that can be seen from Earth. It is a book for people with a wide interest in practical astronomy, those who may not have specialized in a specific area of astronomy and wish to expand their knowledge in all areas. This third edition includes Sir Patrick’s original text but revises its time-sensitive material and adds all of the points of interest that change from year to year, such as e...

  12. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    Directory of Open Access Journals (Sweden)

    Richard K. Payne

    2016-03-01

    Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

  13. Parametric study of the fractional-order Chen-Lee system

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

    2008-08-15

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

  14. Parametric study of the fractional-order Chen-Lee system

    International Nuclear Information System (INIS)

    Tam, L.M.; Tou, W.M.S.

    2008-01-01

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

  15. A numeric-analytic method for approximating the chaotic Chen system

    International Nuclear Information System (INIS)

    Mossa Al-sawalha, M.; Noorani, M.S.M.

    2009-01-01

    The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

  16. Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen

    OpenAIRE

    Thoma, Axel Michael

    2017-01-01

    Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

  17. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    OpenAIRE

    Richard K. Payne

    2016-01-01

    Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

  18. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  19. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

    Science.gov (United States)

    Fan, Ka-Wai

    2018-01-01

    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  20. Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations

    Science.gov (United States)

    Jonsson, J.E.; Afton, A.D.

    2009-01-01

    Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

  1. Le silenciement urbain, ou le silence du ciment. Lire Moi non de Patrick Goujon The Silence of Cement, or Reading Patrick Goujon’s Moi non

    Directory of Open Access Journals (Sweden)

    Claudia Bouliane

    2009-04-01

    Full Text Available Au cours des dernières années, plusieurs romanciers français ont tenté de dépeindre les habitus et les formes de socialisation des jeunes des banlieues. La présente étude porte sur les représentations de l’espace périurbain dans le roman Moi non de Patrick Goujon, œuvre exemplaire de la volonté de donner une valeur symbolique à la vie de ces jeunes. Le roman se présente comme une réévaluation critique des clichés généralement accolés à la banlieue. Pourtant, Moi non propose une lecture ambiguë des alternatives de mobilité sociale offertes aux jeunes des banlieues et des formes de sociabilité qui leur sont propres ; sans les condamner à l’avance, Goujon montre qu’elles tendent à reproduire le schéma tracé par la doxa.Several French novelists have attempted in recent years to portray inner-city youths’ habits and forms of socialization. This study focuses on the representations of inner-city space in Patrick Goujon’s novel Moi non, a novel that epitomizes the desire to give symbolic value to the lives of inner-city youths. The novel presents itself as a critical reassessment of the stereotypes usually associated with inner cities. However, Moi non proposes an ambiguous reading of the forms both of social mobility offered inner-city youths and of their socialization. Without condemning them beforehand, Goujon shows they tend to reproduce the pattern traced by the doxa.

  2. Integration of the geological/engineering model with production performance for Patrick Draw Field, Wyoming

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, S.

    1993-03-01

    The NIPER Reservoir Assessment and Characterization Research Program incorporates elements of the near-term, mid-term and long-term objectives of the National Energy Strategy-Advanced Oil Recovery Program. The interdisciplinary NIPER team focuses on barrier island reservoirs, a high priority class of reservoirs, that contains large amounts of remaining oil in place located in mature fields with a high number of shut-in and abandoned wells. The project objectives are to: (1) identify heterogeneities that influence the movement and trapping of reservoir fluids in two examples of shoreline barrier reservoirs (Patrick Draw Field, WY and Bell Creek Field, MT); (2) develop geological and engineering reservoir characterization methods to quantify reservoir architecture and predict mobile oil saturation distribution for application of targeted infill drilling and enhanced oil recovery (EOR) processes; and (3) summarize reservoir and production characteristics of shoreline barrier reservoirs to determine similarities and differences. The major findings of the research include: (1) hydrogeochemical analytical techniques were demonstrated to be an inexpensive reservoir characterization tool that provides information on reservoir architecture and compartmentalization; (2) the formation water salinity in Patrick Draw Field varies widely across the field and can result in a 5 to 12% error in saturation values calculated from wireline logs if the salinity variations and corresponding resistivity values are not accounted for; and (3) an analysis of the enhanced oil recovery (EOR) potential of Patrick Draw Field indicates that CO[sub 2] flooding in the Monell Unit and horizontal drilling in the Arch Unit are potential methods to recover additional oil from the field.

  3. Integration of the geological/engineering model with production performance for Patrick Draw Field, Wyoming

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, S.

    1993-03-01

    The NIPER Reservoir Assessment and Characterization Research Program incorporates elements of the near-term, mid-term and long-term objectives of the National Energy Strategy-Advanced Oil Recovery Program. The interdisciplinary NIPER team focuses on barrier island reservoirs, a high priority class of reservoirs, that contains large amounts of remaining oil in place located in mature fields with a high number of shut-in and abandoned wells. The project objectives are to: (1) identify heterogeneities that influence the movement and trapping of reservoir fluids in two examples of shoreline barrier reservoirs (Patrick Draw Field, WY and Bell Creek Field, MT); (2) develop geological and engineering reservoir characterization methods to quantify reservoir architecture and predict mobile oil saturation distribution for application of targeted infill drilling and enhanced oil recovery (EOR) processes; and (3) summarize reservoir and production characteristics of shoreline barrier reservoirs to determine similarities and differences. The major findings of the research include: (1) hydrogeochemical analytical techniques were demonstrated to be an inexpensive reservoir characterization tool that provides information on reservoir architecture and compartmentalization; (2) the formation water salinity in Patrick Draw Field varies widely across the field and can result in a 5 to 12% error in saturation values calculated from wireline logs if the salinity variations and corresponding resistivity values are not accounted for; and (3) an analysis of the enhanced oil recovery (EOR) potential of Patrick Draw Field indicates that CO{sub 2} flooding in the Monell Unit and horizontal drilling in the Arch Unit are potential methods to recover additional oil from the field.

  4. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)

    2008-11-15

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

  5. Security problems for a pseudorandom sequence generator based on the Chen chaotic system

    Science.gov (United States)

    Özkaynak, Fatih; Yavuz, Sırma

    2013-09-01

    Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

  6. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    International Nuclear Information System (INIS)

    Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou

    2008-01-01

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

  7. Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state

    OpenAIRE

    Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro

    2014-01-01

    We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

  8. Patrick Hamilton’s Hangover Square and the Landscapes of Fascism

    Directory of Open Access Journals (Sweden)

    Simon GOULDING

    2006-10-01

    Full Text Available If Patrick Hamilton’s name is recognised at all these days, then it is for his stage thrillers Rope (1929 and Gaslight (1938. Still played in repertory, these may be his best-known works but are hardly typical of his output. Hamilton had been a published writer since his early twenties and Hangover Square (1941 was his eighth novel. Like the preceding novels, it covers much of the same thematic and topographic territory. It is a world of boarding houses in unfashionable parts of London, pu...

  9. Le jeu de la création : Le mangeur (2005 de Ying Chen

    Directory of Open Access Journals (Sweden)

    Nicole Dunham

    2013-11-01

    Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

  10. Theoretical and experimental study of Chen chaotic system with notch filter feedback control

    International Nuclear Information System (INIS)

    Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen

    2010-01-01

    Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

  11. Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

    Science.gov (United States)

    Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

    2016-07-01

    Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

  12. Patrick Air Force Base integrated resource assessment. Volume 3, Resource assessment

    Energy Technology Data Exchange (ETDEWEB)

    Sandusky, W.F.; Parker, S.A.; King, D.A.; Wahlstrom, R.R.; Elliott, D.B.; Shankle, S.A.

    1993-12-01

    The US Air Force has tasked the Pacific Northwest Laboratory (PNL) in support of the US Department of Energy Federal Energy Management Program to identify, evaluate, and assist in acquiring all cost effective energy projects at Patrick Air Force Base (AFB). This is part of a model program that PNL is designing to support energy-use decisions in the federal sector. This report provides the results of the fossil fuel and electric energy resource opportunity (ERO) assessments performed by PNL at Patrick AFB which is located south of Cocoa Beach, Florida. It is a companion report to Volume 1, Executive Summary, and Volume.2, Baseline Detail. The results of the analyses of EROs are presented in 11 common energy end-use categories. A narrative description of each ERO is provided, including information on the installed cost, energy and dollar savings, impacts on operations and maintenance, and, when applicable, a discussion of energy supply and demand, energy security, and environmental issues. A description of the evaluation methodologies and technical and cost assumptions is also provided for each ERO. Summary tables present the cost-effectiveness of energy end-use equipment before and after the implementation of each ERO and present the results of the life-cycle cost analysis indicating the net present value and value index of each ERO.

  13. It came from outer space wearing an RAF blazer! a fan's biography of Sir Patrick Moore

    CERN Document Server

    Mobberley, Martin

    2013-01-01

    To British television viewers, the name ‘Patrick Moore’ has been synonymous with Astronomy and Space Travel since he first appeared on The Sky at Night in 1957. To amateur astronomers he has been a source of inspiration, joy, humour and even an eccentric role model since that time. Most people know that his 55 years of presenting The Sky at Night is a world record, but what was he really like in person?  What did he do away from the TV cameras, in his observatory, and within the British Astronomical Association, the organisation that inspired him as a youngster? Also, precisely what did he do during the War Years, a subject that has always been shrouded in mystery? Martin Mobberley, a friend of Patrick Moore’s for 30 years, and a former President of the British Astronomical Association, has spent ten years exhaustively researching Patrick’s real life away from the TV cameras. His childhood, RAF service, tireless voluntary work for astronomy and charity and his endless book writing are all examined in...

  14. Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

    International Nuclear Information System (INIS)

    Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun

    2012-01-01

    In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

  15. Le jeu de la création : Le mangeur (2005) de Ying Chen

    OpenAIRE

    Nicole Dunham

    2013-01-01

    Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

  16. Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass

    Science.gov (United States)

    Liu, Jian-Liang; Yu, Chengjie

    2017-10-01

    In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

  17. The impacts of the St. Patrick's Day superstorm on selected technologies

    Science.gov (United States)

    Carter, B. A.; Yizengaw, E.; Lin, C. S.; Pradipta, R.; Norman, R.; Tseng, T.; Bennett, J.; Bishop, R. L.; Weygand, J. M.; Francis, M.; Terkildsen, M. B.; Groves, K. M.; Caton, R. G.; Tripathi, N.; Zhang, K.

    2015-12-01

    In the past, significant research efforts have been directed towards understanding how severe geomagnetic storms affect the near-Earth space environment. From this research, we have learned that many technologies are affected by these severe space weather events. The 2015 St. Patrick's Day geomagnetic storm has provided a great opportunity to analyze three selected space weather phenomena that adversely impact modern technologies; (1) Geomagnetically Induced Currents (GICs), (2) increased thermospheric mass density, and (3) the occurrence of Equatorial Plasma Bubbles (EPBs). The serious effects of GICs on power grids in the high-latitude regions is well known. Recent research has indicated that the equatorial region is also susceptible to increased GIC activity due to the equatorial electrojet. Thus, an examination of the equatorial magnetometer data during the St. Patrick's Day storm will be presented. It is also well understood that during geomagnetic storms, the thermospheric mass density at a given altitude increases due to the increase in Joule heating in the high-latitude regions. As a consequence of this, low-Earth orbiting satellites and space debris experience increased atmospheric drag. Changes in atmospheric drag causes orbits to be perturbed, resulting in less accurate orbit predictions. An investigation of the orbits of several low-Earth orbiting satellites will be presented and discussed in the context of collision avoidance, as part of the ongoing space debris problem. Finally, Equatorial Plasma Bubbles (EPBs) are a common phenomenon in the nighttime low-latitude ionosphere. EPBs are known to cause random fluctuations (i.e., scintillations) in the amplitude and phase of trans-ionospheric radio signals. While EPBs have been reported during both geomagnetically quiet and disturbed periods, research clearly indicates that the occurrence of EPBs is dependent on the geomagnetic activity level. The occurrence of EPBs around the world will be presented

  18. Education as an Agent of Social Evolution: The Educational Projects of Patrick Geddes in Late-Victorian Scotland

    Science.gov (United States)

    Sutherland, Douglas

    2009-01-01

    This paper examines the educational projects of Patrick Geddes in late-Victorian Scotland. Initially a natural scientist, Geddes drew on an eclectic mix of social theory to develop his own ideas on social evolution. For him education was a vital agent of social change which, he believed, had the potential to develop active citizens whose…

  19. From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

    Science.gov (United States)

    Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

    2017-06-01

    Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

  20. Patrick Saurin, Teocuicatl. Chants sacrés des anciens Mexicains

    OpenAIRE

    Gruzinski, Serge

    2007-01-01

    Patrick Saurin s’est penché sur l’un des nombreux manuscrits laissés par le franciscain Bernardino de Sahagùn : les teocuicatl, ces hymnes sacrés composés en l’honneur des anciens dieux mexicains. Vraisemblablement d’origine mexica, ces chants ont été rassemblés à Tepepulco vers 1560. S’agit- il de textes archaïques comme la critique s’est accordée à le penser ? L’auteur propose d’y voir, au moins pour partie d’entre eux, des hymnes portant la « marque d’une réécriture, voire d’une écriture r...

  1. The Brain Dead Patient Is Still Sentient: A Further Reply to Patrick Lee and Germain Grisez.

    Science.gov (United States)

    Austriaco, Nicanor Pier Giorgio

    2016-06-01

    Patrick Lee and Germain Grisez have argued that the total brain dead patient is still dead because the integrated entity that remains is not even an animal, not only because he is not sentient but also, and more importantly, because he has lost the radical capacity for sentience. In this essay, written from within and as a contribution to the Catholic philosophical tradition, I respond to Lee and Grisez's argument by proposing that the brain dead patient is still sentient because an animal with an intact but severed spinal cord can still perceive and respond to external stimuli. The brain dead patient is an unconscious sentient organism. © The Author 2016. Published by Oxford University Press, on behalf of the Journal of Medicine and Philosophy Inc. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. The practice of Spencerian science: Patrick Geddes's Biosocial Program, 1876-1889.

    Science.gov (United States)

    Renwick, Chris

    2009-03-01

    From the Victorian era to our own, critics of Herbert Spencer have portrayed his science-based philosophical system as irrelevant to the concerns of practicing scientists. Yet, as a number of scholars have recently argued, an extraordinary range of reformist and experimental projects across the human and life sciences took their bearings from Spencer's work. This essay examines Spencerian science as practiced by the biologist, sociologist, and town planner Patrick Geddes (1854-1932). Through a close examination of his experimental natural history of the late 1870s and early 1880s, his wider writings on the evolutionary process in the 1880s, and his efforts later in that decade to improve the slums of Edinburgh, this essay reveals Geddes's deep, unifying, and energizing commitment to Spencer's program. Recapturing that commitment can not only help historians rethink Spencerian science as practice but also suggest ways of overcoming the dichotomy between elite ideas and practical activity that bedevils much contemporary historiography of science.

  3. Patrick Vinton Kirch & Robert C. Green, Hawaiki, Ancestral Polynesia. An Essay in Historical Anthropology

    OpenAIRE

    Di Piazza, Anne

    2007-01-01

    Hawaiki, la patrie des ancêtres chantée par les Polynésiens, le lieu de rassemblement des âmes des morts, est aussi la terre mythique des archéologues. C’est bien celle-ci que ces derniers s’efforcent de localiser dans le temps et dans l’espace. Si l’on en croit Patrick Vinton Kirch et Roger Green, la culture ancestrale polynésienne s’est développée dans les archipels de Tonga et Samoa (avec leurs voisins immédiats) au cours du Ier millénaire avant J.-C. Les auteurs ne s’arrêtent pas à ce con...

  4. A lesson for the future of our science my testimony on Lord Patrick M S Blackett

    CERN Document Server

    Zichichi, Antonio

    2016-01-01

    This unique volume contains a tribute to Lord Patrick M S Blackett through the testimony of Professor Antonino Zichichi, who was one of Blackett's pupils in the experiment at the Sphinx Observatory, Europe's highest lab (3580 meters a.s.l.), at Jungfraujoch. The book presents an overview of Blackett's most significant discoveries, such as the so called "vacuum polarization" effect, the first example of "virtual physics" and the "strange particles", that opened a new horizon towards the existence of the subnuclear universe. After discussing the profound implications of Blackett's pioneering contributions to Subnuclear Physics, the book also recalls his deep interest in the promotion of scientific culture. Blackett was firmly convinced that physicists must be engaged directly to let the people outside our labs know what the role of science is in the progress of our civilisation. In particular, according to Blackett and his friend Bertrand Russell, the Manhattan Project was the example of how the new frontiers o...

  5. Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau

    Science.gov (United States)

    Ju, J.

    2013-12-01

    Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

  6. The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed

    Science.gov (United States)

    Chen, Chi-ju

    2017-04-01

    Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

  7. Wormholes supported by phantom energy from Shan-Chen cosmological fluids

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)

    2016-03-15

    In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

  8. Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents.

    Science.gov (United States)

    Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M

    2014-10-01

    The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

  9. Review: Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa (2013)

    OpenAIRE

    Reinhart Kößler

    2015-01-01

    Review of the monograph:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press, 2013, ISBN 9783869562483, 300 pp.

  10. Viveret Patrick, 2005, Pourquoi ça ne va pas plus mal?, Fayard, 264 p.

    Directory of Open Access Journals (Sweden)

    Fabien Thurette

    2008-05-01

    Full Text Available Patrick Viveret est philosophe de formation et Conseiller-maître à la Cour des comptes. Il a, en outre, été chargé d’une mission, confiée par l'éphémère Secrétaire d'État à l'économie solidaire Guy Hascoët, puis prolongée par le Président Chirac sur une « autre approche de la richesse », dont le rapport final a été publié sous le titre Reconsidérer la richesse (2004.Dans son essai Pourquoi ça ne va pas plus mal ? publié en 2005, Patrick Viveret nous livre une analyse philosophique sur le « m...

  11. Review: Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa (2013)

    OpenAIRE

    Reinhart Kößler; Arnold-Bergstraesser-Institut

    2015-01-01

    Review of the monograph:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press, 2013, ISBN 9783869562483, 300 pp. Besprechung der Monographie:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press...

  12. Observations and global numerical modelling of the St. Patrick's Day 2015 geomagnetic storm event

    Science.gov (United States)

    Foerster, M.; Prokhorov, B. E.; Doornbos, E.; Astafieva, E.; Zakharenkova, I.

    2017-12-01

    With a sudden storm commencement (SSC) at 04:45 UT on St. Patrick's day 2015 started the most severe geomagnetic storm in solar cycle 24. It appeared as a two-stage geomagnetic storm with a minimum SYM-H value of -233 nT. In the response to the storm commencement in the first activation, a short-term positive effect in the ionospheric vertical electron content (VTEC) occurred at low- and mid-latitudes on the dayside. The second phase commencing around 12:30 UT lasted longer and caused significant and complex storm-time changes around the globe with hemispherical different ionospheric storm reactions in different longitudinal ranges. Swarm-C observations of the neutral mass density variation along the orbital path as well as Langmuir probe plasma and magnetometer measurements of all three Swarm satellites and global TEC records are used for physical interpretations and modelling of the positive/negative storm scenario. These observations pose a challenge for the global numerical modelling of thermosphere-ionosphere storm processes as the storm, which occurred around spring equinox, obviously signify the existence of other impact factors than seasonal dependence for hemispheric asymmetries to occur. Numerical simulation trials using the Potsdam version of the Upper Atmosphere Model (UAM-P) are presented to explain these peculiar M-I-T storm processes.

  13. Sir Patrick Dun and the Complete School of Physic in eighteenth-century Dublin.

    Science.gov (United States)

    Mullaney, S

    2015-03-01

    2013 is the tercentenary of the death of Sir Patrick Dun. When Dun died in 1713, he left the proceeds of his estate to enhance medical education in Dublin by funding chairs in medicine. He showed remarkable innovation, but it took 95 years, five Acts of Parliament, two House of Commons enquiries and a House of Lords enquiry before Dun's wishes were brought to fruition and systematic clinical education was available for Dublin medical students. The passage of the final School of Physic Act in 1800 insured that a hospital would open in his name and regular clinical education was provided. The physician, Richard Steevens, who died 3 years earlier in 1710, left the proceeds of his estate to found a hospital, which opened, in his name, in 1733. The contemporary primary sources have been analysed and material from relevant secondary sources has been included where appropriate. Dublin was the beneficiary of these bequests and if circumstances had been more favourable, and the proceeds had been used more efficiently at the start of the eighteenth-century, Dublin could well have rivalled Edinburgh as the seat of medical education in the eighteenth century. In the early nineteenth century, it would fulfil that role and equal Edinburgh as one of the primary centres of medical education in Europe.

  14. Imagery interchange in John Patrick Shanley’s Doubt, a parable

    Directory of Open Access Journals (Sweden)

    Sandra Sirangelo Maggio

    2013-06-01

    Full Text Available John Patrick Shanley’s play Doubt - a Parable (2004 revisits the world he knew as a child, which is the Bronx of the 1960’s. The story centers upon a Catholic Irish-Italian school community, and the plot relates to a doubt - that grows into belief, and ends up as certainty - on the part of Sister Aloysius, the principal of the school, who is persuaded that Father Flynn, the vicar, has been harassing the only Black student in the school. The play is an open-ended construct, allowing each reader/spectator to build their own interpretation of the facts implied. Shanley is more than the author of the play. He has also worked as the producer of the play on the stage and he turned the story into a movie screenplay, Doubt, and has worked as a director to the movie. In this paper we examine the strategies used by Shanley to keep the possibility of interpretation open as he translates his own work into different media, on the page and on the screen.

  15. Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

    Directory of Open Access Journals (Sweden)

    Kay Schaffer

    2006-09-01

    Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

  16. Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

    Directory of Open Access Journals (Sweden)

    Péter Bíró

    2011-01-01

    Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

  17. [Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China].

    Science.gov (United States)

    Huang, Weiping; Li, Naiqi

    2015-03-01

    Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

  18. Underwater cleaning techniqued used for removal of zebra mussels at the FitzPatrick Nuclear Power Plant

    International Nuclear Information System (INIS)

    Hobbs, B.; Kahabka, J.

    1995-01-01

    This paper discusses the use of a mechanical brush cleaning technology recently used to remove biofouling from the Circulating Water (CW) System at New York Power Authority's James A. FitzPatrick Nuclear Power Plant. The FitzPatrick plant had previously used chemical molluscicide to treat zebra mussels in the CW system. Full system treatment was performed in 1992 with limited forebay/screenwell treatment in 1993. The New York Power Authority (NYPA) decided to conduct a mechanical cleaning of the intake system in 1994. Specific project objectives included: (1) Achieve a level of surface cleaniness greater than 98%; (2) Remove 100% of debris, both existing sediment and debris generated as a result of cleaning; (3) Inspect all surfaces and components, identifying any problem areas; (4) Complete the task in a time frame within the 1994-95 refueling outage schedule window, and; (5) Determine if underwater mechanical cleaning is a cost-effective zebra mussel control method suitable for future application at FitzPatrick. A pre-cleaning inspection, including underwater video photography, was conducted of each area. Cleaning was accomplished using diver-controlled, multi-brush equipment included the electro-hydraulic powered Submersible Cleaning and Maintenance Platform (SCAMP), and several designs of hand-held machines. The brushes swept all zebra mussels off surfaces, restoring concrete and metal substrates to their original condition. Sensitive areas including pump housings, standpipes, sensor piping and chlorine injection tubing, were cleaned without degradation. Submersible vortex vacuum pumps were used to remove debris from the cavity. More than 46,000 ft 2 of surface area was cleaned and over 460 cubic yards of dewatered debris were removed. As each area was completed, a post-clean inspection with photos and video was performed

  19. Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review.

    Science.gov (United States)

    Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju

    2016-07-21

    Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

  20. Review: Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa (2013

    Directory of Open Access Journals (Sweden)

    Reinhart Kößler

    2015-01-01

    Full Text Available Review of the monograph:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press, 2013, ISBN 9783869562483, 300 pp.

  1. Ténèbres khmères: les revenants de Phnom Penh : à propos de Kampuchéa de Patrick Deville

    NARCIS (Netherlands)

    van Montfrans, M.; Freyermuth, S.; Bonnot, J.-F.P.

    2014-01-01

    Remonter le Mékong comme Patrick Deville dans les traces de Henri Mouhot, paisible explorateur du XIXe siècle, naturaliste chasseur de papillons, semble une entreprise plus idyllique que de parcourir le monde contemporain comme l’a fait Jean Rolin pour une enquête sur les chiens errants. Ma

  2. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    OpenAIRE

    Giafferri, Xiaomin

    2008-01-01

    Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

  3. James A. FitzPatrick Nuclear Power Plant recirculation pumps vibration system installation and performance since July 7, 1990

    International Nuclear Information System (INIS)

    Lefter, J.

    1992-01-01

    James A. FitzPatrick recirculation pumps are vertical units consisting of General Electric 5,300 hp variable speed motors driving Byron Jackson Pumps. Speed range is from 400 rpm at 20% reactor power to 1,480 rpm at 100% power. Full speed pump output is 42,500 gpm at 530 ft. head. This paper describes the vibration monitoring system. The design of this vibration monitoring system took about five months and was installed during plant refueling outage between February and May 1990. The objectives of this project were as follows: (1) document and assess the mechanical condition of each RRP during plant startup normal operation and shutdown; (2) identify any areas of operation that might be harmful to the unit; (3) perform impact testing of the proximity probe brackets to determine if any bracket resonances existed in the 0 to 20 times operating speed region (0 to 20X); (4) define and recommend Acceptance Regions in the TDM system

  4. Ionospheric Response to St. Patrick's Day Storm of 2015 Over Indian Region: Ionosonde and All-Sky Imager Observations

    Science.gov (United States)

    Gupta, S.; Upadhayaya, A. K.; Taori, A. K.; Kotnala, R. K.

    2017-12-01

    The St. Patrick's Day Storm of 2015 was the first superstorm of 24th solar cycle, with Dst dipping down to -223 nT. The response of this severe (G4) storm is studied using ionosonde data at low-mid latitude Indian station, Delhi (28.6°N, 77.2°E), along with 630.0 nm night airglow observations from low latitude Indian station, Gadanki (13.5°N, 79.2°E). A peculiar occurrence of additional stratification, not observed before at this latitude, is found to be present between F1 and F2 layers before the SSC of the storm. This observed extra stratification in F layer (F1.5) is attributed to TIDs during vertically uplifted F region. Apart from this, additional stratification above F2 layer, lasting for about half an hour, was seen during this storm. A large variation in F2 layer critical parameters, showing both positive and negative phases, with electron density enhancement of 264% and depression of 65%, is observed during this storm. Contrary to the previous reports, Spread-F occurrence at Delhi do not follow anticorrelation with solar activity. The night airglow observations of 630.0 nm from Gadanki indicates towards the presence of external forcing which results in drifting of plasma in the opposite direction (westward) to that of normally seen, during this St. Patrick's Day storm of 2015. The variation in neutral composition (O/N2 taken from GUVI) is found during this storm. This result suggests O/N2 ratio to be a vital contributor, apart from the electric field and neutral wind, in determining the ionospheric response to such transient events.

  5. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

    International Nuclear Information System (INIS)

    Moreno M, A.; Moreno B, A.

