Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
African Journals Online (AJOL)
Mendie, Patrick Johnson. Vol 15, No 2 (2015) - Articles An examination of the nexus between Thomas Hobbes‟ concept of human nature and theory of the state. Abstract. ISSN: 1119-443X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
Interview with Patrick Blackburn
DEFF Research Database (Denmark)
Hendricks, Vincent F.; Hansen, Pelle Guldborg
2005-01-01
In 2005 Patrick Blackburn, who is Directeur de Recherche for INRIA Lorraine (France's national organization for research in computer science), published together with Johan Bos (Università di Roma "La Sapienza") the book Representation and Inference for Natural Language: A First Course in Computa...
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Patrick Janot receives the CNRS silver medal
2005-01-01
Patrick Janot during the award ceremony. (Photo Schwemling, Paris) On 25 November, Patrick Janot of the CERN Physics Department received the CNRS silver medal for IN2P3 (Institut national de physique nucléaire et de physique des particules). This prize, one of the most prestigious awarded by the French research centre, is given to scientists for the 'originality, quality and importance of their work, as recognised both nationally and internationally'. Patrick Janot joined the ALEPH collaboration, one of the four experiments at LEP, then under construction, in 1987. First a CERN Fellow, he went on to work for the CNRS at LAL in 1989. Together with his team, he developed innovative algorithms for the reconstruction of events. This work and others earned him the bronze CNRS medal in 1993, which is awarded to scientists for their first achievements. In 1997, he became a permanent physicist at CERN, where he continued to work for ALEPH. He was appointed LEP scientific co-ordinator for the last two years of the ac...
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Patrick Blanc'i rippuvad aiad / Urmas Grišakov
Grišakov, Urmas, 1942-2013
2010-01-01
Prantsuse botaaniku ja aiakujundaja Patrick Blanc'i taeva poole kõrguvad rohelised seinad võimaldavad tänapäeval imetleda inimese loovuse ja teadmiste koostöös sündinut. Kujundaja on oma töödega tõestanud, et taimed võivad edukalt kasvada ka vertikaalselt üksteise kohal. Patrick Blanc'i kodulehekülg: www.verticalgardenpatrickblanc.com
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
Introduction: Patrick Modiano's Dora Bruder
Directory of Open Access Journals (Sweden)
Richard J. Golsan
2007-06-01
Full Text Available After establishing a reputation as a literary enfant terrible in the late 1960s and early 1970s, Patrick Modiano is now firmly ensconced as a Grand Old Man (perhaps the Grand Old Man of French letters and arguably as France's greatest living novelist…
2014-01-01
Patrick arrived at CERN in January 1994 on a temporary contract in the Finance Department (previously FI), where he worked on the packaging of items for the Meyrin self-service stores (located at the time in Building 113) so that goods could be identified using barcodes, just like in a supermarket. His hard work and initiative were recognised by CERN’s service provider, ISS, who gave him a permanent contract. Following the closure of the self-service stores, Patrick joined the Recuperation and Sales Service, still within the FI Department, where he worked on dismantling many different installations and the disposal of various goods. Here too he impressed his supervisors and departmental managers and became a team leader and, soon after, deputy to the Head of the Sales Service. Patrick’s sociable nature led him to become a member of the CERN Pétanque Club, where he put his talents as a chef to good use by supplying and organising the post-competition meals. ...
Patrick Couvreur: inspiring pharmaceutical innovation.
Stanwix, Hannah
2014-05-01
Patrick Couvreur speaks to Hannah Stanwix, Managing Comissioning Editor: Professor Patrick Couvreur received his pharmacy degree from the Université Catholique de Louvain (Louvain-la-Neuve, Belgium) in 1972. He holds a PhD in pharmaceutical technology from the same university and completed a postdoctoral fellowship at the Eidgenössische Technische Hochschule (Zürich, Switzerland). Since 1984, Professor Couvreur has been Full Professor of Pharmacy at the Paris-Sud University (Paris, France) and was holder of the Chair of Innovation Technologique at the prestigious Collège de France (Paris, France). He has published more than 450 peer-reviewed articles and has an H-index of 73, with over 19,000 citations. Professor Coureur has been recognized by numerous national and international awards, including the 2004 Pharmaceutical Sciences World Congress Award, the prestigious Host Madsen Medal, the Prix Galien, the European Pharmaceutical Scientist Award 2011 from the European Federation of Pharmaceutical Sciences, the Médaille de l'Innovation from the Centre National de la Recherche Scientifique, and recently the European Inventor Award 2013 from the European Patent Office.
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Eetikata edu ei saavuta / Patrick Dixon
Dixon, Patrick
2003-01-01
Ettevõte on edu saavutanud siis, kui ta on võitnud nii selle töötajate ja juhtide kui avalikkuse usalduse, leiab autor. Lisa: Usalduse loomine vajab igapäevast järjekindlat tööd ; Kes on kes: Patrick Dixon
Career Development and Social Inclusion at St Patrick's College: A Case Study
Hughes, Cathy
2010-01-01
Consistent with the Commonwealth government's social inclusion agenda, the mission statement of St Patrick's College advocates the development and delivery of career development services and programs that promote social justice and social inclusion. This case study describes the evolving career development program at St Patrick's College, which…
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
Urban lessons for the modern planner : Patrick Abercrombie and the study of urban development
Dehaene, M.B.M.
2004-01-01
As the first editor of the Town Planning Review, Patrick Abercrombie produced a significant number of contributions to early town planning literature. Through the discussion of a great variety of subjects, Abercrombie gradually defined a specific approach towards town planning. Echoing Patrick
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
Profile Interview: Dr. Patrick Dongosolo Kamalo – Consultant ...
African Journals Online (AJOL)
Dr. Yohane Gadama (YG), an MMJ intern, interviews Dr. Patrick Dongosolo Kamalo (PDK) on his work as Malawi's only local practicing neurosurgeon, the launch of Blantyre Institute of Neurological Sciences (BINS) and the beginning of Neurosurgery training in Malawi ...
Patrick Moore the autobiography
Moore, Patrick
2011-01-01
Throughout his distinguished career, Patrick Moore has, without a doubt, done more to raise the profile of astronomy among the British public than any other figure in the scientific world. As the presenter of The Sky at Night on BBC television for nearly 50 years he was honored with an OBE in 1968 and a CBE in 1988. In 2001 he was knighted 'for services to the popularisation of science and to broadcasting'. The BBC first aired The Sky at Night in April 1957 and it is now in the record books as the world's longest running TV series with the same presenter. He is also the author of over 60
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
An interview with Patrick Tam by Kathryn Senior.
Tam, Patrick
2010-12-01
Patrick Tam's research is focused on the cellular and molecular mechanisms of body patterning during mouse development. He agreed to be interviewed by Development to talk about his interest in mouse development, new concepts in gastrulation, X-linked diseases and his dream of an African safari.
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Response to Patrick Love's "Informal Theory": A Rejoinder
Evans, Nancy J.; Guido, Florence M.
2012-01-01
This rejoinder to Patrick Love's article, "Informal Theory: The Ignored Link in Theory-to-Practice," which appears earlier in this issue of the "Journal of College Student Development", was written at the invitation of the Editor. In the critique, we point out the weaknesses of many of Love's arguments and propositions. We provide an alternative…
Patrick Pearse: Psychobiographical Reflections on an Enigmatic, Paradoxical Personality
Directory of Open Access Journals (Sweden)
Orr, Patricia Meredith
2016-06-01
Full Text Available To date historians have focused almost exclusively on Patrick Pearse’s key role in the 1916 Easter Rising to the extent that there is much less information about his personality development and characteristics. They have portrayed the elusive, paradoxical Patrick as nationalist, revolutionary and martyr or as a flawed and failed human being. Moran, agreeing with comments made at an earlier time by F.S.L. Lyons, suggests that, to have any real understanding of Patrick’s role in the rebellion and the events that led up to it, historians need to focus more attention on understanding the man himself.[1] The approach used in this article is psychobiographical, a methodology that applies psychological theory to biographical information in order to more fully understand an individual’s personality and achievements. In the case of Patrick Pearse the biographical information focuses on consensual aspects of his family background, his life experiences, his role as educator and his emergence as leader and hero. With regard to psychological theory, there are many empirically supported perspectives than could have been applied in this psychobiography. However, for the purposes of this particular article three perspectives have been selected. Drawing on some main tenets of the psychoanalytic, humanistic and trait approaches, the authors hope to provide a broader understanding of the influences and experiences that may have shaped Pearse as son, sibling, peer, educator and ultimately as a main instigator of the 1916 Rising and one of Ireland’s most famous patriots.
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
Directory of Open Access Journals (Sweden)
Damian Paweł Masłowski
2015-12-01
Full Text Available Over centuries, the subject of robinsonade does not seem to be a thoroughly investigated field in literary criticism. In this context, the role of Defoe’s work is still considered as the fundamental hypotext for every future robinsonade. Nevertheless, the twentieth century brings writers such as Michel Tournier, Patrick Chamoiseau or Yann Martel who began to transvalorize their robinsonades. This postmodern and sometimes postcolonial approach questions the topicality of modern and colonial masterpiece. In his recent novel, Patrick Chamoiseau explores the literary myth of Robinson Crusoe. He indicates the equiponderant influence of Daniel Defoe’s Robinson Crusoe and Michel Tournier’s Friday, or, the Other Island. The purpose of this paper is to analyze said hypertextuality in Crusoe’s footprint. It attempts to focus notably on the dialogue between Chamoiseau and Tournier and to see Michel Tournier’s impact not only as the primordial hypotext in case of Crusoe’s footprint but also as the basic reference for robinsonades reversing the ideological message of Daniel Defoe’s text in the XXth and XXIth centuries.
Patrick Air Force Base integrated resource assessment. Volume 2, Baseline detail
Energy Technology Data Exchange (ETDEWEB)
Wahlstrom, R.R.; King, D.A.; Parker, S.A.; Sandusky, W.F.
1993-08-01
The US Air Force has tasked the Pacific Northwest Laboratory (PNL), in support of the US Department of Energy (DOE) Federal Energy Management Program (FEMP), to assess energy use at Patrick Air Force Base (AFB). The information obtained from this assessment will be used in identifying energy resource opportunities to reduce overall energy consumption on the base. The primary focus of this report is to assess the current baseline energy consumption at Patrick AFB. It is a comparison report to Volume 1, the Executive Summary, and Volume 3, the Resource Assessment. This assessment requires that information be obtained and characterized for buildings, utilities, energy sources, energy uses, and load profile information to be used to improve the characterization of energy use on the base. The characteristics of electricity, natural gas, and No. 2 fuel oil are analyzed for on-base facilities and housing. The assessment examines basic regional information used to determine energy-use intensity (EUI) values for Patrick AFB facilities by building, fuel type, and energy end use. It also provides a summary of electricity consumption from Florida Power and Light Company (FPL) metered data for 1985-1991. Load profile information obtained from FPL data is presented for the north and south substations for the four seasons of the year, including weekdays and weekends.
Patrick filmib teismelise tüdruku fantaasiaid / Janno Zõbin
Zõbin, Janno
2003-01-01
Eestis viibib 3 briti režissööri, kes osalevad lühimängufilmide koostööprojektis "The Tyne Tallinn Digital Film Challenge-2003". Lähemalt režissöör Patrick Collertonist ja tema lühimängufilmist "Armuvalu" ("Lovesick")
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Fuchs, Thomas; Burgdorf, Jeffrey
2008-01-01
We report an attempted replication of G. T. W. Patrick and J. A. Gilbert's pioneering sleep deprivation experiment "Studies from the psychological laboratory of the University of Iowa. On the effects of loss of sleep", conducted in 1895/96. Patrick and Gilbert's study was the first sleep deprivation experiment of its kind, performed by some of the…
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
La voz inconformista de Patrick Kavanagh
Directory of Open Access Journals (Sweden)
Maximiliano Brina
2015-03-01
Full Text Available Patrick Kavanagh, rural and self-taught poet, stands out among the Irish poets of the early twentieth century for his critical consideration of literary and political nationalist programs. Facing the quasi mythical representation of the peasantry built by the Irish Literary Revival, which was later used by the Republicans as a synthesis of Irishness, Kavanagh offers a unique opinion, ranging between despair and satire. The purpose of this article is to examine, from “The Great Hunger” (1942 and previous poems, the way Kavanagh disassembles this urban vision of the Irish peasantry.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Fuchs, Thomas; Burgdorf, Jeffrey
2008-05-01
We report an attempted replication of G. T. W. Patrick and J. A. Gilbert’s pioneering sleep deprivation experiment ‘Studies from the psychological laboratory of the University of Iowa. On the effects of loss of sleep’, conducted in 1895/96. Patrick and Gilbert’s study was the first sleep deprivation experiment of its kind, performed by some of the first formally trained psychologists. We attempted to recreate the original experience in two subjects, using similar apparatus and methodology, and drawing direct comparisons to the original study whenever possible. We argue for a strong influence of an ‘Americanized’ Wundtian psychology on Patrick and Gilbert, a claim supported biographically by their education and by their experimental methods. The replication thus opens interesting new perspectives, which are unlikely to be generated by any other historical approach.
'American Psycho': a double portrait of serial yuppie Patrick Bateman
Kooijman, J.; Laine, T.
2003-01-01
Kooijman and Laine analyze Mary Harron's "American Psycho," a 2000 film adaptation of the 1980s satirical novel by Bret Easton Ellis in which Patrick Bateman, a narcissistic Wall Street young urban professional ("yuppie"), assumes an alternate identity as a serial killer. The authors examine the
Patrick Moore’s observer’s year 366 nights of the universe : 2015-2020
2015-01-01
Observers no longer need to wonder what they will turn their attention to each night of the year with this updated text of a beloved favorite from Sir Partick Moore. His night-by-night account of the stars is the best possible guide an observer could ask for, and now includes the latest data for the years 2015-2020, preserving and extending Sir Patrick Moore's legacy. This new edition of his classic text makes it easy to see why Sir Patrick Moore was such a helpful guide to generations of budding astronomers, professional and amateur alike. For every night of the year Patrick gives the reader details of interesting objects that can be seen from Earth. It is a book for people with a wide interest in practical astronomy, those who may not have specialized in a specific area of astronomy and wish to expand their knowledge in all areas. This third edition includes Sir Patrick’s original text but revises its time-sensitive material and adds all of the points of interest that change from year to year, such as e...
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
Ühendriigid otsivad NATOs taas liitlast / Jamie Patrick Shea ; interv. Kadri Liik
Shea, Jamie Patrick
2004-01-01
NATO asepeasekretäri asetäitja räägib alliansi kaitseplaneerimisest, rahukaitsest, arengust, tegevusest Afganistanis, rollist Iraagis, võitlusest terrorismiga, koostööst USA-ga. Lisa: Jamie Patrick Shea
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
DEFF Research Database (Denmark)
Kaarsholm, Preben
2012-01-01
Review article discussing Patrick Chabal, Africa: The Politics of Suffering and Smiling (London: Zed Books, 2009) and Pierre Englebert, Africa: Unity, Sovereignty and Sorrow (Bodulder, CO: Lynne Rienner, 2009).......Review article discussing Patrick Chabal, Africa: The Politics of Suffering and Smiling (London: Zed Books, 2009) and Pierre Englebert, Africa: Unity, Sovereignty and Sorrow (Bodulder, CO: Lynne Rienner, 2009)....
Turner : ettevõtjaks ei sünnita / Patrick Turner ; interv. Erik Aru
Turner, Patrick
2007-01-01
Intervjuu rahvusvahelise ärikooli INSEAD õppejõu Patrick Turneriga, kes vastab küsimustele, mis puudutavad ettevõtlust. Ta leiab, et nii nagu inimene peab omama luba auto juhtimiseks, peaks luba olema ka firma loomiseks. Vt. samas: Kes ta on?
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
Viveret Patrick, 2005, Pourquoi ça ne va pas plus mal?, Fayard, 264 p.
Directory of Open Access Journals (Sweden)
Fabien Thurette
2008-05-01
Full Text Available Patrick Viveret est philosophe de formation et Conseiller-maître à la Cour des comptes. Il a, en outre, été chargé d’une mission, confiée par l'éphémère Secrétaire d'État à l'économie solidaire Guy Hascoët, puis prolongée par le Président Chirac sur une « autre approche de la richesse », dont le rapport final a été publié sous le titre Reconsidérer la richesse (2004.Dans son essai Pourquoi ça ne va pas plus mal ? publié en 2005, Patrick Viveret nous livre une analyse philosophique sur le « m...
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
The impacts of the St. Patrick's Day superstorm on selected technologies
Carter, B. A.; Yizengaw, E.; Lin, C. S.; Pradipta, R.; Norman, R.; Tseng, T.; Bennett, J.; Bishop, R. L.; Weygand, J. M.; Francis, M.; Terkildsen, M. B.; Groves, K. M.; Caton, R. G.; Tripathi, N.; Zhang, K.
2015-12-01
In the past, significant research efforts have been directed towards understanding how severe geomagnetic storms affect the near-Earth space environment. From this research, we have learned that many technologies are affected by these severe space weather events. The 2015 St. Patrick's Day geomagnetic storm has provided a great opportunity to analyze three selected space weather phenomena that adversely impact modern technologies; (1) Geomagnetically Induced Currents (GICs), (2) increased thermospheric mass density, and (3) the occurrence of Equatorial Plasma Bubbles (EPBs). The serious effects of GICs on power grids in the high-latitude regions is well known. Recent research has indicated that the equatorial region is also susceptible to increased GIC activity due to the equatorial electrojet. Thus, an examination of the equatorial magnetometer data during the St. Patrick's Day storm will be presented. It is also well understood that during geomagnetic storms, the thermospheric mass density at a given altitude increases due to the increase in Joule heating in the high-latitude regions. As a consequence of this, low-Earth orbiting satellites and space debris experience increased atmospheric drag. Changes in atmospheric drag causes orbits to be perturbed, resulting in less accurate orbit predictions. An investigation of the orbits of several low-Earth orbiting satellites will be presented and discussed in the context of collision avoidance, as part of the ongoing space debris problem. Finally, Equatorial Plasma Bubbles (EPBs) are a common phenomenon in the nighttime low-latitude ionosphere. EPBs are known to cause random fluctuations (i.e., scintillations) in the amplitude and phase of trans-ionospheric radio signals. While EPBs have been reported during both geomagnetically quiet and disturbed periods, research clearly indicates that the occurrence of EPBs is dependent on the geomagnetic activity level. The occurrence of EPBs around the world will be presented
Energy Technology Data Exchange (ETDEWEB)
Jackson, S.
1993-03-01
The NIPER Reservoir Assessment and Characterization Research Program incorporates elements of the near-term, mid-term and long-term objectives of the National Energy Strategy-Advanced Oil Recovery Program. The interdisciplinary NIPER team focuses on barrier island reservoirs, a high priority class of reservoirs, that contains large amounts of remaining oil in place located in mature fields with a high number of shut-in and abandoned wells. The project objectives are to: (1) identify heterogeneities that influence the movement and trapping of reservoir fluids in two examples of shoreline barrier reservoirs (Patrick Draw Field, WY and Bell Creek Field, MT); (2) develop geological and engineering reservoir characterization methods to quantify reservoir architecture and predict mobile oil saturation distribution for application of targeted infill drilling and enhanced oil recovery (EOR) processes; and (3) summarize reservoir and production characteristics of shoreline barrier reservoirs to determine similarities and differences. The major findings of the research include: (1) hydrogeochemical analytical techniques were demonstrated to be an inexpensive reservoir characterization tool that provides information on reservoir architecture and compartmentalization; (2) the formation water salinity in Patrick Draw Field varies widely across the field and can result in a 5 to 12% error in saturation values calculated from wireline logs if the salinity variations and corresponding resistivity values are not accounted for; and (3) an analysis of the enhanced oil recovery (EOR) potential of Patrick Draw Field indicates that CO[sub 2] flooding in the Monell Unit and horizontal drilling in the Arch Unit are potential methods to recover additional oil from the field.
Energy Technology Data Exchange (ETDEWEB)
Jackson, S.
