WorldWideScience

Sample records for time rt-pcr sybr

  1. Comparison and evaluation of conventional RT-PCR, SYBR green I and TaqMan real-time RT-PCR assays for the detection of porcine epidemic diarrhea virus.

    Science.gov (United States)

    Zhou, Xinrong; Zhang, Tiansheng; Song, Deping; Huang, Tao; Peng, Qi; Chen, Yanjun; Li, Anqi; Zhang, Fanfan; Wu, Qiong; Ye, Yu; Tang, Yuxin

    2017-06-01

    Porcine epidemic diarrhea (PED) caused by porcine epidemic diarrhea virus (PEDV) is a highly contagious intestinal disease, resulting in substantial economic losses to the swine industry worldwide. In this study, three assays, namely a conventional reverse transcription-polymerase chain reaction (RT-PCR), a SYBR Green I real-time RT-PCR and a TaqMan real-time RT-PCR targeting the highly conserved M gene of PEDV, were developed and evaluated. Then, the analytical specificity, sensitivity and reproducibility of these assays were determined and compared. The TaqMan real-time RT-PCR was 100-fold and 10,000-fold more sensitive than that of the SYBR Green I real-time RT-PCR and the conventional RT-PCR, respectively. The analytical sensitivity of TaqMan real-time RT-PCR was 10 copies/μl of target gene and no cross amplification with other viruses tested was observed. With the features of high specificity, sensitivity, and reproducibility, the TaqMan real-time RT-PCR established in this study could be a useful tool for clinical diagnosis, epidemiological surveys and outbreak investigations of PED. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR

    Directory of Open Access Journals (Sweden)

    Lou Sai

    2011-07-01

    Full Text Available Abstract Background Bovine viral diarrhea virus (BVDV is a worldwide pathogen in cattle and acts as a surrogate model for hepatitis C virus (HCV. One-step real-time fluorogenic quantitative reverse transcription polymerase chain reaction (RT-PCR assay based on SYBR Green I dye has not been established for BVDV detection. This study aims to develop a quantitative one-step RT-PCR assay to detect BVDV type-1 in cell culture. Results One-step quantitative SYBR Green I RT-PCR was developed by amplifying cDNA template from viral RNA and using in vitro transcribed BVDV RNA to establish a standard curve. The assay had a detection limit as low as 100 copies/ml of BVDV RNA, a reaction efficiency of 103.2%, a correlation coefficient (R2 of 0.995, and a maximum intra-assay CV of 2.63%. It was 10-fold more sensitive than conventional RT-PCR and can quantitatively detect BVDV RNA levels from 10-fold serial dilutions of titrated viruses containing a titer from 10-1 to 10-5 TCID50, without non-specific amplification. Melting curve analysis showed no primer-dimers and non-specific products. Conclusions The one-step SYBR Green I RT-PCR is specific, sensitive and reproducible for the quantification of BVDV in cell culture. This one-step SYBR Green I RT-PCR strategy may be further optimized as a reliable assay for diagnosing and monitoring BVDV infection in animals. It may also be applied to evaluate candidate agents against HCV using BVDV cell culture model.

  3. Development and evaluation of a SYBR green-based real time RT-PCR assay for detection of the emerging avian influenza A (H7N9 virus.

    Directory of Open Access Journals (Sweden)

    Zheng Zhu

    Full Text Available Most recently a novel avian-origin influenza A (H7N9 virus emerged in China and has been associated with lots of human infection and fatal cases. Genetic analysis of the viral genome revealed that this reassortant virus might be better adapted to humans than other avian influenza viruses. Molecular diagnostic methods are thus urgently needed in public health laboratories. In this study, a SYBR green-based one-step real time reverse transcription-PCR (RT-PCR was developed to detect the novel H7N9 virus. The primer pairs on the basis of the hemagglutinin and neuraminidase gene sequences of H7N9 viruses amplified subtype-specific fragments with Tm values of 80.77±0.06°C for H7 and 81.20±0.17°C for N9 respectively. The standard curves showed a dynamic linear range across 6 log units of RNA copy number (10(6 to 10(1 copies/ µl with a detection limit of 10 copies per reaction for both H7 and N9 assays by using serial ten-fold diluted in-vitro transcribed viral RNA. In addition, no cross-reactivity was observed with seasonal H1N1, H1N1 pdm09, H3N2, H5N1 and H9N2 viruses as well as other human respiratory viruses. When the assay was further evaluated in H7N9 virus infected clinical samples, positive amplification signals were obtained in all of the specimens with the accordance between H7 and N9 assays. Therefore, the established SYBR green-based real time RT-PCR assay could provide a rapid, sensitive, specific and reliable alternative approach with lower costs for high throughput screening of suspected samples from humans, animals and environments in first line public health laboratories.

  4. Relative quantification and detection of different types of infectious bursal disease virus in bursa of Fabricius and cloacal swabs using real time RT-PCR SYBR green technology

    DEFF Research Database (Denmark)

    Li, Yiping; Handberg, K.J.; Kabell, Susanne

    2007-01-01

    In present study, different types of infectious bursal disease virus (IBDV), virulent strain DK01, classic strain F52/70 and vaccine strain D78 were quantified and detected in infected bursa of Fabricius (BF) and cloacal swabs using quantitative real time RT-PCR with SYBR green dye. For selection...... or F52/70 inoculation were detected as virus positive at day I post inoculation (p.i.). The D78 viral load peaked at day 4 and day 8 p.i., while the DK01 and F52/70 viral load showed relatively high levels at day 2 p.i. In cloacal swabs, viruses detectable were at day 2 p.i. for DK01 and F52/70, day 8...... of a suitable internal control gene, real time PCR parameters were evaluated for three candidate genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 28S rRNA and beta-actin to IBDVs. Based on this P-actin was selected as an internal control for quantification of IBDVs in BF. All BF samples with D78, DK01...

  5. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  6. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  7. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    OpenAIRE

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background : Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conven...

  8. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  9. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas....... METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...... rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1...

  11. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  13. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR

    Czech Academy of Sciences Publication Activity Database

    Fajfr, M.; Neubauerová, V.; Pajer, P.; Kubíčková, P.; Růžek, Daniel

    2014-01-01

    Roč. 63, č. 3 (2014), s. 232-238 ISSN 1210-7913 Institutional support: RVO:60077344 Keywords : hemorrhagic fever * filovirus * arenavirus * real-time * RT-PCR – detection Subject RIV: EE - Microbiology, Virology Impact factor: 0.353, year: 2014

  14. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various ...

  15. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    Table 1. Real-time qRT-PCR verification of eight DEGS. Gene ID. Gene description. Gene expression RNA-seq comparisons log2(FC) Up/down. Primer sequence. (5' → 3'). Up. Up. Up. Up F: G. BMK.10019 Uncharacterized protein LOC100777071. JL2 vs YZ9253. 1.63. Up. F: TCTGGТGCTTATCGТССТ. JL2 vs JL7. 2.26.

  16. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  17. Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

    Science.gov (United States)

    Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

    2017-01-01

    Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological

  18. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Meloidogyne javanica Chorismate Mutase Transcript Expression Profile Using Real-Time Quantitative RT-PCR

    OpenAIRE

    Painter, Janet E.; Lambert, Kris N.

    2003-01-01

    A developmental expression profile of the Meloidodgyne javanica esophageal gland gene chorismate mutase-1 (Mj-cm-1) could suggest when in the lifecycle of the nematode the Mj-cm-1 product is functional. This study used real-time quantitative RT-PCR to examine the variation in Mj-cm-1 transcript levels over six timepoints in the nematode lifecycle: egg, infective second-stage juveniles (Inf-J2), 2-day post-inoculation (pi), 7-day pi, 14-day pi, and adult. The Mj-cm-1 mRNA levels peaked at 2-da...

  20. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis.

    Science.gov (United States)

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; Garcia, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; Hermoso de Mendoza, Javier

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was used to evaluate clinical samples collected from naturally infected animals with D. congolensis. The results showed that this assay is a fast and reliable method for diagnosing dermatophilosis.

  1. Development of a real-time SYBR Green PCR assay for the rapid detection of Dermatophilus congolensis

    OpenAIRE

    García, Alfredo; Martínez, Remigio; Benitez-Medina, José Manuel; Risco, David; García, Waldo Luis; Rey, Joaquín; Alonso, Juan Manuel; de Mendoza, Javier Hermoso

    2013-01-01

    Methods such as real time (RT)-PCR have not been developed for the rapid detection and diagnosis of Dermatophilus (D.) congolensis infection. In the present study, a D. congolensis-specific SYBR Green RT-PCR assay was evaluated. The detection limit of the RT-PCR assay was 1 pg of DNA per PCR reaction. No cross-reaction with nucleic acids extracted from Pseudomonas aeruginosa, Mycobacterium tuberculosis, Staphylococcus aureus, or Austwickia chelonae was observed. Finally, the RT-PCR assay was ...

  2. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon

    Directory of Open Access Journals (Sweden)

    Nilsen Tom O

    2005-11-01

    Full Text Available Abstract Background Salmonid fishes are among the most widely studied model fish species but reports on systematic evaluation of reference genes in qRT-PCR studies is lacking. Results The stability of six potential reference genes was examined in eight tissues of Atlantic salmon (Salmo salar, to determine the most suitable genes to be used in quantitative real-time RT-PCR analyses. The relative transcription levels of genes encoding 18S rRNA, S20 ribosomal protein, β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH, and two paralog genes encoding elongation factor 1A (EF1AA and EF1AB were quantified in gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine in six untreated adult fish, in addition to a group of individuals that went through smoltification. Based on calculations performed with the geNorm VBA applet, which determines the most stable genes from a set of tested genes in a given cDNA sample, the ranking of the examined genes in adult Atlantic salmon was EF1AB>EF1AA>β-actin>18S rRNA>S20>GAPDH. When the same calculations were done on a total of 24 individuals from four stages in the smoltification process (presmolt, smolt, smoltified seawater and desmoltified freshwater, the gene ranking was EF1AB>EF1AA>S20>β-actin>18S rRNA>GAPDH. Conclusion Overall, this work suggests that the EF1AA and EF1AB genes can be useful as reference genes in qRT-PCR examination of gene expression in the Atlantic salmon.

  3. Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes.

    Science.gov (United States)

    Czechowski, Tomasz; Bari, Rajendra P; Stitt, Mark; Scheible, Wolf-Rüdiger; Udvardi, Michael K

    2004-04-01

    Summary To overcome the detection limits inherent to DNA array-based methods of transcriptome analysis, we developed a real-time reverse transcription (RT)-PCR-based resource for quantitative measurement of transcripts for 1465 Arabidopsis transcription factors (TFs). Using closely spaced gene-specific primer pairs and SYBR Green to monitor amplification of double-stranded DNA (dsDNA), transcript levels of 83% of all target genes could be measured in roots or shoots of young Arabidopsis wild-type plants. Only 4% of reactions produced non-specific PCR products. The amplification efficiency of each PCR was determined from the log slope of SYBR Green fluorescence versus cycle number in the exponential phase, and was used to correct the readout for each primer pair and run. Measurements of transcript abundance were quantitative over six orders of magnitude, with a detection limit equivalent to one transcript molecule in 1000 cells. Transcript levels for different TF genes ranged between 0.001 and 100 copies per cell. Only 13% of TF transcripts were undetectable in these organs. For comparison, 22K Arabidopsis Affymetrix chips detected less than 55% of TF transcripts in the same samples, the range of transcript levels was compressed by a factor more than 100, and the data were less accurate especially in the lower part of the response range. Real-time RT-PCR revealed 35 root-specific and 52 shoot-specific TF genes, most of which have not been identified as organ-specific previously. Finally, many of the TF transcripts detected by RT-PCR are not represented in Arabidopsis EST (expressed sequence tag) or Massively Parallel Signature Sequencing (MPSS) databases. These genes can now be annotated as expressed.

  4. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  5. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Detection of ROS1 gene rearrangement in lung adenocarcinoma: comparison of IHC, FISH and real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ling Shan

    Full Text Available To compare fluorescence in situ hybridization (FISH, immunohistochemistry (IHC and quantitative real-time reverse transcription-PCR (qRT-PCR assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC patients.Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay.Among 60 cases, 16 (26.7%, 13 (21.7% and 20 (33.3% cases were ROS1 positive revealed by IHC, FISH and qRT-PCR, respectively. Using FISH as a standard method for ROS1 fusion detection, the sensitivity and specificity of IHC were 100% and 93.6%, respectively. Three IHC-positive cases, which showed FISH negative, were demonstrated with ROS1 fusion by qRT-PCR analysis. The sensitivity and specificity of qRT-PCR for detection for ROS1 fusion were 100% and 85.1%, respectively. The total concordance rate between IHC and qRT-PCR were 93.3%.IHC is a reliable and rapid screening tool in routine pathologic laboratories for the identification of suitable candidates for ROS1-targeted therapy. Some ROS1 IHC-positive but FISH-negative cases did harbor the translocation events and may benefit from crizotinib.

  7. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  8. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  9. Evaluation of real-time RT-PCR assays for detection and quantification of norovirus genogroups I and II.

    Science.gov (United States)

    Rupprom, Kitwadee; Chavalitshewinkoon-Petmitr, Porntip; Diraphat, Pornphan; Kittigul, Leera

    2017-04-01

    Noroviruses are the leading cause of acute gastroenteritis in humans. Real-time reverse transcription-polymerase chain reaction (real-time RT-PCR) is a promising molecular method for the detection of noroviruses. In this study, the performance of three TaqMan real-time RT-PCR assays was assessed, which were one commercially available real-time RT-PCR kit (assay A: Norovirus Real Time RT-PCR kit) and two in-house real-time RT-PCR assays (assay B: LightCycler RNA Master Hybprobe and assay C: RealTime ready RNA Virus Master). Assays A and B showed higher sensitivity than assay C for norovirus GI, while they all had the same sensitivity (10 3 DNA copies/mL) for GII DNA standard controls. Assay B had the highest efficiency for both genogroups. No cross-reactivity was observed among GI and GII noroviruses, rotavirus, hepatitis A virus, and poliovirus. The detection rates of these assays in GI and GII norovirus-positive fecal samples were not significantly different. However, the mean quantification cycle (Cq) value of assay B for GII was lower than assays A and C with statistical significance (P-value, 0.000). All three real-time RT-PCR assays could detect a variety of noroviruses including GI.2, GII.2, GII.3, GII.4, GII.6, GII.12, GII.17, and GII.21. This study suggests assay B as a suitable assay for the detection and quantification of noroviruses GI and GII due to good analytical sensitivity and higher performance to amplify norovirus on DNA standard controls and clinical samples.

  10. Automated extraction of avian influenza virus for rapid detection using real-time RT-PCR.

    Science.gov (United States)

    Tewari, Deepanker; Zellers, Corey; Acland, Helen; Pedersen, Janice C

    2007-10-01

    Highly pathogenic H5N1 avian influenza (AI) poses a grave risk to human health. An important aspect of influenza control is rapid diagnosis. This study describes the efficiency of AI-RNA extraction utilizing silica-based magnetic beads with robotics and its detection with an influenza A matrix gene real-time RT-PCR from tracheal swabs, and compares it to virus isolation and manual spin column extractions. Analytical sensitivity was assessed by performing dilution analysis and detection of H2N2 AI viral RNA. Diagnostic sensitivity and specificity was assessed by analyzing tracheal swabs collected from H7N2 infected and uninfected chickens. Both manual and robotic extractions detected AI virus at 1log(10)EID(50)/ml. Diagnostic sensitivity and specificity of matrix gene detection with the automated extraction method for chicken tracheal swab specimens was similar to that of virus isolation and the manual extraction method. There were only three discordant results among 212 tested specimens. The main advantages of automated robotic viral nucleic acid extraction are high throughput processing; hands-free operation; and reduction in human and technical error. This study demonstrates successful detection of influenza A virus with magnetic beads utilizing the Qiagen MagAttract cell kit on a BioRobot M48 platform.

  11. Expression patterns of Doppel gene in golden hamster: quantification using real-time RT-PCR.

    Science.gov (United States)

    Li, Y R; Li, Q; Yang, J M; Zhou, X M; Yin, X M; Zhao, D M

    2008-08-01

    Doppel (prion-like protein, Dpl) may act as a useful molecular marker in tumor diagnosis and in tumor grade definition, as over-expression of Dpl protein has been found in tumors with different histologic origin. Accordingly, the quantitative analysis of the expression of Dpl in different tissues is essential for understanding its role in tumor progression and cancer diagnostic. Herein we report Dpl mRNA quantification in golden hamster by calibrated highly sensitive externally standardized real-time RT-PCR with LightCycler instrument. Total RNA was isolated from nine different organs of golden hamster in different stages of development: from neonatal to adult golden hamster. Highest level of Dpl mRNA was detected in the testis, and lower levels of Dpl mRNA were detected in the following tissues: spleen, heart, bone marrow, skeletal muscles and neocortex (only in neonatal hamster). The expression of Dpl was not detected in kidney, liver and lung. This is the first study to report the expression of Dpl in bone marrow of murine and the difference of expression levels of Dpl in testis between adult and neonatal hamsters.

  12. The development of a qualitative real-time RT-PCR assay for the detection of hepatitis C virus

    NARCIS (Netherlands)

    Clancy, A.; Crowley, B.; Niesters, H.; Herra, C.

    2008-01-01

    Real-time polymerase chain reaction (PCR) represents a favourable option for the detection of hepatitis C virus (HCV). A real-time reverse transcriptase PCR (RT-PCR) assay was developed as a qualitative diagnostic screening method for the detection of HCV using the ABI PRISM 7500 Sequence Detection

  13. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  14. Measurement of bacterial gene expression in vivo by laser capture microdissection and quantitative real-time RT-PCR

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Jensen, Tim Kåre; Angen, Øystein

    2007-01-01

    Due to the relative small number of bacterial pathogens present in an infected host, exploration of pathogen gene expression in vivo is challenging. This study reports the development of a protocol for quantifying bacterial gene expression in vivo in Actinobacillus pleuropneumoniae using laser ca...... capture microdissection and real-time quantitative RT-PCR....

  15. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 90; Issue 2. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1, mBCR-ABL and MLL-AF4 fusion gene transcripts in de novo B-lineage acute lymphoblastic leukaemia patients in south India. Natarajan Sudhakar Kamalalayam Raghavan Rajalekshmy Thangarajan ...

  16. Direct sample preparation methods for the detection of Plum pox virus by real-time RT-PCR.

    Science.gov (United States)

    Capote, Nieves; Bertolini, Edson; Olmos, Antonio; Vidal, Eduardo; Martínez, Maria Carmen; Cambra, Mariano

    2009-03-01

    Direct systems to process plant materials allowed high-throughput testing of Plum pox virus (PPV) by real-time reverse transcription (RT)-PCR without nucleic acids purification. Crude plant extracts were diluted in buffer or spotted on membranes to be used as templates. Alternatively, immobilized PPV targets were amplified from fresh sections of plant tissues printed or squashed onto the same supports, without extract preparation. Spot real-time RT-PCR was validated as a PPV diagnostic method in samples collected during the dormancy period and showed high sensitivity (93.6%), specificity (98.0%), and post-test probability (97.9%) towards sharka disease. In an analysis of 2919 Prunus samples by spot real-time RT-PCR and DASI-ELISA 90.8% of the results coincided, demonstrating high agreement (k = 0.77 +/- 0.01) between the two techniques. These results validate the use of immobilized PPV targets and spot real-time RT-PCR as screening method for largescale analyses.

  17. Quantitative real-time RT-PCR in sentinel lymph nodes from melanoma patients. Detection of melanocytic mRNA predicts disease-free survival

    DEFF Research Database (Denmark)

    Riber-Hansen, Rikke; Abrahamsen, Helene Nortvig; Sorensen, Boe Sandahl

    2008-01-01

    Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) for specific melanoma markers is more sensitive than histology for detecting cells of melanocytic origin in sentinel lymph nodes (SLNs) in cutaneous melanoma. The clinical significance of a positive qRT-PCR analysis...... that the presence of submicroscopic metastases may influence prognosis, indicating that RT-PCR detection of melanocytic cells in SLNs may be an important diagnostic marker....

  18. Development of a multiplex real-time RT-PCR assay for simultaneous detection of dengue and chikungunya viruses.

    Science.gov (United States)

    Cecilia, D; Kakade, M; Alagarasu, K; Patil, J; Salunke, A; Parashar, D; Shah, P S

    2015-01-01

    Dengue and chikungunya viruses co-circulate and cause infections that start with similar symptoms but progress to radically different outcomes. Therefore, an early diagnostic test that can differentiate between the two is needed. A single-step multiplex real-time RT-PCR assay was developed that can simultaneously detect and quantitate RNA of all dengue virus (DENV) serotypes and chikungunya virus (CHIKV). The sensitivity was 100 % for DENV and 95.8 % for CHIKV, whilst the specificity was 100 % for both viruses when compared with conventional RT-PCR. The detection limit ranged from 1 to 50 plaque-forming units. The assay was successfully used for differential diagnosis of dengue and chikungunya in Pune, where the viruses co-circulate.

  19. Comparison of real time RT-PCR and flow cytometry methods for evaluation of biological activity of recombinant human erythropoietin

    Directory of Open Access Journals (Sweden)

    Sepehrizadeh Z

    2008-05-01

    Full Text Available Background: Evaluation of bioactivity of recombinant erythropoietin is essential for pharmaceutical industry, quality control authorities and researchers. The purpose of this study was to compare real time RT-PCR and flow cytometry for the assay of biological activity of recombinant erythropoietin. Methods: Three concentrations of recombinant erythropoietin BRP (80, 40 and 20 IU/ml were injected subcutaneously to mice. After 4 days the blood was collected and used for reticulocyte counts by flow cytometry and also for the RNA extraction. Real time RT-PCR amplification was carried out for β-globin. Results and conclusion: There was a significant correlation between the total RNA amounts (R2= 0.9995, relative quantity of β-globin mRNA (R2= 0.984 and reticulocyte counts (R2= 0.9742 with rhEpo concentrations. Total RNA and quantitative RT-PCR showed significant dose dependent results as well the reticulocyte counts by flow cytometry for the biological activity assay of rhEpo and so these methods could be considered as alternatives for flow cytometry.

  20. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  1. Development and Preliminary Evaluation of a New Real-Time RT-PCR Assay For Detection of Peste des petits Ruminants Virus Genome.

    Science.gov (United States)

    Polci, A; Cosseddu, G M; Ancora, M; Pinoni, C; El Harrak, M; Sebhatu, T T; Ghebremeskel, E; Sghaier, S; Lelli, R; Monaco, F

    2015-06-01

    A duplex real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for a simple and rapid diagnosis of Peste des petits ruminants (PPR). qRT-PCR primers and TaqMan probe were designed on a conserved region of nucleocapsid protein (Np) of PPR virus (PPRV) genome. An in vitro transcript of the target region was constructed and tested to determine analytical sensitivity. Commercial heterologous Armored RNA(®) was used as an internal positive control (IPC) for either RNA isolation or RT-PCR steps. The detection limit of the newly designed duplex real-time RT-PCR (qRT-PCR PPR_Np) was approximately 20 copies/μl with a 95% probability. No amplification signals were recorded when the qRT-PCR PPR_Np was applied to viruses closely related or clinically similar to PPRV- or to PPR-negative blood samples. A preliminary evaluation of the diagnostic performance was carried out by testing a group of 43 clinical specimens collected from distinct geographic areas of Africa and Middle East. qRT-PCR PPR_Np showed higher sensitivity than the conventional gel-based RT-PCR assays, which have been used as reference standards. Internal positive control made it possible to identify the occurrence of 5 false-negative results caused by the amplification failure, thus improving the accuracy of PPRV detection. © 2013 Blackwell Verlag GmbH.

  2. Improvement of Barley yellow dwarf virus-PAV detection in single aphids using a fluorescent real time RT-PCR.

    Science.gov (United States)

    Fabre, Frédéric; Kervarrec, Christine; Mieuzet, Lucie; Riault, Gérard; Vialatte, Aude; Jacquot, Emmanuel

    2003-06-09

    One of the major factors determining the incidence of Barley yellow dwarf virus (BYDV) on autumn-sown cereals is the viruliferous state of immigrant winged aphids. This variable is assessed routinely using the enzyme-linked immunosorbant assay (ELISA). However, the threshold for virus detection by ELISA can lead to false negative results for aphids carrying less than 10(6) particles. Although molecular detection techniques enabling the detection of lower virus quantities in samples are available, the relatively laborious sample preparation and data analysis have restricted their use in routine applications. A gel-free real-time one-step reverse transcription polymerase chain reaction (RT-PCR) protocol is described for specific detection and quantitation of BYDV-PAV, the most widespread BYDV species in Western Europe. This new assay, based on TaqMan technology, detects and quantifies from 10(2) to 10(8) BYDV-PAV RNA copies. This test is 10 and 10(3) times more sensitive than the standard RT-PCR and ELISA assays published previously for BYDV-PAV detection and significantly improves virus detection in single aphids. Extraction of nucleic acids from aphids using either phenol/chloroform or chelatin resin-based protocols allow the use of pooled samples or of a small part (up to 1/1600th) of a single aphid extract for efficient BYDV-PAV detection.

  3. Quantitative one-step real-time RT-PCR for the fast detection of the four genotypes of PPRV.

    Science.gov (United States)

    Kwiatek, Olivier; Keita, Djénéba; Gil, Patricia; Fernández-Pinero, Jovita; Jimenez Clavero, Miguel Angel; Albina, Emmanuel; Libeau, Genevieve

    2010-05-01

    A one-step real-time Taqman RT-PCR assay (RRT-PCR) for peste des petits ruminants virus (PPRV) was developed to detect the four lineages of PPRV by targeting the nucleoprotein (N) gene of the virus. This new assay was compared to a conventional RT-PCR on reference strains and field materials. Quantitation was performed against a standard based on a synthetic transcript of the NPPR gene for which a minimum of 32 copies per reaction were detected with a corresponding C(t) value of 39. Depending on the lineage involved, the detection limit of RRT-PCR was decreased by one to three log copies relative to the conventional method. The lower stringency occurred with lineage III because of minor nucleotide mismatches within the probe region. The assay did not detect phylogenetically or symptomatically related viruses of ruminants (such as rinderpest, bluetongue, and bovine viral diarrhea viruses). However, it was capable of detecting 20% more positive field samples with low viral RNA loads compared to the conventional PCR method. When compared on a proficiency panel to the method developed by Bao et al. (2008), the sensitivity of the in-house assay was slightly improved on lineage II. It proved significantly faster to perform and hence better adapted for monitoring large numbers of at risk or diseased animals. Copyright 2010 Elsevier B.V. All rights reserved.

  4. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  6. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  7. Optimization of one-step duplex real-time RT-PCR for detection of influenza and respiratory syncytial virus in nasopharyngeal aspirates.

    Science.gov (United States)

    de-Paris, Fernanda; Beck, Caroline; Machado, Alice Beatriz Mombach Pinheiro; Paiva, Rodrigo Minuto; da Silva Menezes, Denise; de Souza Nunes, Luciana; Kuchenbecker, Ricardo; Barth, Afonso Luís

    2012-12-01

    Viruses are major contributors to acute respiratory infection-related morbidity and mortality worldwide. The influenza (IF) viruses and human respiratory syncytial virus (RSV) play a particularly important role in the etiology of acute respiratory infections. This study sought to standardize a one-step duplex real-time RT-PCR technique to optimize diagnosis of IFA/IFB and RSVA/RSVB infection. Viral RNA was extracted with the commercially available QIAamp Mini Kit according to manufacturer instructions. RT-PCR was performed with primers to the matrix protein gene of IFA, the hemagglutinin gene of IFB and the N gene of RSVA and RSVB. The limits of detection were 1 copy/μL for IFA, 10 copies/μL for IFB, 5 copies/μL for RSVA, and 250 copies/μL for RSVB. The specificity of RT-PCR was determined by comparison against a panel of several respiratory pathogens. RT-PCR and indirect immunofluorescence (IIF) were compared in a sample of 250 nasopharyngeal aspirates (NPAs) collected during the year 2010. RT-PCR was more sensitive than IIF and able to detect viral co-infections. In summary, RT-PCR optimized for IFA/IFB and RSVA/RSVB is sensitive and specific for these viral agents and is therefore useful for assessment of the etiology of respiratory infections, whether for clinical or epidemiological purposes. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  9. Identification of housekeeping genes as references for quantitative real-time RT-PCR analysis in Misgurnus anguillicaudatus.

    Science.gov (United States)

    Xia, Xiaohua; Huo, Weiran; Wan, Ruyan; Xia, Xiaopei; Du, Qiyan; Chang, Zhongjie

    2017-12-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a well-known method to quantify gene expression by comparing with the reference genes. Generally, housekeeping genes were set as references, as for their stable expression in varying conditions. Here, we try to evaluate few of such genes to identify suitable housekeeping genes as references for qRT-PCR analysis of gene expression in Misgurnus anguillicaudatus. This study evaluated the expression of four commonly used housekeeping genes, i.e. b-actin (ACTB), elongation factor 1 alpha (EF-1a), glyceraldehyde-3-phosphate (GAPDH) and 18S ribosomal RNA (18S rRNA), in gender difference, effects of tissue type, different developmental stages, chemical treatment of embryos/larvae with commonly used vehicles for administration and agents that represent known environmental toxicant. Rank ordering of expression stability was done using geNorm, NormFinder and BestKeeper algorithms. Results suggested that in the qRTPCR test, in all the experimental conditions, EF-1a could be selected as reference gene when analysing a target gene. For the study of different development stages, ACTB could be a candidate as reference gene. For the studies associated with different gender and tissue types, EF-1a would be better targeted as reference gene. Meanwhile, in toxicant treatment, expression of EF-1a seems to be more stable than others and could be considered as reference gene. This study could provide useful guidelines that can be expected to aid M. anguillicaudatus researchers in their initial choice of housekeeping genes for future studies and enable more accurate normalization of gene expression data.

  10. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation <3.1%. 439 clinical samples were evaluated by both duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  12. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  13. Factors Affecting Detection of Hepatitis E Virus on Canadian Retail Pork Chops and Pork Livers Assayed Using Real-Time RT-PCR.

    Science.gov (United States)

    Wilhelm, B J; Leblanc, D; Avery, B; Pearl, D L; Houde, A; Rajić, A; McEwen, S A

    2016-03-01

    We collected 599 Canadian retail pork chops and 283 pork livers routinely (usually weekly) from April 2011 to March 2012 using the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) retail sampling platform. Samples were assayed using validated real-time (q) reverse transcriptase polymerase chain reaction (RT-PCR) and nested classical RT-PCR for the detection of hepatitis E virus (HEV), porcine enteric calicivirus (PEC) and rotavirus (RV). The presence of Escherichia coli, Salmonella spp. and Campylobacter spp. was measured on a subset of our samples. Exact logistic regression models were fitted for predictors for HEV detection, for each assay. For both assays, sample type (pork chop versus liver) was a significant predictor for HEV RNA detection. For nested classical RT-PCR but not qRT-PCR, region of sample collection was a significant predictor (P = 0.008) of HEV detection. Odds of HEV detection were greatest in spring relative to other seasons. E. coli was a significant predictor for HEV RNA detection using the qRT-PCR (P = 0.03). Overall, the prevalence of E. coli, Salmonella spp. and Campylobacter spp. was significantly greater than HEV, PEC or RV on our retail pork samples. Our sparse data set for the detection of PEC and RV precluded modelling of risk factors for the detection of these viruses. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.

  14. Analytical and Clinical Performance of the CDC Real Time RT-PCR Assay for Detection and Typing of Dengue Virus

    Science.gov (United States)

    Santiago, Gilberto A.; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F.; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L.

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1–4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1–4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1–4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1–4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases. PMID:23875046

  15. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  16. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  17. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  19. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Strand-specific real-time RT-PCR quantitation of Maize fine streak virus genomic and positive-sense RNAs using high temperature reverse transcription

    Science.gov (United States)

    Efforts to analyze the replicative RNA produced by Maize fine streak virus (MVSF) within maize tissue was complicated by the lack of specificity during cDNA generation using standard reverse transcriptase protocols. Real-time qRT-PCR using cDNA generated by priming with random hexamers does not dist...

  1. Use of automated real-time reverse transcription-polymerase chain reaction (RT-PCR) to monitor experimental swine vesicular disease virus infection in pigs

    DEFF Research Database (Denmark)

    Reid, S.M.; Paton, D.J.; Wilsden, G.

    2004-01-01

    Automated real-time RT-PCR was evaluated as a diagnostic tool for swine vesicular disease virus (SVDV) infection on a range of samples (vesicular epithelium, serum, nasal swabs, faeces) from four inoculated and three in-contact pigs over a period of 28 days. Traditional diagnostic procedures (vir...

  2. Estrogen receptors alpha and beta in rat placenta: detection by RT-PCR, real time PCR and Western blotting

    Directory of Open Access Journals (Sweden)

    Al-Bader Maie D

    2006-03-01

    Full Text Available Abstract Background High levels of estrogens during pregnancy not only retard placental and fetal growth but can lead to reproductive tract abnormalities in male progeny. Estrogens act through estrogen receptors (ER to modulate the transcription of target genes. These ER exist in two isoforms, ER alpha and ER beta and recently several variants of these isoforms have been identified. Methods The expressions of ER isoforms and variants have been studied in rat placenta at 16, 19 and 21 days gestation (dg. Gene expression was assessed using RT-PCR and real time PCR while protein expression was studied using Western blotting followed by immunodetection. Placental homogenates were probed with: a monoclonal antibody raised against the steroid binding domain of the ER alpha (ER alpha -S, a monoclonal antibody raised against the hinge region of ER alpha (ER alpha -H and a polyclonal antibody raised against the amino terminus of ER beta. Results ER alpha and ER beta mRNA and protein were detected from as early as 16 dg. Two PCR products were detected for ER alpha, one for the wild type ER alpha, and a smaller variant. Real time PCR results suggested the presence of a single product for ER beta. The antibodies used for detection of ER alpha protein both identified a single 67 kDa isoform; however a second 54 kDa band, which may be an ER alpha variant, was identified when using the ER alpha -H antibody. The abundance of both ER alpha bands decreased significantly between 16 and 19 dg. As for ER beta, four bands (76, 59, 54 and 41 kDa were detected. The abundance of the 59 and 54 kDa bands decreased significantly between 16 and 19 dg. Conclusion This study shows that both ER protein isoforms and their variants are present in rat placenta. The decrease in their expression near parturition suggests that the placenta may be relatively unresponsive to estrogens at this stage.

  3. Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2017-03-21

    dispersion via migrating birds . This sequence diversity negatively impacts existing 21 molecular diagnostic assays, leading to false negative diagnostic...Announcement). Briefly, the S segment of each virus was amplified using the 83 SuperScript III One-Step RT-PCR system with Platinum Taq DNA Polymerase High...generated using the Nextera XT DNA Library Kit (Illumina) according to the 86 manufacturer’s instructions. Libraries were pooled and sequenced on the MiSeq

  4. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...... to detect FMDV in materials from both cattle and buffalo. When compared to traditional virus cultivation the virus detection sensitivity was similar but the RT-PCR method can provide a laboratory result much faster than virus cultivation. The real-time PCR method confirms the identity of the amplicon...... by melting point analysis for added specificity and at the same time allows the detection of mutations in the probe region. As such, the described new method is suitable for the robust real-time detection of index cases caused by any serotype of FMDV....

  5. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  7. Simultaneous detection and differentiation of three Potyviridae viruses in sweet potato by a multiplex TaqMan real time RT-PCR assay.

    Science.gov (United States)

    Lan, Pingxiu; Li, Fan; Abad, Jorge; Pu, Lingling; Li, Ruhui

    2018-02-01

    A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay was compared with a multiplex RT-PCR developed in the initial study for the detection and differentiation of the three viruses and host 18S rRNA. Primers and/or probes of the two assays were designed from conserved regions of each virus. The two assays were optimized for primers/probes and primer concentrations and thermal cycling conditions. Sensitivity and specificity of the assays were compared each other and with other assay. Both assays were evaluated by 74 field samples original from five different provinces of China. showed that the TaqMan real time RT-PCR offered rapid, sensitive, effective and reliable for the simultaneous detection and differentiation of the three viruses in sweet potato plants. The assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Copyright © 2017. Published by Elsevier B.V.

  8. Biosurveillance of avian influenza and Newcastle disease viruses in the Barda region of Azerbaijan using real time RT-PCR and hemagglutination inhibition

    Directory of Open Access Journals (Sweden)

    Shalala eZeynalova

    2015-11-01

    Full Text Available The Azerbaijan State Veterinary Control Service (SVCS has conducted active serological surveillance for avian influenza (AI in poultry since 2006, when the first outbreak of AI H5N1 occurred in Azerbaijan. Samples are collected from September to May annually and tested using a hemagglutination inhibition (HI assay to detect antibodies against H5 AI viruses. HI testing is also performed for Newcastle disease virus (NDV upon request, but since this method cannot distinguish between natural infections and immune responses to vaccination, all positive results require follow-up epidemiological investigations. Furthermore, blood collection for the surveillance program is time-intensive and can be stressful to birds. In order to improve the national surveillance program, alternative sampling and testing methodologies were applied among a population of birds in the Barda region and compared with results of the national surveillance program. Tracheal and cloacal swabs were collected instead of blood. Rather than testing individual samples, RNA was pooled to conserve resources and time, and pools were tested by real-time reverse transcription PCR (rRT-PCR. Environmental sampling at a live bird market was also introduced as another surveillance mechanism. A total of 1,030 swabs were collected, comprising tracheal and cloacal samples from 441 birds and 148 environmental surface samples from farms or the live bird market. During the same time, 3,890 blood samples were collected nationally for the surveillance program; 400 of these samples originated in the Barda region. Birds sampled for rRT-PCR were likely different than those tested as part of national surveillance. All swab samples tested negative by rRT-PCR for both AI and NDV. All blood samples tested negative for H5 by HI, while 6.2% of all samples and 5% of the Barda samples tested positive for exposure to NDV. Follow-up investigations found that positive samples were from birds vaccinated in the

  9. Biosurveillance of avian influenza and Newcastle disease viruses in the Barda region of Azerbaijan using real time RT-PCR and hemagglutination inhibition.

    Science.gov (United States)

    Zeynalova, Shalala; Guliyev, Fizuli; Vatani, Mahira; Abbasov, Bahruz

    2015-01-01

    The Azerbaijan State Veterinary Control Service (SVCS) has conducted active serological surveillance for avian influenza (AI) in poultry since 2006, when the first outbreak of AI H5N1 occurred in Azerbaijan. Samples are collected from September to May annually and tested using a hemagglutination inhibition (HI) assay to detect antibodies against H5 AI viruses. HI testing is also performed for Newcastle disease virus (NDV) upon request, but since this method cannot distinguish between natural infections and immune responses to vaccination, all positive results require follow-up epidemiological investigations. Furthermore, blood collection for the surveillance program is time-intensive and can be stressful to birds. In order to improve the national surveillance program, alternative sampling and testing methodologies were applied among a population of birds in the Barda region and compared with results of the national surveillance program. Tracheal and cloacal swabs were collected instead of blood. Rather than testing individual samples, RNA was pooled to conserve resources and time, and pools were tested by real-time reverse transcription polymerase chain reaction (rRT-PCR). Environmental sampling at a live bird market was also introduced as another surveillance mechanism. A total of 1,030 swabs were collected, comprising tracheal, and cloacal samples from 441 birds and 148 environmental surface samples from farms or the live bird market. During the same time, 3,890 blood samples were collected nationally for the surveillance program; 400 of these samples originated in the Barda region. Birds sampled for rRT-PCR were likely different than those tested as part of national surveillance. All swab samples tested negative by rRT-PCR for both AI and NDV. All blood samples tested negative for H5 by HI, while 6.2% of all samples and 5% of the Barda samples tested positive for exposure to NDV. Follow-up investigations found that positive samples were from birds vaccinated in

  10. Molecular detection of a novel human influenza (H1N1) of pandemic potential by conventional and real-time quantitative RT-PCR assays.

    Science.gov (United States)

    Poon, Leo L M; Chan, K H; Smith, G J; Leung, C S W; Guan, Y; Yuen, K Y; Peiris, J S M

    2009-08-01

    Influenza A viruses are medically important viral pathogens that cause significant mortality and morbidity throughout the world. The recent emergence of a novel human influenza A virus (H1N1) poses a serious health threat. Molecular tests for rapid detection of this virus are urgently needed. We developed a conventional 1-step RT-PCR assay and a 1-step quantitative real-time RT-PCR assay to detect the novel H1N1 virus, but not the seasonal H1N1 viruses. We also developed an additional real-time RT-PCR that can discriminate the novel H1N1 from other swine and human H1 subtype viruses. All of the assays had detection limits for the positive control in the range of 1.0 x 10(-4) to 2.0 x 10(-3) of the median tissue culture infective dose. Assay specificities were high, and for the conventional and real-time assays, all negative control samples were negative, including 7 human seasonal H1N1 viruses, 1 human H2N2 virus, 2 human seasonal H3N2 viruses, 1 human H5N1 virus, 7 avian influenza viruses (HA subtypes 4, 5, 7, 8, 9, and 10), and 48 nasopharyngeal aspirates (NPAs) from patients with noninfluenza respiratory diseases; for the assay that discriminates the novel H1N1 from other swine and human H1 subtype viruses, all negative controls were also negative, including 20 control NPAs, 2 seasonal human H1N1 viruses, 2 seasonal human H3N2 viruses, and 2 human H5N1 viruses. These assays appear useful for the rapid diagnosis of cases with the novel H1N1 virus, thereby allowing better pandemic preparedness.

  11. Development and validation of two SYBR green PCR assays and a multiplex real-time PCR for the detection of Shiga toxin-producing Escherichia coli in meat.

    Science.gov (United States)

    Brusa, Victoria; Galli, Lucía; Linares, Luciano H; Ortega, Emanuel E; Lirón, Juan P; Leotta, Gerardo A

    2015-12-01

    Shiga toxin-producing Escherichia coli (STEC) are recognized as food-borne pathogens. We developed and validated two SYBR green PCR (SYBR-PCR) and a real-time multiplex PCR (RT-PCR) to detect stx1 and stx2 genes in meat samples, and compared these techniques in ground beef samples from retail stores. One set of primers and one hydrolysis probe were designed for each stx gene. For RT-PCR, an internal amplification control (IAC) was used. All PCR intra-laboratory validations were performed using pure strains and artificially contaminated ground beef samples. A total of 50 STEC and 30 non-STEC strains were used. Naturally contaminated ground beef samples (n=103) were obtained from retail stores and screened with SYBR-PCR and RT-PCR, and stx-positive samples were processed for STEC isolation. In the intra-laboratory validation, each PCR obtained a 1×10(2) CFU mL(-1) limit of detection and 100% inclusivity and exclusivity. The same results were obtained when different laboratory analysts in alternate days performed the assay. The level of agreement obtained with SYBR-PCR and RT-PCR was kappa=0.758 and 0.801 (P<0.001) for stx1 and stx2 gene detection, respectively. Two PCR strategies were developed and validated, and excellent performance with artificially contaminated ground beef samples was obtained. However, the efforts made to isolate STEC from retail store samples were not enough. Only 11 STEC strains were isolated from 35 stx-positive ground beef samples identically detected by all PCRs. The combination of molecular approaches based on the identification of a virulence genotypic profile of STEC must be considered to improve isolation. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Rapid detection of the pandemic 2009 H1N1 virus M gene by real?time and gel?based RT?PCR assays

    OpenAIRE

    Ma, Wenjun; Oberst, Richard; Li, Xi; Clouser, Deborah; Hesse, Richard; Rowland, Raymond; Richt, Juergen A.

    2010-01-01

    Please cite this paper as: Ma et?al. (2010) Rapid detection of the pandemic 2009 H1N1 virus M gene by real?time and gel?based RT?PCR assays. Influenza and Other Respiratory Viruses 4(6), 397?403. Background? Since the first pandemic 2009 H1N1 (pH1N1) virus was isolated from humans, it has also been detected in other mammalian (pigs, cats, dogs, ferrets) and avian (turkey) species, most likely because of cross?species transmission from humans. The pH1N1 contains six genes derived from swine in...

  13. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR.

    Science.gov (United States)

    Gimeno, Jacinta; Eattock, Nicholas; Van Deynze, Allen; Blumwald, Eduardo

    2014-01-01

    Switchgrass (Panicum virgatum) has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR) has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  14. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  15. Suitable housekeeping genes for normalization of transcript abundance analysis by real-time RT-PCR in cultured bovine granulosa cells during hypoxia and differential cell plating density.

    Science.gov (United States)

    Baddela, Vijay S; Baufeld, Anja; Yenuganti, Vengala R; Vanselow, Jens; Singh, Dheer

    2014-11-27

    Bovine granulosa cell culture models are important to understand molecular mechanisms of ovarian function. Folliculogenesis and luteinization are associated with increasing density of cells and local hypoxic conditions. The current study identified two reliable housekeeping genes useful for gene normalization in granulosa cells under different in vitro conditions. During the current experiments cells were subjected to different biological and physical stimuli, follicle stimulating hormone, different initial cell plating density and hypoxia. Transcript abundance of seven housekeeping genes was quantified by real-time RT-PCR with co-amplification of the respective external standard. Three of the genes, GAPDH, HMBS, and HPRT1 were found to be regulated by initial cell plating density, five of them, GAPDH, HMBS, HPRT1, RPLP0 and RPS18 under hypoxic conditions, but none of them after FSH stimulation. In detail, GAPDH was up regulated, but HPRT1 and HMBS were down regulated at high density and under hypoxia. Expression of RPLP0 and RPS18 was inconsistent, but was significantly down-regulated in particular at high cell density combined with hypoxia. In contrast, TBP and B2M genes were neither regulated under different plating density conditions nor by hypoxia as they showed similar expression levels under all conditions analyzed. The present data indicate that TBP and B2M are appropriate housekeeping genes for normalization of transcript abundance measured by real-time RT-PCR in granulosa cells subjected to different plating densities, oxygen concentrations and FSH stimulation.