    2000-01-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  6. St. Patrick's Day 2015 geomagnetic storm analysis based on Real Time Ionosphere Monitoring

    Science.gov (United States)

    García-Rigo, Alberto

    2017-04-01

    Ionosphere Monitoring (RTIM) is a new Working Group within the International Association of Geodesy (IAG) Sub-Commission 4.3 "Atmosphere Remote Sensing". The complementary expertise of the participating research groups allows to analyse the ionospheric behaviour from a broad perspective, taking benefit of comparing multiple independent real time and near real time ionospheric approaches. In this context, a detailed analysis will be presented for the days in March, 2015 surrounding St. Patrick's Day 2015 geomagnetic storm, based on the existing ionospheric models (global or regional) within the group, which are mainly based on Global Navigation Satellite Systems (GNSS) and ionosonde data. For this purpose, a variety of ionospheric parameters will be considered, including Total Electron Content (TEC), F2 layer critical frequency (foF2), F2 layer peak (hmF2), bottomside half-thickness (B0) and ionospheric disturbance W-index. Also, ionospheric high-frequency perturbations such as Travelling Ionospheric Disturbances (TIDs), scintillations and the impact of solar flares facing the Earth will be presented to derive a clear picture of the ionospheric dynamics. Among other sources of information to take part in the comparisons, there will be (1) scintillation results -from MONITOR ESA/ESTEC-funded project- derived by means of S4 index and Sigma Phi (IEEA), specially significant in the African sector and European high latitudes, (2) dynamics of the global maps of W-index with 1h resolution derived from JPL Global Ionospheric Maps (GIMs; IZMIRAN), (3) deviations from expected quiet-time behavior analysed in terms of foF2, hmF2, B0 and B1 based on IRTAM and GIRO network of digisondes (Lowell), showing F2 layer peculiar changes due to the storm, (4) statistics based on the median of the VTEC for the 15 previous days considering VTEC european regional maps (ROB), (5) time series of VTEC data that are derived by running the NRT ionosphere model of DGFI-TUM in offline mode, which show

  7. Threatened and Endangered Species Survey for Patrick Air Force Base, Florida

    Science.gov (United States)

    Oddy, Donna M.; Stolen, Eric D.; Schmalzer, Paul A.; Larson, Vickie L.; Hall, Patrice; Hensley, Melissa A.

    1997-01-01

    A review of previous environmental work conducted at Patrick Air Force Base (PAFB) indicated that several threatened, endangered, or species of special concern occurred or had the potential to occur there. This study was implemented to collect more information on protected species at PAFB. A map of landcover types was prepared for PAFB using aerial photography, groundtruthing, and a geographic information system (GIS). Herbaceous vegetation was the most common vegetation type. The second most abundant vegetation type was disturbed shrubs/exotics. The beach and associated dune vegetation comprised 3.2% of the land area, but was the most extensive natural community within PAFB. A few isolated mangrove communities exist along the Banana River. Seventy-seven species of vascular plants occurred on the dunes, including four species listed by state agencies: spider lily (Hymenocallis latifolia), prickly pear cactus (Opuntia stricta), beach star (Remirea maritima), and inkberry (Scaevola plumien). Surveys of other habitats revealed eighty-four species of vascular plants including two state-listed species: spider lily and prickly pear cactus. Many of these areas are dominated by invasive, exotic species, particularly Brazilian pepper (Schinus terebinthifolius) and Australian pine (Casuarina equisetifolia), and native species of open or disturbed sites such as camphorweed (Heterotheca subaxillaris) and beardgrass (Andropogon spp.). Due to the isolation of PAFB from other natural areas, most exotic plant populations on the base are not an immediate threat to intact native plant communities. Dune habitat was surveyed for the southeastem beach mouse (Peromyscus polionotus niveiventris) by quarterly trapping along eight 100 m transects. No beach mice were found. The limited extent of dune habitat, its fragmented condition, and the isolation of PAFB from extant populations of the beach mouse probably accounts for its absence. Surveys of birds on PAFB found an avifauna

  8. New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae)

    Science.gov (United States)

    The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

  9. Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

    Directory of Open Access Journals (Sweden)

    M.-L. Lin

    2005-01-01

    Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

  10. Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

    Science.gov (United States)

    Zhang, Wen-Yan; Lin, Chao-Yuan

    2017-04-01

    The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

  11. Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt.

    Science.gov (United States)

    Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.

    2009-01-01

    Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

  12. A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system

    Science.gov (United States)

    Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.

    2017-09-01

    Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

  13. Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

    Directory of Open Access Journals (Sweden)

    Chih-Hung Ko

    2005-12-01

    Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

  14. Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling

    Science.gov (United States)

    Sepehrinia, Reza; Chalangari, Fartash

    2018-03-01

    The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

  15. Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

    Directory of Open Access Journals (Sweden)

    Hongyang Zhang

    2016-01-01

    Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

  16. Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability

    Science.gov (United States)

    Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.

    2008-01-01

    We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

  17. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    Directory of Open Access Journals (Sweden)

    Xiaomin Giafferri

    2008-12-01

    Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

  18. Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response : Patrick Meier, 2015, CRC Press (Boca Raton, FL, 978-1-4822-4839-5, 259 pp.).

    Science.gov (United States)

    Dave, Anushree

    2017-12-01

    This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.

  19. “You may have heard of me”:an archetypal analysis of the protagonist of Patrick Rothfuss’ The Name of the Wind

    OpenAIRE

    Tikkanen, T. (Tapio)

    2016-01-01

    Abstract This research examines the protagonist of the fantasy novel The Name of the Wind written by Patrick Rothfuss. The goal is to establish that the given protagonist is not an archetypal hero or villain character, but rather he transcends the simplistic binary definitions of hero and villain by acting on humane drives and understandable reasons, both of which can contribute towards good or evil. The paper draws upon mu...

  20. Is everyone Irish on St Patrick's Day? Divergent expectations and experiences of collective self-objectification at a multicultural parade.

    Science.gov (United States)

    Pehrson, Samuel; Stevenson, Clifford; Muldoon, Orla T; Reicher, Steve

    2014-06-01

    We examine experiences of collective self-objectification (CSO) (or its failure) among participants in a 'multicultural' St Patrick's Day parade. A two-stage interview study was carried out in which 10 parade participants (five each from ethnic majority and minority groups) were interviewed before and after the event. In pre-event interviews, all participants understood the parade as an opportunity to enact social identities, but differed in the category definitions and relations they saw as relevant. Members of the white Irish majority saw the event as being primarily about representing Ireland in a positive, progressive, light, whereas members of minority groups saw it as an opportunity to have their groups' identities and belonging in Ireland recognized by others. Post-event interviews revealed that, for the former group, the event succeeded in giving expression to their relevant category definitions. The latter group, on the other hand, cited features of the event such as inauthentic costume design and a segregated structure as reasons for why the event did not provide the group recognition they sought. The accounts revealed a variety of empowering and disempowering experiences corresponding to the extent of enactment. We consider the implications in terms of CSO, the performative nature of dual identities, as well as the notion of multicultural recognition. © 2013 The British Psychological Society.

  1. Travels Through Heterotopia: The Textual Realms of Patrick Modiano's Rue des Boutiques Obscures and Mikhail Kuraev's Kapitan Dikshtein

    Directory of Open Access Journals (Sweden)

    Vitaly Chernetsky

    1998-06-01

    Full Text Available Within contemporary prose, one distinct mode or paradigm that can be discerned is constituted by the texts that daringly tackle the dark, suppressed, erased parts of our history and mentality; however, they approach this task not by way of self-righteous denunciatory investigations, but by provocatively problematizing the most established everyday facts, by depriving the reader of the possibility of even conceiving any firm ground of the stable construct of an origin or a self-identification—historically and culturally. Their irreverent and playful deconstruction of the all-pervasive national cultural mythologies has mounted a powerful challenge to ideological constructs big and small. This article considers two representative examples of texts of this kind, which the author proposes to call heterotopic: Patrick Modiano's Rue des Boutiques Obscures and Mikhail Kuraev's Kapitan Dikshtein . It offers an attempt at defining this paradigm through a reading of these two novels, drawing upon Michel Foucault's usage of the term "heterotopia" for the purpose of designating the "other" cultural spaces of our civilization, as well as on Deleuze and Guattari's concept of "minor literature" and the work of several other theorists. The texts of the kind exemplified by these two novels are considered as an instance of successful partaking in the project of cognitive mapping, which has been proposed by Fredric Jameson and others as the positive political edge of postmodern culture.

  2. Return to the far side of planet Moore! rambling through observations, friendships and antics of sir Patrick Moore

    CERN Document Server

    Mobberley, Martin

    2015-01-01

    The result of an exhaustive study of Sir Patrick Moore’s observations of the Moon and planets for more than 60 years, this book is a fantastic companion to the extremely popular, “It Came From Outer Space Wearing an RAF Blazer!” written by the same author.  Moore recorded his telescopic observations in his logbooks, which are reproduced and described here in detail, along with his sketches and notes. In this light, the author discusses the factors that caused Moore to switch from lunar observing to planetary and variable star observing.  He has also included personal recollections and humorous anecdotes from Moore’s friends and acquaintances, as well as a look at his best loved books. Further chapters describe Moore’s foreign travels and correspondence with those back home. Lastly, the author has not neglected a few of Moore’s most memorable television and radio appearances, which are examined along with a close up of what it was like to visit Moore’s beloved home of Farthings in Selsey. Essen...

  3. Your Country is of Great Subtlety: Aspects of the Brazilian Translation of Patrick White’s Voss

    Directory of Open Access Journals (Sweden)

    Ian Alexander

    2016-06-01

    Full Text Available http://dx.doi.org/10.5007/2175-8026.2016v69n2p107 A number of the dialogues in Patrick White’s Voss (1957, especially those involving Laura Trevelyan, involve an implicit debate about what is meant by country and what it means to live in a country. Is the colony of New South Wales simply a province of the British Empire, a little piece of Britain transplanted on the other side of the world, or is it a place where British settlers will have to adapt their ways and gradually be transformed into something new? In these dialogues, each speaker makes use of words such as country, colony, property and land in order to express their vision of the place where they find themselves, frequently forcing a shift of meaning from one sentence to the next. This study examines how this debate is carried out in the novel and how it functions in Paulo Henriques Britto’s 1985 Brazilian translation.

  4. Australian Modernists in London: William Dobell’s The Dead Landlord and Patrick White’s The Ham Funeral

    Directory of Open Access Journals (Sweden)

    Denise Varney

    2016-09-01

    Full Text Available When Patrick White was awarded the Nobel Prize for Literature in 1973, it was primarily for his novels. Less well recognised is the significance of White’s dramatic literature and his involvement in the theatre. This article offers a new analysis of White’s first notable breakthrough into theatre and drama, The Ham Funeral, which he wrote in postwar London and which was produced in Adelaide in 1961. This article argues that a modernist idiom of 20th-century Australian drama can be found in this play that laid the groundwork for a poetics of language, image and theatricality. The play’s aesthetic modernism is found primarily in the blend of expressionist and surrealist elements, the poetic language, the alienated creative subject and the representation of sexuality and the unconscious. White’s thematics also become political, concerned with power, masculinity and gendered assumptions about rationality and emotion, poetry and the body. Having lived in London during the interwar years, White was also part of the networks that included Australian-born artists, and he was exposed to influences from visual arts as well as theatre. Of these, the artist William Dobell was central to the genesis of The Ham Funeral, as was the Polish-born modernist artist S. Ostoja-Kotkowski, who was critical to the design of the brooding expressionist set that set the standard for subsequent stage realisations of the play.

  5. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

    Energy Technology Data Exchange (ETDEWEB)

    Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A

    2000-07-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  6. Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence

    Science.gov (United States)

    Schmutz, J.A.; Laing, K.K.

    2002-01-01

    Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

  7. [Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

    Science.gov (United States)

    Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

    2014-01-01

    Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

  8. Cross-scale observations of the 2015 St. Patrick's day storm: THEMIS, Van Allen Probes, and TWINS

    International Nuclear Information System (INIS)

    Goldstein, J.

    2016-01-01

    In this paper, we present cross-scale magnetospheric observations of the 17 March 2015 (St. Patrick's Day) storm, by Time History of Events and Macroscale Interactions during Substorms (THEMIS), Van Allen Probes (Radiation Belt Storm Probes), and Two Wide-angle Imaging Neutral-atom Spectrometers (TWINS), plus upstream ACE/Wind solar wind data. THEMIS crossed the bow shock or magnetopause 22 times and observed the magnetospheric compression that initiated the storm. Empirical models reproduce these boundary locations within 0.7 R E . Van Allen Probes crossed the plasmapause 13 times; test particle simulations reproduce these encounters within 0.5 R E . Before the storm, Van Allen Probes measured quiet double-nose proton spectra in the region of corotating cold plasma. About 15 min after a 0605 UT dayside southward turning, Van Allen Probes captured the onset of inner magnetospheric convection, as a density decrease at the moving corotation-convection boundary (CCB) and a steep increase in ring current (RC) proton flux. During the first several hours of the storm, Van Allen Probes measured highly dynamic ion signatures (numerous injections and multiple spectral peaks). Sustained convection after ~1200 UT initiated a major buildup of the midnight-sector ring current (measured by RBSP A), with much weaker duskside fluxes (measured by RBSP B, THEMIS a and THEMIS d). A close conjunction of THEMIS d, RBSP A, and TWINS 1 at 1631 UT shows good three-way agreement in the shapes of two-peak spectra from the center of the partial RC. A midstorm injection, observed by Van Allen Probes and TWINS at 1740 UT, brought in fresh ions with lower average energies (leading to globally less energetic spectra in precipitating ions) but increased the total pressure. Finally, the cross-scale measurements of 17 March 2015 contain significant spatial, spectral, and temporal structure.

  9. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

  10. 21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

    CERN Multimedia

    CERN Photo Service

    2008-01-01

    21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

  11. 6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

    CERN Multimedia

    Maximilien Brice

    2012-01-01

    6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

  12. Patrick Suskind: Su narrativa

    Directory of Open Access Journals (Sweden)

    Melba Cecilia Serrano G.

    1988-04-01

    Full Text Available RESUMEN  En este artículo muestra el éxito que tuvo este autor frente a las diferentes obras que ha escrito. No obstante se destaca su obra llamado “perfume”, que lo hace muy representativo de este autor.

  13. “If You Don’t Bring No Grits, Don’t Come”: Critiquing a Critique of Patrick Kelly, Golliwogs, And Camp as A Technique of Black Queer Expression

    Directory of Open Access Journals (Sweden)

    Barnes Sequoia

    2017-12-01

    Full Text Available I have written this article in order to establish Patrick Kelly as a black forbearer of fashion. Kelly complicates our sense of fashion through his use of black memorabilia and camp to not only create something consumable but to comment on the black body as a consumable. Therefore, the role I play in acknowledging this black supernova, as Eric Darnell Pritchard calls him, is by critiquing Lewis and Fraley’s critique of Patrick Kelly and questioning why overtly expressing one’s queerness through camp has not been seen as a viable form of black expression in the mainstream narrative of black creativity. Lewis and Fraley’s complete dismissal of Kelly’s use of camp does not happen in a vacuum. Yet, I must remember that there is also the task of establishing a legacy of technique for Patrick Kelly. Who are his forbearers?

  14. Le néoconservatisme de Daniel Patrick Moynihan : le cas de la politique étrangère

    Directory of Open Access Journals (Sweden)

    Justin Vaïsse

    2010-09-01

    Full Text Available Daniel Patrick Moynihan est une figure archétypale du premier âge du néoconservatisme : jeune membre de l’ADA (American for Democratic Action dès les origines, il s’oppose aux tendances pro-communistes (ou du moins de « compagnonnage de route»  de Henry Wallace en 1948, et soutient avec enthousiasme le libéralisme du « centre vital », mélange de progrès social, de keynésianisme et d’anticommunisme. Dans les années 1950, il écrit ses premiers articles dans The Reporter, encouragé par Irving ...

  15. The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens)

    Science.gov (United States)

    Tuggle, B.N.; Crites, John L.

    1984-01-01

    Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

  16. Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang.

    Science.gov (United States)

    Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li

    2015-04-16

    Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

  17. [Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

    Index Scriptorium Estoniae

    Hirschheydt, Monika von

    2015-01-01

    Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

  18. "Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017).

    Science.gov (United States)

    2017-10-01

    Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  19. L'éloge de la créolité à l'épreuve de la fiction : convergences et divergences dans les romans de Patrick Chamoiseau et Raphaël Confiant

    OpenAIRE

    Casas Valencia, Olga

    2009-01-01

    The purpose of this thesis is to determine the specificities of the two Martinican writers who conceived Creoleness, Patrick Chamoiseau and Raphaël Confiant, when dealing with two topics directly related to their manifesto, i. e. In Praise of Creoleness. More particularly, I study their vision of the West Indian history, which is different from the colonial version, and the relations of the Martinican with the multifaceted Other, in order to find out where these themes converge and diverge. ...

  20. Solar storm effects during Saint Patrick's Days in 2013 and 2015 on the Schumann resonances measured by the ELF station at Sierra Nevada (Spain)

    Science.gov (United States)

    Salinas, A.; Toledo-Redondo, S.; Navarro, E. A.; Fornieles-Callejón, J.; Portí, J. A.

    2016-12-01

    The effects of solar storms occurring during the days 17 to 19 March 2013 and 2015, St. Patrick's Day intervals, on Schumann resonances (SRs) have been studied. To do this, the experimental data recorded by the Juan Antonio Morente extremely low frequency station located at Sierra Nevada, Spain, have been processed in order to obtain hourly averaged information on the first three resonance modes. Results are compared with monthly averages of the SR data for each hour to detect deviations from the regular behavior. Evidence of significant changes in the peak amplitudes and frequencies of the SRs have been identified in the station's measurements and related to the coronal mass ejection impact in the magnetosphere, detected by in situ plasma measurements onboard spacecraft in the solar wind. However, the complicated nature of the Schumann resonances, dependent on multiple variables and subject to multiple unavoidable interferences (e.g., lightning or human radio sources), in conjunction with the complex magnetosphere-ionosphere-atmosphere coupling processes, makes it difficult to conclude that the observed deviations are exclusively due to the solar events mentioned. Results extracted from only two solar events cannot be considered as conclusive, and therefore, independent comparison with results reported by other research would seem advisable in future works on this subject.

  1. NARX neural network Prediction of SYMH and ASYH indices for geomagnetic storms of solar cycle 24 including recent St. Patrick's day, 2015 storm

    Science.gov (United States)

    Bhaskar, A. T.; Vichare, G.

    2017-12-01

    Here, an attempt is made to develop a prediction model for SYMH and ASYH geomagnetic indices using Artificial Neural Network (ANN). SYMH and ASYH indices represent longitudinal symmetric and asymmetric component of the ring current. The ring current state depends on its past conditions therefore, it is necessary to consider its history for prediction. To account this effect Nonlinear Autoregressive Network with eXogenous inputs (NARX) is implemented. This network considers input history of 30 minutes and output feedback of 120 minutes. Solar wind parameters mainly velocity, density and interplanetary magnetic field are used as inputs. SYMH and ASYH indices during geomagnetic storms of 1998-2013, having minimum SYMH training two independent networks. We present the prediction of SYMH and ASYH indices during 9 geomagnetic storms of solar cycle 24 including the recent largest storm occurred on St. Patrick's day, 2015. The present prediction model reproduces the entire time profile of SYMH and ASYH indices along with small variations of 10-30 minutes to good extent within noise level, indicating significant contribution of interplanetary sources and past state of the magnetosphere. However, during the main phase of major storms, residuals (observed-modeled) are found to be large, suggesting influence of internal factors such as magnetospheric processes.

  2. Mid-latitude thermospheric wind changes during the St. Patrick's Day storm of 2015 observed by two Fabry-Perot interferometers in China

    Science.gov (United States)

    Huang, Cong; Xu, Ji-Yao; Zhang, Xiao-Xin; Liu, Dan-Dan; Yuan, Wei; Jiang, Guo-Ying

    2018-04-01

    In this work, we utilize thermospheric wind observations by the Fabry-Perot interferometers (FPI) from the Kelan (KL) station (38.7°N, 111.6°E, Magnetic Latitude: 28.9°N) and the Xinglong (XL) station (40.2°N, 117.4°E, Magnetic Latitude: 30.5°N) in central China during the St. Patrick's Day storm (from Mar. 17 to Mar. 19) of 2015 to analyze thermospheric wind disturbances and compare observations with the Horizontal Wind Model 2007 (HWM07). The results reveal that the wind measurements at KL show very similar trends to those at XL. Large enhancements are seen in both the westward and equatorward winds after the severe geomagnetic storm occurred. The westward wind speed increased to a peak value of 75 m/s and the equatorward wind enhanced to a peak value of over 100 m/s. There also exist obvious poleward disturbances in the meridional winds during Mar. 17 to Mar. 19. According to the comparison with HWM07, there exist evident wind speed and temporal differences between FPI-winds and the model outputs in this severe geomagnetic storm. The discrepancies between the observations and HWM07 imply that the empirical model should be used carefully in wind disturbance forecast during large geomagnetic storms and more investigations between measurements and numerical models are necessary in future studies.

  3. The Effect of Sub-Auroral Polarization Streams (SAPS) on Ionosphere and Thermosphere during 2015 St. Patrick's Day storm: Global Ionosphere-Thermosphere Model (GITM) Simulations

    Science.gov (United States)

    Guo, J.; Deng, Y.; Zhang, D.; Lu, Y.; Sheng, C.

    2017-12-01

    Sub-Auroral Polarization Streams (SAPS) are incorporated into the non-hydrostatic Global Ionosphere-Thermosphere Model (GITM), revealing the complex effects on neutral dynamics and ion-neutral coupling processes. The intense westward ion stream could enhance the neutral zonal wind within the SAPS channel. Through neutral dynamics the neutrals then divide into two streams, one turns poleward and the other turns equatorward, forming a two-cell pattern in the SAPS-changed wind. The significant Joule heating induced by SAPS also leads to traveling atmospheric disturbances (TAD) accompanied by traveling ionospheric disturbances (TID), increasing the total electron content (TEC) by 2-8 TECu in the mid-latitude ionosphere. We investigate the potential causes of the reported poleward wind surge during the St. Patrick's Day storm in 2015. It is confirmed that Coriolis force on the westward zonal wind can contribute the poleward wind during post-SAPS interval. In addition, the simulations imply that the sudden decrease of heating rate within auroral oval could result in a TAD propagating equatorward, which could also be responsible for the sudden poleward wind surge. This study highlights the complicated effects of SAPS on ion-neutral coupling and neutral dynamics.

  4. Aux origines de l’aménagement régional: le schéma de la Valley Section de Patrick Geddes (1925

    Directory of Open Access Journals (Sweden)

    Federico Ferretti

    2013-03-01

    Full Text Available Au début du XXe siècle, les idées de Patrick Geddes sont à l'origine d'une des premières théories de l'aménagement régional, un champ de la connaissance où son influence est largement reconnue. Suivant une démarche paysagère, il fonde son modèle graphique de la Valley Section (coupe de vallée. C'est, à la fois, une coupe longitudinale de vallée aménagée et une métaphore de la dimension géographique du progrès économique et social que Geddes veut promouvoir. Des géographes comme Gary Dunbar et Claude Raffestin ont affirmé que l'idée de cette Valley Section s'inspire du modèle du «bassin fluvial» d'Élisée Reclus avec qui Geddes a entretenu une longue et amicale collaboration que l'on peut suivre à travers les textes de leurs archives.

  5. Para além da polarização racionalismo-reflexivismo nas relações internacionais: A tipologia metodológica de Patrick Jackson e o pluralismo metodológico em debate

    OpenAIRE

    Oliveira, Gilberto Carvalho de

    2014-01-01

    Este artigo propõe uma revisão do debate sobre pluralismo metodológico nas relações internacionais, recentemente reacendido pelo importante trabalho de Patrick Jackson (The Conduct of Inquiry in International Relations: Philosophy of Science and its Implications for the Study of World Politics). O objetivo principal do artigo é fazer uma recensão do livro, mas vai além, situando o argumento de Jackson no contexto das principais críticas que lhe foram dirigidas e no âmbito de uma discussão mai...

  6. Le plurilinguisme textuel et les mécanismes de sa mise en œuvre chez Ahmadou Kourouma et Patrick Chamoiseau Le plurilinguisme textuel et les mécanismes de sa mise en oeuvre chez Ahmadou Kourouma et Patrick Chamoiseau

    Directory of Open Access Journals (Sweden)

    El hadji Camara

    2011-12-01

    Full Text Available Parler du plurilinguisme textuel dans le roman francophone, c’est poser la question du choix de la langue d’écriture chez l’écrivain francophone, mais aussi c’est évoquer à la fois les éléments constitutifs qui participent de la définition même de la littérature francophone. Par définition, un écrivain francophone c’est celui qui écrit en français peut-on dire de manière tautologique. Mais cette définition passe sous silence la dimension institutionnelle voire idéologique à l’œuvre dans la constitution de tout groupe social. Ainsi, selon Dominique Combe, les écrivains francophones forment un groupe bien distinct dans lequel des hommes et des femmes « expriment le sentiment d’appartenir, à travers la langue française, à une communauté de pensée, de culture. » (Combe, 1995 :14. Cependant, il faut reconnaître que tout texte possède sa propre identité, par ses langues et ses référents extratextuels, que ceux-ci soient ceux de l’auteur ou non. Dès lors, comment distinguer la langue de l’auteur de celle du texte ? Et dans quelles mesures les mécanismes de la mise en texte des langues concourent à la production du sens dans l’œuvre ? Alors qu’Ahmadou Kourouma se vante de faire parler ses personnages dans la langue de leur milieu social et culturel, Patrick Chamoiseau, se qualifiant lui-même de marqueur de parole, affirme retranscrire les paroles du conteur. Dès lors, à travers une approche comparative, il sera question dans cette communication d’analyser chez ces deux écrivains francophones, Ahmadou Kourouma et Patrick Chamoiseau en l’occurrence, comment cette textualisation des langues est mise en pratique dans leurs écritures.Parler du plurilinguisme textuel dans le roman francophone, c’est poser la question du choix de la langue d’écriture chez l’écrivain francophone, mais aussi c’est évoquer à la fois les éléments constitutifs qui participent de la définition même de

  7. St. Patrick's Hospital, Cashel, Tipperary.

    LENUS (Irish Health Repository)

    Breen, C

    2014-02-01

    The aim of dietary modification, as a cornerstone of type 2 diabetes (T2DM) management, is to optimise metabolic control and overall health. This study describes food and nutrient intake in a sample of adults with T2DM, and compares this to recommendations, and to intake in age, sex, body mass index (BMI) and social-class matched adults without T2DM.

  8. Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

    Energy Technology Data Exchange (ETDEWEB)

    Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)

    2007-07-07

    The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

  9. Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002.

    Science.gov (United States)

    Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar

    2015-09-29

    The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

  10. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

  11. A PARODIZAÇÃO DA AÇÃO TRÁGICA EM FRANK PIG SAYS HELLO, DE PATRICK McCABE: DRAMA SOCIAL, VIOLÊNCIA E IRREVERÊNCIA

    Directory of Open Access Journals (Sweden)

    Sandra Luna

    2018-06-01

    Full Text Available Publicado em 1992, The Butcher Boy, celebrado romance de Patrick McCabe, logo foi adaptado para o cinema e para o teatro. Em sua forma dramática, intitulada Frank Pig Says Hello, a peça teatraliza as memórias de infância de Frank Pig, ou Piglet, um “menino-porquinho”. A despeito da dimensão trágica dos conflitos existenciais e sociais que modelam a peça de McCabe, sua dramaturgia subverte a conhecida tradição das tragédias e dos dramas sociais por meio da paródia e da ironia, substituindo o pathos trágico por humor e deboche. Fortemente marcada por traços recorrentes na arte pós-moderna, Frank Pig Says Hello apresenta-se como uma peça que, ao desconstruir as formas dramáticas tradicionais, desconstrói também, por via do riso, do sarcasmo e do grotesco, motivos e fatos associados à história da Irlanda, assim como questiona valores hegemônicos da cultura ocidental. O presente estudo analisa a parodização da ação trágica na peça, examinando as relações entre dramaticidade, violência e irreverência estética.