1993-03-01
The NIPER Reservoir Assessment and Characterization Research Program incorporates elements of the near-term, mid-term and long-term objectives of the National Energy Strategy-Advanced Oil Recovery Program. The interdisciplinary NIPER team focuses on barrier island reservoirs, a high priority class of reservoirs, that contains large amounts of remaining oil in place located in mature fields with a high number of shut-in and abandoned wells. The project objectives are to: (1) identify heterogeneities that influence the movement and trapping of reservoir fluids in two examples of shoreline barrier reservoirs (Patrick Draw Field, WY and Bell Creek Field, MT); (2) develop geological and engineering reservoir characterization methods to quantify reservoir architecture and predict mobile oil saturation distribution for application of targeted infill drilling and enhanced oil recovery (EOR) processes; and (3) summarize reservoir and production characteristics of shoreline barrier reservoirs to determine similarities and differences. The major findings of the research include: (1) hydrogeochemical analytical techniques were demonstrated to be an inexpensive reservoir characterization tool that provides information on reservoir architecture and compartmentalization; (2) the formation water salinity in Patrick Draw Field varies widely across the field and can result in a 5 to 12% error in saturation values calculated from wireline logs if the salinity variations and corresponding resistivity values are not accounted for; and (3) an analysis of the enhanced oil recovery (EOR) potential of Patrick Draw Field indicates that CO{sub 2} flooding in the Monell Unit and horizontal drilling in the Arch Unit are potential methods to recover additional oil from the field.
Directory of Open Access Journals (Sweden)
Janet Floyd
2009-11-01
Full Text Available A review of 'Transatlantic Print Culture, 1880-1940: Emerging Media, Emerging Modernisms', edited by Ann Ardis and Patrick Collier (London: Palgrave Macmillan, 2008. Hardback, 259 pages, £50, ISBN 9780554269.
National Research Council Canada - National Science Library
1995-01-01
This initial remedial action plan presents the scope for an expanded bioventing system for in situ treatment of fuel-contaminated soils at the BX Service Station at Patrick Air Force Base (AFB), Florida...
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
1787 and 1776: Patrick Henry, James Madison, and the Revolutionary Legitimacy of the Constitution.
Banning, Lance
1988-01-01
Discusses Patrick Henry's and James Madison's opinions on how the U.S. Constitution should be constructed. Describes how Henry introduced a set of substantive objections which were shared by Antifederalists throughout the country and persuaded many Revolutionaries that the Constitution was essentially at odds with the principles of 1776. (BSR)
Patrick Air Force Base integrated resource assessment. Volume 3, Resource assessment
Energy Technology Data Exchange (ETDEWEB)
Sandusky, W.F.; Parker, S.A.; King, D.A.; Wahlstrom, R.R.; Elliott, D.B.; Shankle, S.A.
1993-12-01
The US Air Force has tasked the Pacific Northwest Laboratory (PNL) in support of the US Department of Energy Federal Energy Management Program to identify, evaluate, and assist in acquiring all cost effective energy projects at Patrick Air Force Base (AFB). This is part of a model program that PNL is designing to support energy-use decisions in the federal sector. This report provides the results of the fossil fuel and electric energy resource opportunity (ERO) assessments performed by PNL at Patrick AFB which is located south of Cocoa Beach, Florida. It is a companion report to Volume 1, Executive Summary, and Volume.2, Baseline Detail. The results of the analyses of EROs are presented in 11 common energy end-use categories. A narrative description of each ERO is provided, including information on the installed cost, energy and dollar savings, impacts on operations and maintenance, and, when applicable, a discussion of energy supply and demand, energy security, and environmental issues. A description of the evaluation methodologies and technical and cost assumptions is also provided for each ERO. Summary tables present the cost-effectiveness of energy end-use equipment before and after the implementation of each ERO and present the results of the life-cycle cost analysis indicating the net present value and value index of each ERO.
Book Review: Critical Condition: Replacing Critical Thinking with Creativity by Patrick Finn
Matthews, Jodie
2016-01-01
In Critical Condition: Replacing Critical Thinking with Creativity, Patrick Finn expands upon his 2011 TEDx Talk, ‘Loving Communication’, to suggest that critical thinking implies disapproval and unnecessary judgement originating from a particular mode of Classical thought. Jodie Matthews argues that Finn’s discussion is dependent upon a crudely drawn straw man and neglects to consider thinking critically as a necessary corollary, rather than antithesis, to thinking creatively.
33 CFR 334.560 - Banana River at Patrick Air Force Base, Fla.; restricted area.
2010-07-01
... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Banana River at Patrick Air Force Base, Fla.; restricted area. 334.560 Section 334.560 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE DANGER ZONE AND RESTRICTED AREA REGULATIONS § 334.560 Banana...
Patrick Hamilton’s Hangover Square and the Landscapes of Fascism
Directory of Open Access Journals (Sweden)
Simon GOULDING
2006-10-01
Full Text Available If Patrick Hamilton’s name is recognised at all these days, then it is for his stage thrillers Rope (1929 and Gaslight (1938. Still played in repertory, these may be his best-known works but are hardly typical of his output. Hamilton had been a published writer since his early twenties and Hangover Square (1941 was his eighth novel. Like the preceding novels, it covers much of the same thematic and topographic territory. It is a world of boarding houses in unfashionable parts of London, pu...
Bell, Adam Patrick
2017-01-01
What does it mean to experience disability in music? Based on interviews with Patrick Anderson--arguably the greatest wheelchair basketball player of all time--this article presents insights into the complexities of the experience of disability in sports and music. Contrasted with music education's tendency to adhere to a medicalized model of…
Patrick Saurin, Teocuicatl. Chants sacrés des anciens Mexicains
Gruzinski, Serge
2007-01-01
Patrick Saurin s’est penché sur l’un des nombreux manuscrits laissés par le franciscain Bernardino de Sahagùn : les teocuicatl, ces hymnes sacrés composés en l’honneur des anciens dieux mexicains. Vraisemblablement d’origine mexica, ces chants ont été rassemblés à Tepepulco vers 1560. S’agit- il de textes archaïques comme la critique s’est accordée à le penser ? L’auteur propose d’y voir, au moins pour partie d’entre eux, des hymnes portant la « marque d’une réécriture, voire d’une écriture r...
Directory of Open Access Journals (Sweden)
Claudia Bouliane
2009-04-01
Full Text Available Au cours des dernières années, plusieurs romanciers français ont tenté de dépeindre les habitus et les formes de socialisation des jeunes des banlieues. La présente étude porte sur les représentations de l’espace périurbain dans le roman Moi non de Patrick Goujon, œuvre exemplaire de la volonté de donner une valeur symbolique à la vie de ces jeunes. Le roman se présente comme une réévaluation critique des clichés généralement accolés à la banlieue. Pourtant, Moi non propose une lecture ambiguë des alternatives de mobilité sociale offertes aux jeunes des banlieues et des formes de sociabilité qui leur sont propres ; sans les condamner à l’avance, Goujon montre qu’elles tendent à reproduire le schéma tracé par la doxa.Several French novelists have attempted in recent years to portray inner-city youths’ habits and forms of socialization. This study focuses on the representations of inner-city space in Patrick Goujon’s novel Moi non, a novel that epitomizes the desire to give symbolic value to the lives of inner-city youths. The novel presents itself as a critical reassessment of the stereotypes usually associated with inner cities. However, Moi non proposes an ambiguous reading of the forms both of social mobility offered inner-city youths and of their socialization. Without condemning them beforehand, Goujon shows they tend to reproduce the pattern traced by the doxa.
2011-12-22
of Cocoa Beach, and covers approximately 2,000 acres bounded by the Atlantic Ocean on the east and the Banana River on the west. The PAFB airfield...significance for greenhouse gas emissions, but the Federal government recognizes the need to reduce energy consumption and shift to renewable and...Historical and Architectural Documentation Reports of Patrick Air Force Base, Cocoa Beach, Florida. U.S. Army Construction Engineering Research
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
Reinhart Kößler; Arnold-Bergstraesser-Institut
2015-01-01
Review of the monograph:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press, 2013, ISBN 9783869562483, 300 pp. Besprechung der Monographie:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press...
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
International Nuclear Information System (INIS)
Hobbs, B.; Kahabka, J.
1995-01-01
This paper discusses the use of a mechanical brush cleaning technology recently used to remove biofouling from the Circulating Water (CW) System at New York Power Authority's James A. FitzPatrick Nuclear Power Plant. The FitzPatrick plant had previously used chemical molluscicide to treat zebra mussels in the CW system. Full system treatment was performed in 1992 with limited forebay/screenwell treatment in 1993. The New York Power Authority (NYPA) decided to conduct a mechanical cleaning of the intake system in 1994. Specific project objectives included: (1) Achieve a level of surface cleaniness greater than 98%; (2) Remove 100% of debris, both existing sediment and debris generated as a result of cleaning; (3) Inspect all surfaces and components, identifying any problem areas; (4) Complete the task in a time frame within the 1994-95 refueling outage schedule window, and; (5) Determine if underwater mechanical cleaning is a cost-effective zebra mussel control method suitable for future application at FitzPatrick. A pre-cleaning inspection, including underwater video photography, was conducted of each area. Cleaning was accomplished using diver-controlled, multi-brush equipment included the electro-hydraulic powered Submersible Cleaning and Maintenance Platform (SCAMP), and several designs of hand-held machines. The brushes swept all zebra mussels off surfaces, restoring concrete and metal substrates to their original condition. Sensitive areas including pump housings, standpipes, sensor piping and chlorine injection tubing, were cleaned without degradation. Submersible vortex vacuum pumps were used to remove debris from the cavity. More than 46,000 ft 2 of surface area was cleaned and over 460 cubic yards of dewatered debris were removed. As each area was completed, a post-clean inspection with photos and video was performed
It came from outer space wearing an RAF blazer! a fan's biography of Sir Patrick Moore
Mobberley, Martin
2013-01-01
To British television viewers, the name ‘Patrick Moore’ has been synonymous with Astronomy and Space Travel since he first appeared on The Sky at Night in 1957. To amateur astronomers he has been a source of inspiration, joy, humour and even an eccentric role model since that time. Most people know that his 55 years of presenting The Sky at Night is a world record, but what was he really like in person? What did he do away from the TV cameras, in his observatory, and within the British Astronomical Association, the organisation that inspired him as a youngster? Also, precisely what did he do during the War Years, a subject that has always been shrouded in mystery? Martin Mobberley, a friend of Patrick Moore’s for 30 years, and a former President of the British Astronomical Association, has spent ten years exhaustively researching Patrick’s real life away from the TV cameras. His childhood, RAF service, tireless voluntary work for astronomy and charity and his endless book writing are all examined in...
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Directory of Open Access Journals (Sweden)
Barnes Sequoia
2017-12-01
Full Text Available I have written this article in order to establish Patrick Kelly as a black forbearer of fashion. Kelly complicates our sense of fashion through his use of black memorabilia and camp to not only create something consumable but to comment on the black body as a consumable. Therefore, the role I play in acknowledging this black supernova, as Eric Darnell Pritchard calls him, is by critiquing Lewis and Fraley’s critique of Patrick Kelly and questioning why overtly expressing one’s queerness through camp has not been seen as a viable form of black expression in the mainstream narrative of black creativity. Lewis and Fraley’s complete dismissal of Kelly’s use of camp does not happen in a vacuum. Yet, I must remember that there is also the task of establishing a legacy of technique for Patrick Kelly. Who are his forbearers?
Sutherland, Douglas
2009-01-01
This paper examines the educational projects of Patrick Geddes in late-Victorian Scotland. Initially a natural scientist, Geddes drew on an eclectic mix of social theory to develop his own ideas on social evolution. For him education was a vital agent of social change which, he believed, had the potential to develop active citizens whose…
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Ténèbres khmères: les revenants de Phnom Penh : à propos de Kampuchéa de Patrick Deville
van Montfrans, M.; Freyermuth, S.; Bonnot, J.-F.P.
2014-01-01
Remonter le Mékong comme Patrick Deville dans les traces de Henri Mouhot, paisible explorateur du XIXe siècle, naturaliste chasseur de papillons, semble une entreprise plus idyllique que de parcourir le monde contemporain comme l’a fait Jean Rolin pour une enquête sur les chiens errants. Ma
Di Piazza, Anne
2007-01-01
Hawaiki, la patrie des ancêtres chantée par les Polynésiens, le lieu de rassemblement des âmes des morts, est aussi la terre mythique des archéologues. C’est bien celle-ci que ces derniers s’efforcent de localiser dans le temps et dans l’espace. Si l’on en croit Patrick Vinton Kirch et Roger Green, la culture ancestrale polynésienne s’est développée dans les archipels de Tonga et Samoa (avec leurs voisins immédiats) au cours du Ier millénaire avant J.-C. Les auteurs ne s’arrêtent pas à ce con...
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
Imagery interchange in John Patrick Shanley’s Doubt, a parable
Directory of Open Access Journals (Sweden)
Sandra Sirangelo Maggio
2013-06-01
Full Text Available John Patrick Shanley’s play Doubt - a Parable (2004 revisits the world he knew as a child, which is the Bronx of the 1960’s. The story centers upon a Catholic Irish-Italian school community, and the plot relates to a doubt - that grows into belief, and ends up as certainty - on the part of Sister Aloysius, the principal of the school, who is persuaded that Father Flynn, the vicar, has been harassing the only Black student in the school. The play is an open-ended construct, allowing each reader/spectator to build their own interpretation of the facts implied. Shanley is more than the author of the play. He has also worked as the producer of the play on the stage and he turned the story into a movie screenplay, Doubt, and has worked as a director to the movie. In this paper we examine the strategies used by Shanley to keep the possibility of interpretation open as he translates his own work into different media, on the page and on the screen.
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
The practice of Spencerian science: Patrick Geddes's Biosocial Program, 1876-1889.
Renwick, Chris
2009-03-01
From the Victorian era to our own, critics of Herbert Spencer have portrayed his science-based philosophical system as irrelevant to the concerns of practicing scientists. Yet, as a number of scholars have recently argued, an extraordinary range of reformist and experimental projects across the human and life sciences took their bearings from Spencer's work. This essay examines Spencerian science as practiced by the biologist, sociologist, and town planner Patrick Geddes (1854-1932). Through a close examination of his experimental natural history of the late 1870s and early 1880s, his wider writings on the evolutionary process in the 1880s, and his efforts later in that decade to improve the slums of Edinburgh, this essay reveals Geddes's deep, unifying, and energizing commitment to Spencer's program. Recapturing that commitment can not only help historians rethink Spencerian science as practice but also suggest ways of overcoming the dichotomy between elite ideas and practical activity that bedevils much contemporary historiography of science.
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
Reinhart Kößler
2015-01-01
Review of the monograph:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press, 2013, ISBN 9783869562483, 300 pp.
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Camille Flammarion's the planet Mars as translated by Patrick Moore
2015-01-01
Camille Flammarion (1842-1925) began his career at 16 as a human computer under the great mathematician U. J. J. Le Verrier at the Paris Observatory. He soon tired of the drudgery; he was drawn to more romantic vistas, and at 19 wrote a book on an idea that he was to make his own—the habitability of other worlds. There followed a career as France’s greatest popularizer of astronomy, with over 60 titles to his credit. An admirer granted him a chateau at Juvisy-sur-l’Orge, and he set up a first-rate observatory dedicated to the study of the planet Mars. Finally, in 1892, he published his masterpiece, La Planete Mars et ses conditions d’habitabilite, a comprehensive summary of three centuries’ worth of literature on Mars, much of it based on his own personal research into rare memoirs and archives. As a history of that era, it has never been surpassed, and remains one of a handful of indispensable books on the red planet. Sir Patrick Moore (1923-2012) needs no introduction; his record of popula...
Directory of Open Access Journals (Sweden)
Reinhart Kößler
2015-01-01
Full Text Available Review of the monograph:Joseph Patrick Ganahl, Corruption, Good Governance, and the African State: A Critical Analysis of the Political-Economic Foundations of Corruption in Sub-Saharan Africa, Potsdam: Potsdam University Press, 2013, ISBN 9783869562483, 300 pp.
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Tikkanen, T. (Tapio)
2016-01-01
Abstract This research examines the protagonist of the fantasy novel The Name of the Wind written by Patrick Rothfuss. The goal is to establish that the given protagonist is not an archetypal hero or villain character, but rather he transcends the simplistic binary definitions of hero and villain by acting on humane drives and understandable reasons, both of which can contribute towards good or evil. The paper draws upon mu...
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Directory of Open Access Journals (Sweden)
El hadji Camara
2011-12-01
Full Text Available Parler du plurilinguisme textuel dans le roman francophone, c’est poser la question du choix de la langue d’écriture chez l’écrivain francophone, mais aussi c’est évoquer à la fois les éléments constitutifs qui participent de la définition même de la littérature francophone. Par définition, un écrivain francophone c’est celui qui écrit en français peut-on dire de manière tautologique. Mais cette définition passe sous silence la dimension institutionnelle voire idéologique à l’œuvre dans la constitution de tout groupe social. Ainsi, selon Dominique Combe, les écrivains francophones forment un groupe bien distinct dans lequel des hommes et des femmes « expriment le sentiment d’appartenir, à travers la langue française, à une communauté de pensée, de culture. » (Combe, 1995 :14. Cependant, il faut reconnaître que tout texte possède sa propre identité, par ses langues et ses référents extratextuels, que ceux-ci soient ceux de l’auteur ou non. Dès lors, comment distinguer la langue de l’auteur de celle du texte ? Et dans quelles mesures les mécanismes de la mise en texte des langues concourent à la production du sens dans l’œuvre ? Alors qu’Ahmadou Kourouma se vante de faire parler ses personnages dans la langue de leur milieu social et culturel, Patrick Chamoiseau, se qualifiant lui-même de marqueur de parole, affirme retranscrire les paroles du conteur. Dès lors, à travers une approche comparative, il sera question dans cette communication d’analyser chez ces deux écrivains francophones, Ahmadou Kourouma et Patrick Chamoiseau en l’occurrence, comment cette textualisation des langues est mise en pratique dans leurs écritures.Parler du plurilinguisme textuel dans le roman francophone, c’est poser la question du choix de la langue d’écriture chez l’écrivain francophone, mais aussi c’est évoquer à la fois les éléments constitutifs qui participent de la définition même de
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Gupta, S.; Upadhayaya, A. K.; Taori, A. K.; Kotnala, R. K.
2017-12-01
The St. Patrick's Day Storm of 2015 was the first superstorm of 24th solar cycle, with Dst dipping down to -223 nT. The response of this severe (G4) storm is studied using ionosonde data at low-mid latitude Indian station, Delhi (28.6°N, 77.2°E), along with 630.0 nm night airglow observations from low latitude Indian station, Gadanki (13.5°N, 79.2°E). A peculiar occurrence of additional stratification, not observed before at this latitude, is found to be present between F1 and F2 layers before the SSC of the storm. This observed extra stratification in F layer (F1.5) is attributed to TIDs during vertically uplifted F region. Apart from this, additional stratification above F2 layer, lasting for about half an hour, was seen during this storm. A large variation in F2 layer critical parameters, showing both positive and negative phases, with electron density enhancement of 264% and depression of 65%, is observed during this storm. Contrary to the previous reports, Spread-F occurrence at Delhi do not follow anticorrelation with solar activity. The night airglow observations of 630.0 nm from Gadanki indicates towards the presence of external forcing which results in drifting of plasma in the opposite direction (westward) to that of normally seen, during this St. Patrick's Day storm of 2015. The variation in neutral composition (O/N2 taken from GUVI) is found during this storm. This result suggests O/N2 ratio to be a vital contributor, apart from the electric field and neutral wind, in determining the ionospheric response to such transient events.
Le néoconservatisme de Daniel Patrick Moynihan : le cas de la politique étrangère
Directory of Open Access Journals (Sweden)
Justin Vaïsse
2010-09-01
Full Text Available Daniel Patrick Moynihan est une figure archétypale du premier âge du néoconservatisme : jeune membre de l’ADA (American for Democratic Action dès les origines, il s’oppose aux tendances pro-communistes (ou du moins de « compagnonnage de route» de Henry Wallace en 1948, et soutient avec enthousiasme le libéralisme du « centre vital », mélange de progrès social, de keynésianisme et d’anticommunisme. Dans les années 1950, il écrit ses premiers articles dans The Reporter, encouragé par Irving ...
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
The Brain Dead Patient Is Still Sentient: A Further Reply to Patrick Lee and Germain Grisez.