  16. In vitro transcribed RNA molecules for the diagnosis of pandemic 2009 influenza A(H1N1) virus by real-time RT-PCR.

    Science.gov (United States)

    Bermúdez de León, Mario; Peñuelas-Urquides, Katia; Aguado-Barrera, Miguel E; Currás-Tuala, María José; Escobedo-Guajardo, Brenda L; González-Ríos, Rosa Nelly; Mata-Tijerina, Viviana L; Vázquez-Monsiváis, Ofelia E

    2013-11-01

    The 2009 influenza A(H1N1) outbreak allowed the implementation of new epidemiologic surveillance tools in several countries around the world. A new molecular protocol with appropriate sensitivity and specificity using real-time RT-PCR was developed by the Centers for Disease Control and Prevention (CDC) to identify the pandemic 2009 influenza A (H1N1) virus in human specimens. In the CDC protocol, positive controls are available only upon request and they are taken from cell cultures infected with 2009 influenza A(H1N1) virus, representing a handling risk for laboratory technicians. The poor availability of positive control materials in diagnostic laboratories may limit the public health response. The aim of the work presented in this paper was to develop positive controls for the diagnostic testing of influenza A(H1N1) virus that could be used in the CDC real-time RT-PCR protocol. A series of plasmid constructs bearing partial sequences of the viral genes were created and each construct was used as a template for in vitro transcription. RNA molecules were obtained successfully at high yield, i.e., 2×10(7) assays per microliter. Thus, the inclusion of these molecules in the influenza panel as positive controls is proposed. The in vitro transcribed RNA could also be used as quality standards in the design of international proficiency studies. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region....... the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce...

  19. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...... tests showed no positive results for heterologous pathogens. The assay was tested on clinical samples from BTV 8 outbreaks in Sweden and Denmark in 2008. The lowest detection limit for that serotype, determined with PCR standards, was 57 genome copies. The assay sensitivity for some other serotypes...... that circulate currently in Europe was also determined. BTV 2, 4, 9 and 16 were tested on available cell culture samples and the detection limits were 109, 12, 13 and 24 copies, respectively. This assay provides an important tool for early and rapid detection of a wide range of BTV strains, including emerging...

  20. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  1. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  2. Performance of two Real-Time RT-PCR assays for quantitation of hepatitis C virus RNA: evaluation on HCV genotypes 1-4.

    Science.gov (United States)

    Elkady, Abeer; Tanaka, Yasuhito; Kurbanov, Fuat; Sugauchi, Fuminaka; Sugiyama, Masaya; Khan, Anis; Ali, Elsayed Mostafa; Mouhamed, Layla; Abou el-fetouh, Sahar; AbdEl-Hameed, AbdEl-Rahaman; Mizokami, Masashi

    2010-11-01

    Accuracy for monitoring of the concentration of hepatitis C virus (HCV) RNA represents a major challenge throughout the management of patients with chronic hepatitis C. To investigate the genotype-independent efficiency and the accuracy of two real-time detection reverse transcription-polymerase chain reaction (RT-PCR) assays; the Cobas Ampliprep/Cobas TaqMan (CAP/CTM); and the Abbott RealTime HCV (ART), a total of 184 samples with different HCV subtypes were examined; 1b (n=58), 2a (n=39), 2b (n=26), 3a (n=20), and 4 (n=41). A robust linear correlation was observed between the two assays applied to genotypes 1b, 2a, 2b, and 3a [the correlation coefficient (R) ranged from 0.99 to 0.98], but not to genotype 4 specimens (R=0.78). A significant difference in measurements of HCV RNA using CAP/CTM and ART in serum samples with genotypes 1b and 4 was observed (0.72, -0.53 log IU/ml, PHCV core antigen and HCV RNA values by either of the HCV RNA quantitation assays applied to all genotypes with exception of genotype 4, for which R was higher with ART (R=0.95) than with CAP/CTM (R=0.80). The lower limit of detection of CAP/CTM and ART were 41.4 and 28.5 IU/ml using the WHO standards, respectively. In conclusion, two RT-PCR assays had a high efficiency and accuracy for quantitation of HCV RNA of genotypes 2a, 2b, and 3a, but the mean values of HCV RNA differed for genotype 1b and 4. © 2010 Wiley-Liss, Inc.

  3. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    ..., real-time, fluorimetric thermocycler. Nucleic acid extract isolated from DEN1-4 inoculated Aedes aegypti, field-captured Aedes aegypti and Culex spp, and field-captured Aedes aegypti and Culex spp spiked with total nucleic acid...

  4. Ebola virus disease diagnosis by real-time RT-PCR: A comparative study of 11 different procedures.

    Science.gov (United States)

    Cherpillod, Pascal; Schibler, Manuel; Vieille, Gaël; Cordey, Samuel; Mamin, Aline; Vetter, Pauline; Kaiser, Laurent

    2016-04-01

    The diagnosis of Ebola virus disease relies on the detection of viral RNA in blood by real-time reverse-transcription PCR. While several of these assays were developed during the unprecedented 2013-2015 Ebola virus disease outbreak in West Africa, few were applied in the field. To compare technical performances and practical aspects of 11 Ebola virus real-time reverse-transcription PCR procedures. We selected the most promising assays using serial dilutions of culture-derived Ebola virus RNA and determined their analytical sensitivity and potential range of quantification using quantified in vitro transcribed RNA; viral load values in the serum of an Ebola virus disease patient obtained with these assays were reported. Finally, ease of use and turnaround times of these kits were evaluated. Commercial assays were at least as sensitive as in-house tests. Five of the former (Altona, Roche, Fast-track Diagnostics, and Life Technologies) were selected for further evaluation. Despite differences in analytical sensitivity and limits of quantification, all of them were suitable for Ebola virus diagnosis and viral load estimation. The Lifetech Lyophilized Ebola Virus (Zaire 2014) assay (Life Technologies) appeared particularly promising, displaying the highest analytical sensitivity and shortest turnaround time, in addition to requiring no reagent freezing. Commercial kits were at least as sensitive as in-house tests and potentially easier to use in the field than the latter. This qualitative comparison of real-time reverse transcription PCR assays may serve as a basis for the design of future Ebola virus disease diagnostics. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  6. Detection and absolute quantitation of Tomato torrado virus (ToTV) by real time RT-PCR.

    Science.gov (United States)

    Herrera-Vásquez, José Angel; Rubio, Luis; Alfaro-Fernández, Ana; Debreczeni, Diana Elvira; Font-San-Ambrosio, Isabel; Falk, Bryce W; Ferriol, Inmaculada

    2015-09-01

    Tomato torrado virus (ToTV) causes serious damage to the tomato industry and significant economic losses. A quantitative real-time reverse-transcription polymerase chain reaction (RT-qPCR) method using primers and a specific TaqMan(®) MGB probe for ToTV was developed for sensitive detection and quantitation of different ToTV isolates. A standard curve using RNA transcripts enabled absolute quantitation, with a dynamic range from 10(4) to 10(10) ToTV RNA copies/ng of total RNA. The specificity of the RT-qPCR was tested with twenty-three ToTV isolates from tomato (Solanum lycopersicum L.), and black nightshade (Solanum nigrum L.) collected in Spain, Australia, Hungary and France, which covered the genetic variation range of this virus. This new RT-qPCR assay enables a reproducible, sensitive and specific detection and quantitation of ToTV, which can be a valuable tool in disease management programs and epidemiological studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Simultaneous detection of five notifiable viral diseases of cattle by single-tube multiplex real-time RT-PCR.

    Science.gov (United States)

    Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2015-06-01

    Multiplexed real-time PCR (qPCR) assays enable the detection of several target genes in a single reaction, which is applicable for simultaneous testing for the most important viral diseases in samples obtained from ruminants with unspecific clinical symptoms. Here, reverse transcription qPCR (RT-qPCR) systems for the detection of bovine viral diarrhoea virus (BVDV) and bluetongue virus (BTV) were combined with an internal control system based on the beta-actin gene. Additionally, a background screening for three further major pathogens of cloven-hoofed animals reportable to the World Organisation for Animal Health, namely foot-and-mouth disease virus, epizootic haemorrhagic disease virus, and Rift Valley fever virus, was integrated using the identical fluorophore for the respective RT-qPCR assays. Every pathogen-specific assay had an analytical sensitivity of at least 100 genome copies per reaction within the multiplex approach, and a series of reference samples and clinical specimens obtained from cattle, but also from small ruminants, were detected reliably. The qPCR systems integrated in the background screening were even not influenced by the simultaneous amplification of very high BVDV and BTV genome copy numbers. The newly developed multiplex qPCR allows the specific and sensitive detection of five of the most important diseases of ruminants and could be used in the context of monitoring programs or for differential diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  9. Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

    Science.gov (United States)

    Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2016-09-01

    Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  11. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  12. Removal of real-time reverse transcription polymerase chain reaction (RT-PCR) inhibitors associated with cloacal swab samples and tissues for improved diagnosis of avian influenza virus by RT-PCR

    Science.gov (United States)

    Real time reverse transcriptase polymerase chain reaction (RRT-PCR) is routinely used for the rapid detection of Avian Influenza virus (AIV) in clinical samples. The usefulness of diagnostic RRT-PCR can be limited, in part, by the inhibitory substances present in some clinical specimens, which can ...

  13. Real-time RT-PCR analysis of human histidine decarboxylase, a new marker for several types of leukemia and cancer.

    Science.gov (United States)

    Melgarejo, Esther; Medina, Miguel Angel; Paz, José Carlos; Sánchez-Jiménez, Francisca; Urdiales, José Luis

    2006-01-01

    Histamine is involved in different physiological and pathological responses, such as immune response, gastric acid secretion or neurotransmission, as either angiogenesis or cancer. Histidine decarboxylase (HDC) catalyzes the formation of histamine from histidine. HDC has been suggested as a new marker for neuroendocrine differentiation, inflammatory pathologies and several leukemia and highly malignant forms of cancer, such as melanoma and small cell lung carcinoma. In the present work, we describe the use of Syber Green-based quantitative real-time RT-PCR to determine the expression of histidine decarboxylase in human cells and tissue. As an internal control, glyceraldehyde 3-phosphate dehydrogenase was also amplified. The linear dynamic range of the assay covered 4 orders of magnitude for HDC amplification. The detection limit was 0.1 ng of total RNA extracted from HMC-1 cells. This method is simple, rapid, sensitive, and quantitative, and allows for the specific identification of cells and tissue expressing HDC, stressing its potential diagnostic usefulness in malignancies in which HDC is described as a new marker.

  14. Optimization of a real-time RT-PCR assay reveals an increase of genogroup I norovirus in the clinical setting.

    Science.gov (United States)

    Van Stelten, A; Kreman, T M; Hall, N; Desjardin, L E

    2011-07-01

    Although norovirus has been identified as the most common cause of gastroenteritis, the majority of cases have no etiologic agent identified. In this study, we describe the optimization of a real-time RT-PCR assay for the improved detection of genogroup I norovirus in patient specimens based upon sequence data from a collection of representative clinical norovirus sequences. The redesigned assay demonstrated a 64 fold increase in sensitivity, a 2 log decrease in the limit of detection, and an 18% increase in amplification efficiency, when compared to the standard assay. The optimized test also detected GI norovirus in clinical specimens that were initially negative by the standard assay. Use of the optimized assay increased the annual positivity of GI norovirus in Iowa from 1.2% to 4.5%, indicating the prevalence of GI norovirus may be higher than previously identified. Laboratory confirmation of the etiologic agent involved in gasteroenteritis cases is essential for better understanding of the prevalence and transmission of noroviruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Increased sensitivity of RT-PCR for Potato virus Y detection using RNA isolated by a procedure with differential centrifugation.

    Science.gov (United States)

    Zhang, Jianhua; Nie, Xianzhou; Boquel, Sébastien; Al-Daoud, Fadi; Pelletier, Yvan

    2015-12-01

    The sensitivity of reverse transcription-polymerase chain reaction (RT-PCR) for virus detection is influenced by many factors such as specificity of primers and quality of templates. These factors become extremely important for successful detection when virus concentration is low. Total RNA isolated from Potato virus Y (PVY)-infected potato plants using the sodium sulfite RNA isolation method or RNeasy plant mini kit contains a high proportion of host RNA and may also contain trace amount of phenolic and polysaccharide residues, which may inhibit RT-PCR. The goal of this study was to enhance the sensitivity of PVY detection by reducing host RNA in the extract by differential centrifugation followed by extraction using an RNeasy mini kit (DCR method). One-step RT-PCR had relatively low amplification efficiency for PVY RNA when a high proportion of plant RNA was present. SYBR Green-based real time RT-PCR showed that the RNA isolated by the DCR method had a higher cycle threshold value (Ct) for the elongation factor 1-α mRNA (Ef1α) of potato than the Ct value of the RNA extracted using the RNeasy plant mini kit, indicating that the DCR method significantly reduced the proportion of potato RNA in the extract. The detectable amount of RNA extracted using the DCR method was sulfite RNA isolation methods, respectively. Copyright © 2015. Published by Elsevier B.V.

  16. Reproducibility of detection of tyrosinase and MART-1 transcripts in the peripheral blood of melanoma patients: a quality control study using real-time quantitative RT-PCR

    NARCIS (Netherlands)

    de Vries, T. J.; Fourkour, A.; Punt, C. J.; van de Locht, L. T.; Wobbes, T.; van den Bosch, S.; de Rooij, M. J.; Mensink, E. J.; Ruiter, D. J.; van Muijen, G. N.

    1999-01-01

    In recent years, large discrepancies were described in the success rate of the tyrosinase reverse transcription polymerase chain reaction (RT-PCR) for detecting melanoma cells in the peripheral blood of melanoma patients. We present a quality control study in which we analysed the reproducibility of

  17. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  18. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    Science.gov (United States)

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  19. Clinical diagnosis of early dengue infection by novel one-step multiplex real-time RT-PCR targeting NS1 gene.

    Science.gov (United States)

    Kim, Je-Hyoung; Chong, Chom-Kyu; Sinniah, Mangalam; Sinnadurai, Jeyaindran; Song, Hyun-Ok; Park, Hyun

    2015-04-01

    Dengue is a mosquito-borne disease that causes a public health problem in tropical and subtropical countries. Current immunological diagnostics based on IgM and/or nonstructural protein 1 (NS1) antigen are limited for acute dengue infection due to low sensitivity and accuracy. This study aimed to develop a one-step multiplex real-time RT-PCR assay showing higher sensitivity and accuracy than previous approaches. Serotype-specific primers and probes were designed through the multiple alignment of NS1 gene. The linearity and limit of detection (LOD) of the assay were determined. The assay was clinically validated with an evaluation panel that was immunologically tested by WHO and Malaysian specimens. The LOD of the assay was 3.0 log10 RNA copies for DENV-1, 2.0 for DENV-3, and 1.0 for DENV-2 and DENV-4. The assay showed 95.2% sensitivity (20/21) in an evaluation panel, whereas NS1 antigen- and anti-dengue IgM-based immunological assays exhibited 0% and 23.8-47.6% sensitivities, respectively. The assay showed 100% sensitivity both in NS1 antigen- and anti-dengue IgM-positive Malaysian specimens (26/26). The assay provided the information of viral loads and serotype with discrimination of heterotypic mixed infection. The assay could be clinically applied to early dengue diagnosis, especially during the first 5 days of illness and approximately 14 days after infection showing an anti-dengue IgM-positive response. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Monitoring epidemic viral respiratory infections using one-step real-time triplex RT-PCR targeting influenza A and B viruses and respiratory syncytial virus.

    Science.gov (United States)

    Papillard-Marechal, Solesne; Enouf, Vincent; Schnuriger, Aurélie; Vabret, Astrid; Macheras, Edouard; Rameix-Welti, Marie-Anne; Page, Bernard; Freymuth, François; van der Werf, Sylvie; Garbarg-Chenon, Antoine; Chevallier, Bertrand; Gaillard, Jean-Louis; Gault, Elyanne

    2011-04-01

    Rapid and specific diagnosis of influenza A/B and respiratory syncytial virus (RSV) viruses is needed for optimal management of patients with acute respiratory infections. In this study, a one-step triplex real-time RT-PCR assay was developed for rapid diagnosis of influenza A/B and RSV infections to optimize diagnosis efficiency of acute respiratory infections. Cell-culture supernatants and clinical samples were used to evaluate specificity and sensitivity of the assay. The assay was used routinely during two winter epidemics for testing respiratory specimens from 2,417 patients. The limit of detection in cell-culture supernatant was 1-10 plaque forming units/input (influenza A/B) and 2 × 10(-2) 50% tissue culture infectious dose/input (RSV). In clinical samples, the assay was as sensitive as commercial molecular assays for the detection of each influenza A/B and RSV (Flu-A/B and RSV-A/B r-gene™) individually, and far more sensitive than antigen detection. During the winter 2008-2009, the assay identified 145 RSV, 42 influenza A, and one mixed RSV-influenza A infections among 298 patients. The next winter, the assay was used in two independent hospital laboratory settings. 776 patients were tested in one hospital and 1,343 in the other, resulting in 184 and 501 RSV, 133 and 150 influenza A, and 1 and 11 mixed RSV-influenza A infections, respectively, being detected. This new user-friendly assay allows rapid (within hours), effective molecular diagnosis of single or mixed infections involving influenza A (including seasonal A H1N1 and H3N2, and A(H1N1) 2009), influenza B, and RSV(A/B). The assay is very valuable for managing patients during winter epidemics when influenza and respiratory syncytial viruses co-circulate. Copyright © 2011 Wiley-Liss, Inc.

  1. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  2. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  3. Evaluation of ALK rearrangement in Chinese non-small cell lung cancer using FISH, immunohistochemistry, and real-time quantitative RT- PCR on paraffin-embedded tissues.

    Directory of Open Access Journals (Sweden)

    Yun-Gang Zhang

    Full Text Available Patients with ALK gene rearrangements often manifest dramatic responses to crizotinib, an ALK inhibitor. Accurate identification of patients with ALK-positive non-small cell lung cancer (NSCLC is essential for the clinical application of ALK-targeted therapy. However, assessing EML4-ALK rearrangement in NSCLC remains challenging in routine pathology practice. The aim of this study was to compare the diagnostic accuracy of FISH, immunohistochemistry (IHC, and real-time quantitative RT-PCR (QPCR methodologies for detection of EML4-ALK rearrangement in NSCLC and to appraise immunohistochemistry as a pre-screening tool. In this study, a total of 473 paraffin-embedded NSCLC samples from surgical resections and biopsies were analyzed by IHC with ALK antibody. ALK rearrangement was further confirmed by FISH and QPCR. ALK protein expression was detected in twenty patients (20/473, 4.2%. Of the 20 ALK-positive cases by IHC, 15 cases were further confirmed as ALK rearrangement by FISH, and 5 cases were not interpretable. Also, we evaluated 13 out of the 20 IHC-positive tissues by QPCR in additional to FISH, and found that 9 cases were positive and 2 cases were equivocal, whereas 2 cases were negative although they were positive by both IHC and FISH. The ALK status was concordant in 5 out of 8 cases that were interpretable by three methods. Additionally, none of the 110 IHC-negative cases with adenocarcinoma histology showed ALK rearrangements by FISH. Histologically, almost all the ALK-rearranged cases were adenocarcinoma, except that one case was sarcomatoid carcinoma. A solid signet-ring cell pattern or mucinous cribriform pattern was presented at least focally in all ALK-positive tumors. In conclusion, our findings suggested that ALK rearrangement was associated with ALK protein expression. The conventional IHC assay is a valuable tool for the pre-screening of patients with ALK rearrangement in clinical practice and a combination of FISH and QPCR is

  4. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse...... transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all...

  5. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  6. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.

  7. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  8. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil.

    Science.gov (United States)

    Romeiro, Marilia Farignoli; Souza, William Marciel de; Tolardo, Aline Lavado; Vieira, Luiz Carlos; Colombo, Tatiana Elias; Aquino, Victor Hugo; Nogueira, Maurício Lacerda; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) method for the diagnosis of the Flavivirus genus. We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA) transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410) of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  9. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR.

    Science.gov (United States)

    Ray, Debashree L; Johnson, Joshua C

    2014-05-18

    Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level of expression stability across

  10. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  11. Schmallenberg Virus Circulation in Culicoides in Belgium in 2012: Field Validation of a Real Time RT-PCR Approach to Assess Virus Replication and Dissemination in Midges

    Science.gov (United States)

    De Regge, Nick; Madder, Maxime; Deblauwe, Isra; Losson, Bertrand; Fassotte, Christiane; Demeulemeester, Julie; Smeets, François; Tomme, Marie; Cay, Ann Brigitte

    2014-01-01

    Indigenous Culicoides biting midges are suggested to be putative vectors for the recently emerged Schmallenberg virus (SBV) based on SBV RNA detection in field-caught midges. Furthermore, SBV replication and dissemination has been evidenced in C. sonorensis under laboratory conditions. After SBV had been detected in Culicoides biting midges from Belgium in August 2011, it spread all over the country by the end of 2011, as evidenced by very high between-herd seroprevalence rates in sheep and cattle. This study investigated if a renewed SBV circulation in midges occurred in 2012 in the context of high seroprevalence in the animal host population and evaluated if a recently proposed realtime RT-PCR approach that is meant to allow assessing the vector competence of Culicoides for SBV and bluetongue virus under laboratory conditions was applicable to field-caught midges. Therefore midges caught with 12 OVI traps in four different regions in Belgium between May and November 2012, were morphologically identified, age graded, pooled and tested for the presence of SBV RNA by realtime RT-PCR. The results demonstrate that although no SBV could be detected in nulliparous midges caught in May 2012, a renewed but short lived circulation of SBV in parous midges belonging to the subgenus Avaritia occured in August 2012 at all four regions. The infection prevalence reached up to 2.86% in the south of Belgium, the region where a lower seroprevalence was found at the end of 2011 than in the rest of the country. Furthermore, a frequency analysis of the Ct values obtained for 31 SBV-S segment positive pools of Avaritia midges showed a clear bimodal distribution with peaks of Ct values between 21–24 and 33–36. This closely resembles the laboratory results obtained for SBV infection of C. sonorensis and implicates indigenous midges belonging to the subgenus Avaritia as competent vectors for SBV. PMID:24466312

  12. RT-PCR detection of HIV in Republic of Macedonia.

    Science.gov (United States)

    Bosevska, Golubinka; Panovski, Nikola; Dokić, Eleni; Grunevska, Violeta

    2008-11-01

    fast, simple for manipulation; with low detection level of 60 IU/ml. RT-PCR needs a small amount of RNA, as well as a small volume of sample. HIV RNA was detected in different periods of time with different clinical presentations in patients, with or without antiretroviral therapy. RT-PCR method gives the opportunity for reliable determination of HIV-1 RNA with border of detection of 60 IU/ml. The test is reproducible and has high analytical and clinical specificity.

  13. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    fast, simple for manipulation; with low detection level of 60 IU/ml. RT-PCR needs a small amount of RNA, as well as a small volume of sample. HIV RNA was detected in different periods of time with different clinical presentations in patients, with or without antiretroviral therapy.RT-PCR method gives the opportunity for reliable determination of HIV-1 RNA with border of detection of 60 IU/ml. The test is reproducible and has high analytical and clinical specificity

  14. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  15. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  16. Use of reverse transcription-real time polymerase chain reaction (real time RT-PCR) assays with Universal Probe Library (UPL) probes for the detection and genotyping of infectious pancreatic necrosis virus strains isolated in Chile.

    Science.gov (United States)

    Calleja, Felipe; Godoy, Marcos G; Cárcamo, Juan G; Bandín, Isabel; Yáñez, Alejandro J; Dopazo, Carlos P; Kibenge, Fred S; Avendaño-Herrera, Ruben

    2012-07-01

    Reverse transcription-real time polymerase chain reaction (real time RT-PCR) assay with Universal Probe Library (UPL) probes has been developed for the detection and genotyping of Chilean infectious pancreatic necrosis virus (IPNV) isolates from infected cell culture. Partial nucleotide sequences (1175 bp) of the VP2 coding region from a selection of 7 Chilean IPNV isolates showed that they clustered into two main groups strongly correlated with Genogroups 1 and 5 proposed by Blake et al. (2001), corresponding to types West Buxton (WB) and Spajarup (Sp), respectively. Based on the VP2 gene sequences of those 7 Chilean isolates and different reference IPNV strains, 2 sets of candidate primer/UPL probes (# 8 and # 117) were designed and evaluated with a total of 32 field isolates isolated from Atlantic salmon (Salmo salar), rainbow trout (Oncorhynchus mykiss) and Pacific salmon (Oncorhynchus kisutch) farms from 2006 to 2010 in Chile. The UPL probes clearly differentiated the same two major Genogroups that those recognized by sequencing analysis. Among the Chilean isolates examined, 18 yielded amplification with UPL probe # 8, and 14 with probe # 117, respectively corresponding to types Sp and WB, as demonstrated by typing by sequencing. Based on the findings reported below, it has been demonstrated that the combined real time RT-PCR protocol with UPLs approach was efficient in discriminating distinct Genogroups of IPNV cultured in fish cell lines and, therefore, recommended its use for detection and typing of IPN viruses. The study also confirmed the existence of two IPNV type strains in Chilean salmonid aquaculture. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. A two-tube multiplex real-time RT-PCR assay for the detection of four hemorrhagic fever viruses: severe fever with thrombocytopenia syndrome virus, Hantaan virus, Seoul virus, and dengue virus.

    Science.gov (United States)

    Li, Zhifeng; Qi, Xian; Zhou, Minghao; Bao, Changjun; Hu, Jianli; Wu, Bin; Wang, Shenjiao; Tan, Zhongmin; Fu, Jianguang; Shan, Jun; Zhu, Yefei; Tang, Fenyang

    2013-09-01

    The aim of this study was to develop and evaluate a two-tube multiplex real-time RT-PCR assay for the detection and identification of four viral hemorrhagic fever (VHF) pathogens, severe fever with thrombocytopenia syndrome virus (SFTSV), Hantaan virus (HTNV), Seoul virus (SEOV), and dengue virus (DENV), from human clinical samples. The two-tube multiplex real-time RT-PCR assay we developed has a sensitivity of 10 copies/μL for each of the targets, and the performance was linear within the range of at least 10(7) transcript copies. Moreover, we evaluated the specificity of the assay using other virus RNA as template, and found no cross-reactivity. This new assay is able to detect SFTSV, HTNV, SEOV and DENV in two reactions and brings a cost of 40 % compared to separate reactions. Evaluation of this assay with clinical serum samples from laboratory-confirmed patients and healthy donors showed 100 % clinical diagnostic sensitivity and over 99 % specificity. The assay was applied for scanning 346 clinical samples collected from patients admitted to the hospital with suspected VHF and compared with virus isolation and immunofluorescence assay (IFA). The assay indentified 59 SFTSV-, 12 HTNV-, 11 SEOV- and 9 DENV-positive samples and showed higher sensitivity. This assay thus provides a reliable and cost-effective screening tool for early clinical diagnosis of SFTSV, HTNV, SEOV and DENV in the acute phase.

  18. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  19. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  20. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    -time RT-PCR is needed to a suitable internal control. We thus investigated the expression pattern of six chicken genes, including P-actin, 28S rRNA, 18S rRNA, glyceral dehyde-3-phosphate dehydrogenase (GAPDH), TATA box-binding protein (TBP) and beta-2-microglobulin, in chicken embryo (CE) cell cultures...... and GAPDH had a lower expression level in CE cell cultures. Also, beta-actin showed no significant variation in both normalized and non-normalized assays and virus dose-independent of inoculation, while other genes did. beta-Actin was further successfully used as an internal control to quantitate Bursine-2...... virus-specific RNA load in CE cell cultures. Thus, beta-actin was suggested as a suitable internal control in studying gene expression as well as virus-specific RNA load in CE cell after IBDV infection....

  1. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  2. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  3. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  4. Detection of West Nile virus using formalin fixed paraffin embedded tissues in crows and horses: quantification of viral transcripts by real-time RT-PCR.

    Science.gov (United States)

    Tewari, Deepanker; Kim, Hyun; Feria, Willard; Russo, Brigite; Acland, Helen

    2004-08-01

    West Nile virus (WNV) RNA was quantified in WNV infected crows and horses with the help of a real-time reverse transcriptase-PCR assay. A 5' nuclease assay, based on NS5 gene detection with a fluorescent probe was used for quantifying WNV RNA using formalin fixed paraffin embedded tissue specimens. Quantitative detection of WNV RNA showed the presence of a higher amount of the viral RNA in crow tissues compared to equine tissues and these results correlated well with the detection of WNV antigen by immunostaining. In crows, the highest amount of virus was seen in the intestine and in horses in the brain.

  5. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  6. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    Science.gov (United States)

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  7. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  8. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  9. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3.

    Science.gov (United States)

    Thonur, Leenadevi; Maley, Madeleine; Gilray, Janice; Crook, Tara; Laming, Ellie; Turnbull, Dylan; Nath, Mintu; Willoughby, Kim

    2012-03-28

    Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD) is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR) to detect the viruses commonly implicated in BRD. A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV), bovine herpes virus type 1 (BoHV-1) and bovine parainfluenza virus type 3 (BPI3 i & ii) nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI) and/or indirect fluorescent antibody test (IFAT). The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA), minor groove binding (MGB) and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  10. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3

    Directory of Open Access Journals (Sweden)

    Thonur Leenadevi

    2012-03-01

    Full Text Available Abstract Background Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR to detect the viruses commonly implicated in BRD. Results A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV, bovine herpes virus type 1 (BoHV-1 and bovine parainfluenza virus type 3 (BPI3 i & ii nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI and/or indirect fluorescent antibody test (IFAT. Conclusions The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA, minor groove binding (MGB and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  11. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  12. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  13. Validation and utilization of an internally controlled multiplex Real-time RT-PCR assay for simultaneous detection of enteroviruses and enterovirus A71 associated with hand foot and mouth disease.

    Science.gov (United States)

    Thanh, Tran Tan; Anh, Nguyen To; Tham, Nguyen Thi; Van, Hoang Minh Tu; Sabanathan, Saraswathy; Qui, Phan Tu; Ngan, Tran Thuy; Van, Tran Thi My; Nguyet, Lam Anh; Ny, Nguyen Thi Han; Thanh, Le Thi My; Chai, Ong Kien; Perera, David; Viet, Do Chau; Khanh, Truong Huu; Ha, Do Quang; Tuan, Ha Manh; Wong, Kum Thong; Hung, Nguyen Thanh; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H Rogier; Van Tan, Le

    2015-06-09

    Hand foot and mouth disease (HFMD) is a disease of public health importance across the Asia-Pacific region. The disease is caused by enteroviruses (EVs), in particular enterovirus A71 (EV-A71). In EV-A71-associated HFMD, the infection is sometimes associated with severe manifestations including neurological involvement and fatal outcome. The availability of a robust diagnostic assay to distinguish EV-A71 from other EVs is important for patient management and outbreak response. We developed and validated an internally controlled one-step single-tube real-time RT-PCR in terms of sensitivity, linearity, precision, and specificity for simultaneous detection of EVs and EV-A71. Subsequently, the assay was then applied on throat and rectal swabs sampled from 434 HFMD patients. The assay was evaluated using both plasmid DNA and viral RNA and has shown to be reproducible with a maximum assay variation of 4.41 % and sensitive with a limit of detection less than 10 copies of target template per reaction, while cross-reactivity with other EV serotypes was not observed. When compared against a published VP1 nested RT-PCR using 112 diagnostic throat and rectal swabs from 112 children with a clinical diagnosis of HFMD during 2014, the multiplex assay had a higher sensitivity and 100 % concordance with sequencing results which showed EVs in 77/112 (68.8 %) and EV-A71 in 7/112 (6.3 %). When applied to clinical diagnostics for 322 children, the assay detected EVs in throat swabs of 257/322 (79.8 %) of which EV-A71 was detected in 36/322 (11.2 %) children. The detection rate increased to 93.5 % (301/322) and 13.4 % (43/322) for EVs and EV-A71, respectively, when rectal swabs from 65 throat-negative children were further analyzed. We have successfully developed and validated a sensitive internally controlled multiplex assay for rapid detection of EVs and EV-A71, which is useful for clinical management and outbreak control of HFMD.

  14. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  15. Development of duplex SYBR Green I-based real-time quantitative reverse-transcription PCR for detection and discrimination of grapevine viruses

    Science.gov (United States)

    A SYBR® Green-based real-time quantitative reverse transcription PCR (qRT-PCR) assay in combination with melt curve analysis (MCA) was developed for the detection of nine grapevine viruses. The detection limits for singleplex qRT-PCR for all nine grapevine viruses were determined to be in the range ...

  16. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus.

    Science.gov (United States)

    Komorowska, B; Malinowski, T; Michalczuk, L

    2010-09-01

    Detection of Apple stem pitting virus (ASPV) using RT-PCR based methods was studied in infected apple and pear trees. Three virus-specific primers (ASPF1CP, ASPF2CP, ASPR3CP) were designed to target the most conservative regions of the coat protein gene of 10 virus isolates in Poland and 7 other ASPV sequences available in GenBank. The suitability of the primer pairs ASPF1CP-ASPR3CP and ASPF2CP-ASPR3CP for detection of 19 virus isolates was checked. Both new primer pairs initiated amplification of a specific product from all sources tested. From 1 to 11 isolates were not detected with the primer sets published previously. Detection of the virus in the samples collected in March, using ASPF1CP-ASPR3CP primer pair, was possible up to 512 times dilution. For the samples collected in July, virus was detected in the extracts from infected plants diluted eight times. More than 100-fold increase of sensitivity could be obtained by semi-nested PCR with primers ASPF2CP-ASPR3CP following the first round with ASPF1CP-ASPR3CP. Identification of virus isolates with different number of deletions in the coat protein gene was possible using RT-PCR with newly designed reverse primer ASPDEL in combination with the published primer ASPV7956. Besides, the comparative analysis of silicacapture-RT-PCR (SC-RT-PCR) versus immunocapture-RT-PCR (IC-RT-PCR) assays was carried out. Few ASPV isolates escaped detection by IC-RT-PCR, while all isolates tested were detected using the SC-RT-PCR with the new primers. Copyright 2010 Elsevier B.V. All rights reserved.

  17. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  18. Influenza B Viruses in the Population of Province of Vojvodina during the 2012/2013 Season: Differentiation of B/Yamagata and B/Victoria Lineages by Real-time RT-PCR, Antigenic and Phylogenetic Characterization.

    Science.gov (United States)

    Radovanov, Jelena; Milošević, Vesna; Cvjetković, Ivana Hrnjaković; Ristić, Mioljub; Djilas, Milan; Nikolić, Nataša; Patić, Aleksandra; Kovačević, Gordana; Galović, Aleksandra Jovanović; Petrović, Tamaš; Mikić, Sandra Stefan

    2015-01-01

    At present, two phylogenetically distinct influenza B virus lineages, B/Yamagata and B/ Victoria, co-circulate worldwide and can cause significant morbidity and mortality. The aim of this study was to determine the prevalences of two influenza B virus lineages in the population of Vojvodina and to identify their antigenic and phylogenetic properties. A total of 369 and 334 nasopharyngeal, or nasal/throat swab samples, collected during the 2012/2013 and 2013/2014 seasons, respectively, were tested using specific singleplex influenza A, influenza B, influenza B/Yamagata and influenza B/Victoria real-time reverse transcription polymerase chain reaction (RT-PCR) assays. Antigenic and genetic testing were done by hemagglutination inhibition assay and hemagglutinin and neuraminidase gene sequence analysis, respectively. During the 2012/2013 season, influenza B viruses were present in 53.4% (101/189) of influenza positive samples.The B/Yamagata-like viruses (81.2%) significantly predominated over the B/Victoria-like viruses (18.8%). Comparing to B/Victoria-like positive patients, among B/Yamagata-like positive patients, children 5-14 years of age were significantly more represented (5.3% vs. 35.4%, respectively), as well as patients with mild form of illness (15.8% vs. 45.1%, respectively). The results of sequence analysis and antigenic testing showed that tested viruses were not closely related to B/Wisconsin/1/2010, the vaccine virus for 2012/2013. During the 2013/2014 season influenza B viruses were not detected. The results of this study confirmed the health significance of influenza B viruses and indicated that B/Yamagata-like viruses were significantly more prevalent than B/Victoria lineage viruses, during the 2012/2013 season. They also showed a sub-optimal match between the tested viruses and the vaccine virus for season 2012/2013.

  19. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  20. SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests

    Science.gov (United States)

    Tsukamoto, K.; Javier, P.C.; Shishido, M.; Noguchi, D.; Pearce, J.; Kang, H.-M.; Jeong, O.M.; Lee, Y.-J.; Nakanishi, K.; Ashizawa, T.

    2012-01-01

    Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10 1.5, 10 2.3, and 10 3.1 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples. Copyright ?? 2012, American Society for Microbiology. All Rights Reserved.

  1. Identifying Haemophilus haemolyticus and Haemophilus influenzae by SYBR Green real-time PCR.

    Science.gov (United States)

    Latham, Roger; Zhang, Bowen; Tristram, Stephen

    2015-05-01

    SYBR Green real time PCR assays for protein D (hpd), fuculose kinase (fucK) and [Cu, Zn]-superoxide dismutase (sodC) were designed for use in an algorithm for the identification of Haemophilus influenzae and H. haemolyticus. When tested on 127 H. influenzae and 60 H. haemolyticus all isolates were identified correctly. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  2. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix®RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  3. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia

    Czech Academy of Sciences Publication Activity Database

    Peková, Soňa; Marková, J.; Pajer, Petr; Dvořák, Michal; Cetkovský, P.; Schwarz, J.

    2005-01-01

    Roč. 9, č. 1 (2005), s. 23-34 ISSN 1084-8592 Institutional research plan: CEZ:AV0Z50520514 Keywords : minimal residual disease * chronic lymphocytic leukaemia * IgV(H) rearrangement Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.562, year: 2003

  4. Deteksi Virus Classical Swine Fever di Bali dengan RT-PCR

    Directory of Open Access Journals (Sweden)

    I Wayan Wirata

    2010-09-01

    Full Text Available Classical Swine Fever (CSF virus has been confirmed for the first time in pig in Bali. The object of thisstudy was suspected CSF cases diagnosed at the diagnostic laboratory assistantship of the Faculty ofVeterinary Medicine, Udayana University, in 2007-2008. Total number of cases was 12. Case recordsincluded the signalment of case (breed, age, body weight, and the origin of respective case, clinical signs,post-mortem lesions, and histological pictures. CSF virus was confirmed using the standardized reversetranscriptase-polymerase chain reaction (RT-PCR for CSF from European Union. One RT-PCR productwas sequenced. CSF virus was confirmed in seven out of 12 cases (58%. The cDNA sequence wasconfirmed to be specific of CSF E2 protein coding region with 98% homology to one isolate from China thatwas available in GeneBank. Further works are recommended to elucidate the sensitivity of RT-PCR, toclarify some differential diagnose, and to find out the genetic variation of CSF virus in Bali.Key words: classical swine fever virus, Bali, RT-PCR

  5. Development of a novel recombinant encapsidated RNA particle: evaluation as an internal control for diagnostic RT-PCR

    DEFF Research Database (Denmark)

    King, Donald P.; Montague, Nick; Ebert, Katja

    2007-01-01

    This report describes the generation of novel encapsidated RNA particles and their evaluation as in-tube internal controls in diagnostic real-time reverse-transcription PCR (rRT-PCR) assays for the detection of RNA viruses. A cassette containing sequences of 2 diagnostic primer sets for foot...... unguiculata). RNA contained in these particles was amplified in diagnostic rRT-PCR assays used for detection of FMDV and SVDV. Amplification of these internal controls was used to confirm that rRT-PCR inhibitors were absent from clinical samples, thereby verifying negative assay results. The recombinant CPMVs...... did not reduce the analytical sensitivity of the rRT-PCRs when amplification of the insert was performed in the same tube as the diagnostic target. This system provides an attractive solution to the production of internal controls for rRT-PCR assays since CPMV grows to high yields in plants...

  6. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  7. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Science.gov (United States)

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  9. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  10. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  11. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Baker, B R; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; Reid, S M; Ebert, K; Ferris, N P; King, D P

    2007-09-18

    A high-throughput multiplexed assay (Multiplex Version 1.0) was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRTPCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  12. Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

    Science.gov (United States)

    2009-01-01

    Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916

  13. Development of a simplified RT-PCR without RNA isolation for rapid detection of RNA viruses in a single small brown planthopper (Laodelphax striatellus Fallén).

    Science.gov (United States)

    Xu, Qiufang; Liu, Haoqiu; Yuan, Pingping; Zhang, Xiaoxia; Chen, Qingqing; Jiang, Xuanli; Zhou, Yijun

    2017-05-03

    The small brown planthopper (SBPH) is an important pest of cereal crops and acts as a transmission vector for multiple RNA viruses. Rapid diagnosis of virus in the vector is crucial for efficient forecast and control of viral disease. Reverse transcription polymerase chain reaction (RT-PCR) is a rapid, sensitive and reliable method for virus detection. The traditional RT-PCR contains a RNA isolation step and is widely used for virus detection in insect. However, using the traditional RT-PCR for detecting RNA virus in individual SBPHs becomes challenging because of the expensive reagents and laborious procedure associated with RNA isolation when processing a large number of samples. We established a simplified RT-PCR method without RNA isolation for RNA virus detection in a single SBPH. This method is achieved by grinding a single SBPH in sterile water and using the crude extract directly as the template for RT-PCR. The crude extract containing the virus RNA can be prepared in approximately two minutes. Rice stripe virus (RSV), rice black streaked dwarf virus (RBSDV) and Himetobi P virus (HiPV) were successfully detected using this simplified method. The detection results were validated by sequencing and dot immunobinding assay, indicating that this simplified method is reliable for detecting different viruses in insects. The evaluation of the sensitivity of this method showed that both RSV and HiPV can be detected when the cDNA from the crude extract was diluted up to 10 3 fold. Compared to the traditional RT-PCR with RNA isolation, the simplified RT-PCR method greatly reduces the sample processing time, decreases the detection cost, and improves the efficiency by avoiding RNA isolation. A simplified RT-PCR method is developed for rapid detection of RNA virus in a single SBPH without the laborious RNA isolation step. It offers a convenient alternative to the traditional RT-PCR method.

  14. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  15. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  17. Clinical utility of RT-PCR in assessing HER 2 gene expression versus traditional IHC and FISH in breast cancer patients.

    Science.gov (United States)

    Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C

    2018-02-09

    would have benefited from RT-PCR testing if it was used as a first-line test. If RT-PCR would have been used as a second-line test among those with IHC score 2 (n = 43), then only 6 patients would have been assigned a conclusive RT-PCR category (category 1 or 3) translating to a clinical benefit of 14% (6/43) as a second-line test. As a second-line test it had 51% probability to prove more cost-effective than the conventional pathway, provided the cost of RT-PCR was 0.4 times the cost of IHC. Also in a three-step pathway, RT-PCR upfront would have 56% probability of higher cost-benefit provided the cost of RT-PCR was 0.1 times the cost of IHC. RT-PCR results were found to be suboptimal to IHC in terms of discriminative ability and clinical benefit; thus, it is unlikely to replace IHC as a first-line test in the near future.

  18. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    Science.gov (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  20. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532.......3-100) and a specificity of 99.1% (95% CI: 97.4-99.8) for detection of Influenza A virus. The positive predictive and negative predictive values were 98.5% (95% CI: 95.8-99.7) and 99.7% (95% CI: 98.3-100) respectively. Influenza B virus detection could not be evaluated due to a low positivity rate. The BD MAX platform......BACKGROUND: Diagnosing of influenza rapidly and accurately helps clinicians to initiate appropriate treatment options and isolation protocols. Unnecessary antimicrobial treatment and laboratory testing can also be reduced. Assess commercial alternatives to in-house assays that may not only reduce...

  1. Table 1. Primers used in the qRT-PCR reactions. LBD gene name ...

    Indian Academy of Sciences (India)

    AGTTCGTCAGCATCATCTTG. VvLBD10. AATCCTTGCTCATCGTCTCAG. CATCTCTTGTTGCTCTCTTGC. VvLBD18. CCCGTGTATGGATGTGCTG. TGCTGCTGCTGCTGAAAG. Vvactin. TACAATTCCATCATGAAGTGTGATG. TTAGAAGCACTTCCTGTGAACAATG. Table 3. qRT-PCR analysis data in grape. Gene. Stress.

  2. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  3. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P AR, ERalpha or PSA expression between the groups. This study represents the first to show an upregulation of ERbeta gene expression in laser microdissected prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  4. Evaluation of the use of RT-PCR for the early diagnosis of dengue fever

    NARCIS (Netherlands)

    Grobusch, M. P.; Niedrig, M.; Göbels, K.; Klipstein-Grobusch, K.; Teichmann, D.

    2006-01-01

    RT-PCR was used to diagnose dengue virus infections confirmed serologically in 26 returning travellers. RT-PCR was positive for three (75%) of four samples taken on or before day 3 of the illness, for 15 (78.9%) of 19 samples taken between days 4 and 7, and for none of three samples tested on or

  5. Evaluation of reference genes in Vibrio parahaemolyticus for gene expression analysis using quantitative RT-PCR

    Science.gov (United States)

    Vibrio parahaemolyticus is a significant human pathogen capable of causing foodborne gastroenteritis associated with the consumption of contaminated raw or undercooked seafood. Quantitative RT-PCR (qRT-PCR) is a useful tool for studying gene expression in V. parahaemolyticus to characterize the viru...

  6. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  7. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  8. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  9. Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR

    Directory of Open Access Journals (Sweden)

    Marcello Gatti

    2010-06-01

    Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91

  10. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  11. Real-time PCR using SYBR Green for the detection of Shigella spp. in food and stool samples.

    Science.gov (United States)

    Mokhtari, W; Nsaibia, S; Gharbi, A; Aouni, M

    2013-02-01

    Shigella spp are exquisitely fastidious Gram negative organisms that frequently get missed in the detection by traditional culture methods. For this reason, this work has adapted a classical PCR for detection of Shigella in food and stool specimens to real-time PCR using the SYBR Green format. This method follows a melting curve analysis to be more rapid and provide both qualitative and quantitative data about the targeted pathogen. A total of 117 stool samples with diarrhea and 102 food samples were analyzed in Public Health Regional Laboratory of Nabeul by traditional culture methods and real-time PCR. To validate the real-time PCR assay, an experiment was conducted with both spiked and naturally contaminated stool samples. All Shigella strains tested were ipaH positive and all non-Shigella strains yielded no amplification products. The melting temperature (T(m) = 81.5 ± 0.5 °C) was consistently specific for the amplicon. Correlation coefficients of standard curves constructed using the quantification cycle (C(q)) versus copy numbers of Shigella showed good linearity (R² = 0.995; slope = 2.952) and the minimum level of detection was 1.5 × 10³ CFU/g feces. All food samples analyzed were negative for Shigella by standard culture methods, whereas ipaH was detected in 8.8% culture negative food products. Moreover, the ipaH specific PCR system increased the detection rate over that by culture alone from 1.7% to 11.1% among patients with diarrhea. The data presented here shows that the SYBR Green I was suitable for use in the real-time PCR assay, which provided a specific, sensitive and efficient method for the detection and quantification of Shigella spp in food and stool samples. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Single-step multiplex RT-PCR for simultaneous and colourimetric detection of six RNA viruses in olive trees.