  12. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  13. MARGA_Chen et al_2016

    Data.gov (United States)

    U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

  14. Patrick Geddes and the Italian Territorialist School: conceptual and methodological approaches. Reflections on the participation of children in the representation of heritage values at Santa Leopoldina City - Espirito Santo State - Brazil

    Directory of Open Access Journals (Sweden)

    Bruno Amaral de Andrade

    2016-07-01

    Full Text Available El estudio de Patrick Geddes sobre el niño en la ciudad, que se remonta a las Exhibiciones del Bienestar del Niño, así como el interés por los estudios de los orígenes históricos y geográficos de las ciudades desde fábulas vinculadas a las condiciones simples y naturales de la relación del hombre con el medio ambiente; por ejemplo, historias de cazador, minero, leñador, pastor, agricultor y pescador. La Escuela Territorialista Italiana, de Alberto Magnaghi, revisita de manera crítica y reflexiva el abordaje participativo precursor del pensamiento geddesiano, y desarrolla el método, la técnica y herramienta para la participación de los niños como actores-protagonistas en la representación y en el proyecto del territorio. De hecho, este artículo aborda la representación de los valores por los niños en sitio histórico, originalmente ocupado por inmigrantes de origen germánico, la ciudad de Santa Leopoldina, Espirito Santo, Brasil. Esto es hecho con diseños de referencia desarrollados por estudiantes de edades comprendidas entre 11 y 15 años, desarrollados individual y colectivamente. Los dibujos producidos por diferentes estrategias recreativas y educativas, revelan una mayor relación emocional con el ambiente paisajístico que con el ambiente urbano.

  15. [The Psychotic Thinking of Patrick Bateman].

    Science.gov (United States)

    Fernando, Muñoz

    2012-06-01

    Literature is an inexhaustible source of study regarding mental illness which allows the academic exercise, whether dynamic oriented or not, that may help to understand the patient's inner world in the psychiatric clinical practice. Freudian, Post-Freudian and analytical examination of the main character in the U.S.A. novel AMERICAN PSYCHO. Review of sources and relevant theoretical currents. Analysis highlights the official nosologic classification boundaries, for conditions where symptoms are scattered across the spectrum of personality disorders and psychosis spectrum; usefulness and applicability of psychoanalytic concepts in psychiatric practice are also pointed out, thus granting flexibility to the clinical approach in order to justify its use. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  16. St Patrick's Hospital, John's Hill, Waterford.

    LENUS (Irish Health Repository)

    Quirke, M

    2014-11-01

    To characterise the Emergency Department (ED) prevalence of cellulitis, factors predicting oral antibiotic therapy and the utility of the Clinical Resource Efficiency Support Team (CREST) guideline in predicting patient management in the ED setting, a prospective, cross-sectional study of consecutive adult patients presenting to 3 Irish EDs was performed. The overall prevalence of cellulitis was 12 per 1,000 ED visits. Of 59 patients enrolled, 45.8% were discharged. Predictors of treatment with oral antibiotics were: CREST, Class 1 allocation (odds ratio (OR) 6.81, 95% Cl =1.5-30.1, p=0.012), patient self-referral (OR= 6.2, 95% Cl 1.9- 20.0, p=0.03) and symptom duration longer than 48 hours (OR 1.2, 95% Cl = 1.0-1.5,p=0.049). In conflict with guideline recommendation, 43% of patients in CREST Class 1 received IV therapy. Treatment with oral antibiotics was predicted by CREST Class 1 allocation, self-referral, symptom duration of more than 48 hours and absence of pre-EO antibiotic therapy.

  17. 724-IJBCS-Article-Aleodjrodo Patrick Edorh

    African Journals Online (AJOL)

    DR GATSING

    Pesticides et métaux lourds dans l'eau de boisson, les sols et les sédiments de la ceinture ... 1Ministère de l'Agriculture, de l'Elevage et de la Pêche (MAEP), Bénin. 2Département de ..... biologique et du coton conventionnel. 65p. GESAMP.

  18. Schuldnerfalle Suchmaschinen-Cache / Patrick Sakowski

    Index Scriptorium Estoniae

    Sakowski, Patrick

    2016-01-01

    Otsingumootorite vahemällu salvestatud andmete kustutamisest (nt kõlvatu konkurentsi või autoriõiguste rikkumisesga seotud kustutatud andmete kustutamine ka vahemälust, et otsingu tulemus ei viitaks kustutatud infole)

  19. 2072-IJBCS-Article-Patrick Agbassi

    African Journals Online (AJOL)

    hp

    Effect of antiretroviral drugs on prolactin in HIV infected pregnant women ... 1Department of Prosthesis and Orthopaedic Technology, School of Health Technology, ..... Hit HIV-1 hard, but only when necessary. Lancet;. 355(9221): 2147- 2152.

  20. 古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West:Prof. Chen Yuan and Chinese Historiography in the 20 th Century

    Institute of Scientific and Technical Information of China (English)

    陳智超

    2010-01-01

    Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

  1. Food Fortification to Prevent and Control Iron Deficiency | Chen ...

    African Journals Online (AJOL)

    It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...

  2. Lateral strukturierte Oberflächen zur THz-Strahlmanipulation

    OpenAIRE

    Jahn, David; Koch, Martin (Prof. Dr.)

    2018-01-01

    Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

  3. Massive Star Formation: Accreting from Companion X. Chen1 ...

    Indian Academy of Sciences (India)

    Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...

  4. Initiation and Propagation of Coronal Mass Ejections P. F. Chen

    Indian Academy of Sciences (India)

    Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...

  5. Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...

    African Journals Online (AJOL)

    The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...

  6. Chemische Reaktionen auf Oberflächen - eine SFG Studie

    OpenAIRE

    Kirsch, Harald

    2014-01-01

    This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

  7. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  8. Chaos synchronization of the fractional-order Chen's system

    International Nuclear Information System (INIS)

    Zhu Hao; Zhou Shangbo; He Zhongshi

    2009-01-01

    In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

  9. Relación heterófilo/linfocito, frecuencia espontánea de eritrocitos micronucleados y prolongaciones nucleares en el ganso nevado (Chen caerulescens: Una propuesta como posible biomonitor de estrés y genotóxicos ambientales

    Directory of Open Access Journals (Sweden)

    Martha C. Martínez Quintanilla

    2017-04-01

    Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.

  10. ACTIVITY BUDGETS OF MALE MACCOA DUCKS FitzPatrick ...

    African Journals Online (AJOL)

    study first of time budgets and then the allocation of energetic costs to the various ..... tions made during two full-moon nights suggested that non-breeding birds did nothing ... activities (Running Flight, Souse, Ski and Fight) were rated 8 x BMR.

  11. 464-IJBCS-Article-Dr Patrick A Edorh

    African Journals Online (AJOL)

    User

    2002), foam (Empain, 1976), mussels. (Bergman, 1993), carrot, cabbage (Garrec and van Haluwyn, 2002) are all good bioindicators of heavy metal pollution. These organisms, real reservoirs of toxic metals, constitute nevertheless a danger to their consumers, reason why it is important to assess the risk of toxicity faced by ...

  12. Ueber Patrick Browne’s Gattungen zweifelhafter Stellung

    NARCIS (Netherlands)

    Hallier, Hans

    1918-01-01

    Vornehmlich durch die Arbeiten GRISEBACH’S und URBAN’S ist die Flora Westindiens schon verhältnismässig gut bekannt. Obgleich aber ersterer die Kenntnis seiner Zeit in seiner bekannten „Flora of the British West Indian Islands” (1864) zusammenfasste und letzterer in seinen Symbolae Antillanae VI, 1

  13. Patrick Hockey : his life and work / Sandra McGrath

    Trove (Australia)

    McGrath, Sandra

    1994-01-01

    ... : the world of art and the world of commerce; the country and the city; the heterosexual and the homosexual; world of society and the world of the stockman; the loner and the bon vivant. Sandra Mcgrath, who was ...

  14. Dr. Patrick Dongosolo Kamalo – Consultant Neurosurgeon at Queen

    African Journals Online (AJOL)

    medical training at College of Medicine and graduated in. 2000. After finishing my ... Central Hospital “I believe that through high quality, collaborative research and training opportunities, we ... the service of a neurologist, and from my experience with ... this training? Some would say Malawi is not ready to offer this delicate,.

  15. St Patrick's Community Hospital, Summerhill, Carrick on Shannon, Leitrim.

    LENUS (Irish Health Repository)

    Kissling, E

    2013-01-01

    Within the Influenza Monitoring Vaccine Effectiveness in Europe (I-MOVE) project we conducted a multicentre case–control study in eight European Union (EU) Member States to estimate the 2011\\/12 influenza vaccine effectiveness against medically attended influenza-like illness (ILI) laboratory-confirmed as influenza A(H3) among the vaccination target groups. Practitioners systematically selected ILI \\/ acute respiratory infection patients to swab within seven days of symptom onset. We restricted the study population to those meeting the EU ILI case definition and compared influenza A(H3) positive to influenza laboratory-negative patients. We used logistic regression with study site as fixed effect and calculated adjusted influenza vaccine effectiveness (IVE), controlling for potential confounders (age group, sex, month of symptom onset, chronic diseases and related hospitalisations, number of practitioner visits in the previous year). Adjusted IVE was 25% (95% confidence intervals (CI): -6 to 47) among all ages (n=1,014), 63% (95% CI: 26 to 82) in adults aged between 15 and 59 years and 15% (95% CI: -33 to 46) among those aged 60 years and above. Adjusted IVE was 38% (95%CI: -8 to 65) in the early influenza season (up to week 6 of 2012) and -1% (95% CI: -60 to 37) in the late phase. The results suggested a low adjusted IVE in 2011\\/12. The lower IVE in the late season could be due to virus changes through the season or waning immunity. Virological surveillance should be enhanced to quantify change over time and understand its relation with duration of immunological protection. Seasonal influenza vaccines should be improved to achieve acceptable levels of protection.

  16. Tööd soovinud noored said rakendust / Patrick Rang

    Index Scriptorium Estoniae

    Rang, Patrick, 1977-

    2004-01-01

    Sotsiaalministeeriumi ja tööturuameti poolt algatatud PHARE 16-24-aastaste noorte tööhõive edendamise projektist, mille eesmärgiks oli pakkuda noortele erinevaid koolitusi. Projekti raames lõpetas 517 noort tööotsingukoolituse ja 280 erialakoolituse

  17. St. Patrick's Community Hospital, Summerhill, Carrick on Shannon, Leitrim

    LENUS (Irish Health Repository)

    Fitzmaurice, Karen

    2012-02-01

    BACKGROUND AND AIMS: CD8 T cells are central to the control of hepatitis C virus (HCV) although the key features of a successful CD8 T cell response remain to be defined. In a cohort of Irish women infected by a single source, a strong association between viral clearance and the human lecucocyte (HLA)-A*03 allele has been described, and the aim of this study was to define the protective nature of the associated CD8 T cell response. METHODS: A sequence-led approach was used to identify HLA-A*03-restricted epitopes. We examine the CD8 T cell response associated with this gene and address the likely mechanism underpinning this protective effect in this special cohort, using viral sequencing, T cell assays and analysis of fitness of viral mutants. RESULTS: A strong \\'HLA footprint\\' in a novel NS3 epitope (TVYHGAGTK) was observed. A lysine (K) to arginine (R) substitution at position 9 (K1088R) was seen in a significant number of A*03-positive patients (9\\/12) compared with the control group (1\\/33, p=0.0003). Threonine (T) was also substituted with alanine (A) at position 8 (T1087A) more frequently in A*03-positive patients (6\\/12) compared with controls (2\\/33, p=0.01), and the double substitution of TK to AR was also observed predominantly in HLA-A*03-positive patients (p=0.004). Epitope-specific CD8 T cell responses were observed in 60% of patients three decades after exposure and the mutants selected in vivo impacted on recognition in vitro. Using HCV replicons matched to the viral sequences, viral fitness was found to be markedly reduced by the K1088R substitution but restored by the second substitution T1087A. CONCLUSIONS: It is proposed that at least part of the protective effect of HLA-A*03 results from targeting of this key epitope in a functional site: the requirement for two mutations to balance fitness and escape provides an initial host advantage. This study highlights the potential protective impact of common HLA-A alleles against persistent viruses, with important implications for HCV vaccine studies.

  18. Patrick Air Force Base Storm Water Pollution Prevention Plan.

    Science.gov (United States)

    1994-09-01

    7758987 Cupric sulfate 77-47-4 Hexachlorocyclopentadliene 10380297 Cupric sulfate, ammoniated 67-72-1 H-exachloroethane 815827 Cupric tartrate 76-47-01...28300745 Antimony potassium 75-00-3 Chloroethane (Ethyl chlo- tartrate ride) 7789619 Antimony tribromide 67-66-3 Chloroform 10025919 Antimony...5 p-Cresol 7787475 Beryllium chloride 1319-77-3 Cresol (mixed isomers) 7787497 Beryllium fluoride 142712 Cupric acetate 7787555 Beryllium nitrate

  19. 75 FR 8081 - Patrick J. Lais: Debarment Order

    Science.gov (United States)

    2010-02-23

    ..., identified as ``Coated Aspirin,'' to customers in Kansas City, MO. In May 2000, this ``Coated Aspirin... during Mr. Lais's debarment, will be subject to civil money penalties (section 307(a)(6) of the act (21 U... pending drug product application during his period of debarment he will be subject to civil money...

  20. DIGITAL FLOOD INSURANCE RATE MAP DATABASE, PATRICK COUNTY, VA, USA

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Digital Flood Insurance Rate Map (DFIRM) Database depicts flood risk information and supporting data used to develop the risk data. The primary risk...

  1. Intervention of M. Patrick Devedjian, deputy Minister to the industry

    International Nuclear Information System (INIS)

    2004-01-01

    In his talk, M. Devedjian recalls the present day world energy situation, the future of petroleum and its share in the world energy policy, the major challenge of the greenhouse effect and the main trends of the French energy policy: re-launching of the energy mastery, development of new and renewable energy sources, optimization of the use of fossil fuels, development of a new generation of nuclear reactors and reinforcement of the research on new energy technologies. Then, he makes some comments about the volatility of oil prices and on their consequences on the reconstitution of petroleum stocks, on the world petroleum investments, and on the economy of the different countries, in particular the developing countries. (J.S.)

  2. Kuidas lugeda "Meeste domineerimist"? / Patrick Champagne ; tlk. Marek Tamm

    Index Scriptorium Estoniae

    Champagne, Patrick

    2005-01-01

    Rets. rmt.: Bourdieu, Pierre. Meeste domineerimine. Tallinn, 2005. Kommenteerivad (lk. 12-14) Liina Lukas, Rein Ruutsoo (TLÜ õppejõud), Marina Grišakova, Aare Pilv, Airi-Alina Allaste, Raivo Vetik (TLÜ Õppejõud), Andres Härm, Voldemar Tomusk

  3. GPS TEC Fluctuations in the Low and High Latitudes During the 2015 St. Patrick`s Day Storm

    Science.gov (United States)

    Chung, Jong-Kyun; Hong, Junseok; Yoo, Sung-Moon; Kim, Jeong-Han; Jee, Geonhwa; Hegai, Valery V.

    2017-12-01

    As a part of collaborative efforts to understand ionospheric irregularities, the Korea ionospheric scintillation sites (KISS) network has been built based on global positioning system (GPS) receivers with sampling rates higher than 1 Hz. We produce the rate of TEC index (ROTI) to represent GPS TEC fluctuations related to ionospheric irregularities. In the KISS network, two ground-based GPS sites at Kiruna (marker: KIRN; geographic: 67.9° N, 21.4° E; geomagnetic: 65.2° N) and Chuuk (marker: CHUK; geographic: 7.5° N, 151.9° E; geomagnetic: 0.4° N) were selected to evaluate the ROTI value for ionospheric irregularities during the occurrence of the 2015 St. Patrick’s Day storm. The KIRN ROTI values in the aurora region appear to be generally much higher than the CHUK ROTI values in the EIA region. The CHUK ROTI values increased to 0.5 TECU/min around UT=13:00 (LT=23:00) on March 16 in the quiet geomagnetic condition. On March 17, 2015, CHUK ROTI values more than 1.0 TECU/min were measured between UT=9:00 and 12:00 (LT=19:00 and 22:00) during the first main phase of the St. Patrick’s Day storm. This may be due to ionospheric irregularities by increased pre-reversal enhancement (PRE) after sunset during the geomagnetic storm. Post-midnight, the CHUK ROTI showed two peaks of 0.5 TECU/min and 0.3 TECU/min near UT=15:00 (LT=01:00) and UT=18:00 (LT=04:00) at the second main phase. The KIRN site showed significant peaks of ROTI around geomagnetic latitude=63.3° N and MLT=15:40 on the same day. These can be explained by enhanced ionospheric irregularities in the auroral oval at the maximum of AE index

  4. Chen et al., Afr J Tradit Complement Altern Med. (2012) 9(2):234 ...

    African Journals Online (AJOL)

    AJTCAM

    E-mail: qidongfanjian@sina.com .... under an inverted microscope. ... Stars image analyzing equipment (Shanghai, P.R. China) was used to analyze the image ... Inverted microscope: The cultured neurons in the control group grew well and ...

  5. Critical node lifetimes in random networks via the Chen-Stein method

    NARCIS (Netherlands)

    Franceschetti, M.; Meester, R.W.J.

    2006-01-01

    This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and

  6. Chen et al., Afr J Tradit Complement Altern Med. (2016) 13(1):25-32 ...

    African Journals Online (AJOL)

    PROF ADEWUNMI

    The phosphorylation of PKA substrate was not activated after 48 hours of treatment with ephedrine and anisodamine. Conclusion: Ephedrine and anisodamine inhibit the proliferation of SKBR3 cells via a significantly change of intracellular cAMP concentration. Key words: anisodamine, breast cancer, cyclic adenosine ...

  7. Q. Shen1, X. Chen1, Jiyune Yi2, DR Jiang1 & YJ Yun3

    Indian Academy of Sciences (India)

    imately six months to cover the 2-yr pulsation cycle of VX Sgr. We used a special phase referencing ... but the υ = 2 line has relatively few maser features, most of which reside in the. Southern and Northern parts. ... stronger masers of both the lines appear, among which the main features reside in the inner shell and show ...

  8. Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...

    African Journals Online (AJOL)

    AJTCAM

    As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...

  9. In search of low cost titanium: the Fray Farthing Chen (FFC) Cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2010-10-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can only be achieved by also reducing the large number of process steps required to process... the sponge to mill product, including sponge purification, comminution, electrode forming, Vacuum Arc Re-melting, Hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost effective to cast the largest...

  10. In search of low cost titanium: the fray farthing chen (FFC) cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2011-03-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can be achieved only by also reducing the large number of process steps required... to process the sponge to mill product, including sponge purification, comminution, electrode forming, vacuum arc re-melting, and hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost...

  11. Chen et al., Afr J Tradit Complement Altern Med. (2014) 11(1):15-22

    African Journals Online (AJOL)

    cadewumi

    x300mm,Japan ) column. The columns were eluted with 0.1M nitric acid and calibrated with ..... Mushiake, H, Tsunoda, T, Nukatsuka,M, Shimao K, Fukushima M, Tahara H. (2005). Dendritic cells might be one of key factors for eliciting antitumor ...

  12. Calibrating the Shan-Chen lattice Boltzmann model for immiscible displacement in porous media

    DEFF Research Database (Denmark)

    Christensen, Britt Stenhøj Baun; Schaap, M.G.; Wildenschild, D.

    2006-01-01

    The lattice Boltzmann (LB) modeling technique is increasingly being applied in a variety of fields where computational fluid dynamics are investigated. In our field of interest, environmentally related flow processes in porous media, the use of the LB method is still not common. For the LB...

  13. Beiträge zur Beugungstheorie elektromagnetischer Wellen an Kanten vollkommen leitender Flächen

    OpenAIRE

    Zinal, Sherko

    2011-01-01

    Den Kern der vorliegenden Arbeit bilden die Untersuchung sowie die Formulierung von Lösungsansätzen für ein elementares, elektromagnetisches Beugungsproblem; einer undendlich langen Schlitzleitung mit einseitig begrenzter etallisierungsplatte (Abschnitt 1.2). Motiviert wird dieses Beugungsproblem im Hinblick auf die Beugungsproblematik planarer Strahler (Antennen) mit endlich ausgedehnter Grundmetallisierung (Abschnitt 1.1). In Kapitel 2 wird ein Stromlinien-Modell zur Formulierung des Beugun...

  14. VizieR Online Data Catalog: IRS spectra with features of crystalline silicates (Chen+, 2016)

    Science.gov (United States)

    Chen, R.; Luo, A.; Liu, J.; Jiang, B.

    2018-04-01

    Spectra taken by the IRS (Houck et al. 2004ApJS..154...18H) on the Spitzer space telescope (Werner et al. 2004ApJS..154....1W) are now publicly available. These spectra are produced using the bksub.tbl products from SL and LL modules of final SSC pipeline, version 18.18. From the IRS data archive, we found a collection of 16986 low-resolution spectra. The spectra are merged by four slits: SL2 (5.21-7.56 μm), SL1 (7.57-14.28 μm), LL2 (14.29-20.66 μm), and LL1 (20.67-38.00 μm). As crystalline silicates have no features in the SL2 band, we choose the spectra that include all the other three bands: SL1, LL2, and LL1 so that the object has a continuous spectrum from about 7.5-38 μm. In this way, five of the seven infrared complexes of crystalline silicates are covered, i.e., the 10, 18, 23, 28, and 33 μm complexes. (5 data files).

  15. Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?

    Directory of Open Access Journals (Sweden)

    Verschwele, Arnd

    2014-07-01

    Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.

  16. Effects of different cleaning treatments on heavy metal removal of Panax notoginseng (Burk) F. H. Chen.

    Science.gov (United States)

    Dahui, Liu; Na, Xu; Li, Wang; Xiuming, Cui; Lanping, Guo; Zhihui, Zhang; Jiajin, Wang; Ye, Yang

    2014-01-01

    The quality and safety of Panax notoginseng products has become a focus of concern in recent years. Contamination with heavy metals is one of the important factors as to P. notoginseng safety. Cleaning treatments can remove dust, soil, impurities or even heavy metals and pesticide residues on agricultural products. But effects of cleaning treatments on the heavy metal content of P. notoginseng roots have still not been studied. In order to elucidate this issue, the effects of five different cleaning treatments (CK, no treatment; T1, warm water (50°C) washing; T2, tap water (10°C) washing; T3, drying followed by polishing; and T4, drying followed by tap water (10°C) washing) on P. notoginseng roots' heavy metal (Cu, Pb, Cd, As and Hg) contents were studied. The results showed that heavy metal (all five) content in the three parts all followed the order of hair root > rhizome > root tuber under the same treatment. Heavy metal removals were in the order of Hg > As > Pb > Cu > Cd. Removal efficiencies of the four treatments were in the order of T2 > T1 > T3 > T4. Treatments (T1-T4) could decrease the contents of heavy metal in P. notoginseng root significantly. Compared with the requirements of WM/T2-2004, P. notoginseng roots' heavy metal contents of Cu, Pb, As and Hg were safe under treatments T1 and T2. In conclusion, the cleaning process after production was necessary and could reduce the content of heavy metals significantly. Fresh P. notoginseng root washed with warm water (T2) was the most efficient treatment to remove heavy metal and should be applied in production.

  17. Chen et al., Afr J Tradit Complement Altern Med. (2011) 8(4):467-476

    African Journals Online (AJOL)

    AJTCAM

    Keywords: Shen-qi-di-huang decoction, proteinuria, nephrin, adriamycin nephropathy. Introduction. Proteinuria is a clinical signature of podocyte injury resulting in many renal diseases. The slit diaphragm (SD) which connects neighboring foot processes of podocytes represents a critical structure of protein filtration (Tarabra ...

  18. AtCCX1 transports Na + and K + in Pitch pastoris | Chen | African ...

    African Journals Online (AJOL)

    Compartmentation of Na+ into vacuoles is an important way for cells to avoid the toxic effects of salt. Here, Arabidopsis AtCCX1 was studied in Pitch pastoris GS115. Yeast expressing AtCCX1 grew better in high H+ concentration medium and high salt medium than original strain and increased Na+ accumulation and ...

  19. First record of molluscs naturally infected with Angiostrongylus cantonensis (Chen, 1935 (Nematoda: Metastrongylidae in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    2007-11-01

    Full Text Available Seeking the identification of Angiostrongylus cantonensis as a potential etiological agent of three clinical cases of eosinophilic meningitis, mollusc specimens were collected in the state of Espírito Santo, Brazil. The snails were identified as Sarasinula marginata (45 specimens, Subulina octona (157, Achatina fulica (45 and Bradybaena similaris (23. Larvae obtained were submitted to polymerase chain reaction and restriction fragment length polymorphism diagnosis. Their genetic profile were corresponded to A. cantonensis. Rattus norvegicus experimentally infected with third-stage larvae, developed menigoencephalitis, and parasites became sexually mature in the lungs. Additionally, larvae obtained from A. fulica snails, from São Vicente, state of São Paulo, also showed genetic profiles of this nematode. This is the first record of Brazilian molluscs infected with this nematode species.

  20. VizieR Online Data Catalog: YSO candidates in the Magellanic Bridge (Chen+, 2014)

    Science.gov (United States)

    Chen, C.-H. R.; Indebetouw, R.; Muller, E.; Kawamura, A.; Gordon, K. D.; Sewilo, M.; Whitney, B. A.; Fukui, Y.; Madden, S. C.; Meade, M. R.; Meixner, M.; Oliveira, J. M.; Robitaille, T. P.; Seale, J. P.; Shiao, B.; van Loon, J. Th.

    2017-06-01

    The Spitzer observations of the Bridge were obtained as part of the Legacy Program "Surveying the Agents of Galaxy Evolution in the Tidally-Stripped, Low-Metallicity Small Magellanic Cloud" (SAGE-SMC; Gordon et al. 2011AJ....142..102G). These observations included images taken at 3.6, 4.5, 5.8, and 8.0 um bands with the InfraRed Array Camera (IRAC) and at 24, 70, and 160 um bands with the Multiband Imaging Photometer for Spitzer (MIPS). The details of data processing are given in Gordon et al. (2011AJ....142..102G). To construct multi-wavelength SEDs for sources in the Spitzer catalog, we have expanded it by adding photometry from optical and NIR surveys covering the Bridge, i.e., BRI photometry from the Super COSMOS Sky Surveys (SSS; Hambly et al. 2001MNRAS.326.1279H) and JHKs photometry from the Two Micron All Sky Survey (2MASS; Skrutskie et al. 2006AJ....131.1163S, Cat. VII/233). (5 data files).

  1. Was kommt nach dem Handel? Umnutzung von Einzelhandelsflächen und deren Beitrag zur Stadtentwicklung

    OpenAIRE

    Sperle, Tilman

    2012-01-01

    In der Stadt europäischen Typs sind Stadt und Handel eng miteinander verwoben. Die Bedeutung des Handels geht weit über dessen originäre Versorgungsfunktion hinaus. Für die städtischen Zentren und Nebenzentren übernimmt er sowohl gestaltende als auch soziale Funktionen und trägt mit seiner belebenden Wirkung maßgeblich zum urbanen Leben bei. Mit dem tief greifenden Strukturwandel im Einzelhandel verändert sich diese Beziehung zwischen Stadt und Handel dramatisch, Trading-down-Prozesse geh...

  2. VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016)

    Science.gov (United States)

    Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.

    2016-04-01

    We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).

  3. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.

  4. VizieR Online Data Catalog: Quasars narrow absorption lines from SDSS (Chen+, 2015)

    Science.gov (United States)

    Chen, Z.-F.; Gu, Q.-S.; Chen, Y.-M.; Cao, Y.