Austriaco, Nicanor Pier Giorgio
2016-06-01
Patrick Lee and Germain Grisez have argued that the total brain dead patient is still dead because the integrated entity that remains is not even an animal, not only because he is not sentient but also, and more importantly, because he has lost the radical capacity for sentience. In this essay, written from within and as a contribution to the Catholic philosophical tradition, I respond to Lee and Grisez's argument by proposing that the brain dead patient is still sentient because an animal with an intact but severed spinal cord can still perceive and respond to external stimuli. The brain dead patient is an unconscious sentient organism. © The Author 2016. Published by Oxford University Press, on behalf of the Journal of Medicine and Philosophy Inc. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
Your Country is of Great Subtlety: Aspects of the Brazilian Translation of Patrick White’s Voss
Directory of Open Access Journals (Sweden)
Ian Alexander
2016-06-01
Full Text Available http://dx.doi.org/10.5007/2175-8026.2016v69n2p107 A number of the dialogues in Patrick White’s Voss (1957, especially those involving Laura Trevelyan, involve an implicit debate about what is meant by country and what it means to live in a country. Is the colony of New South Wales simply a province of the British Empire, a little piece of Britain transplanted on the other side of the world, or is it a place where British settlers will have to adapt their ways and gradually be transformed into something new? In these dialogues, each speaker makes use of words such as country, colony, property and land in order to express their vision of the place where they find themselves, frequently forcing a shift of meaning from one sentence to the next. This study examines how this debate is carried out in the novel and how it functions in Paulo Henriques Britto’s 1985 Brazilian translation.
A lesson for the future of our science my testimony on Lord Patrick M S Blackett
Zichichi, Antonio
2016-01-01
This unique volume contains a tribute to Lord Patrick M S Blackett through the testimony of Professor Antonino Zichichi, who was one of Blackett's pupils in the experiment at the Sphinx Observatory, Europe's highest lab (3580 meters a.s.l.), at Jungfraujoch. The book presents an overview of Blackett's most significant discoveries, such as the so called "vacuum polarization" effect, the first example of "virtual physics" and the "strange particles", that opened a new horizon towards the existence of the subnuclear universe. After discussing the profound implications of Blackett's pioneering contributions to Subnuclear Physics, the book also recalls his deep interest in the promotion of scientific culture. Blackett was firmly convinced that physicists must be engaged directly to let the people outside our labs know what the role of science is in the progress of our civilisation. In particular, according to Blackett and his friend Bertrand Russell, the Manhattan Project was the example of how the new frontiers o...
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
Sir Patrick Dun and the Complete School of Physic in eighteenth-century Dublin.
Mullaney, S
2015-03-01
2013 is the tercentenary of the death of Sir Patrick Dun. When Dun died in 1713, he left the proceeds of his estate to enhance medical education in Dublin by funding chairs in medicine. He showed remarkable innovation, but it took 95 years, five Acts of Parliament, two House of Commons enquiries and a House of Lords enquiry before Dun's wishes were brought to fruition and systematic clinical education was available for Dublin medical students. The passage of the final School of Physic Act in 1800 insured that a hospital would open in his name and regular clinical education was provided. The physician, Richard Steevens, who died 3 years earlier in 1710, left the proceeds of his estate to found a hospital, which opened, in his name, in 1733. The contemporary primary sources have been analysed and material from relevant secondary sources has been included where appropriate. Dublin was the beneficiary of these bequests and if circumstances had been more favourable, and the proceeds had been used more efficiently at the start of the eighteenth-century, Dublin could well have rivalled Edinburgh as the seat of medical education in the eighteenth century. In the early nineteenth century, it would fulfil that role and equal Edinburgh as one of the primary centres of medical education in Europe.
Observations and global numerical modelling of the St. Patrick's Day 2015 geomagnetic storm event
Foerster, M.; Prokhorov, B. E.; Doornbos, E.; Astafieva, E.; Zakharenkova, I.
2017-12-01
With a sudden storm commencement (SSC) at 04:45 UT on St. Patrick's day 2015 started the most severe geomagnetic storm in solar cycle 24. It appeared as a two-stage geomagnetic storm with a minimum SYM-H value of -233 nT. In the response to the storm commencement in the first activation, a short-term positive effect in the ionospheric vertical electron content (VTEC) occurred at low- and mid-latitudes on the dayside. The second phase commencing around 12:30 UT lasted longer and caused significant and complex storm-time changes around the globe with hemispherical different ionospheric storm reactions in different longitudinal ranges. Swarm-C observations of the neutral mass density variation along the orbital path as well as Langmuir probe plasma and magnetometer measurements of all three Swarm satellites and global TEC records are used for physical interpretations and modelling of the positive/negative storm scenario. These observations pose a challenge for the global numerical modelling of thermosphere-ionosphere storm processes as the storm, which occurred around spring equinox, obviously signify the existence of other impact factors than seasonal dependence for hemispheric asymmetries to occur. Numerical simulation trials using the Potsdam version of the Upper Atmosphere Model (UAM-P) are presented to explain these peculiar M-I-T storm processes.
International Nuclear Information System (INIS)
Lefter, J.
1992-01-01
James A. FitzPatrick recirculation pumps are vertical units consisting of General Electric 5,300 hp variable speed motors driving Byron Jackson Pumps. Speed range is from 400 rpm at 20% reactor power to 1,480 rpm at 100% power. Full speed pump output is 42,500 gpm at 530 ft. head. This paper describes the vibration monitoring system. The design of this vibration monitoring system took about five months and was installed during plant refueling outage between February and May 1990. The objectives of this project were as follows: (1) document and assess the mechanical condition of each RRP during plant startup normal operation and shutdown; (2) identify any areas of operation that might be harmful to the unit; (3) perform impact testing of the proximity probe brackets to determine if any bracket resonances existed in the 0 to 20 times operating speed region (0 to 20X); (4) define and recommend Acceptance Regions in the TDM system
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Obituary: Patrick L. Nolan (1952-2011)
Digel, Seth
2011-12-01
Patrick Lee Nolan died at his home in Palo Alto, California, on November 6, 2011, from complications related to a brain tumor, glioblastoma multiforme, which had been diagnosed less than five months earlier. He was born in Colusa, California, on November 18, 1952. Pat was the only child of John Henry Nolan and Carol Lee Harris Nolan. For most of his childhood they lived in Grass Valley, California, where his father was a butcher and his mother was a surgical nurse. Pat graduated from the California Institute of Technology in 1974 with a B.S. in Physics and completed a Ph.D. at the University of California at San Diego in 1982. His graduate and professional career was devoted to high-energy astronomy. His loss is being keenly felt by his friends and colleagues around the world, including the members of the Chancel Choir of the Menlo Park Presbyterian Church, of which he was a member for 25 years. At U. C. San Diego, Pat worked on construction of the Hard X-ray and Low Energy Gamma Ray Experiment for the first High Energy Astronomy Observatory mission, which was launched in 1977. His Ph.D. thesis, supervised by Prof. Laurence E. Peterson, was based on data from this instrument and addressed variability of the high-energy emission from Cygnus X-1 and other black hole binary systems in the Milky Way. After he completed his Ph.D., Pat took a National Research Council postdoctoral research position at the Naval Research Laboratory in Washington, D.C. He worked there from 1982-1984 developing spectral analysis software and studying gamma-ray bursts using the gamma-ray spectrometer on the Solar Maximum Mission satellite. A paper in Nature setting constraining limits on positron-electron annihilation radiation in the spectra of bursts marked the culmination of his efforts. Pat was hired by Prof. Robert Hofstadter at Stanford University in 1984 to work on the Energetic Gamma-Ray Experiment Telescope (EGRET). As a co-investigator for EGRET, Pat worked on its calorimeter
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
Casas Valencia, Olga
2009-01-01
The purpose of this thesis is to determine the specificities of the two Martinican writers who conceived Creoleness, Patrick Chamoiseau and Raphaël Confiant, when dealing with two topics directly related to their manifesto, i. e. In Praise of Creoleness. More particularly, I study their vision of the West Indian history, which is different from the colonial version, and the relations of the Martinican with the multifaceted Other, in order to find out where these themes converge and diverge. ...
Mobberley, Martin
2015-01-01
The result of an exhaustive study of Sir Patrick Moore’s observations of the Moon and planets for more than 60 years, this book is a fantastic companion to the extremely popular, “It Came From Outer Space Wearing an RAF Blazer!” written by the same author. Moore recorded his telescopic observations in his logbooks, which are reproduced and described here in detail, along with his sketches and notes. In this light, the author discusses the factors that caused Moore to switch from lunar observing to planetary and variable star observing. He has also included personal recollections and humorous anecdotes from Moore’s friends and acquaintances, as well as a look at his best loved books. Further chapters describe Moore’s foreign travels and correspondence with those back home. Lastly, the author has not neglected a few of Moore’s most memorable television and radio appearances, which are examined along with a close up of what it was like to visit Moore’s beloved home of Farthings in Selsey. Essen...
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Oliveira, Gilberto Carvalho de
2014-01-01
Este artigo propõe uma revisão do debate sobre pluralismo metodológico nas relações internacionais, recentemente reacendido pelo importante trabalho de Patrick Jackson (The Conduct of Inquiry in International Relations: Philosophy of Science and its Implications for the Study of World Politics). O objetivo principal do artigo é fazer uma recensão do livro, mas vai além, situando o argumento de Jackson no contexto das principais críticas que lhe foram dirigidas e no âmbito de uma discussão mai...
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
Directory of Open Access Journals (Sweden)
Vitaly Chernetsky
1998-06-01
Full Text Available Within contemporary prose, one distinct mode or paradigm that can be discerned is constituted by the texts that daringly tackle the dark, suppressed, erased parts of our history and mentality; however, they approach this task not by way of self-righteous denunciatory investigations, but by provocatively problematizing the most established everyday facts, by depriving the reader of the possibility of even conceiving any firm ground of the stable construct of an origin or a self-identification—historically and culturally. Their irreverent and playful deconstruction of the all-pervasive national cultural mythologies has mounted a powerful challenge to ideological constructs big and small. This article considers two representative examples of texts of this kind, which the author proposes to call heterotopic: Patrick Modiano's Rue des Boutiques Obscures and Mikhail Kuraev's Kapitan Dikshtein . It offers an attempt at defining this paradigm through a reading of these two novels, drawing upon Michel Foucault's usage of the term "heterotopia" for the purpose of designating the "other" cultural spaces of our civilization, as well as on Deleuze and Guattari's concept of "minor literature" and the work of several other theorists. The texts of the kind exemplified by these two novels are considered as an instance of successful partaking in the project of cognitive mapping, which has been proposed by Fredric Jameson and others as the positive political edge of postmodern culture.
Aux origines de l’aménagement régional: le schéma de la Valley Section de Patrick Geddes (1925
Directory of Open Access Journals (Sweden)
Federico Ferretti
2013-03-01
Full Text Available Au début du XXe siècle, les idées de Patrick Geddes sont à l'origine d'une des premières théories de l'aménagement régional, un champ de la connaissance où son influence est largement reconnue. Suivant une démarche paysagère, il fonde son modèle graphique de la Valley Section (coupe de vallée. C'est, à la fois, une coupe longitudinale de vallée aménagée et une métaphore de la dimension géographique du progrès économique et social que Geddes veut promouvoir. Des géographes comme Gary Dunbar et Claude Raffestin ont affirmé que l'idée de cette Valley Section s'inspire du modèle du «bassin fluvial» d'Élisée Reclus avec qui Geddes a entretenu une longue et amicale collaboration que l'on peut suivre à travers les textes de leurs archives.
Directory of Open Access Journals (Sweden)
Denise Varney
2016-09-01
Full Text Available When Patrick White was awarded the Nobel Prize for Literature in 1973, it was primarily for his novels. Less well recognised is the significance of White’s dramatic literature and his involvement in the theatre. This article offers a new analysis of White’s first notable breakthrough into theatre and drama, The Ham Funeral, which he wrote in postwar London and which was produced in Adelaide in 1961. This article argues that a modernist idiom of 20th-century Australian drama can be found in this play that laid the groundwork for a poetics of language, image and theatricality. The play’s aesthetic modernism is found primarily in the blend of expressionist and surrealist elements, the poetic language, the alienated creative subject and the representation of sexuality and the unconscious. White’s thematics also become political, concerned with power, masculinity and gendered assumptions about rationality and emotion, poetry and the body. Having lived in London during the interwar years, White was also part of the networks that included Australian-born artists, and he was exposed to influences from visual arts as well as theatre. Of these, the artist William Dobell was central to the genesis of The Ham Funeral, as was the Polish-born modernist artist S. Ostoja-Kotkowski, who was critical to the design of the brooding expressionist set that set the standard for subsequent stage realisations of the play.
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Pehrson, Samuel; Stevenson, Clifford; Muldoon, Orla T; Reicher, Steve
2014-06-01
We examine experiences of collective self-objectification (CSO) (or its failure) among participants in a 'multicultural' St Patrick's Day parade. A two-stage interview study was carried out in which 10 parade participants (five each from ethnic majority and minority groups) were interviewed before and after the event. In pre-event interviews, all participants understood the parade as an opportunity to enact social identities, but differed in the category definitions and relations they saw as relevant. Members of the white Irish majority saw the event as being primarily about representing Ireland in a positive, progressive, light, whereas members of minority groups saw it as an opportunity to have their groups' identities and belonging in Ireland recognized by others. Post-event interviews revealed that, for the former group, the event succeeded in giving expression to their relevant category definitions. The latter group, on the other hand, cited features of the event such as inauthentic costume design and a segregated structure as reasons for why the event did not provide the group recognition they sought. The accounts revealed a variety of empowering and disempowering experiences corresponding to the extent of enactment. We consider the implications in terms of CSO, the performative nature of dual identities, as well as the notion of multicultural recognition. © 2013 The British Psychological Society.
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
Huang, Cong; Xu, Ji-Yao; Zhang, Xiao-Xin; Liu, Dan-Dan; Yuan, Wei; Jiang, Guo-Ying
2018-04-01
In this work, we utilize thermospheric wind observations by the Fabry-Perot interferometers (FPI) from the Kelan (KL) station (38.7°N, 111.6°E, Magnetic Latitude: 28.9°N) and the Xinglong (XL) station (40.2°N, 117.4°E, Magnetic Latitude: 30.5°N) in central China during the St. Patrick's Day storm (from Mar. 17 to Mar. 19) of 2015 to analyze thermospheric wind disturbances and compare observations with the Horizontal Wind Model 2007 (HWM07). The results reveal that the wind measurements at KL show very similar trends to those at XL. Large enhancements are seen in both the westward and equatorward winds after the severe geomagnetic storm occurred. The westward wind speed increased to a peak value of 75 m/s and the equatorward wind enhanced to a peak value of over 100 m/s. There also exist obvious poleward disturbances in the meridional winds during Mar. 17 to Mar. 19. According to the comparison with HWM07, there exist evident wind speed and temporal differences between FPI-winds and the model outputs in this severe geomagnetic storm. The discrepancies between the observations and HWM07 imply that the empirical model should be used carefully in wind disturbance forecast during large geomagnetic storms and more investigations between measurements and numerical models are necessary in future studies.
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
Guo, J.; Deng, Y.; Zhang, D.; Lu, Y.; Sheng, C.
2017-12-01
Sub-Auroral Polarization Streams (SAPS) are incorporated into the non-hydrostatic Global Ionosphere-Thermosphere Model (GITM), revealing the complex effects on neutral dynamics and ion-neutral coupling processes. The intense westward ion stream could enhance the neutral zonal wind within the SAPS channel. Through neutral dynamics the neutrals then divide into two streams, one turns poleward and the other turns equatorward, forming a two-cell pattern in the SAPS-changed wind. The significant Joule heating induced by SAPS also leads to traveling atmospheric disturbances (TAD) accompanied by traveling ionospheric disturbances (TID), increasing the total electron content (TEC) by 2-8 TECu in the mid-latitude ionosphere. We investigate the potential causes of the reported poleward wind surge during the St. Patrick's Day storm in 2015. It is confirmed that Coriolis force on the westward zonal wind can contribute the poleward wind during post-SAPS interval. In addition, the simulations imply that the sudden decrease of heating rate within auroral oval could result in a TAD propagating equatorward, which could also be responsible for the sudden poleward wind surge. This study highlights the complicated effects of SAPS on ion-neutral coupling and neutral dynamics.
Bhaskar, A. T.; Vichare, G.
2017-12-01
Here, an attempt is made to develop a prediction model for SYMH and ASYH geomagnetic indices using Artificial Neural Network (ANN). SYMH and ASYH indices represent longitudinal symmetric and asymmetric component of the ring current. The ring current state depends on its past conditions therefore, it is necessary to consider its history for prediction. To account this effect Nonlinear Autoregressive Network with eXogenous inputs (NARX) is implemented. This network considers input history of 30 minutes and output feedback of 120 minutes. Solar wind parameters mainly velocity, density and interplanetary magnetic field are used as inputs. SYMH and ASYH indices during geomagnetic storms of 1998-2013, having minimum SYMH training two independent networks. We present the prediction of SYMH and ASYH indices during 9 geomagnetic storms of solar cycle 24 including the recent largest storm occurred on St. Patrick's day, 2015. The present prediction model reproduces the entire time profile of SYMH and ASYH indices along with small variations of 10-30 minutes to good extent within noise level, indicating significant contribution of interplanetary sources and past state of the magnetosphere. However, during the main phase of major storms, residuals (observed-modeled) are found to be large, suggesting influence of internal factors such as magnetospheric processes.
Cross-scale observations of the 2015 St. Patrick's day storm: THEMIS, Van Allen Probes, and TWINS
International Nuclear Information System (INIS)
Goldstein, J.
2016-01-01
In this paper, we present cross-scale magnetospheric observations of the 17 March 2015 (St. Patrick's Day) storm, by Time History of Events and Macroscale Interactions during Substorms (THEMIS), Van Allen Probes (Radiation Belt Storm Probes), and Two Wide-angle Imaging Neutral-atom Spectrometers (TWINS), plus upstream ACE/Wind solar wind data. THEMIS crossed the bow shock or magnetopause 22 times and observed the magnetospheric compression that initiated the storm. Empirical models reproduce these boundary locations within 0.7 R E . Van Allen Probes crossed the plasmapause 13 times; test particle simulations reproduce these encounters within 0.5 R E . Before the storm, Van Allen Probes measured quiet double-nose proton spectra in the region of corotating cold plasma. About 15 min after a 0605 UT dayside southward turning, Van Allen Probes captured the onset of inner magnetospheric convection, as a density decrease at the moving corotation-convection boundary (CCB) and a steep increase in ring current (RC) proton flux. During the first several hours of the storm, Van Allen Probes measured highly dynamic ion signatures (numerous injections and multiple spectral peaks). Sustained convection after ~1200 UT initiated a major buildup of the midnight-sector ring current (measured by RBSP A), with much weaker duskside fluxes (measured by RBSP B, THEMIS a and THEMIS d). A close conjunction of THEMIS d, RBSP A, and TWINS 1 at 1631 UT shows good three-way agreement in the shapes of two-peak spectra from the center of the partial RC. A midstorm injection, observed by Van Allen Probes and TWINS at 1740 UT, brought in fresh ions with lower average energies (leading to globally less energetic spectra in precipitating ions) but increased the total pressure. Finally, the cross-scale measurements of 17 March 2015 contain significant spatial, spectral, and temporal structure.
Salinas, A.; Toledo-Redondo, S.; Navarro, E. A.; Fornieles-Callejón, J.; Portí, J. A.
2016-12-01
The effects of solar storms occurring during the days 17 to 19 March 2013 and 2015, St. Patrick's Day intervals, on Schumann resonances (SRs) have been studied. To do this, the experimental data recorded by the Juan Antonio Morente extremely low frequency station located at Sierra Nevada, Spain, have been processed in order to obtain hourly averaged information on the first three resonance modes. Results are compared with monthly averages of the SR data for each hour to detect deviations from the regular behavior. Evidence of significant changes in the peak amplitudes and frequencies of the SRs have been identified in the station's measurements and related to the coronal mass ejection impact in the magnetosphere, detected by in situ plasma measurements onboard spacecraft in the solar wind. However, the complicated nature of the Schumann resonances, dependent on multiple variables and subject to multiple unavoidable interferences (e.g., lightning or human radio sources), in conjunction with the complex magnetosphere-ionosphere-atmosphere coupling processes, makes it difficult to conclude that the observed deviations are exclusively due to the solar events mentioned. Results extracted from only two solar events cannot be considered as conclusive, and therefore, independent comparison with results reported by other research would seem advisable in future works on this subject.