    Science.gov (United States)

    Bertolini, E; Olmos, A; Martínez, M C; Gorris, M T; Cambra, M

    2001-07-01

    A single-step multiplex RT-PCR was developed for the simultaneous and colourimetric detection of six RNA viruses (Cucumber mosaic virus, Cherry leaf roll virus, strawberry latent ringspot virus, Arabis mosaic virus, Olive latent-1 virus and Olive latent-2 virus) which infect olive trees. Six compatible primer set for one-step RT-PCR amplification in a single closed-tube and 3' digoxigenin labelled probes were designed in optimal, specific and conserved regions. The method has been assessed with 195 Spanish field olive trees, suggesting that approximately 1.5% of the tested material was infected by Cucumber mosaic virus and 0.5% by Cherry leaf roll virus. This method saves time and reagent costs compared with monospecific RT-PCR which needs several reactions for the same number of tests. Using colourimetric detection, it is possible to analyse many samples, it increases sensitivity 10-fold, and whilst facilitating the interpretation of results, it avoids the use of gels and the toxic ethidium bromide. The method could be used routinely for sanitary and certification programmes.

  13. Identification and Validation of Reference Genes for qRT-PCR Studies of Gene Expression in Dioscorea opposita.

    Science.gov (United States)

    Zhao, Xiting; Zhang, Xiaoli; Guo, Xiaobo; Li, Shujie; Han, Linlin; Song, Zhihui; Wang, Yunying; Li, Junhua; Li, Mingjun

    2016-01-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) is one of the most common methods for gene expression studies. Data normalization based on reference genes is essential for obtaining reliable results for qRT-PCR assays. This study evaluated potential reference genes of Chinese yam (Dioscorea opposita Thunb.), which is an important tuber crop and medicinal plant in East Asia. The expression of ten candidate reference genes across 20 samples from different organs and development stages was assessed. We identified the most stable genes for qRT-PCR studies using combined samples from different organs. Our results also suggest that different suitable reference genes or combinations of reference genes for normalization should be applied according to different organs and developmental stages. To validate the suitability of the reference genes, we evaluated the relative expression of PE2.1 and PE53, which are two genes that may be associated with microtuber formation. Our results provide the foundation for reference gene(s) selection in D. opposita and will contribute toward more accurate gene analysis studies of the genus Dioscorea.

  14. Detection of Campylobacter jejuni in dairy farm environmental samples using SYBR Green real-time polymerase chain reaction.

    Science.gov (United States)

    Nam, H M; Srinivasan, V; Murinda, S E; Oliver, S P

    2005-01-01

    The aim of this study was to evaluate a SYBR Green based real-time PCR assay using well-characterized primers to detect Campylobacter jejuni in naturally contaminated dairy farm environmental samples. Specificity of the assay was determined with 62 C. jejuni strains and 120 non-C. jejuni strains. Peak melting temperature obtained with melting curves specific for C. jejuni was 77.5 degrees C. Standard curves were constructed using mean threshold cycle (C(T)) and various concentrations of C. jejuni ranging from 10(0) to 10(8) colony forming units (CFU)/mL, which resulted in a linear relationship between C(T) and log input DNA. Correlation coefficients of standard curves based on pure culture of C. jejuni in broth and spiked cells in lagoon water were R(2) = 0.995 (slope = 3.21) and R(2) = 0.988 (slope = 3.22), respectively, and sensitivity limits were 10(3) CFU/mL, respectively. After 24-h enrichment, total C. jejuni counts of all samples spiked with 10(0) CFU/mL reached >10(5) CFU/mL, and the detection limit was improved from >10(3) CFU/mL to PCR assay detected C. jejuni in 25 (30.4%) of 82 samples, with 17 (68%) of these samples being culture positive for C. jejuni. All samples that were positive by standard culture methods were also positive by the real-time PCR method. Mean C( T ) values of 48-h enriched cultures for 17 PCR-positive/culture-positive samples and eight PCR-positive/culture-negative samples were 21.4 +/- 3.6, and 34.6 +/- 1.5 (p 38.0. These results indicate that the SYBR Green real-time PCR assay provides a specific, reproducible, and simple method for detecting C. jejuni in dairy farm environmental samples.

  15. A SYBR Green real-time PCR assay to detect and quantify pork meat in processed poultry meat products.

    Science.gov (United States)

    Soares, Sónia; Amaral, Joana S; Oliveira, M Beatriz P P; Mafra, Isabel

    2013-05-01

    Species identification in meat products has grown in interest in recent years since these foodstuffs are susceptible targets for fraudulent labelling. In this work, a real-time PCR approach based on SYBR Green dye was proposed for the quantitative detection of pork meat in processed meat products. For the development of the method, binary meat mixtures containing known amounts of pork meat in poultry meat were used to obtain a normalised calibration model from 0.1 to 25% with high linear correlation and PCR efficiency. The method revealed high specificity by melting curve analysis, being successfully validated through its application to blind meat mixtures, which confirmed its adequacy for pork meat determination. The fully applicability of the method was further demonstrated in commercial meat products, allowing verification of labelling compliance and identification of meat species in processed foods. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum.

    Science.gov (United States)

    Song, A; You, Y; Chen, F; Li, P; Jiang, J; Chen, S

    2013-01-01

    Chrysanthemum plants are subject to serious virus diseases, so detection and identification of virus pathogens is important to prevent the virus spread. A reliable one-step multiplex RT-PCR was developed to simultaneously detect two viruses and two viriods: chrysanthemum virus B, tomato Aspermy virus, chrysanthemum stunt viroid and chrysanthemum chlorotic mottle viroid. In addition, we investigated the detection limit and the efficiency of single and multiplex RT-PCR assays. The results showed that the multiplex RT-PCR assay proved to be as sensitive as the single one. In conclusion, this technique is potentially useful in routine diagnosis of chrysanthemum viruses and viroids. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in chrysanthemum, which provides a fast, convenient, cost-saving way to detect the virus and viroid mixed infections in plants. © 2012 The Society for Applied Microbiology.

  17. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  18. Application of Multiplex RT-PCR for Detection of Cucurbit-infecting Tobamovirus

    OpenAIRE

    Daryono, Budi Setiadi; Natsuaki, Keiko T.

    2016-01-01

    Cucumber green mottle mosaic virus (CGMMV) and Kyuri green mottle mosaic virus (KGMMV) are seed borne viruses and they are also transmitted mechanically during agricultural practice and through water. Hence, these viruses have potential diseases widely distributed throughout the world. To detect different strains of CGMMV and KGMMV, several specific primers for each virus were designed for single and multiplex RT-PCR. The results of single and multiplex RT-PCR showed that CGMMV was detected i...

  19. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  20. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  1. Evaluation of four different systems for extraction of RNA from stool suspensions using MS-2 coliphage as an exogenous control for RT-PCR inhibition.

    Directory of Open Access Journals (Sweden)

    Lester M Shulman

    Full Text Available Knowing when, and to what extent co-extracted inhibitors interfere with molecular RNA diagnostic assays is of utmost importance. The QIAamp Viral RNA Mini Kit (A; MagNA Pure LC2.0 Automatic extractor (B; KingFisher (C; and NucliSENS EasyMag (D RNA extraction systems were evaluated for extraction efficiency and co-purification of inhibitors from stool suspensions. Real-Time Reverse Transcriptase Polymerase Chain Reaction (rRT-PCR of MS-2 coliphage spiked into each system's lysis buffer served as an external control for both. Cycle thresholds (Cts of the MS2 were determined for RNA extracted from stool suspensions containing unknown (n = 93 or varying amounts of inhibitors (n = 92. Stool suspensions from the latter group were also used to determine whether MS-2 and enterovirus rRT-PCR inhibitions were correlated. Specifically 23 RNA extracts from stool suspensions were spiked with enterovirus RNA after extraction and 13 of these stool suspension were spiked with intact enterovirus before extraction. MS2 rRT-PCR inhibition varied for RNAs extracted by the different systems. Inhibition was noted in 12 (13.0%, 26 (28.3%, 7 (7.6%, and 7 (7.6% of the first 93 RNA extracts, and 58 (63.0%, 55 (59.8%, 37 (40.2% and 30 (32.6% of the second 92 extracts for A, B, C, and D, respectively. Furthermore, enterovirus rRT-PCR inhibition correlated with MS2 rRT-PCR inhibition for added enterovirus RNA or virus particles. In conclusion, rRT-PCR for MS-2 RNA is a good predictor of inhibition of enterovirus RNA extracted from stool suspensions. EasyMag performed the best, however all four extraction methods were suitable provided that external controls identified problematic samples.

  2. ROS1 gene rearrangement and expression of splice isoforms in lung cancer, diagnosed by a novel quantitative RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Kalla C

    2016-07-01

    Full Text Available Successful treatment of lung cancer (NSCLC patients with ROS1 inhibitors depends on the accurate diagnosis of ROS1 gene rearrangements. The approved FISH tests are low-throughput assays difficult to use in daily diagnostic practice. Immunohistochemistry is currently discussed as screening test. We aimed to devise an alternative, sensitive diagnostic test for the rearrangement of ROS1 and to investigate upregulated ROS1 gene expression as potential target in NSCLC. We developed a qRT-PCR assay adapted to RNA isolated from FFPE material and applied it to 695 NSCLC specimens. The reliability to detect ROS1 rearrangements was evidenced by comparison with FISH and immunohistochemistry. qRT-PCR analysis detected unbalanced ROS1 expression indicative of gene rearrangement in 5 (0.7% and expression of non-rearranged ROS1 transcripts in 65 (9.6% of 680 interpretable tumors. In comparison with FISH, qRT-PCR accurately typed 99% of 5 rearranged and 121 non-rearranged tumors. Immunohistochemistry detected ROS1 protein expression in 7/8 tumors with gene fusions and 6/35 NSCLC with transcriptional upregulation. To elucidate RNA processing, 12 NSCLC were examined by systematic RT-PCR and sequence analysis. In all 12 NSCLC analyzed, up-regulated gene expression independent of translocation was associated with aberrant expression of fetal transcript isoforms identified here. We conclude that our qRT-PCR assay reliably diagnoses and distinguishes ROS1 rearrangements and expression of non-rearranged transcripts. Immunostaining is a suitable screening tool, but re-examination of ROS1 protein expressing cases by qRT-PCR/FISH is compulsory. The expression of ROS1 splice isoforms – shown here for the first time - may be relevant for ROS1 inhibitor therapy in NSCLC.

  3. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  4. Prompt detection of influenza A and B viruses using the BD Veritor™ System Flu A+B, Quidel® Sofia® Influenza A+B FIA, and Alere BinaxNOW® Influenza A&B compared to real-time reverse transcription-polymerase chain reaction (RT-PCR).

    Science.gov (United States)

    Dunn, Jim; Obuekwe, Joy; Baun, Traci; Rogers, Justin; Patel, Twinkle; Snow, Linda

    2014-05-01

    The performance characteristics of rapid influenza diagnostic tests vary widely. This study evaluated the BD Veritor™ System Flu A+B (Veritor; BD Diagnostics, Sparks, MD, USA), Quidel® Sofia® Influenza A+B FIA (Sofia; Quidel Corp., San Diego, CA, USA), and Alere BinaxNOW® Influenza A&B (Binax; Alere Scarborough, Inc., Scarborough, ME, USA) compared to reverse transcription-polymerase chain reaction (RT-PCR) for detection of influenza viruses in nasal wash specimens from 240 pediatric patients. Positive percent agreements for influenza A and B virus detection were 93.8% and 94.2%, 95.8% and 98.1%, and 79.2% and 80.8% for Veritor, Sofia, and Binax, respectively. The Veritor and Binax tests demonstrated negative percent agreements >97.9% for detection of both influenza viruses, but the negative percent agreement of the Sofia test was 91.1% for influenza A and 70.7% for influenza B virus. Overall, the Veritor and Sofia tests were nearly as sensitive as RT-PCR and considerably more sensitive than Binax for detection of influenza viruses. However, the accuracy of the Sofia test was significantly lower than either Veritor or Binax. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Prognostic Value of RT-PCR Tyrosinase Detection in Peripheral Blood of Melanoma Patients

    Science.gov (United States)

    Carrillo, Esmeralda; Prados, José; Marchal, Juan Antonio; Boulaiz, Houria; Martínez, Antonio; Rodríguez-Serrano, Fernando; Caba, Octavio; Serrano, Salvio; Aránega, Antonia

    2006-01-01

    Malignant melanoma (MM) prognosis has been related to tumour thickness and clinical stage and metastasis risk has been associated with presence of tumour cells in peripheral blood. The aim of this study was to determine the relationship between presence of tyrosinase in peripheral blood of MM patients and their clinical prognosis. Blood samples from 58 MM patients (stage I–IV) were analysed, using RT-PCR assay to detect tyrosinase mRNA. The results showed that positive RT-PCR assay for tyrosinase were significantly associated with clinical status and tumour thickness. After a median follow-up of 24 months, RT-PCR results were found to be significant correlated with recurrence (p < 0.05) and clinical stage III (p < 0.05). Separate analysis of stage III tumours to determine the prognostic value of tyrosinase presence in peripheral blood showed an overall 24-month survival rate of 70% in the RT-PCR negative group versus 10% in the positive group (p < 0.02). These results suggest that detection of circulating melanoma cells may be especially relevant in stage III patients, in whom RT-PCR positivity defines a subpopulation at high risk of recurrence. PMID:16788251

  6. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  7. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  8. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India

    Directory of Open Access Journals (Sweden)

    K P Dinoop

    2016-01-01

    Interpretation & conclusions: Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  9. Differential Diagnosis of Entamoeba spp. in Clinical Stool Samples Using SYBR Green Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Thiago dos Santos Gomes

    2014-01-01

    Full Text Available Amoebiasis, a disease caused by Entamoeba histolytica, is usually diagnosed by microscopic examination, which does not differentiate the morphologically identical species of the E. histolytica/E. dispar complex. Furthermore, morphologically similar species such as Entamoeba hartmanni contribute to misidentification. Therefore, there is a need for more sensitive and specific methods. This study standardized a multiplex real-time PCR system for E. histolytica and E. dispar and a single real-time PCR for E. hartmanni. The multiplex protocol detected up to 0.0143 pg of E. histolytica DNA and 0.5156 pg of E. dispar DNA, and the average melting temperature (Tm was 73°C and 70°C, respectively. For E. hartmanni, the Tm was 73°C and the amplification was successful down to 0.03 fg of plasmid DNA. Negative controls and other intestinal parasites presented no amplification. Among the 48 samples tested, E. dispar DNA was detected in 37; none exhibited E. histolytica DNA and 11 were negative in the multiplex protocol. In 4 of these 11 samples, however, E. hartmanni DNA was amplified. SYBR Green is demonstrated to be an interesting option and these combined PCR reactions can improve laboratory diagnosis of amoebiasis in developing countries.

  10. Differential diagnosis of Entamoeba spp. in clinical stool samples using SYBR green real-time polymerase chain reaction.

    Science.gov (United States)

    Gomes, Thiago Dos Santos; Garcia, Mariana Coimbra; de Souza Cunha, Flavia; Werneck de Macedo, Heloisa; Peralta, José Mauro; Peralta, Regina Helena Saramago

    2014-01-01

    Amoebiasis, a disease caused by Entamoeba histolytica, is usually diagnosed by microscopic examination, which does not differentiate the morphologically identical species of the E. histolytica/E. dispar complex. Furthermore, morphologically similar species such as Entamoeba hartmanni contribute to misidentification. Therefore, there is a need for more sensitive and specific methods. This study standardized a multiplex real-time PCR system for E. histolytica and E. dispar and a single real-time PCR for E. hartmanni. The multiplex protocol detected up to 0.0143 pg of E. histolytica DNA and 0.5156 pg of E. dispar DNA, and the average melting temperature (T(m)) was 73 °C and 70 °C, respectively. For E. hartmanni, the T(m) was 73 °C and the amplification was successful down to 0.03 fg of plasmid DNA. Negative controls and other intestinal parasites presented no amplification. Among the 48 samples tested, E. dispar DNA was detected in 37; none exhibited E. histolytica DNA and 11 were negative in the multiplex protocol. In 4 of these 11 samples, however, E. hartmanni DNA was amplified. SYBR Green is demonstrated to be an interesting option and these combined PCR reactions can improve laboratory diagnosis of amoebiasis in developing countries.

  11. Differential Diagnosis of Entamoeba spp. in Clinical Stool Samples Using SYBR Green Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Gomes, Thiago dos Santos; Garcia, Mariana Coimbra; de Souza Cunha, Flavia; Peralta, José Mauro; Peralta, Regina Helena Saramago

    2014-01-01

    Amoebiasis, a disease caused by Entamoeba histolytica, is usually diagnosed by microscopic examination, which does not differentiate the morphologically identical species of the E. histolytica/E. dispar complex. Furthermore, morphologically similar species such as Entamoeba hartmanni contribute to misidentification. Therefore, there is a need for more sensitive and specific methods. This study standardized a multiplex real-time PCR system for E. histolytica and E. dispar and a single real-time PCR for E. hartmanni. The multiplex protocol detected up to 0.0143 pg of E. histolytica DNA and 0.5156 pg of E. dispar DNA, and the average melting temperature (T m) was 73°C and 70°C, respectively. For E. hartmanni, the T m was 73°C and the amplification was successful down to 0.03 fg of plasmid DNA. Negative controls and other intestinal parasites presented no amplification. Among the 48 samples tested, E. dispar DNA was detected in 37; none exhibited E. histolytica DNA and 11 were negative in the multiplex protocol. In 4 of these 11 samples, however, E. hartmanni DNA was amplified. SYBR Green is demonstrated to be an interesting option and these combined PCR reactions can improve laboratory diagnosis of amoebiasis in developing countries. PMID:24693242

  12. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Validation of artificial microRNA expression by poly(A) tailing-based RT-PCR

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Rui Shi, Chenmin Yang, Ronald Sederoff & Vincent Chiang ### Abstract Here we describe a protocol for validating expression of artificial microRNAs (amiRNAs) by poly(A) tailing-based RT-PCR. Total RNAs, including amiRNA, are poly(A) tailed using E.coli. poly(A) polymerase. Poly(A) tailed amiRNA can be converted into cDNA along with mRNAs in a reverse transcription reaction primed by a standard poly(T) anchor adaptor. AmiRNA can then be amplified and quantitated by real-time PC...

  14. Real-Time PCR Detection ofBurkholderia cepaciain Pharmaceutical Products Contaminated with Low Levels of Bacterial Contamination.

    Science.gov (United States)

    Jimenez, Luis; Jashari, Theranda; Vasquez, Jenifer; Zapata, Stephanie; Bochis, Joy; Kulko, Margarita; Ellman, Victoria; Gardner, Matthew; Choe, Tina

    2018-01-01

    A real-time polymerase chain reaction (RT-PCR) assay was developed to detect Burkholderia cepacia in pharmaceutical products contaminated with low levels of bacteria. Different pharmaceutical suspensions were artificially contaminated with B. cepacia , Escherichia coli , Staphylococcus aureus , and Bacillus megaterium After a 24 h incubation in trypticase soy broth with Tween 20, samples were streaked on mannitol salt, phenyl ethyl alcohol, eosin methylene blue, MacConkey, and pseudomonas isolation agar. Microbial DNA was extracted from each sample by using a Tris-EDTA, proteinase K, Tween 20 buffer. Regular PCR targeting the 1.5 kilobases 16S rRNA eubacterial gene and cloning showed the predominant DNA in the extracted mix belonged to E. coli Selective media isolation of bacterial contamination showed B. cepacia only detected on pseudomonas isolation while eosin methylene blue and MacConkey detected only E. coli RT-PCR using primers PSL1 and PSR1 amplified a 209 bp 16S rRNA fragment using a Roche LightCycler 96 ® system with SYBR green I, a common double-stranded binding dye. The cycle at which fluorescence from amplification exceeds the background fluorescence was referred to as quantification cycle. All samples were found to be positive by standard microbiological testing and RT-PCR. B. cepacia was detected within 30 h in all contaminated samples using RT-PCR. Based upon standard curve analysis of B. cepacia DNA, the minimum DNA concentration that could be detected was 10 fg/uL with a correlation value of 0.98. RT-PCR detection of B. cepacia allowed faster quality control analysis, corrective actions, and process optimization. LAY ABSTRACT: A real-time polymerase chain reaction (RT-PCR) assay was developed to detect Burkholderia cepacia in pharmaceutical products contaminated with low levels of bacteria. B. cepacia is the number one reason for microbial contamination recalls of non-sterile drug products in the USA. RT-PCR using primers PSL1 and PSR1 amplified a

  15. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  16. A rapid and sensitive protocol for competitive reverse transcriptase (cRT) PCR analysis of cellular genes.

    Science.gov (United States)

    Waha, A; Watzka, M; Koch, A; Pietsch, T; Przkora, R; Peters, N; Wiestler, O D; von Deimling, A

    1998-01-01

    The specific analysis of gene transcripts is of increasing importance for studies in molecular pathology. Competitive RT-PCR with mutagenized exogenous competitor templates has evolved as an attractive approach to quantify individual mRNA levels. The generation of exogenous competitor RNAs usually requires mutagenesis and cloning of the mutant fragment into plasmids followed by in vitro transcription. In contrast to primer directed mutagenesis and in vitro transcription, preparation of the mutant fragments is a time consuming procedure. Here we report on a modified semi-quantitative RT-PCR protocol to circumvent the laborious cloning of mutant exogenous competitors. Templates for the in vitro transcription are generated in a single PCR reaction with simultaneous addition of a promoter sequence 5'of the forward primer and deletion of 10-20 nucleotides at the opposite end just ahead of the reverse primer binding site. The product of this PCR step serves as template for in vitro transcription to yield exogenous competitor RNA of equal quality and amount as conventional cloning strategies. Total RNA amounts are corrected for by analyzing the expression of different housekeeping genes in the same manner. One of the primers used in the following competitive RT-PCR reaction is labeled with a fluorescent dye for the analysis of target and exogenous competitor product on an semiautomated sequencer. In the present study, this protocol was employed to analyze the expression of the PTCH, Fas-receptor, NF-1, beta2-microglobulin and GAPD genes in human brain tumors. It will, however, be widely applicable to studies on cellular transcripts in biological specimens.

  17. Field detection of avian influenza virus in wild birds: evaluation of a portable rRT-PCR system and freeze-dried reagents

    Science.gov (United States)

    Takekawa, John Y.; Iverson, Samuel A.; Schultz, Annie K.; Hill, Nichola J.; Cardona, Carol J.; Boyce, Walter M.; Dudley, Joseph P.

    2010-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAIV) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds is often conducted in remote regions, but results are often delayed because of limited local analytical capabilities, difficulties with sample transportation and permitting, or problems keeping samples cold in the field. In response to these challenges, the performance of a portable real-time, reverse transcriptase-polymerase chain reaction (rRT-PCR) unit (RAPID(Registered), Idaho Technologies, Salt Lake City, UT) that employed lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies) was compared to virus isolation combined with real-time RT-PCR conducted in a laboratory. This study included both field and experimental-based sampling. Field samples were collected from migratory shorebirds captured in northern California, while experimental samples were prepared by spiking fecal material with an H6N2 AIV isolate. Results indicated that the portable rRT-PCR unit had equivalent specificity to virus isolation with no false positives, but sensitivity was compromised at low viral titers. Use of portable rRT-PCR with lyophilized reagents may expedite surveillance results, paving the way to a better understanding of wild bird involvement in HPAIV H5N1 transmission.

  18. Quantification of ochratoxin A-producing molds in food products by SYBR Green and TaqMan real-time PCR methods

    DEFF Research Database (Denmark)

    Rodríguez, Alicia; Rodríguez, Mar; Luque, M. Isabel

    2011-01-01

    Ochratoxin A (OTA) is a mycotoxin synthesized by a variety of different fungi, most of them from the genera Penicillium and Aspergillus. Early detection and quantification of OTA producing species is crucial to improve food safety. In the present work, two protocols of real-time qPCR based on SYBR...... 1 and 10 conidia/g for SYBR Green assay and TaqMan. No significant differences were found between the Ct values obtained from pure mold DNA and pure mold DNA mixed with food DNA. The ability of the designed qPCR methods to quantify two known conidial suspensions inoculated on several foods...... was evaluated. The amount of conidia assessed by both qPCR methods was close to the inoculated amount for most foods and indicates that the described procedure holds potential for use for the detection and quantification of OTA producing molds in foods....

  19. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT......-PCR-ELISA) and 2) the subtype specific RT-PCR for H5 and H7 were compared to the results obtained by inoculation of the same specimens into the allantoic cavity of embryonated specific pathogen free (SPF) hen's eggs. Using inoculation in SPF fowl eggs as standard the sensitivity of the NP RT-PCR-ELISA and the RT...

  20. Molecular detection of Papaya meleira virus in the latex of Carica papaya by RT-PCR

    NARCIS (Netherlands)

    Araujo, de M.M.M.; Tavares, E.T.; Silva, da F.R.; Marinho, V.L.D.; Souza, M.T.

    2007-01-01

    A RT-PCR assay was developed for early and accurate detection of Papaya meleira virus (PMeV) in the latex from infected papayas. The meleira disease is characterized by an excessive exudation of more fluidic latex from fruits, leaves and stems. This latex oxidises and gives the fruit a ¿sticky¿

  1. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  2. Detecting the Presence of Nora Virus in "Drosophila" Utilizing Single Fly RT-PCR

    Science.gov (United States)

    Munn, Bethany; Ericson, Brad; Carlson, Darby J.; Carlson, Kimberly A.

    2015-01-01

    A single fly RT-PCR protocol has recently been developed to detect the presence of the persistent, horizontally transmitted Nora virus in "Drosophila." Wild-caught flies from Ohio were tested for the presence of the virus, with nearly one-fifth testing positive. The investigation presented can serve as an ideal project for biology…

  3. Evaluation of Microarray Preprocessing Algorithms Based on Concordance with RT-PCR in Clinical Samples

    DEFF Research Database (Denmark)

    Hansen, Kasper Lage; Szallasi, Zoltan Imre; Eklund, Aron Charles

    2009-01-01

    performed. METHODOLOGY/PRINCIPAL FINDINGS: We used TaqMan RT-PCR arrays as a reference to evaluate the accuracy of expression values from Affymetrix microarrays in two experimental data sets: one comprising 84 genes in 36 colon biopsies, and the other comprising 75 genes in 29 cancer cell lines. We...

  4. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  5. The feasibility of tetraplex RT-PCR in the determination of PVS ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... Dormant potato tubers belonging to cvs., namely, Agria, Granola and Marfona known to be infected with potato viruses (Potato leafroll virus, PLRV; Potato virus S, PVS; Potato virus X, PVX and Potato virus Y,. PVY) were tested with uniplex RT-PCR and strong bands specific to each virus were obtained from.

  6. Standardized quantitative RT-PCR assays for quantitation of yellow fever and chimeric yellow fever-dengue vaccines.

    Science.gov (United States)

    Mantel, N; Aguirre, M; Gulia, S; Girerd-Chambaz, Y; Colombani, S; Moste, C; Barban, V

    2008-07-01

    Yellow fever-dengue chimeras (CYDs) are being developed currently as live tetravalent dengue vaccine candidates. Specific quantitative assays are needed to evaluate the viral load of each serotype in vaccine batches and biological samples. A quantitative real-time RT-PCR (qRT-PCR) system was developed comprising five one-step qRT-PCRs targeting the E/NS1 junction of each chimera, or the NS5 gene in the yellow fever backbone. Each assay was standardized using in vitro transcribed RNA qualified according to its size and purity, and precisely quantified. A non RNA-extracted virus sample was introduced as external quality control (EQC), as well as 2 extraction controls consisting of 2 doses, 40 and 4,000 GEQ (genomic equivalents), of this EQC extracted in parallel to the samples. Between 6 and 10 GEQ/reaction were reproducibly measured with all assays and similar titers were obtained with the two methods when chimeric virus samples were quantified with the E/NS1- or the NS5-specific assays. Reproducibility of RNA extraction was ensured by automation of the process (yield>or=50%), and infectious virus was isolated in >or=80% of PCR-positive sera from immune monkeys.

  7. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  8. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  9. APPLICATION OF RT-PCR FOR ACETOBACTER SPECIES DETECTION IN RED WINE

    Directory of Open Access Journals (Sweden)

    Attila Kántor

    2014-02-01

    Full Text Available Acetic acid bacteria play a negative role in wine making because they increase the volatile acidity of wines. They can survive in the various phases of alcoholic fermentation and it is very important to control their presence and ulterior development. The main objective of the present work is to test fast, sensitive and reliable technique such as real-time PCR (rt-PCR and detecting the presence of Acetobacter aceti, Acetobacter pasteurianus, Gluconobacter oxydans, Gluconacetobacter liquefaciens and Gluconacetobacter hansenii in red wine. The aim of our study was the identification of some species of acetic acid bacteria in red wine during the fermentation process using a classical microbiological method. The changes in different groups of microorganisms were monitored in total counts of bacteria, and Acetobacter cells. Microbiological parameters were observed during the current collection and processing of wine in 2012. Samples (Modry Portugal, MP and Frankovka modra, FM were taken during the fermentation process in wine enterprises and were storage with different conditions. The total counts of bacteria ranged from 4.21 in the wine MP at 4°C of storage to 5.81 log CFU.mL-1 in the wine MP at 25°C of storage, but the total counts of bacteria ranged from 4.85 in the wine FM at 4°C of storage to 5.63 log CFU.mL-1 in the wine FM at 25°C of storage. The higher number of Acetobacter cells was found in wine MP at 25°C.

  10. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection.

    NARCIS (Netherlands)

    Vlems, F.A.; Diepstra, J.H.S.; Cornelissen, I.M.; Ligtenberg, M.J.L.; Wobbes, Th.; Punt, C.J.A.; Krieken, J.H.J.M. van; Ruers, T.J.M.; Muijen, G.N.P. van

    2003-01-01

    BACKGROUND: In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth

  11. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection

    NARCIS (Netherlands)

    Vlems, F. A.; Diepstra, J. H. S.; Cornelissen, I. M. H. A.; Ligtenberg, M. J. L.; Wobbes, Th; Punt, C. J. A.; van Krieken, J. H. J. M.; Ruers, T. J. M.; van Muijen, G. N. P.

    2003-01-01

    In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth factor receptor

  12. RT-PCR diagnosis of recurrent rearrangements in pediatric acute lymphoblastic leukemia in Argentina.

    Science.gov (United States)

    Alonso, Cristina N; Gallego, Marta S; Rossi, Jorge G; Medina, Adriana; Rubio, Patricia L; Bernasconi, Andrea R; Zubizarreta, Pedro A; Felice, María S

    2012-06-01

    The present study was performed to establish the prevalence of the recurrent fusion transcripts in Argentinean pediatric patients with acute lymphoblastic leukemia (ALL). A total of 380 newly diagnosed children (including 50 infants and 44 T-ALL) were screened by RT-PCR; the incidence of recurrent rearrangements was: ETV6-RUNX1, 12.9%; TCF3-PBX1, 5.0%; BCR-ABL1, 1.6%; and MLL rearrangements, 10.5%. STIL-TAL1 was detected in 22.7% of T-ALL cases. In B-ALL cases, the pEFS was significantly influenced by the presence of genetic alterations. RT-PCR studies improved patients' stratification and also the overall outcome of children treated in a pediatric hospital from a developing country. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Simple and Rapid Detection for Rice stripe virus Using RT-PCR and Porous Ceramic Cubes

    Directory of Open Access Journals (Sweden)

    Su-Bin Hong

    2015-12-01

    Full Text Available A rapid and simple RT-PCR diagnosis method for detection of Rice stripe virus (RSV, one of major virus infecting rice, was developed using porous ceramic cubes in this study. The porous ceramic cube can rapidly absorb biological molecules such as small-sized proteins and nucleic acid fragments into its pores. We examined whether this ability of porous ceramic cubes could be applied for isolating viral nucleic acids or particles from the RSV- infected plant tissues. In this study, we found that the porous ceramic cube was capable of absorbing a detection level of viruses from the rice tissues infected with RSV and established RT-PCR-based RNA diagnosis method using porous ceramic cubes.

  14. Standard-curve competitive RT-PCR quantification of myogenic regulatory factors in chicken embryos

    Directory of Open Access Journals (Sweden)

    L.E. Alvares

    2003-12-01

    Full Text Available The reverse transcription-polymerase chain reaction (RT-PCR is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions. The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

  15. Detection of circulating tumor cells by nested RT-PCR targeting ...

    African Journals Online (AJOL)

    Salwa H. Teama

    We used nested RT-PCR-based reverse transcription PCR assay for the detection of circu- lating cancer cells in the peripheral blood. Results: The blood samples from the colon cancer patients showed detection of EGFR in 15/36 patients (41.7%); CEAmRNA in 22/36 patients (61.1%) and CK20mRNA in 24/36 patients.

  16. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  17. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  18. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  19. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  20. Identification of candidate reference genes in perennial ryegrass for quantitative RT-PCR under various abiotic stress conditions.

    Directory of Open Access Journals (Sweden)

    Linkai Huang

    Full Text Available BACKGROUND: Quantitative real-time reverse-transcriptase PCR (qRT-PCR is an important technique for analyzing differences in gene expression due to its sensitivity, accuracy and specificity. However, the stability of the expression of reference genes is necessary to ensure accurate qRT-PCR assessment of expression in genes of interest. Perennial ryegrass (Lolium perenne L. is important forage and turf grass species in temperate regions, but the expression stability of its reference genes under various stresses has not been well-studied. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 11 candidate reference genes were evaluated for use as controls in qRT-PCR to quantify gene expression in perennial ryegrass under drought, high salinity, heat, waterlogging, and ABA (abscisic acid treatments. Four approaches--Delta CT, geNorm, BestKeeper and Normfinder were used to determine the stability of expression in these reference genes. The results are consistent with the idea that the best reference genes depend on the stress treatment under investigation. Eukaryotic initiation factor 4 alpha (eIF4A, Transcription elongation factor 1 (TEF1 and Tat binding protein-1 (TBP-1 were the three most stably expressed genes under drought stress and were also the three best genes for studying salt stress. eIF4A, TBP-1, and Ubiquitin-conjugating enzyme (E2 were the most suitable reference genes to study heat stress, while eIF4A, TEF1, and E2 were the three best reference genes for studying the effects of ABA. Finally, Ubiquitin (UBQ, TEF1, and eIF4A were the three best reference genes for waterlogging treatments. CONCLUSIONS/SIGNIFICANCE: These results will be helpful in choosing the best reference genes for use in studies related to various abiotic stresses in perennial ryegrass. The stability of expression in these reference genes will enable better normalization and quantification of the transcript levels for studies of gene expression in such studies.

  1. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  2. Development of SYBR Green and TaqMan quantitative real-time PCR assays for hepatopancreatic parvovirus (HPV) infecting Penaeus monodon in India.

    Science.gov (United States)

    Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V

    2015-12-01

    Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Selection of housekeeping genes for normalization of RT-PCR in hypoxic neural stem cells of rat in vitro.

    Science.gov (United States)

    Yao, Lu; Chen, Xinlin; Tian, Yingfang; Lu, Haixia; Zhang, Pengbo; Shi, Qindong; Zhang, Junfeng; Liu, Yong

    2012-01-01

    Gene expression analysis under various conditions using real-time reverse transcription polymerase chain reaction (RT-PCR) needs reliable control genes. Housekeeping genes are commonly used as the control. However, no validated housekeeping gene is available for study of hypoxic neural stem cell culture. To choose appropriate internal control genes, the expression of eight commonly used housekeeping genes was examined in rat neural stem cell model to find one or more stably expressed genes under hypoxic/ischemic conditions. Two genes, HPRT and RPL13A were identified as the most confidential housekeeping genes in this research by geNorm and NormFinder softwares. As a groundwork, the most stable housekeeping genes for neural stem cells under hypoxic/ischemic conditions are initially investigated and validated in this experiment, which might provide a better understanding for the gene expression study in ischemic and necrotic neural stem cell cultures or in ischemic diseases of the central nervous system (CNS).

  4. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  5. Multiprobe RNase protection assay with internally labeled radioactive probes, generated by RT-PCR and nested PCR.

    Science.gov (United States)

    von Wolff, M; Tabibzadeh, S

    1999-07-01

    RNase Protection Assay (RPAs) is a highly sensitive and reproducible method of quantitating the levels of specific mRNA transcripts. The introduction of the commercially available Multiprobe RPAs allow comparing and quantifying the expression of up to different mRNA species in a single sample of 1-20 micrograms of total RNA. To generate probes which are not commercially available, we prepared highly specific probes by RT-PCR and nested PCR. Then, after ligation of a T7 promoter, another PCR was performed with a primer set consisting of a specific sense primer and antisense T7 primer. Only the antisense strand of the double stranded PCR-product contained the T7-promoter sequence on its 5' end, allowing in vitro transcription and internal labeling with [alpha-32]UTP. Probe concentration was determined in a scintillation counter and equal counts were introduced in the assay. In vitro transcription of the PCR generated probes resulted in radioactive probes with a very high specific activity, allowing simultaneous analysis of 70 different RNA samples. RPA could be performed under the same conditions as recommended for the commercially available probe sets, avoiding time consuming optimization of reaction conditions. Negative controls consisted of yeast RNA and sense RNA probes. Positive controls were single stranded templates, generated by asymmetric PCR. Dilution series revealed a high reproducibility and the potential of this technique to semi-quantitate mRNA in different RNA samples. In conclusion, probes may be generated by RT-PCR and nested PCR that will work with the commercially available Multiprobe RPAs. The high probe yield allows analysis of a great number of samples using the same set of probes with a high reproducibility.

  6. Evaluation and selection of candidate reference genes for normalization of quantitative RT-PCR in Withania somnifera (L. Dunal.

    Directory of Open Access Journals (Sweden)

    Varinder Singh

    Full Text Available Quantitative real-time PCR (qRT-PCR is now globally used for accurate analysis of transcripts levels in plants. For reliable quantification of transcripts, identification of the best reference genes is a prerequisite in qRT-PCR analysis. Recently, Withania somnifera has attracted lot of attention due to its immense therapeutic potential. At present, biotechnological intervention for the improvement of this plant is being seriously pursued. In this background, it is important to have comprehensive studies on finding suitable reference genes for this high valued medicinal plant. In the present study, 11 candidate genes were evaluated for their expression stability under biotic (fungal disease, abiotic (wounding, salt, drought, heat and cold stresses, in different plant tissues and in response to various plant growth regulators (methyl jasmonate, salicylic acid, abscisic acid. The data as analyzed by various software packages (geNorm, NormFinder, Bestkeeper and ΔCt method suggested that cyclophilin (CYP is a most stable gene under wounding, heat, methyl jasmonate, different tissues and all stress conditions. T-SAND was found to be a best reference gene for salt and salicylic acid (SA treated samples, while 26S ribosomal RNA (26S, ubiquitin (UBQ and beta-tubulin (TUB were the most stably expressed genes under drought, biotic and cold treatment respectively. For abscisic acid (ABA treated samples 18S-rRNA was found to stably expressed gene. Finally, the relative expression level of the three genes involved in the withanolide biosynthetic pathway was detected to validate the selection of reliable reference genes. The present work will significantly contribute to gene analysis studies in W. somnifera and facilitate in improving the quality of gene expression data in this plant as well as and other related plant species.

  7. Selection of housekeeping genes as internal controls for quantitative RT-PCR analysis of the veined rapa whelk (Rapana venosa).

    Science.gov (United States)

    Song, Hao; Dang, Xin; He, Yuan-Qiu; Zhang, Tao; Wang, Hai-Yan

    2017-01-01

    The veined rapa whelk Rapana venosa is an important commercial shellfish in China and quantitative real-time PCR (qRT-PCR) has become the standard method to study gene expression in R. venosa . For accurate and reliable gene expression results, qRT-PCR assays require housekeeping genes as internal controls, which display highly uniform expression in different tissues or stages of development. However, to date no studies have validated housekeeping genes in R. venosa for use as internal controls for qRT-PCR. In this study, we selected the following 13 candidate genes for suitability as internal controls: elongation factor-1 α ( EF-1α ), α -actin ( ACT ), cytochrome c oxidase subunit 1 ( COX1 ), nicotinamide adenine dinucleotide dehydrogenase (ubiquinone) 1 α subcomplex subunit 7 ( NDUFA7 ), 60S ribosomal protein L5 ( RL5 ), 60S ribosomal protein L28 ( RL28 ), glyceraldehyde 3-phosphate dehydrogenase ( GAPDH ), β -tubulin ( TUBB ), 40S ribosomal protein S25 ( RS25 ), 40S ribosomal protein S8 ( RS8 ), ubiquitin-conjugating enzyme E2 ( UBE2 ), histone H3 ( HH3 ), and peptidyl-prolyl cis-trans isomerase A ( PPIA ). We measured the expression levels of these 13 candidate internal controls in eight different tissues and twelve larvae developmental stages by qRT-PCR. Further analysis of the expression stability of the tested genes was performed using GeNorm and RefFinder algorithms. Of the 13 candidate genes tested, we found that EF-1α was the most stable internal control gene in almost all adult tissue samples investigated with RL5 and RL28 as secondary choices. For the normalization of a single specific tissue, we suggested that EF-1α and NDUFA7 are the best combination in gonad, as well as COX1 and RL28 for intestine, EF-1α and RL5 for kidney, EF-1α and COX1 for gill, EF-1α and RL28 for Leiblein and mantle, EF-1α , RL5 , and NDUFA7 for liver , GAPDH , PPIA , and RL28 for hemocyte. From a developmental perspective, we found that RL28 was the most stable gene

  8. Selection of internal references for qRT-PCR assays of human hepatocellular carcinoma cell lines.

    Science.gov (United States)

    Liu, Yang; Qin, Zhaoyu; Cai, Lili; Zou, Lili; Zhao, Jing; Zhong, Fan

    2017-12-22

    Selecting internal references is important for normalizing the loading quantity of samples in quantitative reverse-transcription PCR (qRT-PCR). In the present study, a systematic evaluation of reference genes among nine hepatocellular carcinoma (HCC) cell lines was conducted. After screening the microarray assay data of ten HCC cell lines, 19 candidate reference genes were preselected and then evaluated by qRT-PCR, together with ACTB, GAPDH, HPRT1 and TUBB The expression evenness of these candidate genes was evaluated using RefFinder. The stabilities of the reference genes were further evaluated under different experimental perturbations in Huh-7 and MHCC-97L, and the applicability of the reference genes was assessed by measuring the mRNA expression of CCND1, CCND3, CDK4 and CDK6 under sorafenib treatment in Huh-7. Results showed that TFG and SFRS4 are among the most reliable reference genes, and ACTB ranks third and acts quite well as a classical choice, whereas GAPDH, HPRT1 and TUBB are not proper reference genes in qRT-PCR assays among the HCC cell lines. SFRS4, YWHAB, SFRS4 and CNPY3 are the most stable reference genes of the MHCC-97L under the perturbations of chemotherapy, oxidative stress, starvation and hypoxia respectively, whereas YWHAB is the most stable one of Huh-7 under all perturbations. GAPDH is recommended as a reference gene under chemotherapy perturbations. YWHAB and UBE2B, TMED2 and TSFM , and GAPDH and TSFM are the two best reference genes under oxidative stress, starvation and hypoxia perturbations respectively. TSFM is stable in both cell lines across all the perturbations. © 2017 The Author(s).

  9. A Host-Based RT-PCR Gene Expression Signature to Identify Acute Respiratory Viral Infection

    Science.gov (United States)

    Zaas, Aimee K.; Burke, Thomas; Chen, Minhua; McClain, Micah; Nicholson, Bradly; Veldman, Timothy; Tsalik, Ephraim L.; Fowler, Vance; Rivers, Emanuel P.; Otero, Ronny; Kingsmore, Stephen F.; Voora, Deepak; Lucas, Joseph; Hero, Alfred O.; Carin, Lawrence; Woods, Christopher W.; Ginsburg, Geoffrey S.

    2014-01-01

    Improved ways to diagnose acute respiratory viral infections could decrease inappropriate antibacterial use and serve as a vital triage mechanism in the event of a potential viral pandemic. Measurement of the host response to infection is an alternative to pathogen-based diagnostic testing and may improve diagnostic accuracy. We have developed a host-based assay with a reverse transcription polymerase chain reaction (RT-PCR) TaqMan low-density array (TLDA) platform for classifying respiratory viral infection. We developed the assay using two cohorts experimentally infected with influenza A H3N2/Wisconsin or influenza A H1N1/Brisbane, and validated the assay in a sample of adults presenting to the emergency department with fever (n = 102) and in healthy volunteers (n = 41). Peripheral blood RNA samples were obtained from individuals who underwent experimental viral challenge or who presented to the emergency department and had microbiologically proven viral respiratory infection or systemic bacterial infection. The selected gene set on the RT-PCR TLDA assay classified participants with experimentally induced influenza H3N2 and H1N1 infection with 100 and 87% accuracy, respectively. We validated this host gene expression signature in a cohort of 102 individuals arriving at the emergency department. The sensitivity of the RT-PCR test was 89% [95% confidence interval (CI), 72 to 98%], and the specificity was 94% (95% CI, 86 to 99%). These results show that RT-PCR–based detection of a host gene expression signature can classify individuals with respiratory viral infection and sets the stage for prospective evaluation of this diagnostic approach in a clinical setting. PMID:24048524

  10. Rapid RT-PCR amplification of full-length poliovirus genomes allows rapid discrimination between wild-type and recombinant vaccine-derived polioviruses.

    Science.gov (United States)

    Boot, Hein J; Schepp, Rutger M; van Nunen, Femke J H B; Kimman, Tjeerd G

    2004-03-01

    Poliomyelitis outbreaks in areas that were free for a long time of wild-type polioviruses have been reported. Characterization at nucleotide level of the causative agents showed that the isolated viruses were recombinant oral polio vaccine (OPV)-derived polioviruses. To allow rapid identification and detailed analysis of such recombinant polioviruses, a robust full-length reverse transcriptase-PCR (RT-PCR) was developed using SuperScript II (RT) and expand (PCR). Without extensive purification, it was possible to amplify and characterize the full-length genomes of all selected vaccine, wild-type, and recombinant vaccine-derived polioviruses within a week. Endonuclease nuclease analysis (SpeI) of the full-length amplicons allowed easy discrimination between recombinant and non-recombinant polioviruses. Furthermore, sequence analysis of cloned full-length amplicons of a recombinant vaccine-derived poliovirus strain showed that the quasi-species nature of a viral stock is preserved during the RT-PCR procedure. This robust and rapid RT-PCR method will allow rapid characterization of (recombinant) poliovirus strains in case of a local poliomyelitis outbreak, and will help to assess the risk of the appearance of such strains after wild-type poliovirus has been eradicated globally.