    2017-11-01

    The Baryon Oscillation Spectroscopic Survey (BOSS: Eisenstein et al. 2011AJ....142...72E; Paris et al. 2012, Cat. VII/269) is the main dark-time legacy survey of the third stage of the SDSS, which used the same 2.5-m telescope (Gunn et al. 2006AJ....131.2332G; Ross et al. 2012, J/ApJS/199/3) as the first and second stages of the SDSS (hereafter SDSS-I/II). SDSS-I/II spectra have a wavelength coverage from 3800-9200Å with a spectral resolution of 1800-2200 (e.g. York et al. 2000AJ....120.1579Y). BOSS spectra span a range from 3600-10500Å at a resolution of 1300-2500 (Paris et al. 2012, Cat. VII/269). During the first two years, BOSS detected 87822 quasars over an area of 3275 deg2, including 7932 quasars that were observed by SDSS-I/II as well. Quasars observed by both SDSS-I/II and BOSS provide a remarkable chance to study the variabilities of absorption lines in a large population. Throughout this work, we take the quasar emission redshifts provided by Hewett & Wild (2010, J/MNRAS/405/2302, http://das.sdss.org/va/HewettWilddr7qso_newz/) directly. (2 data files).

  5. REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘

    Directory of Open Access Journals (Sweden)

    Reviewed by Wu Jing 吴晶

    2018-05-01

    Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...

  6. Extended Bioventing Testing Results at the BX Service Station Site, Patrick AFB, Florida

    National Research Council Canada - National Science Library

    Marchand, Ed

    1997-01-01

    .... Soil gas samples were collected, and in situ respiration testing was performed by Parsons ES from 8 to 14 November 1996 to assess the extent of remediation completed during approximately 3 months...

  7. Environmental Assessment for Beach Shoreline Protection at Patrick Air Force Base, Florida

    Science.gov (United States)

    2012-02-27

    by embryonic snapping turtles (Chelydra serpentina ). Journal of Experimental Biology 108:195-204. 47 Packard, G.C., M.J. Packard, and W.H.N. Gutzke...composition of hatchling snapping turtles (Chelydra serpentina ). Journal of Comparative Physiology B 158:117-125. Parmenter, C.J. 1980. Incubation

  8. Brigadier General Marsena Patrick, Provost Marshal General for the Army of the Potomac

    Science.gov (United States)

    2013-12-13

    professionals. Just as the populations of the states reflected, attendance by cadets from northern states was approximately double that of cadets from southern...the department of the Provost Marshals within his own division, and extending his jurisdiction over the surrounding country beyond the range of...a curse to it; and refugees from taxation and conscription at home are fattening upon the plunder obtained here.”298 He moved to establish firmer

  9. A designated centre for people with disabilities operated by St Patricks Centre (Kilkenny) Ltd., Kilkenny

    LENUS (Irish Health Repository)

    Hennessy, D

    2010-03-01

    Outpatient non-attendance is a considerable source of inefficiency in the health service, wasting time, resources and potentially lengthening waiting lists, Given the current economic climate, methods need to be employed to reduce non-attendance. The aim was to analyse outpatient non-attendance and determine what factors influence attendance. A prospective audit over a two-month period to a tertiary-referral Urological service was performed to determine the clinical and demographic profile of non-attendees. Of 737 appointments, 148 (20%) patients did not attend (DNA). A benign urological condition was evident in 116 cases (78%). This group of patients also accounted for the majority of new patients not attending 40\\/47, returning patients not attending 101\\/148 and the majority of patients who missed multiple appointments 43\\/49. Patients with benign conditions make up the majority of clinic non-attendance. Consideration may be given to discharging such patients back to their general practitioner after one unexplained non-attendance until other alternatives of follow up are available.

  10. MP3-e leiutajatele jäävad näpud / Patrick Jenkins

    Index Scriptorium Estoniae

    Jenkins, Patrick

    2005-01-01

    Tänu MP3-mängija iPod edukale müügile suurenes Apple Computeri I kvartali kasum 368% ning oli 295 miljonit dollarit. MP3 tehnoloogia leiutati Saksamaal peaaegu 20 aastat tagasi, kuid tookord ei saadud tehnoloogia rakendamiseks Euroopas tuge. Lisa: MPEG Layer 3 kodeerimine

  11. 78 FR 15293 - Safety Zone; St. Patrick's Day Fireworks; Manitowoc River, Manitowoc, WI

    Science.gov (United States)

    2013-03-11

    ... pursuant to authority under section 4(a) of the Administrative Procedure Act (APA) (5 U.S.C. 553(b)). This... Security Management Directive 023-01 and Commandant Instruction M16475.lD, which guide the Coast Guard in...

  12. James A. FitzPatrick Nuclear Power Plant. Semiannual operating report, July--December 1975

    International Nuclear Information System (INIS)

    1976-01-01

    Net electrical power generated was 1,824,209 MWh(e) with the reactor on line 3,229.2 hrs. Information is presented concerning operation, power generation, shutdowns, corrective maintenance, physics and testing, occupational radiation exposure, release of radioactive materials, and abnormal and reportable occurrences

  13. Intrinsic Remediation Treatability Study for Site ST-29 Patrick Air Force Base, Florida

    Science.gov (United States)

    1995-08-01

    of the northeast/southwest (NE/SW) runway. The BX Service Station has been in operation since 1954. The site consists of a small food market (Building... UCg /1 0 86-4-MWD .09 12.4 1.47 0 86-5-MWS .17 23.6 6.86 86-7 .12 30.2 2.52 86-8 .10 44.7 8.51 86-9-MWD .11 34.7 15.3 86-9-MWD Dup .11 86-9-MWS .10

  14. A designated centre for people with disabilities operated by St PatricksCentre (Kilkenny) Ltd., Kilkenny

    LENUS (Irish Health Repository)

    Ryan, S

    2011-01-01

    Accurate handover of clinical information is imperative to ensure continuity of patient care, patient safety and reduction in clinical errors. Verbal and paper-based handovers are common practice in many institutions but the potential for clinical errors and inefficiency is significant. We have recently introduced an electronic templated signout to improve clarity of transfer of patient details post-surgical take. The aim of this study was to prospectively audit the introduction of this new electronic handover in our hospital with particular emphasis regarding efficacy and efficiency. The primary surrogate chosen to assess efficacy and efficiency was length of stay for those patients admitted through the emergency department. To do this we compared two separate, two-week periods before and after the introduction of this new electronic signout format. Users were not informed of the study. Information recorded on the signout included details of the emergency admissions, consults received on call and any issues with regard to inpatients. ASA grade, time to first intervention and admission diagnosis were also recorded. Our results show that introduction of this electronic signout significantly reduced median length of stay from five to four days (P=0.047). No significant difference in ASA grades, time to first intervention or overall admission diagnosis was obtained between the two time periods. In conclusion, this is the first study to show that the introduction of electronic signout post-call was associated with a significant reduction in patient length of stay and provided better continuity of care than the previously used paper-based handover.

  15. okokon o. umoh1, Patrick P. obot1 & isidore S. obot1, 2 1Centre for ...

    African Journals Online (AJOL)

    Key Words: Perception, alcohol policy, alcohol advertising, university students corresponding Author: Okokon ... health problem and the hazardous pattern of consumption in ... promotion strategies; perception of alcohol policies with emphasis ...

  16. Harvard Pilgrim's Patrick Cahill Tries To Make Sense of It All.

    Science.gov (United States)

    Diamond, Frank

    2018-03-01

    The 40-year-old vice president of regional markets for eastern Massachusetts wants enrollees and, especially, employers to know that there will continue to be a lot of public policy change as the ACA evolves. His course? Keep strengthening ties with providers.

  17. James A. FitzPatrick Nuclear Power Plant. Semiannual operating report, January--June 1975

    International Nuclear Information System (INIS)

    1975-01-01

    The reactor, which was licensed for operation on October 17, 1974, has been in the start-up testing phase and has successfully completed the 50 percent testing plateau. Information is presented concerning operations, maintenance, instrumentation and control, radiochemistry and radiation protection; luel loading, and abnormal occurrences. Two supplements are included. Supplement A is the environmental report and Supplement B describes effluents and waste disposal. (FS)

  18. Kui sa oled mind sellisena loonud : [Patrick Shanley filmi "Kahtlus" arvustus] / Miina Piir

    Index Scriptorium Estoniae

    Piir, Miina

    2009-01-01

    Filmis "Kahtlus" puutume kokku igavese teemaga - katoliku preestrid ja kooripoisid. Katoliku preestrit homoseksuaalsuses kahtlustada on ülimalt lihtne, sest ordineeritakse reeglina vallalisi mehi, kes elavad tsölibaadis

  19. Surra Tallinna eest / Patrick J. Buchanan ; tõlk. Marek Laane

    Index Scriptorium Estoniae

    Buchanan, Patrick J.

    2007-01-01

    USA presidendikandidaat kirjutab Venemaa-Eesti konfliktist pronkssõduri pärast ja võimalikust Venemaa rünnakust Eesti vastu ning arvab, et USA ei peaks, hoolimata NATO põhimõttest, sekkuma, sest see tooks kaasa veel suurema sõja

  20. A designated centre for people with disabilities operated by St Patricks Centre (Kilkenny) Ltd., Kilkenny

    LENUS (Irish Health Repository)

    Dardis, Christopher

    2015-12-21

    Epidural anesthesia is the most commonly used method of pain relief during labor in the USA. It is not classically associated with alterations in level of alertness. Coma during the procedure is rare, with a reported incidence of 0.1-0.3%.

  1. Prantsusmaa mälupoliitikad / Patrick Garcia ; tõlk. Triinu Tamm

    Index Scriptorium Estoniae

    Garcia, Patrick

    2006-01-01

    Ajalookirjutusest Prantsusmaal pärast revolutsiooni, elukutselise ajaloolaskonna sünnist Prantsusmaal, 11. novebmri ja 8. mai tähistamisest, okupatsiooniperioodi kriitilisest läbivaatamisest, mälukonfliktidest tänapäeva demokraatlikus ühiskonnas

  2. 77 FR 36003 - Patrick K. Chau, M.D.; Decision and Order

    Science.gov (United States)

    2012-06-15

    ... committed ``[i]ncompetence, negligence, or malpractice which results in injury to a patient or which creates... civil negligence.''' Laurence T. McKinney, 73 FR 43260, 43266 (quoting United States v. McIver, 470 F.3d...

  3. Environmental Assessment of the General Plan and Maintenance of Patrick Air Force Base, Florida

    Science.gov (United States)

    2012-07-17

    females annually ccur in the Northern Gulf of Mexico (U.S.), Dry Tortugas (U.S.), Cay Sal Bank (Bahamas), ergipe and Northern Bahia (Brazil), Southern...Subpopulation occurring from about 29°N. on Florida’s east coast to Sarasota on Florida’s west coast; (3) Dry Tortugas , Florida, Sul>population, (4...B. Witherington, FWC, personal communication 2007). A near complete census of the Dry Tortugas Subpopulation undertaken from 1995 to 2004

  4. Environmental Assessment for the General Plan and Maintenance of Patrick Air Force Base, Florida

    Science.gov (United States)

    2005-05-01

    considered viable. P A F B G e n e r a l P l a n E A 2 Environmental Effects The General Plan EA evaluated the environmental impacts of...year cycle. The potential environmental effects were assessed for the following environmental resource areas: air quality, water quality, geology...ADP Area Development Plan AF Air Force AFB Air Force Base AFETR Air Force Eastern Test Range AFI Air Force Instruction AFMAN Air Force Manual

  5. Review of Matters Related to the Death of Corporal Patrick Tillman, U.S. Army

    Science.gov (United States)

    2007-03-26

    34 or " jingle " truck). The jinga truck, driven by a local Afghan, was towing a fifth (inoperable) U.S. vehicle. After the split, Serial 1 traveled down...vehicle, with the assistance of a local " jingle " truck, to a pre-designated location for pick up. After the two Serials separated, and due to terrain

  6. A designated centre for people with disabilities operated by St Patricks Centre (Kilkenny) Ltd., Kilkenny

    LENUS (Irish Health Repository)

    Hickey, C

    2016-09-01

    Hepatitis E virus (HEV) is a single stranded RNA virus causing infection worldwide. In developing countries HEV genotypes 1 and 2 spread faeco-orally via water. Recently, infections with HEV have been detected in Europe and North America in patients with no travel history. These are food-borne HEV genotypes 3 and 4, a pig-associated zoonosis. Most infections are asymptomatic but morbidity and chronic infection may occur with prior liver disease or immunosuppression. International seroprevalence rates vary and with improved diagnostics have increased. To determine the current prevalence in this region we studied anonymised serum samples submitted in 2015 for routine testing. We detected anti-HEV IgG in 16\\/198 (8%) individuals, highest rate in 40-59 year olds (43.8%). This is higher than reported for the same region in 1995 (0.4%) using a previous generation assay. This study provides evidence of HEV circulation in Ireland and reinforces the need for ongoing surveillance.

  7. Bauxite Mine Rehabilitation Programs — A Progress Report Patrick Atkins, Alcoa Inc.

    Science.gov (United States)

    Donaldson, Don; Raahauge, Benny E.

    Bauxite is the primary source of raw material for the production of aluminum oxide and aluminum metal. At the current primary aluminum production level, known bauxite reserves will last for hundreds of years. Two to three tonnes of bauxite are required to produce one tonne of alumina and two tonnes of alumina are required to produce one tonne of aluminum metal. Typical bauxites contain from 30%-60% aluminum hydroxides and various levels of iron, silica, and titanium impurities. Approximately 125 million tonnes of bauxite are mined each year from 45 mines located on every continent except Antarctica. The major mining areas are located in the tropics, above and below the equator, as well as in Western Australia, the Caribbean Region, and the Mediterranean. Most bauxite is surface mined, although a few small underground mines remain active. The overburden depth ranges from almost none to several 10s of meters, with the average near five meters. The total land disturbed by bauxite mining each year is estimated to be 2,000-2,500 hectares per year.

  8. Evaluation of the Effectiveness of Chemical Dependency Counseling Course Based on Patrick and Partners

    Science.gov (United States)

    Keshavarz, Yousef; Ghaedi, Sina; Rahimi-Kashani, Mansure

    2012-01-01

    Background The twelve step program is one of the programs that are administered for overcoming abuse of drugs. In this study, the effectiveness of chemical dependency counseling course was investigated using a hybrid model. Methods In a survey with sample size of 243, participants were selected using stratified random sampling method. A questionnaire was used for collecting data and one sample t-test employed for data analysis. Findings Chemical dependency counseling courses was effective from the point of view of graduates, chiefs of rehabilitation centers, rescuers and their families and ultimately managers of rebirth society, but it was not effective from the point of view of professors and lecturers. The last group evaluated the effectiveness of chemical dependency counseling courses only in performance level. Conclusion It seems that the chemical dependency counseling courses had appropriate effectiveness and led to change in attitudes, increase awareness, knowledge and experience combination and ultimately increased the efficiency of counseling. PMID:24494132

  9. Environmental Assessment for the 920th Rescue Wing Beddown Patrick Air Force Base, Florida

    Science.gov (United States)

    2005-10-01

    will be hollow core precast concrete planks with a structural concrete topping. Column and beam construction will be used for the exterior porches and... connection for fire protection. 8. Pararescue Facility of approximately 6,000 SF 9. The Concrete Building of approximately 400 SF for the storage of... connections of cast iron material are showing degrees of deterioration from internal corrosion. Adjacent to the new north lift station is a 140,000

  10. James A. FitzPatrick Nuclear Power Plant. Annual report of operations: January-December 1976

    International Nuclear Information System (INIS)

    1977-01-01

    Net electrical energy generated was 4,156,298 MWH with the generator on line 6,289.1 hrs. Information is presented concerning operating experience, specification changes, maintenance, licensee event reports, fuel performance and data tabulations

  11. Die Erfassung von städtischen Oberflächen mittels EDV-gestützter Luftbildauswertung : ein Beitrag zur klimatologischen und luftklimatischen Bewertung von städtischen Teilflächen

    Directory of Open Access Journals (Sweden)

    M. Sandtner

    Full Text Available The article shows that the computer-aided, analogous-visual, stereometric interpretation of large-scale colour-infrared (CIR aerial photographs and subsequent data processing in a Geographical Information System (GIS can provide fundamental data necessary to describe aspects of urban ecology in a scale relevant for city-planning. This is exemplified by an evaluation of urban areas concerning their climates and airpollution using maps of urban surfaces (scale1:2500. An argumentation relying on such detailed and current basic data can stress the importance of environmental aspects in contrast to competing public and private interests in the process of city planning.

  12. Erste Erfahrungen mit RDA an wissenschaftlichen Universalbibliotheken in Deutschland - Ergebnisse aus Fokusgruppengesprächen mit Katalogisierenden

    Directory of Open Access Journals (Sweden)

    Heidrun Wiesenmüller

    2017-04-01

    Full Text Available Einige Monate nach dem Umstieg auf das neue Regelwerk "Resource Description and Access" (RDA wurden an 18 großen deutschen wissenschaftlichen Universalbibliotheken Fokusgruppengespräche mit Katalogisierererinnen und Katalogisierern durchgeführt. Die Katalogisierenden wurden u.a. befragt, wie sicher sie sich bei der Anwendung von RDA fühlen, was sie am neuen Regelwerk gut oder schlecht finden, wie sie den Aufwand im Vergleich zum früheren Regelwerk RAK einschätzen, welche Informations- und Hilfsmittel sie verwenden und wie sie zu den regelmäßigen Änderungen im Standard stehen. Der vorliegende Aufsatz dokumentiert die Ergebnisse der Gespräche.   Several months after the introduction of the new cataloging standard "Resource Description and Access" (RDA, focus-group interviews with catalogers were conducted at 18 large academic and state libraries in Germany. Among other things, the catalogers were asked how confident they feel in applying RDA, which aspects of the new cataloging code they like or do not like, how they estimate the expenditure of time in comparison to the former cataloging code RAK, which sources they use to get help or information, and what they think about the frequent changes to the new standard. The paper presents the results of these interviews.

  13. Organisation der Lektoratsarbeit in Öffentlichen Bibliotheken, ihre Stärken und Schwächen

    OpenAIRE

    Umlauf, Konrad

    2011-01-01

    Die Praxis der Lektoratsarbeit an Öffentlichen Bibliotheken wurde 2010 mit einer Online-Befragung unter Biblothekspersonal erhoben. Die Fragen richten sich auf die Aufbauorganisation (Anteil der Lektoren unter dem Personal, den am Bestandsaufbau beteiligten Personalgruppen, die Lektoratsaufgaben im Einzelnen, typische Aufgaben der Lektoren neben den Lektoratsaufgaben, insbes. Verbindung von Lektoratsaufgaben mit Auskunftsdienst), die Ablauforganisation (Entscheidungsablauf und Kaufsitzungen, ...

  14. Chem TV: Choices I, v. 1.5.1 (by B. A. Luceigh, P. Ngo, and J. Chen)

    Science.gov (United States)

    Kraig Steffen, L.

    1999-08-01

    CHEM TV: Sunland, CA, 1998. 24.95, students; 59.95, faculty. This CD-ROM presents a series of interactive overviews and drills for students of organic chemistry. The material covered is generally taught in the first semester. This suite is much more than a simple presentation of material and, for students sufficiently motivated to take the time and work with the problems, will provide valuable review. Five interactive spaces are provided: concentration drills that emphasize recall of related structures/names, reagents/reactions, and stereochemistry; a structural review based on epinephrine; interactive synthesis projects; arcade game reagent review; and a set of timed self-tests. The CD-ROM installed and ran without problem on a Power PC Mac and on a Pentium running Windows 95. The program did fail to run when a student reviewing it switched to a very new version of Windows Quick Time. Most of the drills ran without a problem, although at times it was unclear how to respond to queries. I turned off the music, which would be much less annoying if the loops were simply longer. Publishers are flooding the market with add-on computer-based materials for the various levels of chemistry. Many constitute little more than a stack of overheads. This is one that may be of sufficient value to warrant the extra cost. A large number of examples are provided for many of the areas covered. Most of the graphical interfaces are clear and easy to manipulate, with the exception of a couple of mechanistic screens that had hard-to-figure-out arrows. Two sections, or modules, are of special note. The first of these is the synthesis challenges, where students must choose reactants, reagents, and reaction conditions for a particular reaction. These synthesis problems are well thought out and can be challenging. It is unfortunate that there are only five of them. The Self-Tests module is also of great practical value, forcing students to work through a variety of topics (200 problems) with limited time allotted per test. The structures are clear and easy to view and include a large number of three-dimensional molecular models that help make the connection between simple line drawings and actual molecules. More feedback information on incorrect answers would be nice, although it is obvious that this can balloon into an unworkable situation if every possible "wrong" answer is considered. The structure summary, which uses a single complicated molecule to review a large range of structural topics, is a good integrated look at bonding, stereochemistry, and conformational analysis. The concentration game is informative, albeit a bit obtuse on a few of the answers! The selection drills, a shooting gallery game with various chemical targets, seems a bit silly, but then if one can learn to recognize all the major reducing agents by snagging butterflies with faux nets than this could be helpful! With its varying levels of difficulty, this set of modules should be accessible even to weaker students and yet will provide a challenge for the more advanced. A great future addition would be an interactive module builder that allows faculty to modify existing questions and add their own. How can one effectively use this program? The relatively low cost does make it accessible for individual students to purchase, perhaps as a "recommended" item for the class. Another very practical option is to purchase 5-10 copies (assuming a class size of around 30-40) and make them available through a common computer laboratory (or an appropriate network site-license arrangement) or for check-out to small groups of students. One drawback is that only about 1/3 of the major topics that fill the year in organic are covered. I have used some of the drills as in-class interactive examples with a projector and laptop. This type of interactive tutorial-quiz-based program is a welcome change from the simple textbook on a CD-ROM approach. Given easy access to computers and an environment that encourages individual and small-group interactions, I believe this program can be a worthwhile aid for students of organic chemistry.

  15. Helical Magnetic Fields in AGN Jets Y. J. Chen1,2,∗ , G.-Y. Zhao1,2 ...

    Indian Academy of Sciences (India)

    Abstract. We establish a simple model to describe the helical mag- netic fields in AGN jets projected on the sky plane and the line-of-sight. This kind of profile has been detected in the polarimetric VLBI observa- tion of many blazar objects, suggesting the existence of helical magnetic fields in these sources. Key words.

  16. VizieR Online Data Catalog: New IR photometric study of Ap and Am stars (Chen+, 2017)

    Science.gov (United States)

    Chen, P. S.; Liu, J. Y.; Shan, H. G.

    2018-05-01

    In the General Catalog of Ap and Am stars (Renson & Manfroid 2009, Cat. III/260) 8265 stars are included in which, as Renson & Manfroid (2009, Cat. III/260) described, only 426 stars are of the "well known confirmed sample". We take these 426 stars as our working sample. The cross-identifications of 2MASS/WISE counterparts for all Ap, Am, and HgMn stars listed in this paper are made from Cutri et al. (2012, Cat. II/311) by using the radius of 2 arcsec. All 426 Ap, Am, and HgMn stars have 2MASS and/or WISE counterparts, which are listed in Table 3. The cross-identifications of IRAS counterparts are made according to the positional error ellipse of the source, because it has a 95% confidence level (IRAS Explanatory Supplement, Beichman et al. 1988, Cat. II/274). Finally, 202 stars are found to have the IRAS counterparts from IRAS PSC/FSC, which is listed in Table 4. (5 data files).

  17. J. Chen1, Z.-Q. Shen1, H. Sudou3, S. Iguchi4, Y. Murata5

    Indian Academy of Sciences (India)

    4National Astronomical Observatory of Japan, Tokyo 181-8588, Japan. 5The Institute of Space and Astronautical Science, JAXA, Kanagawa 229-8510, Japan. 6Research Center for Space and Cosmic Evolution, Ehime University,. Matsuyama 790-8577, Japan. ∗ e-mail: gyzhao@shao.ac.cn. Abstract. It was argued that 3C ...

  18. X-ray Time Lags in TeV Blazars X. Chen1,∗ , G. Fossati1, E. Liang1 ...

    Indian Academy of Sciences (India)

    Abstract. We use Monte Carlo/Fokker–Planck simulations to study the. X-ray time lags. Our results show that soft lags will be observed as long as the decay of the flare is dominated by radiative cooling, even when acceleration and cooling time scales are similar. Hard lags can be pro- duced in the presence of a competitive ...

  19. Trichodina nobilis Chen, 1963 and Trichodina reticulata Hirschmann et Partsch, 1955 from ornamental freshwater fishes in Brazil

    Directory of Open Access Journals (Sweden)

    ML Martins

    Full Text Available In the present work Trichodina reticulata and T. nobilis (Ciliophora: Trichodinidae are morphologically characterised from ornamental freshwater fish culture in the State of Santa Catarina, Brazil. The prevalence of infection and a list of comparative measurements are discussed. We examined "southern platyfish" Xiphophorus maculatus (n = 35, "goldfish" Carassius auratus (n = 31, "guppy" Poecilia reticulata (n = 20, "sailfin molly" Poecilia latipinna (n = 6, "beta" Betta splendens (n = 2 and "spotted headstander" Chilodus punctatus (n = 1. After being anesthetised in a benzocaine solution, fishes were examined for parasitological evaluation. A total of 51.57% fishes were parasitised by Trichodina spp. Carassius auratus was the most parasitised species, followed by X. maculatus and P. reticulata. Beta splendens, C. punctatus and P. latipinna were not parasitised by any trichodinid species. Two species of Trichodina were collected from the skin of fish: T. nobilis was found in C. auratus, P. reticulata and X. maculatus and T. reticulata was only observed in C. auratus. The importance of adequate handling in ornamental fish culture are also discussed.

  20. Müra kontoris segab tööd / Patrick Kurtz ; tõlk. Pille Korpen

    Index Scriptorium Estoniae

    Kurtz, Patrick

    2005-01-01

    Üldnõuetest kontorite planeerimisel. Müra vähendamise planeerimisest. Tabelid: Müra helivõimsuse taseme allikad; Arvutitöökohtade akustika. Vt. ka: Avatud kontor võib olla ka vaikne. BNSi vastutav peatoimetaja Anvar Samost räägib avatud tööruumi eelistest

  1. Book Review on: Patrick Barrett, Daniel Chavez and Cesar Rodriguez Garavito. The New Latin American Left. Utopia Reborn?

    NARCIS (Netherlands)

    R.A. Icaza Garza (Rosalba)

    2010-01-01

    textabstractBarret, Chavez and Rodriguez main task in The New Latin American Left. Utopia Reborn?, is that of identifying what are the factors that can explain the emergence of a new left in Latin America. The result is a nicely edited collection of expert voices on leftist politics in the region

  2. Télécoms pour l’ingénierie du risque, Tullio Tanzi, Patrick Perrot

    Directory of Open Access Journals (Sweden)

    Jean-Baptiste Morin

    2013-04-01

    Full Text Available "Télécoms pour l’ingénierie du risque" est un ouvrage de 234 pages qui convoque la rencontre entre les Technologies de l’Information de la Communication (TIC et le risque. Les risques naturels, les risques industriels et technologiques ou encore les nouveaux risques générés par des usages déviants dans le domaine du numérique (cybercriminalité sont devenus monnaie courante. Les auteurs Tullio Tanzi (Professeur à Télécom ParisTech, département Traitement du Signal et des Images en télécommun...

  3. Male Beauty in the Eye of the Beholder? Guys, Guises and Disguise in Patrick White’s The Twyborn Affair

    Directory of Open Access Journals (Sweden)

    Jean-Francois Vernay

    2012-05-01

    Full Text Available Peer reviewed article. “Beauty is in the eye of the beholder”, which first appeared in the 3rd century BC in Greek, quickly gained proverbial currency in the English language thanks to its wisdom. Admittedly, whenever beauty has been acknowledged, one should take it primarily as a comment on the beholder rather than on the model. In heterosexual relationships, male beauty would thus be informative of the female gaze and conception of aesthetics. But what of homosexual relationships? Logically, male beauty would inform as much on the aesthetics of the beholder as on the canons of male beauty through the representation of the perfect man. Now what if the male model appeals to both male and female beholders? Can gay men and straight women share the same aesthetics of the male body? Do they seek and value the same things in a partner? And then what if the male model switches to female beauty all the while sustaining an unflinching power of seduction? Would that prove that beauty is genderless or would that mean that desirability is unrelated to beauty? On a creative level, when White depicts an ambiguous protean protagonist, beauty essentially relies on his characterization skills. But is male beauty objectively inherent to the model or is it solely to be found in the novelist’s subjective representation of his central character?