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
Directory of Open Access Journals (Sweden)
Sandra Luna
2018-06-01
Full Text Available Publicado em 1992, The Butcher Boy, celebrado romance de Patrick McCabe, logo foi adaptado para o cinema e para o teatro. Em sua forma dramática, intitulada Frank Pig Says Hello, a peça teatraliza as memórias de infância de Frank Pig, ou Piglet, um “menino-porquinho”. A despeito da dimensão trágica dos conflitos existenciais e sociais que modelam a peça de McCabe, sua dramaturgia subverte a conhecida tradição das tragédias e dos dramas sociais por meio da paródia e da ironia, substituindo o pathos trágico por humor e deboche. Fortemente marcada por traços recorrentes na arte pós-moderna, Frank Pig Says Hello apresenta-se como uma peça que, ao desconstruir as formas dramáticas tradicionais, desconstrói também, por via do riso, do sarcasmo e do grotesco, motivos e fatos associados à história da Irlanda, assim como questiona valores hegemônicos da cultura ocidental. O presente estudo analisa a parodização da ação trágica na peça, examinando as relações entre dramaticidade, violência e irreverência estética.
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Threatened and Endangered Species Survey for Patrick Air Force Base, Florida
Oddy, Donna M.; Stolen, Eric D.; Schmalzer, Paul A.; Larson, Vickie L.; Hall, Patrice; Hensley, Melissa A.
1997-01-01
A review of previous environmental work conducted at Patrick Air Force Base (PAFB) indicated that several threatened, endangered, or species of special concern occurred or had the potential to occur there. This study was implemented to collect more information on protected species at PAFB. A map of landcover types was prepared for PAFB using aerial photography, groundtruthing, and a geographic information system (GIS). Herbaceous vegetation was the most common vegetation type. The second most abundant vegetation type was disturbed shrubs/exotics. The beach and associated dune vegetation comprised 3.2% of the land area, but was the most extensive natural community within PAFB. A few isolated mangrove communities exist along the Banana River. Seventy-seven species of vascular plants occurred on the dunes, including four species listed by state agencies: spider lily (Hymenocallis latifolia), prickly pear cactus (Opuntia stricta), beach star (Remirea maritima), and inkberry (Scaevola plumien). Surveys of other habitats revealed eighty-four species of vascular plants including two state-listed species: spider lily and prickly pear cactus. Many of these areas are dominated by invasive, exotic species, particularly Brazilian pepper (Schinus terebinthifolius) and Australian pine (Casuarina equisetifolia), and native species of open or disturbed sites such as camphorweed (Heterotheca subaxillaris) and beardgrass (Andropogon spp.). Due to the isolation of PAFB from other natural areas, most exotic plant populations on the base are not an immediate threat to intact native plant communities. Dune habitat was surveyed for the southeastem beach mouse (Peromyscus polionotus niveiventris) by quarterly trapping along eight 100 m transects. No beach mice were found. The limited extent of dune habitat, its fragmented condition, and the isolation of PAFB from extant populations of the beach mouse probably accounts for its absence. Surveys of birds on PAFB found an avifauna
2009-10-01
Moana Blvd, Room 206 Honolulu, HI 96814 LOCAL PARTIES: Mayor Mufi Hannemann 530 S. King St Honolulu, HI 96813 City and County of Honolulu...Patrick January 22, 2009 15 CES/CEV, Environmental Planning Element 75 H Street Hickam AFB, HI 96853-5233 Dear Ms. Patrick: MUFl HANNEMANN , Mayor...DEPARTME NT OF PLANNING AND PERMITTING CITY AND COUNTY OF HONOLULU MUFI HANNEMANN MAYOR Ms. Tiffany Patrick 15 CES/CEVP 650 SOUTH KING STREET
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
Directory of Open Access Journals (Sweden)
Melba Cecilia Serrano G.
1988-04-01
Full Text Available RESUMEN En este artículo muestra el éxito que tuvo este autor frente a las diferentes obras que ha escrito. No obstante se destaca su obra llamado “perfume”, que lo hace muy representativo de este autor.
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
75 FR 55799 - Government-Owned Inventions; Availability for Licensing
2010-09-14
... licensing. Licensing Contact: Patrick P. McCue, PhD, (301) 435-5560; [email protected] . Collaborative... Reference No. E-051-2010/0-US-01). Licensing Status: Available for licensing. Licensing Contact: Patrick P... for the brain tumors or brain cancers indentified as gliomas, glioblastomas, or astrocytomas. This...
African Journals Online (AJOL)
HEALTH & FINANCE. Patrick Thokwa Masobe. Patrick Thokwa Masobe completed his undergraduate studies at Grinnel/. University in the USA, and a Master. Degreefrom the University of London in. 1995. He is wrrently employed by the national Department of Health, where he led the task team charged with making.
Rademakers, F
2009-01-01
Pictures 1-4: Cédric Fournier Pictures 5-7: Patrick Vallet Pictures 8-11: Franck Lamour, Patrick Vallet, Bernard Chadaj, Gérard Decreuse, Cédric Fournier and Bernard Corajod Pictures 12-15: Franck Lamour Pictures 16-18: Bernard Chadaj Pictures 19-22: Bernard Corajod and Gérard Decreuse
2010-03-11
... Power Plant Environmental Assessment and Finding of No Significant Impact The U.S. Nuclear Regulatory...), for the operation of the James A. FitzPatrick Nuclear Power Plant (JAFNPP) located in Oswego County... the Final Environmental Statement for the James A. FitzPatrick Nuclear Power Plant, Docket No. 50-333...
Journal of Astrophysics and Astronomy | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Astrophysics and Astronomy. PATRICK DAS GUPTA. Articles written in Journal of Astrophysics and Astronomy. Volume 39 Issue 1 February 2018 pp 14 Review. Collapsing supra-massive magnetars: FRBs, the repeating FRB121102 and GRBs · PATRICK DAS GUPTA NIDHI SAINI · More Details ...
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
From Diagnosis, to Life Saving Therapy, to Hollywood: The Journey of John Crowley
Apel, Laura
2010-01-01
In February of 2000, "Exceptional Parent" introduced readers to the Crowley family. The author profiled John, Aileen, and their three children: Megan, Patrick, and John Jr. They told "Exceptional Parent" that in 1998 both Megan and Patrick were diagnosed with Pompe disease, a progressive, multisystemic, debilitating, and often fatal muscular…
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
Directory of Open Access Journals (Sweden)
Bruno Amaral de Andrade
2016-07-01
Full Text Available El estudio de Patrick Geddes sobre el niño en la ciudad, que se remonta a las Exhibiciones del Bienestar del Niño, así como el interés por los estudios de los orígenes históricos y geográficos de las ciudades desde fábulas vinculadas a las condiciones simples y naturales de la relación del hombre con el medio ambiente; por ejemplo, historias de cazador, minero, leñador, pastor, agricultor y pescador. La Escuela Territorialista Italiana, de Alberto Magnaghi, revisita de manera crítica y reflexiva el abordaje participativo precursor del pensamiento geddesiano, y desarrolla el método, la técnica y herramienta para la participación de los niños como actores-protagonistas en la representación y en el proyecto del territorio. De hecho, este artículo aborda la representación de los valores por los niños en sitio histórico, originalmente ocupado por inmigrantes de origen germánico, la ciudad de Santa Leopoldina, Espirito Santo, Brasil. Esto es hecho con diseños de referencia desarrollados por estudiantes de edades comprendidas entre 11 y 15 años, desarrollados individual y colectivamente. Los dibujos producidos por diferentes estrategias recreativas y educativas, revelan una mayor relación emocional con el ambiente paisajístico que con el ambiente urbano.
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
St. Patrick's Day 2015 geomagnetic storm analysis based on Real Time Ionosphere Monitoring
García-Rigo, Alberto
2017-04-01
Ionosphere Monitoring (RTIM) is a new Working Group within the International Association of Geodesy (IAG) Sub-Commission 4.3 "Atmosphere Remote Sensing". The complementary expertise of the participating research groups allows to analyse the ionospheric behaviour from a broad perspective, taking benefit of comparing multiple independent real time and near real time ionospheric approaches. In this context, a detailed analysis will be presented for the days in March, 2015 surrounding St. Patrick's Day 2015 geomagnetic storm, based on the existing ionospheric models (global or regional) within the group, which are mainly based on Global Navigation Satellite Systems (GNSS) and ionosonde data. For this purpose, a variety of ionospheric parameters will be considered, including Total Electron Content (TEC), F2 layer critical frequency (foF2), F2 layer peak (hmF2), bottomside half-thickness (B0) and ionospheric disturbance W-index. Also, ionospheric high-frequency perturbations such as Travelling Ionospheric Disturbances (TIDs), scintillations and the impact of solar flares facing the Earth will be presented to derive a clear picture of the ionospheric dynamics. Among other sources of information to take part in the comparisons, there will be (1) scintillation results -from MONITOR ESA/ESTEC-funded project- derived by means of S4 index and Sigma Phi (IEEA), specially significant in the African sector and European high latitudes, (2) dynamics of the global maps of W-index with 1h resolution derived from JPL Global Ionospheric Maps (GIMs; IZMIRAN), (3) deviations from expected quiet-time behavior analysed in terms of foF2, hmF2, B0 and B1 based on IRTAM and GIRO network of digisondes (Lowell), showing F2 layer peculiar changes due to the storm, (4) statistics based on the median of the VTEC for the 15 previous days considering VTEC european regional maps (ROB), (5) time series of VTEC data that are derived by running the NRT ionosphere model of DGFI-TUM in offline mode, which show
The Caldwell Objects and How to Observe Them
Mobberley, Martin
2009-01-01
There have been only a handful of famous deep sky "catalogs," including Charles Messier’s, which was the first and remains the most famous. Messier was a comet hunter, and in the late 1700s he published a list of 109 objects in the sky that were not comets. In December 1995, Sky & Telescope published a list of deep sky objects sent to them by British amateur astronomer extraordinare, Sir Patrick Moore (officially, Sir Patrick Caldwell-Moore). It was a huge hit! Sir Patrick may be the most prolific authors of astronomy books for all time and has been presenting the BBC Sky at Night television series since April 1957. Moore’s list contained 109 non-Messier objects that were Patrick’s favorites, many of them visible only in the southern hemisphere. Accompanying the list of objects were long exposure black and white and color photographs of some of these objects. In this book Martin Mobberley, who has known Sir Patrick Moore for many years, describes these objects and tells how to locate them. He discus...
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
UNSC’s Expansion: Prospects for Change and Implications for the Regions and the World
2015-12-01
Security Council Reform? Lesson for and from Institutional Theory ,” in Multilateralism and Security Institutions in an Era of Globalization, eds...world politics.153 151 Voeten, Why no U.N. Security Council Reform? Lesson for and from Institutional ... Theory , 289. 152 McDonald and Patrick, Security Council Enlargement and U. S. Interests, 4. 153 McDonald and Patrick, Security Council Enlargement
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
Schuldnerfalle Suchmaschinen-Cache / Patrick Sakowski
Sakowski, Patrick
2016-01-01
Otsingumootorite vahemällu salvestatud andmete kustutamisest (nt kõlvatu konkurentsi või autoriõiguste rikkumisesga seotud kustutatud andmete kustutamine ka vahemälust, et otsingu tulemus ei viitaks kustutatud infole)
2072-IJBCS-Article-Patrick Agbassi
African Journals Online (AJOL)
hp
Effect of antiretroviral drugs on prolactin in HIV infected pregnant women ... 1Department of Prosthesis and Orthopaedic Technology, School of Health Technology, ..... Hit HIV-1 hard, but only when necessary. Lancet;. 355(9221): 2147- 2152.
St. Patrick's Hospital, Cashel, Tipperary.
LENUS (Irish Health Repository)
Breen, C
2014-02-01
The aim of dietary modification, as a cornerstone of type 2 diabetes (T2DM) management, is to optimise metabolic control and overall health. This study describes food and nutrient intake in a sample of adults with T2DM, and compares this to recommendations, and to intake in age, sex, body mass index (BMI) and social-class matched adults without T2DM.
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
Ada 9X Project Revision Request Report. Supplement 1
1990-01-01
SYNCHRONIZATION POINTS OF A TASK DATE: August 8, 1989 NAME: Patrick de Bondeli ADDRESS: CR2A, 19 Avenue Dubonnet 92411 - COURBEVOIE - CEDEX, FRANCE TELEPHONE...to the parent task. Evaluating the attributes TERMINATED or CALLABLE - Giovini and Zucca (1986) consider them as synchronization points, but we do not...Elena. An Analysis of Ada Tasking December 1986. Companion paper of the Ada Formal Definition Sponsored by the European Commission. De Bondeli , Patrick
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
2012-03-01
Attacks,” Der Speigel, July 25, 2011, http://www.spiegel.de/international/europe/0,1518,776437,00.html 114 “Profile: Anders Behring Breivik ,” BBC...144 Patrick Donovan, “Puyallup Fire & Rescue’s Response to Active School Shooting Incident,” National Fire Academy (July 2008): 24, 26, 49...Learn Them.” Homeland Security Affairs Journal II, no. 2 (July 2006): 11. Donovan, Patrick . “Puyallup Fire & Rescue’s Response to Active School
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
Epigenetic Mediation of Endocrine and Immune Response in an Animal Model of Gulf War Illness
2016-10-01
PRINCIPAL INVESTIGATOR: Patrick McGowan, PhD CONTRACTING ORGANIZATION: University of Toronto Toronto, Ontario, Canada, M5S 1A1 REPORT DATE: October 2016...Illness 5b. GRANT NUMBER W81XWH-14-1-0550 5c. PROGRAM ELEMENT NUMBER Patrick O. McGowan, PhD, Gordon Broderick, PhD, James O’Callaghan, PhD...chromatin modifications in peripheral blood and the brain (specifically hippocampus and prefrontal cortex) in order to pursue a mechanistic understanding
Staff Association
2017-01-01
Les vibrantes Patrick Robbe-Grillet Du 30 octobre au 10 novembre 2017 CERN Meyrin, Main Building Patrick Robbe-Grillet - Feux d'artifices Qui est Patrick Robbe-Grillet ? Artiste Franco-Suisse, né en 1968 à Genève. En recherche du sentiment de paix, autodidacte, après un séjour en Chine en 2000, puis au Japon en 2002, suivi d’un long questionnement, il trouve sa voie dans la peinture, élément libérateur de sa créativité et expression de sa sensibilité à fleur de peau. « La Chine m’a enseigné les courbes, les nuances. Le Japon, la ligne droite, la rigueur. » Vous avez su rendre visible l'invisible ! - commentaire de Monsieur Fawaz Gruosi Pour plus d’informations et demandes d’accès : staff.association@cern.ch | Tél : 022 766 37 38
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
Defending Norway and the Northern Flank: Analysis of NATO’s Strategic Options.
1985-12-01
22a NAME OF RESPONSIBLE INDIVIDUAL 22b TELEPHONE (Include Area Code) 22c OFFICE SYMBOL Prof. Patrick J. Parker 646-2097 56 DV C")RM 1473,s84 MAt 53...34Roy Breivik , Assuring the Security of Reinforcements to Norway," NATO s Fifteen Nations, special issue no. 2 (1982), pp. 66 67. 22...Analyses 1 2000 North Beauregard Street P.O. Box 11280 Alexandria, Virginia 22311 5. Professor Patrick J. Parker, Code 56Pr 1 4 Department of National
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
Staff members with 25 years' service at CERN in 2003
2003-01-01
The following staff members with 25 years' service in 2003 were invited by the Director-General to a reception in their honour on 20 November 2003: ALLIOD Patrick/ATGESCHONKE Gunther/AB AYMON Marcel/HRGLASER Maurice/EP BAUDET Serge/TISHUGOT Bernard/AB BENOIT-JEANNIN Brigitte/SPLJOUVE Christian/AT BERRY Peter/HRJULLIARD André/ST BIERI Catherine/STLAFAGE Patrice/ST BLANC Didier/STLAJUST Danièle/DSU BLANC Michel/ITLEGRAND Dominique/AT BOCH Guy/ITLONG Serge/EST BONZANO Roberto/STLYONNET André/EP BURCKHART Doris/EPMALOD-DOGNIN Jean-Pierre/ST BURNS Alan/ABMAURY Stephan/AC BURTIN Gérard/ABMILES John/AT CARENA Wisla/EPMONET René/EST CASTEL André/ESTMULLER André/TIS CLIFF Frank/HRPERREAL Pierre/AT CUCCURU Giovanni/ATPETERSEN Jørgen/EP DAMIANI Michel/ABPETIT Patrick/EP DELUCINGE Evelyne/ATPIERRE Patrice/AB DHOTE Patrick/SPLROUX Jacques/EP FLUCKIGER François/ITSAMYN Dirk/EP FORESTE Antonio/ESTSAVIOZ Jean Jacques/AB FRAIS...
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
グローカリィティ研究の課題 : ゲディスとウォード&デュボス
藤川, 哲
2012-01-01
“Think Globally, Act Locally” is now a very popular phrase. Wikipedia on the internet tells that the original form of it :“Think Global, Act Local” has been attributed to Scots town planner and social activist Patrick Geddes. Walter Stephen, who is the Chairman of the Sir Patrick Geddes Memorial Trust, edited an anthology Think Global, Act Local (2004) and says that Geddes coined the mantra in his Cities in Evolution (1915). But the word “global” does not appear in the book. Geddes insisted b...
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
[The Psychotic Thinking of Patrick Bateman].
Fernando, Muñoz
2012-06-01
Literature is an inexhaustible source of study regarding mental illness which allows the academic exercise, whether dynamic oriented or not, that may help to understand the patient's inner world in the psychiatric clinical practice. Freudian, Post-Freudian and analytical examination of the main character in the U.S.A. novel AMERICAN PSYCHO. Review of sources and relevant theoretical currents. Analysis highlights the official nosologic classification boundaries, for conditions where symptoms are scattered across the spectrum of personality disorders and psychosis spectrum; usefulness and applicability of psychoanalytic concepts in psychiatric practice are also pointed out, thus granting flexibility to the clinical approach in order to justify its use. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.
St Patrick's Hospital, John's Hill, Waterford.
LENUS (Irish Health Repository)
Quirke, M
2014-11-01
To characterise the Emergency Department (ED) prevalence of cellulitis, factors predicting oral antibiotic therapy and the utility of the Clinical Resource Efficiency Support Team (CREST) guideline in predicting patient management in the ED setting, a prospective, cross-sectional study of consecutive adult patients presenting to 3 Irish EDs was performed. The overall prevalence of cellulitis was 12 per 1,000 ED visits. Of 59 patients enrolled, 45.8% were discharged. Predictors of treatment with oral antibiotics were: CREST, Class 1 allocation (odds ratio (OR) 6.81, 95% Cl =1.5-30.1, p=0.012), patient self-referral (OR= 6.2, 95% Cl 1.9- 20.0, p=0.03) and symptom duration longer than 48 hours (OR 1.2, 95% Cl = 1.0-1.5,p=0.049). In conflict with guideline recommendation, 43% of patients in CREST Class 1 received IV therapy. Treatment with oral antibiotics was predicted by CREST Class 1 allocation, self-referral, symptom duration of more than 48 hours and absence of pre-EO antibiotic therapy.
724-IJBCS-Article-Aleodjrodo Patrick Edorh
African Journals Online (AJOL)
DR GATSING
Pesticides et métaux lourds dans l'eau de boisson, les sols et les sédiments de la ceinture ... 1Ministère de l'Agriculture, de l'Elevage et de la Pêche (MAEP), Bénin. 2Département de ..... biologique et du coton conventionnel. 65p. GESAMP.
GPS TEC Fluctuations in the Low and High Latitudes During the 2015 St. Patrick`s Day Storm
Chung, Jong-Kyun; Hong, Junseok; Yoo, Sung-Moon; Kim, Jeong-Han; Jee, Geonhwa; Hegai, Valery V.