  11. Multiplex RT-PCR for detection and identification of three necroviruses that infect olive trees

    OpenAIRE

    Varanda, Carla; Cardoso, Joana M.S.; Félix, M. Rosário; Oliveira, Solange; Clara, M.Ivone

    2010-01-01

    An optimized multiplex RT-PCR assay was developed to discriminate three necrovirus (Olive latent virus 1 (OLV-1), Tobacco necrosis virus D (TNV-D) and Olive mild mosaic virus (OMMV)) that infect olive trees. An olive orchard consisting of 54 trees of cv. "Galega vulgar" in the south of Portugal was surveyed. dsRNA fraction was used as template and revealed the 3 viruses, singly or in multiple infections, present in 17 out of 54 trees in the orchard. OMMV was the most frequent occurring in 15 ...

  12. Rapid subtyping of tick-borne encephalitis virus isolates using multiplex RT-PCR

    Czech Academy of Sciences Publication Activity Database

    Růžek, Daniel; Šťastná, B.; Kopecký, Jan; Golovljova, I.; Grubhoffer, Libor

    2007-01-01

    Roč. 144, 1/2 (2007), s. 133-137 ISSN 0166-0934 R&D Projects: GA MŠk(CZ) LC06009; GA ČR(CZ) GA524/06/1479 Grant - others:Grantová agentura Jihočeské univerzity(CZ) 44/2006/P-BF; Estonian Science Foundation(EE) 5963; GAMŠk(CZ) FRVŠ 230/2007 Institutional research plan: CEZ:AV0Z60220518 Keywords : tick-borne encephalitis virus * subtyping * multiplex RT-PCR Subject RIV: EE - Microbiology, Virology Impact factor: 1.933, year: 2007

  13. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  14. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  15. Strategy for the maximization of clinically relevant information from hepatitis C virus, RT-PCR quantification.

    LENUS (Irish Health Repository)

    Levis, J

    2012-02-03

    BACKGROUND: The increasing clinical application of viral load assays for monitoring viral infections has been an incentive for the development of standardized tests for the hepatitis C virus. OBJECTIVE: To develop a simple model for the prediction of baseline viral load in individuals infected with the hepatitis C virus. METHODOLOGY: Viral load quantification of each patient\\'s first sample was assessed by RT-PCR-ELISA using the Roche MONITOR assay in triplicate. Genotype of the infecting virus was identified by reverse line probe hybridization, using amplicons resulting from the qualitative HCV Roche AMPLICOR assay. RESULTS: Retrospective evaluation of first quantitative values suggested that 82.4% (n=168\\/204) of individuals had a viral load between 4.3 and 6.7 log(10) viral copies per ml. A few patients (3.4%; n=7\\/204) have a serum viremia less than the lower limit of the linear range of the RT-PCR assay. Subsequent, prospective evaluation of hepatitis C viral load of all new patients using a model based on the dynamic range of viral load in the retrospective group correctly predicted the dynamic range in 75.9% (n=33\\/54). CONCLUSION: The dynamic range of hepatitis C viremia extends beyond the linear range of the Roche MONITOR assay. Accurate determination of serum viremia is substantially improved by dilution of specimens prior to quantification.

  16. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  17. Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

    Science.gov (United States)

    Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

    2009-10-01

    Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

  18. Análise de citocinas pela RT-PCR em pacientes com rinite alérgica RT-PCR cytokine study in patients with allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Tarcimara Moreira da Silva

    2009-02-01

    Full Text Available Rinite alérgica é uma doença que decorre de um processo inflamatório da mucosa nasal conseqüente à reação de hipersensibilidade a alérgenos inalatórios e, eventualmente, alimentares. É mediada por IgE, envolvendo diferentes células, mediadores e citocinas. OBJETIVO: Avaliar as transcrições para as seguintes citocinas: IL-4, IL-5, IL-8 e IFN-gama, particularmente importantes no processo alérgico nasal, principalmente IL-4 e IL-5. Neste estudo, optou-se por avaliar os pacientes atópicos fora das crises alérgicas, com a finalidade de se conhecer as expressões das citocinas neste período. MATERIAL E MÉTODO: Realizou-se um estudo transversal e prospectivo, selecionando-se 30 pacientes, sendo 13 pacientes portadores de rinite alérgica paucissintomáticos e 17 pacientes não-atópicos. Os grupos foram selecionados através da história, do exame clínico otorrinolaringológico e do teste alérgico cutâneo - Prick Test. O perfil das citocinas foi pesquisado nos fragmentos de mucosa nasal, através da RT-PCR semiquantitativa, escolhida por apresentar boa reprodutibilidade e especificidade, utilizando-se como referência o gene da Beta-actina. RESULTADOS: Os valores de IL-5, IL-8, IFN-gama mantiveram-se homogêneos em relação ao grupo controle. A IL-4 apresentou diferença com significância estatística. CONCLUSÃO: Os pacientes alérgicos paucissintomáticos apresentaram normalização da expressão das citocinas na mucosa nasal à exceção de IL-4.Allergic rhinitis is an inflammatory reaction of the nasal mucosa, in consequence of an IgE mediated hypersensitive reaction to inhaling allergens, involving different mediators and cytokine cells. AIM: The purpose of this study was to evaluate the transcriptions for IL-4, IL-5, IL-8 and IFN-gama, particularly important in the nasal allergy process, especially IL-4 and IL-5. For this study we decided to evaluate atopic patients who were free from allergic crises, with the purpose of

  19. Comparison of multiplex RT-PCR with virus isolation for detection, typing and sub-typing of influenza virus from influenza-like illness cases

    Directory of Open Access Journals (Sweden)

    S Dhakad

    2015-01-01

    Full Text Available Purpose: Influenza epidemics and periodic pandemics occur worldwide resulting in significant mortality, morbidity and economic loss. There is need for a sensitive, rapid and cost-effective assay to detect, type and sub-type influenza viruses, as cell culture has a long turnaround time. Materials and Methods: Nasopharyngeal swabs were collected from patients presenting with influenza-like illness (ILI at AIIMS OPD and Primary Health Centre Ballabhgarh (Haryana. From June 2007 to January 2009 and then from September to November 2009, of 1567 specimens collected, 544 were randomly selected and were tested by virus culture using Madin-Darby Canine Kidney (MDCK cells and by reverse transcription polymerase chain reaction (RT-PCR for influenza A using primers for matrix gene and for influenza B using non-structural gene (NS primers. All influenza A positives were sub-typed using primers for HA and NA genes of A/H1, A/H3. A separate multiplex RT-PCR having primers from matrix and HA genes of pandemic A (H1N1 pdm09 viruses was carried out on samples collected after September 2009. Results: Of the 544 samples, 136 (25% were positive for influenza by RT-PCR. Further typing analysis revealed 86 (63.2% were typed as influenza A and 47 (34.5% as influenza B viruses and 3 (2% samples showed dual infection with influenza A and B. Of the 86 influenza A positive samples 48 (55.8% were identified as seasonal influenza A/H1N1, 22 (25.6% as A (H1N1 pdm09 and 16 (18.6% as A/H3N2. Comparison of influenza positivity using virus culture revealed that only 97/136 (71.3% were influenza positive. Sensitivity of viral detection was lowest for seasonal A/H1 (26/48; 54%, followed by H3N2 (11/16; 68.7% and influenza B (38/47; 80.8%; all influenza A/H1N1pdm09 viruses were detected by both methods. Conclusion: RT-PCR is a sensitive, low cost and rapid screening test for diagnosing influenza infection during epidemics and pandemics. mRT-PCR increased the detection rates for

  20. Detection of circulating tumor cells with CK20 RT-PCR is an independent negative prognostic marker in colon cancer patients - a prospective study.

    Science.gov (United States)

    Hinz, Sebastian; Hendricks, Alexander; Wittig, Amke; Schafmayer, Clemens; Tepel, Jürgen; Kalthoff, Holger; Becker, Thomas; Röder, Christian

    2017-01-13

    Detection of circulating (CTC) or disseminated tumor cells (DTC) has been associated with negative prognosis and outcome in patients with colorectal cancer, though testing for these cells is not yet part of clinical routine. There are several different methodological approaches to detect tumor cells but standardized detection assays are not implemented so far. In this prospective monocentric study 299 patients with colon cancer were included. CTC and DTC were detected using CK20 RT-PCR as well as immunocytochemistry staining with anti-pan-keratin and anti-EpCAM antibodies. The primary endpoints were: Evaluation of CTC and DTC at the time of surgery and correlation with main tumor characteristics and overall (OS) and disease free survival (DFS). Patients with detectable CTC had a 5-year OS rate of 68% compared to a 5-year OS rate of 85% in patients without detectable CTC in the blood (p = 0.002). Detection of DTC in the bone marrow with CK20 RT-PCR was not associated with a worse OS or DFS. Detection of pan-cytokeratin positive DTC in the bone marrow correlated with a significantly reduced 5-year OS rate (p = 0.048), but detection of DTC in the bone marrow with the anti-EpCAM antibody did not significantly influence the 5-year OS rate (p = 0.958). By multivariate analyses only detection of CTC with CK20 RT-PCR in the blood was revealed to be an independent predictor of worse OS (HR1.94; 95% CI 1.0-3.7; p = 0.04) and DFS (HR 1.94; 95% CI 1.1-3.7; p = 0.044). Detection of CTC with CK20 RT-PCR is a highly specific and independent prognostic marker in colon cancer patients. Detection of DTC in the bone marrow with CK20 RT-PCR or immunohistochemistry with anti-EpCAM antibody is not associated with a negative prognostic influence.

  1. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  2. Real-time PCR Detection of Brucella Abortus: A Comparative Study of SYBR Green I, 5'-exonuclease, and Hybridization Probe Assays

    Energy Technology Data Exchange (ETDEWEB)

    Newby, Deborah Trishelle; Hadfield, Ted; Roberto, Francisco Figueroa

    2003-08-01

    Real-time PCR provides a means of detecting and quantifying DNA targets by monitoring PCR product accumulation during cycling as indicated by increased fluorescence. A number of different approaches can be used to generate the fluorescence signal. Three approaches—SYBR Green I (a double-stranded DNA intercalating dye), 5'-exonuclease (enzymatically released fluors), and hybridization probes (fluorescence resonance energy transfer)—were evaluated for use in a real-time PCR assay to detect Brucella abortus. The three assays utilized the same amplification primers to produce an identical amplicon. This amplicon spans a region of the B. abortus genome that includes portions of the alkB gene and the IS711 insertion element. All three assays were of comparable sensitivity, providing a linear assay over 7 orders of magnitude (from 7.5 ng down to 7.5 fg). However, the greatest specificity was achieved with the hybridization probe assay.

  3. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs.

  4. Optimization of the Sybr Green real time PCR for the detection of Human Herpes Virus type 6 (HHV-6 Otimização da PCR em tempo real - Sybr Green para detecção do Herpes Vírus Humano tipo 6 (HHV-6

    Directory of Open Access Journals (Sweden)

    Cynthia Liliane Motta do Canto

    2008-02-01

    Full Text Available HHV-6 is the etiological agent of Exanthem subitum which is considered the sixth most frequent disease in infancy. In immuno-compromised hosts, reactivation of latent HHV-6 infection may cause severe acute disease. We developed a Sybr Green Real Time PCR for HHV-6 and compared the results with nested conventional PCR. A 214 pb PCR derived fragment was cloned using pGEM-T easy from Promega system. Subsequently, serial dilutions were made in a pool of negative leucocytes from 10-6 ng/µL (equivalent to 2465.8 molecules/µL to 10-9 (equivalent to 2.46 molecules/µL. Dilutions of the plasmid were amplified by Sybr Green Real Time PCR, using primers HHV3 (5' TTG TGC GGG TCC GTT CCC ATC ATA 3'and HHV4 (5' TCG GGA TAG AAA AAC CTA ATC CCT 3' and by conventional nested PCR using primers HHV1 (outer: 5'CAA TGC TTT TCT AGC CGC CTC TTC 3'; HHV2 (outer: 5' ACA TCT ATA ATT TTA GAC GAT CCC 3'; HHV3 (inner and HHV4 (inner 3'. The detection threshold was determined by plasmid serial dilutions. Threshold for Sybr Green real time PCR was 24.6 molecules/µL and for the nested PCR was 2.46 molecules/µL. We chose the Real Time PCR for diagnosing and quantifying HHV-6 DNA from samples using the new Sybr Green chemistry due to its sensitivity and lower risk of contamination.HHV-6 é o agente etiológico do Exantema Súbito e considerado a sexta doença mais comum na infância. Em indivíduos imunocomprometidos, a reativação da infecção latente pode causar doença aguda ou morte. Padronizamos PCR em Tempo Real utilizando a química Sybr Green na detecção do HHV-6 e comparamos os resultados com a PCR convencional. Um fragmento de 214 pb foi clonado através do kit pGEM-T do sistema Promega. Com este clone, foram feitas diluições seriadas em um pool de leucócitos negativos a partir de 10-6 ng/µL (equivalente a 2465,8 moleculas/µL até 10-9 (equivalente a 2,46 moleculas/µL. As diluições foram amplificadas por PCR em Tempo Real utilizando Sybr Green, com

  5. A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

    Directory of Open Access Journals (Sweden)

    Jiyun Li

    2017-10-01

    Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

  6. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    genomic locus, but limits the detection of its correct genomic integration by standard PCR methods. Genomic Long Range PCR (LR-PCR), using primers adjacent to the homology arms, has been used as an alternative to radioactive-based Southern blot screenings. However, LR-PCRs are often difficult and render...... many false positive and false negative results. Here, we propose an alternative screening method based on the detection of a genetic modification at the mRNA level, which we successfully optimized in two mouse models. This screening method consists of a reverse-transcription PCR (RT-PCR) using primers...... that match exons flanking the targeting construct. The detection of the expected modification in this PCR product confirms the integration at the correct genomic location and shows that the mutant mRNA is expressed. This is a simple and sensitive strategy to screen locus-specific recombination of targeting...

  7. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  8. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  9. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  10. Rapid and Specific Detection of Acidovorax avenae subsp. citrulli Using SYBR Green-Based Real-Time PCR Amplification of the YD-Repeat Protein Gene.

    Science.gov (United States)

    Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk

    2015-09-01

    The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.

  11. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples originat......Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

  12. Reference gene selection for qRT-PCR analysis in the sweetpotato whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae).

    Science.gov (United States)

    Li, Rumei; Xie, Wen; Wang, Shaoli; Wu, Qingjun; Yang, Nina; Yang, Xin; Pan, Huipeng; Zhou, Xiaomao; Bai, Lianyang; Xu, Baoyun; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Accurate evaluation of gene expression requires normalization relative to the expression of reliable reference genes. Expression levels of "classical" reference genes can differ, however, across experimental conditions. Although quantitative real-time PCR (qRT-PCR) has been used extensively to decipher gene function in the sweetpotato whitefly Bemisia tabaci, a world-wide pest in many agricultural systems, the stability of its reference genes has rarely been validated. In this study, 15 candidate reference genes from B. tabaci were evaluated using two Excel-based algorithms geNorm and Normfinder under a diverse set of biotic and abiotic conditions. At least two reference genes were selected to normalize gene expressions in B. tabaci under experimental conditions. Specifically, for biotic conditions including host plant, acquisition of a plant virus, developmental stage, tissue (body region of the adult), and whitefly biotype, ribosomal protein L29 was the most stable reference gene. In contrast, the expression of elongation factor 1 alpha, peptidylprolyl isomerase A, NADH dehydrogenase, succinate dehydrogenase complex subunit A and heat shock protein 40 were consistently stable across various abiotic conditions including photoperiod, temperature, and insecticide susceptibility. Our finding is the first step toward establishing a standardized quantitative real-time PCR procedure following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments) guideline in an agriculturally important insect pest, and provides a solid foundation for future RNA interference based functional study in B. tabaci.

  13. Reference gene selection for qRT-PCR analysis in the sweetpotato whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae.

    Directory of Open Access Journals (Sweden)

    Rumei Li

    Full Text Available Accurate evaluation of gene expression requires normalization relative to the expression of reliable reference genes. Expression levels of "classical" reference genes can differ, however, across experimental conditions. Although quantitative real-time PCR (qRT-PCR has been used extensively to decipher gene function in the sweetpotato whitefly Bemisia tabaci, a world-wide pest in many agricultural systems, the stability of its reference genes has rarely been validated.In this study, 15 candidate reference genes from B. tabaci were evaluated using two Excel-based algorithms geNorm and Normfinder under a diverse set of biotic and abiotic conditions. At least two reference genes were selected to normalize gene expressions in B. tabaci under experimental conditions. Specifically, for biotic conditions including host plant, acquisition of a plant virus, developmental stage, tissue (body region of the adult, and whitefly biotype, ribosomal protein L29 was the most stable reference gene. In contrast, the expression of elongation factor 1 alpha, peptidylprolyl isomerase A, NADH dehydrogenase, succinate dehydrogenase complex subunit A and heat shock protein 40 were consistently stable across various abiotic conditions including photoperiod, temperature, and insecticide susceptibility.Our finding is the first step toward establishing a standardized quantitative real-time PCR procedure following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments guideline in an agriculturally important insect pest, and provides a solid foundation for future RNA interference based functional study in B. tabaci.

  14. Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

    Science.gov (United States)

    Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

    2017-06-01

    Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    International Nuclear Information System (INIS)

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang

    2005-01-01

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter

  16. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  17. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Directory of Open Access Journals (Sweden)

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  18. A family-wide RT-PCR assay for detection of paramyxoviruses and application to a large-scale surveillance study.

    Directory of Open Access Journals (Sweden)

    Sander van Boheemen

    Full Text Available Family-wide molecular diagnostic assays are valuable tools for initial identification of viruses during outbreaks and to limit costs of surveillance studies. Recent discoveries of paramyxoviruses have called for such assay that is able to detect all known and unknown paramyxoviruses in one round of PCR amplification. We have developed a RT-PCR assay consisting of a single degenerate primer set, able to detect all members of the Paramyxoviridae family including all virus genera within the subfamilies Paramyxovirinae and Pneumovirinae. Primers anneal to domain III of the polymerase gene, with the 3' end of the reverse primer annealing to the conserved motif GDNQ, which is proposed to be the active site for nucleotide polymerization. The assay was fully optimized and was shown to indeed detect all available paramyxoviruses tested. Clinical specimens from hospitalized patients that tested positive for known paramyxoviruses in conventional assays were also detected with the novel family-wide test. A high-throughput fluorescence-based RT-PCR version of the assay was developed for screening large numbers of specimens. A large number of samples collected from wild birds was tested, resulting in the detection of avian paramyxoviruses type 1 in both barnacle and white-fronted geese, and type 8 in barnacle geese. Avian metapneumovirus type C was found for the first time in Europe in mallards, greylag geese and common gulls. The single round family-wide RT-PCR assay described here is a useful tool for the detection of known and unknown paramyxoviruses, and screening of large sample collections from humans and animals.

  19. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  20. Using laser micro-dissection and qRT-PCR to analyze cell type-specific gene expression in Norway spruce phloem

    Directory of Open Access Journals (Sweden)

    Nina E. Nagy

    2014-04-01

    Full Text Available The tangentially oriented polyphenolic parenchyma (PP and radially organized ray parenchyma in the phloem are central in the defense of conifer stems against insects and pathogens. Laser micro-dissection enables examination of cell-specific defense responses. To examine induced defense responses in Norway spruce stems inoculated with the necrotrophic blue-stain fungus Ceratocystis polonica, RNA extracted from laser micro-dissected phloem parenchyma and vascular cambium was analyzed using real-time RT-PCR (qRT-PCR to profile transcript levels of selected resistance marker genes. The monitored transcripts included three pathogenesis-related proteins (class IV chitinase (CHI4, defensin (SPI1, peroxidase (PX3, two terpene synthesis related proteins (DXPS and LAS, one ethylene biosynthesis related protein (ACS, and a phenylalanine ammonia-lyase (PAL. Three days following inoculation, four genes (CHI4, PAL, PX3, SPI1 were differentially induced in individual cell and tissue types, both close to the inoculation site (5 mm above and, to a lesser degree, further away (10 mm above. These resistance marker genes were all highly induced in ray parenchyma, supporting the important role of the rays in spruce defense propagation. CHI4 and PAL were also induced in PP cells and in conducting secondary phloem tissues. Our data suggests that different cell types in the secondary phloem of Norway spruce have overlapping but not fully redundant roles in active host defense. Furthermore, the study demonstrates the usefulness of laser micro-dissection coupled with qRT-PCR to characterize gene expression in different cell types of conifer bark.

  1. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  2. RT-PCR analysis of dystrophin mRNA in DND/BMD patients

    Energy Technology Data Exchange (ETDEWEB)

    Ciafaloni, E.; Silva, H.A.R. de; Roses, A.D. [Duke Univ. Medical Center, Durham, NC (United States)

    1994-09-01

    Duchenne and Becker muscular dystrophies (DMD, BMD) are X-linked recessive disorders caused by mutations in the dystrophin (dys) gene. The majority of these mutations are intragenic deletions of duplications routinely detected by Southern biots and multiplex PCR. The remainder are very likely, smaller mutations, mostly point-mutations. Detection of these mutations is very difficult due to the size and complexity of the dys gene. We applied RT-PCR to analyse the entire dys mRNA of three DMD patients with no detectable genomic defect. In two unrelated patients, a duplication of the 62 bp exon 2 was identified. This causes a frameshift sufficient to explain the DMD phenotype. In the third patient, who had congenital DMD and severe mental retardation, a complex pattern of aberrant splicing at the 3-prime exons 67-79 was observed. Sural nerve biopsy in this patient showed the complete absence of Dp116. PCR-SSCP studies are presently in progress to identify the mutations responsible for the aberrant splicing patterns.

  3. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  4. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Directory of Open Access Journals (Sweden)

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  5. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  6. Detection of siRNA Mediated Target mRNA Cleavage Activities in Human Cells by a Novel Stem-Loop Array RT-PCR Analysis

    Science.gov (United States)

    2016-09-07

    of input synthetic RNU44 ducts were analyzed by agarose gel electrophoresis (B). (C) Dynamic range of the SL- by using SLA-RT-PCR assay and SL-RT-PCR...by agarose gel electrophoresis (upper panel) and relative band intensity was shown in lower panel. J. Lin et al. / Biochemistry and Biophysics...by polyacrylamide gel electrophoresis (PAGE). The purified RUN44 RNA was used as a RNA template to evaluate SLA-RT-PCR for detection and verification

  7. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus...... isolation. However, in a titration experiment under laboratory conditions, the sensitivity of RT-PCR was not significantly higher when compared with virus isolation....

  8. Qualitative Sybr Green real-time detection of single nucleotide polymorphisms responsible for target-site resistance in insect pests: the example of Myzus persicae and Musca domestica.

    Science.gov (United States)

    Puggioni, V; Chiesa, O; Panini, M; Mazzoni, E

    2017-02-01

    Chemical insecticides have been widely used to control insect pests, leading to the selection of resistant populations. To date, several single nucleotide polymorphisms (SNPs) have already been associated with insecticide resistance, causing reduced sensitivity to many classes of products. Monitoring and detection of target-site resistance is currently one of the most important factors for insect pest management strategies. Several methods are available for this purpose: automated and high-throughput techniques (i.e. TaqMan or pyrosequencing) are very costly; cheaper alternatives (i.e. RFLP or PASA-PCRs) are time-consuming and limited by the necessity of a final visualization step. This work presents a new approach (QSGG, Qualitative Sybr Green Genotyping) which combines the specificity of PASA-PCR with the rapidity of real-time PCR analysis. The specific real-time detection of Cq values of wild-type or mutant alleles (amplified used allele-specific primers) allows the calculation of ΔCqW-M values and the consequent identification of the genotypes of unknown samples, on the basis of ranges previously defined with reference clones. The methodology is applied here to characterize mutations described in Myzus persicae and Musca domestica and we demonstrate it represents a valid, rapid and cost-effective technique that can be adopted for monitoring target-site resistance in field populations of these and other insect species.

  9. Comparison of the Roche RealTime ready Influenza A/H1N1 Detection Set with CDC A/H1N1pdm09 RT-PCR on samples from three hospitals in Ho Chi Minh City, Vietnam.

    Science.gov (United States)

    Tham, Nguyen thi; Hang, Vu thi Ty; Khanh, Trong Huu; Viet, Do Chau; Hien, Tran Tinh; Farrar, Jeremy; Chau, Nguyen van Vinh; van Doorn, H Rogier

    2012-10-01

    Real-time polymerase chain reaction (PCR) can be considered the gold standard for detection of influenza viruses due to its high sensitivity and specificity. Roche has developed the RealTime ready Influenza A/H1N1 Detection Set, consisting of a generic influenza virus A PCR targeting the M2 gene (M2 PCR) and a specific PCR targeting the hemagglutinin (HA) of A/H1N1-pdm09 (HA PCR, 2009 H1N1), with the intention to make a reliable, rapid, and simple test to detect and quantify 2009 H1N1 in clinical samples. We evaluated this kit against the US Centers for Disease Control and Prevention (USCDC)/World Health Organization real-time PCR for influenza virus using 419 nose and throat swabs from 210 patients collected in 3 large hospitals in Ho Chi Minh City, Vietnam. In the per-patient analysis, when compared to CDC PCR, the sensitivity and specificity of the M2 PCR were 85.8% and 97.6%, respectively; the sensitivity and specificity of HA PCR were 88.2% and 100%, respectively. In the per-sample analysis, the sensitivity and specificity in nose swabs were higher than those in throat swabs for both M2 and HA PCRs. The viral loads as determined with the M2 and HA PCRs correlated well with the Ct values of the CDC PCR. Compared with the CDC PCR, the kit has a reasonable sensitivity and very good specificity for the detection and quantification of influenza A virus and A/H1N1-pdm09. However, given the current status of 2009 H1N1, a kit that can detect all circulating seasonal influenza viruses would be preferable. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

    OpenAIRE

    Adriana Cortez; Vanessa Souza; Telma Fernandes; Jane Megid

    2015-01-01

    The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR) was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS) were collected from 68 dogs and tested by direct immunofluorescence test (RFID) and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotei...

  11. Development and validation of a SYBR Green real-time PCR assay for rapid and quantitative detection of goose interferons and proinflammatory cytokines.

    Science.gov (United States)

    Zhou, Hao; Chen, Shun; Qi, Yulin; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun

    2015-10-01

    Real time quantitative polymerase chain reaction (RT-qPCR) based on SYBR-Green I binding is a quick, reliable, and easy method for analyzing small amounts of mRNA. Viral pathogens are recognized at the time of infection by pattern recognition receptors; thus, the inflammatory cytokines (IL1β, IL6, and IL18) and antiviral cytokines (IFNα, IFNγ) are secreted by innate immune cells and induced to respond to the pathogens. The objective of this study was to develop an effective and sensitive RT-qPCR assay for the rapid and accurate quantification of goose cytokines: IFNα, IFNγ, IL1β, IL6, and IL18. Subsequently, the established methods were employed to detect the immune response in agonist-stimulated goose spleen cells in vitro. These data indicated that the established RT-qPCR is a reliable method for determining relative gene expression. The results revealed that Imiquimod led to the significant upregulation of goose IFNα (P pathogens. © 2015 Poultry Science Association Inc.

  12. A SYBR®Green-based real-time PCR method for improved detection of mcr-1-mediated colistin resistance in human stool samples.

    Science.gov (United States)

    Donà, Valentina; Bernasconi, Odette J; Kasraian, Sara; Tinguely, Regula; Endimiani, Andrea

    2017-06-01

    The aim of this study was to design a rapid and sensitive real-time PCR (rt-PCR) method for colistin resistance mcr-1 gene detection in human faecal samples. Stools (n=88) from 36 volunteers were analysed. To isolate mcr-1-producing Enterobacteriaceae, samples were enriched overnight in Luria-Bertani (LB) broth containing 2mg/L colistin and were then plated on selective agar plates with 4mg/L colistin. A SYBR ® Green-based rt-PCR targeting mcr-1 was then designed. For method validation and to establish the limit of detection (LOD), total DNA was extracted from mcr-1-negative and mcr-1-positive Escherichia coli. rt-PCR was also performed with DNA extracted from 88 native stools and after enriching them in LB broth containing colistin. Based on the culture approach, three unique volunteers resulted colonised with mcr-1-harboring E. coli strains. For culture isolates, rt-PCR exhibited a LOD of 10 genomic copies/reaction, with both sensitivity and specificity of 100%. Nevertheless, when testing native stools, only two of the three mcr-1-positive specimens were detected. However, after enrichment in LB broth containing colistin, the rt-PCR was strongly positive for all culture-positive samples. The average cycle threshold was 22, granting rapid and confident detection of positive specimens within 30 cycles. No false positives were observed for the remaining 85 culture-negative specimens. A rapid rt-PCR for detection of mcr-1 from stool specimens was developed. The detection rate was increased by testing selective broth enrichments. This approach also has the advantage of concomitant isolation of mcr-1-harboring strains for further antimicrobial susceptibility and genetic testing. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  13. Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2015-12-01

    Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.

  14. Proteomic Analysis and qRT-PCR Verification of Temperature Response to Arthrospira (Spirulina) platensis

    Science.gov (United States)

    Huili, Wang; Xiaokai, Zhao; Meili, Lin; Dahlgren, Randy A.; Wei, Chen; Jaiopeng, Zhou; Chengyang, Xu; Chunlei, Jin; Yi, Xu; Xuedong, Wang; Li, Ding; Qiyu, Bao

    2013-01-01

    Arthrospira (Spirulina) platensis (ASP) is a representative filamentous, non-N2-fixing cyanobacterium that has great potential to enhance the food supply and possesses several valuable physiological features. ASP tolerates high and low temperatures along with highly alkaline and salty environments, and can strongly resist oxidation and irradiation. Based on genomic sequencing of ASP, we compared the protein expression profiles of this organism under different temperature conditions (15°C, 35°Cand 45°C) using 2-DE and peptide mass fingerprinting techniques. A total of 122 proteins having a significant differential expression response to temperature were retrieved. Of the positively expressed proteins, the homologies of 116 ASP proteins were found in Arthrospira (81 proteins in Arthrospira platensis str. Paraca and 35 in Arthrospira maxima CS-328). The other 6 proteins have high homology with other microorganisms. We classified the 122 differentially expressed positive proteins into 14 functions using the COG database, and characterized their respective KEGG metabolism pathways. The results demonstrated that these differentially expressed proteins are mainly involved in post-translational modification (protein turnover, chaperones), energy metabolism (photosynthesis, respiratory electron transport), translation (ribosomal structure and biogenesis) and carbohydrate transport and metabolism. Others proteins were related to amino acid transport and metabolism, cell envelope biogenesis, coenzyme metabolism and signal transduction mechanisms. Results implied that these proteins can perform predictable roles in rendering ASP resistance against low and high temperatures. Subsequently, we determined the transcription level of 38 genes in vivo in response to temperature and identified them by qRT-PCR. We found that the 26 differentially expressed proteins, representing 68.4% of the total target genes, maintained consistency between transcription and translation levels. The

  15. A combined RT-PCR and dot-blot hybridization method reveals the coexistence of SJNNV and RGNNV betanodavirus genotypes in wild meagre (Argyrosomus regius).

    Science.gov (United States)

    Lopez-Jimena, B; Cherif, N; Garcia-Rosado, E; Infante, C; Cano, I; Castro, D; Hammami, S; Borrego, J J; Alonso, M C

    2010-10-01

    To detect the possible coexistence of striped jack nervous necrosis virus (SJNNV) and red-spotted grouper nervous necrosis virus (RGNNV) genotypes in a single fish, a methodology based on the combination of PCR amplification and blot hybridization has been developed and applied in this study. The degenerate primers designed for the PCR procedure target the T4 region within the capsid gene, resulting in the amplification of both genotypes. The subsequent hybridization of these amplification products with two different specific digoxigenin-labelled probes resulted in the identification of both genotypes separately. The application of the RT-PCR protocol to analyse blood samples from asymptomatic wild meagre (Argyrosomus regius) specimens has shown a 46.87% of viral nervous necrosis virus carriers. The combination of RT-PCR and blot hybridization increases the detection rate up to 90.62%, and, in addition, it has shown the coexistence of both genotypes in 18 out of the 32 specimens analysed (56.25%). This study reports the coexistence of betanodaviruses belonging to two different genotypes (SJNNV and RGNNV) in wild fish specimens. This is the first report demonstrating the presence of SJNNV and RGNNV genotypes in the same specimen. This study also demonstrates a carrier state in this fish species for the first time. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  16. Comparison of protocols for the analysis of type 1 porcine reproductive and respiratory syndrome virus by RT-PCR using oral fluids.

    Science.gov (United States)

    Gibert, Elisa; Martín-Valls, Gerard; Mateu, Enric

    2017-05-01

    The detection of porcine reproductive and respiratory syndrome virus (PRRSV) in oral fluids (OF) by quantitative real-time polymerase chain reaction (qRT-PCR) is gaining increasing popularity. However, the different steps leading to a result have not been extensively evaluated. The aim of the present study was to examine the effect on the performance of qRT-PCR with different sampling materials, conditions of storage of the OF, the need for centrifuging OF, as well as to compare RNA extraction methods and PCR mixes. For the assays, pen-based oral fluids were used, which were pooled and spiked in a serial dilution (up to genotype 10 0 TCID 50 /mL) of type 1 PRRSV isolate 3267. Centrifugation at 15,000g for 15min resulted in an increase in sensitivity (1-2 PCR cycles) that was significant (PPCR Kit PCR mix reagents were more sensitive for the detection of PRRSV using a purified plasmid as standard, but LSI VetMAX PRRSV EU/NA PRRSV reagents resulted in a slightly better sensitivity with OF (pPCR. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Simultaneous detection and quantitation of Chikungunya, dengue and West Nile viruses by multiplex RT-PCR assays and dengue virus typing using high resolution melting.

    Science.gov (United States)

    Naze, F; Le Roux, K; Schuffenecker, I; Zeller, H; Staikowsky, F; Grivard, P; Michault, A; Laurent, P

    2009-12-01

    Chikungunya (CHIKV), Dengue (DENV) and West Nile (WNV) viruses are arthropod-borne viruses that are able to emerge or re-emerge in many regions due to climatic changes and increase in travel. Since these viruses produce similar clinical signs it is important for physicians and epidemiologists to differentiate them rapidly. A molecular method was developed for their detection and quantitation in plasma samples and a DENV typing technique were developed. The method consisted in performing two multiplex real-time one-step RT-PCR assays, to detect and quantify the three viruses. Both assays were conducted in a single run, from a single RNA extract containing a unique coextracted and coamplified composite internal control. The quantitation results were close to the best detection thresholds obtained with simplex RT-PCR techniques. The differentiation of DENV types was performed using a High Resolution Melting technique. The assays enable the early diagnosis of the three arboviruses during viremia, including cases of coinfection. The method is rapid, specific and highly sensitive with a potential for clinical diagnosis and epidemiological surveillance. A DENV positive sample can be typed conveniently using the High Resolution Melting technique using the same apparatus.

  18. Development of a SYBR Green real-time PCR assay with melting curve analysis for simultaneous detection and differentiation of canine adenovirus type 1 and type 2.

    Science.gov (United States)

    Balboni, Andrea; Dondi, Francesco; Prosperi, Santino; Battilani, Mara

    2015-09-15

    Canine adenovirus type 1 (CAdV-1) and canine adenovirus type 2 (CAdV-2) cause infectious canine hepatitis (ICH) and infectious tracheobronchitis (ITB) in dogs, respectively. Cases of ICH have been documented in recent years and recent surveys have demonstrated a wide percentage of asymptomatic CAdV-1 infection in the canine population. Since both CAdV types are detectable in the same biological matrices, and viral coinfection with CAdV-1 and CAdV-2 are reported with high frequency, it is urgent to have available a rapid, highly sensitive and specific assay for the diagnosis of CAdV infection and distinction between CAdV-1 and CAdV-2. In order to detect canine adenovirus in biological samples and to rapidly distinguish the two viral types, a SYBR Green real-time PCR assay was optimized to discriminate CAdV-1 and CAdV-2 via a melting curve analysis. The developed assay showed high sensitivity and reproducibility and was highly efficient and specific in discriminating the two CAdV types. This reliable and rapid technique may represent a simple, useful and economic option for simultaneous CAdV types detection, which would be feasible and attractive for all diagnostic laboratories, both for clinical purposes and for epidemiological investigations. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. An improved validated SYBR green-based real-time quantitative PCR assay for the detection of the Penaeus stylirostris densovirus in penaeid shrimp.

    Science.gov (United States)

    Encinas-García, Trinidad; Mendoza-Cano, Fernando; Enríquez-Espinoza, Tania; Luken-Vega, Leonardo; Vichido-Chávez, Rodrigo; Sánchez-Paz, Arturo

    2015-02-01

    The Penaeus stylirostris densovirus (PstDV) (also known as infectious hypodermal and hematopoietic necrosis virus, IHHNV), one of the major shrimp pathogens, has a worldwide distribution in farmed and wild shrimp populations. Outbreaks of IHHNV have been associated with substantial economic losses which are accompanied by a negative social impact. Current diagnostic PCR tests may result in false-positive results as several parts of PstDV genome may be endogenized in the nuclear genome of the shrimp P. stylirostris. A one-step qPCR SYBR-Green based quantitative real-time polymerase chain reaction (qPCR) assay to detect different isolates of the IHHNV in shrimp samples was developed. The detection limit of the assay was 81 viral copies of targeted DNA per reaction. The specificity of the assay was evaluated by melting curve analysis, which showed that the IHHNV product generated a single melt peak at 81.4±0.044°C. The assay was more sensitive than conventional PCR. The standardized PCR was shown to be highly sensible, specific, robust, and reproducible, which makes it an economical and powerful tool for both diagnostic applications and general research of IHHNV. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  1. Comparing influenza positivity rates by Real-Time RT-PCR, Elisa ...

    African Journals Online (AJOL)

    Detection of circulating influenza strains is a key public health concern especially in limited-resource settings where diagnosis capabilities remain a challenge. As part of multi-site surveillance in Côte d'Ivoire during the 2009 influenza A(H1N1) pandemic, we had the opportunity to test respiratory specimens collected from ...

  2. Evaluation and validation of reference genes for qRT-PCR normalization in Frankliniella occidentalis (Thysanoptera: Thripidae.

    Directory of Open Access Journals (Sweden)

    Yu-Tao Zheng

    Full Text Available Quantitative real time PCR (qRT-PCR has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects.

  3. Evaluation and validation of reference genes for qRT-PCR normalization in Frankliniella occidentalis (Thysanoptera: Thripidae).

    Science.gov (United States)

    Zheng, Yu-Tao; Li, Hong-Bo; Lu, Ming-Xing; Du, Yu-Zhou

    2014-01-01

    Quantitative real time PCR (qRT-PCR) has emerged as a reliable and reproducible technique for studying gene expression analysis. For accurate results, the normalization of data with reference genes is particularly essential. Once the transcriptome sequencing of Frankliniella occidentalis was completed, numerous unigenes were identified and annotated. Unfortunately, there are no studies on the stability of reference genes used in F. occidentalis. In this work, seven candidate reference genes, including actin, 18S rRNA, H3, tubulin, GAPDH, EF-1 and RPL32, were evaluated for their suitability as normalization genes under different experimental conditions using the statistical software programs BestKeeper, geNorm, Normfinder and the comparative ΔCt method. Because the rankings of the reference genes provided by each of the four programs were different, we chose a user-friendly web-based comprehensive tool RefFinder to get the final ranking. The result demonstrated that EF-1 and RPL32 displayed the most stable expression in different developmental stages; RPL32 and GAPDH showed the most stable expression at high temperatures, while 18S and EF-1 exhibited the most stable expression at low temperatures. In this study, we validated the suitable reference genes in F. occidentalis for gene expression profiling under different experimental conditions. The choice of internal standard is very important in the normalization of the target gene expression levels, thus validating and selecting the best genes will help improve the quality of gene expression data of F. occidentalis. What is more, these validated reference genes could serve as the basis for the selection of candidate reference genes in other insects.

  4. Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter

    Directory of Open Access Journals (Sweden)

    Davi de Oliveira Almeida

    2015-03-01

    Full Text Available ABSTRACT. Almeida D.O., Tortely R., Nascimento E.R., Khan M., Pereira V.L.A & Babapoor S. [Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter.] Uso das técnicas de RT-PCR e elisa no diagnóstico da bronquite infecciosa em frangos de corte ao abate. Revista Brasileira de Medicina Veterinária, 37(1:55-59, 2015. Departamento de Saúde Coletiva Veterinária e Saúde Pública, Universidade Federal Fluminense, Rua Vital Brazil Filho, 64, Santa Rosa, Niterói, RJ 24230-340, Brasil. E-mail: elmiro@vm.uff.br Avian infectious bronchitis (IB is a viral, acute and highly contagious disease caused by infectious bronchitis virus (IBV. The disease affects broilers improvement and performance causing major economic losses in the world poultry industry. Generally, IBV infections can be diagnosed by detection of IBV itself or the specific antibody response. This study aimed to detect IBV in broilers under Sanitary Inspection by RT-PCR and ELISA, comparing the results and relating them with the average weight of the flock. Samples were collected from 40 vaccinated broiler flocks under Sanitary Inspection at slaughter. Ten birds from every flock were randomly selected and blood samples were collected for ELISA as well three birds had their trachea and caecal tonsils collected for RT- -PCR test. From 40 flocks, 30 were IBV positive by ELISA and 26 by RT-PCR, in which 15 were detected simultaneously in trachea and caecal tonsil and 5 in each sample. There was no agreement between ELISA and RT-PCR results regarding IBV diagnosis as well positivity in both tests was not statistically significant with the average weight of the flock. There was an improvement on IBV diagnosis when caecal tonsils and tracheas were used instead of just one of them. Considering the only vaccine serotype allowed by Brazilian government is the Mass serotype and its persistence in broilers would only be detected up to 28 days

  5. Amplifikasi Gen Penyandi Protein Fusion Virus Tetelo dari Spesimen Lapangan dengan Metode OneStep RT-PCR. (AMPIFICATION OF FUSION PROTEIN ENCODING GENE OF NEWCASTLE DISEASE VIRUS FROM FIELD SPECIMENS BY ONESTEP RT-PCR METHOD

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2013-11-01

    Full Text Available Tetelo or Newcastle Disease (ND  virus is belong to the family Paramyxoviridae, which has a singlestranded RNA (ss RNA genome and it has viral envelope.  The viral envelope consists of two majorproteins, namely Haemagglutinin/Neuraminidase (H/N and Fusion (F protein. Molecular diagnosticmethods OneStep RT-PCR is a commonly diagnostic tool that used to diagnose of Tetelo in poultry. In thisstudy the diagnosis of Tetelo is accomplished by amplification of F protein encoding gene of Tetelo virusdirectly from field specimens without inoculation and propagation of Tetelo virus into embryonated chickeneggs. The objective of this study is to conduct rapid diagnosis of Tetelo virus directly from the field specimensbased on the amplification of the F gene by a OneStep RT-PCR method, so that the results of this study canbe used to assist in the identification of Tetelo virus directly from the field specimens. The results showedthat from the 15 samples of virus which isolated from tracheal swabs of clinical poultry showing symptomsof Tetelo virus infection, a total of 12 samples from 15 tested sampels (80% are positive tested for Tetelovirus infection. They were indicated by the amplification product of DNA fragments in size of 362 bp.OneStep RT-PCR is a method for rapid and effective diagnosis which can be used  to diagnose of Tetelovirus directly from field specimens.

  6. VARIATION OF THE EXPRESSION OF ENDOGENOUS "HOUSEKEEPING" GENES IN B[A]P TREATED MOUSE LUNGS MEASURED BY qRT-PCR

    Science.gov (United States)

    Quantitative RT-PCR is frequently used to analyze gene expression in different experimental systems. In this assay, housekeeping genes are frequently used to normalize for the variability between samples (relative quantification). We have examined the utility of using qRT-PCR and...

  7. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    , represented by non-neoplastic lymph nodes and diffuse large B-cell lymphomas, by using 2 statistical software applications, geNorm and NormFinder. In addition, we wanted to validate the usefulness of paraffin-embedded samples for Q-RT-PCR studies by investigating gene expressions of relevant target genes...... in paired frozen and paraffin-embedded samples. Moreover, we studied the impact of amplicon sizes on the efficiency of Q-RT-PCR in paraffin-embedded tissues. Six putative reference genes were tested for stability of expression in 21 pairs of snap-frozen and formalin-fixed, paraffin-embedded lymph nodes...... and lymphomas. The genes were ranked according to their suitability as reference genes. According to both statistical approaches, beta-glucoronidase was the single most appropriate reference gene in both snap-frozen and paraffin-embedded samples. TATA box-binding protein gene and Abelson murine leukemia viral...

  8. Optimization of rapid Salmonella enterica detection in liquid whole eggs by SYBR green I-based real-time reverse transcriptase-polymerase chain reaction.

    Science.gov (United States)

    Techathuvanan, Chayapa; D'Souza, Doris Helen

    2011-04-01

    Eggs and egg products have a high risk of Salmonella enterica serovar Enteritidis contamination leading to gastroenteritis outbreaks in humans. Thus, a rapid screening tool for viable Salmonella Enteritidis cells in the egg industry is needed. Our objective was to rapidly and sensitively detect viable Salmonella Enteritidis from spiked liquid whole eggs (LWEs) within 24 h using SYBR green I-based real-time reverse transcriptase-polymerase chain reaction (PCR) targeting the Salmonella specific invA gene along with an internal amplification control in a Bio-Rad iCycler. LWE was inoculated with Salmonella Enteritidis and mixed with tetrathionate broth, and 100 μL of serially diluted portions in phosphate-buffered saline was plated on Xylose Lysine Tergitol 4 agar or 5 mL were used for RNA extraction by the TRIzol method immediately or after enrichment of 6, 12, or 16 h at 37 °C. The real-time reverse transcriptase-PCR assay was carried out using previously described Salmonella invA gene primers. Melt temperature analysis of the PCR product was included to determine specific invA amplification. Without enrichment, the assay detection limit was 10(7) colony forming units (CFU)/25 mL LWE. After enrichment for 6 and 12 h, Salmonella Enteritidis could be detected from LWE up to 10(4) and 10(2) CFU/25 mL, respectively. Improved Salmonella Enteritidis detection up to 10(0) CFU/25 mL was obtained after 16-h enrichment. Even with 16-h enrichment, the results could be still be obtained within 24 h, which is much faster than by traditional cultural detection that takes several days. Therefore, this assay appears suitable for routine detection of Salmonella enterica contamination by the egg industry to help prevent the transmission of egg-associated Salmonella outbreaks and timely recall of contaminated products. © Mary Ann Liebert, Inc.