  4. Kieran Hicks, Kathrin Gerling & Patrick Dickinson - ‘What makes a Game? Reflections on Juiciness and Player Experience’

    OpenAIRE

    uk, khicks lincoln ac

    2017-01-01

    “Juiciness” refers to the visual and auditory elements that are used in games to amplify feedback to the player in response to an in-game action (Schell 2014 ), and are intended to make the player feel satisfied and excited. Juicy elements are commonly employed as a way of improving the feedback loop of the game (e.g., visually showering the player with particle effects and sound effects upon picking up a collectible) and although common in games development, little academic work has empirica...

  5. On 25 November, Patrick Janot of the CERN Physics Department received the CNRS silver medal for IN2P3

    CERN Multimedia

    Ph. Schwemling, Paris

    2005-01-01

    This prize, one of the most prestigious awarded by the French research centre, is given to scientists for the 'originality, quality and importance of their work, as recognised both nationally and internationally'.

  6. Archeological Survey of the Proposed Charity Lake Hydroelectric Project, Upper Smith River Basin, Patrick and Franklin Counties, Virginia.

    Science.gov (United States)

    1986-04-01

    small patch of white Gesso with India Ink. This label is then covered with a protective coat of clear polyurethane. Each artifact will receive a unique...ID number, specific to each site. Different colors of Gesso * on the ID field aid as a visual key to artifact provenience during analysis. Artifacts

  7. Environmental Assessment: Proposed U.S. Air Force Military Family Housing Privatization Initiative Patrick Air Force Base, Florida

    Science.gov (United States)

    2008-11-03

    mockingbird , other songbirds, and white ibis (Eudocimus albus). Cormorants (Phalacrocorax auritus) were observed resting on old dock pilings in the...surfacing, nursing, breeding, feeding or sheltering), hunting, capturing, or killing of polar bears, sea otters, marine otters, whales, porpoises, walruses

  8. A comparison of the ground magnetic responses during the 2013 and 2015 St. Patrick's Day geomagnetic storms

    DEFF Research Database (Denmark)

    Xu, Z.; Hartinger, M. D.; Clauer, Robert C.

    2017-01-01

    The magnetosphere-ionosphere system response to extreme solar wind driving conditions depends on both the driving conditions and ionospheric conductivity. Since extreme driving conditions are rare, there are few opportunities to control for one parameter or another. The 17 March 2013 and 17 March...... 2015 geomagnetic storms driven by coronal mass ejections (CME) provide one such opportunity. The two events occur during the same solar illumination conditions; in particular, both occur near equinox on the same day of the year leading to similar ionospheric conductivity profiles. Moreover, both CMEs...... systems. There are dramatic differences between the intensity, onset time and occurrence, duration, and spatial structure of the current systems in each case. For example, differing solar wind driving conditions lead to interhemispheric asymmetries in the high-latitude ground magnetic response during...

  9. 75 FR 14637 - James A. FitzPatrick Nuclear Power Plant; Environmental Assessment and Finding of No Significant...

    Science.gov (United States)

    2010-03-26

    ...). There will be no change to radioactive effluents that affect radiation exposures to plant workers and... cultural resources. There would be no impact to socioeconomic resources. Therefore, no changes to or...

  10. Annotated bibliography of selected references on shoreline barrier island deposits with emphasis on Patrick Draw Field, Sweetwater County, Wyoming

    Energy Technology Data Exchange (ETDEWEB)

    Rawn-Schatzinger, V.; Schatzinger, R.A.

    1993-07-01

    This bibliography contains 290 annotated references on barrier island and associated depositional environments and reservoirs. It is not an exhaustive compilation of all references on the subject, but rather selected papers on barrier islands, and the depositional processes of formation. Papers that examine the morphology and internal architecture of barrier island deposits, exploration and development technologies are emphasized. Papers were selected that aid in understanding reservoir architecture and engineering technologies to help maximize recovery efficiency from barrier island oil reservoirs. Barrier islands from Wyoming, Montana and the Rocky Mountains basins are extensively covered.

  11. On Meng Chen-shun's Romance Theory and His Opera and Drama Greation%孟称舜"传情"理论及其戏曲创作

    Institute of Scientific and Technical Information of China (English)

    刘伟

    2002-01-01

    孟称舜戏曲深受汤显祖的影响,前期剧作和"传情"理论表现出对"至情"的赞颂和对封建礼教的批判.作为生活在明清易代时期的落魄文人,他又与那个时代和环境紧密相连,由于受到当时社会、思想等多种因素的影响,其传情理论和戏曲创作都发生了很大的变化.他以"诚"为主体,他"情正"与"言道"结合的"言情"倾向,是他的特色,也是他的局限.

  12. 论陈亮事功主义伦理思想的基本特征%On Chen Liang's Essential Features of Utilitarian Ethics

    Institute of Scientific and Technical Information of China (English)

    朱晓鹏

    2005-01-01

    陈亮是永康学派的创始人.他的事功主义伦理思想的基本特征是"理欲统一"的道德观、"义利合一"的价值观和"学为成人"的人生观.这种事功主义伦理思想具有创新精神,对中国传统的伦理观是一种挑战,对后世产生了深远的影响.

  13. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen Internal Discrepancies: EU Women’s Policies between Deregulation and Claims to Equality

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.This anthology, consisting of nine essays written by women authors, offers insights into central areas of EU politics: the European Economic and Currency Union, structural policies, policies dealing with gender equality, the expansion of the EU, as well as the creation of a new European constitution. These policies include relevant parts of the 1992 Maastricht Treaty, the 1997 Treaty of Amsterdam, and the 2000 Treaty of Nizza. The information and insights presented here make this book an important basis for any discussions about EU women’s policies.

  14. Bya rog prog zhu, The raven crest : the life and teachings of bDe chen 'od gsal rdo rje treasure revealer of contemporary Tibet

    NARCIS (Netherlands)

    Terrone, Antonio

    2010-01-01

    This research starts from the historical assertion that notwithstanding their claim of increased religious tolerance, the dramatic post-Mao political campaigns have continued to weaken the pervasive force of religious faith, traditional monastery-centered religious power, religious leadership, and

  15. Discussion of “Nanoscale Fluid Mechanics and Energy Conversion” (Chen, X., Xu, B., and Liu, L., 2014, ASME Appl. Mech. Rev., 66(5), p. 050803)

    NARCIS (Netherlands)

    Eijkel, Jan C.T.

    2014-01-01

    The authors of the paper “Nanoscale Fluid Mechanics and Energy Conversion” have presented an overview of recent applications of nanofluidic phenomena for energy conversion and storage. The discussion given here aims to place this paper in a broader context of literature and theory.

  16. Redescription of Paragaleus tengi (Chen, 1963) (Carcharhiniformes: Hemigaleidae) and first record of Paragaleus randalli Compagno, Krupp & Carpenter, 1996 from the western North Pacific.

    Science.gov (United States)

    White, William T; Harris, Mark

    2013-01-01

    Paragaleus tengi was previously considered to be the only member of this genus occurring in the Western Pacific, with Paragaleus randalli occurring in the Indian Ocean and allopatric in distribution. Recent molecular and morphological studies showed that P. randalli also occurs in the Western Pacific with records from Thailand, Malaysia and Indonesia previously mostly incorrectly attributed to P. tengi. This paper provides a redescription of P. tengi and confirms the presence of P. randalli from off Taiwan in the western North Pacific. These two species are morphologically very similar in appearance but differ in meristics, dentition, some coloration attributes and minor morphological characters. The conservation status of these two species needs to be reassessed based on this new information.

  17. How Structural Deficiencies Hamper Estonia’s Catching-up Process. Strukturschwächen als Hemmnis für Estlands Aufholprozess

    Directory of Open Access Journals (Sweden)

    Klaus Schrader

    2016-10-01

    Full Text Available Estonia is widely regarded as a paramount example for a successful transformation of a socialist economic system to a functioning market economy. Against the backdrop of this positive image which contrasts strongly with the crisis scenarios in Southern Europe the remaining problems of Estonia are often ignored. Estonia has hardly succeeded in catching-up economically with the richer countries of the EU. In this paper the authors raise the question why the catching-up process of Estonia is not as successful as it could have been expected from the policy performance during the last decades. It turns out that Estonia faces a serious productivity problem, particularly in the manufacturing sector producing tradable goods which is normally the driving engine behind economic and technological catching-up. The Estonian economy has failed to undergo the necessary structural change towards technologically more advanced employment structures and export patterns. Accordingly, Estonian economic policy needs to create a suitable business environment to support this kind of structural change.

  18. New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

    Directory of Open Access Journals (Sweden)

    Hua-yan Chen

    2017-01-01

    Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

  19. Colonel Joseph J. Reynolds and the Saint Patrick's Day Celebration on Powder River Battle of Powder River (Montana, 17 March 1876)

    National Research Council Canada - National Science Library

    Hedegaard, Michael

    2001-01-01

    The Battle of Powder River occurred on 17 March 1876 in southeastern Montana. Historians and researchers have consistently overlooked the importance of this battle on the outcome of the Great Sioux War of 1876. Colonel Joseph J...

  20. DOE hearing on the draft area recommendation report for the Crystalline Repository Project, Patrick Henry High School, Ashland, Virginia: Session 2: Transcript of proceedings

    International Nuclear Information System (INIS)

    1986-01-01

    This document contains a transcript of the comments of more than witnesses. Also included is a list of 2 exhibits. These meetings were held to hear public comments regarding the selection of a site for a second high-level nuclear waste repository

  1. Wounding effects of the AK-47 rifle used by Patrick Purdy in the Stockton, California, schoolyard shooting of January 17, 1989.

    Science.gov (United States)

    Fackler, M L; Malinowski, J A; Hoxie, S W; Jason, A

    1990-09-01

    The limited disruption produced in tissue simulant by the rifle and bullets used in the Stockton, California, schoolyard shooting is entirely consistent with the autopsy reports on the five children who died of their wounds. It is also entirely consistent with well-documented battlefield studies and with previous tissue-simulant studies from many laboratories. It is inconsistent with many exaggerated accounts of assault-rifle wounding effects described by the media in the aftermath of this incident. This information should be documented for the historical record. However, the critical reason for correcting the misconceptions produced by media reaction to this incident is to prevent inappropriate gunshot-wound treatment.

  2. Proceedings of the Biennial EO/EEO Research Symposium (5th) Held at Patrick Air Force Base, Florida on February 17-18, 2005

    Science.gov (United States)

    2005-02-01

    only captures social acceptance of groups at a given moment in time, a time immediately after the first successful attack on U.S. mainland soil ... Eggshells ; Chicanas in the Labor Force. In Stephen B. Knouse, Paul Rosenfeld, & Amy L. Culbertson (Eds.), Hispanics in the Workplace (pp. 173-193

  3. Comment on “A new Arctic hadrosaurid from the Prince Creek Formation (lower Maastrichtian of northern Alaska” by Hirotsugu Mori, Patrick S. Druckenmiller, and Gregory M. Erickson

    Directory of Open Access Journals (Sweden)

    Anthony R. Fiorillo

    2016-02-01

    Full Text Available Recently Mori et al. (2016 published a paper describing a new tax- on of hadrosaurid dinosaur from the Upper Cretaceous Prince Creek Formation of the North Slope Alaska, a rock unit that has recently proven to be a productive source of scientific insights into the work- ings of an ancient Arctic terrestrial ecosystem (Fiorillo and Gangloff 2001; Gangloff et al. 2005; Fiorillo et al. 2009, 2010; Gangloff and Fiorillo 2010; Flaig et al. 2011, 2013, 2014; Fiorillo and Tykoski 2012, 2014. Although thorough testing of the systematics of this proposed taxon will occur over the next few years, one statement in the Mori et al. (2016 paper warrants comment now

  4. Colonel Joseph J. Reynolds and the Saint Patrick's Day Celebration on Powder River Battle of Powder River (Montana, 17 March 1876)

    National Research Council Canada - National Science Library

    Hedegaard, Michael

    2001-01-01

    .... Reynolds set out to destroy the Indian camp established by the combined Cheyenne and Oglala Sioux in order to push the Indians back to the reservations and allow miners to enter the Black Hills to mine gold...

  5. DOE hearing on the draft area recommendation report for the Crystalline Repository Project, Patrick Henry High School, Ashland, Virginia: Session 1, April 7, 1986: Transcript of proceedings

    International Nuclear Information System (INIS)

    1986-01-01

    This document contains a transcript of the comments of 35 witnesses. These meetings were held to hear public comments regarding the selection of a site for a second high-level nuclear waste repository

  6. Environmental Assessment for Construction of the United States Air Force Technical Application Center (AFTAC) on Patrick Air Force Base, Florida (Amended)

    Science.gov (United States)

    2010-07-01

    carbon footprint of this large facility; however, there may be still be greater cumulative energy consumption because of the 24-hour use of the...Florida, south of the City of Cocoa Beach, and covers approximately 1,937 acres bounded by the Atlantic Ocean on the east and the Banana River on the...County 0.012 0.012 0.012 Ozone (O3) 1-hour Highest Cocoa Beach, Brevard County 0.106 0.095 0.099 1-hour Highest Winter Park, Orange County 0.109

  7. Environmental Assessment for the Construction of the United States Air Force Technical Application Center (AFTAC) on Patrick Air Force Base, Florida

    Science.gov (United States)

    2009-12-01

    facility; however, there may still be greater cumulative energy consumption because of the 24-hour use of the facility. Because construction designs...989 on PAFB. PAFB is located on a barrier island on the east-central coast of Florida, south of the City of Cocoa Beach, and covers approximately...County 3 8 3 Nitrogen Dioxide (NO2) Annual Arithmetic Mean Winter Park, Orange County 0.012 0.012 0.012 Ozone (O3) 1-hour Highest Cocoa Beach

  8. Simulation of low-latitude ionospheric response to 2015 St. Patrick's Day super geomagnetic storm using ionosonde-derived PRE vertical drifts over Indian region

    Science.gov (United States)

    Joshi, L. M.; Sripathi, S.; Singh, Ram

    2016-03-01

    In this paper, we present low-latitude ionospheric response over Indian longitude to the recent super geomagnetic storm of 17 March 2015, using the Sami2 is Another Model of the Ionosphere (SAMI2) model which incorporates ionosonde-derived vertical drift impacted by prompt penetration eastward electric field occurring during the evening prereversal enhancement (PRE) in the vertical drift. The importance of this storm is that (1) Dst reaches as low as -228 nT and (2) prompt penetration of eastward electric field coincided with evening hours PRE. The daytime vertical E × B drifts in the SAMI2 model are, however, considered based on Scherliess-Fejer model. The simulations indicate a significant enhancement in F layer height and equatorial ionization anomaly (EIA) in the post sunset hours on 17 March 2015 vis-a-vis quiet day. The model simulations during recovery phase, considering disturbance dynamo vertical E × B drift along with equatorward disturbance wind, indicate suppression of the daytime EIA. SAMI2 simulations considering the disturbance wind during the recovery phase suggest that equatorward wind enhances the ionospheric density in the low latitude; however, its role in the formation of the EIA depends on the polarity of the zonal electric field. Comparison of model derived total electron content (TEC) with the TEC from ground GPS receivers indicates that model does reproduce enhancement of the EIA during the main phase and suppression of the EIA during the recovery phase of the superstorm. However, peculiarities pertaining to the ionospheric response to prompt penetration electric field in the Indian sector vis-a-vis earlier reports from American sector have been discussed.

  9. FitzPatrick Lecture: King George III and the porphyria myth - causes, consequences and re-evaluation of his mental illness with computer diagnostics.

    Science.gov (United States)

    Peters, Timothy

    2015-04-01

    Recent studies have shown that the claim that King George III suffered from acute porphyria is seriously at fault. This article explores some of the causes of this misdiagnosis and the consequences of the misleading claims, also reporting on the nature of the king's recurrent mental illness according to computer diagnostics. In addition, techniques of cognitive archaeology are used to investigate the nature of the king's final decade of mental illness, which resulted in the appointment of the Prince of Wales as Prince Regent. The results of this analysis confirm that the king suffered from bipolar disorder type I, with a final decade of dementia, due, in part, to the neurotoxicity of his recurrent episodes of acute mania. © 2015 Royal College of Physicians.

  10. The Archaeology and Pottery of Nazca, Peru. Alfred L. Kroeber's 1926 Expedition. Alfred L Kroeber and Donald Collier. edited by Patrick H. Carmichael, Walnut Creek: Altamira Press, 1998

    Directory of Open Access Journals (Sweden)

    David L. Browman

    2000-05-01

    Full Text Available This volume is the much delayed publication of the results of the Second Marshall Field Archaeological Expedition to Peru in 1926, sponsored by the Field Museum of Natural History in Chicago, and con­ducted by Alfred Kroeber(1876-1960. It contains some useful short "history of the discipline" remarks both in the preface by Carmichael and in the draft introduction to the original manuscript by Kroeber and Collier. Donald Collier (1911-1995, was curator at the Field Museum from 1941 to 1976, and was working with Kroeber in the late 1950s to help bring the report out, but work stopped with Kroeber's death in 1960. Carmichael ran across the unfinished manuscript in the Field Museum in 1986 while do­ing research on the Nazca assemblages as a graduate student, and with Collier's permission and assis­tance, reassembled the component parts and edited the manuscript for publication.

  11. Commentary on: "An integrated metabolic atlas of clear cell renal cell carcinoma." Hakimi AA, Reznik E, Lee CH, Creighton CJ, Brannon AR, Luna A, Aksoy BA, Liu EM, Shen R, Lee W, Chen Y, Stirdivant SM, Russo P, Chen YB, Tickoo SK, Reuter VE, Cheng EH, Sander C, Hsieh JJ.: Cancer Cell. 2016 Jan 11;29(1):104-16.

    Science.gov (United States)

    Lee, Byron H

    2017-09-01

    Dysregulated metabolism is a hallmark of cancer, manifested through alterations in metabolites. We performed metabolomic profiling on 138 matched clear cell renal cell carcinoma (ccRCC)/normal tissue pairs and found that ccRCC is characterized by broad shifts in central carbon metabolism, one-carbon metabolism, and antioxidant response. Tumor progression and metastasis were associated with metabolite increases in glutathione and cysteine/methionine metabolism pathways. We develop an analytic pipeline and visualization tool (metabolograms) to bridge the gap between TCGA transcriptomic profiling and our metabolomic data, which enables us to assemble an integrated pathway-level metabolic atlas and to demonstrate discordance between transcriptome and metabolome. Lastly, expression profiling was performed on a high-glutathione cluster, which corresponds to a poor-survival subgroup in the ccRCC TCGA cohort. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Uso de plâncton silvestre, fermento fresco e levedura desidratada na alimentação de larvas do cascudo chinelo, Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae Natural plankton, fresh ferment and dehydrated yeast utilization at Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae, cascudo chinelo, fry feeding

    Directory of Open Access Journals (Sweden)

    Claudemir Martins Soares

    2002-05-01

    Full Text Available Objetivando avaliar a utilização de diferentes alimentos para larvas do cascudo chinelo Loricariichthys platymetopon (Osteichthyes, Loricariidae, 240 larvas com cinco dias pós-eclosão foram distribuídas em 20 aquários (12 L. Foram utilizados cinco tratamentos com quatro repetições cada, os quais consistiram do emprego de diferentes tipos de alimentos como: plâncton (P, fermento (F, levedura desidratada (LD e as combinações P+F e P+LD por 15 dias consecutivos. O F e a LD foram fornecidos à vontade três vezes ao dia, enquanto o P foi fornecido pela manhã, após os aquários serem sifonados. Os valores da temperatura, pH, condutividade elétrica e oxigênio dissolvido se mantiveram dentro de níveis aceitáveis para a aquicultura. Os valores de biomassa/aquário das larvas alimentadas com P+LD foram superiores aos dos alimentados com P, F e P+F, entretanto não diferiram daqueles com o uso de LD. As larvas alimentadas com P+LD apresentaram valores de peso final médio superiores às dos demais tratamentos, sendo que F levou a valores de peso final médio inferiores em comparação ao uso de P, LD e P+F. Observou-se menor sobrevivência com o uso de P em comparação a LD e P+LD. Conclui-se que se pode utilizar P+LD na criação do cascudo chinelo em suas fases iniciais de desenvolvimento.Aiming to evaluate different foods effects in the rearing of Loricariichthys platymetopon (Osteichthyes, Loricariidae fry, 240 5-day-after-hatch specimens were distributed in 20 aquarium glasses (12 L. Five treatments, with four repetitions each, were tested, consisting in: plankton (P, fresh ferment (F, dehydrated yeast (DY and the combinations P+F and P+DY, for 15 days. F and DY were given ad libitum three times a day, and P only in the morning, after the aquariums siphoning. Temperature, pH, electric conductivity and dissolved oxygen were in levels acceptable for fish. The fry biomass per aquarium values were higher for the P + DY treatment, when compared to P, F and P+F, but equal to DY. Also, P +DY-fed fry showed higher mean final weight than all the other treatments. F-treated fry showed mean final weight lower than the ones treated with P, DY and P+F. The P treatment showed lower survival rate than DY and P+DY. The results indicate that P + DY can be used for Loricariichthys platymetopon fry rearing during their initial development phases.

  13. 研究/電子資源使用統計標準與規範之探討/陳雪華;許嘉珍;朱雅琦 | Study of the Electronic Resources Usage Statistics Standards and Guidelines/ Hsueh-Hua Chen;Chia-Chen Hsu;Ya-Chi Chu

    Directory of Open Access Journals (Sweden)

    陳雪華、許嘉珍、朱雅琦

    2007-04-01

    Full Text Available

    近年來,由於資訊科技的進步,圖書館中的電子資源數量快速增加,所佔預算金額比例也大幅增長。圖書館希望能夠透過評鑑電子資源的使用,以便能夠在電 子資源館藏發展等方面做出正確的決策。由於體認到電子資源使用統計之重要性,圖書館界與相關組織紛紛發展或修訂圖書館統計標準,增列電子資源使用統計的項 目以充分反映圖書館電子資源使用之狀況。本文主要採用文獻分析法以及內容分析法,收集探討並比較近軍來國內外電子資源使用統計之相關規範及標準,包含 ISO 2789、 ICOLC Guidelines、州ANSI/NISO Z39.7、CNS13151、ARL E-Metrlcs、E-Measures Project、以及Project COUNTER等。

    Recently, due to the advances of information technology, electronic resources are gradually replacing print resources as the largest consumer of library acquisition budgets. Logically, libraries want to evaluate the usage of electronic resources and incorporate the results into their decision making regarding electronic resource acquisition. Over these years, there is a general awareness among libraries to develop statistics standards and guidelines for library electronic resources usage. In this paper, literature review and content analysis methods are used to compare several library statistics standards, including: ISO 2789 、ICOLC Guidelines、ANSI/NISO Z39.7、CNS13151、ARL E-Metrics、E-Measures Project、and Project COUNTER etc.

    頁次:89-102

  14. Bestimmung des Bodenreibungsbeiwertes und der Oberflächenreibung eisbedeckter Wasserflächen im Meiningenstrom der Darß-Zingster Boddenkette und Anwendung auf vertikal integrierte hydronumerische Modelle

    OpenAIRE

    Schönfeldt, Hans-Jürgen; Raabe, Armin; Baudler, Henning

    2016-01-01

    In einem hydronumerischen Modell zur Prognose des Strömungs- und Wasserstandsfeldes flacher Gewässer wird eine auf der Turbulenztheorie basierende Tiefenkorrektur für den Bodenreibungsbeiwertwert eingeführt und auf der Basis von Berechnungen für die DarßZingster Boddenkette überprüft. Für einen ausgewählten Meßpunkt der Darß-Zingster Boddenkette wurde der Reibungsbeiwert sowohl am Boden als auch unter einer Eisschicht experimentell bestimmt. Die Auswirkungen einer Tiefenkorrektur des Reibungs...

  15. Das Usutu-Virus als Ursache von Massensterben bei Amseln Turdus merula und anderen Vogelarten in Europa: Erfahrungen aus fünf Ausbrüchen zwischen 2001 und 2011

    OpenAIRE

    Bosch, Stefan; Schmidt-Chanasit, Jonas; Fiedler, Wolfgang

    2012-01-01

    Das Usutu-Virus (USUV) ist ein durch Stechmücken der Gattung Culex übertragenes Flavivirus. Es wurde wahrscheinlich durch Zugvögel oder Stechmücken nach Europa eingeschleppt und hat sich inzwischen dauerhaft in der einheimischen Stechmücken-und Vogelfauna etabliert. Seit seinem Erstnachweis 2001 in Österreich hat das USUV fünf größere Ausbrüche mit USUV-assoziierten Vogelsterben, vor allem unter Amseln und in Volieren gehaltenen Eulen, sowie vermutlich kleinere Ausbrüche ohne augenfälliges Vo...

  16. Monitoring Protein Conformation Changes as an Activating Step for Protein Interactions with Cross-linking/MS Analysis. / Chen, Zhuo; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri

    DEFF Research Database (Denmark)

    Rasmussen, Morten

    of C3 to its active form C3b. C3 (187kDa) is a twelve domain protein (ANA, CUB, TED and MG1 to MG9). During the conversion of C3 to C3b, one domain, ANA (99 residues), is proteolytically removed and a number of domains change their position. This exposes protein-binding sites for downstream...... interactions in the complement response.   Methods 250 pmol of C3 and C3b were both cross-linked with a 1000X excess of cross-linkers. BS2G, BS3, and sulfo-EGS were applied respectively. The cross-linking products were separated with 1D-PAGE gel. Monomer bands were sliced and digested with trypsin. Cross......-terminus. The TED domain relocates as is revealed by three cross-links to the ANA domain in C3 and four cross-links to the MG1 domain in C3b, a domain that is remote in C3. In C3b case, a cross-link within the CUB domain suggests a folded structure of this domain, a matter of dispute in the competing crystal...

  17. Patrick Mccabe’in Plüton’da Kahvaltı ve Jeffrey Eugenides’in Middlesex adlı romanlarında cinsel kimlik, aile ve göç

    OpenAIRE

    DEMİR, Elif

    2016-01-01

    Cinsiyet  ve  toplumsal  cinsiyet  kavramları  merak  ve  ilham  uyandıran  yapısıyla  pek  çok  bilimsel  alanın  ilgi  konusu  olmuş  ve  kadın/erkek  ikiliği  dışına  çıkan  bireylere  atfedilen  ‘queer’  kavramıyla  edebi  imgelemde &nbs...

  18. Novel about Artist: Postmodern Variations (Instantiated by Novels “The Tin Drum” by Günter Grass, “Brother of Sleep” by Robert Schneider, “Perfume: The Story of a Murderer” by Patrick Süskind

    Directory of Open Access Journals (Sweden)

    Sofiya Varetska

    2013-12-01

    Full Text Available An attempt to show the modification of classic novel about an artist (Künstlerroman through a prism of postmodernism instantiated by German novels of the second half of the twentieth century “The Tin Drum”, “Brother of Sleep”, “Perfume: The Story of a Murderer” was accomplished. Crisis of artistic apperception in the twentieth century is demonstrated. Different conceptions of the creative process of main characters are compared. The main attention was focused on the clash between man and artist, life and art, daily routine and spirituality. In the postmodern age the cynical worldview model is predominating. At the same time tales, where magic and reality, sentimentality and brutality are combined, enjoy widespread popularity. An art of genius has positive connotations in general, but some of chosen novels are revealing the reverse side of the coin, when the art is capable to create an evil in its superior manifestations. For a wonder a presence of negative, monstrosity and disgust attract attention of the crowd rather than beauty. Therefore tin the article new idea that talent is on the verge of monstrosity is asserted. These two concepts exist together rely on each other. Every hero is like two-faced Janus to some extent. On the one hand, being endowed with Divine Grace he has a talent, but on the other hand, having something demoniacal is possessed by physical defect. On the one hand, they limelight and fire our imagination by their unusualness, on the other hand, they push away by their monstrosity and disgust. Main characters are always teetering on the edge. However the notion of edge is taking the wider meaning in the contemporary society. Consequently, having used all features of classic novel about an artist and portrayed them through a prism of modern perception of the world, writers created a new compilation – postmodern novel about an artist.