2017-12-01
As a part of collaborative efforts to understand ionospheric irregularities, the Korea ionospheric scintillation sites (KISS) network has been built based on global positioning system (GPS) receivers with sampling rates higher than 1 Hz. We produce the rate of TEC index (ROTI) to represent GPS TEC fluctuations related to ionospheric irregularities. In the KISS network, two ground-based GPS sites at Kiruna (marker: KIRN; geographic: 67.9° N, 21.4° E; geomagnetic: 65.2° N) and Chuuk (marker: CHUK; geographic: 7.5° N, 151.9° E; geomagnetic: 0.4° N) were selected to evaluate the ROTI value for ionospheric irregularities during the occurrence of the 2015 St. Patrick’s Day storm. The KIRN ROTI values in the aurora region appear to be generally much higher than the CHUK ROTI values in the EIA region. The CHUK ROTI values increased to 0.5 TECU/min around UT=13:00 (LT=23:00) on March 16 in the quiet geomagnetic condition. On March 17, 2015, CHUK ROTI values more than 1.0 TECU/min were measured between UT=9:00 and 12:00 (LT=19:00 and 22:00) during the first main phase of the St. Patrick’s Day storm. This may be due to ionospheric irregularities by increased pre-reversal enhancement (PRE) after sunset during the geomagnetic storm. Post-midnight, the CHUK ROTI showed two peaks of 0.5 TECU/min and 0.3 TECU/min near UT=15:00 (LT=01:00) and UT=18:00 (LT=04:00) at the second main phase. The KIRN site showed significant peaks of ROTI around geomagnetic latitude=63.3° N and MLT=15:40 on the same day. These can be explained by enhanced ionospheric irregularities in the auroral oval at the maximum of AE index
2011-06-01
Patrick Facon, Histoire de l’Armée de l’Air, provides the context of French operations in Africa in the broadest history of the French Air Force. 3 In...during the 2000s, including its 3 Patrick Facon, Histoire de L’armée de L’air (Paris: La...34, 8. 5 Facon, Histoire de L’armée de L’air, 451. 6 Facon, Histoire de L’armée de L’air, 458. The third phase began in 1994 after the Rwanda
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
Kommunen er død - længe leve den digitale disruption
DEFF Research Database (Denmark)
Andersen, Kim Normann
2017-01-01
"New Public Management is Dead. Long Live the Digital Era." Sådan proklamerede Patrick Donleavy digitaliseringens muligheder i en banebrydende artikel fra 2005. Med en omskrivning af dette citat til "Kommunen er død, længe leve den digitale disruption", er ballet åbnet for denne artikel......."New Public Management is Dead. Long Live the Digital Era." Sådan proklamerede Patrick Donleavy digitaliseringens muligheder i en banebrydende artikel fra 2005. Med en omskrivning af dette citat til "Kommunen er død, længe leve den digitale disruption", er ballet åbnet for denne artikel....
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
Ueber Patrick Browne’s Gattungen zweifelhafter Stellung
Hallier, Hans
1918-01-01
Vornehmlich durch die Arbeiten GRISEBACH’S und URBAN’S ist die Flora Westindiens schon verhältnismässig gut bekannt. Obgleich aber ersterer die Kenntnis seiner Zeit in seiner bekannten „Flora of the British West Indian Islands” (1864) zusammenfasste und letzterer in seinen Symbolae Antillanae VI, 1
464-IJBCS-Article-Dr Patrick A Edorh
African Journals Online (AJOL)
User
2002), foam (Empain, 1976), mussels. (Bergman, 1993), carrot, cabbage (Garrec and van Haluwyn, 2002) are all good bioindicators of heavy metal pollution. These organisms, real reservoirs of toxic metals, constitute nevertheless a danger to their consumers, reason why it is important to assess the risk of toxicity faced by ...
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...
African Journal of Biotechnology - Vol 10, No 60 (2011)
African Journals Online (AJOL)
Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...
Three novel antioxidants from Cinnamomum plants | Cheng | African ...
African Journals Online (AJOL)
Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.
van Achterberg, Cornelis; Long, Khuat Dang
2010-01-01
Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus
Keerulised ja põnevad / Tõnu Kaalep
Kaalep, Tõnu, 1966-2018
2009-01-01
22. oktoobril Tallinnas Rock Cafes toimunud ansambli KTU (Kimmo Pohjonen, Lee Patrick Mastelotto, Trey Gunn) kontserdist ja 25. oktoobril Salme Kultuurikeskuses etendunud Heiner Goebbelsi lavastusest "Eraritjaritjaka"
Lateral strukturierte Oberflächen zur THz-Strahlmanipulation
Jahn, David; Koch, Martin (Prof. Dr.)
2018-01-01
Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...
C. Huang , G. Zhao , HW Zhang & YQ Chen
Indian Academy of Sciences (India)
the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.
Chaos synchronization of the fractional-order Chen's system
International Nuclear Information System (INIS)
Zhu Hao; Zhou Shangbo; He Zhongshi
2009-01-01
In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.
Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors
2008-04-01
Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...
75 FR 1066 - Center for Scientific Review; Notice of Closed Meetings
2010-01-08
... Person: Patrick K. Lai, PhD, Scientific Review Officer, Center for Scientific Review, National Institutes... Committee: Brain Disorders and Clinical Neuroscience Integrated Review Group; Clinical Neuroscience and...
The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica
Directory of Open Access Journals (Sweden)
Sollman Philip
2015-07-01
Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.
(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs
2012-12-21
increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha
The effects of growth time on the quality of graphene synthesized by ...
Indian Academy of Sciences (India)
by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.
African Journals Online (AJOL)
Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...
Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...
Hsieh, Hui-Chen
2016-01-01
Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…
77 FR 293 - Center for Scientific Review; Notice of Closed Meetings
2012-01-04
.... Contact Person: Patrick K Lai, Ph.D., Scientific Review Officer, Center for Scientific Review, [email protected] . Name of Committee: Brain Disorders and Clinical Neuroscience Integrated Review Group...
Kui näitlejal on oma etendus / Margot Visnap
Visnap, Margot
1990-01-01
Patrick Süskindi "Kontrabass" Vanalinnastuudios, lavastaja Eino Baskin ja Noorsooteatris William Luce'i "Amhersti kaunitar", lavastaja Rudolf Allabert ning Jerome Kilty "Armas luiskaja", näitejuht Kalju Orro
Teater kinos või kino teatris? "Salome" juhtum / Rein Veidemann
Veidemann, Rein, 1946-
2008-01-01
Ooper kinolinal : Richard Strauss. "Salome". Dirigent Patrick Summers, lavastaja Jürgen Flimm. New Yorgi Metropolitan Opera etenduse otseülekanne 11. oktoobril Tallinna kobarkinos ja Tartu kinos Ekraan
Emerging technologies: from hindsight to foresight
National Research Council Canada - National Science Library
Einsiedel, Edna F
2009-01-01
... Pharmaceuticals in the United States / 120 Patrick A. Stewart 8 Forestalling Liabilities? Stakeholder Participation and Regulatory Development / 138 Stuart Smyth In the Stem Cell Fields 9 When Human Dign...
Zur historischen Aufarbeitung und medialen Vermittlung der Shoah in Italien und Deutschland
Directory of Open Access Journals (Sweden)
Peter Kuon
2016-03-01
Full Text Available Claudia Müller, Patrick Ostermann und Karl-Siegbert Rehberg, Hrsg., Die Shoah in Geschichte und Erinnerung: Perspektiven medialer Vermittlung in Italien und Deutschland (Bielefeld: transcript, 2015.
Jätkub filmisari "Ainult friikidele"
2008-01-01
Filmisarjas "Ainult friikidele" linastub Tallinnas Sõpruse kinos täna ja Tartus Athena Keskuses homme Alain Corneau' kutuslik kriminaalfilm "Serie noir" : Prantsusmaa 1979. Suurepärase rolli teeb Patrick Dewaere
Eesti Maanteemuuseumis lavastub Roman Baskini käe all "Augustikuu teemaja"
Veski, Rivo
2009-01-01
Roman Baskini lavastatud komöödia "Augustikuu teemaja" Maanteemuuseumis. Autor John Patrick, mängivad mitmed harrastusteatrite näitlejad, teiste hulgas MTÜ Vilde Teatri liikmed. Peaosas Marko Matvere
Ameerika teatriauhinnad jagatud / Neeme Raud
Raud, Neeme, 1969-
2005-01-01
Ameerika kommertsteatri auhinnad said muusikalid "Spamalot" ja "Valgus Piazzal" ning parima draama preemia Ameerika kirjaniku John Patrick Shanley näidend "Kahtlus". Parima lavastaja Tony sai kuuendat korda Mike Nichols
Kas tunned maad Tobiki rannal? / Veiko Märka
Märka, Veiko, 1964-
2009-01-01
Roman Baskini lavastatud komöödia "Augustikuu teemaja" Maanteemuuseumis. Autor John Patrick, mängivad mitmed harrastusteatrite näitlejad, teiste hulgas MTÜ Vilde Teatri liikmed. Peaosas Marko Matvere
Komöödia täis Jaapani elutarkust/ Mari Hiiemäe
Hiiemäe, Mari
2009-01-01
Roman Baskini lavastatud komöödia "Augustikuu teemaja" Maanteemuuseumis. Autor John Patrick, mängivad mitmed harrastusteatrite näitlejad, teiste hulgas MTÜ Vilde Teatri liikmed - peaosas Marko Matvere
Vehicle/Guideway Interaction in Maglev Systems
1992-03-01
Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1
Indian Academy of Sciences (India)
20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.
2010-02-19
... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...
75 FR 4571 - Government-Owned Inventions; Availability for Licensing
2010-01-28
.... Applications: Therapies for tumors associated with NF1 (including brain and peripheral nervous system tumors...-US-01). Licensing Status: Available for licensing. Licensing Contact: Patrick P. McCue, Ph.D.; 301...
2010-10-05
... REQUIREMENTS CONTACT: Program Contact: Patrick McDermott, Division of Animal and Food Microbiology, Center for Veterinary Medicine, Food and Drug Administration, 7519 Standish Pl., Mod II, rm. 1505, Rockville, MD 20855...
2011-10-21
... contemplated exclusive license should be directed to: Patrick P. McCue, Ph.D., Licensing and Patenting Manager... has been demonstrated for biliary tract, kidney, lung, and stomach cancers. The prospective exclusive...
2012-12-19
... Patrick Clinton, Office Associate Chief Counsel (Income Tax & Accounting), (202) 622- 4930 (not a toll... and depreciation reserve of the general asset account, and that reflect the amount realized during the...
78 FR 60297 - Center for Scientific Review; Notice of Closed Meetings
2013-10-01
..., Rockville, MD 20852. Contact Person: Leonid V. Tsap, Ph.D., Scientific Review Officer, Center for Scientific...: Residence Inn Bethesda, 7335 Wisconsin Avenue, Bethesda, MD 20814. Contact Person: Patrick K Lai, Ph.D...
Briti mütsid, kotid ja kingad kahes galeriis
2002-01-01
Tallinna Kunstihoone galeriis ja Tallinna Linnagaleriis briti moekunstnike aksessuaaride näitus "Satellites of Fashion", kus eksponeeritakse Vivianne Westwoodi, Philip Treacy, Patrick Coxi ja Lulu Guinnessi loodud peakatteid, jalanõusid ja kotte
ESARBICA Journal: Journal of the Eastern and Southern Africa ...
African Journals Online (AJOL)
Socioeconomic determinants of e-government adoption in selected districts of Tanzania · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Mercy Mlay Komba, Patrick Ngulube, 71-82 ...
Hawaiian and Other Pacific Islander population groups. FFF: Women's History Month: March 2018 February 15 . Patrick's Day: March 2018 February 06, 2018 To commemorate this day which celebrates all things Irish, the
The high pressure gas Cerenkov counter at the Omega Facility.
1975-01-01
The high-pressure gas Cerenkov was used to measure reactions as pion (or kaon)- hydrogen --> forward proton - X. It was built by the Ecole Polytechnique (Palaiseu). Here Peter Sonderegger and Patrick Fleury,
National Research Council Canada - National Science Library
Conley, Verena Andermatt
1993-01-01
.... Katherine Hayles 11. The Leap and the Lapse: Hacking a Private Site in Cyberspace Alberto Moreiras 12. Telefigures and Cyberspace Patrick Clancy 173 191 207 Works Cited 233 Contributors 241 Index 24...
On the Unsteady-Motion Theory of Magnetic Forces for Maglev
1993-11-01
DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S
On integral equation methods for electromagnetic scattering by biperiodic structures
Bugert, Beatrice
2014-01-01
In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...
Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa
Tootmaa, Rein
2001-01-01
Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128
78 FR 38352 - Government-Owned Inventions; Availability for Licensing
2013-06-26
...). The invention rat is superior to AD mice models because the rat has a larger sized brain to.... Licensing Contact: Patrick McCue, Ph.D.; 301-435-5560; [email protected] . Collaborative Research...
2010-07-02
... information on individual limit orders including the order type (buy/ sell), the order price, the order size...); De Fontnouvelle, Patrick, Fishe, Raymond P., and Harris, Jeffrey H., The Behavior of Bid-Ask Spreads...
A Post-"Leahy Conditions" Theater Security Cooperation Plan for Indonesia
National Research Council Canada - National Science Library
Grady, Gregory L
2007-01-01
Currently, Public Law 115, Section 572 of the Foreign Operations, Export Financing and Related Programs Appropriations Act of 2002, also known as the "Leahy Conditions" for its sponsor, Senator Patrick Leahy (Democrat-Vermont...
DEFF Research Database (Denmark)
Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper
2004-01-01
reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....
2018-02-01
Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the
ACTIVITY BUDGETS OF MALE MACCOA DUCKS FitzPatrick ...
African Journals Online (AJOL)
study first of time budgets and then the allocation of energetic costs to the various ..... tions made during two full-moon nights suggested that non-breeding birds did nothing ... activities (Running Flight, Souse, Ski and Fight) were rated 8 x BMR.
75 FR 8081 - Patrick J. Lais: Debarment Order
2010-02-23
..., identified as ``Coated Aspirin,'' to customers in Kansas City, MO. In May 2000, this ``Coated Aspirin... during Mr. Lais's debarment, will be subject to civil money penalties (section 307(a)(6) of the act (21 U... pending drug product application during his period of debarment he will be subject to civil money...
Kõrged kontsad, kokteilid ja Cosmo / Laurence Lumiere
Lumiere, Laurence
2008-01-01
Menutelesarja "Seks ja linn" peategelastega samanimelisest mängufilmist (režissöör Michael Patrick King). Seriaali sünniloost, alates ideest produtsent Darren Stari peas ning filmi ja seriaali võrdlusest
100th meeting of the Governing Board of the CERN Insurance Scheme
CERN PhotoLab
1981-01-01
M. Corsier sits on the centre. Behind him, first raw, Constantin Tièche, M. Beechten (SBS), and on background, Charles Forman, Patrick Mollet, Cornelis Zilverschoon, Kurt S. Koelbig, M. Houmard (UBS), Roger Hugentobler.
... Inflammation of the Penis (Balanitis; Posthitis; Balanoposthitis) By Patrick J. Shenot, MD, Associate Professor and Deputy Chair, ... of stimuli to nerves, blood vessels, and the brain. Which of the following happens to blood during ...
Saaremets, Raul
2007-01-01
Heliplaatidest: The Horrors "Strange House", Earlies "The Enemy Chorus", Finish Me Off "Seed", Kasabian "Empire", Norah Jones "Not Too Late", Kaiser Chiefs "Yours Truly Angry Mob", Skinny Puppy "Mythmaker", Patrick Wolf "The Magic Position"
Solar Imagery - Composites - Synoptic Maps - McIntosh
National Oceanic and Atmospheric Administration, Department of Commerce — In 1964 (solar cycle 20) Patrick McIntosh began creating hand-drawn synoptic maps of solar activity, based on Hydrogen alpha (H?) imaging measurements. These...
1989-05-17
brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus
Viets, Carmen
2001-01-01
Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...
Unconventional Density Wave and Superfluidity in Cold Atom Systems
2014-06-01
Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority
Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes
2016-12-30
Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division
Aerial Logistics Management for Carrier Onboard Delivery
2016-09-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
Sexual Harassment DEOCS 4.1 Construct Validity Summary
2017-08-01
Sexual Harassment DEOCS 4.1 Construct Validity Summary DEFENSE EQUAL OPPORTUNITY MANAGEMENT INSTITUTE...DIRECTORATE OF RESEARCH DEVELOPMENT AND STRATEGIC INITIATIVES Directed by Dr. Daniel P. McDonald, Executive Director 366 Tuskegee Airmen Drive Patrick AFB
Transboundary Water Resources in Southern Africa: Conflict or cooperation?
CSIR Research Space (South Africa)
Patrick, MJ
2006-01-01
Full Text Available Literature suggests a linkage between internationally shared water resources and conflict potential. Anthony R. Turton, Marian J. Patrick and Frederic Julien examine transboundary water resource management in southern Africa, showing that empirical...
96 Globalization and Management: Issues and Concepts
African Journals Online (AJOL)
User
2010-10-17
Oct 17, 2010 ... Oseyomon, Ehi Patrick - Department of Business, Admiistration, Faculty of. Management ... attention of scholars apart from economic issues such as trade, labour practices, the ..... Moral Issues in Business. 6th Edition. In C.
9620 DIETARY ADEQUACY OF RURAL SCHOOL CHILDREN ...
African Journals Online (AJOL)
Mimi
to reduced mental and physical development of children, hence delayed ... of health and neurocognitive performance of school-age children [2]. ..... Patrick H and TA Nicklas A review of family and social determinants of ... Physiology and.
40 CFR 52.1670 - Identification of plans.
2010-07-01
... regulations. (x) February 20, 1980, dealing with public hearings to revise Parts 229 and 231 of 6 NYCRR... Corporation. (2) October 17, 1996 letter to Mr. Ted Gardella, EPA from Mr. Patrick Lentlie, supplementing the...
Massive Star Formation: Accreting from Companion X. Chen1 ...
Indian Academy of Sciences (India)
Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...
Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...
African Journals Online (AJOL)
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...
Food Fortification to Prevent and Control Iron Deficiency | Chen ...
African Journals Online (AJOL)
It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Kuu filmid / Maria Ulfsak-Šeripova
Ulfsak-Šeripova, Maria, 1981-
2009-01-01
Lühiarvustused filmidele "Kahtlus" (näitekirjanik, stsenarist ja režissöör John Patrick Shanley) ja "Gomorra" (režissöör Matteo Garrone, ajakirjaniku ja kirjaniku Roberto Saviano raamatu põhjal)
Kahe kuninganna duell / Timo Diener
Diener, Timo
2007-01-01
Mängufilm "Ühe skandaali märkmed" ("Notes on a Scandal") : stsenarist Zoe Helleri romaani järgi Patrick Marber : režissöör Richard Eyre : peaosades Judi Dench, Cate Blanchett : Suurbritannia 2006
"Ühe skandaali märkmed" : kui kiindumusest tõuseb tüli / Andris Feldmanis
Feldmanis, Andris, 1982-
2007-01-01
Mängufilm "Ühe skandaali märkmed" ("Notes on a Scandal") : stsenarist Zoe Helleri romaani järgi Patrick Marber : režissöör Richard Eyre : peaosades Judi Dench, Cate Blanchett : Suurbritannia 2006
Existence of positive periodic solution of mutualism system with several delays
International Nuclear Information System (INIS)
Wu Haihui; Xia Yonghui; Lin Muren
2008-01-01
In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53
Robust anonymous authentication scheme for telecare medical information systems.
Xie, Qi; Zhang, Jun; Dong, Na
2013-04-01
Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.
Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes
2013-12-18
2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the
Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen
2015-01-01
Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...
2013-01-01
Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner
CLEAR: Cross-Layer Exploration for Architecting Resilience
2017-03-01
unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting
Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency
2017-06-30
automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index
African Journals Online (AJOL)
security in order to identify how best Kenyans can meet their human security needs. * Patrick Mutahi ... internal security. The void has .... and private security companies that bring the otherwise ... for crime and other deviant behaviours but also.
African Journals Online (AJOL)
Percy FitzPatrick Institute of African Ornithology, University of Cape Town, Rondebosch. The inshore distribution .... either travelling or foraging (Siegfried, Frost, Kinahan & ..... significantly different (d = 0,78; P> 0,01; n = 138; Student's t test for ...
Energy Technology Data Exchange (ETDEWEB)
Chain, Patrick
2011-10-13
Patrick Chain of DOE JGI at LANL, Co-Chair of the Metagenome-specific Assembly session, on Metagenome Assembly at the DOE JGIat the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.
Kaks head prantslast korraga / Peeter Künstler
Künstler, Peeter, 1958-2009
1996-01-01
Arvustus: Guibert, Hervé. Sõbrale, kes ei päästnud mu elu / Prantsuse k. tlk. T. Arot. Tln. : Kupar, 1996; Modiano, Patrick. Hämarate poodide tänav / Prantsuse k. tlk. Tatjana Hallap. Tln. : Kupar, 1996
Full Text Available ... Washing Video from CDC called "Put Your Hands Together" - Duration: 3:40. Patrick Boshell 27,834 views ... Policy & Safety Send feedback Test new features Loading... Working... Sign in to add this to Watch Later ...
African Zoology - Vol 37, No 1 (2002)
African Journals Online (AJOL)
A new species of Eilica (Araneae: Gnaphosidae) · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Moira J. FitzPatrick, 109–113. http://dx.doi.org/10.1080/15627020.2002.11657162 ...