  9. An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

  10. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  11. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting chrysanthemum.

    Science.gov (United States)

    Zhao, Xiting; Liu, Xingliang; Ge, Beibei; Li, Mingjun; Hong, Bo

    2015-05-01

    Pathogens causing significant economic losses in chrysanthemum include tomato aspermy virus (TAV), chrysanthemum virus B (CVB), cucumber mosaic virus (CMV), tobacco mosaic virus (TMV), potato virus Y (PVY), chrysanthemum stunt viroid (CSVd) and chrysanthemum chlorotic mottle viroid (CChMVd). A multiplex reverse transcription polymerase chain reaction (RT-PCR) method, using specific primer sets for each virus or viroid, was developed for simultaneous detection and differentiation of TAV, CVB, CMV, TMV, PVY, CChMVd, and CSVd. The RT-PCR method was validated by testing chrysanthemum samples collected from different regions of China. In this study, CVB, TAV, TMV, PVY, CSVd, CMV, and CChMVd were detected, respectively, in 24.7 %, 17.5 %, 4.4 %, 4.4 %, 2.9 %, 2.5 %, and 1.5 % of the samples tested. These results indicate that CVB and TAV (24.7 % and 17.5 %) are common, whereas CMV, TMV, CChMVd, CSVd, and PVY (all below 5 %) are less frequently encountered. This new multiplex RT-PCR method has potential to be used routinely in large-scale virus and viroid surveys.

  12. Evidence-based RT-PCR methods for the detection of the 8 most common MLL aberrations in acute leukemias.

    Science.gov (United States)

    Burmeister, Thomas; Meyer, Claus; Gröger, Daniela; Hofmann, Julia; Marschalek, Rolf

    2015-02-01

    MLL aberrations are detected in around 5-10% of acute myeloid and lymphatic leukemias and an additional 5% of acute myeloid leukemias show a partial internal MLL duplication (PTD). MLL rearrangements are important for therapy stratification, assessment of minimal residual disease and for targeted therapies. However, no truly evidence-based RT-PCR methods for the detection of most of these aberrations have been published yet. Based on the large data collection of MLL genomic breakpoints in acute leukemias comprising more than 1.600 cases at the Diagnostic Center for Acute Leukemias (DCAL) in Frankfurt, Germany that provide an overview over the experimentally observed fusion transcript variants, we developed RT-PCR methods for the reliable detection of the 8 most common MLL aberrations (MLL-AF4, MLL-AF6, MLL-AF9, MLL-AF10, MLL-ENL, MLL-ELL, MLL-EPS15, MLL PTD), together accounting for around 90% of MLL-r cases. The easily implementable RT-PCRs should enable a reliable detection of these MLL fusion transcripts by RT-PCR. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Simultaneous detection and differentiation of four closely related sweet potato potyviruses by a multiplex one-step RT-PCR.

    Science.gov (United States)

    Li, Fan; Zuo, Ruijuan; Abad, Jorge; Xu, Donglin; Bao, Gaili; Li, Ruhui

    2012-12-01

    Four closely related potyviruses, Sweet potato feathery mottle virus (SPFMV), Sweet potato virus C (SPVC), Sweet potato virus G (SPVG) and/or Sweet potato virus 2 (SPV2), are involved in sweet potato virus disease complexes worldwide. Identification and detection of these viruses are complicated by high similarity among their genomic sequences, frequent occurrence as mixed infections and low titer in many sweet potato cultivars. A one-tube multiplex reverse transcription-PCR (mRT-PCR) assay was developed for simultaneous detection and differentiation of SPFMV, SPVC, SPVG and SPV2. Four specific forward primers unique to each virus and one reverse primer based on the region conserved in all four viruses were selected and used in the assay. The mRT-PCR assay was optimized for primer concentration and cycling conditions. It was tested using sweet potato plants infected naturally with one to four target viruses and then evaluated using field samples collected from southwestern China. The mRT-PCR assay is reliable and sensitive as a simple, rapid and cost-effective method to detect these pathogens in sweet potato. This assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Published by Elsevier B.V.

  14. Detection of Salmonella in Shellfish Using SYBR Green™ I-Based Real-Time Multiplexed PCR Assay Targeting invA and spvB

    KAUST Repository

    Gangwar, Maulshree

    2012-09-23

    A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.

  15. APLIKASI KUANTIFIKASI KOI HERPESVIRUS : REAL TIME – QUANTITATIVE POLYMERASE CHAIN REACTION (RT-Q PCR MENGGUNAKAN SYBR GREEN PADA IKAN MAS (Cyprinus carpio

    Directory of Open Access Journals (Sweden)

    Isti Koesharyani

    2017-08-01

    Full Text Available Koi Herpes Virus (KHV di Indonesia sejak tahun 2002 merupakan penyakit mematikan yang menyerang ikan koi Cyprinus carpio koi dan ikan mas Cyprinus carpio carpio, dan sampai saat ini, infeksi KHV dilaporkan sudah menyebar hampir di seluruh dunia. Untuk mengetahui adanya infeksi KHV perlu cara diagnosa yang sangat akurat/sensitif, sehingga keberadaan KHV dapat diketahui secara pasti dengan tingkat sensitivitas yang lebih baik pada ikan budidaya. Tujuan dari penelitian ini adalah untuk mengaplikasikan teknik deteksi dengan real time quantitative polymerase chain reaction (RT- qPCR/qPCR guna mengetahui adanya infeksi KHV secara kuantitatif pada ikan mas dengan mengetahui kandungan virus (viral load. Sebanyak masing-masing 3 ekor sampel diperoleh dari sentra budidaya ikan mas di Cirata-Jawa Barat, Maninjau-Sumatera Barat, dan Banjarmasin-Kalimantan Selatan. Sampel-sampel tersebut selanjutnya dianalisa keberadaan KHV-nya dengan RT-qPCR menggunakan SYBR Green. Hasil pengujian menunjukkan bahwa jumlah tertinggi (viral load diperoleh dari ikan mas asal Cirata-3 dengan nilai Threshold Cycle (Ct. 18,24 atau setara dengan 3,4 x 107 kopi, dan terendah dari ikan mas asal Banjarmasin-3 dengan nilai Ct. 33,39 atau 1,8 x 102 kopi. Dua standar yang digunakan dalam pengujian ini berupa plasmid dengan jumlah kopi 2 x 104 (Ct 27,24 dan 2 x 103 (Ct 30,24 dan kontrol atau Non Template Control (NTC adalah 3,1 x 10 atau dengan nilai Ct 35,65. Uji aplikasi deteksi KHV dengan metode RT-qPCR ini memberikan hasil yang lebih sensitif, di mana sampel yang tidak terdeteksi dengan metode PCR konvensional dapat dideteksi dan dihitung jumlah kopi DNA (DNA copy. Since 2002, Koi herpesvirus (KHV in Indonesian has been a malignant diseases, now recognized as a worldwide cause of mortality among populations of koi Cyprinus carpio koi and common carp Cyprinus carpio carpio. To determine the presence of infection is required the KHV diagnosis method with highly accurate and sensitive

  16. SYBR Green real-time PCR-RFLP assay targeting the plasmodium cytochrome B gene--a highly sensitive molecular tool for malaria parasite detection and species determination.

    Directory of Open Access Journals (Sweden)

    Weiping Xu

    Full Text Available A prerequisite for reliable detection of low-density Plasmodium infections in malaria pre-elimination settings is the availability of ultra-sensitive and high-throughput molecular tools. We developed a SYBR Green real-time PCR restriction fragment length polymorphism assay (cytb-qPCR targeting the cytochrome b gene of the four major human Plasmodium species (P. falciparum, P. vivax, P. malariae, and P. ovale for parasite detection and species determination with DNA extracted from dried blood spots collected on filter paper. The performance of cytb-qPCR was first compared against four reference PCR methods using serially diluted Plasmodium samples. The detection limit of the cytb-qPCR was 1 parasite/μl (p/μl for P. falciparum and P. ovale, and 2 p/μl for P. vivax and P. malariae, while the reference PCRs had detection limits of 0.5-10 p/μl. The ability of the PCR methods to detect low-density Plasmodium infections was then assessed using 2977 filter paper samples collected during a cross-sectional survey in Zanzibar, a malaria pre-elimination setting in sub-Saharan Africa. Field samples were defined as 'final positive' if positive in at least two of the five PCR methods. Cytb-qPCR preformed equal to or better than the reference PCRs with a sensitivity of 100% (65/65; 95%CI 94.5-100% and a specificity of 99.9% (2910/2912; 95%CI 99.7-100% when compared against 'final positive' samples. The results indicate that the cytb-qPCR may represent an opportunity for improved molecular surveillance of low-density Plasmodium infections in malaria pre-elimination settings.

  17. SYBR Green real-time PCR-RFLP assay targeting the plasmodium cytochrome B gene--a highly sensitive molecular tool for malaria parasite detection and species determination.

    Science.gov (United States)

    Xu, Weiping; Morris, Ulrika; Aydin-Schmidt, Berit; Msellem, Mwinyi I; Shakely, Delér; Petzold, Max; Björkman, Anders; Mårtensson, Andreas

    2015-01-01

    A prerequisite for reliable detection of low-density Plasmodium infections in malaria pre-elimination settings is the availability of ultra-sensitive and high-throughput molecular tools. We developed a SYBR Green real-time PCR restriction fragment length polymorphism assay (cytb-qPCR) targeting the cytochrome b gene of the four major human Plasmodium species (P. falciparum, P. vivax, P. malariae, and P. ovale) for parasite detection and species determination with DNA extracted from dried blood spots collected on filter paper. The performance of cytb-qPCR was first compared against four reference PCR methods using serially diluted Plasmodium samples. The detection limit of the cytb-qPCR was 1 parasite/μl (p/μl) for P. falciparum and P. ovale, and 2 p/μl for P. vivax and P. malariae, while the reference PCRs had detection limits of 0.5-10 p/μl. The ability of the PCR methods to detect low-density Plasmodium infections was then assessed using 2977 filter paper samples collected during a cross-sectional survey in Zanzibar, a malaria pre-elimination setting in sub-Saharan Africa. Field samples were defined as 'final positive' if positive in at least two of the five PCR methods. Cytb-qPCR preformed equal to or better than the reference PCRs with a sensitivity of 100% (65/65; 95%CI 94.5-100%) and a specificity of 99.9% (2910/2912; 95%CI 99.7-100%) when compared against 'final positive' samples. The results indicate that the cytb-qPCR may represent an opportunity for improved molecular surveillance of low-density Plasmodium infections in malaria pre-elimination settings.

  18. SYBR Green Real-Time PCR-RFLP Assay Targeting the Plasmodium Cytochrome B Gene – A Highly Sensitive Molecular Tool for Malaria Parasite Detection and Species Determination

    Science.gov (United States)

    Xu, Weiping; Morris, Ulrika; Aydin-Schmidt, Berit; Msellem, Mwinyi I.; Shakely, Delér; Petzold, Max; Björkman, Anders; Mårtensson, Andreas

    2015-01-01

    A prerequisite for reliable detection of low-density Plasmodium infections in malaria pre-elimination settings is the availability of ultra-sensitive and high-throughput molecular tools. We developed a SYBR Green real-time PCR restriction fragment length polymorphism assay (cytb-qPCR) targeting the cytochrome b gene of the four major human Plasmodium species (P. falciparum, P. vivax, P. malariae, and P. ovale) for parasite detection and species determination with DNA extracted from dried blood spots collected on filter paper. The performance of cytb-qPCR was first compared against four reference PCR methods using serially diluted Plasmodium samples. The detection limit of the cytb-qPCR was 1 parasite/μl (p/μl) for P. falciparum and P. ovale, and 2 p/μl for P. vivax and P. malariae, while the reference PCRs had detection limits of 0.5–10 p/μl. The ability of the PCR methods to detect low-density Plasmodium infections was then assessed using 2977 filter paper samples collected during a cross-sectional survey in Zanzibar, a malaria pre-elimination setting in sub-Saharan Africa. Field samples were defined as ‘final positive’ if positive in at least two of the five PCR methods. Cytb-qPCR preformed equal to or better than the reference PCRs with a sensitivity of 100% (65/65; 95%CI 94.5–100%) and a specificity of 99.9% (2910/2912; 95%CI 99.7–100%) when compared against ‘final positive’ samples. The results indicate that the cytb-qPCR may represent an opportunity for improved molecular surveillance of low-density Plasmodium infections in malaria pre-elimination settings. PMID:25774805

  19. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    Science.gov (United States)

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  20. Rapid diagnosis of avian influenza virus in wild birds: use of a portable rRT-PCR and freeze-dried reagents in the field.

    Science.gov (United States)

    Takekawa, John Y; Hill, Nichola J; Schultz, Annie K; Iverson, Samuel A; Cardona, Carol J; Boyce, Walter M; Dudley, Joseph P

    2011-08-02

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  1. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  2. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  3. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Rapid group-, serotype-, and vaccine strain-specific identification of poliovirus isolates by real-time reverse transcription-PCR using degenerate primers and probes containing deoxyinosine residues.

    Science.gov (United States)

    Kilpatrick, David R; Yang, Chen-Fu; Ching, Karen; Vincent, Annelet; Iber, Jane; Campagnoli, Ray; Mandelbaum, Mark; De, Lina; Yang, Su-Ju; Nix, Allan; Kew, Olen M

    2009-06-01

    We have adapted our previously described poliovirus diagnostic reverse transcription-PCR (RT-PCR) assays to a real-time RT-PCR (rRT-PCR) format. Our highly specific assays and rRT-PCR reagents are designed for use in the WHO Global Polio Laboratory Network for rapid and large-scale identification of poliovirus field isolates.

  5. A novel rapid genotyping technique for Collie eye anomaly: SYBR Green-based real-time polymerase chain reaction method applicable to blood and saliva specimens on Flinders Technology Associates filter paper.

    Science.gov (United States)

    Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu

    2010-09-01

    Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds.

  6. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  7. Expression of efflux pump MexAB-OprM and OprD of Pseudomonas aeruginosa strains isolated from clinical samples using qRT-PCR.

    Science.gov (United States)

    Arabestani, Mohammad Reza; Rajabpour, Mojtaba; Yousefi Mashouf, Rasoul; Alikhani, Mohammad Yousef; Mousavi, Seyed Masoud

    2015-02-01

    Pseudomonas aeruginosa is one of the most common nosocomial pathogens with high mortality rates. Organisms such as Pseudomonas aeruginosa have the ability to develop high level MDR (Multi drug resistance). The MexAB-OprM system is one of the largest multi-drug resistant efflux pumps with high levels of expression and the first finding of the RND (Resistance-nodulation-division) family in P. aeruginosa. For better understanding of the antibiotic resistance mechanism in P. aeruginosa, this study was conducted to determine the expression of the genes encoding these efflux pumps in 100 strains of P. aeruginosa isolated from patients admitted to various hospitals in Hamadan using quantitative Real-Time PCR (qRT-PCR). This study examined 100 strains of P. aeruginosa isolated from patients admitted to various hospitals in Hamadan. Then, 31 samples were selected based on collected specimen type and their antibiotic susceptibility pattern; i.e., the samples with reduced susceptibility to antibiotics, particularly carbapenems. Antibiotic disk diffusion method was performed for aminoglycoside, quinolone and carbapenem. Furthermore, MIC method was performed for ciprofloxacin, gentamicin and imipenem. Finally, qRT-PCR was used for determining the efflux pump genes expression.  Among eight selected antibiotics, the greatest resistance was to levofloxacin (61.2%, n = 19) and the lowest one to imipenem (9.6%, n = 3). All isolates (100%, n = 31) exhibited efflux pump MexAB-OprM genes but different expression was observed in different strains. The result of gene expression indicated that significant differences in expression of MexR (P value = 0.003), OprD (P value resistance mechanisms is very complicated. Although efflux pump MexAB-OprM plays an important role in antibiotic resistance in P. aeruginosa, because of acting the efflux pumps on antibiotics in a non-specific manner, it is elusive to consider or describe an antibiotic resistance based on the presence or absence of an

  8. Multiplex RT-PCR Assay for Detection of Common Fusion Transcripts in Acute Lymphoblastic Leukemia and Chronic Myeloid Leukemia Cases.

    Science.gov (United States)

    Limsuwanachot, Nittaya; Siriboonpiputtana, Teerapong; Karntisawiwat, Kanlaya; Chareonsirisuthigul, Takol; Chuncharunee, Suporn; Rerkamnuaychoke, Budsaba

    2016-01-01

    Acute lymphoblastic leukemia (ALL) is a heterogeneous disease which requires a risk-stratified approach for appropriate treatment. Specific chromosomal translocations within leukemic blasts are important prognostic factors that allow identification of relevant subgroups. In this study, we developed a multiplex RT-PCR assay for detection of the 4 most frequent translocations in ALL (BCR-ABL, TEL-AML1, MLL-AF4, and E2A- PBX1). A total of 214 diagnosed ALL samples from both adult and pediatric ALL and 14 cases of CML patients (154 bone marrow and 74 peripheral blood samples) were assessed for specific chromosomal translocations by cytogenetic and multiplex RT-PCR assays. The results showed that 46 cases of ALL and CML (20.2%) contained the fusion transcripts. Within the positive ALL patients, the most prevalent cryptic translocation observed was mBCR-ABL (p190) at 8.41%. In addition, other genetic rearrangements detected by the multiplex PCR were 4.21% TEL-AML1 and 2.34% E2A-PBX1, whereas MLL-AF4 exhibited negative results in all tested samples. Moreover, MBCR-ABL was detected in all 14 CML samples. In 16 samples of normal karyotype ALL (n=9), ALL with no cytogentic result (n=4) and CML with no Philadelphia chromosome (n=3), fusion transcripts were detected. Multiplex RT-PCR provides a rapid, simple and highly sensitive method to detect fusion transcripts for prognostic and risk stratification of ALL and CML patients.

  9. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  10. Multiplex RT-PCR and indirect immunofluorescence assays for detection and subtyping of human influenza virus in Tunisia.

    Science.gov (United States)

    Ben M'hadheb, Manel; Harrabi, Myriam; Souii, Amira; Jrad-Battikh, Nadia; Gharbi, Jawhar

    2015-03-01

    Influenza viruses are negative stranded segmented RNA viruses belonging to Orthomyxoviridae family. They are classified into three types A, B, and C. Type A influenza viruses are classified into subtypes according to the antigenic characters of the surface glycoproteins: hemagglutinin (H) and neuraminidase (N). The aim of the present study is to develop a fast and reliable multiplex RT-PCR technique for detecting simultaneously the subtypes A/H1N1 and A/H3N2 of influenza virus. Our study included 398 patients (mean age 30.33 ± 19.92 years) with flu or flu-like syndromes, consulting physicians affiliated with collaborating teams. A multiplex RT-PCR detecting A/H1N1 and A/H3N2 influenza viruses and an examination by indirect immunofluorescence (IFI) were performed. In the optimized conditions, we diagnosed by IFI a viral infection in 90 patients (22.6 %): 85 cases of influenza type A, four cases of influenza type B, and only one case of coinfection with types A and B. An evaluation of the technique was performed on 19 clinical specimens positive in IFI, and we detected eight cases of A/H3N2, five cases of A/H1N1, one case of influenza virus type A which is not an H1N1 nor H3N2, and five negative cases. Multiplex RT-PCR is a sensitive technique allowing an effective and fast diagnosis of respiratory infections caused by influenza viruses in which the optimization often collides with problems of sensibility.

  11. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  12. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  13. High-throughput qRT-PCR validation of blood microRNAs in non-small cell lung cancer.

    Science.gov (United States)

    Leidinger, Petra; Brefort, Thomas; Backes, Christina; Krapp, Medea; Galata, Valentina; Beier, Markus; Kohlhaas, Jochen; Huwer, Hanno; Meese, Eckart; Keller, Andreas

    2016-01-26

    Validation of biomarkers is essential to advance the translational process to clinical application. Although there exists an increasing number of reports on small non-coding RNAs (microRNAs) as minimally-invasive markers from blood, serum or plasma, just a limited number is verified in follow-up studies. We used qRT-PCR to evaluate a known miRNA signature measured from blood that allowed for separation between patients with non-small cell lung cancer (NSCLC), COPD and healthy controls.From the data of our previous microarray studies we selected a panel of 235 miRNAs related to lung cancer and COPD. We observed a high concordance between the AUC values of our initial microarray screening and the qRT-PCR data (correlation of 0.704, p < 10-16). Overall, 90.3% of markers were successfully validated. Among the top markers that were concordant between both studies we found hsa-miR-20b-5p, hsa-miR-20a-5p, hsa-miR-17-5p, and hsa-miR-106a-5p. The qRT-PCR analysis also confirmed that non-small cell lung cancer patients could be accurately differentiated from unaffected controls: a subset of five markers was sufficient to separate NSCLC patients from unaffected controls with accuracy of 94.5% (specificity and sensitivity of 98% and 91%). Beyond differentiation from controls, we also succeeded in separating NSCLC patients from patients with COPD. MiRNAs that were identified as relevant for the separation between lung cancer and COPD by both qRT-PCR and the array-based studies included hsa-miR-26a-5p, hsa-miR-328-3p and hsa-miR-1224-3p. Although for differentiation between NSCLC patients from COPD patients more markers were required, still high accuracy rates were obtained (5 markers: 78.8%; 10 markers: 83.9%; 50 markers: 87.6%).

  14. Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay.

    Science.gov (United States)

    Myatt, Theodore A; Johnston, Sebastian L; Rudnick, Stephen; Milton, Donald K

    2003-01-13

    Rhinovirus, the most common cause of upper respiratory tract infections, has been implicated in asthma exacerbations and possibly asthma deaths. Although the method of transmission of rhinoviruses is disputed, several studies have demonstrated that aerosol transmission is a likely method of transmission among adults. As a first step in studies of possible airborne rhinovirus transmission, we developed methods to detect aerosolized rhinovirus by extending existing technology for detecting infectious agents in nasal specimens. We aerosolized rhinovirus in a small aerosol chamber. Experiments were conducted with decreasing concentrations of rhinovirus. To determine the effect of UV irradiation on detection of rhinoviral aerosols, we also conducted experiments in which we exposed aerosols to a UV dose of 684 mJ/m2. Aerosols were collected on Teflon filters and rhinovirus recovered in Qiagen AVL buffer using the Qiagen QIAamp Viral RNA Kit (Qiagen Corp., Valencia, California) followed by semi-nested RT-PCR and detection by gel electrophoresis. We obtained positive results from filter samples that had collected at least 1.3 TCID50 of aerosolized rhinovirus. Ultraviolet irradiation of airborne virus at doses much greater than those used in upper-room UV germicidal irradiation applications did not inhibit subsequent detection with the RT-PCR assay. The air sampling and extraction methodology developed in this study should be applicable to the detection of rhinovirus and other airborne viruses in the indoor air of offices and schools. This method, however, cannot distinguish UV inactivated virus from infectious viral particles.

  15. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  16. Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR.

    Science.gov (United States)

    Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li

    2003-09-01

    Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

  17. Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT-PCR in dahlias and their distribution in Japanese dahlias.

    Science.gov (United States)

    Asano, S; Matsushita, Y; Hirayama, Y; Naka, T

    2015-08-01

    Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) are economically important viruses and viroid that infect cultivated dahlias. Prior to this investigation, no multiplex RT-PCR assay for the detection of dahlia virus and viroid infections existed. In this study, we report the development of a multiplex RT-PCR that simultaneously detects TSWV, DMV and CSVd infections in dahlias. In addition, a simple RT-PCR method that does not require RNA extraction, microtissue direct RT-PCR, could be used to prepare samples for analysis by this multiplex RT-PCR. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions, and CSVd in the Hokkaido region. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in dahlia. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions and CSVd in the Hokkaido region. © 2015 The Society for Applied Microbiology.

  18. Detection of poliovirus type 2 in oysters by using cell culture and RT-PCR Detecção de poliovírus tipo 2 em ostras através de cultura celular e RT-PCR

    Directory of Open Access Journals (Sweden)

    Cecília E.B. Vinatea

    2006-03-01

    Full Text Available Shellfish are readily contaminated with viruses present in water containing sewage due to the concentrating effect of filter feeding. Enteroviruses are generally used as a model for the detection of viruses from shellfish due to their public health significance. In the present work, oysters were placed in glass aquaria containing seawater plus unicellular algae. Two experiments were performed: 1 oysters bioaccumulating four different poliovirus type 2 concentrations: 5 x 10(4, 2.5 x 10(4, 5 x 10³ and 5 x 10² PFU/mL during 20h; 2 oyster tissues directly inoculated with 6.0 x 10(5 and 1.0 x 10(5 PFU/mL. After viruses seeding, tissue samples were processed by an adsorption-elution-precipitation method. Positive controls were performed by seeding 6.0 x 10(5 PFU/mL of poliovirus type 2 directly on the final oyster tissue extracts. Oyster extracts were assayed for viruses recovery by plaque assay, RT-PCR and integrated cell culture-PCR methodologies (ICC/PCR. The last one was based on the inoculation of the samples onto VERO cell monolayer followed by RT-PCR analysis of the infected cell fluid. In the first experiment (20h bioaccumulation until 5 x 10³ PFU were detected after 24 and 48h growth on VERO cells. Direct RT-PCR and ICC/PCR were able to detect 3 and 0.04 PFU of poliovirus, respectively, when bioaccumulation assay was used. When direct tissue virus seeding was performed, the plaque assays showed that polioviruses were recovered in all tested concentrations. Based on these results, it is possible to conclude that viable polioviruses can be detected in oysters after bioaccumulation and these techniques can be directly applied for monitoring virus contamination in environmental samples.Devido ao hábito alimentar filtrante, os moluscos bivalves são contaminados por vírus presentes em águas contaminadas por esgoto. Os enterovírus são geralmente usados como modelos para a detecção de vírus em moluscos bivalves devido a sua import

  19. A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame

    Directory of Open Access Journals (Sweden)

    Tavis John E

    2005-12-01

    Full Text Available Abstract Background Hepatitis C virus (HCV is a pathogenic hepatic flavivirus with a single stranded RNA genome. It has a high genetic variability and is classified into six major genotypes. Genotype 1a and 1b cause the majority of infections in the USA. Viral genomic sequence information is needed to correlate viral variation with pathology or response to therapy. However, reverse transcription-polymerase chain reaction (RT-PCR of the HCV genome must overcome low template concentration and high target sequence diversity. Amplification conditions must hence have both high sensitivity and specificity yet recognize a heterogeneous target population to permit general amplification with minimal bias. This places divergent demands of the amplification conditions that can be very difficult to reconcile. Results RT and nested PCR conditions were optimized independently and systematically for amplifying the complete open reading frame (ORF from HCV genotype 1a and 1b using several overlapping amplicons. For each amplicon, multiple pairs of nested PCR primers were optimized. Using these primers, the success rate (defined as the rate of production of sufficient DNA for sequencing with any one of the primer pairs for a given amplicon for amplification of 72 genotype 1a and 1b patient plasma samples averaged over 95% for all amplicons. In addition, two sets of sequencing primers were optimized for each genotype 1a and 1b. Viral consensus sequences were determined by directly sequencing the amplicons. HCV ORFs from 72 patients have been sequenced using these primers. Sequencing errors were negligible because sequencing depth was over 4-fold and both strands were sequenced. Primer bias was controlled and monitored through careful primer design and control experiments. Conclusion Optimized RT-PCR and sequencing conditions are useful for rapid and reliable amplification and sequencing of HCV genotype 1a and 1b ORFs.

  20. Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Rudnick Stephen

    2003-01-01

    Full Text Available Abstract Background Rhinovirus, the most common cause of upper respiratory tract infections, has been implicated in asthma exacerbations and possibly asthma deaths. Although the method of transmission of rhinoviruses is disputed, several studies have demonstrated that aerosol transmission is a likely method of transmission among adults. As a first step in studies of possible airborne rhinovirus transmission, we developed methods to detect aerosolized rhinovirus by extending existing technology for detecting infectious agents in nasal specimens. Methods We aerosolized rhinovirus in a small aerosol chamber. Experiments were conducted with decreasing concentrations of rhinovirus. To determine the effect of UV irradiation on detection of rhinoviral aerosols, we also conducted experiments in which we exposed aerosols to a UV dose of 684 mJ/m2. Aerosols were collected on Teflon filters and rhinovirus recovered in Qiagen AVL buffer using the Qiagen QIAamp Viral RNA Kit (Qiagen Corp., Valencia, California followed by semi-nested RT-PCR and detection by gel electrophoresis. Results We obtained positive results from filter samples that had collected at least 1.3 TCID50 of aerosolized rhinovirus. Ultraviolet irradiation of airborne virus at doses much greater than those used in upper-room UV germicidal irradiation applications did not inhibit subsequent detection with the RT-PCR assay. Conclusion The air sampling and extraction methodology developed in this study should be applicable to the detection of rhinovirus and other airborne viruses in the indoor air of offices and schools. This method, however, cannot distinguish UV inactivated virus from infectious viral particles.

  1. Identification of Suitable Endogenous Normalizers for qRT- PCR Analysis of Plasma microRNA Expression in Essential Hypertension

    Science.gov (United States)

    Solayman, Mohamed Hassan M.; Langaee, Taimour; Patel, Archanakumari; El-Wakeel, Lamia; El-Hamamsy, Manal; Badary, Osama; Johnson, Julie A.

    2016-01-01

    Circulating microRNAs (miRNAs) are promising biomarkers for many diseases. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a gold standard for miRNA expression profiling that requires proper data normalization. Since there is no universal normalizer, it is recommended to evaluate normalizers under every experimental condition. This study describes the identification of suitable endogenous normalizer(s) (ENs) for plasma miRNA expression in essential hypertension. Expression levels of 5 candidate ENs and 2 plasma quality markers were determined by qRT-PCR in plasma samples from 18 hypertensive patients and 10 healthy controls. NormFinder, GeNorm, and DataAssist software programs were used to select the best EN(s). Expression levels of the 5 candidate ENs were also analyzed in urine samples from hypertensive patients and compared to the plasma samples of the hypertensive patients. Among the analyzed candidates, hsa-miR-92a-3p was identified as the best EN, and hsa-miR-21-5p and hsa-miR-16-5p as next best. Moreover, hsa-miR-92a-3p showed the most consistent expression between plasma and urine In conclusion, this study showed that hsa-miR-92a-3p, hsa-miR-21-5p, and hsa-miR-16-5p may be used as normalizers for plasma miRNA expression data in essential hypertension studies. PMID:26798072

  2. A modified in situ RT-PCR method for localizing fungal-specific gene expression in Candida-infected mice renal cells.

    Science.gov (United States)

    Yong, Voon Chen; Ong, Khang Wei; Sidik, Shiran Mohd; Rosli, Rozita; Chong, Pei Pei

    2009-11-01

    In situ Reverse Transcriptase PCR (in situ RT-PCR) can amplify mRNA and localize gene expression in cells. However, this method is not feasible in fungi as the thick fungal cell wall constitutes a barrier to this procedure. We developed a two step in situ RT-PCR procedure which enabled the detection and localization of Candida tropicalis mRNA expression in formalin-fixed, paraffin-embedded (FFPE) mouse kidney sections. This in situ hybridization study revealed the first direct evidence for deposition of Candida tropicalis secreted aspartic proteinase 2 (CtSAP2) in the tip of pseudohyphae and its involvement in acute systemic candidiasis. We conclude that in situ RT-PCR can be successfully applied to FFPE tissues and will offer new perspectives in studying gene expression in Candida species.

  3. Ligation-dependent RT-PCR: a new specific and low-cost technique to detect ALK, ROS, and RET rearrangements in lung adenocarcinoma.

    Science.gov (United States)

    Piton, Nicolas; Ruminy, Philippe; Gravet, Claire; Marchand, Vinciane; Colasse, Élodie; Lamy, Aude; Naoures Mear, Cécile Le; Bibeau, Fréderic; Marguet, Florent; Guisier, Florian; Salaün, Mathieu; Thiberville, Luc; Jardin, Fabrice; Sabourin, Jean-Christophe

    2018-03-01

    Detection of anaplastic lymphoma kinase (ALK), ROS proto-oncogene 1 (ROS1), and rearranged during transfection (RET) gene rearrangements in lung adenocarcinoma is usually performed by immunohistochemistry (IHC) screening followed by fluorescence in situ hybridization (FISH), which is an expensive and difficult technique. Ligation-dependent reverse transcription polymerase chain reaction (RT-PCR) multiplex technique can detect gene rearrangements using probes specifically hybridized to either side of the break point. PCR products are then sequenced by pyrosequencing or high throughput sequencing in order to identify the two genes involved. The reagent cost is <15 dollars per patient and results are available in 2 days. We have developed a 47-probe LD-RT-PCR kit especially for lung adenocarcinomas. Thirty-nine lung adenocarcinomas were studied: 24 ALK+, 14 ROS1+, and 1 RET+. ALK+ and ROS1+ were IHC+ (D5F3 Ventana for ALK and D4D6 Cell Signaling Technology for ROS1) and all cases were FISH+ (Vysis ALK Breakapart Probe Abbott for ALK, Zytolight SPEC ROS1 Dualcolor Breakapart Probe for ROS1 and Zytolight SPEC RET Dual Color Breakapart for RET); 14 wild type samples were included as negative controls. Using LD-RT-PCR, 15 rearrangements (63%) were detected in the ALK cases (gene partner: EML4 in all cases), 9 rearrangements (64%) in the ROS1 cases (gene partners: CD74 in 8 cases and SLC34A2 in 1 case) and 1 (100%) in the single RET case (gene partner: KIF5B). No rearrangement was found in the 14 negative control cases. Negative cases using LD-RT-PCR could be explained by the fact that some partner genes were not included in our assay and therefore could not be detected. Because it is an affordable, fast, and very simple technique, we propose using LD-RT-PCR when ALK immunostaining is positive. For LD-RT-PCR-negative cases, samples should then be analyzed by FISH.

  4. Data-driven normalization strategies for high-throughput quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Suzuki Harukazu

    2009-04-01

    Full Text Available Abstract Background High-throughput real-time quantitative reverse transcriptase polymerase chain reaction (qPCR is a widely used technique in experiments where expression patterns of genes are to be profiled. Current stage technology allows the acquisition of profiles for a moderate number of genes (50 to a few thousand, and this number continues to grow. The use of appropriate normalization algorithms for qPCR-based data is therefore a highly important aspect of the data preprocessing pipeline. Results We present and evaluate two data-driven normalization methods that directly correct for technical variation and represent robust alternatives to standard housekeeping gene-based approaches. We evaluated the performance of these methods against a single gene housekeeping gene method and our results suggest that quantile normalization performs best. These methods are implemented in freely-available software as an R package qpcrNorm distributed through the Bioconductor project. Conclusion The utility of the approaches that we describe can be demonstrated most clearly in situations where standard housekeeping genes are regulated by some experimental condition. For large qPCR-based data sets, our approaches represent robust, data-driven strategies for normalization.

  5. Reference genes for quantitative RT-PCR data in gastric tissues and cell lines

    Science.gov (United States)

    Wisnieski, Fernanda; Calcagno, Danielle Queiroz; Leal, Mariana Ferreira; dos Santos, Leonardo Caires; Gigek, Carolina de Oliveira; Chen, Elizabeth Suchi; Pontes, Thaís Brilhante; Assumpção, Paulo Pimentel; de Assumpção, Mônica Barauna; Demachki, Sâmia; Burbano, Rommel Rodríguez; Smith, Marília de Arruda Cardoso

    2013-01-01

    AIM: To evaluate the suitability of reference genes in gastric tissue samples and cell lines. METHODS: The suitability of genes ACTB, B2M, GAPDH, RPL29, and 18S rRNA was assessed in 21 matched pairs of neoplastic and adjacent non-neoplastic gastric tissues from patients with gastric adenocarcinoma, 27 normal gastric tissues from patients without cancer, and 4 cell lines using reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). The ranking of the best single and combination of reference genes was determined by NormFinder, geNorm™, BestKeeper, and DataAssist™. In addition, GenEx software was used to determine the optimal number of reference genes. To validate the results, the mRNA expression of a target gene, DNMT1, was quantified using the different reference gene combinations suggested by the various software packages for normalization. RESULTS: ACTB was the best reference gene for all gastric tissues, cell lines and all gastric tissues plus cell lines. GAPDH + B2M or ACTB + B2M was the best combination of reference genes for all the gastric tissues. On the other hand, ACTB + B2M was the best combination for all the cell lines tested and was also the best combination for analyses involving all the gastric tissues plus cell lines. According to the GenEx software, 2 or 3 genes were the optimal number of references genes for all the gastric tissues. The relative quantification of DNMT1 showed similar patterns when normalized by each combination of reference genes. The level of expression of DNMT1 in neoplastic, adjacent non-neoplastic and normal gastric tissues did not differ when these samples were normalized using GAPDH + B2M (P = 0.32), ACTB + B2M (P = 0.61), or GAPDH + B2M + ACTB (P = 0.44). CONCLUSION: GAPDH + B2M or ACTB + B2M is the best combination of reference gene for all the gastric tissues, and ACTB + B2M is the best combination for the cell lines tested. PMID:24222956

  6. RT-PCR evidence for the turp effect: re-visiting an 80's concept with a 90's technology

    International Nuclear Information System (INIS)

    Moreno, Jose G.; Corn, Benjamin W.; Valicenti, Richard; Alexander, Archibald; Shupp-Byrne, Dolores; Gomella, Leonard G.

    1996-01-01

    PURPOSE: The 'TURP effect' is a controversial phenomenon that suggests that transurethral resection of the prostate (especially in those with advanced stage, moderately-poorly differentiated tumors) promotes tumor dissemination that leads to inferior survival. Although the advent of trans-rectal ultrasonography (TRUS), prostate specific antigen (PSA) testing, and spring-loaded biopsy guns have minimized the percentage of patients who have a diagnosis established by TURP, some investigators continue to advocate a different clinical algorithm for those who have TURP prior to definitive irradiation. The Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) technique is an exquisitely sensitive molecular application that allows the detection of a small number of PSA-synthesizing cells in a highly diluted population of peripheral blood cells. The purpose of the present analysis was to prospectively acquire RT-PCR data to determine whether surgical manipulation of the prostate gland engenders release of prostate cells into the peripheral circulation. MATERIALS AND METHODS: Patients undergoing TRUS-guided biopsy (n=51), radical prostatectomy (n=3), and TURP (n=4) consented to have 8 ml of peripheral venous blood drawn before and 10-30 minutes after their respective procedures. RNA was extracted from fractionated blood, and RNA quality was assured with actin RT-PCR analysis. PSA primers binding exons 4 and 5 yielded a 254 bp PCR product with a sensitivity of 1LNcap cell in 100 million lymphoid cells on ethidium bromide gel. RESULTS: 50/51TRUS cases were negative prior to biopsy, of which 4 (8%) became positive after the procedure. Of the 3 radical prostatectomy cases, one remained positive pre and post-operatively, one remained negative and the other converted to a positive result. Of the 4 TURP cases, all had negative baseline studies, of which 3 converted to a positive result after the procedure (p<0.05). All 3 TURP cases that became positive had a highly intense

  7. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR) method

    OpenAIRE

    FIGUEIREDO Luiz Tadeu Moraes; BATISTA Weber Chelli; IGARASHI Akira

    1997-01-01

    We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture incl...

  8. Reference Gene Selection for qRT-PCR Normalization Analysis in kenaf (Hibiscus cannabinus L. under Abiotic Stress and Hormonal Stimuli

    Directory of Open Access Journals (Sweden)

    Xiaoping Niu

    2017-05-01

    Full Text Available Kenaf (Hibiscus cannabinus L., an environmental friendly and economic fiber crop, has a certain tolerance to abiotic stresses. Identification of reliable reference genes for transcript normalization of stress responsive genes expression by quantitative real-time PCR (qRT-PCR is important for exploring the molecular mechanisms of plants response to abiotic stresses. In this study, nine candidate reference genes were cloned, and their expression stabilities were assessed in 132 abiotic stress and hormonal stimuli samples of kenaf using geNorm, NormFinder, and BestKeeper algorithms. Results revealed that HcPP2A (Protein phosphatase 2A and HcACT7 (Actin 7 were the optimum reference genes across all samples; HcUBC (Ubiquitin-conjugating enzyme like protein was the worst reference gene for transcript normalization. The reliability of the selected reference genes was further confirmed by evaluating the expression profile of HcWRKY28 gene at different stress durations. This work will benefit future studies on discovery of stress-tolerance genes and stress-signaling pathways in this important fiber crop.

  9. Dataset of proinflammatory cytokine and cytokine receptor gene expression in rainbow trout (Oncorhynchus mykiss measured using a novel GeXP multiplex, RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Ivan Kutyrev

    2017-04-01

    Full Text Available A GeXP multiplex, RT-PCR assay was developed and optimized that simultaneously measures expression of a suite of immune-relevant genes in rainbow trout (Oncorhynchus mykiss, concentrating on tumor necrosis factor and interleukin-1 ligand/receptor systems and acute phase response genes. The dataset includes expression values for drpt, il11a, il1b1, il1b2, il1b3, il1r-like-1(e3-5, il1r-like-1(e9-11, il1r1-like-a, il1r1-like-b, il1r2, saa, tnfa1, tnfa2, tnfa3, tnfrsf1a, tnfrsf1a-like-a, tnfrsf1a-like-b, tnfrsf5, and tnfrsf9. Gene expression was measured at four time-points post-challenge in both a resistant line (ARS-Fp-R and a susceptible line (ARS-Fp-S of rainbow trout. In addition, fish body weight, spleen index and the Flavobacterium psychrophilum load are reported. These data are an extension of information presented and discussed in “Proinflammatory cytokine and cytokine receptor gene expression kinetics following challenge with Flavobacterium psychrophilum in resistant and susceptible lines of rainbow trout (Oncorhynchus mykiss” (Kutyrev et al., 2016 [1].

  10. Dataset of proinflammatory cytokine and cytokine receptor gene expression in rainbow trout (Oncorhynchus mykiss) measured using a novel GeXP multiplex, RT-PCR assay.

    Science.gov (United States)

    Kutyrev, Ivan; Cleveland, Beth; Leeds, Timothy; Wiens, Gregory D

    2017-04-01

    A GeXP multiplex, RT-PCR assay was developed and optimized that simultaneously measures expression of a suite of immune-relevant genes in rainbow trout ( Oncorhynchus mykiss ), concentrating on tumor necrosis factor and interleukin-1 ligand/receptor systems and acute phase response genes. The dataset includes expression values for drpt , il11a , il1b1 , il1b2 , il1b3 , il1r-like-1 (e3-5), il1r-like-1 (e9-11), il1r1-like-a , il1r1-like-b , il1r2 , saa , tnfa1 , tnfa2 , tnfa3 , tnfrsf1a , tnfrsf1a-like-a , tnfrsf1a-like-b , tnfrsf5 , and tnfrsf9 . Gene expression was measured at four time-points post-challenge in both a resistant line (ARS-Fp-R) and a susceptible line (ARS-Fp-S) of rainbow trout. In addition, fish body weight, spleen index and the Flavobacterium psychrophilum load are reported. These data are an extension of information presented and discussed in " Proinflammatory cytokine and cytokine receptor gene expression kinetics following challenge with Flavobacterium psychrophilum in resistant and susceptible lines of rainbow trout ( Oncorhynchus mykiss )" (Kutyrev et al., 2016) [1].

  11. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  12. Exploring the Histogenesis and Diagnostic Strategy Using Immunoassay and RT-PCR in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Ju, Xinxin; Sun, Kunming; Liu, Ruixue; Li, Shugang; Abulajiang, Gulinaer; Zou, Hong; Lan, Jiaojiao; Ren, Yan; Jiang, Jinfang; Liang, Weihua; Pang, Lijuan; Li, Feng

    2017-08-01

    Alveolar soft part sarcoma (ASPS) is a rare soft tissue sarcoma, but it's easily misdiagnosed in rare locations. The derivation of ASPS is still uncertain, therefore we conducted this study to explore the histogenesis of ASPS by analyzing stem cell markers (ALDH1, CD29, CD133 and Nestin). Protein TFE3 and fusion gene ASPS-TFE3 were tested in paraffin to explore diagnostic strategy and molecular pathological features. In this study, nine cases of ASPS were immunostained with stem cell surface markers (ALDH1, CD29, CD133 and Nestin) and protein TFE3. Seven cases of ASPS mRNA were successfully extracted from nine paraffin-embedded tissues. The expression of fusion gene ASPL-TFE3 was examined by reverse transcriptase-polymerase chain reaction. The immunohistochemical staining of nine patients showed that CD29 and Nestin were negative in all nine cases (0/9). CD133 was weakly positive in one cases (1/9) and ALDH1 was weakly positive in one cases (1/9). TFE3 was positive in nine cases (9/9). Seven paraffin tissues could be successfully extracted with mRNA in nine cases. The results of Reverse Transcription Polymerase Chain Reaction (RT-PCR) showed that ASPL-TFE3 fusion transcripts could be tested in the seven cases (four cases being type 2 and three cases being type 1). The positive rate of CD133 and ALDH1 were less than 1% and the expression of CD29 and Nestin were negative in ASPS. Immunohistochemistry results indicated that the histogenesis of ASPS maybe not derive from mesenchymal stem cells. Immunohistochemistry staining showed that TFE3 protein expression was highly sensitive in ASPS. Furthermore, RT-PCR results showed that fusion gene ASPL-TFE3 (ASPL-TFE3 type 1 and ASPL-TFE3 type 2) was expressed in ASPS, which could provide information for clinical molecular pathological diagnosis and improve the diagnosis rate of rare atypical ASPS.