  19. Closing talk of Mr Patrick Devedjian, delegate minister of industry, following the energy debate which took place at the senate on April 27, 2004. Taken from the integral proceedings available on the Senate web site; Discours de cloture prononce par M. Patrick Devedjian, ministre delegue a l'Industrie, suite au debat sur l'energie qui s'est tenu au Senat le 27 avril 2004. A partir du compte rendu integral publie sur le site internet du Senat

    Energy Technology Data Exchange (ETDEWEB)

    Devedjian, P.

    2004-04-01

    In this talk, the French minister of industry makes a synthesis with some particular comments about the different points discussed during the energy debate organized at the French senate in April 2004: the European pressurized reactor (EPR), the management of radioactive wastes, the status of the electric and gas utilities Electricite de France (EdF) and Gaz de France (GdF) in the framework of the European deregulation of energy markets, the development of bio-fuels and renewable energy sources, the project of energy orientation law etc.. The talk includes several questions and answers with the audience. (J.S.)

  20. JPRS Report, China

    National Research Council Canada - National Science Library

    1993-01-01

    ...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

  1. Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

    DEFF Research Database (Denmark)

    Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.

    2014-01-01

    (H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

  2. 專論/台灣圖書館史數位圖書館建構之研究/王梅玲;蔡明月;陳志銘;柯雲娥;蔡佳縈;陳勇汀;林怡甄 | A Digital Library Pilot Study on Taiwan Libraries' History / Mei-Ling Wang; Ming-Yueh Tsay; Chih-Ming Chen; Yun-Er Ke; Chia-Ying Tsai; Yong-Ting Chen; Yi-Jen Lin

    Directory of Open Access Journals (Sweden)

    王梅玲、蔡明月、陳志銘、柯雲娥、蔡佳縈、陳勇汀、林怡甄

    2008-04-01

    Full Text Available

    圖書館是保存與詮釋人類文化重要的機構,1990 年代開始,網際網路的進步,促成數位圖書館蓬勃發展,有人預測它就是未來的圖書館,因此,圖書館界與教育界積極參與相關研究。台灣地區歷經日據時期、重建 時期、成長時期及茁壯時期四階段,建設許多圖書館,有其豐富的主題與素材值得發展成為數位圖書館。政治大學圖書資訊與檔案學研究所有鑑於此,提出「『台灣 百無圖書館史』數位圖書館」的構想,並獲得政大「發展國際一流大學及頂尖研究中心計畫」經費支持。本研究計畫目的包括:(1探索以台彎圖書館事業史為主 題的數位圖書館建構模式;(2建構數位圖書館以支援圖書資訊學教育與研究;(3研訂圖書館事業史料文獻的Metadata與數位資料格式;(4將圖 書文獻與文物數位化以建構數位館藏;(5發展數位圖書館系統與技術;(6研發數位圖書館網站的瀏覽與檢索功能;(7探討數位圖書館支援數位學習的模 式。計畫成果共研訂六種 Metadata標準:建置746筆數位化資料;以Dspace系統平台,依據需求設計台灣百年圖書館史系統架構與網站,最後提出結論與建議。

    Libraries are important social institutions that preserve and communicate human culture and knowledge. From the beginning of 1990s, the digital library has grown up rapidly based on the progress of the Internet. Libraries and educational institutions should be actively involved in digital library research and development. The Taiwan libraries’ history can be divided into four stages: Japanese occupation period, reconstruction period, growth period and strong period. In these processes, many events and libraries with rich materials that can be developed into a digital library. Graduate Institute of Library, Information and Archival Studies, National Chengchi University, planned the Digital Library Pilot Study on Taiwan Libraries’ History and got the university support. The pilot study objectives include: (1 exploring the digital library model on Taiwan libraries' history; (2 constructing digital library to support education and research in information and library science; (3 developing Metadata standards of library documents and heritage; (4 digitalizing documents and heritage to build digital collections (5 developing digital library systems and technology; (6 researching browsing and search functions of the digital library; (7 exploring the model of the digital library supports e-learning. In this pilot study, we developed six Metadata standards, built 746 digital resources, constructed a digital library system and web site, and proposed the conclusions and suggestions finally.

    頁次:15-38

  3. China Report, Political, Sociological and Military Affairs, No. 445.

    Science.gov (United States)

    1983-08-11

    2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

  4. Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics

    Science.gov (United States)

    1998-07-01

    Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

  5. Use of epoxidized natural rubber as a compatibilizer in silica-filled natural rubber tire tread compounds ; Verwendung von epoxydiertem Naturkautschuk als Verträglichkeitsvermittler in Zusammensetzungen aus kieselsäuregefülltem Naturkautschuk für Reifenlaufflächen

    NARCIS (Netherlands)

    Sengloyluan, K.; Sahakaro, Kannika; Noordermeer, Jacobus W.M.

    2012-01-01

    Silica-reinforced natural rubber (NR) tire tread compounds with epoxidized natural rubber (ENR) as a compatibilizer are investigated. ENR contents of 2.5-15.0 phr, with epoxide levels of 10, 38 and 51 mol%, are used. The addition of ENRs, especially ENR-38 and ENR-51, as compatibilizers decreases

  6. 热河生物群凌源东方叶肢介的软体构造及其分类意义%SOFT BODY PRESERVATION IN THE CONCHOSTRACAN EOSESTHERIA LINGYUANENSIS CHEN FROM THE JEHOL BIOTA AND ITS TAXONOMIC SIGNIFICANCE

    Institute of Scientific and Technical Information of China (English)

    沈炎彬

    2011-01-01

    东方叶肢介(Eosestheria)是著名热河生物群中最为常见的一类甲壳动物,关于它的形态、壳瓣结构及微细纹饰特征的研究已相当详尽,但一直没有关于其软体构造的报道。本文描述的凌源东方叶肢介(Eosestheria lingyuanensis)采自辽宁北票市尖山沟村,产于下白垩统义县组的尖山沟夹层。这些软体构造包括:头部形态、眼、闭壳肌痕、雄性执握肢、体节、消化道及尾节等。通过与现生叶肢介软体形态构造比较,显示其与刺尾亚目的蚌壳虫科的代表最为亲近。从而为探讨化石与现生叶肢介之间的演化关系及建立高一级的统一分类,提供了有价值的依据。%The clam shrimp Eosestheria is an extraordinarily abundant and important member of the con-chostracan fauna from the famous Jehol Biota. Here the occurrence of partial soft body preservation in E. Lingyuanensis is reported for the first time, occurring as impressions, inside the valve, of the head, eye, adductor muscle scar, male claspers, digestive tube, and telson.The exceptionally preserved specimens were found in the Lower Cretaceous Yixian Formation at Jianshangou village, near Beipiao, in Liaoning Province of NE China. The preservation of soft parts in conchostracans is significant partly because its occurrence is very rare-known previously only from about 16 species . Worldwide and several of which are actually much less complete than the present material. Soft body characteristics are also important for accurate taxonomic determination and assessment of relationships. For example, all conchostracan males have the first pair of trunk limbs modified to form so called 'claspers', which hold to the female during mating. Some modification of the second pair of trunk limbs is seen in lae-vicaudatan conchostracans, two species of which are also known as fossils with soft body parts, butthe second pair appears not to be clasper-like in form. Eosestheria lingyuanensis on the other hand has two pairs of clearly defined claspers as in spini-caudatan conchostracans. Furthermore in its more distinct growth lines and acute rostrum as well as its two pairs of claspers it clearly belongs to the suborder Spinicaudata. Within that group, although it is similar to the Cyzicidae in its rostrum lacking an apical spine and in its short stout telson, it differs in its less developed occipital notch and larger palp with a row of pores.Although the name Conchostraca is commonly used in fossil and extant literature, recent molecular and morphological analyses show that the 'Conchostraca' appears not to be a monophyletic group. As such it has no taxonomic meaning. It has therefore been abandoned as a taxonomic unit by many authors. However, Shen et al. (2006) retain use of the 'Conchostraca', which include five suborders. Laevicaudata, Spinicaudata, Cycles-therida, Leaiina and Estheriellina. The two latter are distinct extinct groups and their soft bodies were found recently in several specimens. Leaiina with 1-5 radial carina on the carapace valve ranges from the Devonian to Permian and Estheriellina with 3-16 radial costae on the carapace valve appears in the Triassic to Cretaceous interval.

  7. Comments on X. Yin, A. Wen, Y. Chen, and T. Wang, `Studies in an optical millimeter-wave generation scheme via two parallel dual-parallel Mach-Zehnder modulators', Journal of Modern Optics, 58(8), 2011, pp. 665-673

    Science.gov (United States)

    Hasan, Mehedi; Maldonado-Basilio, Ramón; Hall, Trevor J.

    2015-04-01

    Yin et al. have described an innovative filter-less optical millimeter-wave generation scheme for octotupling of a 10 GHz RF oscillator, or sedecimtupling of a 5 GHz RF oscillator using two parallel dual-parallel Mach-Zehnder modulators (DP-MZMs). The great merit of their design is the suppression of all harmonics except those of order ? (octotupling) or all harmonics except those of order ? (sedecimtupling), where ? is an integer. A demerit of their scheme is the requirement to set a precise RF signal modulation index in order to suppress the zeroth order optical carrier. The purpose of this comment is to show that, in the case of the octotupling function, all harmonics may be suppressed except those of order ?, where ? is an odd integer, by the simple addition of an optical ? phase shift between the two DP-MZMs and an adjustment of the RF drive phases. Since the carrier is suppressed in the modified architecture, the octotupling circuit is thereby released of the strict requirement to set the drive level to a precise value without any significant increase in circuit complexity.

  8. 專論/以關鍵詞網絡探討動態性知識管理議題/陳良駒;張正宏 | Exploring Dynamic Knowledge Management Research Issues: A Keyword Network Analysis / Liang-Chu Chen; Jeng-Horng Chang

    Directory of Open Access Journals (Sweden)

    陳良駒、張正宏

    2007-10-01

    Full Text Available

    知識管理是企業邁向知識經濟時代的實務顯學,也是學術界近年來持續探討的重要研究議題。然而知識管理的面向是一種多維度的呈現,如何快速而正確的瞭 解知識管理議題的發展,是許多組織知識工作者及學術研究學者努力的目標。許多學者提出知識管理內容的架構及分類,但卻都是屬於一種由上而下的靜態設計。社 會網絡分析是呈現及量測網絡實體成員互動的技術,適合建構關係網絡的動態性。本文嘗試以關鍵詞網絡來分析國內資訊相關系所從事知識管理研究的主題及脈絡, 並透過關鍵詞的連結來建構一套動態性的知識管理研究範疇。研究成果除驗證知識管理學域中的研究重點,更透過網絡關係來連結多樣性的研究構想,進而提供產官 學界更宏觀且動態的知識管理研究建議。

    Knowledge management (KM is an important practice in a corporation and an essential issue that academic scholars intend to explore continuously in the era of knowledge economy. However, KM presents a variety of perspectives that are still undefined for many knowledge workers and academic researchers. Many scholars propose a few categories and frameworks about KM, but a static outcome. Social network analysis (SNA is a method to present and measure the interaction among network entities and it is suitable to construct the dynamic relationship networks. The purpose of this study is to acquire the research issues and contexts of KM within information-related graduate schools based on a keyword network analysis. Moreover, we build a dynamic KM research network through these linkages with keywords. The results of this study confirm the essential research perspectives in a KM domain and suggest a variety of KM research ideas which provide the industries, governments, and academic communities with a macro and dynamic KM research viewpoint.

    頁次:81-94

  9. Response to the comment by C. Kisielowski, H.A. Calderon, F.R. Chen, S. Helveg, J.R. Jinschek, P. Specht, D. Van Dyck on the article "On the influence of the electron dose-rate on the HRTEM image contrast" by J. Barthel, M. Lentzen, A. Thust, Ultramicroscopy 176 (2017) 37-45.

    Science.gov (United States)

    Barthel, Juri; Lentzen, Markus; Thust, Andreas

    2017-08-01

    In a recent article [1] we examined the influence of the applied electron dose rate on the magnitude of the image contrast in high-resolution transmission electron microscopy (HRTEM). We concluded that the magnitude of the image contrast is not substantially affected by the applied electron dose rate. This result is in obvious contradiction to numerous earlier publications by Kisielowski and coworkers [2-7], who commented our recent article due to this contradiction. The present short communication is a response to the comment of Kisielowski and coworkers on our recent article, where we provide additional arguments supporting our initial findings and conclusions on the magnitude of the image contrast in HRTEM. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. 實徵研究/國小教師以CREATER模式推動資訊素養創新課程之歷程/謝佩紋;林菁|The Process of Elementary School Teachers Implementing an Innovation Curriculum of Information Literacy with CREATER Model/Pei-Wen Hsieh; Lin Ching Chen

    Directory of Open Access Journals (Sweden)

    謝佩紋、林菁 Pei-Wen Hsieh; Lin Ching Chen

    2009-04-01

    Full Text Available 本研究旨在探究國小教師推動資訊素養創新課程的歷程,並以CREATER革新模式的七個階段為架構,深入瞭解教師作為創新推動者在每個階段的經歷及結果,以提供有意推動資訊素養理念或其它創新的教育工作者參考。本研究採個案研究,以南部一所國小為研究個案,研究時間歷時一年半,透過觀察、訪談、文件分析等方法進行資料的蒐集。研究結果發現,國小教師推動資訊素養課程的歷程大致與CREATER模式的七個階段相符,但「關心」、「連結」與「檢視」階段並無明顯次序,教師以組織內成員的角色推動創新,能有效地將創新理念化為行動,但行動能否持續及發揮效果,還有賴團隊組成的完整性、教師的持續更新力及組織內掌握實權者的支持與參與。The purpose of this study was to explore the change process of implementing an information literacy curriculum by elementary school teachers. Based on the CREATER model, this study investigated the teachers’ experiences as change agents in each stage of the process. The research results could provide guidelines for educators who are devoted to promote the information literacy or other innovations. The method of case study was used to design this study. The subjects of this study were the teachers who voluntarily implemented the information literacy curriculum in an elementary school in the southern part of Taiwan. The methods for collecting research data were observations, interviews, and document analyses. The research results showed that the change process of implementing the information literacy curriculum corresponded to the seven stages of the CREATER model. However, the stages of “care,” “relate,” and “examine,” did not obviously happen in sequence. As members of the organization, the teachers could transform effectively the innovative concept into an action, but whether the innovation could be persistent depended on team relationships, teachers’ self-renewal capacity, and approvals and participation of the leaders who really managed the organization.頁次:70-89

  11. Fortschritt als Fraktur im frühen Science Fiction Film. Metaphorologische Überlegungen zu Auf- und Einbrüchen in LE VOYAGE DANS LA LUNE und LE VOYAGE À TRAVERS L`IMPOSSIBLE von G. Méliès

    Directory of Open Access Journals (Sweden)

    Hartmann, Jörg

    2009-09-01

    Full Text Available Fantasies of man travelling into space form a main part of the popular movie genre ‘Science Fiction’. These celluloid visions are not only fantasies of improving transport, they also convey a meaning in a figurative sense. They can be seen as a modern adoption of one of humanities oldest metaphors, ‘life as a sea fare voyage’: the meaning, which was once expressed by this ‘nautical metaphor’, has been transferred and can nowadays be found in films, which show astro-nauts crossing the frontier from known space into the unknown space. In order to conclude on their attitude towards technological progress in the early 20th century, the two oldest space travel movies, Le Voyage dans la Lune (F 1902 and Le Voyage a Travers L’Impossible (F 1904 will be analyzed.

  12. Web Usability Policies/Standards/Guidelines Do Not Influence Practices at ARL Academic Libraries. A Review of: Chen, Yu‐Hui, Carol Anne Germain and Huahai Yang. “An Exploration into the Practices of Library Web Usability in ARL Academic Libraries.” Journal of the American Society for Information Science and Technology 60.5 (2009: 953‐68.

    Directory of Open Access Journals (Sweden)

    Shandra Protzko

    2009-12-01

    Full Text Available Objective – To survey the current status of Web usability Policies/Standards/Guidelines (PSGs found in academic libraries of the Association of Research Libraries (ARL. Researchers sought to investigate whether PSGs are in place, the levels of difficulty surrounding implementation, the impact of PSGs on design, testing, and resource allocation, and the relationship between ARL ranking and usability practice or PSGs.Design – Survey.Setting – North America.Subjects – Academic libraries of the ARL.Methods – An 18‐question survey consisting of multiple choice, Likert scale, and open‐ended questions was sent to all 113 ARL libraries in November 2007. Survey recipients were selected as the person in charge of Web site usability by visiting library Web sites and phone inquiry. The survey was concluded in January 2008 with a response rate of 74% (84 institutions. The researchers used t‐test to detect any difference in ARL library ranking between libraries with and without PSGs. Pair‐wise t‐tests were conducted to identify gaps in difficulty implementing PSGs. In addition, they used Pearson’s Correlation to investigate any significant correlations between variables such as ARL rank and resource allocation.Main Results – Of the 84 respondents, 34 (40% have general library Web PSGs and 25 (30% have specific usability PSGs; 41 (49% have at least one type of in‐library PSG. Of the 43 (51% libraries that do not have PSGs, 30 (36% are at universities with institutional Web usability PSGs; 26 (87% follow those guidelines. There was no statistically significant relationship between ARL ranking and PSG status (see Table 1. The authors asked about difficulty in implementing PSGs. Of the 32 libraries responding to a question about general library Web PSGs, most had slight or moderate difficulty. Twenty‐three libraries with specific usability PSGs identified difficulty levels; some had no difficulty, but a majority had moderate difficulty. For the 26 libraries using institutional Web usability PSGs, most had no or slight difficulty. Pair‐wise t‐tests showed that library Web usability PSGs were significantly more difficult to implement than university Web usability PSGs. Enforcement/agreement issues were reported as the primary difficulty in implementing in‐library PSGs. Technical issues and ambiguity were obstacles at the institutional level. More than half of the 84 libraries have Web advisory committees and about one third have usability committees or Web usability subcommittees. Several libraries answered that they have none of these committees, but indicated that they have some sort of ad hoc committee or user study group to address usability issues. Of the 84 respondents, 71 (85% have conducted usability testing. Sixty‐two libraries (73.8% rated usability testing as important, very important, or extremely important: the rate given for the importance of usability testing did not correlate with ARL ranking. Cited most often in open ended questioningwere the importance of iterative testing, library wide buy‐in, and staff and resource availability. Main web pages were tested most frequently. Fifty‐three libraries (74.6% tested their lower level pages at least once. OPACs were tested the least often. The amount of testing was impacted neither by the existence of library Web PSGs nor usability PSGs. The top two testing methods were in‐person observation and think aloud protocol.Of the 84 libraries, 24 (28% reported having staff dedicated to Web usability issues; twenty full‐time staff and four part‐time staff. There was a weak association between ARL ranking and hours worked by dedicated staff; no association existed for regular staff who take on Web responsibilities. Fifty‐one (60% of libraries had regular staff whose duties included Web usability; forty‐six full‐time and five part‐time. Training did not correlate to amount of testing methods used. There was a weak link between ALR ranking and availability of resources and, the authors showed, more testing was done as resources increased. In response to a query about future Web usability plans, the focus was on usability testing and site redesign, with only three libraries planning to refine or establish usability PSGs.Conclusion – The authors hypothesized that “web usability PSGs would influence usability practice within libraries and other institutions” (953. The data show that PSGs do not influence practices. The authors conclude that there is no significant relationship between PSGs and testing practices or PSGs and the availability of resources. Likewise, ARL ranking had no effect on the establishment of usability PSGs. Most libraries are conducting usability testing, and there was a weak link between ARL ranking and availability of testing resources. Highlighted in the open‐ended questions is the lack of usability expertise among stakeholders. Workload, inadequate human resources, and lack of organizational cohesion are also cited as barriers to the adoption of Web usability PSGs. The authors speculate that Web professionals likely use their own working knowledge and internalized guidelines without having formal documentation. The authors further speculate that the difficulty related to creating mental models that adequately represent library tasks may hinder the use of formal usability PSGs. Additionally, libraries may not regard the lack of usability PSGs as a liability, especially in light of the lack of government mandates or standards. The authors recommend educational efforts for key players on the value of Web usability, support for hiring dedicated staff, and formal documentation to guide design practice. The authors plan to compare the collected PSGs in an upcoming project. Future research could focus on non‐ARL libraries, the relationship between PSGs and user experience, and Content Management System (CMS usability characteristics.

  13. Final Environmental Assessment Construction of New Recreational Lodging at Bellows Air Force Station O’ahu, Hawai’i

    Science.gov (United States)

    2009-10-01

    Moana Blvd, Room 206 Honolulu, HI 96814 LOCAL PARTIES: Mayor Mufi Hannemann 530 S. King St Honolulu, HI 96813 City and County of Honolulu...Patrick January 22, 2009 15 CES/CEV, Environmental Planning Element 75 H Street Hickam AFB, HI 96853-5233 Dear Ms. Patrick: MUFl HANNEMANN , Mayor...DEPARTME NT OF PLANNING AND PERMITTING CITY AND COUNTY OF HONOLULU MUFI HANNEMANN MAYOR Ms. Tiffany Patrick 15 CES/CEVP 650 SOUTH KING STREET

  14. 75 FR 1066 - Center for Scientific Review; Notice of Closed Meetings

    Science.gov (United States)

    2010-01-08

    ... Person: Patrick K. Lai, PhD, Scientific Review Officer, Center for Scientific Review, National Institutes... Committee: Brain Disorders and Clinical Neuroscience Integrated Review Group; Clinical Neuroscience and...

  15. Keerulised ja põnevad / Tõnu Kaalep

    Index Scriptorium Estoniae

    Kaalep, Tõnu, 1966-2018

    2009-01-01

    22. oktoobril Tallinnas Rock Cafes toimunud ansambli KTU (Kimmo Pohjonen, Lee Patrick Mastelotto, Trey Gunn) kontserdist ja 25. oktoobril Salme Kultuurikeskuses etendunud Heiner Goebbelsi lavastusest "Eraritjaritjaka"

  16. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  17. How Many Women Are Affected by or at Risk of Preeclampsia?

    Science.gov (United States)

    ... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

  18. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

  19. Kinetic investigation on enantioselective hydrolytic resolution of ...

    African Journals Online (AJOL)

    Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

  20. 77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection

    Science.gov (United States)

    2012-02-27

    ... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...

  1. Personalized Information Service for Clinicians: Users Like It. A Review of: Jerome, Rebecca N., Nunzia Bettinsoli Giuse, S. Trent Rosenbloom, and Patrick G. Arbogast. “Exploring Clinician Adoption of a Novel Evidence Request Feature in an Electronic Medical Record System.” Journal of the Medical Library Association 96.1 (Jan. 2008: 34-41, with online appendices.

    Directory of Open Access Journals (Sweden)

    Gale G. Hannigan

    2008-09-01

    Full Text Available Objective – To examine physician use of an Evidence-Based Medicine (EBM literature request service available to clinicians through the institution’s electronic medical record system (EMR. Specifically, the authors posed the following questions: 1 Did newly implemented marketing and communication strategies increase physicians’ use of the service? 2 How did clinicians rate the relevance of the information provided? 3 How was the information provided used and shared? Design – Ten-month, prospective, observational study employing a questionnaire, statistics, a focus group, and a “before and after marketing intervention” analysis.Setting – Adult primary care outpatient clinic in an academic medical centre.Subjects – Forty-eight attending and 89 resident physicians.Methods – In 2003, a new service was introduced that allowed physicians in the Adult Primary Care Center clinic to request evidence summaries from the library regarding complex clinical questions. Contact with the library was through the secure messaging feature of the institution’s electronic medical record (EMR. From March through July 2005, the librarian employed “standard” publicity methods (email, flyers, posters, demonstrations to promote the service. A focus group in July 2005 provided feedback about the service as well as recommendations about communicating its availability and utility. New communication methods were implemented, including a monthly electronic “current awareness” newsletter, more frequent visits by the librarian during resident clinic hours, and collaborations between the librarian and residents preparing for morning report presentations. At the end of the study period, a 25-item Web-based questionnaire was sent to the 137 physicians with access to the service. Main Results – During the 10-month study period, 23 unique users submitted a total of 45 questions to the EBM Literature RequestService. More questions were from attending physicians than residents: 36 (80% vs. 9 (20%. At least one of the 23 users asked 12 (26% of the questions. Utilization did not significantly change after the mid-study intervention. At the end of the study, 48 physicians (35% completed the survey (32 attending physicians and 16residents. While 94% of the respondents indicated awareness of the service, only 40% indicated using it. The 19 who used the service, on average, agreed that the information provided was relevant and“sometimes leads to a change in my clinical practice” (p.37. Those who indicated that they shared the information (n=15 mostly did so with other attending physicians and residents, but also mentioned sharing with fellows, patients, and nurses. Information was typically shared verbally but also by distributing a printout, forwarding by email, and forwarding within the EMR message system. The information was used primarily for general self-education,instruction of trainees, and confirmation of a current plan.Conclusion – The newly implemented marketing and communication strategies did not significantly increase the use of the EBM Literature Request Service. Those who used the service found it relevant and often shared the information with others. Based on a small number of respondents and survey information, the librarian-provided EBM Literature Request Service was “well received”(39.

  2. IM-CRDS for the analysis of matrix-bound water isotopes: a streamlined (and updated) tool for ecohydrologists to probe small-scale variability in plants Yasuhara, S. (syasuhara@picarro.com)1,Carter, J.A. (jcarter@picarro.com)1, Dennis, K.J. (kdennis@picarro.com)1 1Picarro Inc., 3105 Patrick Henry Drive, Santa Clara, CA 95054

    Science.gov (United States)

    Yasuhara, S.

    2013-12-01

    The ability to measure the isotopic composition of matrix-bound water is valuable to many facets of earth and environmental sciences. For example, ecohydrologists use stable isotopes of oxygen and hydrogen in plant and soil water, in combination with measurements of atmospheric water vapor, surface water and precipitation, to estimate budgets of evapotranspiration. Likewise, water isotopes of oceanic water, brines and other waters with high total dissolved solids (TDS, e.g., juices) are relevant to studying large-scale oceanic circulation, small-scale mixing, groundwater contamination, the balance of evaporation to precipitation, and the provenance of food. Conventionally matrix-bound water has been extracted using cryogenic distillation, whereby water is distilled from the material in question (e.g., a leaf sample) by heating under vacuum and collecting the resultant water vapor using liquid nitrogen. The water can then be analyzed for its stable isotopic composition by a variety of methods, including isotope ratio mass spectrometry and laser techniques, such as Cavity Ring-Down Spectroscopy (CRDS). Here we present recent improvements in an alternative, and stream-lined, solution for integrated sample extraction and isotopic measurement using a Picarro Induction Module (IM) coupled to commercially-available CRDS analyzer from Picarro. This technique is also valuable for waters with high TDS, which can have detrimental effects on flash vaporization process, typically used for the introduction of water to Picarro CRDS water isotope analyzers. The IM works by inductively heating a sample held within a metal sample holder in a glass vial flushed with dry air. Tested samples include leaves, stems, twigs, calibration water, juices, and salt water. The heating process evolves water vapor which is then swept through the system at approximately 150 standard cubic centimeters per minute. The evolved water vapor passes through an activated charcoal cartridge for removal of large organics, and then through Picarro's Micro-Combustion Cartridge that acts to oxidize interfering organics to CO2 and H2O. Using an open-split, the IM is interfaced directly with a CRDS system (in this case, an L2130-i) for the measurement of δ18O and δD. Based on replicate measurements of water introduced to the system using glass filter paper, the precision of the system is better than 0.35 and 1.5 ‰ for δ18O and δD, respectively. We will present improvements in system operation that have reduced systematic errors associated with (i) variable backgrounds, and (ii) exchange between the sample and the local atmosphere during sample introduction. In addition, we will present calibration data, and data demonstrating the effectiveness of the Micro-Combustion Cartridge at removing organics, which can result in spectroscopic interference. Finally, we will compare localized leaf water data against integrated whole leaf water data to demonstrate the added value of being able to sample small (approximately 5 mm diameter) areas of a leaf, and compare the results of measuring samples with high TDS on an IM and a Picarro High Precision Vaporizer.