A high selectivity quaternized polysulfone membrane for alkaline direct methanol fuel cells
CSIR Research Space (South Africa)
Abuin, GC
2015-04-01
Full Text Available polysulfone membrane for alkaline direct methanol fuel cells Graciela C. Abuina, Esteban A. Franceschinib, Patrick Nonjolac, Mkhulu K. Mathec, Mmalewane Modibedic, Horacio R. Cortib,* aCentro de Procesos Superficiales, Instituto Nacional de Tecnología...
National Research Council Canada - National Science Library
Knights, Michael
2008-01-01
...%. As the result of leadership targeting and the loss of safe havens, Multinational Force Iraq (MNF-I) spokesman Rear Admiral Patrick Driscoll characterized AQI and other insurgent groups in Mosul as being "off-balance and on the run."
2011-07-01
Lieutenant General, Canadian Forces, Canadian Military Repre- sentative to NATO Elizabeth Race, Deputy Defence Policy Advisor, Canadian Joint...Ruehle, Head, Energy Security Section, Emerging Security Challenges Division, NATO ( Brus - sels) Patrick Nash, Lieutenant General, Irish Army, for- mer
Andres Ehin tähistas sünnipäeva raamatuesitlusega / Maire Kõrver
Kõrver, Maire, 1961-
2006-01-01
Andres Ehin esitles oma luulekogu "Põdrapõrnikapääsukene" ja selle ingliskeelset tõlget "Moose Beetle Swallow" oma sünnipäeval Iiri suursaadiku residentsis, kus oli kohal ka luulekogu tõlkija, Iiri luuletaja Patrick Cotter
Kauni vaatega villa / Jaan Mettik
Mettik, Jaan
2008-01-01
Kauni vaatega villast - Quinta da Boa Vista - Madeiral, orhideeaiandist. Omaniku Betty Gartoni pojal Patrick Gartonil oli Westminsteri näitusehallis väljas Quinta da Boa Vista orhideekollektsioonil põhinev akvarelliseeria ning Briti Kuninglik Aiandusselts tunnustas teda kuldmedaliga
Juhendamine juhtimise asemel / Vahur Murutar
Murutar, Vahur, 1961-
2003-01-01
Rets. rmt.: Patrick J. McKenna, David H. Maister. Esimene võrdsete seas. Fontes, Pärnu Konverentsid 2003. Autor selgitab McKenna ja Maisteri raamatule tuginedes, mida eeldab maailmas üha enam populaarsust koguv juhi roll meeskonna treenerina
Pricing American and Asian Options
Pat Muldowney
2015-01-01
An analytic method for pricing American call options is provided; followed by an empirical method for pricing Asian call options. The methodology is the pricing theory presented in "A Modern Theory of Random Variation", by Patrick Muldowney, 2012.
Arte como saúde: crítica, clínica e o povo que falta
Directory of Open Access Journals (Sweden)
Cíntia Vieira da Silva
2016-12-01
Full Text Available O artigo se propõe a comentar o texto “A arte da crítica: conversa entre um ator japonês e um crítico brasileiro”, de Patrick Pessoa. Como foi escrito para ser apresentado em um encontro do GT de Estética, cujo funcionamento supõe que os participantes tenham acesso ao texto comentado antes do evento, procurou-se evitar repetir excessivamente o que o texto apresenta, já que ele é bastante claro. Em lugar de explicar as ideias ali desenvolvidas, ou discuti-las, o artigo se construiu em diálogo com elas, procurando pensar as questões que Patrick Pessoa elabora numa perspectiva diferente da sua. Em suma, o artigo apresenta o conceito deleuziano de crítica, mostrando como ele pode esposar a “arte da crítica” reivindicada por Pessoa.
Health for all: a fundamental goal of public health in our region.
Binns, Colin; Lee, Mi Kyung
2015-01-01
Since its foundation 30 years ago, the mission of the Asia-Pacific Academic Consortium for Public Health has been promoting "health for all" through public health. "Health for all" became the theme of Walter Patrick's public health career and inspired his contribution to APACPH. However, the universality of health care is now under threat, more from economists and politicians than public health workers. Health for all remains a continuing challenge for all public health workers in our region. Progress is being made toward this goal as life expectancy in the Western Pacific has increased from 64 to 78 in the past 3 decades. Prof Walter Patrick was strong public health advocate, and this review was written as a tribute to good friend and inspiring colleague who believed in, and worked for "health for all." © 2014 APJPH.
Intertekstualiteit en die Bose in Kroniek van Perdepoort (Anna M. Louw
Directory of Open Access Journals (Sweden)
E. Linde
1986-05-01
Patrick White is also an author of religious literature to whom Anna M. Louw is attracted by her own admission. His novels. The solid Mandala and Riders in the Chariot are studied, and similarities with Kroniek van Perdepoort indicated.
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
From P T -symmetric quantum mechanics to conformal field theory · Patrick Dorey Clare Dunning ... pp 251-257. Statistical features of quantum evolution · Sudhir R ... Sturm–Schrödinger equations: Formula for metric · Miloslav Znojil Hendrik B ...
Irooniline pilguheit Iirima lähiajaloole / Aare Ermel
Ermel, Aare, 1957-2013
2001-01-01
Mängufilm "Väike lihunik" ("The Butcher Boy") : Stsenaristid Neil Jordan ja Patrick McCabe viimase samanimelise romaani järgi : režissöör Neil Jordan : Ameerika Ühendriigid 1997. Ka : Teleleht nr. 1, lk. 4
Integrating biodiversity concepts with good governance to support ...
African Journals Online (AJOL)
2005-10-04
Oct 4, 2005 ... support water resources management in South Africa. PJ Ashton1*, MJ Patrick2, HM .... Figure 1 shows that human activities, motivated by a diverse array of goals and .... catchment management strategy. • Legislation is the ...
CSIR Research Space (South Africa)
Egoh, Benis N
2012-12-01
Full Text Available -1 Ecosystem Services December 2012/ Vol. 2 An African account of ecosystem service provision: Use, threats and policy options for sustainable livelihoods Benis N. Egoh a, , , , Patrick J. O'Farrellb, Aymen Charefa, Leigh Josephine Gurney a...
Chen YC; Ho HO; Chiu CC; Sheu MT
2013-01-01
Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...
Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu
2018-01-01
Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...
Reforming China’s Criminal Procedure Law
Winckler, Hugo
2014-01-01
Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...
Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas
2015-01-01
Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...
Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Chen, Ming
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou
2013-01-01
Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lwati: A Journal of Contemporary Research: Editorial Policies
African Journals Online (AJOL)
Professor Felix Mnthali: University of Botswana, Gaborone Professor Theresa Chisanga: Walter Sisulu University, Umtata, Republic of South Africa Venerable Professor Benjamin N. Egede: Ambrose Alli University, Ekpoma, Nigeria Professor Patrick J. Ebewo: Tshwane University of Technology, Pretoria, Republic of South ...
Noormets, Jaanus
2006-01-01
Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Parfüüm : ühe mõrva lugu" ("Perfume: The Story of a Murderer") : režissöör Tom Tykwer : peaosas Ben Whishaw : Ameerika Ühendriigid - Saksamaa 2006
Jaan Ruus soovitab : "Parfüüm : ühe mõrva lugu" / Jaan Ruus
Ruus, Jaan, 1938-2017
2006-01-01
Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Parfüüm : ühe mõrva lugu" ("Perfume: The Story of a Murderer") : režissöör Tom Tykwer : peaosas Ben Whishaw : Ameerika Ühendriigid - Saksamaa 2006
DVD. Alar Niineväli soovitab : "Parfüüm : Ühe mõrva lugu" / Alar Niineväli
Niineväli, Alar
2007-01-01
Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Parfüüm : Ühe mõrva lugu" ("Perfume: The Story of a Murderer") : režissöör Tom Tykwer : peaosas Ben Whishaw : Ameerika Ühendriigid - Saksamaa 2006
Tapvalt hõrk naiselõhn paistab mõrvari ninasõõrmeist / Andres Laasik
Laasik, Andres, 1960-2016
2006-01-01
Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Parfüüm : ühe mõrva lugu" ("Perfume: The Story of a Murderer") : režissöör Tom Tykwer : peaosas Ben Whishaw : Ameerika Ühendriigid - Saksamaa 2006
2010-03-26
..., CPHQ Patrick A. Grusenmeyer, Sc.D., FACHE David Halsey, M.D. Judith T. Kelly, B.S.H.A., RHIT, RHIA, CCS....D.* Daniel Pothen, M.S., RHIA, CPHIMS, CCS, CCS-P, CHC Gregory J. Przbylski, M.D. Russ Ranallo, M.S...
2010-07-13
... TENNESSEE VALLEY AUTHORITY Northeastern Tributary Reservoirs Land Management Plan, Beaver Creek...-managed public land on Beaver Creek, Clear Creek, Boone, Fort Patrick Henry, South Holston, Watauga, and... Proposed Land Use Alternative) identified in the final environmental impact statement (FEIS). Under the...
77 FR 63337 - Renewal of Charter of Advisory Committee on Actuarial Examinations
2012-10-16
... examinations in actuarial mathematics and methodology. The Joint Board administers such examinations in... JOINT BOARD FOR THE ENROLLMENT OF ACTUARIES Renewal of Charter of Advisory Committee on Actuarial... the Advisory Committee on Actuarial Examinations. FOR FURTHER INFORMATION CONTACT: Patrick McDonough...
75 FR 63505 - Renewal of Advisory Committee on Actuarial Examinations
2010-10-15
... actuarial mathematics and methodology. The Joint Board administers such examinations in discharging its... JOINT BOARD FOR THE ENROLLMENT OF ACTUARIES Renewal of Advisory Committee on Actuarial... Committee on Actuarial Examinations. FOR FURTHER INFORMATION CONTACT: Patrick W. McDonough, 202-622-8225...
11 : olematult teatrist (II) / Ott Karulin
Karulin, Ott, 1980-
2006-01-01
Eesti teater on Baltoscandalil koondatud olematu teatri mõiste alla. Andres Härma "Cooking and Shitting", Sven Kuntu "Miks Eesti mehed ei tantsi?", Linnar Priimäe "Inimese lõhn", Patrick Süskindi teose "Parfüüm" järgi
Stille, Lana
2006-01-01
Õppemaksudest USA-s, Itaalias, Suurbritannias, Hollandis ja Soomes. Kommenteerivad Sean Patrick Williams Iowa Ülikoolist (USA), Thomas Mark Carey Leedsi Ülikoolist (Suurbritannia), Alies Hoitsma Windwshwimi Kristlikust Kõrgkoolist (Holland) ja Antti Tiainen Jyväskylä Ülikoolist (Soome)
Scattering of plane waves by rough surfaces in the sense of Born approximation
Arnold, Thomas
2014-01-01
Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...
Distributed mechatronics controller for modular wall climbing robot
CSIR Research Space (South Africa)
Tlale, NS
2006-07-01
Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...
Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan
2018-01-01
Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...
Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning
2016-01-01
Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...
Directory of Open Access Journals (Sweden)
Haoyu Liu
2017-03-01
Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.
2012-08-06
K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and
Is the Chinese Army the Real Winner in PLA Reforms
2016-10-01
44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other
Karaca, Koray
2017-01-01
According to the hierarchy of models (HoM) account of scientific experimentation developed by Patrick Suppes and elaborated by Deborah Mayo, theoretical considerations about the phenomena of interest are involved in an experiment through theoretical models that in turn relate to experimental data
Top–down and Bottom–up: Front to Back
DEFF Research Database (Denmark)
Nadal, Marcos; Skov, Martin
2017-01-01
Refers to: Matthew Pelowski, Patrick S. Markey, Michael Forster, Gernot Gerger, Helmut Leder: Move me, astonish me… delight my eyes and brain: The Vienna Integrated Model of top-down and bottom-up processes in Art Perception (VIMAP) and corresponding affective, evaluative, and neurophysiological...
“Coastal zones are some of the most complex “multiple-use” areas ...
African Journals Online (AJOL)
spamer
dubious distinction of being the most challenging ... the substantial impacts that marine fisheries are having ... that need resolution and requires development of management plans. ... Percy FitzPatrick Institute of African Ornithology, University of Cape Town, ... tion, education and tourism (Kelleher and Kenchington. 1990).
AMI-LA 15 GHz Observation of the Type IIP Supernova SN 2017eaw
Bright, Joe; Mooley, Kunal; Fender, Rob; Horesh, Assaf
2017-05-01
SN 2017eaw was discovered by Patrick Wiggins on 2017 May 14.24 and confirmed as a transient object (located in NGC 6946, at a distance of around 5.5 Mpc) in follow up observations from the McDonald observatory (ATel #10372).
EXPRESSION PROFILING OF ESTROGENIC COMPOUNDS USING A SHEEPSHEAD MINNOW CDNA MACROARRAY
Larkin, Patrick, Leroy C. Folmar, Michael J. Hemmer, Arianna J. Poston and Nancy D. Denslow. 2003. Expression Profiling of Estrogenic Compounds Using a Sheepshead Minnow cDNA Macroarray. Environ. Health Perspect. 111(6):839-846. (ERL,GB 1171). A variety of anthropogenic c...
Ei enamat kui halb illustratsioon / Kristiina Davidjants
Davidjants, Kristiina, 1974-
2006-01-01
Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Parfüüm : ühe mõrva lugu" ("Perfume: The Story of a Murderer") : režissöör Tom Tykwer : peaosas Ben Whishaw : Ameerika Ühendriigid - Saksamaa 2006. Võrdlus raamatuga
In vitro and in vivo antiplasmodial activity of extracts from Polyalthia ...
African Journals Online (AJOL)
In vitro and in vivo antiplasmodial activity of extracts from Polyalthia suaveolens, Uvaria angolensis and Monodora tenuifolia (Annonaceae). Alvine Ngoutane Mfopa, Cedric Derick Jiatsa Mbouna, Lauve Rachel Yamthe Tchokouaha, Marthe Aimée Tchuenmegne Tchuente, Rufin Marie Toghueo Kouipou, Patrick Valere ...
2011-06-02
... CONTACT: Patrick Farina, Aerospace Engineer, Cabin Safety Branch, ANM-150L, FAA, Los Angeles Aircraft... understands that the FAA considers this phased testing structure as an acceptable testing plan, but also... the suspect seats were witnessed by FAA ``delegates'' (designated engineering representatives (DERs...
HIV/AIDS treatment in two Ghanaian hospitals : experiences of patients, nurses and doctors
Dapaah, Jonathan Mensah
2012-01-01
This thesis is based on fifteen months of anthropological research in the voluntary counselling and testing centres and antiretroviral therapy clinics of two hospitals in Ghana, St. Patrick's Hospital at Maase-Offinso and Komfo Anokye Teaching Hospital in Kumasi, including in-depth conversations
Sindbad, Pjatatshok i vsje-vsje-vsje / Jevgeni Levik
Levik, Jevgeni
2003-01-01
Kaks uut USA täispikka animafilmi - "Sinband : Seitsme mere legend" ("Sinbad : Legend of the Seven Seas") : režissöörid Tim Johnson, Patrick Gilmore : stsenarist John Logan ja "Nodzufilm" ("Piglet's Big Movie") : režissöör Francis Glebas
African Journal of AIDS Research - Vol 3, No 1 (2004)
African Journals Online (AJOL)
Malawi faith communities responding to HIV/AIDS: preliminary findings of a knowledge translation and participatory-action research (PAR) project · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Dennis G Willms, Maria-Ines Arratia, Patrick Makondesa, 23-32.
78 FR 13747 - Safety Advisory 2013-01; Passing Stop Signals Protecting Movable Bridges
2013-02-28
... Association Manual for Railway Engineering. 2. Evaluate operating rules and procedures that permit the...: (1) Evaluate the design and construction of existing movable bridges to determine if effective span... perform these duties. FOR FURTHER INFORMATION CONTACT: Carlo M. Patrick, Staff Director, Rail and...
Rijnierse, E.
1999-01-01
This paper proposes a conceptual framework for the systematic linking of theory and empiricism in a transnational perspective accommodating the local, the national and the international simultaneously. The argument expands the narrow State-centred approach of Patrick Chabal and Jean-Pascal Daloz in
Ümber mõtestades piire ja kaugust = Distance Between the Vision and the Context / Maia Tüür
Tüür, Maia
2006-01-01
Musee du Quai Branly Pariisis. Arhitekt Jean Nouvel, maastikuarhitekt Gilles Clement. Pargi üldskeemi kujundab teede ja pinkide võrgustik, mis põhineb kilpkonna kilbi mustril. Yann Kersale teosest pargis. Maja Seine'i-äärset fassaadi katab Patrick Blanci loodud taimevaip
Bullock on Rat Gastrointestinal Microflora
African Journals Online (AJOL)
Dr Olaleye
the years, P. nigrescens has been used as an ingredient in the medications for insanity ... to safeguard the microbiota of the GI (Davis and Milner,. 2010). Although most ..... Sunday, D., Kazeem, S. I., Matthew, D., Patrick E. C.,. Charles W. and ...
African Journal of Library, Archives and Information Science - Vol 15 ...
African Journals Online (AJOL)
Disaster and Security Management in Public Archival Institutions in ESARBICA Region. Patrick Ngulube ... Setting Up and Managing ICT Laboratory in a Nigerian Library School: Ahmadu Bello University, Zaria Experience. Gbaje Ezra ... The Management of Chieftaincy Records in Ghana: An Overview. Musah Adams ...
Governor's Council on Disabilities and Special Education
State Employees Governor's Council on Disabilities and Special Education DHSS State of Alaska Home ; Governor's Council on Disabilities and Special Education Page Content Untitled Document Patrick Reinhart : follow GCDSE to 40404 The Governor's Council on Disabilities & Special Education is pleased to award
Kahu, Tõnis, 1962-
2005-01-01
Heliplaatidest: Tori Amos "The Beekeeper", 3 Doors Down "Seventeen Days", Jay-Z / Linkin Park "Collision Course", Patrick Moraz / Bill Bruford "Flags", Shuttle358 "Chessa", Erasure "Nightbird", Erinevad esitajad "Kingston 5 Presents The New Sound of Reggae", Ryuichi Sakamoto "Chasm", Ryuichi Sakamoto "Derrida"
Polarimetric Wavelet Fractal Remote Sensing Principles for Space Materials (Preprint)
2012-06-04
H. Picard, Phan D. Dao, Peter N. Crabtree, Patrick J. 5d. PROJECT NUMBER 1010 McNicholl, Jeff Petermann, Suman Shrestha, Chaya Narayan, and...Jeff Petermann, *Suman Shrestha, * Chaya Narayan, and **Stefanie Marotta *Dept. of Electrical and Computer Engineering, **Dept. of Biomedical
International Nuclear Information System (INIS)
Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza
2015-01-01
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models
Energy Technology Data Exchange (ETDEWEB)
Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)
2015-01-15
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.
El uso político de la edad media. The myth of nations. The medieval origins of Europe
Directory of Open Access Journals (Sweden)
Abel Ignacio López
2002-01-01
Full Text Available El uso político de la edad media. Geary, Patrick, The Myth of Nations. The Medieval Origins of Europe. Princeton: Princeton University Press, 2002, pp: 199. El libro de Patrick Geary es una brillante crítica a los abusos que políticos e incluso historiadores han hecho a propósito de la temprana Edad Media. En efecto, este historiador norteamericano muestra que ideólogos del nacionalismo europeo de nuestro tiempo se han basado y aún se basan en un conocimiento erróneo de la época medieval para fundamentar sus propios prejuicios y exclusiones. Según esa interpretación, los pueblos modernos de hoy se constituyeron por primera vez en el período posterior a la caída del Imperio Romano y a la consolidación en Europa de los llamados pueblos germanos.
O jornalista gastronômico e a arte de julgar
Directory of Open Access Journals (Sweden)
Márcia Atália Pietrolungo
2011-10-01
Full Text Available Resumo: Análise do julgamento de gosto e das imagens de jornalista produzidas nas revistas gastronômicas Saveurs, GaultMillau, La Bonne Cuisine e Cuisine et Vins de France, à luz da análise semiolinguística do discurso de Patrick Charaudeau e de conceitos sociológicos de Pierre Bourdieu.Palavras-chave: Análise do discurso; semiolingüística; revista; gastronomia.Résumé: Ce travail propose une analyse du jugement de goût et des images du journaliste gastronomique, présentes dans les revues Saveurs, GaultMillau, La Bonne Cuisine e Cuisine et Vins de France, à partir de la théorie sémiolinguistique du discours de Patrick Charaudeau et des concepts sociologigues de Pierre Bourdieu. Mots-clés: Analyse du discours; sémiolinguistique; revue; gastronomie.Keywords: Discourse analysis; semiolinguistics; magazine; gastronomy.
Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong
2017-01-01
Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...
International Nuclear Information System (INIS)
Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua
2007-01-01
Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme
2013-10-01
Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL. Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and
Dr. Patrick Dongosolo Kamalo – Consultant Neurosurgeon at Queen
African Journals Online (AJOL)
medical training at College of Medicine and graduated in. 2000. After finishing my ... Central Hospital “I believe that through high quality, collaborative research and training opportunities, we ... the service of a neurologist, and from my experience with ... this training? Some would say Malawi is not ready to offer this delicate,.
St Patrick's Community Hospital, Summerhill, Carrick on Shannon, Leitrim.
LENUS (Irish Health Repository)
Kissling, E
2013-01-01
Within the Influenza Monitoring Vaccine Effectiveness in Europe (I-MOVE) project we conducted a multicentre case–control study in eight European Union (EU) Member States to estimate the 2011\\/12 influenza vaccine effectiveness against medically attended influenza-like illness (ILI) laboratory-confirmed as influenza A(H3) among the vaccination target groups. Practitioners systematically selected ILI \\/ acute respiratory infection patients to swab within seven days of symptom onset. We restricted the study population to those meeting the EU ILI case definition and compared influenza A(H3) positive to influenza laboratory-negative patients. We used logistic regression with study site as fixed effect and calculated adjusted influenza vaccine effectiveness (IVE), controlling for potential confounders (age group, sex, month of symptom onset, chronic diseases and related hospitalisations, number of practitioner visits in the previous year). Adjusted IVE was 25% (95% confidence intervals (CI): -6 to 47) among all ages (n=1,014), 63% (95% CI: 26 to 82) in adults aged between 15 and 59 years and 15% (95% CI: -33 to 46) among those aged 60 years and above. Adjusted IVE was 38% (95%CI: -8 to 65) in the early influenza season (up to week 6 of 2012) and -1% (95% CI: -60 to 37) in the late phase. The results suggested a low adjusted IVE in 2011\\/12. The lower IVE in the late season could be due to virus changes through the season or waning immunity. Virological surveillance should be enhanced to quantify change over time and understand its relation with duration of immunological protection. Seasonal influenza vaccines should be improved to achieve acceptable levels of protection.
Patrick Air Force Base Storm Water Pollution Prevention Plan.
1994-09-01
7758987 Cupric sulfate 77-47-4 Hexachlorocyclopentadliene 10380297 Cupric sulfate, ammoniated 67-72-1 H-exachloroethane 815827 Cupric tartrate 76-47-01...28300745 Antimony potassium 75-00-3 Chloroethane (Ethyl chlo- tartrate ride) 7789619 Antimony tribromide 67-66-3 Chloroform 10025919 Antimony...5 p-Cresol 7787475 Beryllium chloride 1319-77-3 Cresol (mixed isomers) 7787497 Beryllium fluoride 142712 Cupric acetate 7787555 Beryllium nitrate
Tööd soovinud noored said rakendust / Patrick Rang
Rang, Patrick, 1977-
2004-01-01
Sotsiaalministeeriumi ja tööturuameti poolt algatatud PHARE 16-24-aastaste noorte tööhõive edendamise projektist, mille eesmärgiks oli pakkuda noortele erinevaid koolitusi. Projekti raames lõpetas 517 noort tööotsingukoolituse ja 280 erialakoolituse
St. Patrick's Community Hospital, Summerhill, Carrick on Shannon, Leitrim
LENUS (Irish Health Repository)
Fitzmaurice, Karen
2012-02-01
BACKGROUND AND AIMS: CD8 T cells are central to the control of hepatitis C virus (HCV) although the key features of a successful CD8 T cell response remain to be defined. In a cohort of Irish women infected by a single source, a strong association between viral clearance and the human lecucocyte (HLA)-A*03 allele has been described, and the aim of this study was to define the protective nature of the associated CD8 T cell response. METHODS: A sequence-led approach was used to identify HLA-A*03-restricted epitopes. We examine the CD8 T cell response associated with this gene and address the likely mechanism underpinning this protective effect in this special cohort, using viral sequencing, T cell assays and analysis of fitness of viral mutants. RESULTS: A strong \\'HLA footprint\\' in a novel NS3 epitope (TVYHGAGTK) was observed. A lysine (K) to arginine (R) substitution at position 9 (K1088R) was seen in a significant number of A*03-positive patients (9\\/12) compared with the control group (1\\/33, p=0.0003). Threonine (T) was also substituted with alanine (A) at position 8 (T1087A) more frequently in A*03-positive patients (6\\/12) compared with controls (2\\/33, p=0.01), and the double substitution of TK to AR was also observed predominantly in HLA-A*03-positive patients (p=0.004). Epitope-specific CD8 T cell responses were observed in 60% of patients three decades after exposure and the mutants selected in vivo impacted on recognition in vitro. Using HCV replicons matched to the viral sequences, viral fitness was found to be markedly reduced by the K1088R substitution but restored by the second substitution T1087A. CONCLUSIONS: It is proposed that at least part of the protective effect of HLA-A*03 results from targeting of this key epitope in a functional site: the requirement for two mutations to balance fitness and escape provides an initial host advantage. This study highlights the potential protective impact of common HLA-A alleles against persistent viruses, with important implications for HCV vaccine studies.
Patrick Hockey : his life and work / Sandra McGrath
McGrath, Sandra
1994-01-01
... : the world of art and the world of commerce; the country and the city; the heterosexual and the homosexual; world of society and the world of the stockman; the loner and the bon vivant. Sandra Mcgrath, who was ...
Kuidas lugeda "Meeste domineerimist"? / Patrick Champagne ; tlk. Marek Tamm
Champagne, Patrick
2005-01-01
Rets. rmt.: Bourdieu, Pierre. Meeste domineerimine. Tallinn, 2005. Kommenteerivad (lk. 12-14) Liina Lukas, Rein Ruutsoo (TLÜ õppejõud), Marina Grišakova, Aare Pilv, Airi-Alina Allaste, Raivo Vetik (TLÜ Õppejõud), Andres Härm, Voldemar Tomusk
Directory of Open Access Journals (Sweden)
Martha C. Martínez Quintanilla
2017-04-01
Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.
Joining the Video-Game Literacy Club: A Reluctant Mother Tries to Join the "Flow"
Norton-Meier, Lori
2005-01-01
The author discusses the influence of video games and other technologies on modern family life, drawing on her own experiences. The implications of digital and other "new" and multiple literacies are described, with reference particularly to the work of Patrick Shannon and James Paul Gee.
Morskije prikljutshenija Rassela Krou / Ilja Svensson
Svensson, Ilja
2003-01-01
Seiklusfilm "Kapten ja komandör : retk maailma äärele" ("Master and Commander : The Far Side of the World") : stsenarist Patrick O'Briani romaanide järgi ja režissöör Peter Weir : peaosas Russell Crowe : Ameerika Ühendriigid 2003
2013-06-20
... the Treatment of Brain, Liver, and Pancreatic Cancers and Congestive Heart Failure AGENCY: National..., development, manufacture, distribution, sale, and use in humans for the treatment of brain cancer, liver...: Patrick McCue, Ph.D., Licensing and Patenting Manager, Office of Technology Transfer, National Institutes...
2013-04-05
... Brain and Hepatocellular Cancers AGENCY: National Institutes of Health, HHS. ACTION: Notice. SUMMARY..., and use in humans for the treatment of brain cancer or hepatocellular cancer within the Licensed... contemplated exclusive commercialization license should be directed to: Patrick McCue, Ph.D., Licensing and...
FIELD VALIDATION OF A SHEEPSHEAD MINNOW ESTROGEN-RESPONSIVE CDNA MACROARRAY
Hemmer, Michael J., Iris Knoebl, Becky L. Hemmer, Patrick Larkin, Peggy S. Harris and Nancy D. Denslow. In press. Field Validation of a Sheepshead Minnow Estrogen-Responsive cDNA Macroarray (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portl...
CRUSER 2015, TechCon, Robots in the Roses, Robo-Ethics [video
2015-01-01
CRUSER 2015 events Technical Consortium Robots in the Roses Robo-Ethics Ray Buettner, CRUSER Director Tim Chung, CRUSER Deputy Director LT Raymond Davis, Systems Engineering student LT Patrick Livesay, Systems Engineering student LT Eric Beaty, National Security Affairs student Matt Kiefer, recent distance learning graduate
Resonance – Journal of Science Education | Indian Academy of ...
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 3. General Relativity and the Accelerated Expansion of the Universe. Patrick Das Gupta. General Article Volume 17 Issue 3 March 2012 pp 254-273. Fulltext. Click here to view fulltext PDF. Permanent link:
Identifying and Solving the Real Problems Facing the Integrated Disability Evaluation System (IDES)
2013-06-14
353. Boal, Kimberly B., and Patrick L. Schultz. 2007. Storytelling , time and evolution: The role of strategic leadership in complex adaptive...culture, change and emotions : A qualitative study. Journal of Change Management 9, no. 4: 435-457. Snavely, Kevin, and Uday Desai. Mapping local
Dangerous Gulf? The Relationship between America and its All-Volunteer Military
2013-03-01
altering transformations like finding or converting to a new religion, or even turning Vegan . The pronounced changes brought on by a dramatic change...846961/celebrating- motherhood-how-becoming-a-mom-changes-you (accessed January 14, 2008); Colleen Patrick- Goudreau, “The Joyful Vegan : Stories of
South African Medical Journal - Vol 89, No 9 (1999)
African Journals Online (AJOL)
Measurements of iron status and survival in African iron overload · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. A Patrick MacPhail, Eberhard M Mandishona, Peter D Bloom, Alan C Paterson, Tracey A Rouault, Victor R Gordeuk ...
2011-05-11
... International Business Machines Corporation; The AM3 Irrevocable Trust; International Business Machines..., M.D.; Celgene Corporation; Dr. Patrick Soon-Shiong, M.D. 20110722 G Schneider Electric SA; Weston Presidio V, L.P.; Schneider Electric SA. 20110728 G Charles W. Ergen; Blockbuster Inc.--Debtor-in...
Tanzania Journal of Agricultural Sciences - Vol 14, No 1 (2015)
African Journals Online (AJOL)
Agricultural drought analysis for sustainable smallholder maize production in semi-arid areas: a case study of the Lower Moshi Irrigation Scheme, Tanzania · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Patrick Bell, Didas Kimaro, Rattan Lal ...
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.
A glimpse into the littoral nutrient dynamics of a lake system connected to the sea
CSIR Research Space (South Africa)
Taljaard, Susan
2018-01-01
Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. https://doi.org/10.1016/j.agwat.2008.06.013 CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...
清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として
梁, 艶; Liang, Yan
2011-01-01
Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...
The Secret of Guided Missile Re-Entry,
1986-06-25
I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED
Initiation and Propagation of Coronal Mass Ejections P. F. Chen
Indian Academy of Sciences (India)
Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...
Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?
Directory of Open Access Journals (Sweden)
Verschwele, Arnd
2014-07-01
Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.
Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen
Directory of Open Access Journals (Sweden)
Ingrid Biermann
2003-03-01
Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.
CERN PhotoLab
1977-01-01
From face, 1st raw: Erich Lohrmann, Sergio Fubini, Léon Van Hove, John Adams (Directors-General), Paul Levaux (President of the Council) Hans-Otto Wüster, Franco Bonaudi, Robert Lévy-Mandel and 2nd raw, centre: Patrick Mollet, Eliane de Modzelewska, Jean-Marie Dufour
African Journal of Infectious Diseases - Vol 10, No 1 (2016)
African Journals Online (AJOL)
Review of past and present Ebola hemorrhagic fever outbreaks in the Democratic Republic of Congo 1976 -2014 · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Auralie Kasangye Kangoy, Guy Mutangala Muloye, Patrick Mawupemor Avevor, Li Shixue, 38-42.
DEFF Research Database (Denmark)
Elias, Camelia
Acker, Friedrich Nietzsche, David Markson, Andrei Codrescu, and a host of others, gather here to offer an answer. --"Camelia Elias speaks to the reader from that place where the language of the birds becomes the language of silence." (Patrick Blackburn, Professor of Formal Logic, Roskilde University)...
76 FR 52641 - Open Meeting Notice; Advisory Council on Dependents' Education
2011-08-23
... committee meeting of the Advisory Council on Dependents' Education will take place. DATES: Tuesday, December... the Advisory Council on Dependents' Education, Dr. Patrick A. Dworakowski, 4040 North Fairfax Drive... this date may not be provided to or considered by the Advisory Council on Dependents' Education until...
African Journals Online (AJOL)
raoul
2011-03-14
Mar 14, 2011 ... Zipporah Gatheru8, Patrick Wamae Maranga9, Alassane Dicko10, Adegoke Gbadegesin Falade11, Angeline Yvette Crescence Boula12, Stephanus. Benjamin Kuit13, Olumuyiwa O Odusanya14, Papa Salif Sow15, Nuruddin Lakhani16, Evans Mwila Mpabalwani17, Jean-Jacques Muyembe Tamfum18,.
Kivirähk, Pinter ja Inglise spioonid Rakvere teatris / Kristo Kruusman
Kruusman, Kristo
2010-01-01
Tänavu 70. sünnipäeva tähistava teatri repertuaaris on mitu uuslavastust: Andrus Kivirähk "Kaelkirjak", lavastaja Marion Undusk, Patrick Barlow’ spioonikomöödia „39 astet”, lavastaja Kati Kivitar ja Harold Pinteri näidend „Eikellegimaa”, lavastajaks Peeter Raudsepp
2016-11-30
hierarchies on (001)- and (111)-oriented quantum well structures. Our results demonstrate the unprecedented capability of electron holographic...SrTiO3” Feng Bi, Mengchen Huang, Chung-Wung Bark, Sangwoo Ryu, Sanghan Lee, Chang-Beom Eom, Patrick Irvin and Jeremy Levy, J. Appl . Phys. 119
2011-12-09
...'Tonya Davis Sheryl Lard-Whiteford David Elder Murray Lumpkin Denise Esposito William Maisel Tracy Forfa... Steven Solomon Daniel McChesney Stephen Spielberg William McConagha Roberta Wagner Patrick McGarey David... Murphy Donald Zink Melinda Plaisier Lynne Rice Mark Roh James Sigg Steven Silverman Howard Sklamberg...
75 FR 16520 - James A. Fitzpatrick Nuclear Power Plant; Exemption
2010-04-01
... Power Plant; Exemption 1.0 Background Entergy Nuclear Operations, Inc. (the licensee) is the holder of Facility Operating License No. DPR-59, which authorizes operation of the James A. FitzPatrick Nuclear Power... date for all operating nuclear power plants, but noted that the Commission's regulations provide...
Association for Education in Journalism and Mass Communication.
The Media Ethics Division section of the proceedings contains the following seven papers: "The Concept of Media Accountability Reconsidered" (Patrick Lee Plaisance); "Of Joint Ventures, Sock Puppets and New Media Synergy: Codes of Ethics and the Emergence of Institutional Conflicts of Interest" (Charles N. Davis and Stephanie…
African Journals Online (AJOL)
Items 151 - 180 of 180 ... Vol 33 (2014), Socioeconomic determinants of e-government adoption in selected districts of Tanzania, Abstract. Mercy Mlay Komba, Patrick Ngulube. Vol 30 (2011), Student Assessment of the Master of Philosophy in Information Sciences (Records and Archives Management) Degree Programme at ...
Critique of the Graduate Nurse: An International Perspective.
Greenwood, Jennifer
2000-01-01
Nurses in service fault beginning nurses' insufficient clinical and patient management skills. Nurse educators maintain that practicing nurses do not facilitate the transition of entry-level nurses. More collaboration between teachers and practitioners is needed. (Commentaries by Sally Glen, Patrick Crookes, and Pam Walter follow.) (SK)
Moore on Mercury the planet and the missions
Moore, Patrick
2007-01-01
In his inimitable style, Patrick Moore describes Mercury. He tells of those who have observed it over the centuries, and the past, present and future space missions to it. In doing so he has written the most up-to-date book about Mercury for amateur astronomers.
2008-01-01
Vannitoa mööbli, peeglite, vannide, kraanikausside ja aksessuaaride valmistamisele spetsialiseerunud Antonio Lupi tehasest Itaalias. Koostööd tehakse itaalia disaineritega, nagu Carlo Colombo, Mauro Carlesi, Nevio Tellatin, Anne ja Patrick Poirier. Eestis saab tootenäidistega tutvuda salongis Gerhard Vannitoad (Maakri 19/21, Tallinn)
Millennial Generation Spirituality and Religion in the United States Army
2013-04-01
influenced Millennial Generation spirituality and practice. They have moved toward the same relativism , tolerance, and community in their spiritual...Patrick J. Sweeney, Sean T. Hannah, and Don M. Snider, The Domain of the Human Spirit, Ch. 2 of Forging the Warrior’s Character, Moral Precepts From
Club de Pétanque
2016-01-01
Pour la troisième année se disputait le Challenge de notre ami Patrick Durand. C'est sous un soleil radieux et une température tout à fait estivale que 42 compétiteurs honoraient ce concours qui nous obligeait de faire les équipes en formation de triplettes pour cause du manque de nombres de terrains. Andréa l'amie de Patrick avec ces cousins ainsi que le président du club de Crissier et quatre de ces membres nous faisaient l'honneur d'être présents. Après trois parties très disputées Claude Jouve toujours dans sa fonction de juge arbitre devait déclarer vainqueur son frère Christian Jouve qui bat au goal-average Claude Macari (vainqueur l'an passé), Mario du club de Crissier ainsi que Michèle Dunand tou...
Staff members with 25 years' service at CERN in 2005
2005-01-01
The 74 staff members who have spent 25 years at CERN in 2005 were invited by the Director-General to a reception in their honour on 22 November. ADRIAN Gilbert / AB ALLIOD Marie-Noëlle / AB ANTOINET Gérard / SC AUBERT Marc / TS AUQUIER Christian / SC BAIRD Simon / AB BARRAS Suzanne / PH BAUD Richard / AT BELLONI Jean / SC BERTUOL Gilbert / SC BLANC Jean-Luc / AB BONVALLET Guy / SC BOSSUS Patrice / SC BROERE Johannes / AB BRU Yvon / TS BURDAIRON Alain / TS CANARD Philippe / AT CAVALLO Patrice / SC CHARRA Patrick / PH CHATAIGNEAU Marc / SC COLIN Gilles / SC DAHLEN Pierre / AB DE GROOT Johannes / PH DEDOBBELER Bernard / TS DELCAMBRE Jean Pierre / SC DELENCLOS Yves / TS DEROYER Patrick / SC DESBISSONS Christian / SC DRAPER Mick / AB DROUX Pascal / FI DUCASTEL Claude / TS DUMUR Alain / SC FOCKER Gerrit / AB FOFFANO Giuseppe / TS FORRAT Isabelle / IT FREI Marie-José / DSU FRESSARD Michel / TS GAGNIERE Daniel / TS GIUDICI Pierre-Ange / PH GOICOECHEA Bernard / TS GUEHO Alain / TS GUENEHEC François / SC JE...
African Journals Online (AJOL)
Items 551 - 600 of 985 ... Vol 30 (2015), Modelling Monthly Mental Sickness Cases Using Principal Component Regression Method, Abstract. Patrick O Aye. Vol 18 (2011), Modelling of California Bearing Ratio with Unconfined Compressive Strength for Cement Stabilized Laterite Soil, Abstract. SD Iyeke, SO Osuji. Vol 12 (2008) ...
Indian Academy of Sciences (India)
18 Computing the Symmetry Groups of the Platonic. Solids With the Help of Maple. Patrick J Morandi. 27 Bacterialleaching. Biotechnology in the Mining Industry. Preston Devasia and K A Natarajan. 35 Detergents - Zeolites and Enzymes Excel Cleaning. Power. B S Sekhon and Manjeet K Sangha. 46 Heisenberg, Matrix ...
2011-02-11
... PATRICK COYLE BRENDAN H D'ALVIELLA EUGENIE AIMEE GOBLET DARWIN ANGELA MARY BRUCE DAVID CARY RICHARD DAVID... ELIZABETH U FUNG PASCALE N GIBSON MATTHEW CHARLES GIBSON SARAH CLAIRE GIDRON GILLA MEZZAN GINDIN DMITRY... LINDA ANETTE HANSEN PAUL ROBERT HARDWICK III CHARLES CHEEVER HARRIS JANE VELDA HARSONO SUDARGO HARTLEY...