  13. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Optimization of RT-PCR reactions in studies with genes of lignin biosynthetic route in Saccharum spontaneum

    Directory of Open Access Journals (Sweden)

    JUAN P.P. LLERENA

    Full Text Available ABSTRACT Saccharum spontaneum has been used for the development of energy cane a crop aimed to be used for the production of second-generation ethanol, or lignocellulosic ethanol. Lignin is a main challenge in the conversion of cell wall sugars into ethanol. In our studies to isolate the genes the lignin biosynthesis in S. spontaneum we have had great difficulty in RT-PCR reactions. Thus, we evaluated the effectiveness of different additives in the amplification of these genes. While COMT and CCoAOMT genes did not need any additives for other genes there was no amplification (HCT, F5H, 4CL and CCR or the yield was very low (CAD and C4H. The application of supplementary cDNA was enough to overcome the non-specificity and low yield for C4H and C3H, while the addition of 0.04% BSA + 2% formamide was effective to amplify 4CL, CCR, F5H and CCR. HCT was amplified only by addition of 0.04% BSA + 2% formamide + 0.1 M trehalose and amplification of PAL was possible with addition of 2% of DMSO. Besides optimization of expression assays, the results show that additives can act independently or synergistically.

  15. Development of a novel hepatitis B virus encapsidation detection assay by viral nucleocapsid-captured quantitative RT-PCR.

    Science.gov (United States)

    Ryu, Dong-Kyun; Ahn, Yeji; Ryu, Wang-Shick; Windisch, Marc P

    2015-11-01

    After encapsidation, where pregenomic RNA (pgRNA) is packaged into viral nucleocapsids, hepatitis B virus (HBV) uses the pgRNA as a template to replicate its DNA genome by reverse transcription. To date, there are only two encapsidation detection methods for evaluating the amount of pgRNA packaged into nucleocapsids: (i) the RNase protection assay and (ii) the native agarose gel electrophoresis assay. However, these methods are complex and laborious because they require multiple pgRNA purification steps followed by detection via an isotope-labeled probe. Moreover, both assays are unsuitable for evaluating a large number of antiviral agents in a dose-dependent manner. To overcome these limitations, we devised a novel HBV encapsidation assay in a 96-well plate format using nucleocapsid capture plates coated with an anti-HBV core (HBc) antibody, usually employed in enzyme-linked immunosorbent assays, to immobilize viral nucleocapsids. Viral pgRNA is then detected by quantitative RT-PCR (RT-qPCR). This strategy allows fast, convenient, and quantitative analysis of multiple viral RNA samples to evaluate encapsidation inhibitors. Furthermore, our protocol is potentially suitable for high-throughput screening (HTS) of compounds targeting HBV pgRNA encapsidation.

  16. Combined Metabonomic and Quantitative RT-PCR Analyses Revealed Metabolic Reprogramming Associated with Fusarium graminearum Resistance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fangfang Chen

    2018-01-01

    Full Text Available Fusarium head blight disease resulting from Fusarium graminearum (FG infection causes huge losses in global production of cereals and development of FG-resistant plants is urgently needed. To understand biochemistry mechanisms for FG resistance, here, we have systematically investigated the plant metabolomic phenotypes associated with FG resistance for transgenic Arabidopsis thaliana expressing a class-I chitinase (Chi, a Fusarium-specific recombinant antibody gene (CWP2 and fused Chi-CWP2. Plant disease indices, mycotoxin levels, metabonomic characteristics, and expression levels of several key genes were measured together with their correlations. We found that A. thaliana expressing Chi-CWP2 showed higher FG resistance with much lower disease indices and mycotoxin levels than the wild-type and the plants expressing Chi or CWP2 alone. The combined metabonomic and quantitative RT-PCR analyses revealed that such FG-resistance was closely associated with the promoted biosynthesis of secondary metabolites (phenylpropanoids, alkanoids and organic osmolytes (proline, betaine, glucose, myo-inositol together with enhanced TCA cycle and GABA shunt. These suggest that the concurrently enhanced biosyntheses of the shikimate-mediated secondary metabolites and organic osmolytes be an important strategy for A. thaliana to develop and improve FG resistance. These findings provide essential biochemical information related to FG resistance which is important for developing FG-resistant cereals.

  17. Ectopic expression of target genes may represent an inherent limitation of RT-PCR assays used for micrometastasis detection : Studies on the epithelial glycoprotein gene EGP-2

    NARCIS (Netherlands)

    deGraaf, H; Maelandsmo, GM; Ruud, P; Forus, A; Oyjord, T; Fodstad, O; Hovig, E

    1997-01-01

    Our objective was to develop and study the feasibility of a quantitative, nested reverse-transcription polymerase chain reaction (RT-PCR) assay for detection of micrometastatic, epithelial tumor cells using the epithelial glycoprotein EGP-2 gene as a target, Several carcinoma cell lines and

  18. A comparison of the sensitivities of detection of Plasmodium falciparum gametocytes by magnetic fractionation, thick blood film microscopy, and RT-PCR

    Directory of Open Access Journals (Sweden)

    St-Pierre Tim G

    2009-05-01

    Full Text Available Abstract Background The magnetic properties of Plasmodium-infected erythrocytes have been exploited for different clinical and research purposes. A recent study in a rural clinical setting in Papua New Guinea has demonstrated that Plasmodium falciparum gametocyte detection is facilitated by magnetic deposition microscopy but no study has yet determined the relative sensitivity and limit of detection of a magnetic fractionation technique. The present study compares the detection limit and sensitivity of a technique based on the use of commercially available magnetic fractionation columns with those for thick blood film microscopy and reverse transcriptase polymerase chain reaction (RT-PCR methods. Methods Gametocyte detection in six series of dilutions of cultured P. falciparum parasites with known gametocytaemia was conducted using magnetic fractionation, thick blood film, and RT-PCR techniques. Results The preparations obtained by the magnetic fractionation method were of thin film quality allowing easy gametocyte identification by light microscopy. Magnetic fractionation had a higher sensitivity and approximately two orders of magnitude better limit of detection than thick blood film microscopy. Gametocytes were also more readily detectable on the magnetically fractionated preparations. Magnetic fractionation had a similar limit of detection to that of RT-PCR. Conclusion Magnetic fractionation is a highly sensitive and convenient method for gametocyte detection in comparison with the standard thick blood film and RT-PCR methods, and could readily be adapted to field application.

  19. Foot-and-mouth disease virus: A first inter-laboratory comparison trial to evaluate virus isolation and RT-PCR detection methods.

    NARCIS (Netherlands)

    Ferris, N.P.; King, D.P.; Reid, S.M.; Hutchings, G.H.; Shawa, A.E.; Paton, D.J.; Goris, N.; Haas, B.; Hoffmann, B.; Brocchi, E.; Bugnetti, M.; Dekker, A.; Clerq, De K.

    2006-01-01

    Five European reference laboratories participated in an exercise to evaluate the sensitivity and specificity of their routinely employed RT-PCR tests and cell cultures for the detection and isolation of foot-and-mouth disease (FMD) virus. Five identical sets of 20 coded samples were prepared from 10

  20. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  1. RT-PCR and statistical analyses of adeABC expression in clinical isolates of Acinetobacter calcoaceticus-Acinetobacter baumannii complex.

    Science.gov (United States)

    Ruzin, Alexey; Immermann, Frederick W; Bradford, Patricia A

    2010-06-01

    The relationship between expression of adeABC and minimal inhibitory concentration (MIC) of tigecycline was investigated by RT-PCR and statistical analyses in a population of 106 clinical isolates (MIC range, 0.0313-16 microg/ml) of Acinetobacter calcoaceticus-Acinetobacter baumannii complex. There was a statistically significant linear relationship (p calcoaceticus-A. baumannii complex.

  2. Quantification of cDNA generated by reverse transcription of total RNA provides a simple alternative tool for quantitative RT-PCR normalization

    Czech Academy of Sciences Publication Activity Database

    Libus, Jiří; Štorchová, Helena

    2006-01-01

    Roč. 41, - (2006), s. 156-164 ISSN 0736-6205 R&D Projects: GA ČR GA522/05/0300 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z5038910 Keywords : Quantitative RT PCR * normalization method * cDNA quantification Subject RIV: EF - Botanics Impact factor: 2.462, year: 2006

  3. A bacterial community analysis using reverse transcription (RT) PCR which detects the bacteria with high activity in a wastewater treatment reactor

    Science.gov (United States)

    This research used reverse transcription polymerase chain reaction (RT-PCR) method to help detect active bacteria in a single-tank deammonification reactor combining partial nitritation and anammox. The single-tank aerobic deammonification reactor effectively removed the ammonia in anaerobically di...

  4. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  5. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  6. Multiplex RT-PCR amplification of HIV genes to create a completely autologous DC-based immunotherapy for the treatment of HIV infection.

    Directory of Open Access Journals (Sweden)

    Irina Tcherepanova

    Full Text Available BACKGROUND: Effective therapy for HIV-infected individuals remains an unmet medical need. Promising clinical trials with dendritic cell (DC-based immunotherapy consisting of autologous DC loaded with autologous virus have been reported, however, these approaches depend on large numbers of HIV virions to generate sufficient doses for even limited treatment regimens. METHODOLOGY/PRINCIPAL FINDINGS: The present study describes a novel approach for RT-PCR amplification of HIV antigens. Previously, RT-PCR amplification of autologous viral sequences has been confounded by the high mutation rate of the virus which results in unreliable primer-template binding. To resolve this problem we developed a multiplex RT-PCR strategy that allows reliable strain-independent amplification of highly polymorphic target antigens from any patient and requires neither viral sequence data nor custom-designed PCR primers for each individual. We demonstrate the application of our RT-PCR process to amplify translationally-competent RNA encoding regions of Gag, Vpr, Rev and Nef. The products amplified using this method represent a complex mixture of autologous antigens encoded by viral quasispecies. We further demonstrate that DCs electroporated with in vitro-transcribed HIV RNAs are capable of stimulating poly-antigen-specific CD8+ T cell responses in vitro. CONCLUSION/SIGNIFICANCE: This study describes a strategy to overcome patient to patient viral diversity enabling strain-independent RT-PCR amplification of RNAs encoding sequence divergent quasispecies of Gag, Vpr, Rev and Nef from small volumes of infectious plasma. The approach allows creation of a completely autologous therapy that does not require advance knowledge of the HIV genomic sequences, does not have yield limitations and has no intact virus in the final product. The simultaneous use of autologous viral antigens and DCs may provoke broad patient-specific immune responses that could potentially induce

  7. Multiplex RT-PCR Amplification of HIV Genes to Create a Completely Autologous DC-Based Immunotherapy for the Treatment of HIV Infection

    Science.gov (United States)

    Tcherepanova, Irina; Harris, Jason; Starr, Aijing; Cleveland, Jaclyn; Ketteringham, Helen; Calderhead, David; Horvatinovich, Joe; Healey, Don; Nicolette, Charles A.

    2008-01-01

    Background Effective therapy for HIV-infected individuals remains an unmet medical need. Promising clinical trials with dendritic cell (DC)-based immunotherapy consisting of autologous DC loaded with autologous virus have been reported, however, these approaches depend on large numbers of HIV virions to generate sufficient doses for even limited treatment regimens. Methodology/Principal Findings The present study describes a novel approach for RT-PCR amplification of HIV antigens. Previously, RT-PCR amplification of autologous viral sequences has been confounded by the high mutation rate of the virus which results in unreliable primer-template binding. To resolve this problem we developed a multiplex RT-PCR strategy that allows reliable strain-independent amplification of highly polymorphic target antigens from any patient and requires neither viral sequence data nor custom-designed PCR primers for each individual. We demonstrate the application of our RT-PCR process to amplify translationally-competent RNA encoding regions of Gag, Vpr, Rev and Nef. The products amplified using this method represent a complex mixture of autologous antigens encoded by viral quasispecies. We further demonstrate that DCs electroporated with in vitro-transcribed HIV RNAs are capable of stimulating poly-antigen-specific CD8+ T cell responses in vitro. Conclusion/Significance This study describes a strategy to overcome patient to patient viral diversity enabling strain-independent RT-PCR amplification of RNAs encoding sequence divergent quasispecies of Gag, Vpr, Rev and Nef from small volumes of infectious plasma. The approach allows creation of a completely autologous therapy that does not require advance knowledge of the HIV genomic sequences, does not have yield limitations and has no intact virus in the final product. The simultaneous use of autologous viral antigens and DCs may provoke broad patient-specific immune responses that could potentially induce effective control of viral

  8. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Quantification of hTERT Splice Variants in Melanoma by SYBR Green Real-time Polymerase Chain Reaction Indicates a Negative Regulatory Role for the β Deletion Variant

    Directory of Open Access Journals (Sweden)

    Lisa F. Lincz

    2008-10-01

    Full Text Available Telomerase activity is primarily determined by transcriptional regulation of the catalytic subunit, human telomerase reverse transcriptase (hTERT. Several mRNA splice variants for hTERT have been identified, but it is not clear if telomerase activity is determined by the absolute or relative levels of full-length (functional and variant hTERT transcripts. We have developed an SYBR green-based reverse transcription-quantitative polymerase chain reaction assay for the enumeration of the four common hTERT mRNA variants and correlated these with telomerase activity and telomere length in 24 human melanoma cell lines. All except five of the lines expressed four hTERT transcripts, with an overall significant level of co-occurrence between absolute mRNA levels of full-length α+/β+ hTERT and the three splice variants α-/β+, α+/β-, and α-/β-. On average, α+/β+ made up the majority (48.1% of transcripts, followed by α+/β- (44.6%, α-/β- (4.4%, and α-/β+ (2.9%. Telomerase activity ranged from 1 to 247 relative telomerase activity and correlated most strongly with the absolute amount of α+/β+ (R = 0.791, P = .000004 and the relative amount of α+/β- (R = -0.465, P = .022. This study shows that telomerase activity in melanoma cells is best determined by the absolute expression of full-length hTERT mRNA and indicates a role for the hTERT β deletion variant in the negative regulation of enzyme activity.

  10. Application of the differential display RT-PCR strategy for the identification of inflammation-related mouse genes

    Directory of Open Access Journals (Sweden)

    Silva A.M.

    1999-01-01

    Full Text Available The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31% were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38% showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

  11. Factor VIII (F8) inversions in severe hemophilia A: Male germ cell origin and diagnosis with RT-PCR

    Energy Technology Data Exchange (ETDEWEB)

    Antonarakis, S.E. [Geneva Medical School (Switzerland)]|[Johns Hopkins School of Medicine, Baltimore, MD (United States); Rossiter, J.P. [Johns Hopkins School of Medicine, Baltimore, MD (United States); Young, M. [Geneva Medical School (Switzerland)] [and others

    1994-09-01

    The Factor VIII (F8) gene, which is defective in hemophilia A, is located in the most telomeric megabase of Xq. Inversions due to intrachromosomal homologous recombination between mispaired copies of gene A located within intron 22 of the gene and about 500 kb telomeric to it account for nearly half of the cases of severe hemophilia A. We hypothesized that pairing of Xq with its homolog inhibits the inversion process, and that therefore the event originates predominantly in male germ cells. In all 21 informative cases in which the inversion originated in a maternal grandparent, DNA polymorphism analysis using markers within or very closely linked to F8, determined that it occurred in the male germline. In addition, all but one of 56 mothers of sporadic cases due to inversions were carriers. The data indicate that the F8 gene inversions leading to severe hemophilia A occur almost exclusively in male germ cells. The mean age of maternal grandfathers at the birth of their carrier daughters was 29.9 years (13 cases), i.e. not different from the mean paternal age in the general population, supporting the hypothesis that the inversions occur in meiosis. The inversions can be diagnosed by Southern blot analysis. For more rapid diagnosis we have used RT-PCR of RNA ectopically expressed in blood. Oligonucleotides were used to PCR amplify, after the initial RT reaction of RNA samples using random hexamers, either the normal transcript (F8 exons 21 to 24;312 bp product) or the novel abnormal transcript that is generated after the inversion. Both type 1 and 2 inversions can be recognized in affecteds and carriers by the presence of the diagnostic PcR product of 248 bp. Correct diagnoses were made in samples from 6 patients and 2 carriers with type 1 inversions, 2 patients and 2 carriers with type 2 inversions and 5 normal controls.

  12. Metabolic regulation analysis of an ethanologenic Escherichia coli strain based on RT-PCR and enzymatic activities

    Directory of Open Access Journals (Sweden)

    Martinez Alfredo

    2008-05-01

    Full Text Available Abstract Background A metabolic regulation study was performed, based upon measurements of enzymatic activities, fermentation performance, and RT-PCR analysis of pathways related to central carbon metabolism, in an ethanologenic Escherichia coli strain (CCE14 derived from lineage C. In comparison with previous engineered strains, this E coli derivative has a higher ethanol production rate in mineral medium, as a result of the elevated heterologous expression of the chromosomally integrated genes encoding PDCZm and ADHZm (pyruvate decarboxylase and alcohol dehydrogenase from Zymomonas mobilis. It is suggested that this behavior might be due to lineage differences between E. coli W and C. Results This study demonstrated that the glycolytic flux is controlled, in this case, by reactions outside glycolysis, i.e., the fermentative pathways. Changes in ethanol production rate in this ethanologenic strain result in low organic acid production rates, and high glycolytic and ethanologenic fluxes, that correlate with enhanced transcription and enzymatic activity levels of PDCZm and ADHZm. Furthermore, a higher ethanol yield (90% of the theoretical in glucose-mineral media was obtained with CCE14 in comparison with previous engineered E. coli strains, such as KO11, that produces a 70% yield under the same conditions. Conclusion Results suggest that a higher ethanol formation rate, caused by ahigher PDCZm and ADHZm activities induces a metabolic state that cells compensate through enhanced glucose transport, ATP synthesis, and NAD-NADH+H turnover rates. These results show that glycolytic enzymatic activities, present in E. coli W and C under fermentative conditions, are sufficient to contend with increases in glucose consumption and product formation rates.

  13. Molecular detection of host cytokine expression in Helicobacter pylori infected patients via semi-quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Hosseini M

    2010-01-01

    Full Text Available Background: Helicobacter pylori (Hp is a bacterium recognised as a main causative agent for the development of chronic active gastritis, peptic ulcer disease, gastric adenocarcinoma and primary gastric lymphoma. Objective: Determination of the levels of IFN-γ (pro-inflammatory and IL-4 (anti inflammatory cytokine expression as indicators of Th1 and Th2 immune responses in gastric cancer (GC and non gastric cancer (Non GC dyspeptic patients by gene specific RT-PCR. Materials and Methods: Biopsy specimens were collected from three groups of gastric cancer (GC=18, non ulcer dyspepsia (NUD = 38 and peptic ulcer patients (PUD=20. Total RNA was extracted and complementary DNA was synthesised. PCR amplification was performed for HPRT, IFN-γ and IL-4 cytokines and the intensity of each band was measured by densitometry and normalized against HPRT expression as a house keeping gene. Results: Comparison of the results from different groups of patients indicated that IFN-γ gene expression was similar in nonGC dyspeptic patients (NUD and PUD groups; 3.38 ± 0.57,3.43 ± 0.41, respectively whereas, in GC patients, it was significantly higher than others (5.52 ± 0.59; P < 0.0001. On the other hand, IL-4 gene expression showed no significant difference between NUD and GC patients (2.81 ± 0.43,2.3 ± 0.12 respectively, whereas the expression rate of this cytokine was significantly higher in PUD patients (3.7 ± 0.1; P 0.05. Our data indicate an association between Th1 and Th2 immune responses and the development of gastric cancer and peptic ulcer disease respectively.

  14. Minimal residual disease monitoring by quantitative RT-PCR in core binding factor AML allows risk stratification and predicts relapse: results of the United Kingdom MRC AML-15 trial.

    Science.gov (United States)

    Yin, John A Liu; O'Brien, Michelle A; Hills, Robert K; Daly, Sarah B; Wheatley, Keith; Burnett, Alan K

    2012-10-04

    The clinical value of serial minimal residual disease (MRD) monitoring in core binding factor (CBF) acute myeloid leukemia (AML) by quantitative RT-PCR was prospectively assessed in 278 patients [163 with t(8;21) and 115 with inv(16)] entered in the United Kingdom MRC AML 15 trial. CBF transcripts were normalized to 10(5) ABL copies. At remission, after course 1 induction chemotherapy, a > 3 log reduction in RUNX1-RUNX1T1 transcripts in BM in t(8;21) patients and a > 10 CBFB-MYH11 copy number in peripheral blood (PB) in inv(16) patients were the most useful prognostic variables for relapse risk on multivariate analysis. MRD levels after consolidation (course 3) were also informative. During follow-up, cut-off MRD thresholds in BM and PB associated with a 100% relapse rate were identified: for t(8;21) patients BM > 500 copies, PB > 100 copies; for inv(16) patients, BM > 50 copies and PB > 10 copies. Rising MRD levels on serial monitoring accurately predicted hematologic relapse. During follow-up, PB sampling was equally informative as BM for MRD detection. We conclude that MRD monitoring by quantitative RT-PCR at specific time points in CBF AML allows identification of patients at high risk of relapse and could now be incorporated in clinical trials to evaluate the role of risk directed/preemptive therapy.

  15. Acetobacter malorum and Acetobacter cerevisiae identification and quantification by Real-Time PCR with TaqMan-MGB probes.

    Science.gov (United States)

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2013-10-01

    The identification and quantification of Acetobacter malorum and Acetobacter cerevisiae in wine and vinegar were performed using the Real-Time PCR (RT-PCR) with two TaqMan-MGB probes designed to amplify the internal transcribed spacer (ITS) region between the 16S-23S rRNA genes. The primers and probes were highly specific, with a detection limit of 10² cells/ml for both species, and the efficiency of the technique was >80%. The RT-PCR technique with these two new TaqMan-MGB probes, together with the five (Acetobacter aceti, Acetobacter pasteurianus, Gluconobacter oxydans, Gluconacetobacter hansenii and Gluconacetobacter europaeus) that are already available (Torija et al., 2010), were validated on known concentrations of Acetic Acid Bacteria (AAB) grown in glucose medium (GY) and in inoculated matrices of wine and vinegar. Furthermore, this technique was applied to evaluate the AAB population in real wine samples collected in the Canary Islands. PCR enrichment performed prior to RT-PCR increased the accuracy of quantification and produced results similar to those detected with SYBR-Green. In real wine samples, the total AAB enumeration ranged from 9 × 10² to 10⁶ cells/ml, and the seven AAB species tested were detected in more than one sample. However, AAB recovery on plates was poor; the isolates obtained on plates were A. malorum, G. oxydans, A. cerevisiae and A. pasteurianus species. RT-PCR with TaqMan-MGB probes is an accurate, specific and fast method for the identification and quantification of AAB species commonly found in wine and vinegar. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Detection and characterization of Leishmania (Leishmania and Leishmania (Viannia by SYBR green-based real-time PCR and high resolution melt analysis targeting kinetoplast minicircle DNA.

    Directory of Open Access Journals (Sweden)

    Marcello Ceccarelli

    Full Text Available Leishmaniasis is a neglected disease with a broad clinical spectrum which includes asymptomatic infection. A thorough diagnosis, able to distinguish and quantify Leishmania parasites in a clinical sample, constitutes a key step in choosing an appropriate therapy, making an accurate prognosis and performing epidemiological studies. Several molecular techniques have been shown to be effective in the diagnosis of leishmaniasis. In particular, a number of PCR methods have been developed on various target DNA sequences including kinetoplast minicircle constant regions. The first aim of this study was to develop a SYBR green-based qPCR assay for Leishmania (Leishmania infantum detection and quantification, using kinetoplast minicircle constant region as target. To this end, two assays were compared: the first used previously published primer pairs (qPCR1, whereas the second used a nested primer pairs generating a shorter PCR product (qPCR2. The second aim of this study was to evaluate the possibility to discriminate among subgenera Leishmania (Leishmania and Leishmania (Viannia using the qPCR2 assay followed by melting or High Resolution Melt (HRM analysis. Both assays used in this study showed good sensitivity and specificity, and a good correlation with standard IFAT methods in 62 canine clinical samples. However, the qPCR2 assay allowed to discriminate between Leishmania (Leishmania and Leishmania (Viannia subgenera through melting or HRM analysis. In addition to developing assays, we investigated the number and genetic variability of kinetoplast minicircles in the Leishmania (L. infantum WHO international reference strain (MHOM/TN/80/IPT1, highlighting the presence of minicircle subclasses and sequence heterogeneity. Specifically, the kinetoplast minicircle number per cell was estimated to be 26,566±1,192, while the subclass of minicircles amplifiable by qPCR2 was estimated to be 1,263±115. This heterogeneity, also observed in canine clinical

  17. Microarray-based identification and RT-PCR test screening for epithelial-specific mRNAs in peripheral blood of patients with colon cancer

    Directory of Open Access Journals (Sweden)

    Coppola Domenico

    2006-10-01

    Full Text Available Abstract Background The efficacy of screening for colorectal cancer using a simple blood-based assay for the detection of tumor cells disseminated in the circulation at an early stage of the disease is gaining positive feedback from several lines of research. This method seems able to reduce colorectal cancer mortality and may replace colonoscopy as the most effective means of detecting colonic lesions. Methods In this work, we present a new microarray-based high-throughput screening method to identifying candidate marker mRNAs for the early detection of epithelial cells diluted in peripheral blood cells. This method includes 1. direct comparison of different samples of colonic mucosa and of blood cells to identify consistent epithelial-specific mRNAs from among 20,000 cDNA assayed by microarray slides; 2. identification of candidate marker mRNAs by data analysis, which allowed selection of only 10 putative differentially expressed genes; 3. Selection of some of the most suitable mRNAs (TMEM69, RANBP3 and PRSS22 that were assayed in blood samples from normal subjects and patients with colon cancer as possible markers for the presence of epithelial cells in the blood, using reverse transcription – polymerase chain reaction (RT-PCR. Results Our present results seem to provide an indication, for the first time obtained by genome-scale screening, that a suitable and consistent colon epithelium mRNA marker may be difficult to identify. Conclusion The design of new approaches to identify such markers is warranted.

  18. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions.

    Directory of Open Access Journals (Sweden)

    Dung Tien Le

    Full Text Available Quantitative RT-PCR can be a very sensitive and powerful technique for measuring differential gene expression. Changes in gene expression induced by abiotic stresses are complex and multifaceted, which make determining stably expressed genes for data normalization difficult. To identify the most suitable reference genes for abiotic stress studies in soybean, 13 candidate genes collected from literature were evaluated for stability of expression under dehydration, high salinity, cold and ABA (abscisic acid treatments using delta CT and geNorm approaches. Validation of reference genes indicated that the best reference genes are tissue- and stress-dependent. With respect to dehydration treatment, the Fbox/ABC, Fbox/60s gene pairs were found to have the highest expression stability in the root and shoot tissues of soybean seedlings, respectively. Fbox and 60s genes are the most suitable reference genes across dehydrated root and shoot tissues. Under salt stress the ELF1b/IDE and Fbox/ELF1b are the most stably expressed gene pairs in roots and shoots, respectively, while 60s/Fbox is the best gene pair in both tissues. For studying cold stress in roots or shoots, IDE/60s and Fbox/Act27 are good reference gene pairs, respectively. With regard to gene expression analysis under ABA treatment in either roots, shoots or across these tissues, 60s/ELF1b, ELF1b/Fbox and 60s/ELF1b are the most suitable reference genes, respectively. The expression of ELF1b/60s, 60s/Fbox and 60s/Fbox genes was most stable in roots, shoots and both tissues, respectively, under various stresses studied. Among the genes tested, 60s was found to be the best reference gene in different tissues and under various stress conditions. The highly ranked reference genes identified from this study were proved to be capable of detecting subtle differences in expression rates that otherwise would be missed if a less stable reference gene was used.

  19. VEGF system expression by immunohistochemistry and real-time RT-PCR study on collared peccary placenta

    DEFF Research Database (Denmark)

    Santos, Tatiana C.; Oliveira, Moacir F.; Papa, Paula C.

    2014-01-01

    Vascular endothelial growth factor (VEGF) is known to induce endothelial cell proliferation, to promote cell migration, and to inhibit apoptosis, thus playing a central role in angiogenesis and in the regulation of vasculogenesis. The expression of the VEGF-ligand receptor system was studied in t...

  20. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Department of Molecular Oncology, Cancer Institute (WIA) 38, Sardar Patel Road, Chennai 600 036, India; Department of Biotechnology, Dr M. G. R. Educational and Research Institute, Dr M. G. R. University, Maduravoyal, Chennai 600 095, India; Department of Hemato Immunology, Cancer Institute (WIA) 38, Sardar Patel ...

  1. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... Chromosomal translocation is the hallmark of leukaemias and acute lymphoblastic leukaemia (ALL) in particular. DNA damage arises from endogenous and exogenous geno- toxic factors and lack of complete fidelity in DNA-repair leads to chromosomal translocations (Greaves and Wiemels. 2003; Zhang ...

  2. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... types and make them a unique biological entity (Armstrong et al. 2002). A study of 259 pre-B ALL samples from two major can- cer centres in India revealed 5% of mBCR-ABL, 7% of. E2A-PBX1 and TEL-AML1 fusion gene respectively with the absence of MLL-AF4 (Siraj et al. 2002). Sazawal et al. (2004).

  3. Quantification of dissimilatory (bi)sulphite reductase gene expression in Desulfobacterium autotrophicum using real-time RT-PCR

    DEFF Research Database (Denmark)

    Neretin, LN; Schippers, A.; Pernthaler, A.

    2003-01-01

    was 2.0 to 4.1-fold higher during sulphate or thiosulphate respiration than during pyruvate fermentation. After transfer of a pyruvate-fermenting culture into sulphate-rich medium, upregulation of the DSR mRNA content was observed. Irrespective of the mode of metabolism the per-cell DSR mRNA content...... changed significantly during growth (up to 310-fold from the early to the late exponential phase during respiration with thiosulphate). The maximum DSR mRNA per-cell contents correlated with cell-specific sulphate reduction rates for all experiments. Environmental applications for the quantification...

  4. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    Dengue fever and the more severe form of the disease, dengue hemorrhagic fever, occurs in tropical and subtropical regions globally through infection by one or more of four viral serotypes, DEN-1, DEN-2, DEN-3 and DEN-4...

  5. Diagnóstico temprano del Virus Dengue 1 usando RT-PCR y perspectivas para la caracterización molecular de Cepas Autóctonas

    Directory of Open Access Journals (Sweden)

    C Yábar

    1999-01-01

    Full Text Available Un sistema de diagnóstico para la detección temprana del virus Dengue 1 fue llevado a cabo exitosamente usando la reacción en cadena por polimerasa de transcriptasa reversa (RT-PCR, a través de la amplificación de una porción genómica del gen NS1. Los resultados obtenidos, a partir de muestras clínicas, corroboraron los datos de anteriores trabajos de RT-PCR dirigidos hacia la región estructural del virión. Posteriormente el ADNc del virus Dengue, correspondiente a una de las muestras serológicas, fue clonado y secuenciado. La comparación por análisis de secuencia nucleotídica con otras cepas referenciales determinó que la cepa viral correspondía al serotipo 1.

  6. MULTI INFEKSI PADA UDANG Litopenaeus vannamei : DIAGNOSIS DENGAN POLYMERASE CHAIN REACTION (PCR) DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR)

    OpenAIRE

    Isti Koesharyani; Lila Gardenia; Hambali Supriyadi

    2012-01-01

    Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi), penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR) dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR) menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MB...

  7. An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

  8. RT-PCR versus immunohistochemistry for correlation and quantification of ERCC1, BRCA1, TUBB3 and RRM1 in NSCLC

    DEFF Research Database (Denmark)

    Vilmar, Adam Christian; Garcia-Foncillas, J; Huarriz, M

    2012-01-01

    Customized chemotherapy is increasingly used in the management of patients with advanced non-small cell lung cancer (NSCLC). However, the most reliable methodology to determine biomarker status is neither fully elucidated nor agreed upon. Accordingly, we evaluated the predictive efficiency of q......RT-PCR and immunohistochemical analysis (IHC) on excision cross complementation group 1 (ERCC1), breast cancer susceptibility gene 1 (BRCA1), ribonucleotide reductase subunit M1 (RRM1) and class III ß-tubulin (TUBB3)....

  9. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and

  10. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  11. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  12. Impact of coccidial infection on vaccine- and vvIBDV in lymphoid tissues of SPF chickens as detected by RT-PCR

    Directory of Open Access Journals (Sweden)

    Bisgaard Magne

    2006-09-01

    Full Text Available Abstract Background This study aimed at investigating a potential effect caused by coccidia on the immune response to vaccine- and very virulent infectious bursal disase virus (vvIBDV in SPF chickens. Methods Two groups of three weeks old SPF chickens were vaccinated prior to inoculation with coccidia and challenge with virulent IBDV, all within a period of eight days. Two control groups were similarly treated, except that challenge with field virus was omitted in one group while inoculation with coccidia was omitted in the other group. Clinical signs, lesions in the intestines caused by coccidia, lesions in the bursa of Fabricius caused by IBDV, IBDV-antibody titres, and virus detection by reverse transcription polymerase chain reaction (RT-PCR were compared among the groups. Lymphoid tissues and swab samples were analysed by general RT-PCR, and positive results were identified by strain specific duplex (DPX RT-PCR. Results In the tripple-infected groups, vaccine strain IBDV was detected in spleen and thymus tissues, and no field virus was detected in bursa samples, contrary to the double-infected groups. Conclusion The results suggest an enhancing effect on the immune response caused by subclinical coccidiosis and vvIBDV acting in concert.

  13. Localisation of Abundant and Organ-Specific Genes Expressed in Rosa hybrida Leaves and Flower Buds by Direct In Situ RT-PCR

    Directory of Open Access Journals (Sweden)

    Agata Jedrzejuk

    2012-01-01

    Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.

  14. The RT-PCR identification and sequence analysis of Apple chlorotic leaf spot virus from apple cultivars in Jiaodong Peninsula, China.

    Science.gov (United States)

    Hu, Dechang; Wang, Lei; Jiang, Xiaoman; Wang, Ning; Gu, Liang

    2014-03-04

    A set of specific primer pairs was utilized to detect Apple chlorotic leaf spot virus (ACLSV) from seven different apple cultivars in Jiaodong Peninsula via reverse transcription polymerase chain reaction (RT-PCR), and the sequence of ACLSV genome was analysed. The results indicate that: (1) High-purity total RNA could be successfully isolated using plant RNA rapid extraction kit. The ratios of A 260 /A 280 varied between 1.8 and 2.1. The fragmentation in agarose gel was good and the 28S and 16S bands were clear, which suggested that the extracted RNA had better quality and could be used for RT-PCR. (2) The amplified products by RT-PCR were approximately 220 bp, which showed the tested samples were infected by ACLSV in this study. (3) Sequencing analysis showed that the lengths of the target fragments were 217 bp, and the sequence identity rate ranged from 85.7% to 99.1% at the nucleotide level aligned with the corresponding sequences of other ACLSV strains in National Center for Biotechnology Information.

  15. Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes

    Directory of Open Access Journals (Sweden)

    Nie Jingbai

    2010-02-01

    Full Text Available Abstract Potato virus M (PVM, Carlavirus is considered to be one of the most common potato viruses distributed worldwide. Sequences of the coat protein (CP gene of several Canadian PVM isolates were determined. Phylogenetic analysis indicated that all known PVM isolates fell into two distinct groups and the isolates from Canada and the US clustered in the same group. The Canadian PVM isolates could be further divided into two sub-groups. Two molecular procedures, reverse transcription - polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP were developed in this study for the detection and identification of PVM in potato tubers. RT-PCR was highly specific and only amplified PVM RNA from potato samples. PVM RNAs were easily detected in composite samples of 400 to 800 potato leaves or 200 to 400 dormant tubers. Restriction analysis of PCR amplicons with MscI was a simple method for the confirmation of PCR tests. Thus, RT-PCR followed by RFLP analysis may be a useful approach for screening potato samples on a large scale for the presence of PVM.

  16. Diagnóstico temprano en un brote epidémico del virus Dengue en Piura usando RT-PCR y nested-PCR

    Directory of Open Access Journals (Sweden)

    Oscar Nolasco

    1997-07-01

    Full Text Available Un test de diagnóstico temprano (RT-PCR y Nested-PCR fue evaluado y comparado con métodos convencionales (cultivo in vitro, IFI y MAC-ELISA. Treinta y cuatro sueros de pacientes correspondientes de un brote epidémico de la costa norte peruana (Mancora, Piura en mayo de 1997 fueron incluidos en este estudio. Todos los sueros fueron obtenidos de pacientes que presentaron en los primeros cinco días manifestaciones clínicas siendo diagnosticados luego como dengue serotipo 1. Asimismo, RT-PCR permitió diagnosticar 82% de los sueros (28/34, sin embargo Mac-ELISA y cultivo in vitro reconocieron unicamente 41% de los sueros (14/34 y 38% de los sueros (13/34 respectivamente. Por lo tanto, el uso de esta herramienta molecular (RT-PCR y Nested-PCR permitiró dar un diagnóstico temprano a estos pacientes y actuar inmediatamente ante la presencia de un brote epidémico.

  17. Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    Directory of Open Access Journals (Sweden)

    C.M.S. Gebara

    2004-08-01

    Full Text Available A presença do vírus da cinomose canina (CDV foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR, em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1% das 87 amostras de urina provenientes de cães com sinais clínicos sugestivos de cinomose. Todas as amostras obtidas de animais assintomáticos foram negativas na RT-PCR. Amostras positivas foram encontradas nos três grupos de animais com sinais clínicos na proporção de 51,2% (24/41, 29% (11/37 e 100% (9/9 para os grupos A, B e C, respectivamente. A leucocitose foi a alteração hematológica mais freqüente nos três grupos de cães com sinais clínicos porém, não foi possível estabelecer correlação entre o resultado da RT-PCR e as alterações hematológicas. Os resultados demonstraram que, independente da forma de apresentação clínica, a técnica da RT-PCR realizada em urina pode ser utilizada no diagnóstico ante mortem da infecção pelo CDV.The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control included 20 assymptomatic dogs. A chi2

  18. An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    Directory of Open Access Journals (Sweden)

    Miyazawa Takayuki

    2010-12-01

    Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.

  19. RT-PCR Analysis of ED-A,ED-B, and IIICS Fibronectin Domains: A New Screening Marker For Bladder Cancer

    Directory of Open Access Journals (Sweden)

    M Ahmadi Javid

    2004-12-01

    Full Text Available Background: Fibronectin seems to play a very important role in the progression and invasion of bladder cancer. EDA, EDB, and IIICS domains of fibronectin are not expressed in the adult persons but they’re expressed in different cancers. The aim of this study is to investigate the mRNA of fibronectin in transitional carcinoma cells (TCC of bladder to study these domains. Methods: A total of 20 patients with known bladder cancer were studied. Two of them excluded since their excised tissues were not enough for both the pathological examination and RNA study. Another 20 (control group were normal volunteers who needed bladder operations. The excised tissue was immediately transferred to RNAlater (Ambion,TX. RNA was extracted via RNAWIZ (Ambion, TX. cDNA was made via RevertAid First Strand cDNA Synthesis Kit (Fermentas. PCR of the cDNAs was performed using primers for EDA, EDB, and IIICS (Eurogentec,Belgium. Results: For the first time, we present the expression of the oncofetal fibronectin mRNA in the transitional cell carcinoma of bladder. The high grade muscle invasive (G3T2 tumor, expressed ED-A, ED-B, and IIICS. Expression of ED-A, ED-B, and IIICS was confirmed in the two patients with G3T1 TCC. The four patients with G2Ta and G3Ta expressed both ED-A and ED-B. The four patients with G1T1 tumor expressed ED-A only, similar to the nine patients with G1Ta tumor. None of the normal volunteers expressed the oncofetal extra domains. The sensitivity of ED-A positive fibronectin RNA for detecting TCC of any kind is 100%, and of ED-B was only 35%. The specificity of ED-B positive fibronectin RNA for the high grade TCC is 100%. Conclusion: ED-A, ED-B, and IIICS could be used as useful markers for the diagnosis and following up of bladder carcinoma. Keywords: Transitional Cell Carcinoma, bladder cancer, fibronectin, RT-PCR, oncofetal.

  20. Detection of potato mop-top virus in soils and potato tubers using bait-plant bioassay, ELISA and RT-PCR.

    Science.gov (United States)

    Arif, Muhammad; Ali, Murad; Rehman, Anayatur; Fahim, Muhammad

    2014-01-01

    The hilly region of Northwest of Pakistan is leading seed potato producing areas of the country. Soil and plant samples were collected from the region and tested for PMTV using both conventional and molecular techniques. The bait plants exhibited PMTV-characteristic v-shaped yellow leaf markings in Nicotiana debneyi plants grown in putative viruliferious soils from 20/26 locations. The results were confirmed by back inoculation of sap from both roots and leaves of bait plant on indicator hosts (N. debneyi, Nicotiana benthamiana). The root samples of bait plants grown in soils of 25 locations and leaves of 24 locations reproduced systemic infection on indicator hosts upon back inoculation. The virus was identified in bait plants grown in soils from 25/26 locations using double antibody sandwich-enzyme linked immunosorbent assay (DAS)-ELISA and reverse transcription and polymerase chain reaction (RT-PCR) methods. The products of the 566bp were amplified from coat protein region of PMTV RNA 3 in both root and leaf samples of baited plants. The virus was detected in 10 potato cultivars commercially grown in the region using DAS-ELISA and RT-PCR. The virus was also detected in zoospores of Spongospora subterranea derived from the peels of selected scabby tubers using triple antibody sandwich (TAS)-ELISA. The results indicate that a bait plant bioassay, infectivity assay, ELISA and RT-PCR can detect PMTV in roots and leaves of baited plants, field samples, zoospores of S. subterranea and tubers of 10 potato cultivars commercially grown in the region. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism...... analysis. The method was used to compare ORF 1 sequences of two divergent European-type PRRSV strains. Our results indicated that the structural and replicase parts of these two strains had evolved at overall similar rates....

  2. Immunocapture RT-PCR detection of Bean common mosaic virus and strain blackeye cowpea mosaic in common bean and black gram in India

    DEFF Research Database (Denmark)

    Udayashankar, A.C.; Nayaka, S. Chandra; Niranjana, S.R.

    2012-01-01

    The strains of Bean common mosaic virus (BCMV) and blackeye cowpea mosaic (BICM), genus Potyvirus, were detected from 25 common bean and 14 black gram seeds among 142 seed samples collected from different legume-growing regions of India. The samples were subjected to a growing-on test, an indicator...... plant test, an electron microscopic observations, an enzyme linked immunosorbent assay and an immunocapture RT-PCR. The incidence of the two tested viruses in common bean and black gram seed samples was 1–6% and 0.5–3.5%, respectively in growing-on test evaluations. Electron microscopic observations...

  3. Detección y cuantificación del Potato mop-top virus (PMTV en Colombia mediante qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nevar García Bastidas

    2013-04-01

    Full Text Available El Potato mop-top virus (PMTV es uno de los virus re-emergentes en cultivos de papa en Colombia. Es transmitido por Spongospora subterranea, el agente causal de la sarna polvosa. La detección del PMTV presenta dificultades debido a su distribución irregular en las plantas, bajo título y movimiento sistémico como ARN desnudo. Con el fin de ampliar el rango de herramientas disponibles para detectar el PMTV en los programas de certificación de tubérculo-semilla, en este estudio se evaluó la prueba de RT-PCR en tiempo real (qRT-PCR en dos pasos: con los cebadores PMTV-1948F/PMTV-2017R y la sonda Taqman® PMTV-1970, dirigidos al gen CP-RT del ARN2 viral. Se construyó una curva estándar a partir de la transcripción in vitro de un fragmento de 1513 pb de este gen. Posteriormente, se evaluó la utilidad de la técnica a partir de tres tipos de muestras: plantas señuelo de Nicotiana benthamiana y Solanum phureja inoculadas con quistosoros de Sss, raíces de papa con síntomas de sarna polvosa del municipio de La Unión (Antioquia y tubérculos-semilla. Mediante qRT-PCR fue posible detectar el virus en 11 de las 20 muestras de raíz de plantas señuelo, mientras que 14 de las 15 muestras de raíces de papa resultaron positivas, estimándose una concentración entre 4.72 x 10(11 y 7.60 x 10(13 partículas virales/µl. Adicionalmente, en el ensayo de tubérculo-semilla se determinó la presencia del PMTV en una de las 16 muestras. Estos resultados indican la viabilidad de utilizar rutinariamente la técnica de qRT-PCR para la detección de PMTV en Colombia.

  4. Genomic signature-based identification of influenza A viruses using RT-PCR/electro-spray ionization mass spectrometry (ESI-MS technology.

    Directory of Open Access Journals (Sweden)

    Varough M Deyde

    Full Text Available BACKGROUND: The emergence and rapid spread of the 2009 H1N1 pandemic influenza A virus (H1N1pdm in humans highlights the importance of enhancing the capability of existing influenza surveillance systems with tools for rapid identification of emerging and re-emerging viruses. One of the new approaches is the RT-PCR electrospray ionization mass spectrometry (RT-PCR/ESI-MS technology, which is based on analysis of base composition (BC of RT-PCR amplicons from influenza "core" genes. Combination of the BC signatures represents a "genomic print" of an influenza A virus. METHODOLOGY/PRINCIPAL FINDINGS: Here, 757 samples collected between 2006 and 2009 were tested, including 302 seasonal H1N1, 171 H3N2, 7 swine triple reassortants, and 277 H1N1pdm viruses. Of the 277 H1N1pdm samples, 209 were clinical specimens (throat, nasal and nasopharyngeal swabs, nasal washes, blood and sputum. BC signatures for the clinical specimen from one of the first cases of the 2009 pandemic, A/California/04/2009, confirmed it as an unusual, previously unrecognized influenza A virus, with "core" genes related to viruses of avian, human and swine origins. Subsequent analysis of additional 276 H1N1pdm samples revealed that they shared the genomic print of A/California/04/2009, which differed from those of North American swine triple reassortant viruses, seasonal H1N1 and H3N2 and other viruses tested. Moreover, this assay allowed distinction between "core" genes of co-circulating groups of seasonal H1N1, such as clades 2B, 2C, and their reassortants with dual antiviral resistance to adamantanes and oseltamivir. CONCLUSIONS/SIGNIFICANCE: The RT-PCR/ESI-MS assay is a broad range influenza identification tool that can be used directly on clinical specimens for rapid and accurate detection of influenza virus genes. The assay differentiates the H1N1pdm from seasonal and other nonhuman hosts viruses. Although not a diagnostic tool, this assay demonstrates its usefulness and

  5. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    Science.gov (United States)

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-02-27

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

  6. Survey of Cherry necrotic rusty mottle virus and Cherry green ring mottle virus incidence in Korea by Duplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Seung-Yeol Lee

    2014-12-01

    Full Text Available The incidence of Cherry necrotic rusty mottle virus (CNRMV and Cherry green ring mottle virus (CGRMV have recently been occurred in Korea, posing a problem for sweet cherry cultivation. Since infected trees have symptomless leaves or ring-like spots on the pericarp, it is difficult to identify a viral infection. In this study, the incidence of CNRMV and CGRMV in sweet cherry in Gyeongbuk province was surveyed using a newly developed duplex reverse transcriptase polymerase chain reaction (RT-PCR method that can detect both viruses in a single reaction. CNRMV and CGRMV co-infection rates were 29.6%, 53.6%, and 17.6%, respectively, in samples collected from three different sites (Daegu, Gyeongju and Gyeongsan in Gyeongbuk province during 2012 and 2013. This duplex RT-PCR method offers a simple, rapid, and effective way of identifying CNRMV and CGRMV simultaneously in sweet cherry trees, which can aid in the management of viral infections that could undermine yield.