  3. The tariffs deadlock. Agreements and disagreements. Auctions make disappointments. Congestion: the auctions way. Energy in Switzerland. The fortnight of energy prices. Patrick Pierron: 'inverting steam'. Pierre Lepetit: 'the power has waken up'. Green electricity: is it necessary to establish a voluntaristic contribution?

    International Nuclear Information System (INIS)

    Corbier, M.Ch.; Schneid, O.

    2001-01-01

    This issue of 'Energies News' makes comments about the worldwide events of the moment in the domain of energy. Four articles concern the production, transportation and distribution of electricity after the transposition of the European directive and deal with the electricity tariffs, auctions and transit capacities. One short article summarizes the key-energy data of Switzerland in a couple of tables and graphs and a brief note presents the situation of the oil market after the September 11, 2001 terror events. One interview (P. Pierron, federal secretary of the CFDT syndicate) makes an analysis of the competition in the French and European energy market, while another interview (P. Lepetit, IFRI) analyzes the possible impacts of the September 11 events on the US energy policy. A last article analyzes the different solutions for the financing of the development of electricity produced from renewable energy sources and the opinion of the public with respect to an increase of electricity tariffs accordingly. (J.S.)

  4. Comment on "Nanosecond laser textured superhydrophobic metallic surfaces and their chemical sensing applications" by Duong V. Ta, Andrew Dunn, Thomas J. Wasley, Robert W. Kay, Jonathan Stringer, Patrick J. Smith, Colm Connaughton, Jonathan D. Shephard (Appl. Surf. Sci. 357 (2015) 248-254)

    Science.gov (United States)

    Boinovich, L. B.; Emelyanenko, A. M.; Emelyanenko, K. A.; Domantovsky, A. G.; Shiryaev, A. A.

    2016-08-01

    Nowadays the problem of design of durable ecologically friendly superhydrophobic surfaces is of great importance for science and technology. A recent paper in Applied Surface Science reports the method of fabricating the superhydrophobic metallic surfaces by infrared nanosecond laser surface texturing without using hydrophobic agents. Since this method of surface texturing can be considered as one of the most suitable for various industrial applications, the nature of superhydrophobic state of surfaces produced by laser texturing in the abovementioned paper deserves to be analyzed in detail. Authors of the commented paper attributed the change in wettability to the partial deoxidation of CuO into Cu2O on the surface during storage in atmosphere. However, such interpretation of the results contradicts to the basic notions in the theory of wetting and to more accurate and detailed data. In our Comment we discuss these contradictions point by point.

  5. Review of Excavating Occaneechi Town: Archaeology of an Eighteenth-Century Indian Village in North Carolina. 1998, edited by R.P. Stephen Davis Jr., Patrick C. Livingood, Trawick Ward, and Vincas P. Steponaitis. University of North Carolina Press. ISBN 0-8078-6503-6 [CD-ROM

    Directory of Open Access Journals (Sweden)

    Jonathan Bateman

    1999-05-01

    Full Text Available The CD-ROM Excavating Occaneechi Town: Archaeology of an Eighteenth-Century Indian Village in North Carolina has become a familiar site on my desk in the last few months. Not, I admit, because I have been avidly scouring its content on a regular basis, but because I have been putting off writing this review. A wealth of information can be an intimidating thing.

  6. Reference: 291 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

  7. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

  8. Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

    African Journals Online (AJOL)

    Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

  9. Untitled

    Indian Academy of Sciences (India)

    Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

  10. Untitled

    Indian Academy of Sciences (India)

    Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

  11. Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

    Directory of Open Access Journals (Sweden)

    Zhilin Chen

    2017-02-01

    Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

  12. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

  13. Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

    African Journals Online (AJOL)

    Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

  14. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  15. LHCb support team - technical

    CERN Multimedia

    Rademakers, F

    2009-01-01

    Pictures 1-4: Cédric Fournier Pictures 5-7: Patrick Vallet Pictures 8-11: Franck Lamour, Patrick Vallet, Bernard Chadaj, Gérard Decreuse, Cédric Fournier and Bernard Corajod Pictures 12-15: Franck Lamour Pictures 16-18: Bernard Chadaj Pictures 19-22: Bernard Corajod and Gérard Decreuse

  16. From Diagnosis, to Life Saving Therapy, to Hollywood: The Journey of John Crowley

    Science.gov (United States)

    Apel, Laura

    2010-01-01

    In February of 2000, "Exceptional Parent" introduced readers to the Crowley family. The author profiled John, Aileen, and their three children: Megan, Patrick, and John Jr. They told "Exceptional Parent" that in 1998 both Megan and Patrick were diagnosed with Pompe disease, a progressive, multisystemic, debilitating, and often fatal muscular…

  17. 75 FR 55799 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2010-09-14

    ... licensing. Licensing Contact: Patrick P. McCue, PhD, (301) 435-5560; [email protected] . Collaborative... Reference No. E-051-2010/0-US-01). Licensing Status: Available for licensing. Licensing Contact: Patrick P... for the brain tumors or brain cancers indentified as gliomas, glioblastomas, or astrocytomas. This...

  18. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Astrophysics and Astronomy. PATRICK DAS GUPTA. Articles written in Journal of Astrophysics and Astronomy. Volume 39 Issue 1 February 2018 pp 14 Review. Collapsing supra-massive magnetars: FRBs, the repeating FRB121102 and GRBs · PATRICK DAS GUPTA NIDHI SAINI · More Details ...

  19. HEALTH & FINANCE

    African Journals Online (AJOL)

    HEALTH & FINANCE. Patrick Thokwa Masobe. Patrick Thokwa Masobe completed his undergraduate studies at Grinnel/. University in the USA, and a Master. Degreefrom the University of London in. 1995. He is wrrently employed by the national Department of Health, where he led the task team charged with making.

  20. 75 FR 11575 - James A. Fitzpatrick Nuclear Power Plant Environmental Assessment and Finding of No Significant...

    Science.gov (United States)

    2010-03-11

    ... Power Plant Environmental Assessment and Finding of No Significant Impact The U.S. Nuclear Regulatory...), for the operation of the James A. FitzPatrick Nuclear Power Plant (JAFNPP) located in Oswego County... the Final Environmental Statement for the James A. FitzPatrick Nuclear Power Plant, Docket No. 50-333...

  1. Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae

    Directory of Open Access Journals (Sweden)

    Mingqiang Wang

    2017-12-01

    Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.

  2. Are psychiatric comorbidities and associated cognitive functions related to treatment response to methylphenidate in boys with attention-deficit/hyperactivity disorder?

    Directory of Open Access Journals (Sweden)

    Chan MH

    2017-04-01

    Full Text Available Mandy H Chan,1 Patrick WL Leung,2 Ting-pong Ho,3 Se-fong Hung,4 Chi-chiu Lee,5 Chun-pan Tang,5 Ka-chai Cheung,2 Fung-yee Ching,2 Fefe HK Chan,6 Lu-hua Chen,2 Merce Garcia-Barcelo,7 Pak-chung Sham3 1Department of Clinical Psychology, Kowloon Hospital, Hospital Authority, 2Department of Psychology, The Chinese University of Hong Kong, 3Department of Psychiatry, University of Hong Kong, 4Department of Psychiatry, The Chinese University of Hong Kong, 5Department of Psychiatry, Kwai Chung Hospital, Hospital Authority, 6Department of Clinical Psychology, Alice Ho Mui Ling Nethersole Hospital, Hospital Authority, 7Department of Surgery, University of Hong Kong, Hong Kong, People’s Republic of China Background: Methylphenidate (MPH has been found to be an effective medication for attention-deficit/hyperactivity disorder (ADHD. However, there are neither consistent nor sufficient findings on whether psychiatric comorbidities and associated cognitive functions of ADHD are related to treatment response to MPH in ADHD children.Objectives: This study investigated whether psychiatric comorbidities, IQ, and neurocognitive deficits are related to treatment response to MPH in ADHD children. In some ways, it is preferable to have a drug that the effectiveness of which to a disorder is not affected by its associated cognitive functions and psychiatric comorbidities. On the other hand, it is likely that the baseline symptom severity of ADHD is associated with the effectiveness of MPH treatment on the symptoms post treatment.Methods: A total of 149 Chinese boys (aged 6–12 years with ADHD, combined type, and normal IQ participated in this study. Assessment of ADHD symptom severity was conducted pre and post MPH treatment, while assessment of psychiatric comorbidities, IQ, and neurocognitive deficits was performed in a non-medicated condition. Treatment response was defined as the ADHD symptom severity post MPH treatment.Results: Results indicated that MPH

  3. Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

    Directory of Open Access Journals (Sweden)

    Li Xi-Ying

    2013-02-01

    postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

  4. REMOTE SENSING OF CH4 BY COMBINING LIDAR AND OPTICAL CORRELATION SPECTROSCOPY : FIRST EXPERIMENTAL RESULTS B. Thomas1, A. Miffre1, G. David1, J.P. Cariou2, P. Rairoux1 1Laboratoire de Spectrométrie Ionique et Moléculaire, CNRS, UMR 5579 Université Lyon 1, 10 rue Ada Byron, 69622 Villeurbanne, France, patrick.rairoux@univ-lyon1.fr 2Leosphere France, 14-16 rue Jean Rostand, 91400 Orsay, France, jpcariou@leosphere.fr

    Science.gov (United States)

    Thomas, B.; Miffre, A.; David, G.; Cariou, J.; Rairoux, P.

    2012-12-01

    In this contribution, we present a new methodology, called OCS-lidar, to remotely evaluate trace gas concentrations in the atmosphere (B. Thomas et al, 2012), as well as the first methane concentration measurements using this methodology. It is based on combining the Optical Correlation Spectroscopy (OCS) method with laser remote sensing technique (lidar). As displayed on figure 1, an Acoustic Optical Programmable Dispersive Filter is coupled with spectrally broadened femtosecond laser pulses to achieve the optical correlation between the emitted laser pulse and the methane absorption cross-section. In a first time, statistical and systematical errors of the OCS-lidar methodology have been evaluated thanks to a numerical model. The detection noise, interfering trace gases, temperature and pressure variations as well as laser pulse-to-pulse fluctuations have been considered. OCS-lidar simulations for methane concentration measurements have been achieved for background concentration (1.5 to 3 ppm), low (tens of ppm) and high sources (hundreds of ppm). Results show that background measurements are possible in the hour range while sources assessment and localization can be achieved in 10 minutes range up to 3 km range. Then, first methane concentration experimental measurements by using the OCS-lidar methodology will be presented. The laser source is an Oscillator Parametric Amplifier with emitting wavelength from 1.1 to 2 μm with 0.2 mJ at 1 kHz repetition rate. An AOPDF is used to generate correlated and non-correlated (or reference) signal. Experimental results on background methane concentration and on remote point source measurements will be presented, showing the achieved sensitivity and accuracy in both geophysical conditions.igure 1. Scheme of the OCS-Lidar principle. A broadened laser source centered on λ0-wavelength, with power spectral density P0, is used to create spectrally shaped power density P0M1 and P0M2, which are respectively correlated and anti-correlated to the target gas absorption cross-section σ(λ), (M1 and M2 are the wavelength dependent AOPDF-transmissions). In the atmosphere, these two emitted laser pulses, which undergo different absorptions due to the target gas presence, methane in our case, give rise to the output OCS-Lidar signals P1 and P2, after collection by a Lidar receiver and detection on an optical detector D.

  5. 76 FR 65518 - Prospective Grant of Exclusive License: The Development of a Companion Diagnostic Kit for...

    Science.gov (United States)

    2011-10-21

    ... contemplated exclusive license should be directed to: Patrick P. McCue, Ph.D., Licensing and Patenting Manager... has been demonstrated for biliary tract, kidney, lung, and stomach cancers. The prospective exclusive...

  6. 100th meeting of the Governing Board of the CERN Insurance Scheme

    CERN Multimedia

    CERN PhotoLab

    1981-01-01

    M. Corsier sits on the centre. Behind him, first raw, Constantin Tièche, M. Beechten (SBS), and on background, Charles Forman, Patrick Mollet, Cornelis Zilverschoon, Kurt S. Koelbig, M. Houmard (UBS), Roger Hugentobler.

  7. 96 Globalization and Management: Issues and Concepts

    African Journals Online (AJOL)

    User

    2010-10-17

    Oct 17, 2010 ... Oseyomon, Ehi Patrick - Department of Business, Admiistration, Faculty of. Management ... attention of scholars apart from economic issues such as trade, labour practices, the ..... Moral Issues in Business. 6th Edition. In C.

  8. 75 FR 38587 - Self-Regulatory Organizations; International Securities Exchange, LLC; Order Approving Proposed...

    Science.gov (United States)

    2010-07-02

    ... information on individual limit orders including the order type (buy/ sell), the order price, the order size...); De Fontnouvelle, Patrick, Fishe, Raymond P., and Harris, Jeffrey H., The Behavior of Bid-Ask Spreads...

  9. 75 FR 61501 - Cooperative Agreement To Support Capacity Building Activities Through the World Health...

    Science.gov (United States)

    2010-10-05

    ... REQUIREMENTS CONTACT: Program Contact: Patrick McDermott, Division of Animal and Food Microbiology, Center for Veterinary Medicine, Food and Drug Administration, 7519 Standish Pl., Mod II, rm. 1505, Rockville, MD 20855...

  10. Pop / Raul Saaremets

    Index Scriptorium Estoniae

    Saaremets, Raul

    2007-01-01

    Heliplaatidest: The Horrors "Strange House", Earlies "The Enemy Chorus", Finish Me Off "Seed", Kasabian "Empire", Norah Jones "Not Too Late", Kaiser Chiefs "Yours Truly Angry Mob", Skinny Puppy "Mythmaker", Patrick Wolf "The Magic Position"

  11. 78 FR 60297 - Center for Scientific Review; Notice of Closed Meetings

    Science.gov (United States)

    2013-10-01

    ..., Rockville, MD 20852. Contact Person: Leonid V. Tsap, Ph.D., Scientific Review Officer, Center for Scientific...: Residence Inn Bethesda, 7335 Wisconsin Avenue, Bethesda, MD 20814. Contact Person: Patrick K Lai, Ph.D...

  12. 78 FR 38352 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2013-06-26

    ...). The invention rat is superior to AD mice models because the rat has a larger sized brain to.... Licensing Contact: Patrick McCue, Ph.D.; 301-435-5560; [email protected] . Collaborative Research...

  13. 75 FR 4571 - Government-Owned Inventions; Availability for Licensing

    Science.gov (United States)

    2010-01-28

    .... Applications: Therapies for tumors associated with NF1 (including brain and peripheral nervous system tumors...-US-01). Licensing Status: Available for licensing. Licensing Contact: Patrick P. McCue, Ph.D.; 301...

  14. Inflammation of the Penis

    Science.gov (United States)

    ... Inflammation of the Penis (Balanitis; Posthitis; Balanoposthitis) By Patrick J. Shenot, MD, Associate Professor and Deputy Chair, ... of stimuli to nerves, blood vessels, and the brain. Which of the following happens to blood during ...

  15. 77 FR 293 - Center for Scientific Review; Notice of Closed Meetings

    Science.gov (United States)

    2012-01-04

    .... Contact Person: Patrick K Lai, Ph.D., Scientific Review Officer, Center for Scientific Review, [email protected] . Name of Committee: Brain Disorders and Clinical Neuroscience Integrated Review Group...

  16. Transboundary Water Resources in Southern Africa: Conflict or cooperation?

    CSIR Research Space (South Africa)

    Patrick, MJ

    2006-01-01

    Full Text Available Literature suggests a linkage between internationally shared water resources and conflict potential. Anthony R. Turton, Marian J. Patrick and Frederic Julien examine transboundary water resource management in southern Africa, showing that empirical...

  17. Intertekstualiteit en die Bose in Kroniek van Perdepoort (Anna M. Louw

    Directory of Open Access Journals (Sweden)

    E. Linde

    1986-05-01

    Patrick White is also an author of religious literature to whom Anna M. Louw is attracted by her own admission. His novels. The solid Mandala and Riders in the Chariot are studied, and similarities with Kroniek van Perdepoort indicated.

  18. Briti mütsid, kotid ja kingad kahes galeriis

    Index Scriptorium Estoniae

    2002-01-01

    Tallinna Kunstihoone galeriis ja Tallinna Linnagaleriis briti moekunstnike aksessuaaride näitus "Satellites of Fashion", kus eksponeeritakse Vivianne Westwoodi, Philip Treacy, Patrick Coxi ja Lulu Guinnessi loodud peakatteid, jalanõusid ja kotte

  19. Kõrged kontsad, kokteilid ja Cosmo / Laurence Lumiere

    Index Scriptorium Estoniae

    Lumiere, Laurence

    2008-01-01

    Menutelesarja "Seks ja linn" peategelastega samanimelisest mängufilmist (režissöör Michael Patrick King). Seriaali sünniloost, alates ideest produtsent Darren Stari peas ning filmi ja seriaali võrdlusest

  20. A high selectivity quaternized polysulfone membrane for alkaline direct methanol fuel cells

    CSIR Research Space (South Africa)

    Abuin, GC

    2015-04-01

    Full Text Available polysulfone membrane for alkaline direct methanol fuel cells Graciela C. Abuina, Esteban A. Franceschinib, Patrick Nonjolac, Mkhulu K. Mathec, Mmalewane Modibedic, Horacio R. Cortib,* aCentro de Procesos Superficiales, Instituto Nacional de Tecnología...

  1. ESARBICA Journal: Journal of the Eastern and Southern Africa ...

    African Journals Online (AJOL)

    Socioeconomic determinants of e-government adoption in selected districts of Tanzania · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Mercy Mlay Komba, Patrick Ngulube, 71-82 ...

  2. Sexual Harassment DEOCS 4.1 Construct Validity Summary

    Science.gov (United States)

    2017-08-01

    Sexual Harassment DEOCS 4.1 Construct Validity Summary DEFENSE EQUAL OPPORTUNITY MANAGEMENT INSTITUTE...DIRECTORATE OF RESEARCH DEVELOPMENT AND STRATEGIC INITIATIVES Directed by Dr. Daniel P. McDonald, Executive Director 366 Tuskegee Airmen Drive Patrick AFB

  3. Solar Imagery - Composites - Synoptic Maps - McIntosh

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — In 1964 (solar cycle 20) Patrick McIntosh began creating hand-drawn synoptic maps of solar activity, based on Hydrogen alpha (H?) imaging measurements. These...

  4. A Post-"Leahy Conditions" Theater Security Cooperation Plan for Indonesia

    National Research Council Canada - National Science Library

    Grady, Gregory L

    2007-01-01

    Currently, Public Law 115, Section 572 of the Foreign Operations, Export Financing and Related Programs Appropriations Act of 2002, also known as the "Leahy Conditions" for its sponsor, Senator Patrick Leahy (Democrat-Vermont...

  5. The high pressure gas Cerenkov counter at the Omega Facility.

    CERN Multimedia

    1975-01-01

    The high-pressure gas Cerenkov was used to measure reactions as pion (or kaon)- hydrogen --> forward proton - X. It was built by the Ecole Polytechnique (Palaiseu). Here Peter Sonderegger and Patrick Fleury,

  6. CQ No. 25

    African Journals Online (AJOL)

    security in order to identify how best Kenyans can meet their human security needs. * Patrick Mutahi ... internal security. The void has .... and private security companies that bring the otherwise ... for crime and other deviant behaviours but also.

  7. Facts for Features

    Science.gov (United States)

    Hawaiian and Other Pacific Islander population groups. FFF: Women's History Month: March 2018 February 15 . Patrick's Day: March 2018 February 06, 2018 To commemorate this day which celebrates all things Irish, the

  8. Emerging technologies: from hindsight to foresight

    National Research Council Canada - National Science Library

    Einsiedel, Edna F

    2009-01-01

    ... Pharmaceuticals in the United States / 120 Patrick A. Stewart 8 Forestalling Liabilities? Stakeholder Participation and Regulatory Development / 138 Stuart Smyth In the Stem Cell Fields 9 When Human Dign...

  9. Jätkub filmisari "Ainult friikidele"

    Index Scriptorium Estoniae

    2008-01-01

    Filmisarjas "Ainult friikidele" linastub Tallinnas Sõpruse kinos täna ja Tartus Athena Keskuses homme Alain Corneau' kutuslik kriminaalfilm "Serie noir" : Prantsusmaa 1979. Suurepärase rolli teeb Patrick Dewaere

  10. 9620 DIETARY ADEQUACY OF RURAL SCHOOL CHILDREN ...

    African Journals Online (AJOL)

    Mimi

    to reduced mental and physical development of children, hence delayed ... of health and neurocognitive performance of school-age children [2]. ..... Patrick H and TA Nicklas A review of family and social determinants of ... Physiology and.

  11. CTC Sentinel. Volume 1, Issue 7, June 2008. Al-Qa'ida in Iraq: Lessons from the Mosul Security Operation

    National Research Council Canada - National Science Library

    Knights, Michael

    2008-01-01

    ...%. As the result of leadership targeting and the loss of safe havens, Multinational Force Iraq (MNF-I) spokesman Rear Admiral Patrick Driscoll characterized AQI and other insurgent groups in Mosul as being "off-balance and on the run."

  12. Eesti Maanteemuuseumis lavastub Roman Baskini käe all "Augustikuu teemaja"

    Index Scriptorium Estoniae

    Veski, Rivo

    2009-01-01

    Roman Baskini lavastatud komöödia "Augustikuu teemaja" Maanteemuuseumis. Autor John Patrick, mängivad mitmed harrastusteatrite näitlejad, teiste hulgas MTÜ Vilde Teatri liikmed. Peaosas Marko Matvere

  13. Ameerika teatriauhinnad jagatud / Neeme Raud

    Index Scriptorium Estoniae

    Raud, Neeme, 1969-

    2005-01-01

    Ameerika kommertsteatri auhinnad said muusikalid "Spamalot" ja "Valgus Piazzal" ning parima draama preemia Ameerika kirjaniku John Patrick Shanley näidend "Kahtlus". Parima lavastaja Tony sai kuuendat korda Mike Nichols

  14. Kas tunned maad Tobiki rannal? / Veiko Märka

    Index Scriptorium Estoniae

    Märka, Veiko, 1964-

    2009-01-01

    Roman Baskini lavastatud komöödia "Augustikuu teemaja" Maanteemuuseumis. Autor John Patrick, mängivad mitmed harrastusteatrite näitlejad, teiste hulgas MTÜ Vilde Teatri liikmed. Peaosas Marko Matvere

  15. Komöödia täis Jaapani elutarkust/ Mari Hiiemäe

    Index Scriptorium Estoniae

    Hiiemäe, Mari

    2009-01-01

    Roman Baskini lavastatud komöödia "Augustikuu teemaja" Maanteemuuseumis. Autor John Patrick, mängivad mitmed harrastusteatrite näitlejad, teiste hulgas MTÜ Vilde Teatri liikmed - peaosas Marko Matvere

  16. The North Atlantic Treaty Organization and the European Union’s Common Security and Defense Policy: Intersecting Trajectories

    Science.gov (United States)

    2011-07-01

    Lieutenant General, Canadian Forces, Canadian Military Repre- sentative to NATO Elizabeth Race, Deputy Defence Policy Advisor, Canadian Joint...Ruehle, Head, Energy Security Section, Emerging Security Challenges Division, NATO ( Brus - sels) Patrick Nash, Lieutenant General, Irish Army, for- mer

  17. Kui näitlejal on oma etendus / Margot Visnap

    Index Scriptorium Estoniae

    Visnap, Margot

    1990-01-01

    Patrick Süskindi "Kontrabass" Vanalinnastuudios, lavastaja Eino Baskin ja Noorsooteatris William Luce'i "Amhersti kaunitar", lavastaja Rudolf Allabert ning Jerome Kilty "Armas luiskaja", näitejuht Kalju Orro

  18. 40 CFR 52.1670 - Identification of plans.

    Science.gov (United States)

    2010-07-01

    ... regulations. (x) February 20, 1980, dealing with public hearings to revise Parts 229 and 231 of 6 NYCRR... Corporation. (2) October 17, 1996 letter to Mr. Ted Gardella, EPA from Mr. Patrick Lentlie, supplementing the...

  19. Rethinking technologies

    National Research Council Canada - National Science Library

    Conley, Verena Andermatt

    1993-01-01

    .... Katherine Hayles 11. The Leap and the Lapse: Hacking a Private Site in Cyberspace Alberto Moreiras 12. Telefigures and Cyberspace Patrick Clancy 173 191 207 Works Cited 233 Contributors 241 Index 24...

  20. Integrating biodiversity concepts with good governance to support ...

    African Journals Online (AJOL)

    2005-10-04

    Oct 4, 2005 ... support water resources management in South Africa. PJ Ashton1*, MJ Patrick2, HM .... Figure 1 shows that human activities, motivated by a diverse array of goals and .... catchment management strategy. • Legislation is the ...

  1. Metagenome Assembly at the DOE JGI (Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    Energy Technology Data Exchange (ETDEWEB)

    Chain, Patrick

    2011-10-13

    Patrick Chain of DOE JGI at LANL, Co-Chair of the Metagenome-specific Assembly session, on Metagenome Assembly at the DOE JGIat the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  2. Teater kinos või kino teatris? "Salome" juhtum / Rein Veidemann

    Index Scriptorium Estoniae

    Veidemann, Rein, 1946-

    2008-01-01

    Ooper kinolinal : Richard Strauss. "Salome". Dirigent Patrick Summers, lavastaja Jürgen Flimm. New Yorgi Metropolitan Opera etenduse otseülekanne 11. oktoobril Tallinna kobarkinos ja Tartu kinos Ekraan

  3. 77 FR 75016 - Guidance Regarding Deduction and Capitalization of Expenditures Related to Tangible Property

    Science.gov (United States)

    2012-12-19

    ... Patrick Clinton, Office Associate Chief Counsel (Income Tax & Accounting), (202) 622- 4930 (not a toll... and depreciation reserve of the general asset account, and that reflect the amount realized during the...

  4. An African account of ecosystem service provision: Use, threats and policy options for sustainable livelihoods

    CSIR Research Space (South Africa)

    Egoh, Benis N

    2012-12-01

    Full Text Available -1 Ecosystem Services December 2012/ Vol. 2 An African account of ecosystem service provision: Use, threats and policy options for sustainable livelihoods Benis N. Egoh a, , , , Patrick J. O'Farrellb, Aymen Charefa, Leigh Josephine Gurney a...

  5. Clean Hands Count

    Medline Plus

    Full Text Available ... Washing Video from CDC called "Put Your Hands Together" - Duration: 3:40. Patrick Boshell 27,834 views ... Policy & Safety Send feedback Test new features Loading... Working... Sign in to add this to Watch Later ...