Aeronautical Engineering: A Continuing Bibliography with Indexes (Supplement 216)
1987-08-01
HELO COMPUTER-AIDED PROCESSES FOR THE GROUND TESTING PATRICK J. DONOGHUE, PREBEN JENSEN, and ROBERT M. OF AVIATION EQUIPMENT [ SISTEMA ZADACH PROEKTIRO...Exploitation of Landes The digitall map as a tactical situation display DYAI EPNE(Frencee)-Front campaign and complesmentairy p 423 A87-3t4117
Long-term continuous administration of a hydro-ethanolic extract of ...
African Journals Online (AJOL)
However patients with renal or cardiac problems should use the plant with caution. Funding: Jointly supported by the International Foundation for Science, Stockholm, Sweden, through a grant (# F/5191-1) to Dr. Patrick Amoateng and the Office of Research, Innovation and Development (ORID), University of Ghana, Accra, ...
Combining Performance and Flexibility for RMS with a Hybrid Architecture
Dennis Koole; Arjan Groenewegen; Daniël Telgen; Patrick Wit; Leo van Moergestel; Arjan van Zanten; John-Jules Meyer; Ing. Erik Puik; Dick van der Steen; Pascal Muller
2013-01-01
Author supplied Combining Performance and Flexibility for RMS with a Hybrid Architecture Dani¨el Telgen 12? , Leo van Moergestel 1 , Erik Puik 1 , Pascal Muller 1 , Arjan Groenewegen 1 , Dick van der Steen 1 , Dennis Koole 1 , Patrick de Wit 1 , Arjen van Zanten 1 , and John-Jules
It is generally appreciated that estuaries are productive systems that ...
African Journals Online (AJOL)
spamer
Marine & Coastal Management, Private Bag X2, Rogge Bay 8012, South ... Percy FitzPatrick Institute, University of Cape Town, Rondebosch 7701, .... Va – Obligate catadromous species that require a freshwater phase in their development .... It is difficult to attribute the actual contribution of ... The 14 factors described in.
Antibiotic stewardship – it starts with you!
African Journals Online (AJOL)
implemented along with infection control measures, especially hand hygiene interventions ... thrown its support behind a National Strategic Framework tackling ... This open-access article is distributed under ... Hughes JS, Hurford A, Finley RL, Patrick DM, Wu J, Morris AM. How to ... Dedicated to quality care for the critically ill.
Reference: 696 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 696 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u18047472i Harrison B...gravity signal transduction pathway in root statocytes. 2 380-92 18047472 2008 Jan The Plant journal Harrison Benjamin R|Masson Patrick H
2018-05-09T08:04:19Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/24359 2018-05-09T08:04:19Z ajfm:ART Equity and VAT in Tanzania. Mugoya, Patrick KD It is normally argued that Value Added Tax (VAT) is essentially regressive in the sense that all consumers pay the same amount of the tax per unit of ...
sand. This provides a suitable location for the entrance to gerbil ...
African Journals Online (AJOL)
COLOUR OF FERAL CATS ON. DASSEN ISLAND. J. COOPER. FitzPatrick Institute,. University of Cape Town and five 'control' seeds had germinated after three weeks. Roughly equal numbers of 'control' and 'ingested' seeds (43 and 39 respectively) bad., however, genninated 13 weeks after planting. It appears, therefore ...
76 FR 58277 - Performance Review Board Members
2011-09-20
.... Cantrell, Patrick H. Conway, Kathleen M. Crosby, John Czajkowski, Cheryl R. Dammons, Michelle S. Davis..., William B. Schultz, Neil Shapiro, Jeremy B. Sharp, George H. Sheldon, Steven D. Silverman, Rebecca T... E. Tyler Jr., Stephen J. Veneruso, Karen V. Walker Bryce, Luis A. Wilmot, Holly J. Wong, Robert K...
Optimum profit model considering production, quality and sale problem
Chen, Chung-Ho; Lu, Chih-Lun
2011-12-01
Chen and Liu ['Procurement Strategies in the Presence of the Spot Market-an Analytical Framework', Production Planning and Control, 18, 297-309] presented the optimum profit model between the producers and the purchasers for the supply chain system with a pure procurement policy. However, their model with a simple manufacturing cost did not consider the used cost of the customer. In this study, the modified Chen and Liu's model will be addressed for determining the optimum product and process parameters. The authors propose a modified Chen and Liu's model under the two-stage screening procedure. The surrogate variable having a high correlation with the measurable quality characteristic will be directly measured in the first stage. The measurable quality characteristic will be directly measured in the second stage when the product decision cannot be determined in the first stage. The used cost of the customer will be measured by adopting Taguchi's quadratic quality loss function. The optimum purchaser's order quantity, the producer's product price and the process quality level will be jointly determined by maximising the expected profit between them.
Choi, Younsung; Nam, Junghyun; Lee, Donghoon; Kim, Jiye; Jung, Jaewook; Won, Dongho
2014-01-01
An anonymous user authentication scheme allows a user, who wants to access a remote application server, to achieve mutual authentication and session key establishment with the server in an anonymous manner. To enhance the security of such authentication schemes, recent researches combined user's biometrics with a password. However, these authentication schemes are designed for single server environment. So when a user wants to access different application servers, the user has to register many times. To solve this problem, Chuang and Chen proposed an anonymous multiserver authenticated key agreement scheme using smart cards together with passwords and biometrics. Chuang and Chen claimed that their scheme not only supports multiple servers but also achieves various security requirements. However, we show that this scheme is vulnerable to a masquerade attack, a smart card attack, a user impersonation attack, and a DoS attack and does not achieve perfect forward secrecy. We also propose a security enhanced anonymous multiserver authenticated key agreement scheme which addresses all the weaknesses identified in Chuang and Chen's scheme.
[A review for a traditional Chinese medical journal Shou Shi Yi Bao].
Xiao, Mei-Hua; Sun, Wen-Zhong
2009-06-01
Shou Shi Yi Bao was a journal of traditional Chinese medicine (TCM) during the period from 1935 to 1937, and was originated by Chen Huan-yun, a TCM physician in Suzhou. It is mainly to transmit the knowledge of TCM and to promote the epidemic prevention capacity of local public. The editorial characteristics and historical value of the journal were explored in initial background, staff writers, editorial policies, contents and the Editor Chen's medical ideas. Shou Shi Yi Bao was supported by many famous TCM physicians, although the journal was originated from the civil society. It was an academic TCM journal with perfect practicability for orientating to the public and highlighting the academic spirit. Chen Huan-yun was a resolute defender of TCM, and had many opinions on clinical practice and lots of scientific suggestions on TCM development. Shou Shi Yi Bao reflected the main characteristics of TCM journals in 1930s. The journal was one of the important documents to study the TCM history during the period of the Republic of China in Jiangsu Province, and it also set a stage for the struggle between TCM and Western medicine at that time. The documentary information of the journal has literature and history values in reflecting the historical process of TCM self-improvement. The success of the journal was due to not only the broken-up sectarian bias and cooperation of the TCM practitioners but also the preponderant geographic and cultural circumstances of Suzhou as well as Chen Huan-yun's profound knowledge in traditional Chinese culture and medicine.
African Journals Online (AJOL)
Items 101 - 108 of 108 ... Issue, Title. Vol 8, No 2 (2016), The status and challenges of clinical informatics development in South Africa, Abstract PDF. Abayomi Kehinde Owolabi, Thokozani Patrick Mhlongo, Neil Evans. Vol 4, No 1 (2012), The stuttering implementation of language policies in the South African education system ...
Consumers, Creators or Commentators? Problems of Audience and Mission in the Digital Humanities
Prescott, Andrew
2012-01-01
A 2008 article by Patrick Juola describes the digital humanities community as marginal to mainstream academic discussions and suggests that its work has little scholarly impact. At the same time, mainstream humanities scholars are using digital resources more and more, but these resources are chiefly produced by libraries and commercial…
African Journals Online (AJOL)
Oshevire, Patrick. Vol 30 (2015) - Articles Load Flow Analysis of a 15Mva Injection Substation Abstract · Vol 30 (2015) - Articles Design and Construction of a Home Automation System Using a Smart Phone Abstract. ISSN: 1116-4336. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...
76 FR 22907 - Center for Scientific Review; Notice of Closed Meetings
2011-04-25
... Chase Pavilion, 4300 Military Road, NW., Washington, DC 20015. Contact Person: Patrick K Lai, PhD... 20892, 301-408- 9901, [email protected] . Name of Committee: Brain Disorders and Clinical Neuroscience Integrated Review Group; Developmental Brain Disorders Study Section. Date: June 2-3, 2011. Time: 8 a.m. to 5...
Influence of hatching order and brood size on growth in jackass ...
African Journals Online (AJOL)
1991-06-26
Jun 26, 1991 ... Percy FitzPatrick Institute of African Ornithology, University of Cape Town, Private Bag, Rondebosch, ... Singletons showed only a non-significant trend towards faster growth in mass ... may adversely affect rates of provisioning to chicks, food ..... tions were so bad as to result in chick mortality (van Heezik.
Large numbers of seabirds are killed each year by long- line ...
African Journals Online (AJOL)
denise
member nations to produce “Plans of Action for ... Percy FitzPatrick Institute, University of Cape Town, Rondebosch 7701, South Africa. ... Marine & Coastal Management, Private Bag X2, Rogge Bay 8012, Cape Town, ... Affairs and Tourism, were placed aboard tuna long- ... a South African port once, making it difficult to de-.
Journal of Earth System Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Ata Allah Nadiri1 2 Asghar Asghari Moghaddam1 Frank T-C Tsai2 Elham Fijani1 2. Department of Geology, University of Tabriz, 29 Bahman Boulevard, Tabriz, East Azerbaijan, Iran. Department of Civil and Environmental Engineering, Louisiana State University, 3418G Patrick F. Taylor Hall, Baton Rouge, LA 70803, USA.
Confirmation of AT 2017eaw, a Probable Supernova in NGC 6946
Dong, Subo; Stanek, K. Z.
2017-05-01
Supernova candidate AT 2017eaw was discovered by Patrick Wiggins at 12.8 mag on 2017-05-14 05:42:43. We confirmed AT 2017eaw with images taken by Las Cumbres Observatory (LCO)'s 1m telescope at McDonald observatory on UT 2017-05-14 10:30:31.
Keller, George, Ed.
This anthology contains selections from "Planning for Higher Education," the quarterly journal of the Society for College and University Planning. Following the preface, the second section, "Coming Changes in Academe," contains these articles: (1) "Designing Colleges for Greater Learning" (Ernest Pascarella and Patrick Terenzini, v20 n3); (2) "The…
From PT-symmetric quantum mechanics to conformal field theory
Indian Academy of Sciences (India)
Author Affiliations. Patrick Dorey1 Clare Dunning2 Roberto Tateo3. Department of Mathematical Sciences, Durham University, Durham DH1 3LE, UK; IMSAS, University of Kent, Canterbury CT2 7NF, UK; Dip. di Fisica Teorica and INFN, Università di Torino, Via P. Giuria 1, 10125 Torino,Italy ...
Nationalism, Mass Politics, and Sport: Cold War Case Studies at Seven Degrees
2008-06-01
recognized state.”34 Patrick O’Neil maintains nationalism is “a pride in one’s people and the belief that they have their own sovereign political destiny ...because of nationalist movements and the peoples’ desires for self-rule. Colonialism provided the embryo in which the nation- state would gestate.57
Conflicts between Two Religious Cultures: Achieving Reconciliation ...
African Journals Online (AJOL)
Religion Dept
Conflicts between Two Religious Cultures: Achieving Reconciliation. Patrick E. Nmah ... origins of human life in Africa in order to underline in an African way the new kind of life of an African ... oneself fast to God”, while religere means to choose and select again. .... create development, tolerance, love and lasting peace.
Vedder-Weiss, Dana; Fortus, David
2018-01-01
Employing achievement goal theory (Ames "Journal of Educational psychology," 84(3), 261-271, 1992), we explored science teachers' instruction and its relation to students' motivation for science learning and school culture. Based on the TARGETS framework (Patrick et al. "The Elementary School Journal," 102(1), 35-58, 2001) and…
78 FR 63460 - Performance Review Board Membership
2013-10-24
..., Deputy Chief of Staff, G-1/4 (Personnel and Logistics), United States Army Training and Doctrine Command... Reserve Affairs) 22. Mr. Matthew L. Scully, Deputy Chief of Staff G-8, United States Army Training and... the Assistant Secretary of the Army (Acquisition, Logistics and Technology) 7. Mr. Patrick K. Hallinan...
Overcoming Degraded Communications under A2AD: A Doctrinal Solution
2014-05-15
LCDR Travis K. Suggs, USN 5e. TASK NUMBER Paper Advisor: Prof. Patrick Sweeney, Ph.D.& CAPT Andrew Norris , USCG 5f. WORK UNIT NUMBER...Newport, RI, 2010),.9. 6 war syndrome .” 16 The Joint Force is slowly recovering from nearly a decade of combat operations in Iraq and Afghanistan
Evolution of a Computer-Based Testing Laboratory
Moskal, Patrick; Caldwell, Richard; Ellis, Taylor
2009-01-01
In 2003, faced with increasing growth in technology-based and large-enrollment courses, the College of Business Administration at the University of Central Florida opened a computer-based testing lab to facilitate administration of course examinations. Patrick Moskal, Richard Caldwell, and Taylor Ellis describe the development and evolution of the…
Saine diversification des repas servis dans les écoles grâce aux ...
International Development Research Centre (IDRC) Digital Library (Canada)
Saine diversification des repas servis dans les écoles grâce aux innovations en agriculture. 03 janvier 2018. Wendy-Ann Isaac, Gaius Eudoxie, Patrick Cortbaoui, Wayne Ganpat et Sylvia Borucki. Des élèves qui mangent un repas à l'école. Photo : Arne Hoel / Banque mondiale ...
Freedom’s Gate: The Southern Insurgency in the American Revolution, 1770-1781
2014-01-01
cruelty a parallel to the history of our Scottish fathers?" 16 Had he survived the Battle of King’s Mountain, Patrick Ferguson had intended on spending...the independence of the State." After his forceful enunciation of prior principles, Hill reported "visible animation in the countenance of the
75 FR 13323 - James A. Fitzpatrick Nuclear Power Plant; Exemption
2010-03-19
... Power Plant; Exemption 1.0 Background Entergy Nuclear Operations, Inc. (the licensee) is the holder of... nuclear power plants that were licensed before January 1, 1979, satisfy the requirements of 10 CFR Part 50...), as supplemented by letter dated March 30, 2009, ``James A. FitzPatrick Nuclear Power Plant-Response...
Diagnosis of Salmonella Enteritidis Infection in Broiler Chickens ...
African Journals Online (AJOL)
Diagnosis of Salmonella Enteritidis Infection in Broiler Chickens Using Elisa. ES Soliman, E Taha, WS Abdella, C KilPatrick, AN Wise, MAA Sobieh, PG Reddy. Abstract. The program for the eradication of Salmonella Enteritidis from chickens was based on bacteriological examination of breeding flocks. There is a great need ...
2010-06-09
... June 23, 2010. A. Federal Reserve Bank of Chicago (Colette A. Fried, Assistant Vice President) 230 South LaSalle Street, Chicago, Illinois 60690-1414: 1. John V. Tippmann, Sr., as an individual, and John V. Tippman, Sr.; John and Helen McCarthy; Richard and Sally Ley; John Tippman, Jr.; Patrick Tippman...
2010-07-01
..., 2010. A. Federal Reserve Bank of Chicago (Colette A. Fried, Assistant Vice President) 230 South LaSalle Street, Chicago, Illinois 60690-1414: 1. John V. Tippmann, Sr., as an individual; John V. Tippmann, Sr.; John and Helen McCarthy; Richard and Sally Ley; John Tippmann, Jr.; Patrick Tippmann; and Brian and...
Sex, snakes and violence / Sherwin Das, Tim Ochser
Das, Sherwin
2006-01-01
Patrick Süskindi krimiromaani "Parfüüm" ekraniseering "Perfume: The Story of a Murderer" : režissöör Tom Tykver : Ameerika Ühendriigid - Saksamaa 2006. Õuduspõnevik "Maod lennukis" ("Snakes on a Plane") : režissöör David R. Ellis : Ameerika Ühendriigid 2006
Water-Filled Telescopes and the Pre-History of Fresnel's Ether Dragging
DEFF Research Database (Denmark)
Pedersen, Kurt Møller
2000-01-01
The idea of measuring stellar aberration with a water-filled telescope was entertained from the middle of the 18th century by Thomas Melvill, Patrick Wilson, Roger Joseph Boscovich, and John Robison. I shall discuss their ideas as well as those discussed by Thomas Young, Francois Arago, and Augus...
Congress of the U.S., Washington, DC. Senate Committee on the Judiciary.
This document presents witness testimony and supplemental materials from a Congressional hearing called to address pornography in cyberspace. It features opening statements by Senator Charles E. Grassley and Senator Patrick J. Leahy; and statements by Senators Strom Thurmond, Russell D. Feingold, Orrin G. Hatch, Chairman of the Senate Committee on…
African Journals Online (AJOL)
Bell, Patrick. Vol 14, No 1 (2015) - Articles Agricultural drought analysis for sustainable smallholder maize production in semi-arid areas: a case study of the Lower Moshi Irrigation Scheme, Tanzania Abstract PDF. ISSN: 0856 668X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians ...
2012-02-10
Cremer , J-Y Chen, C.K. Westbrook, L.Q. Maurice, J. Propul. Power 18 (1) (2002) 192–198. K. Harstad, J. Bellan / Combustion and Flame 157 (2010) 1594... Cremer , J.-Y. Chen, C.K. Westbrook, L.Q. Maurice, J. Propuls. Power 18 (1) (2002) 192–198. a 10-9 10-7 10-5 10-3 10-1 101 N oh (m ol /m 3 ) T0 = 800...Caltech by the Army Research Office under the direction of Drs. David Mann, Kevin McNesby and Ralph Anthenien. References 1U. C. Müeller, N. Peters, A
Spiegelberg, Jakob; Rusz, Ján
2015-12-01
In the framework of the slice transition operator technique, a general multislice theory for electron scattering in crystals is developed. To achieve this generalization, we combine the approaches for inelastic scattering derived by Yoshioka [J. Phys. Soc. Jpn. 12, 6 (1957)] and backscattering based on the formalism of Chen and Van Dyck [Ultramicroscopy 70, 29-44 (1997)]. A computational realization of the obtained equations is suggested. The proposed computational scheme is tested on elastic backscattering of electrons, where we consider single backscattering in analogy to the computational scheme proposed by Chen and Van Dyck. Copyright © 2015 Elsevier B.V. All rights reserved.
Bigelow, Terry Patrick; Ried, C. A.
2006-01-01
The first part of this article recounts the experiences of a language arts teacher, Terry Patrick Bigelow, and his former student, Cynthia (Noyes) Ried, who suffers from Fahr's Syndrome, a neurodegenerative congenital disease that forms calcium deposits deep inside the brain. It is irreversible, inoperable, and incurable. In the first part of the…
The CERN Control Centre is up and running!
Maximilien Brice
2006-01-01
The CERN Control Centre (CCC) that combines all the control rooms for the accelerators, the cryogenic system and the technical infrastructure came into operation on 1st February. On 1st February, at 2.00 p.m., Patrick Villeton Pachot started the first Technical Infrastructure shift at the brand new CERN Control Centre.
Russell Crowe maailma tipust maailma äärele / Timo Diener
Diener, Timo
2003-01-01
Näitleja Russell Crowe ja tema suhe oma rolliga seiklusfilmis "Kapten ja komandör : retk maailma äärele" ("Master and Commander : The Far Side of the World") : stsenarist Patrick O'Briani romaanide järgi ja režissöör Peter Weir : peaosas Russell Crowe : Ameerika Ühendriigid 2003
A Design for Life: A Consideration of the Learning Legacy of P.H. Pearse's "The Murder Machine"
Cronin, James G. R.
2016-01-01
In the centenary of the death of Patrick Henry Pearse--one of the leaders of Ireland's 1916 Rebellion--it is interesting to reflect on the relevance of his writing for contemporary approaches to lifelong and lifewide learning. Pearse's essay "The Murder Machine" was forged within the tradition of progressive education movements in the…