  7. Identification and Characterization of Lipopeptides from Bacillus subtilis B1 Against Sapstain Fungus of Rubberwood Through MALDI-TOF-MS and RT-PCR.

    Science.gov (United States)

    Sajitha, K L; Dev, Suma Arun; Maria Florence, E J

    2016-07-01

    Bacillus subtilis is a potent biocontrol agent producing a wide array of antifungal lipopeptides for the inhibition of fungal growth. B. subtilis B1 isolated from market-available compost provided an efficient control of rubberwood sapstain fungus, Lasiodiplodia theobromae. The current study is aimed to identify and characterize the lipopeptides responsible for the biocontrol of rubberwood sapstain fungus by Bacillus subtilis B1. The bacterial whole-cell surface extract from the dual culture of B. subtilis B1 and sapstain fungus (L. theobromae) was analysed using MALDI-TOF-MS. The protonated as well as sodium, potassium adducts of homologues of iturin C, surfactin, bacillomycin D and fengycin A and B were identified and expression of the lipopeptide biosynthetic genes could be confirmed through RT-PCR. This is the first report of mycobacillin and trimethylsilyl derivative of bacilysin during antagonism through MALDI-TOF-MS. MALDI-TOF-MS with RT-PCR offered easy platforms to characterize the antifungal lipopeptides. The identification of antifungal lipopeptides can lead to the formulation of prospective biocontrol by-products which have wide-scale utility.

  8. Sensitive Detection of Measles Virus Infection in the Blood and Tissues of Humanized Mouse by One-step Quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Shota eIkeno

    2013-10-01

    Full Text Available Live attenuated measles virus (MV has long been recognized as a safe and effective vaccine, and it has served as the basis for development of various MV-based vaccines. However, because MV is a human-tropic virus, the evaluation of MV-based vaccines has been hampered by the lack of a small-animal model. The humanized mouse, a recently developed system in which an immunodeficient mouse is transplanted with human fetal tissues or hematopoietic stem cells, may represent a suitable model. Here, we developed a sensitive one-step quantitative reverse transcription (qRT PCR that simultaneously measures nucleocapsid (N and human RNase P mRNA levels. The results can be used to monitor MV infection in a humanized mouse model. Using this method, we elucidated the replication kinetics of MV expressing EGFP both in vitro and in humanized mice in parallel with flow-cytometric analysis. Because our qRT-PCR system was sensitive enough to detect MV expression using RNA extracted from a small number of cells, it can be used to monitor MV infection in humanized mice by sequential blood sampling.

  9. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Song

    2016-05-01

    Full Text Available Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is a rapid and sensitive method for analyzing microRNA (miRNA expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA, salicylic acid (SA and abscisic acid (ABA, respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  10. [Identification of Env-specific monoclonal antibodies from Chinese HIV-1 infected person by magnetic beads separating B cells and single cell RT-PCR cloning].

    Science.gov (United States)

    Huang, Xiang-Ying; Yu, Shuang-Qing; Cheng, Zhan; Ye, Jing-Rong; Xu, Ke; Feng, Xia; Zeng, Yi

    2013-04-01

    To establish a simple and practical method for screening of Env-specific monoclonal antibodies from HIV-1 infected individuals. Human B cells were purified by negative sorting from PBMCs and memory B cells were further enriched using anti-CD27 microbeads. Gp120 antigen labbled with biotin was incubated with memory B cells to specifically bind IgG on cells membrane. The memory B cells expressing the Env-specific antibody were harvested by magnetic beads separating, counted and diluted to the level of single cell in each PCR well that loading with catch buffer containing RNase inhibitor to get RNAs. The antibody genes were amplified by single cell RT-PCR and nested PCR, cloned into eukaryotic expression vectors and transfected into 293T cells. The binding activity of recombinant antibodies to Env were tested by ELISA. Three monocolonal Env-specific antibodies were isolated from one HIV-1 infected individual. We can obtain Env-specific antibody by biotin labbled antigen, magnetic beads separating technique coupled with single cell RT-PCR and expression cloning.

  11. Identification by real-time PCR with SYBR Green of Leishmania spp. and Serratia marcescens in canine 'sterile' cutaneous nodular lesions.

    Science.gov (United States)

    Cornegliani, Luisa; Corona, Antonio; Vercelli, Antonella; Roccabianca, Paola

    2015-06-01

    Noninfectious, non-neoplastic, nodular to diffuse, so-called 'sterile' granulomatous/pyogranulomatous skin lesions (SGPSLs) are infrequently identified in dogs and may represent a diagnostic challenge. Their correct identification is based on history, histopathology and absence of intralesional foreign bodies and micro-organisms. The aim of this study was to investigate the presence of Leishmania spp., Mycobacterium spp., Serratia marcescens and Nocardia spp. by real-time PCR in canine nodular skin lesions histologically diagnosed as putatively sterile. Formalin-fixed skin biopsies were collected from 40 dogs. All samples were associated with an SGPSL diagnosis characterized by multifocal, nodular to diffuse, periadnexal and perifollicular pyogranulomas/granulomas. Neither micro-organisms nor foreign bodies were detected with haematoxylin and eosin staining, under polarized light. Further analyses included periodic acid Schiff, Ziehl-Neelsen, Fite Faraco, Giemsa and Gram histochemical stains; anti-Bacillus Calmette-Guérin (BCG) and Leishmania spp. immunohistochemistry; and real-time PCR analysis for Leishmania spp., Mycobacterium spp., S. marcescens and Nocardia spp. Special stains and BCG/immunohistochemistry were negative in all samples. Real-time PCR was positive for Leishmania spp. in four of 40 biopsies and for S. marcescens in two of 40 samples. Real-time PCR for Mycobacterium spp. and Nocardia spp. was negative. No correlation between real-time PCR positivity and a specific histological pattern was identified. Leishmania spp. have been previously identified as possible agents of certain SGPSLs, while the involvement of S. marcescens has not been investigated previously. According to our findings, Serratia spp. should be included in the list of agents possibly associated with a subgroup of granulomatous/pyogranulomatous skin lesions in dogs. © 2015 ESVD and ACVD.

  12. Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

    Science.gov (United States)

    Gentilini, Fabio; Turba, Maria E

    2014-01-01

    A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Quantitative detection and differentiation of free-living amoeba species using SYBR green-based real-time PCR melting curve analysis.

    Science.gov (United States)

    Behets, Jonas; Declerck, Priscilla; Delaedt, Yasmine; Verelst, Lieve; Ollevier, Frans

    2006-12-01

    Real-time polymerase chain reaction melting curve analysis (MCA) allows differentiation of several free-living amoebae species. Distinctive characteristics were found for Naegleria fowleri, N. lovaniensis, N. australiensis, N. gruberi, Hartmanella vermiformis, and Willaertia magna. Species specificity of the amplicons was confirmed using agarose gel electrophoresis and sequence-based approaches. Amplification efficiency ranged from 91% to 98%, indicating the quantitative potential of the assay. This MCA approach can be used for quantitative detection of free-living amoebae after cultivation but also as a culture-independent detection method.

  14. A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

    2014-06-01

    Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

  15. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  16. Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome.

    Science.gov (United States)

    Shen, Haoran; Liang, Zhou; Zheng, Saihua; Li, Xuelian

    2017-11-01

    The purpose of this study was to identify promising candidate genes and pathways in polycystic ovary syndrome (PCOS). Microarray dataset GSE345269 obtained from the Gene Expression Omnibus database includes 7 granulosa cell samples from PCOS patients, and 3 normal granulosa cell samples. Differentially expressed genes (DEGs) were screened between PCOS and normal samples. Pathway enrichment analysis was conducted for DEGs using ClueGO and CluePedia plugin of Cytoscape. A Reactome functional interaction (FI) network of the DEGs was built using ReactomeFIViz, and then network modules were extracted, followed by pathway enrichment analysis for the modules. Expression of DEGs in granulosa cell samples was measured using quantitative RT-PCR. A total of 674 DEGs were retained, which were significantly enriched with inflammation and immune-related pathways. Eight modules were extracted from the Reactome FI network. Pathway enrichment analysis revealed significant pathways of each module: module 0, Regulation of RhoA activity and Signaling by Rho GTPases pathways shared ARHGAP4 and ARHGAP9; module 2, GlycoProtein VI-mediated activation cascade pathway was enriched with RHOG; module 3, Thromboxane A2 receptor signaling, Chemokine signaling pathway, CXCR4-mediated signaling events pathways were enriched with LYN, the hub gene of module 3. Results of RT-PCR confirmed the finding of the bioinformatic analysis that ARHGAP4, ARHGAP9, RHOG and LYN were significantly upregulated in PCOS. RhoA-related pathways, GlycoProtein VI-mediated activation cascade pathway, ARHGAP4, ARHGAP9, RHOG and LYN may be involved in the pathogenesis of PCOS.

  17. Serotype specific primers and gel-based RT-PCR assays for 'typing' African horse sickness virus: identification of strains from Africa.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available African horse sickness is a devastating, transboundary animal disease, that is 'listed' by the Office International des Epizooties (OIE. Although attenuated, inactivated and subunit vaccines have been developed for African horse sickness virus (AHSV, these are serotype-specific and their effective deployment therefore relies on rapid and reliable identification of virus type. AHSV serotype is controlled by the specificity of interactions between neutralising antibodies, and components of the outer-capsid, particularly protein VP2 (encoded by AHSV genome segment 2 (Seg-2. We report the development and evaluation of novel gel based reverse transcription-PCR (RT-PCR assays targeting AHSV Seg-2, which can be used to very significantly increase the speed and reliability of detection and identification (compared to virus neutralisation tests of the nine serotypes of AHSV. Primer sets were designed targeting regions of Seg-2 that are conserved between strains within each of the AHSV serotype (types 1 to 9. These assays were evaluated using multiple AHSV strains from the orbivirus reference collection at IAH (www.reoviridae.org/dsRNA_virus_proteins/ReoID/AHSV-isolates.htm. In each case the Seg-2 primers showed a high level of specificity and failed to cross-amplify the most closely related heterologous AHSV types, or other related orbiviruses (such as bluetongue virus (BTV, or equine encephalosis virus (EEV. The assays are rapid and sensitive, and can be used to detect and type viral RNA in blood, tissue samples, or cultivated viral suspensions within 24 h. They were used to identify AHSV strains from recent outbreaks in sub-Saharan African countries. These methods also generate cDNAs suitable for sequencing and phylogenetic analyses of Seg-2, identifying distinct virus lineages within each virus-type and helping to identify strain movements/origins. The RT-PCR methods described here provide a robust and versatile tool for rapid and specific detection

  18. Application of NeuroTrace staining in the fresh frozen brain samples to laser microdissection combined with quantitative RT-PCR analysis.

    Science.gov (United States)

    Benner, Seico; Kakeyama, Masaki; Endo, Toshihiro; Yoshioka, Wataru; Tohyama, Chiharu

    2015-06-20

    The heterogeneity of the brain requires appropriate molecular biological approaches to account for its morphological complexity. Laser-assisted microdissection followed by transcript profiling by quantitative determination has been reported to be an optimal methodology. Nevertheless, not all brain regions can be identified easily without staining, restricting the accuracy and efficiency in sampling. The aim of the present study was to validate whether fixation and staining treatments are suitable for quantitative transcript expression analysis in laser microdissection (LMD) samples. Quantitative RT-PCR was used to determine the absolute transcript expression levels and profiles of samples obtained from the hippocampal dentate gyrus from fresh frozen mice brain sections that had been fixed with ethanol and stained with NeuroTrace. The results were compared with those obtained from unfixed and unstained samples. We found that the quantitative relationship of transcript expression levels between various housekeeping genes and immediate early genes was preserved, although the preparation compromised the yield of the transcripts. In addition, histological and molecular integrities of the fixed and stained specimens were preserved for at least a week at room temperature. Based on the lobe specific profiles of transcripts in the anterior and posterior lobes of the pituitary, we confirmed that no cross-contamination on transcription expressions occurred as a result of the fixation and staining. We have provided detailed information of the procedures on ethanol fixation followed by NeuroTrace staining on the absolute quantitative RT-PCR analysis using microdissected fresh frozen mouse brain tissues. The present study demonstrated that quantitative transcript expression analysis can be conducted reliably on stained tissues. This method is suitable for applications in basic and clinical studies on particular transcript expressions in various regions of the brain.

  19. Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

    Directory of Open Access Journals (Sweden)

    Timotijević Gordana S.

    2015-01-01

    Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

  20. Detection of five potentially periodontal pathogenic bacteria in peri-implant disease: A comparison of PCR and real-time PCR.

    Science.gov (United States)

    Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk

    2016-07-01

    The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

    Directory of Open Access Journals (Sweden)

    Bukina Y.V.

    2016-06-01

    Full Text Available Introduction. The problem of formation of bacterial resistance to glycopeptides and beta-lactam antibiotics (cephalosporins and carbapenems are used worldwide for the treatment of severe community acquired and nosocomial infections, especially caused by polymicrobial flora has become global and is a major factor limiting the effectiveness of antibiotic therapy. In this regard, the study of genetic microbial resistance determinants allows not only to carry out an effective antibiotic therapy, but also to identify two main processes leading to the development of epidemiologically significant events: the introduction of the agent in the risk population from the outside and in situ pathogen (spontaneous genetic drift targeted restructuring of the population. Therefore, the aim of our study was to investigate the resistance genes to carbapenems, cephalosporins, glycopeptides have clinically important phenotype of resistant strains of microorganisms families Enterobacteriaceae, Pseudomonadaceae, Bacteroidaceae, Enterococcaceae, Peptostreptococcaceae. Materials and methods. As a material for PCR studies 712 phenotypically resistant strains of microorganisms isolated from 80 rats "Wistar" line in microbiological study microflora of the wall were used. During the investigation 474 isolates of bacteria of the family Enterobacteriaceae, 39 - Pseudomonadaceae, 71 - Bacteroidaceae, 96 - Enterococcaceae, 32 - Peptostreptococcaceae were studied. Isolation of DNA from bacteria in the study was performed using reagents "DNA-Express" ("Litekh", Russia. For the detection of resistance genes by PCR in real time (RT-PCR reagent kits "FLUOROPOL-RV" ("Litekh", Russia were used. During the experiment, the VIM genes, OXA-48, NDM, KPC, responsible for the resistance of microorganisms to carbapenems, CTX-M - resistance to cephalosporins, as well as genes Van A and van B, the development of resistance to glycopeptides (vancomycin and teicoplanin were determined. Analysis

  2. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  3. Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86.

    Science.gov (United States)

    Nijhof, Ard M; Balk, Jesper A; Postigo, Milagros; Jongejan, Frans

    2009-12-29

    For accurate and reliable gene expression analysis, normalization of gene expression data against reference genes is essential. In most studies on ticks where (semi-)quantitative RT-PCR is employed, normalization occurs with a single reference gene, usually beta-actin, without validation of its presumed expression stability. The first goal of this study was to evaluate the expression stability of commonly used reference genes in Rhipicephalus appendiculatus and Rhipicephalus (Boophilus) microplus ticks. To demonstrate the usefulness of these results, an unresolved issue in tick vaccine development was examined. Commercial vaccines against R. microplus were developed based on the recombinant antigen Bm86, but despite a high degree of sequence homology, these vaccines are not effective against R. appendiculatus. In fact, Bm86-based vaccines give better protection against some tick species with lower Bm86 sequence homology. One possible explanation is the variation in Bm86 expression levels between R. microplus and R. appendiculatus. The most stable reference genes were therefore used for normalization of the Bm86 expression profile in all life stages of both species to examine whether antigen abundance plays a role in Bm86 vaccine susceptibility. The transcription levels of nine potential reference genes: beta-actin (ACTB), beta-tubulin (BTUB), elongation factor 1alpha (ELF1A), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), glutathione S-transferase (GST), H3 histone family 3A (H3F3A), cyclophilin (PPIA), ribosomal protein L4 (RPL4) and TATA box binding protein (TBP) were measured in all life stages of R. microplus and R. appendiculatus. ELF1A was found to be the most stable expressed gene in both species following analysis by both geNorm and Normfinder software applications, GST showed the least stability. The expression profile of Bm86 in R. appendiculatus and R. microplus revealed a more continuous Bm86 antigen abundance in R. microplus throughout its one

  4. Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86

    Directory of Open Access Journals (Sweden)

    Jongejan Frans

    2009-12-01

    Full Text Available Abstract Background For accurate and reliable gene expression analysis, normalization of gene expression data against reference genes is essential. In most studies on ticks where (semi-quantitative RT-PCR is employed, normalization occurs with a single reference gene, usually β-actin, without validation of its presumed expression stability. The first goal of this study was to evaluate the expression stability of commonly used reference genes in Rhipicephalus appendiculatus and Rhipicephalus (Boophilus microplus ticks. To demonstrate the usefulness of these results, an unresolved issue in tick vaccine development was examined. Commercial vaccines against R. microplus were developed based on the recombinant antigen Bm86, but despite a high degree of sequence homology, these vaccines are not effective against R. appendiculatus. In fact, Bm86-based vaccines give better protection against some tick species with lower Bm86 sequence homology. One possible explanation is the variation in Bm86 expression levels between R. microplus and R. appendiculatus. The most stable reference genes were therefore used for normalization of the Bm86 expression profile in all life stages of both species to examine whether antigen abundance plays a role in Bm86 vaccine susceptibility. Results The transcription levels of nine potential reference genes: β-actin (ACTB, β-tubulin (BTUB, elongation factor 1α (ELF1A, glyceraldehyde 3-phosphate dehydrogenase (GAPDH, glutathione S-transferase (GST, H3 histone family 3A (H3F3A, cyclophilin (PPIA, ribosomal protein L4 (RPL4 and TATA box binding protein (TBP were measured in all life stages of R. microplus and R. appendiculatus. ELF1A was found to be the most stable expressed gene in both species following analysis by both geNorm and Normfinder software applications, GST showed the least stability. The expression profile of Bm86 in R. appendiculatus and R. microplus revealed a more continuous Bm86 antigen abundance in R

  5. Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

    Directory of Open Access Journals (Sweden)

    Alexandre Mendes Amude

    2007-06-01

    Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

  6. Diagnosis Molekuler Virus Flu Burung-A Subtipe H5 Berdasarkan Amplifikasi Gen M dan H5 dengan Metode Onestep Simplex RT-PCR (MOLECULAR DIAGNOSIS OF AVIAN INFLUENZA VIRUS TYPE A AND SUBTYPE H5 BY AMPLIFICATION OF ITS M AND H5 GENES USING ONE STEP SIMPLEX R

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2014-08-01

    Full Text Available Influenza A viruses which belong to the Family of Orthomyxoviridae are a group of viruses withsegmented ssRNA genome. The viruses can be subgroupped into many subtypes on the basis of theirsurface glycoproteins, hemagglutinin (HA and neuraminidase (NA proteins. Among the HA subtypes, H5and H7 have been found to be the most pathogenic. Conventional diagnosis of the viruses is usuallyperformed by isolation of the viruses in embryonated eggs, and hemagglutination (HA and hemagglutinationinhibition test. Although those methods are sensitive and accurate, they are time consuming and requirelaboratory facilities with high biosafety level. Commercial methods such as emzyme-linked immonosorbentassay (ELISA and immunoflurescense assay also provide a rapid result but less sensitive and specificthan conventional methods. Molecular diagnosis by amplification of M and H5 genes using one strepsimplex reverse transcriptase-polymerase chain eraction (RT-PCR provices a rapid and accurate diagnosisfor the viruses. A study was therefore conducted to evaluate the accurate and rapidity of such the moleculartests for diagnosis of avian influenza A virus, subtype H5. As many as 10 sample of the virus isolateswhich were available at the Animal Desease investigation Center in Wates, Yogyakarta, were uses in thisstudy. The virus isolates were firstly propagated in specific antigen negative (SAN chicken embryos andtested by HA/HI test. The viruses were then subjected for the RT-PCR test with varying annealingtemperatures of 500C and 520C. The result showed that all 10 isolates were type A influenza virus and 8out of 10 were influenza A subtype H5 influenza virus. RT-PCR used in this study appears to be moresensitive, rapid and accurate as compared to those by serological and isolation of the virus in embryonatedeggs.

  7. Expression analysis of KAP9.2 and Hoxc13 genes during different cashmere growth stages by qRT-PCR method.

    Science.gov (United States)

    Wang, X; Xu, H R; Li, T; Qu, L; Zhao, Z D; Zhang, Z Y

    2014-09-01

    Keratin-associated protein 9.2 (KAP9.2) and Homeobox C13 (Hoxc13) genes were chosen to study because of their biological functions involving hair formation. KAP9.2 gene belongs to the ultra high sulfur KAPs, which is important for hair formation and may have association with cashmere. Hoxc13 takes part in the formation of cashmere keratin and maintaining the normal structure of follicle. It has been reported that Hoxc13 gene exists binding site of KP and KAP genes at its promoter regions in mouse. So the expression of KAP9.2 and Hoxc13 genes was detected at anagen stage vs telogen stage by qRT-PCR. The data showed that KAP9.2 and Hoxc13 gene had similar expression trend at different stages, which indicated that there was interaction between them. KAP9.2 and Hoxc13 gene had lower expression level in anagen than that of in telogen of cashmere growth. In anagen, KAP9.2 and Hoxc13 expressed lower in high cashmere yield individuals than that of in low cashmere yield ones. In telogen, the result was reverse. The study would provide the evidence of involvement of KAP9.2 and Hoxc13 in hair periodic growth.

  8. Analyzing Thiol-Dependent Redox Networks in the Presence of Methylene Blue and Other Antimalarial Agents with RT-PCR-Supported in silico Modeling

    Science.gov (United States)

    Zirkel, J.; Cecil, A.; Schäfer, F.; Rahlfs, S.; Ouedraogo, A.; Xiao, K.; Sawadogo, S.; Coulibaly, B.; Becker, K.; Dandekar, T.

    2012-01-01

    Background In the face of growing resistance in malaria parasites to drugs, pharmacological combination therapies are important. There is accumulating evidence that methylene blue (MB) is an effective drug against malaria. Here we explore the biological effects of both MB alone and in combination therapy using modeling and experimental data. Results We built a model of the central metabolic pathways in P. falciparum. Metabolic flux modes and their changes under MB were calculated by integrating experimental data (RT-PCR data on mRNAs for redox enzymes) as constraints and results from the YANA software package for metabolic pathway calculations. Several different lines of MB attack on Plasmodium redox defense were identified by analysis of the network effects. Next, chloroquine resistance based on pfmdr/and pfcrt transporters, as well as pyrimethamine/sulfadoxine resistance (by mutations in DHF/DHPS), were modeled in silico. Further modeling shows that MB has a favorable synergism on antimalarial network effects with these commonly used antimalarial drugs. Conclusions Theoretical and experimental results support that methylene blue should, because of its resistance-breaking potential, be further tested as a key component in drug combination therapy efforts in holoendemic areas. PMID:23236254

  9. Detection of BCR-ABL and E2A-PBX1 fusion genes by RT-PCR in acute lymphoblastic leukaemia with failed or normal cytogenetics.

    Science.gov (United States)

    Devaraj, P E; Foroni, L; Kitra-Roussos, V; Secker-Walker, L M

    1995-02-01

    To evaluate the use of molecular analysis as a complement to karyotypic analysis in the detection of specific chromosomal abnormalities, the occurrence of t(1;19)(q23;p13) and t(9;22)(q34;q11) was investigated by RT-PCR in 43 diagnostic acute lymphoblastic leukaemia cases in whom cytogenetic investigations had failed (32 cases) or showed only a normal karyotype (> or = 20 normal metaphases, 11 cases). One child (aged 14 years) and five adults (aged 18-60 years) were BCR-ABL positive on first round for M-BCR-ABL (one case) or m-BCR-ABL (one case), or on nested PCR for m-BCR-ABL (three cases). Co-expression of M-BCR-ABL (first-round PCR) and m-BCR-ABL (nested PCR was seen in one case. One m-BCR-ABL-positive case also expressed the E2A-PBX1 fusion transcript. Patients positive for the transcript(s) were older, had higher white blood cell counts and a significantly poorer event-free survival (P < 0.001) than those negative for the transcript.

  10. Expression Profile of IL-35 mRNA in Gingiva of Chronic Periodontitis and Aggressive Periodontitis Patients: A Semiquantitative RT-PCR Study

    Directory of Open Access Journals (Sweden)

    Nagaraj B. Kalburgi

    2013-01-01

    Full Text Available Background. Proinflammatory and anti-inflammatory cytokines play a key role in the pathogenesis of periodontal diseases. Secretion of bioactive IL-35 has been described by T regulatory cells ( and is required for their maximal suppressive activity. are involved in the modulation of local immune response in chronic periodontitis patients. Objective. Hence, the present study was aimed to investigate the expression of IL-35 mRNA in chronic periodontitis and aggressive periodontitis patients. Materials and Methods. The present study was carried out in 60 subjects, which included 20 chronic periodontitis patients, 20 aggressive periodontitis patients, and 20 periodontally healthy controls. IL-35 mRNA expression in gingival tissue samples of all subjects was semiquantitatively analyzed using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR. Results. The present study demonstrated the expression of IL-35 mRNA in gingival tissues of all the three groups. IL-35 mRNA expression was highest in chronic periodontitis subjects ( as compared to the aggressive periodontitis group ( and least seen in healthy patients (. Conclusion. The increased expression of IL-35 in chronic and aggressive periodontitis suggests its possible role in pathogenesis of periodontitis. Future studies done on large samples with intervention will strengthen our result.

  11. Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells.

    Science.gov (United States)

    Behjati, Mohaddeseh; Hashemi, Mohammad; Kazemi, Mohammad; Salehi, Mansoor; Javanmard, Shaghayegh Haghjooy

    2017-01-01

    Decreased high-energy phosphate level is involved in endothelial cell injury and dysfunction. Reduced telomerase activity in endothelial cells in parallel with reduced energy levels might be due to altered direction of alternative splicing machine as a complication of depleted energy during the process of atherosclerosis. Isolated human umbilical vein endothelial cells (HUVECs) were treated for 24 hours by oligomycine (OM) and 2-deoxy glucose (2-DG). After 24 hours, the effect of energy depletion on telomerase splicing pattern was evaluated using RT-PCR. Indeed, in both treated and untargeted cells, nitric oxide (NO) and von Willebrand factor (vWF) were measured. ATP was depleted in treated cells by 43.9% compared with control group. We observed a slight decrease in NO levels ( P = 0.09) and vWF ( P = 0.395) in the setting of 49.36% ATP depletion. In both groups, no telomerase gene expression was seen. Telomerase and housekeeping gene expression were found in positive control group (colon cancer tissue) and sample tissue. The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.

  12. MULTI INFEKSI PADA UDANG Litopenaeus vannamei : DIAGNOSIS DENGAN POLYMERASE CHAIN REACTION (PCR DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR

    Directory of Open Access Journals (Sweden)

    Isti Koesharyani

    2012-04-01

    Full Text Available Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi, penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MBV, TSV, IMNV, dan PvNV. Sampel udang yang secara visual normal dan abnormal diambil lalu disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisis di laboratorium dengan metode yang sudah dikembangkan oleh Pusat Penelitian dan Pengembangan Perikanan Budidaya. Hasilnya menunjukkan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus IHHNV dan IMNV. Hasil penelitian ini juga mengindikasikan bahwa udang yang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan, sedangkan udang yang diserang IMNV otot daging di tubuh memutih terutama pada bagian punggung dan dapat menimbulkan kematian.

  13. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

    1995-01-01

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  14. A novel pancoronavirus RT-PCR assay: frequent detection of human coronavirus NL63 in children hospitalized with respiratory tract infections in Belgium

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2005-02-01

    Full Text Available Abstract Background Four human coronaviruses are currently known to infect the respiratory tract: human coronaviruses OC43 (HCoV-OC43 and 229E (HCoV-229E, SARS associated coronavirus (SARS-CoV and the recently identified human coronavirus NL63 (HCoV-NL63. In this study we explored the incidence of HCoV-NL63 infection in children diagnosed with respiratory tract infections in Belgium. Methods Samples from children hospitalized with respiratory diseases during the winter seasons of 2003 and 2004 were evaluated for the presence of HCoV-NL63 using a optimized pancoronavirus RT-PCR assay. Results Seven HCoV-NL63 positive samples were identified, six were collected during January/February 2003 and one at the end of February 2004. Conclusions Our results support the notation that HCoV-NL63 can cause serious respiratory symptoms in children. Sequence analysis of the S gene showed that our isolates could be classified into two subtypes corresponding to the two prototype HCoV-NL63 sequences isolated in The Netherlands in 1988 and 2003, indicating that these two subtypes may currently be cocirculating.

  15. Genetic grouping of avian infectious bronchitis virus isolated in Brazil based on RT-PCR/RFLP analysis of the S1 gene Agrupamento genético de isolados do vírus da bronquite infecciosa das aves no Brasil com base na análise do gene S1 por RT-PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Maria de Fátima S. Montassier

    2008-03-01

    Full Text Available Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP, using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2, B (2, C (2 or D (1. Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.Doze isolados de campo do Brasil e uma estirpe de referência vacinal do vírus da bronquite infecciosa das aves (VBI foram propagadas em ovos embrionados SPF. O gene S1 dessas amostras foi analisado por RT-PCR seguido de RFLP, empregando-se as enzimas de restrição HaeIII, XcmI e BstyI. Observou-se a existência de cinco genotipos diferentes: M (Massachusetts, A , B, C e D. Cinco dos doze isolados de campo do VBI foram classificados no genótipo Massachusetts e os sete vírus restantes foram classificados em quatro genotipos diferentes; A (2, B (2, C (2 ou D (1. Os resultados desta genotipagem concordam com os dados obtidos na análise imunológica previamente realizada para a maior parte destes vírus, destacando a ocorrência de uma variabilidade marcante entre os isolados do VBI que estão circulando nas granjas avícolas comerciais do Brasil.

  16. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  17. Identification of valid housekeeping genes for quantitative RT-PCR analysis of cardiosphere-derived cells preconditioned under hypoxia or with prolyl-4-hydroxylase inhibitors.

    Science.gov (United States)

    Tan, Suat Cheng; Carr, Carolyn A; Yeoh, Kar Kheng; Schofield, Christopher J; Davies, Kay E; Clarke, Kieran

    2012-04-01

    Infarction irreversibly damages the heart, with formation of an akinetic scar that may lead to heart failure. Endogenous cardiac stem cells (CSCs) are a promising candidate cell source for restoring lost tissue and thereby preventing heart failure. CSCs may be isolated in vitro, via the formation of cardiospheres, to give cardiosphere-derived cells (CDCs). Although qRT-PCR analyses of CDCs have been performed, no justification for the selection of the housekeeping gene has been published. Here, we evaluated the most suitable housekeeping gene for RNA expression analysis in CDCs cultured under normoxia, hypoxia or with prolyl-4-hydroxylase inhibitors (PHDIs), from both neonatal and adult rats, to determine the effects of ageing and different culture conditions on the stability of the housekeeping gene for CDCs. Six candidate housekeeping genes, [glyceraldehyde-3-phosphate dehydrogenase (GAPDH), beta-actin (Actb), hypoxanthine phosphoribosyltransferase 1 (HPRT-1), beta-2-microtubulin (β2M), 60S acidic ribosomal protein large P1 (RPLP-1) and TATA box binding protein (Tbp)] were evaluated in this study. Analysis using geNorm and NormFinder revealed that GAPDH was the most constant housekeeping gene among all genes tested under normoxia for both neonatal and adult CDCs, whereas Actb was the most stable housekeeping gene under hypoxia. For the PHDI-treated CDCs, overall, GADPH, Actb and β2M were more consistently expressed, whereas HPRT-1, RPLP-1 and Tbp showed unstable expression. The ranking for β2M, HPRT-1 and RPLP-1 stability was different for neonatal and adult cells, indicating that expression of these genes was age-dependent. Lastly, independent of age or culture conditions, Tbp was the least stable housekeeping gene. In conclusion, a combination of Actb and GADPH gave the most reliable normalization for comparative analyses of gene transcription in neonatal and adult rat CDCs preconditioned by hypoxia or PHDIs.

  18. A strain-specific multiplex RT-PCR for Australian rabbit haemorrhagic disease viruses uncovers a new recombinant virus variant in rabbits and hares.

    Science.gov (United States)

    Hall, R N; Mahar, J E; Read, A J; Mourant, R; Piper, M; Huang, N; Strive, T

    2018-04-01

    Rabbit haemorrhagic disease virus (RHDV, or GI.1) is a calicivirus in the genus Lagovirus that has been widely utilized in Australia as a biological control agent for the management of overabundant wild European rabbit (Oryctolagus cuniculus) populations since 1996. Recently, two exotic incursions of pathogenic lagoviruses have been reported in Australia; GI.1a-Aus, previously called RHDVa-Aus, is a GI.1a virus detected in January 2014, and the novel lagovirus GI.2 (previously known as RHDV2). Furthermore, an additional GI.1a strain, GI.1a-K5 (also known as 08Q712), was released nationwide in March 2017 as a supplementary tool for wild rabbit management. To discriminate between these lagoviruses, a highly sensitive strain-specific multiplex RT-PCR assay was developed, which allows fast, cost-effective and sensitive detection of the four pathogenic lagoviruses currently known to be circulating in Australia. In addition, we developed a universal RT-qPCR assay to be used in conjunction with the multiplex assay that broadly detects all four viruses and facilitates quantification of viral RNA load in samples. These assays enable rapid detection, identification and quantification of pathogenic lagoviruses in the Australian context. Using these assays, a novel recombinant lagovirus was detected in rabbit tissue samples, which contained the non-structural genes of GI.1a-Aus and the structural genes of GI.2. This variant was also recovered from the liver of a European brown hare (Lepus europaeus). The impact of this novel recombinant on Australian wild lagomorph populations and its competitiveness in relation to circulating field strains, particularly GI.2, requires further studies. © 2017 Blackwell Verlag GmbH.

  19. Gene cloning and evaluation of the Acinetobacter baumannii nlpD gene expression in human dermal fibroblast cells using RT-PCR

    Directory of Open Access Journals (Sweden)

    Rasoul Hashemzehi

    2017-08-01

    Full Text Available Background: Acinetobacter baumannii is one of the highly antibiotic-resistant bacteria in the world. This bacterium is a cause of endemic and epidemic nosocomial infections and despite many efforts, there is still no effective vaccine agains it. NlpD is one of the important antigenic agents that stimulate the immune system. So, the aim of this study was to examine gene cloning and expression of the nlpD gene of A. baumannii in human dermal fibroblast (HDF cells. Materials and Methods: In this experimental study, the nlpD gene was amplified from A. baumannii genome using polymerase chain reaction (PCR. Then, the nlpD gene was cloned and sub-cloned in pTZ57R/T and pIRES2-EGFP vectors, respectively. Confirmation of gene cloning was performed by PCR, restriction endonuclease and sequencing methods. The final pIRES2-EGFP-nlpD recombinant vector was transformed into HDF cells using electroporation and the expression of target gene was evaluated by RT-PCR. Results: In this study, the 831 bp nlpD gene of A. baumannii was amplified successfully. Also, the results of the study showed that the recombinant pIRES2-EGFP-nlpD final construct was produced. Observation of the 831 bp band on agarose gel in transformed cells compared to control cells confirmed the nlpD gene expression in HDF cells. Conclusion: The final construct that generates in this study can express the nlpD gene of A. baumannii in eukaryotic cells. Successful expression of the target gene can be used as a new recombinant vaccine in animal model. The pIRES2-EGFP-nlpD recombinant vector has also the potential as a gene vaccine for future research.

  20. SPAM1 (PH-20 protein and mRNA expression in the epididymides of humans and macaques: utilizing laser microdissection/RT-PCR

    Directory of Open Access Journals (Sweden)

    Zhang Hong

    2003-08-01

    Full Text Available Abstract Background The Sperm Adhesion Molecule 1 (SPAM1 is an important sperm surface hyaluronidase with at least three functions in mammalian fertilization. Previously our laboratory reported that in the mouse, in addition to its expression in the testis, Spam1 is synthesized in the epididymis where it is found in membranous vesicles in the principal cells of the epithelium in all three regions. Since SPAM1 is widely conserved among mammals the aim of the study was to determine if its expression pattern in the epididymis is conserved in rodents and primates. Methods We used laser microdissection (LM/RT-PCR on frozen and paraffin-embedded epididymal sections of humans (n = 3 and macaques (n = 2 as well as in situ transcript hybridization to determine if transcripts are present in the epididymal epithelium. Western analysis and immunohistochemistry were used to detect and confirm the protein expression, and hyaluronic acid substrate gel electrophoresis analyzed its hyaluronidase activity. An in silico analysis of the proximal promoter of SPAM1 was also performed to identify relevant putative transcription binding sites for the androgen receptor. Results We demonstrate that mRNA unique to SPAM1 is present in the principal cells of the epididymal epithelium in all individuals of both species studied. SPAM1 protein is present in all three regions of the epididymis, as well as the vas deferens, and is localized similarly to the transcripts. SPAM1 was shown to have hyaluronidase activity at pH 7.0. In the proximal promoter of SPAM1 were uncovered putative epididymal transcription factor binding sites including androgen receptor elements (AREs, consistent with epididymal expression. Conclusions These findings allow us to conclude that epididymal SPAM1 is conserved in at least two mammalian classes, rodents and primates. This conservation of expression suggests that the protein is likely to play an important function, possibly in sperm maturation.

  1. [Identification of Env-specific monoclonal antibodies from Chinese HIV-1 infected person by B cell activation and RT-PCR cloning].

    Science.gov (United States)

    Wang, Hui-Min; Xu, Ke; Yu, Shuang-Qing; Ding, Lin-Lin; Luo, Hai-Yan; Flinko, Robin; Lewis, George K; Feng, Xia; Shao, Ji-Rong; Guan, Yong-Jun; Zeng, Yi

    2012-06-01

    To obtain protective human monoclonal antibody from HIV-1 infected person, we adapted a technology for isolating antigen specific monoclonal antibody from human memory B cells through in vitro B cell activation coupled with RT-PCT and expression cloning. Human B cells were purified by negative sorting from PBMCs of HIV-1 infected individuals and memory B cells were further enriched using anti-CD27 microbeads. Two hundred memory B cells per well were cultured in 96-well round-bottom plates Env-specific antibodies in supernatants were with feeder cells in medium containing EBV and CpG. screened by ELISA after 1-2 weeks' culture. Cells from positive wells of Env-specific antibody were harvested and total RNA was isolated. Human VH and Vkappa or Vlambda genes were amplified by RT-PCR and cloned into IgG1 and kappa or lambda expressing vectors. Functional VH and Vkappa or Vlambda were identified by cotransfecting 293T cells with individual heavy chain and light chain clones followed by analysis of culture supernatants by ELISA for Env-specific antibodies. Finally, corresponding mAb was produced by transient transfection of 293T cells with the identified VH and Vkappa/lambda pair and purified by protein A affinity chromatography. Purified monocolonal antibodies were used for HIV-1 specific antibody-dependent cell-mediated cytotoxicity (ADCC) and neutralizing activity assay. Four monocolonal Env-specific antibodies were isolated from one HIV-1 subtype B' infected individual. Two of them showed strong ADCC activity and one showed weak neutralizing activity against HIV-1. Its further studies on their application in therapeutic or prophylactic vaccines against HIV-1 should be grounded.

  2. Comparative analysis of intraperitoneal minimal free cancer cells between colorectal and gastric cancer patients using quantitative RT-PCR: possible reason for rare peritoneal recurrence in colorectal cancer.

    Science.gov (United States)

    Hara, Masayasu; Nakanishi, Hayao; Jun, Qian; Kanemitsu, Yukihide; Ito, Seiji; Mochizuki, Yoshinari; Yamamura, Yoshitaka; Kodera, Yasuhiro; Tatematsu, Masae; Hirai, Takashi; Kato, Tomoyuki

    2007-01-01

    Peritoneal recurrence has a much lower incidence in colorectal cancer (CRC) patients than gastric cancer (GC) patients. The aim of this study is to clarify the reason for the rare peritoneal recurrence in CRC as compared with GC. The incidence and the abundance of free tumor cells in the peritoneal lavages from 102 CRC and 126 GC patients who underwent curative surgery were assessed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) with carcinoembryonic antigen (CEA) and cytokeratin 20 (CK20) as genetic markers. Prognostic significance of CEA and CK20 mRNA was also compared between CRC and GC after 2 years of follow-up by Kaplan-Meyer method with overall and peritoneal recurrence-free survival as endpoints. Positivity rate and average values of CEA and CK20 mRNA in peritoneal lavages of CRC patients, which are correlated to the depth of tumor invasion (pT category), were essentially the same as those of GC cases. Overall survival was significantly (marginally) worse in CEA mRNA (CK20 mRNA)-positive CRC patients than negatives like GC. However, peritoneal recurrence-free survival was not different between CEA (CK20) mRNA-positive and -negative CRC patients, in quite contrast to GC cases. Multivariate analysis showed that CEA mRNA was an independent prognostic factor for overall survival in GC patients, but not in CRC patients. These results suggest that the rare peritoneal recurrence in CRC patients is not due to the low incidence or the small number of intraperitoneal free cancer cells, but more likely reflects due to the low-peritoneal metastatic potential of CRC cells.

  3. Tissue- and cell-specific expression of metallothionein genes in cadmium- and copper-exposed mussels analyzed by in situ hybridization and RT-PCR

    International Nuclear Information System (INIS)

    Zorita, I.; Bilbao, E.; Schad, A.; Cancio, I.; Soto, M.; Cajaraville, M.P.

    2007-01-01

    Metallothioneins (MTs) are metal-inducible proteins that can be used as biomarkers of metal exposure. In mussels two families of MT isoforms (MT10 and MT20) have been characterized. In this study, mussels (Mytilus galloprovincialis) were exposed to 200 ppb Cd and 40 ppb Cu for 2 and 9 days to characterize the tissue and isoform specificity of metal-induced MT expression. Non-radioactive in situ hybridization demonstrated that both MT isoforms were mainly transcribed in digestive tubule epithelial cells, especially in basophilic cells. Weaker MT expression was detected in non-ciliated duct cells, stomach and gill epithelial cells, haemocytes, adipogranular cells, spermatic follicles and oocytes. RT-PCR resulted in cloning of a novel M. galloprovincialis isoform homologous to recently cloned Mytilus edulis intron-less MT10B isoform. In gills, Cd only affected MT10 gene expression after 2 days of exposure while increases in MT protein levels occurred at day 9. In the digestive gland, a marked increase of both isoforms, but especially of MT20, was accompanied by increased levels of MT proteins and basophilic cell volume density (Vv BAS ) after 2 and 9 days and of intralysosomal metal accumulation in digestive cells after 9 days. Conversely, although metal was accumulated in digestive cells lysosomes and the Vv BAS increased in Cu-exposed mussels, Cu exposure did not produce an increase of MT gene expression or MT protein levels. These data suggest that MTs are expressed in a tissue-, cell- and isoform-specific way in response to different metals

  4. Rapid detection of bovine coronavirus by a semi-nested RT-PCR Detecção rápida do Coronavírus Bovino (BCoV por meio de uma semi-nested RT-PCR

    Directory of Open Access Journals (Sweden)

    Karen M. Asano

    2009-11-01

    Full Text Available Bovine coronavirus (BCoV is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256 in DEPC treated ultra-pure water, in fetal bovine serum (FBS and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694. The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.O Coronavírus bovino (BCoV pertence ao grupo 2 do gênero Coronavirus (Nidovirales: Coronaviridae e é agente causador de enterites tanto em bezerros como em bovinos adultos, bem como de doen

  5. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis

  6. Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active anti-retroviral therapy (HAART

    Directory of Open Access Journals (Sweden)

    DA Meira

    2008-01-01

    Full Text Available A cross-sectional study was performed on HIV-1 infected individuals with or without antiretroviral treatment (ARV in the AIDS Day Hospital, Botucatu Medical School, UNESP. Between August 2004 and October 2005, 73 HIV-1 infected individuals were divided into three groups: infected individuals with or without AIDS who had never received ARV (G1 = 15; patients on HAART that had had plasma HIV-1 RNA viral load (VL equal to or greater than 50 copies/mL (G2 = 27; and patients on HAART with undetectable VL for at least the past six months (G3 = 31. There was also an additional group that comprised blood donors without any sign of the disease and with negative HIV serum tests (G4 = 20, which was the control group. Serum cytokine levels (values in pg/mL were measured by enzyme-linked immunosorbent assay (ELISA and specific mRNA expression by reverse transcription polymerase chain reaction (RT-PCR. Both techniques were performed on the four groups for TNF-α, IL-2, INF-γ, IL-4 and IL-10. All patients were submitted to VL determination and CD4+ and CD8+T lymphocyte counts. The analysis of the results revealed a significant comparison among groups for both methods and an association between the latter (> 80% r² > 0.80. There was only one exception, in control individuals for IL-2 by ELISA. The cytokine profiles, in both methods, for the three patient groups, were mature Th-0. The behaviors of IL-2 and INF-γ required emphasis due to consequent expression of dominant Th profile. Both methods showed low IL-2 and high mean values of INF-γ in the three groups. Several authors have recently drawn attention to the substantial apoptosis of infected and non-infected CD4+T cells, mainly during primary infection, persisting only in those with INF-γ phenotype producer and not IL-2. HIV infected individuals submitted to HAART are expected to produce IL-2 in an attempt to present Th-1 profile, but in most cases this did not occur.

  7. The Use of Real-Time Reverse Transcription-PCR for Assessing Estrogen Receptor and Estrogen-Responsive Gene Expression.