  6. Pricing American and Asian Options

    OpenAIRE

    Pat Muldowney

    2015-01-01

    An analytic method for pricing American call options is provided; followed by an empirical method for pricing Asian call options. The methodology is the pricing theory presented in "A Modern Theory of Random Variation", by Patrick Muldowney, 2012.

  7. Zur historischen Aufarbeitung und medialen Vermittlung der Shoah in Italien und Deutschland

    Directory of Open Access Journals (Sweden)

    Peter Kuon

    2016-03-01

    Full Text Available Claudia Müller, Patrick Ostermann und Karl-Siegbert Rehberg, Hrsg., Die Shoah in Geschichte und Erinnerung: Perspektiven medialer Vermittlung in Italien und Deutschland (Bielefeld: transcript, 2015.

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

  9. Soil Behavior Under Blast Loading

    Science.gov (United States)

    2010-12-01

    in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

  10. Reference: 418 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

  11. Force Protection for Fire Fighters: Warm Zone Operations at Paramilitary Style Active Shooter Incidents in a Multi-Hazard Environment as a Fire Service Core Competency

    Science.gov (United States)

    2012-03-01

    Attacks,” Der Speigel, July 25, 2011, http://www.spiegel.de/international/europe/0,1518,776437,00.html 114 “Profile: Anders Behring Breivik ,” BBC...144 Patrick Donovan, “Puyallup Fire & Rescue’s Response to Active School Shooting Incident,” National Fire Academy (July 2008): 24, 26, 49...Learn Them.” Homeland Security Affairs Journal II, no. 2 (July 2006): 11. Donovan, Patrick . “Puyallup Fire & Rescue’s Response to Active School

  12. UNSC’s Expansion: Prospects for Change and Implications for the Regions and the World

    Science.gov (United States)

    2015-12-01

    Security Council Reform? Lesson for and from Institutional Theory ,” in Multilateralism and Security Institutions in an Era of Globalization, eds...world politics.153 151 Voeten, Why no U.N. Security Council Reform? Lesson for and from Institutional ... Theory , 289. 152 McDonald and Patrick, Security Council Enlargement and U. S. Interests, 4. 153 McDonald and Patrick, Security Council Enlargement

  13. Ada 9X Project Revision Request Report. Supplement 1

    Science.gov (United States)

    1990-01-01

    SYNCHRONIZATION POINTS OF A TASK DATE: August 8, 1989 NAME: Patrick de Bondeli ADDRESS: CR2A, 19 Avenue Dubonnet 92411 - COURBEVOIE - CEDEX, FRANCE TELEPHONE...to the parent task. Evaluating the attributes TERMINATED or CALLABLE - Giovini and Zucca (1986) consider them as synchronization points, but we do not...Elena. An Analysis of Ada Tasking December 1986. Companion paper of the Ada Formal Definition Sponsored by the European Commission. De Bondeli , Patrick

  14. Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges

    National Research Council Canada - National Science Library

    Dumbaugh, Kerry

    2005-01-01

    .... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...

  15. 77 FR 28880 - Ocean Transportation Intermediary License Applicants

    Science.gov (United States)

    2012-05-16

    ... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...

  16. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

  17. Evaluation of effectiveness in a novel wound healing ointment ...

    African Journals Online (AJOL)

    Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

  18. Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings

    Science.gov (United States)

    2015-07-01

    resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

  19. Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers

    Science.gov (United States)

    2014-09-18

    22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

  20. A comparative study assessing a new tool for occluding ...

    African Journals Online (AJOL)

    0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

  1. (DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs

    Science.gov (United States)

    2012-12-21

    increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

  2. The roles of electronic books in the transformation of learning and instruction

    NARCIS (Netherlands)

    Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel

    2014-01-01

    Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

  3. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  4. Trend analysis and change point detection of annual and seasonal ...

    Indian Academy of Sciences (India)

    elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

  5. The effects of growth time on the quality of graphene synthesized by ...

    Indian Academy of Sciences (India)

    by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

  6. Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors

    Science.gov (United States)

    2008-04-01

    Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

  7. The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations

    Science.gov (United States)

    2011-09-01

    properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

  8. Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior

    Science.gov (United States)

    2011-09-01

    applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

  9. Untitled

    Indian Academy of Sciences (India)

    20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

  10. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  11. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  12. WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b)

    Science.gov (United States)

    Canivez, Gary L.; Kush, Joseph C.

    2013-01-01

    Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

  13. A reviewof the pharmacologicalmechanism of traditional Chinese ...

    African Journals Online (AJOL)

    A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

  14. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

  15. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

  16. Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

    Science.gov (United States)

    2009-09-01

    this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

  17. Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor

    Science.gov (United States)

    2015-09-01

    Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

  18. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  19. Browse Title Index

    African Journals Online (AJOL)

    Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

  20. 75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the...

    Science.gov (United States)

    2010-02-19

    ... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

  1. 75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use

    Science.gov (United States)

    2010-01-28

    ... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

  2. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  3. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...

  4. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...

  5. Three novel antioxidants from Cinnamomum plants | Cheng | African ...

    African Journals Online (AJOL)

    Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

  6. The validity and accuracy in foot-to-foot bioelectrical impedance ...

    African Journals Online (AJOL)

    The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...

  7. High School Students' Topic Preferences and Oral Development in an English-Only Short-Term Intensive Language Program

    Science.gov (United States)

    Hsieh, Hui-Chen

    2016-01-01

    Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…

  8. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...

  9. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  10. Revision of the subfamily Opiinae (Hymenoptera, Braconidae) from Hunan (China), including thirty-six new species and two new genera

    Science.gov (United States)

    Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai

    2013-01-01

    van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis

  11. Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China

    Science.gov (United States)

    Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min

    2018-01-01

    Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422

  12. EDITORIAL Solar harvest Solar harvest

    Science.gov (United States)

    Demming, Anna

    2010-12-01

    into the charge transport mechanism and trap distribution in these composites [3]. An advantage of investigating solar cell technology based on organic materials rather than silicon is that silicon photovoltaics requires high-purity silicon, whereas the material demands of organic technology are not nearly so strict. Work by researchers in Denmark and Germany highlights the simplicity and tolerance to ambient conditions of organic photovoltaic fabrication in the demonstration of a nanostructured polymer solar cell made from a thermocleavable polymer material and zinc oxide nanoparticles. All the manipulations during device preparation could be carried out in air at around 20 °C and 35% humidity [4]. A possible route to enhancing cell performance is through the improvment of the transport efficiency. Researchers in Taiwan demonstrate how effectively this can be implemented in a hybrid device comprising TiO2 nanorods and poly[2-methoxy-5-(2-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV) [5]. In addition, inorganic semiconductor nanocrystals that have tunable optical bandgaps can be combined with organic semiconductors for the fabrication of hybrid photovoltaic devices with broad spectral sensitivity. A collaboration of researchers in the UK and the US has now developed a near-infrared sensitive hybrid photovoltaic system with PbS nanocrystals and C60. The reported improvement in device performance is attributed to increased carrier mobility of the PbS nanocrystal film [6]. In this issue, Patrick G Nicholson and Fernando A Castro from the National Physical Laboratory in the UK present a topical review on the principles and techniques for the characterization of organic photovoltaics [7]. The review presents a comprehensive picture of the current state-of-the-art understanding of the working mechanisms behind organic solar cells, and also describes electronic morphological considerations relevant to optimizing the devices, as well as different nanoscale techniques for

  13. Wide Band Gap Semiconductors Symposium Held in Boston, Massachusetts on 2-6 December 1991. Materials Research Society Symposium Proceedings. Volume 242

    Science.gov (United States)

    1992-01-01

    AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys

  14. Pitfalls in VAR based return decompositions: A clarification

    DEFF Research Database (Denmark)

    Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

    in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...

  15. THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA

    Institute of Scientific and Technical Information of China (English)

    CHENTie-mei; SONGShi-mei; YUANDe-cheng

    2003-01-01

    Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.

  16. The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica

    Directory of Open Access Journals (Sweden)

    Sollman Philip

    2015-07-01

    Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.

  17. Influence of French Air Power Strategy in the European Union’s Military Operations in Africa (2003-2009)

    Science.gov (United States)

    2011-06-01

    Patrick Facon, Histoire de l’Armée de l’Air, provides the context of French operations in Africa in the broadest history of the French Air Force. 3 In...during the 2000s, including its 3 Patrick Facon, Histoire de L’armée de L’air (Paris: La...34, 8. 5 Facon, Histoire de L’armée de L’air, 451. 6 Facon, Histoire de L’armée de L’air, 458. The third phase began in 1994 after the Rwanda

  18. グローカリィティ研究の課題 : ゲディスとウォード&デュボス

    OpenAIRE

    藤川, 哲

    2012-01-01

    “Think Globally, Act Locally” is now a very popular phrase. Wikipedia on the internet tells that the original form of it :“Think Global, Act Local” has been attributed to Scots town planner and social activist Patrick Geddes. Walter Stephen, who is the Chairman of the Sir Patrick Geddes Memorial Trust, edited an anthology Think Global, Act Local (2004) and says that Geddes coined the mantra in his Cities in Evolution (1915). But the word “global” does not appear in the book. Geddes insisted b...

  19. Epigenetic Mediation of Endocrine and Immune Response in an Animal Model of Gulf War Illness

    Science.gov (United States)

    2016-10-01

    PRINCIPAL INVESTIGATOR: Patrick McGowan, PhD CONTRACTING ORGANIZATION: University of Toronto Toronto, Ontario, Canada, M5S 1A1 REPORT DATE: October 2016...Illness 5b. GRANT NUMBER W81XWH-14-1-0550 5c. PROGRAM ELEMENT NUMBER Patrick O. McGowan, PhD, Gordon Broderick, PhD, James O’Callaghan, PhD...chromatin modifications in peripheral blood and the brain (specifically hippocampus and prefrontal cortex) in order to pursue a mechanistic understanding

  20. Defending Norway and the Northern Flank: Analysis of NATO’s Strategic Options.

    Science.gov (United States)

    1985-12-01

    22a NAME OF RESPONSIBLE INDIVIDUAL 22b TELEPHONE (Include Area Code) 22c OFFICE SYMBOL Prof. Patrick J. Parker 646-2097 56 DV C")RM 1473,s84 MAt 53...34Roy Breivik , Assuring the Security of Reinforcements to Norway," NATO s Fifteen Nations, special issue no. 2 (1982), pp. 66 67. 22...Analyses 1 2000 North Beauregard Street P.O. Box 11280 Alexandria, Virginia 22311 5. Professor Patrick J. Parker, Code 56Pr 1 4 Department of National

  1. Kommunen er død - længe leve den digitale disruption

    DEFF Research Database (Denmark)

    Andersen, Kim Normann

    2017-01-01

    "New Public Management is Dead. Long Live the Digital Era." Sådan proklamerede Patrick Donleavy digitaliseringens muligheder i en banebrydende artikel fra 2005. Med en omskrivning af dette citat til "Kommunen er død, længe leve den digitale disruption", er ballet åbnet for denne artikel......."New Public Management is Dead. Long Live the Digital Era." Sådan proklamerede Patrick Donleavy digitaliseringens muligheder i en banebrydende artikel fra 2005. Med en omskrivning af dette citat til "Kommunen er død, længe leve den digitale disruption", er ballet åbnet for denne artikel....

  2. LDL Particle Testing

    Science.gov (United States)

    ... P. Caulfield, Jay Wohlgemuth, Zhizong Chen, Robert Superko, Charles M. Rowland, Robert J. Glynn, Paul M. Ridker, ... See Less Ask a Laboratory Scientist Your questions will be answered by a laboratory scientist as part ...

  3. 77 FR 52311 - Wooden Bedroom Furniture From the People's Republic of China: Partial Rescission of Antidumping...

    Science.gov (United States)

    2012-08-29

    ... Furniture Co., Ltd. Zhangjiagang Zheng Yan Decoration Co., Ltd. Zhangjiang Sunwin Arts & Crafts Co., Ltd.... Trendex Industries Limited Wan Bao Chen Group Hong Kong Co., Ltd. World Design International Co., Ltd...

  4. On synchronization of three chaotic systems

    International Nuclear Information System (INIS)

    Yan Jianping; Li Changpin

    2005-01-01

    In this paper, a simple but efficient method is applied to the synchronization of three chaotic systems, i.e., the chaotic Lorenz, Chua, and Chen systems. Numerical simulations show this method works very well

  5. ONE WAY ANOVA RANDOMIZED COMPLETE BLOCKS

    African Journals Online (AJOL)

    ******

    2012-04-24

    Apr 24, 2012 ... Key words: Grey mullet, growth, foreign DNA, genetically modified. INTRODUCTION ... ration, food quality and preservation (Shears et al., 1991;. Chen et al. ... fish eggs (Khoo et al., 1992) and 4) direct injection of foreign DNA ...

  6. Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

    Science.gov (United States)

    Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

    2014-03-01

    This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

  7. Fulltext PDF

    Indian Academy of Sciences (India)

    Journal of Earth System Science wishes to place on record the valuable ... Chen Xun-Hong, University of Nebraska-Lincoln, Nebraska, United States ... Dasgupta Somnath, Indian Institute of Science Education and Research, Kolkata.

  8. The Application of First‑Trimester Volumetry in Predicting Pregnancy ...

    African Journals Online (AJOL)

    Rawal MY, Malhotra N. Ultrasonography in Early Intrauterine pregnancy. ... Leung KY, Ma Teresa, Lau BY, Chen M. First trimester ultrasound volumetry: .... Ghosh A, Tang MH, Lam YH, Fung E, Chan V. Ultrasound measurement of placental ...

  9. Appiah-Adjei et al

    African Journals Online (AJOL)

    PUBLICATIONS1

    ing, sale of automobile spare parts, and metal fabrication. Some of these activities generate huge ... Keywords: Groundwater quality, pollution, waste disposal, Suame, Ghana ... of fertilizers (Chen et al., 2007; Parris, 2011;. Shen et al., 2011), ...

  10. Genetics Home Reference: isobutyryl-CoA dehydrogenase deficiency

    Science.gov (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  11. Genetics Home Reference: short-chain acyl-CoA dehydrogenase deficiency

    Science.gov (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  12. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Spinal Cord Injury ... Jennifer Piatt, PhD David Chen, MD Read Bio Medical Director, Spinal Cord Injury Rehabilitation Program, Rehabilitation Institute ...

  13. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Fang Dong1 Jiang Chenning1 Zhu Ting1 Yang Jinming1. Department of Pharmaceutical Engineering, School of Chemistry and Chemical Engineering, Yancheng Teachers University, 50 Kai Fang Da Dao, Yancheng 224002, Jiangsu, P. R. China ...

  14. Probability to produce animal vaccines in insect baculovirus ...

    African Journals Online (AJOL)

    Administrator

    2011-09-07

    Sep 7, 2011 ... The insect baculovirus expression system is a valuable tool for the production of vaccine. .... vaccine expression/delivery vehicle (Yu-Chen et al., ... baculoviruses are applied in cell-based assays for drug ... Intramuscular.

  15. Extraction and Purification of Flavonoids from Radix Puerariae

    African Journals Online (AJOL)

    and preparations are now on sale. ... significant for optimization of extraction, resin selection and ... and flavonoids as indexes, optimize the proper density. ..... system. Sep Purif Technol. 2008; 62: 590-595. 12. Chen JH, Liau BC, Jong TT.

  16. ACKNOWLEDGEMENTS

    Indian Academy of Sciences (India)

    Chen Xingyuan Lorraine, University of California, Berkeley, United States ... Das Kaushik, Bengal Engineering and Science University, Kolkata de Boyer ..... Samborska Katarzyna, Institute for Ecology of Industrial Areas, Katowice, Poland.

  17. 1,6-Diaminoperylene bisimide with a highly twisted perylene core

    Indian Academy of Sciences (India)

    ... KEW-YU CHEN. ∗. Department of Chemical Engineering, Feng Chia University, 40724 Taichung, Taiwan, Republic of China ... chromic materials,6 and organic field-effect transis- ..... Wasielewski M R 2012 Competition between singlet fis-.

  18. Phenotype-gene: 396 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ciency in organ named stomatal complex during process named stomatal movement for AT5G13680 Chen Zhizhong et...943431i increased efficiency in organ named stomatal complex during process named stomatal movement

  19. Screening a heterogeneous elderly South African population for ...

    African Journals Online (AJOL)

    Age and race influenced performance on the MMSE, SIS and SMRS. Conclusion: Different types .... Depression Scale (GDS)34 employing a cut-off score of >11. ...... Society for Academic Emergency Medicine 2008;15(7):613-6. 42. Chen MR ...

  20. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to Home ...

  1. Afrika Statistika ISSN 2316-090X Network estimation in State Space ...

    African Journals Online (AJOL)

    continuous, stochastic differential equation model (Chen et al., 2005; ... a large number of model parameters and are not well suited to deal with noisy data ... and selection in regression analysis that incorporates an L1 regularization constraint.

  2. Isolation and identification of two galangin metabolites from rat urine ...

    African Journals Online (AJOL)

    Isolation and identification of two galangin metabolites from rat urine and determination of their in vitro hypolipidemic activity. Xuguang Zhang, Shouqian Cheng, Hailong Li, Xiaopo Zhang, Feng Chen, Youbin Li, Junqing Zhang, Yinfeng Tan ...

  3. Fulltext PDF

    Indian Academy of Sciences (India)

    The newly synthesized molecules were characterized by spectral analysis and subjected to antioxidant and ... membered heterocyclic compounds with oxygen and nitrogen atoms. ...... Yen G C and Chen H Y 1995 J. Agric. Food Chem. 43. 27.

  4. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    dimensional stochastic Navier–Stokes equations in the presence of delays. The results extend some of the existing results. Author Affiliations. Huabin Chen1. Department of Mathematics, School of Science, Nanchang University, Nanchang 330031, ...

  5. Genetics Home Reference: type 2 diabetes

    Science.gov (United States)

    ... Chen H, Huyghe JR, van de Bunt M, Pearson RD, Kumar A, Müller-Nurasyid M, Grarup N, ... Accessibility FOIA Viewers & Players U.S. Department of Health & Human Services National Institutes of Health National Library of ...

  6. hispidulin and other constituents of scoparia dulcis linn

    African Journals Online (AJOL)

    Administrator

    HIV. INTRODUCTION. Scoparia dulcis Linn. (Scrophulariaceae) has been extensively studied for its flavone and terpene constituents (Ahmed et al., 1990, Ah- san et al., 2003, Chen et al., 1976, Hayashi et al., 1987, 1987b, 1988, 1990, 1991, ...

  7. Wahab et al (14)

    African Journals Online (AJOL)

    DELL

    food chain via cereals, vegetables, fishes and meat. (Abdulqawi, 2011). ... different functional groups which are involved in metal binding, and .... Penicillium species. A phylogenetic tree was ..... Chemistry and Ecology, 29(4),. 320–328. Chen ...

  8. Synthesis, characterization and photocatalytic reactions of ...

    Indian Academy of Sciences (India)

    The methods used usually include various surface modifi- cations. Several ... In recent years, innovative solid catalysts have been prepared ... post-treatment with phosphoric acid (Clesla et al 1996; Chen .... The ammonia adsorption was ca-.

  9. Hong et al., Afr J Tradit Complement Altern Med. (2013) 10(4):66-69 ...

    African Journals Online (AJOL)

    AJTCAM

    inflammation, annex inflammation, uterine prolapse, and neurasthenia. .... Research progress on pharmacological effects of Bidens bipinnata L. China Pharmacy. ... Clinic. 24 (3): 147-149. 8. Wang, Q., Zhang Y.N., Chen F.H. (2009). Research ...

  10. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Sex and Fertility After Spinal Cord Injury Adult Injuries Spinal Cord Injury 101 David Chen, ...

  11. THE AGINCOURT FIELD SITE - EVOLUTION AND CURRENT ...

    African Journals Online (AJOL)

    teaching, research and practice since C C Chen's impressive efforts at the ... HSDU tended to emphasise human resource development, for example ... innovative subdistrict and health centre programmes could be ... Agincourt Study Area. Fig.

  12. “Use salt and foods high in salt sparingly”: a food-based dietary ...

    African Journals Online (AJOL)

    2013-04-12

    Apr 12, 2013 ... effect on blood pressure, a high sodium intake has also been associated with ... promotion of healthy eating habits from an early age is important. Chen and ..... help consumers make informed purchasing decisions. However ...

  13. Moskva kunstibiennaal reaktsiooni teenistuses? / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-

    2007-01-01

    Moskva II rahvusvahelisest nüüdiskunsti biennaalist. Näitustest "Sotsart. Poliitiline kunst Venemaal" (kuraator Andrei Jerofejev), "Sotsart. Poliitiline kunst Hiinas" (kuraator Xin Don Chen), "Mõtlev realism" (kuraator Jekaterina Djegot) ja "Mina usun" (kuraator Oleg Kulik)

  14. Online Resources Microsatellites development, cross-amplification ...

    Indian Academy of Sciences (India)

    unknown

    1Guangdong Provincial Key Laboratory of Applied Botany, South China ... In south China, urban development is another threat to A. sinensis. ..... Chen G., Liu C. and Sun W. 2016 Pollination and seed dispersal of Aquilaria sinensis (Lour.) ...

  15. A lanthanum pyromellitate coordination polymer with three ...

    Indian Academy of Sciences (India)

    Framework Solids Laboratory, Chemistry and Physics of Materials Unit, Jawaharlal Nehru Centre for. Advanced Scientific ... bases, though the quality of the single crystals ob- tained using ..... Chen J S and Wang S N 2003 Inorg. Chem. 42 944.

  16. Nanocomposite Membrane via Magnetite Nanoparticle Assembly

    KAUST Repository

    Xie, Yihui

    2012-01-01

    discussions and suggestions. I also want to extend my gratitude to the staff from the KAUST Core Lab for Advanced Nanofabrication, Imaging and Characterization, especially Dr. Ali Reza Behzad, Dr. Rachid Sougrat, and Dr. Long Chen, for their assistance

  17. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xiaoming Liao1 Hongyang Zhu1 Guangfu Yin1 Zhongbing Huang1 Yadong Yao1 Xianchun Chen1. College of Materials Science and Engineering, Sichuan University, Chengdu 610064, P.R. of China ...

  18. ocular findings in children with cerebral palsy attending a tertiary

    African Journals Online (AJOL)

    ocular abnormalities among children with cerebral palsy that attended the neurology clinic of University of. Ilorin Teaching ... recognize faces or hand-held toys (Chen, Weinberg and Catalano ... palsy that is also blind/visually impaired pose a.

  19. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... RN Pediatric Injuries Pediatric Spinal Cord Injury 101 Lawrence Vogel, MD The Basics of Pediatric SCI Rehabilitation ... Rogers, PT Recreational Therapy after Spinal Cord Injury Jennifer Piatt, PhD David Chen, MD Read Bio Medical ...

  20. Effect of demographic variables on public attitudes towards ...

    African Journals Online (AJOL)

    Jane

    2011-09-30

    Sep 30, 2011 ... 5Faculty of Social Sciences and Humanities, Universiti Kebangsaan Malaysia, 43600 UKM, Bangi, ..... race formulates a cultural/social network. .... Macer D, Chen Ng MA (2000). Changing Attitudes to Biotechnology in. Japan.

  1. Galactosemia

    Science.gov (United States)

    ... and Rector's The Kidney. 10th ed. Philadelphia, PA: Elsevier; 2016:chap 45. Broomfield A, Brain C, Grunewald S. ... Neurology in Clinical Practice. 7th ed. Philadelphia, PA: Elsevier; 2016:chap 91. Kishnani PS, Chen Y-T. ...

  2. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  3. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  4. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  5. TMX magnet system, present and future

    International Nuclear Information System (INIS)

    Wong, R.L.; Pedrotti, L.R.; Leavitt, G.A.; Waugh, A.F.; Chargin, A.K.; Calderon, M.O.

    1979-01-01

    The magnetic field design and the mechanical design of the TMX magnet system were previously reported by Chen and Hinkle. This paper is a summary of the work that has been accomplished in the two years since then

  6. On bounds in Poisson approximation for distributions of independent negative-binomial distributed random variables.

    Science.gov (United States)

    Hung, Tran Loc; Giang, Le Truong

    2016-01-01

    Using the Stein-Chen method some upper bounds in Poisson approximation for distributions of row-wise triangular arrays of independent negative-binomial distributed random variables are established in this note.

  7. Download this PDF file

    African Journals Online (AJOL)

    Andries du Toit

    11 Chen, et al Mainstreaming informal Employment and Gender (2004). 12 Svendsen Work (2008) at 3. ...... In the workplace, other than changes in ..... Philip K Second economy strategy: addressing inequality and economic marginalisation.

  8. Novel alleles of 31-bp VNTR polymorphism in the human ...

    Indian Academy of Sciences (India)

    Author Affiliations. Yik-Yuen Gan1 Chuan-Fei Chen1. Natural Sciences and Science Education, National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616, Republic of Singapore ...

  9. Tourism and microcredit for sustainable community development in Sub-Saharan Africa

    NARCIS (Netherlands)

    Hoeve ten, Marieke

    2009-01-01

    Poverty reduction is one of the main Millennium Development Goals (United Nations, 2000). Sub-Saharan Africa is the region with the highest prevalence of poverty. Almost half the population lives in extreme poverty (Chen & Ravillion, 2004; UN, 2005). Pove

  10. Recognition of Pitman shorthand text using tangent feature values at ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    a prerequisite for directional code measurement (Chen & Lee 1992). The handwritten PSL ... shows the directional code and an example to illustrate the coding method for a word formed by the concatenation .... Primitive selection. 5.1 Corner ...

  11. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  12. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  13. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  14. 76 FR 72850 - Adjustment of Monetary Threshold for Reporting Rail Equipment Accidents/Incidents for Calendar...

    Science.gov (United States)

    2011-11-28

    ... 2010. DATES: This regulation is effective January 1, 2012. FOR FURTHER INFORMATION CONTACT: Kebo Chen... of 1995 Pursuant to Section 201 of the Unfunded Mandates Reform Act of 1995 (Pub. L. 104-4, 2 U.S.C...

  15. 77 FR 13393 - Endangered and Threatened Wildlife and Plants; Revised Endangered Status, Revised Critical...

    Science.gov (United States)

    2012-03-06

    ..., 1995). Chance or stochastic events have occurred in the range of M. viminea, and may continue to make M.... 2010; Chen et al. 2011). Scientists are projecting possible impacts and responses of ecological systems...

  16. 77 FR 71354 - Adjustment of Monetary Threshold for Reporting Rail Equipment Accidents/Incidents for Calendar...

    Science.gov (United States)

    2012-11-30

    ... 2011. DATES: This regulation is effective January 1, 2013. FOR FURTHER INFORMATION CONTACT: Kebo Chen... of 1995 Pursuant to Section 201 of the Unfunded Mandates Reform Act of 1995 (Pub. L. 104-4, 2 U.S.C...

  17. T'ai Chi

    Science.gov (United States)

    ... are different styles of t'ai chi, including: Chen style Hao (or Wu Shi) style Hu Lei ... medical advice, diagnoses, and treatment, consult your doctor. © 1995- The Nemours Foundation. All rights reserved. Images provided ...

  18. LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities

    Energy Technology Data Exchange (ETDEWEB)

    Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2013-12-31

    This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.

  19. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    related traits between Brassica napus and Oryza sativa. Fupeng Li, Chaozhi Ma, Qingfang Chen, Touming Liu, Jinxiong Shen, Jinxing Tu, Yongzhong Xing and Tingdong Fu. J. Genet. 91, 163–170. Length of. Position of. Position of. Expect.

  20. Treatment responses in adult depressive patients treated with ...

    African Journals Online (AJOL)

    with dexamethasone/corticotrophin-releasing hormone. Lina Zhang1*, Yanbo Chen2, ... Keywords: stress, depressive patients, hormonal response, hormonal dysregulation, sertraline, ..... interactions in depression: will cause inform cure. Mol.