    Science.gov (United States)

    Booze, Michelle L; Eyster, Kathleen M

    2016-01-01

    Real-time reverse transcription-polymerase chain reaction (RT-PCR), also known as quantitative RT-PCR (qRT-PCR), is a powerful tool for assessing gene transcription levels. The technique is especially useful for measuring estrogen receptor transcript levels as well as gene expression changes in response to estrogen stimulation as it is quick, accurate, robust, and allows the measurement of gene expression in a variety of tissues and cells. This chapter describes the protocols used for the real-time RT-PCR assay using hydrolysis (TaqMan-type) probes.

  8. Replacement of HIV p24 Ag test by a multiplex RT-PCR method for primary screening of blood donors Substituição do teste de p24 Ag (HIV por um RT-PCR multiplex na triagem primária de doadores de sangue

    Directory of Open Access Journals (Sweden)

    José Eduardo Levi

    2007-06-01

    Full Text Available Nucleic Acid Testing (NAT as a tool for primary screening of blood donors became a reality in the end of the 1990 decade. We report here the development of an "in-house" RT-PCR method that allows the simultaneous (multiplex detection of HCV and HIV-RNA in addition to an artificial RNA employed as an external control. This method detects all HIV group M subtypes, plus group N and O, with a detection threshold of 500 IU/mL. After validation, the method replaced p24 Ag testing, in use for blood donation screening since 1996 at our services. From July 2001 to February 2006, 102,469 donations were tested and 41 (0.04% were found HIV-RNA reactive. One NAT-only reactive donation (antibody non-reactive was observed, with subsequent seroconversion of the implied donor, giving a yield of 1:102,469. This rate is in contrast to the international experience that reports a detection of approximately 1:600,000 - 1:3,100,000 of isolated HIV-RNA donations.O uso de testes de ácidos nucleicos (NAT na rotina de triagem de doadores de sangue tornou-se uma realidade ao final da década de 1990. Descreve-se aqui uma metodologia de RT-PCR multiplex "in-house" que permite a detecção simultânea dos RNAs dos vírus HIV e HCV além de uma molécula artificial de RNA usada como controle externo. O método detecta todos os subtipos de HIV do grupo M e também do grupo N e O, com uma sensibilidade de 500 UI/mL. Após validação, este teste substituiu o do antígeno p24, até então na rotina de triagem em nosso laboratório, desde 1996. De julho de 2001 a fevereiro de 2006 foram testadas 102.469 doações e 41 (0.04% foram NAT reativas. Uma doação NAT isoladamente reativa (anticorpo não-reativa foi detectada com soroconversão subseqüente do doador, portanto, o rendimento do NAT nesta população até o presente momento é de 1:102.469. Este número contrasta com a experiência obtida internacionalmente, onde taxas de 1:600.000 - 1:3.100.000 foram descritas.

  9. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    Science.gov (United States)

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  10. When can real-time quantitative RT-PCR effectively define molecular relapse in acute promyelocytic leukemia patients? (Results of the French Belgian Swiss APL Group).

    Science.gov (United States)

    Cassinat, Bruno; de Botton, Stéphane; Kelaidi, Charikleia; Ades, Lionel; Zassadowski, Fabien; Guillemot, Isabelle; Schlageter, Marie-Helene; Raffoux, Emmanuel; Harousseau, Jean-Luc; Legrand, Olivier; Escoffre-Barbe, Martine; Reman, Oumedaly; Gardembas, Martine; Himberlin, Chantal; Cahn, Jean Yves; Guyotat, Denis; Bouscary, Didier; Parry, Anne; Rousselot, Philippe; Baruchel, Andre; Dombret, Hervé; Chevret, Sylvie; Fenaux, Pierre; Chomienne, Christine

    2009-09-01

    10-20% of APL patients relapse and the challenge remains to early identify these patients to improve survival rate. We report PML-RARalpha transcript detection by RQ-PCR in 260 consecutive APL patients (n = 970 samples). 223 patients with samples of sufficient RNA quality to demonstrate they reached molecular remission were monitored for MRD. During follow-up, 38 of these patients were tested positive for PML-RARalpha mRNA. 13 out of the 38 patients (34%) effectively developed hematological relapse. In the first positive sample, specific PML-RARalpha NCN thresholds over which, or under which, patients could effectively be predicted to relapse or not, were identified and subsequently validated in a second cohort.

  11. A duplex real-time RT-PCR system with an internal control offers sensitive and reliable broad spectrum detection of Squash mosaic virus variants

    Science.gov (United States)

    Squash mosaic virus (SqMV) is a seed-borne virus, belonging to the genus Commovirus in the subfamily Comoviridae of family Secoviridae. SqMV has a bipartite single-stranded ribonucleic acid (RNA) genome (RNA1 and RNA2) encapsidated separately with two capsid proteins. Two serotypes (genotypes) of ...

  12. Molecular cloning of three pyranose dehydrogenase-encoding genes from Agaricus meleagris and analysis of their expression by real-time RT-PCR

    Czech Academy of Sciences Publication Activity Database

    Kittl, R.; Sygmund, Ch.; Halada, Petr; Volc, Jindřich; Divne, Ch.; Haltrich, D.; Peterbauer, C.

    2008-01-01

    Roč. 53, č. 2 (2008), s. 117-127 ISSN 0172-8083 R&D Projects: GA MŠk LC545 Grant - others:GA MŠk(CZ) Kontakt 6-06-4 Institutional research plan: CEZ:AV0Z50200510 Keywords : pyranose dehydrogenase * lignocellulose degradation * agarices spp Subject RIV: EE - Microbiology, Virology Impact factor: 2.323, year: 2008

  13. Ekspresi level gen mRNA protein ekstraseluler otak embrio mencit black-6 uk-12 akibat induksi 2-methoxyethanol : analisis secara real time RT-PCR

    OpenAIRE

    Yulia Irnidayanti; Win Darmanto; Agus Abadi

    2012-01-01

    The aim of this research was to investigate impact of 2-methoxyethanol, a major industrial chemical, and its individual metaboliteson the expression DNA of the embryonic brain development of black-6 mice. The expression levels mRNA protein of GAPDH, Fibronectin,tenascin, vimentin, Neurofilamen, NCam between brain embrio treatment with 2-ME at gestation day 12 and Embryo control wereachieved. The Electroforesis DNA on brain Embryonic day 12 showed that there were expression of GAPDH (447bp), F...

  14. Comparison of two real-time RT-PCR assays for differentiation of C-strain vaccinated from classical swine fever infected pigs and wild boars

    DEFF Research Database (Denmark)

    Widén, F.; Everett, H.; Blome, S.

    2014-01-01

    Classical swine fever is one of the most important infectious diseases for the pig industry worldwide due to its economic impact. Vaccination is an effective means to control disease, however within the EU its regular use is banned owing to the inability to differentiate infected and vaccinated a...

  15. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  16. Efeito da mitomicina C em polipose nasossinusal eosinofílica, in vivo: dosagem de IL5 e GM-CSF, RT-PCR Effect of mitomocin C in eosinophilic nasal polyposis, in vivo: concentration of IL5 and GM-CSF, RT-PCR

    Directory of Open Access Journals (Sweden)

    Mirian Cabral Moreira de Castro

    2006-02-01

    Full Text Available A polipose nasossinusal eosinofílica (PNS é manifestação de uma doença inflamatória crônica na mucosa do nariz e nos seios paranasais caracterizada por infiltração de granulócitos eosinófilos. O fator responsável pela eosinofilia e manutenção dessas células com a perpetuação do processo inflamatório e formação polipóide é objeto constante de estudos. As citocinas como IL5 (interleucina 5 e GM-CSF (fator estimulador de colônia granulócito macrófago aumentam a sobrevida dos eosinófilos e prolongam a sua presença no tecido polipóide, diminuindo o índice de apoptose eosinofílica. OBJETIVO: Avaliar o efeito da mitomicina C - MMC - por meio de aplicação tópica em pacientes portadores de PNS eosinofílica quanto à presença de IL5 e GM-CSF. CASUÍSTICA E MÉTODOS: Quinze pacientes portadores de PNS eosinofílica foram submetidos à aplicação tópica de MMC na concentração de 0,5mg/ml, 1ml, durante cinco minutos, na cavidade nasal direita, e submetidos à biópsia para RT-PCR 24hs após. O grupo-controle foi a cavidade nasal esquerda. O perfil de citocinas foi analisado para IL5 e GM-CSF. RESULTADOS: A comparação dos resultados de GM-CSF pré e pós-uso de MMC quando usamos o teste t pareado apresenta p=0,041. A comparação para IL5 resulta em p Eosinophilic nasosinusal polyposis is a chronic inflammatory infection with elevated infiltration of eosinophils, which presents high rate of recurrence after surgical treatment. The continuous inflammatory process that leads to the formation of polyps requires constant clinical treatment. Contributing to the maintenance of eosinophilia are cytokines IL5 (interleukin-5 and GM-CSF (granulocyte macrophages colony-stimulating factor, which show up in elevated concentrations. These oligoproteins diminish the rate of apoptosis and prolong the survival of eosinophils. AIM: By diminishing these cytokines, the action of Mitomycin C (MMC, an antineoplasic drug which inhibits the

  17. Quantitative RT-PCR analysis of PSA and prostate-specific membrane antigen mRNA to detect circulating tumor cells improves recurrence-free survival nomogram prediction after radical prostatectomy.

    Science.gov (United States)

    Yates, David R; Rouprêt, Morgan; Drouin, Sarah J; Comperat, Eva; Ricci, Sylvie; Lacave, Roger; Sèbe, Philippe; Cancel-Tassin, Geraldine; Bitker, Marc-Olivier; Cussenot, Olivier

    2012-09-01

    Circulating tumor cell (CTC) analysis is a potential new biomarker in prostate cancer. We hypothesize that quantitative detection of CTCs in patients pre- and post-radical prostatectomy (RP) using quantitative TaqMan® fluorogenic RT-PCR will improve the accuracy of the Kattan nomogram to predict the probability of recurrence-free survival (RFS) post-RP. Ninty-two patients who underwent RP between 2004 and 2009 had venous blood samples taken pre- (Day - 1) and post-operatively (Day + 7). We performed quantitative Taqman® RT-PCR to detect circulating prostate-specific antigen (PSA) and prostate-specific membrane antigen (PSMA) mRNA. We calculated both the logarithmic ratio of Day + 7/Day - 1 for PSA (PSAr) and PSMA (PSMAr) expression (log(Day+7/Day-1) ) and the Kattan nomogram predicted probability of disease recurrence for each patient. We then analyzed how the AUC-ROC analysis for the Kattan nomogram prediction alone (K) compared to the addition of the PSAr and PSMAr in predicting 5-year RFS. The mean age (years), PSA (ng/ml), and follow-up (mo) was 65.1, 9.13, and 72, respectively. The AUCs for K, PSAr + K, and PSMAr + K were 0.752 (95%CI 0.620-0.860), 0.830 (95%CI 0.740-0.911), and 0.837 (95%CI 0.613-0.923), respectively (P = 0.03). The Kattan 5-year PSA RFS was 75%. The actual 5-year PSA RFS survival rate was 77%. Data from modern quantitative RT-PCR to detect circulating prostate-derived PSA and PSM mRNA pre- and post-RP improves the accuracy of the Kattan nomogram to predict biochemical recurrence. Copyright © 2012 Wiley Periodicals, Inc.

  18. Detección mediante RT-PCR en tiempo real del virus vacunal en cerdos inmunizados con la vacuna cubana contra la peste porcina clásica

    OpenAIRE

    Tania Campos-Cuello; Laura Coroas-González; Livany Martínez-Rodríguez

    2016-01-01

    La peste porcina clásica (PPC) es una enfermedad viral infectocontagiosa, producida por un virus ARN del género Pestivirus, familia Flaviviridae. En la actualidad es una de las causas de pérdidas económicas en la industria porcina a nivel mundial. En su prevención se han utilizado vacunas vivas atenuadas, empleando la cepa China lapinizada. La Reacción en Cadena de la Polimerasa Reverso Transcriptasa (RT-PCR) ha sido uno de los métodos más sensibles aplicado en Medicina Veterinaria para la de...

  19. Protocol for qRT-PCR analysis from formalin fixed paraffin embedded tissue sections from diffuse large b-cell lymphoma: Validation of the six-gene predictor score

    Science.gov (United States)

    Tekin, Nilgun; Conget, Paulette; Bruna, Flavia; Timar, Botond; Gagyi, Eva; Basak, Ranjan; Naik, Omkar; Auewarakul, Chirayu; Sritana, Narongrit; Levy, Debora; Cerci, Juliano Julio; Bydlowski, Sergio Paulo; Pereira, Juliana; Dimamay, Mark Pierre; Natividad, Filipinas; Chung, June-Key; Belder, Nevin; Kuzu, Isinsu; Paez, Diana; Dondi, Maurizio; Carr, Robert

    2016-01-01

    As a part of an international study on the molecular analysis of Diffuse Large B-cell Lymphoma (DLBCL), a robust protocol for gene expression analysis from RNA extraction to qRT-PCR using Formalin Fixed Paraffin Embedded tissues was developed. Here a study was conducted to define a strategy to validate the previously reported 6-gene (LMO2, BCL6, FN1, CCND2, SCYA3 and BCL2) model as predictor of prognosis in DLBCL. To avoid variation, all samples were tested in a single centre and single platform. This study comprised 8 countries (Brazil, Chile, Hungary, India, Philippines, S. Korea, Thailand and Turkey). Using the Kaplan-Meier and log rank test on patients (n=162) and two mortality risk groups (with those above and below the mean representing high and low risk groups) confirmed that the 6-gene predictor score correlates significantly with overall survival (OS, p<0.01) but not with event free survival (EFS, p=0.18). Adding the International Prognostic Index (IPI) shows that the 6-gene predictor score correlates significantly with high IPI scores for OS (p<0.05), whereas those with low IPI scores show a trend not reaching significance (p=0.08). This study defined an effective and economical qRT-PCR strategy and validated the 6-gene score as a predictor of OS in an international setting. PMID:27825111

  20. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  1. Investigations on the frequency of norovirus contamination of ready-to-eat food items in Istanbul, Turkey, by using real-time reverse transcription PCR.

    Science.gov (United States)

    Yilmaz, Aysun; Bostan, Kamil; Altan, Eda; Muratoglu, Karlo; Turan, Nuri; Tan, Derya; Helps, Christopher; Yilmaz, Huseyin

    2011-05-01

    Investigation of norovirus (NoV) contamination of food items is important because many outbreaks occur after consumption of contaminated shellfish, vegetables, fruits, and water. The frequency of NoV contamination in food items has not previously been investigated in Turkey. The aim of this study was to investigate the frequency of human NoV genogroups (G) I and II in ready-to-eat tomatoes, parsley, green onion, lettuce, mixed salads, and cracked wheat balls. RNA was extracted with the RNeasy Mini Kit, and a real-time reverse transcription (RT) PCR assay was performed using primers specific for NoV GI and GII. Among the 525 samples analyzed, NoV GII was detected in 1 green onion sample and 1 tomato sample by both SYBR Green and TaqMan real-time RT-PCR assays; no GI virus was detected. The Enterobactericaeae and Escherichia coli levels in the NoV-positive green onion were 6.56 and 1.28 log CFU/g, and those in the tomato were 5.55 and 1.30 log CFU/g, respectively. No significant difference in the bacterial levels was found between the NoV-positive and NoV-negative samples. This study is the first in which NoV GII was found in ready-to-eat food collected from Istanbul, Turkey; thus, these foods may be considered a risk to human health. Epidemiological studies and measures to prevent NoV infection should be considered.

  2. Evaluation of two real-time polymerase chain reaction assays for porcine epidemic diarrhea virus (PEDV) to assess PEDV transmission in growing pigs

    Science.gov (United States)

    In April 2013 a porcine epidemic diarrhea virus (PEDV) epidemic began in the United States. As part of the response, real-time RT-PCR assays to detect PEDV were developed by several Veterinary Diagnostic Laboratories. This study evaluated RT-PCR PEDV assays that detect the N gene (gN) and S gene (gS...

  3. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders

    2005-01-01

    Aims: To develop a real-time (rt) PCR for species differentiation of thermophilic Campylobacter and to develop a method for assessing co-colonization of pigs by Campylobacter spp. Methods and Results: The specificity of a developed 5' nuclease rt-PCR for species-specific identification of Campylo...

  4. Detección de virus influenza A, B y subtipos A (H1N1 pdm09, A (H3N2 por múltiple RT-PCR en muestras clínicas

    Directory of Open Access Journals (Sweden)

    Pool Marcos

    Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.

  5. A novel strategy for human papillomavirus detection and genotyping with SybrGreen and molecular beacon polymerase chain reaction.

    Science.gov (United States)

    Szuhai, K; Sandhaus, E; Kolkman-Uljee, S M; Lemaître, M; Truffert, J C; Dirks, R W; Tanke, H J; Fleuren, G J; Schuuring, E; Raap, A K

    2001-11-01

    Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogeneous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology.

  6. Detección mediante RT-PCR en tiempo real del virus vacunal en cerdos inmunizados con la vacuna cubana contra la peste porcina clásica

    Directory of Open Access Journals (Sweden)

    Tania Campos-Cuello

    2016-08-01

    Full Text Available La peste porcina clásica (PPC es una enfermedad viral infectocontagiosa, producida por un virus ARN del género Pestivirus, familia Flaviviridae. En la actualidad es una de las causas de pérdidas económicas en la industria porcina a nivel mundial. En su prevención se han utilizado vacunas vivas atenuadas, empleando la cepa China lapinizada. La Reacción en Cadena de la Polimerasa Reverso Transcriptasa (RT-PCR ha sido uno de los métodos más sensibles aplicado en Medicina Veterinaria para la detección de virus ARN. En el caso del virus de la PPC es muy útil porque el ácido nucleico se puede detectar desde muy temprano en la infección y en periodos más largos en aquellos animales que se recuperan. El objetivo de este estudio fue aplicar la técnica de RT-PCR en tiempo real para la detección de la cepa China lapinizada de la vacuna cubana contra la PPC. Las tonsilas de los cerdos vacunados fueron el órgano más positivo en la detección del ARN del virus vacunal. Los resultados obtenidos evidenciaron una interferencia del virus vacunal en el diagnóstico, siendo el día 12 posvacunación en el que se obtiene una emisión umbral de fluorescencia más bajo.

  7. Development of novel AllGlo-probe-based one-step multiplex qRT-PCR assay for rapid identification of avian influenza virus H7N9.

    NARCIS (Netherlands)

    Zhang, Y.; Mao, H.; Yan, J.; Wang, X.; Zhang, L.; Koch, G.; Li, H.; Li, Z.; Chen, Y.; Gong, L.; Chen, Z.; Xia, S.

    2014-01-01

    Recently, human deaths have resulted from infection with low-pathogenicity avian influenza virus H7N9 strains that have emerged recently in China. To strengthen H7N9 surveillance and outbreak control, rapid and reliable diagnostic methods are needed. To develop a sensitive quantitative real-time

  8. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris

    Directory of Open Access Journals (Sweden)

    Biffali Elio

    2009-07-01

    Full Text Available Abstract Background Quantitative real-time polymerase chain reaction (RT-qPCR is valuable for studying the molecular events underlying physiological and behavioral phenomena. Normalization of real-time PCR data is critical for a reliable mRNA quantification. Here we identify reference genes to be utilized in RT-qPCR experiments to normalize and monitor the expression of target genes in the brain of the cephalopod mollusc Octopus vulgaris, an invertebrate. Such an approach is novel for this taxon and of advantage in future experiments given the complexity of the behavioral repertoire of this species when compared with its relatively simple neural organization. Results We chose 16S, and 18S rRNA, actB, EEF1A, tubA and ubi as candidate reference genes (housekeeping genes, HKG. The expression of 16S and 18S was highly variable and did not meet the requirements of candidate HKG. The expression of the other genes was almost stable and uniform among samples. We analyzed the expression of HKG into two different set of animals using tissues taken from the central nervous system (brain parts and mantle (here considered as control tissue by BestKeeper, geNorm and NormFinder. We found that HKG expressions differed considerably with respect to brain area and octopus samples in an HKG-specific manner. However, when the mantle is treated as control tissue and the entire central nervous system is considered, NormFinder revealed tubA and ubi as the most suitable HKG pair. These two genes were utilized to evaluate the relative expression of the genes FoxP, creb, dat and TH in O. vulgaris. Conclusion We analyzed the expression profiles of some genes here identified for O. vulgaris by applying RT-qPCR analysis for the first time in cephalopods. We validated candidate reference genes and found the expression of ubi and tubA to be the most appropriate to evaluate the expression of target genes in the brain of different octopuses. Our results also underline the

  9. Quantitative RT-PCR Detection of Hepatitis A Virus, Rotaviruses and Enteroviruses in the Buffalo River and Source Water Dams in the Eastern Cape Province of South Africa

    Directory of Open Access Journals (Sweden)

    Anthony Ifeanyi Okoh

    2012-11-01

    Full Text Available Human enteric viruses (HEntVs are a major cause of water-related diseases. The prevalence of hepatitis A virus (HAV, rotaviruses (RoV and enteroviruses (EnV in Buffalo River waters was assessed quantitatively over a period of 12 months (August 2010 to July 2011. Seventy-two samples were collected from six sites, including three dams, and concentrated using the adsorption-elution method. Viral RNA was extracted using a commercial kit, and the viruses were quantified by real-time quantitative reverse transcriptase PCR (RT-qPCR. Two or more viruses were detected in 12.5% of the samples. HAV was detected in 43.1% of the samples and in significantly (p < 0.05 varying concentrations of 1.5 × 101–1.9 × 105 genome copies/L compared to RoV and EnV, while RoVs were detected in 13.9% of samples, with concentrations ranging from 2.5 × 101–2.1 × 103 genome copies/L, and EnV were detected in 9.7% of the samples, with concentrations ranging from 1.3 × 101–8.6 × 101 genome copies/L. Only HAV was detected at all the sites, with the Bridle Drift Dam recording significantly higher (p < 0.05 concentrations. The presence of enteric viruses in Buffalo River may constitute public health risks and the incidence of HAV at all the sites could reflect both the epidemiological status of hepatitis A and HAV persistence in the water environments.

  10. UPLC/Q-TOF MS-based metabolomics and qRT-PCR in enzyme gene screening with key role in triterpenoid saponin biosynthesis of Polygala tenuifolia.

    Directory of Open Access Journals (Sweden)

    Fusheng Zhang

    Full Text Available The dried root of Polygala tenuifolia, named Radix Polygalae, is a well-known traditional Chinese medicine. Triterpenoid saponins are some of the most important components of Radix Polygalae extracts and are widely studied because of their valuable pharmacological properties. However, the relationship between gene expression and triterpenoid saponin biosynthesis in P. tenuifolia is unclear.In this study, ultra-performance liquid chromatography (UPLC coupled with quadrupole time-of-flight mass spectrometry (Q-TOF MS-based metabolomic analysis was performed to identify and quantify the different chemical constituents of the roots, stems, leaves, and seeds of P. tenuifolia. A total of 22 marker compounds (VIP>1 were explored, and significant differences in all 7 triterpenoid saponins among the different tissues were found. We also observed an efficient reference gene GAPDH for different tissues in this plant and determined the expression level of some genes in the triterpenoid saponin biosynthetic pathway. Results showed that MVA pathway has more important functions in the triterpenoid saponin biosynthesis of P. tenuifolia. The expression levels of squalene synthase (SQS, squalene monooxygenase (SQE, and beta-amyrin synthase (β-AS were highly correlated with the peak area intensity of triterpenoid saponins compared with data from UPLC/Q-TOF MS-based metabolomic analysis.This finding suggested that a combination of UPLC/Q-TOF MS-based metabolomics and gene expression analysis can effectively elucidate the mechanism of triterpenoid saponin biosynthesis and can provide useful information on gene discovery. These findings can serve as a reference for using the overexpression of genes encoding for SQS, SQE, and/or β-AS to increase the triterpenoid saponin production of P. tenuifolia.

  11. Risk estimation of distant metastasis in node-negative, estrogen receptor-positive breast cancer patients using an RT-PCR based prognostic expression signature

    International Nuclear Information System (INIS)

    Tutt, Andrew; Shu, Henry; Springall, Robert; Cane, Paul; McCallie, Blair; Kam-Morgan, Lauren; Anderson, Steve; Buerger, Horst; Gray, Joe; Bennington, James; Esserman, Laura; Wang, Alice; Hastie, Trevor; Broder, Samuel; Sninsky, John; Brandt, Burkhard; Waldman, Fred; Rowland, Charles; Gillett, Cheryl; Lau, Kit; Chew, Karen; Dai, Hongyue; Kwok, Shirley; Ryder, Kenneth

    2008-01-01

    Given the large number of genes purported to be prognostic for breast cancer, it would be optimal if the genes identified are not confounded by the continuously changing systemic therapies. The aim of this study was to discover and validate a breast cancer prognostic expression signature for distant metastasis in untreated, early stage, lymph node-negative (N-) estrogen receptor-positive (ER+) patients with extensive follow-up times. 197 genes previously associated with metastasis and ER status were profiled from 142 untreated breast cancer subjects. A 'metastasis score' (MS) representing fourteen differentially expressed genes was developed and evaluated for its association with distant-metastasis-free survival (DMFS). Categorical risk classification was established from the continuous MS and further evaluated on an independent set of 279 untreated subjects. A third set of 45 subjects was tested to determine the prognostic performance of the MS in tamoxifen-treated women. A 14-gene signature was found to be significantly associated (p < 0.05) with distant metastasis in a training set and subsequently in an independent validation set. In the validation set, the hazard ratios (HR) of the high risk compared to low risk groups were 4.02 (95% CI 1.91–8.44) for the endpoint of DMFS and 1.97 (95% CI 1.28 to 3.04) for overall survival after adjustment for age, tumor size and grade. The low and high MS risk groups had 10-year estimates (95% CI) of 96% (90–99%) and 72% (64–78%) respectively, for DMFS and 91% (84–95%) and 68% (61–75%), respectively for overall survival. Performance characteristics of the signature in the two sets were similar. Ki-67 labeling index (LI) was predictive for recurrent disease in the training set, but lost significance after adjustment for the expression signature. In a study of tamoxifen-treated patients, the HR for DMFS in high compared to low risk groups was 3.61 (95% CI 0.86–15.14). The 14-gene signature is significantly

  12. Selection of suitable reference genes for normalization of quantitative RT-PCR (RT-qPCR) expression data across twelve tissues of riverine buffaloes (Bubalus bubalis)

    Science.gov (United States)

    Kaur, Ramneek; Sodhi, Monika; Sharma, Ankita; Sharma, Vijay Lakshmi; Verma, Preeti; Swami, Shelesh Kumar; Kumari, Parvesh

    2018-01-01

    Selection of reference genes has become an integral step in any real time quantitative PCR (RT-qPCR) based expression studies. The importance of this study stems from the fact that riverine buffaloes are major dairy species of Indian sub-continent and the information generated here will be of great interest to the investigators engaged in functional genomic studies of this important livestock species. In this study, an effort was made to evaluate a panel of 10 candidate reference genes (glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta- actin (ACTB), ubiquitously expressed transcript (UXT), ribosomal protein S15 (RPS15), ribosomal protein L-4 (RPL4), ribosomal protein S9 (RPS9), ribosomal protein S23 (RPS23), hydroxymethylbilane synthase (HMBS), β2 Microglobulin (β2M) and eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) across 12 tissues (mammary gland, kidney, spleen, liver, heart, intestine, ovary, lung, muscle, brain, subcutaneous fat and testis) of riverine buffaloes. In addition to overall analysis, tissue wise evaluation of expression stability of individual RG was also performed. Three different algorithms provided in geNorm, NormFinder and BestKeeper softwares were used to evaluate the stability of 10 potential reference genes from different functional classes. The M-value given by geNorm ranged from 0.9797 (RPS9 and UXT) to 1.7362 (RPS15). From the most stable to the least stable, genes were ranked as: UXT/RPS9> RPL4> RPS23> EEF1A1> ACTB> HMBS> GAPDH> B2M> RPS15. While NormFinder analysis ranked the genes as: UXT> RPS23> RPL4> RPS9> EEF1A1> HMBS> ACTB> β2M> GAPDH> RPS15. Based on the crossing point SD value and range of fold change expression, BestKeeper analysis ranked the genes as: RPS9> RPS23/UXT> RPL4> GAPDH> EEF1A1> ACTB> HMBS> β2M> RPS15. Overall the study has identified RPS23, RPS9, RPL4 and UXT genes to be the most stable and appropriate RGs that could be utilized for normalization of transcriptional data in various tissues of

  13. Transcription of putative tonoplast transporters in response to glyphosate and paraquat stress in Conyza bonariensis and Conyza canadensis and selection of reference genes for qRT-PCR.

    Science.gov (United States)

    Moretti, Marcelo L; Alárcon-Reverte, Rocio; Pearce, Stephen; Morran, Sarah; Hanson, Bradley D

    2017-01-01

    Herbicide resistance is a challenge for modern agriculture further complicated by cases of resistance to multiple herbicides. Conyza bonariensis and Conyza canadensis are invasive weeds of field crops, orchards, and non-cropped areas in many parts of the world. In California, USA, Conyza populations resistant to the herbicides glyphosate and paraquat have recently been described. Although the mechanism conferring resistance to glyphosate and paraquat in these species was not elucidated, reduced translocation of these herbicides was observed under experimental conditions in both species. Glyphosate and paraquat resistance associated with reduced translocation are hypothesized to be a result of sequestration of herbicides into the vacuole, with the possible involvement of over-expression of genes encoding tonoplast transporters of ABC-transporter families in cases of glyphosate resistance or cationic amino acid transporters (CAT) in cases of paraquat resistance. However, gene expression in response to herbicide treatment has not been studied in glyphosate and paraquat resistant populations. In the current study, we evaluated the transcript levels of genes possibly involved in resistance using real-time PCR. First, we evaluated eight candidate reference genes following herbicide treatment and selected three genes that exhibited stable expression profiles; ACTIN, HEAT-SHOCK-PROTEIN-70, and CYCLOPHILIN. The reference genes identified here can be used for further studies related to plant-herbicide interactions. We used these reference genes to assay the transcript levels of EPSPS, ABC transporters, and CAT in response to herbicide treatment in susceptible and resistant Conyza spp. lines. No transcription changes were observed in EPSPS or CAT genes after glyphosate or paraquat treatment, suggesting that these genes are not involved in the resistance mechanism. Transcription of the two ABC transporter genes increased following glyphosate treatment in all Conyza spp. lines

  14. Determination of respiratory virus by RT-PCR in people with acute respiratory infection of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos 'Dr. Carlos Saenz Herrera', in the period January 2012 to September 2012

    International Nuclear Information System (INIS)

    Montero Bonilla, Andrei

    2014-01-01

    Respiratory viruses are diagnosed through reverse transcriptase polymerase chain reaction (RT-PCR) in people with acute respiratory disease of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos. The frequency of respiratory viruses are determined in the samples analyzed in the study population. The presence of viral coinfections is identified in the samples analyzed. The frequency of patients with respiratory viruses is categorized according to age in the study population. The frequency of respiratory viruses is examined between the studied geographic regions (Pavas and Paraiso). The results found by RT-PCR are compared with the frequency data reported with the direct immunofluorescence technique [es

  15. Development and Characterization of a Highly Specific and Sensitive SYBR Green Reverse Transcriptase PCR Assay for Detection of the 2009 Pandemic H1N1 Influenza Virus on the Basis of Sequence Signatures▿ †

    Science.gov (United States)

    Medina, Rafael A.; Rojas, Mark; Tuin, Astrid; Huff, Stephen; Ferres, Marcela; Martinez-Valdebenito, Constanza; Godoy, Paula; García-Sastre, Adolfo; Fofanov, Yuriy; SantaLucia, John

    2011-01-01

    The emergence and rapid spread of the 2009 H1N1 pandemic influenza virus showed that many diagnostic tests were unsuitable for detecting the novel virus isolates. In most countries the probe-based TaqMan assay developed by the U.S. Centers for Disease Control and Prevention was used for diagnostic purposes. The substantial sequence data that became available during the course of the pandemic created the opportunity to utilize bioinformatics tools to evaluate the unique sequence properties of this virus for the development of diagnostic tests. We used a comprehensive computational approach to examine conserved 2009 H1N1 sequence signatures that are at least 20 nucleotides long and contain at least two mismatches compared to any other known H1N1 genome. We found that the hemagglutinin (HA) and neuraminidase (NA) genes contained sequence signatures that are highly conserved among 2009 H1N1 isolates. Based on the NA gene signatures, we used Visual-OMP to design primers with optimal hybridization affinity and we used ThermoBLAST to minimize amplification artifacts. This procedure resulted in a highly sensitive and discriminatory 2009 H1N1 detection assay. Importantly, we found that the primer set can be used reliably in both a conventional TaqMan and a SYBR green reverse transcriptase (RT)-PCR assay with no loss of specificity or sensitivity. We validated the diagnostic accuracy of the NA SYBR green assay with 125 clinical specimens obtained between May and August 2009 in Chile, and we showed diagnostic efficacy comparable to the CDC assay. Our approach highlights the use of systematic computational approaches to develop robust diagnostic tests during a viral pandemic. PMID:21084522

  16. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR

    DEFF Research Database (Denmark)

    Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Cirera, Susanna

    2007-01-01

    Background: Real-time quantitative PCR (qPCR) is a method for rapid and reliable quantification of mRNA transcription. Internal standards such as reference genes are used to normalise mRNA levels between different samples for an exact comparison of mRNA transcription level. Selection of high...... quality reference genes is of crucial importance for the interpretation of data generated by real-time qPCR. Results: In this study nine commonly used reference genes were investigated in 17 different pig tissues using real-time qPCR with SYBR green. The genes included beta-actin (ACTB), beta-2...

  17. Optimization of a combined human parechovirus-enterovirus real-time reverse transcription-PCR assay and evaluation of a new parechovirus 3-specific assay for cerebrospinal fluid specimen testing.

    Science.gov (United States)

    Selvaraju, Suresh B; Nix, W Allan; Oberste, M Steven; Selvarangan, Rangaraj

    2013-02-01

    Human parechoviruses (HPeVs), particularly type 3 (HPeV3), are known central nervous system (CNS) pathogens, causing serious infections in infants similar to those caused by enteroviruses (EVs). The primary aim of this study was to combine and validate HPeV and EV real-time reverse transcription-PCR (RT-PCR) detection assays with the best available RT-PCR reagents and conditions for parallel detection of HPeV and EV on a single platform. The secondary aim was to develop and validate a newly developed HPeV3-specific real-time RT-PCR assay. Five commercially available RT-PCR kits were evaluated with the pan-HPeV and EV assays in one-step and two-step RT-PCRs. Two-step RT-PCR with the AgPath ID RT-PCR (AGP) kit performed best for both pan-HPeV and EV assays. The pan-HPeV-specific assay performed best with the AGP kit in a one-step RT-PCR. Frozen aliquots of 145 (for HPeV, n = 70; for EV, n = 75) previously characterized cerebrospinal fluid (CSF) specimens were tested by EV-, pan-HPeV-, and HPeV3-specific (HPeV specimens only) assays. The pan-HPeV and EV assays demonstrated 100% analytical sensitivity and specificity compared to historic results, while the HPeV3-specific assay demonstrated 97% sensitivity and 100% specificity. We propose a real-time pan-HPeV, EV two-step RT-PCR algorithm for simultaneous detection of HPeV and EV from CSF specimens on a single platform. The HPeV3-specific one-step RT-PCR assay can be used as a rapid and cost-effective assay to detect and identify HPeV3 in pan-HPeV RT-PCR assay-positive CSF specimens.

  18. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  19. [Establish and optimization of real-time fluorescent reverse transcription loop-mediated isothermal amplification for detection of avian influenza H5 hemagglutinin gene].

    Science.gov (United States)

    Liu, Yun; Tang, Jin-ming; Tao, Hong; Sun, Jie; Lu, Ti-kang; Liao, Li-shan; Liu, Jian-li; Zeng, Shao-ling; Cao, Chen-fu; Zhang, Cai-hong; Ruan, Zhou-xi; Lv, Jian-qiang; Yang, Jun-xing; Hua, Qun-yi; Chen, Zheng-li; Qin, Zhi-feng

    2013-09-01

    H5 subtype avian influenza (AIV-H5) is a major causative agent of animalloimia a rapid and sensitive molecular biological diagnosis is crucial to the control program of AIV-H5. AIV-H5 real-time fluorescent reverse transcription loop-mediated isothermal amplification (qRT-LAMP) was established by means of heat treatment of the samples. The sensitivity, specificity and repeatability of this method were assessed and the performance of Calcein,SYBR Green I,HNB,SYTO 81 in colorimetric detection was comparatively analyzed to screen the optimum dye. The results showed the sensitivity of this method was 100 times higher than that of standard real-time fluorescent RT-PCR, and the detection limit was one copy of the gene per reaction. This method had no cross-reactivity with other common avian respiratory tract infectious disease-related pathogens such as IBV and NDV. The present study suggested Calcein was the optimum dye. Small-scale tests suggested this method was reliable for survey monitoring of AIV-H5 on the spot, indicating its potential applications in field investigation.

  20. A Multiplex RT-PCR Assay for Detection and Differentiation of Avian-Origin Canine H3N2, Equine-Origin H3N8, Human-Origin H3N2, and H1N1/2009 Canine Influenza Viruses.

    Directory of Open Access Journals (Sweden)

    Chenxi Wang

    Full Text Available Virological and serological surveys have documented that H1N1/2009, avian-origin canine H3N2 (cH3N2, seasonal human-origin H3N2 (hH3N2, and equine-origin H3N8 influenza viruses are consistently circulating in dogs. In the present study, a multiplex reverse-transcriptase polymerase chain reaction (mRT-PCR assay was developed for simultaneous detection and differentiation of these influenza viruses. Four primer sets were designed to target the hemagglutinin genes of H1N1/2009, cH3N2, hH3N2, and H3N8 canine influenza viruses (CIVs. This mRT-PCR assay demonstrated high specificity and sensitivity for the four CIV subtypes. Additionally, mRT-PCR results obtained from 420 clinical samples were consistent with those obtained by the conventional virus isolation method. Our mRT-PCR assay is reliable for clinical diagnosis and rapid identification of CIVs.

  1. Avaliação da urina e de leucócitos como amostras biológicas para a detecção ante mortem do vírus da cinomose canina por RT-PCR em cães naturalmente infectados Evaluation of the urine and leucocytes as biological samples for ante mortem detection of canine distemper virus by RT-PCR assay in naturally infected dogs

    Directory of Open Access Journals (Sweden)

    F.J. Negrão

    2007-02-01

    Full Text Available Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of the canine distemper virus (CDV by a reverse transcription-polymerase chain reaction (RT-PCR assay. One hundred and eighty eight dogs with clinical symptoms of distemper, were distributed in three groups. The group A was constituted of 93 dogs with systemic signs of distemper; the group B by 11 dogs with neurological signs, and the group C by 84 dogs that presented simultaneously systemic and neurological signs. In 66.5% (125/188 of the dogs was amplified an amplicon with 287 base pair of the CDV nucleoprotein gene. In 60.8% (76/125 of the animals the CDV was detected simultaneously in the urine and leucocytes, and in 39.2% (49/125 of the dogs just a type of clinical sample (urine: n=37; leucocytes: n=12 was positive. These results demonstrate that the different forms of clinical distemper disease can hinder the choice of only one type of clinical sample to carry out the ante mortem etiological diagnosis of CDV infection, and false-negative results can be generated.

  2. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  3. Investigation of a Sybr-Green-Based Method to Validate DNA Sequences for DNA Computing

    National Research Council Canada - National Science Library

    Pogozelski, Wendy; Priore, Salvatore; Bernard, Matthew; Macula, Anthony

    2005-01-01

    .... Strands were tested for their potential to cross-hybridize by measuring fluorescence over varying temperatures in the presence of SYBR Green Strands were tested in pools to show that hybridization...

  4. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Differential expression analysis of boron transporters and some stress-related genes in response to 24-epibrassinolide and boron by semi-quantitative RT-PCR in Arabidopsis thaliana (L. Heynh

    Directory of Open Access Journals (Sweden)

    Surgun Yonca

    2016-01-01

    Full Text Available Plant steroidal hormones, brassinosteroids (BRs, promote plant developmental processes and enhance tolerance to several abiotic stresses including high boron (B stress. To examine the possible role of BR in high B-induced stress at the transcriptional level, we investigated the response of B transporter genes (BOR1-4, high B-induced genes (MATE, Hsp-like, BR-induced genes (Hsp70-4, Hsp90-1 and other stress-related genes (LTI/COR78, LEA4-5 upon exogenous treatments of 24-epibrassinolide (EBL on Arabidopsis thaliana (L. Heynh exposed to high concentrations of boric acid (BA using semi-quantitative RT-PCR. BA treatments led to down regulation of BOR1 and BOR3 genes in leaf and root tissues and higher concentration of EBL further decreased expression of these genes in roots. The expression of high B-induced genes was observed to be upregulated by 1 μM EBL treatment under high B stress in both tissues of the seedlings. The upregulation of BR-induced genes were clearly evident in root tissues co-treated with 1 μM EBL and BA as compared to BA alone. Higher concentration of EBL was found to be more effective in increasing expression of LTI/COR78 gene in root and LEA4-5 gene in shoot tissues. To our knowledge, this is the first report how exogenous application of EBL modulates high B stress responses at molecular level in model plant Arabidopsis thaliana.

  6. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.

    Science.gov (United States)

    Peng, Xiujuan; Nguyen, Alex; Ghosh, Debadyuti

    2018-02-01

    TaqMan and SYBR Green quantitative PCR (qPCR) methods were developed as DNA-based approaches to reproducibly enumerate M13 and T7 phages from phage display selection experiments individually and simultaneously. The genome copies of M13 and T7 phages were quantified by TaqMan or SYBR Green qPCR referenced against M13 and T7 DNA standard curves of known concentrations. TaqMan qPCR was capable of quantifying M13 and T7 phage DNA simultaneously with a detection range of 2.75*10 1 -2.75*10 8 genome copies(gc)/μL and 2.66*10 1 -2.66*10 8 genome copies(gc)/μL respectively. TaqMan qPCR demonstrated an efficient amplification efficiency (E s ) of 0.97 and 0.90 for M13 and T7 phage DNA, respectively. SYBR Green qPCR was ten-fold more sensitive than TaqMan qPCR, able to quantify 2.75-2.75*10 7 gc/μL and 2.66*10 1 -2.66*10 7 gc/μL of M13 and T7 phage DNA, with an amplification efficiency E s of 1.06 and 0.78, respectively. Due to its superior sensitivity, SYBR Green qPCR was used to enumerate M13 and T7 phage display clones selected against a cell line, and quantified titers demonstrated accuracy comparable to titers from traditional double-layer plaque assay. Compared to enzyme linked immunosorbent assay, both qPCR methods exhibited increased detection sensitivity and reproducibility. These qPCR methods are reproducible, sensitive, and time-saving to determine their titers and to quantify a large number of phage samples individually or simultaneously, thus avoiding the need for time-intensive double-layer plaque assay. These findings highlight the attractiveness of qPCR for phage enumeration for applications ranging from selection to next-generation sequencing (NGS). Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Incorporation of real-time PCR into routine public health surveillance of culture negative bacterial meningitis in São Paulo, Brazil.

    Directory of Open Access Journals (Sweden)

    Claudio T Sacchi

    Full Text Available Real-time (RT-PCR increases diagnostic yield for bacterial meningitis and is ideal for incorporation into routine surveillance in a developing country. We validated a multiplex RT-PCR assay for Streptococcus pneumoniae, Neisseria meningitidis, and Haemophilus influenzae in Brazil. Risk factors for being culture-negative, RT-PCR positive were determined. The sensitivity of RT-PCR in cerebrospinal fluid (CSF was 100% (95% confidence limits, 96.0%-100% for N. meningitidis, 97.8% (85.5%-99.9% for S. pneumoniae, and 66.7% (9.4%-99.2% for H. influenzae. Specificity ranged from 98.9% to 100%. Addition of RT-PCR to routine microbiologic methods increased the yield for detection of S. pneumoniae, N. meningitidis, and H. influenzae cases by 52%, 85%, and 20%, respectively. The main risk factor for being culture negative and RT-PCR positive was presence of antibiotic in CSF (odds ratio 12.2, 95% CI 5.9-25.0. RT-PCR using CSF was highly sensitive and specific and substantially added to measures of meningitis disease burden when incorporated into routine public health surveillance in Brazil.

  8. SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.

    Science.gov (United States)

    Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra

    2016-03-01

    Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.

  9. Real-Time PCR Analysis of Peripheral Blood: A Non-Invasive Technology that can be Used to Assess Tumor Burden in Breast Cancer Patients

    National Research Council Canada - National Science Library

    Mitas, Michael

    2002-01-01

    ... (Oncoquick, HEXAL Gentech) to enrich CTC prior to real- time RT-PCR analysis. METHODS: MDA361 breast cancer cells were spiked into normal PBL by micromanipulation, and processed using Ficoll or BDGC medium...

  10. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  11. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  12. Flow cytometric analysis using SYBR Green I for genome size estimation in coffee.

    Science.gov (United States)

    Ronildo Clarindo, Wellington; Roberto Carvalho, Carlos

    2011-02-01

    Plant genome size has been measured by flow cytometry using propidium iodide as a dye for nuclear DNA staining. However, some authors have reported the occurrence of genome size estimation errors, especially in plants rich in secondary metabolites, such as the coffee tree. In this context, we tested an alternative cytometric protocol using the SYBR Green I as a fluorochrome for stoichiometrically staining nuclear double-stranded DNA in Coffea canephora (2x) and Coffea arabica (4x). The results showed that the respective mean genome size measured from nuclei stained with SYBR Green I and propidium iodide was statistically identical. However, the G(0)/G(1) peaks of nuclei stained with SYBR Green I exhibited lower coefficient variations (1.57-2.85%) compared to those stained with propidium iodide (2.75-4.80%). Coefficient variation statistical data suggest that SYBR Green I is adequate for stoichiometric nuclei staining using this methodology. Our results provide evidence that SYBR Green I can be used in flow cytometry measurements of plants, with the advantages of minimizing errors in nuclear DNA content quantification, staining relatively quicker, with high affinity, and being less mutagenic than propidium iodide. Copyright © 2009 Elsevier GmbH. All rights reserved.

  13. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  14. Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

    Science.gov (United States)

    Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

    2015-10-01

    The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

  15. Selection and validation of reference genes for normalization of quantit